Manual de biología
de suelos tropicales

Esta publicación presenta parte de los resultados del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity”, implementado en siete países tropicales: México, Brasil, Costa de Marfil, Kenia, Uganda, India e Indonesia. El proyecto es coordinado por el Tropical Soil Biology and Fertility Institute del CIAT (TSBF-CIAT) con co-financiamiento del Global Environment Facility (GEF), y con apoyo para su implementación del Programa de Naciones Unidas para el Medio Ambiente (PNUMA-UNEP). Las opiniones expresadas en esta publicación pertenecen a los autores del libro y no necesariamente concuerdan con las de PNUMA-UNEP o GEF. La traducción y publicación de este libro en español fue posible gracias al apoyo financiero del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity” y al Instituto Nacional de Ecología (INE). También queremos agradecer todas las facilidades proporcionadas por Tiberious Brian Etyang del Tropical Soil Biology and Fertility Research Area of CIAT (TSBFCIAT) Nairobi, Kenia, a Teotonio Soares de Carvalho de la Universidade Federal de Lavras, Brazil, al Dr. José Antonio García Pérez por sus valiosos consejos y sugerencias, y a Caridad González Lerma por cuidar los últimos detalles.

Manual de biología de suelos tropicales
Muestreo y caracterización de la biodiversidad bajo suelo
Fátima M. S. Moreira, E. Jeroen Huising y David E. Bignell (editores )

Secretaría de Medio Ambiente y Recursos Naturales (S emarnat) Instituto Nacional de Ecología (INE)

Título original de la obra: A Handbook of Tropical Soil Biology Sampling and Characterization of Below-Ground Biodiversity © Earthscan en el Reino Unido y Estados Unidos en 2008 Hardcover ISBN: 978-1-84407-621-5 Paperback ISBN: 978-1-84407-593-5

Revisión de capítulos por especialistas en el tema: Dra. Isabelle Barois Boullard, Instituto de Ecología, A.C. Dra. Simoneta Negrete Yankelevich, Instituto de Ecología, A.C. Dra. Rocío Vega Frutis , Instituto de Ecología, A.C. M.C. José Antonio Gómez Anaya , Instituto de Ecología, A.C. M.C. Francisco Franco Navarro, Colegio de Posgraduados Dra. Esperanza Martínez-Romero, Centro de Ciencias Genómicas, UNAM Dra. Lucia Varela Fregoso, Hongos y Derivados, S.A. de C.V. Dr. Juan Rull Gabayet, Instituto de Ecología A.C. Dra. Dora Trejo Aguilar, Universidad Veracruzana

Primera edición: 2012
D.R. © Instituto Nacional de Ecología

Periférico Sur 5000. Col. Insurgentes Cuicuilco, Deleg. Coyoacán, 04530, México, D.F. www.ine.gob.mx

Coordinación General de la Publicación en Español: Isabelle Barois Boullard Coordinación editorial y formación: Raúl Marcó del Pont Lalli Corrección de estilo: Adriana Victoria Arcos Méndez Revisión y preparación de originales: Martín De Los Santos Bailón Colaboradora en la traducción al español: Judy Shirley Adaptación del texto: Mariluz Pérez Lorenzo Diseño portada: Álvaro Figueroa Foto de la portada: Claudio Contreras Edición para internet: Susana Escobar Maravillas Forma sugerida de citar el libro: Moreira, F., E. J. Huising y D. E. Bignell. 2012. Manual de biología de suelos tropicales. Muestreo y caracterización de la biodiversidad bajo suelo. Instituto Nacional de Ecología, México, 337 pp., México.
Ninguna parte de esta publicación, incluyendo el diseño de la portada, puede ser reproducida, traducida, almacenada o transmitida de forma alguna ni por ningún medio, ya sea electrónico, químico, mecánico, óptico, de grabación o de fotocopia sin permiso previo de los editores. Pequeños párrafos, tablas o figuras, pueden reproducirse dentro de lo estipulado en la Ley Federal de Derecho de Autor y el Convenio de Berna, o previa autorización por escrito de la editorial. ISBN: 978-607-7908-31-9 Impreso y hecho en México

Índice

1 2 3 4

Listado de tablas Listado de figuras Prólogo a la edición en español Prólogo Prefacio Lista de acrónimos y abreviaturas El inventario de la biodiversidad biológica del suelo: conceptos y guía general Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo Macrofauna Collembola, acari y otra mesofauna del suelo: el método Berlese

9 10 13 17 21 25 29 53 91 149

5 6 7 8 9 Nematodos del suelo Bacterias formadoras de nódulos en leguminosas Hongos micorrizógenos arbusculares (HMA) Hongos del suelo saprófitos y patógenos de plantas Muestreo. preservación e identificación de moscas de la fruta 163 177 217 243 281 287 10 Hongos y nematodos entomopatógenos 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo Colaboradores Índice analítico 297 339 343 .

a través de una gradiente de perturbación de la selva.1 7.2 5.5 11. Especie de bacterias formadoras de nódulos en leguminosas Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes.1 8.8 11. procesos asociados de cambio y componentes relevantes de la biodiversidad Grupos de organismos del suelo colectados utilizando diferentes métodos de captura Ejemplo de lista de especies Densidad numérica (individuos m-2) de termitas en siete localidades. Género.2 4.1 11.1 3. en la provincia de Jambi del centro de Sumatra Composición química para aclarar y montar especímenes Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina Familias y valores cp utilizados para el índice de madurez Familias y valores cp utilizados para el índice fitoparasítico Filum/Orden.4 11.1 3.2 11. fertilizantes y cosecha Características de la parcela y distribución del uso de suelo Características de los árboles en la finca (TROF) Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca Ejemplo de clasificadores y valores de atributos para parcelas de maíz 26 33 44 72 103 122 154 167 168 169 174 210 253 295 297 298 298 299 303 307 310 312 315 318 319 .2 1.1 1. amplificados del DNA total Clasificadores y atributos técnicos para el cultivo principal Tamaño del campo y características de la cobertura del cultivo Atributos de cultivos combiandos Características del suministro de agua Factor tiempo de cultivo Clasificadores y atributos relacionados con la limpieza de la parcela. Familia.7 11.3 6.3 2. labranza y deshierbe Clasificadores y atributos para el manejo de plagas y enfermedades.3 11.10 11.11 Número de especies descritas en las principales categorías taxonómicas de plantas.6a 11.9 11.1 5.Listado de tablas 1.1 11.1 5. biota del suelo y principales grupos funcionales a los que pertenecen Principales grupos funcionales de la biota del suelo Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. unidades de referencia.6b 11.

32 Principales grupos funcionales. 99 Ejemplo de curva de acumulación de especies con una desviación estándar. hormigas y escarabajos. 93 Separación a mano de lombrices de tierra en charolas de plástico. 81 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. b) ilustración de la división de una cuadrícula entre seis. hecha con un vaso. c) incrementando la replicación. 109 Esquema de una trampa pitfall con cebo. 94 Extracción de termitas de una muestra de suelo en una charola de aluminio. 115 Trampa pitfall improvisada.1 3. 70 Esquema alternativo para muestrear macrofauna.1 2. 148 . 54 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. b) si se incluyen de manera deliberada valores de MOS más extremos.Listado de figuras 1. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. estudiados en el proyecto CSM-BGBD. según se requiera. tres y dos ventanas. hormigas. utilizando una pequeña cuchara o cuchillo de campo. clasificados de acuerdo con dominios y reinos.2 2. 77 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada.2 2. b) se utilizan guantes como precaución contra enredaderas. tamaños y procesos de ecosistemas relacionados. b) tres cuadrículas que muestrean tres diferentes parches de selva. 116 Sacabocados de metal.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. con puntos de muestreo adicionales.3 2. utilizando permutaciones de datos al azar.1 1.3 3. a) cuadrícula completa. cuatro palitos pequeños y una cubierta de celofán.6 3.4 2.6 3.7 4. El muestreo se puede ampliar si se usa uno o dos transectos para termitas. 91 Esquema de alineación de monolitos complementarios de lombrices de tierra. 35 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. arañas y otros artrópodos. por estratificación. utilizando un transecto de 50 m. d) reconociendo los límites como otra categoría. dispuestas a lo largo del gradiente.2 3. dando un estimado pobre de la pendiente. para muestrear la mesofauna en la hojarasca y en el suelo mineral.5 2.4 3. 71 Ejemplos de diferentes configuraciones de ventanas de muestreo. esto aumentará la precisión de la estimación de la pendiente. 59 Esquema de muestreo por puntos para toda la biota. mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.5 3.

Las cajas Petri no deben contener más de una tercera parte de líquido.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea.3 a) Nematodos recuperados mediante el lavado de malla de 400.7 Charola con montajes permanentes de especímenes de nematodos. 282 10. con embudo superior de 40 cm de diámetro. 184 6.3 Producción de acetileno en campo o laboratorio. fijadoras de nitrógeno en diversos sistemas de uso de suelo. b) sistema Berlese– Tullgren en operación.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca).4 Embudo Berlese modificado. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. 163 5. d) emergencia de juveniles infectivos en la trampa White. d) almacenaje de conidios en tubos Eppendorf. 282 10. y a la derecha.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas. 189 7.1 ml) en una caja Petri con medio de cultivo. 162 5. suspensión de suelo en reposo.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) disolución seriada de la suspensión acuosa que contiene al hongo. resumida en seis pasos. b) inoculación de la suspensión (alícuota de 0. de 50cm de altura.1 Evaluación de bacterias formadoras de nódulos en leguminosas. 216 10. 166 5.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos.1 A la izquierda.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos 165 5. c) incubación bajo condiciones controladas en una cámara DBO. 152 5.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. 151 4. 187 6.2 Cultivos purificados de Beauveria bassiana. creciendo en medio ADP. 284 . hecho de aluminio. bajo condiciones de congelación. juego de tamices de metal (de malla de 45 arriba y de 400 abajo). 151 4. b) muerte de nematodos en agua caliente.5 Equipo básico requerido para extracciones núcleo por núcleo Berlese-Tullgren. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa.4. 166 6. c) larvas que muestran la patología típica de infección por nematodos.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo.3 Embudos Berlese llenos de suelo y hojarasca. 165 5.2 a) contenedor de apoyo para embudos Berlese–Tullgren. 163 5. 149 4. 180 6.

11.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. y presencia o ausencia del componente arbóreo. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos.3 Clasificación del uso del suelo en términos de la intensidad de uso. 11.11.2. 322 324 325 .

Por otra parte. 13 . la regulación de la dinámica de la materia orgánica del suelo. CH4) son realizados principalmente por el grupo funcional de los ingenieros químicos del ecosistema. Como lo afirmó el Dr. que pueden incorporar y asimilar estos conocimientos en beneficio de la biodiversidad del suelo. hongos y protozoarios y los reguladores biológicos como los ácaros. José Sarukhán. la fijación de nitrógeno. escarabajos y pequeños mamíferos. que son las lombrices de tierra. hormigas. pero ahora sabemos que interviene y participa ampliamente en los servicios ambientales que brinda el suelo: por una parte. en términos generales. la captura de carbono y la reducción de emisiones de gases traza (CO2.Prólogo a la edición en español Este prólogo es el segundo elaborado para esta misma obra y se presenta para su versión en español. es decir. La biodiversidad del suelo alberga más del 25 % de la que existe en todo el planeta y. Cabe mencionar que un tipo de organismo puede participar en varios grupos funcionales. las bacterias. colémbolos y nematodos. el ciclaje de nutrientes. fundador de la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad de México. la elaboración de la estructura del suelo y el mantenimiento del régimen hídrico la desarrollan los ingenieros del ecosistema. la sostenibilidad y el desarrollo de sus comunidades rurales. termitas. por la importancia que reviste su divulgación en un idioma que puede ser leído por un amplio grupo de países de América Latina. es la que menos se conoce. El conocimiento de esta biodiversidad se ha dejado de lado durante mucho tiempo por la dificultad para abordarla. “¡Se sabe más de las estrellas que de los organismos del suelo!”. N2O.

entendidas ahora bajo el concepto de calentamiento global. reduciendo la materia orgánica contenida y alterando gravemente sus redes biológicas y funcionales. y se dejó de lado el estudio de la biología del suelo y. se reconoce la necesidad de estimular la formación de profesionales en taxonomía y sistemática de la biodiversidad del suelo. Mientras leemos estas líneas. el uso de fertilizantes. contribuye a nuestro alimento. Y si bien se ha avanzado mucho al respecto. más aun. particularmente en los ecosistemas tropicales. fibra y combustible. Ante este panorama. así como preservar y restaurar la fertilidad natural de los suelos. conocer y aprender a manejar dicha biodiversidad resulta fundamental para conservar o restaurar la fertilidad del suelo. son fundamentales. La pérdida de la fertilidad. las condiciones de la biota del suelo continúan alterándose aceleradamente en todo el mundo debido a las actividades humanas. se requieren muchos años más de investigación taxonómica y funcional para comprender y manejar los procesos edáficos. son grandes pero se desconocen en buena medida los mecanismos y procesos que se afectan. Durante años los estudios del suelo fueron enfocados al conocimiento de la física y química del suelo. sobre el verdadero impacto que están teniendo las prácticas de manejo. permite el control de plagas y fomenta la producción de las plantas y de los animales. pues permitirán diseñar y establecer estrategias para mantener la sustentabilidad. que se estiman en miles de millones de euros anuales. que han sido desarrolladas y probadas en siete países y tres continentes. particularmente en las regiones tropicales. esta biodiversidad le da estabilidad al paisaje. conservación y equilibrio del ecosistema. combinada con las necesidades alimenticias de una población humana en continuo crecimiento. que se encuentran entre los más afectados por la deforestación y el 14 Manual de biología de suelos tropicales . tanto del punto de vista morfométrico como molecular para lograrlo. su biodiversidad. silvícolas y ganaderas en el mundo. pero su impacto y repercusiones sobre los procesos de funcionamiento. el equilibrio y la funcionalidad de los suelos modificados por las prácticas agrícolas. actualizada y rápida. lo que visto desde el punto de vista antropogénico.De manera global. Y aunque es difícil cuantificar el valor económico de estos servicios. generan y provocan el avance de la frontera agrícola y la intensificación productiva. las técnicas de muestreo y estudio de la materia orgánica y los organismos del suelo que permitan obtener información veraz. En este sentido. pesticidas y técnicas mecánicas de cultivo modifican fuertemente las condiciones originales del suelo. Este manual reúne técnicas de muestreo en campo. con repercusiones a nivel global.

La información de este manual se ha organizado de acuerdo con la funcionalidad de los grupos del suelo. Esto es así porque. permitiendo llevar a cabo evaluaciones sobre la diversidad y salud del ecosistema que sirvan como base para el diseño de prácticas de manejo sustentables. sino constituir un apoyo en el camino hacia la sustentabilidad y la relación armónica entre el hombre y la naturaleza. financiado por el GEF. generando información útil no sólo para investigadores o especialistas sino para toda persona interesada en el estudio de la conservación y la productividad del suelo. Su elaboración tiene como finalidad no sólo ser una herramienta de utilidad en el trabajo técnico. inglés. Estas técnicas de muestreo básicas han demostrado ser poderosas herramientas para llevar a cabo investigación básica y aplicada. estudiantes. en México. lo que demuestra la mayor presencia y formación de especialistas nacionales preocupados por sus recursos naturales.C. Fondo para el medio ambiente. De manera especial queremos P rólogo a la edición en español 15 . Cabe mencionar que la mayoría de los autores que colaboraron para desarrollar este manual residen justamente en países tropicales. Con esta versión en español. para que su alcance e impacto sea más amplio. portugués y español. La información contenida en este manual es útil para investigadores. Al inicio del manual se incluyen dos capítulos que ofrecen una guía para establecer un método de muestreo representativo que permita evaluar y comparar la biodiversidad del suelo en diferentes sitios. profesores y profesionales involucrados en el manejo productivo de los suelos y también en su conservación. Las técnicas y métodos de muestreo presentados en este manual no constituyen sólo una recopilación de los procedimientos originales ya conocidos.cambio en el uso del suelo. incluso en plantaciones agrícolas con manejo de bajo insumos.BGBD. implementado por el PNUMA y ejecutado por el TSBF a nivel internacional y por el Instituto de Ecología A. ahora este manual se encuentra disponible en tres idiomas. por sus siglas en inglés) . pues en este caso fueron probados. las consecuencias de un mal manejo de suelos pueden provocar consecuencias dramáticas. Agradecemos a todos los especialistas que revisaron la traducción de los textos que correspondían a su especialidad y competencia. mientras que al final se encuentra un capítulo integrador que permite relacionar los inventarios de los organismos del suelo con una clasificación del uso de suelo para estimar el impacto del manejo del suelo sobre su biodiversidad. mejorados y actualizados durante el desarrollo del proyecto Conservación y manejo sostenible de la biodiversidad debajo del suelo (CMS.

agradecer al Instituto Nacional de Ecología. Isabelle Barois Boullard Coordinadora de la traducción y del proyecto CSM-BGBD en México 16 Manual de biología de suelos tropicales . y en particular a Raúl Marcó del Pont y su equipo. por su trabajo editorial y su paciencia ejemplar.

a su vez. Dicha intensificación es necesaria para asegurar el suministro global de alimentos. surge la gran necesidad de aplicar los conocimientos referentes al papel que desempeña la biodiversidad bajo suelo para su sustentabilidad. Ante esta situación. Un aspecto a destacar del cambio global en las regiones tropicales. Este manual es. se enfatizó la importancia de la diversidad bajo suelo y se exhortó a abrir nuevas líneas de investigación multidisciplinaria. tiene como consecuencia 17 . sólo en tiempos recientes se ha planteado que los suelos contienen un componente biológicamente activo. es el cambio de uso de suelo asociado a la intensificación agrícola. la regulación biológica del suelo se verá afectada e incluso sustituida por fertilizantes y cultivos mecánicos. los suelos en todo el mundo enfrentan una grave crisis.Prólogo Durante mucho tiempo la sociedad ha reconocido su dependencia respecto del suelo. Una línea de investigación surgida a partir de entonces es la de cómo evaluar y manejar diversidad bajo suelo en sistemas de agricultura que faciliten la productividad agrícola y sustentabilidad de suelo a largo plazo. celebrada en el año 2006. sin embargo. Mediante la aprobación de la Iniciativa Internacional para la Conservación y el Uso Sustentable de la Biodiversidad del suelo en la Convención sobre Biodiversidad Biológica. sin embargo. Sea como fuere. en la medida que esto ocurra. la mejor muestra –y la más actual– para poder evaluar la biodiversidad del suelo en ecosistemas que están siendo rápidamente alterados como consecuencia de los cambios en el uso del suelo. sin lugar a dudas. Esto.

un número mayor de diferentes tipos de microorganismos. La biodiversidad tropical ha sido subestimada y es posible que las verdaderas densidades de especies sean mayores que en otras latitudes. así como la conservación de la biodiversidad en todo el mundo y no. quizás.una reducción de la biodiversidad del suelo. manejar la biodiversidad del suelo para poder incrementar la productividad agrícola en regiones que están siendo degradadas? La respuesta a esta pregunta atañe a toda la humanidad porque la tierra está siendo degradada. La relación entre la diversidad de especies y la diversidad funcional de la biota del suelo sigue siendo incierta. Del mismo modo. en los trópicos. estas herramientas pueden ser utilizadas para aprovechar los organismos del suelo en el manejo de los ecosistemas. Un metro cuadrado de bosque templado puede contener hasta mil especies de invertebrados y. asociada a la deforestación y al proceso de Intensificación agrícola en los márgenes de los bosques. vitales para poder alcanzar la meta: productividad agrícola sustentable. tanto en el laboratorio como en el campo. problema cuya solución implica un gran reto: ¿es posible. Dichos conocimientos son. desde los invertebrados más grandes hasta las bacterias. la reducción de las emisiones de gas invernadero. Durante mucho tiempo los ecologistas han debatido sobre la importancia de la diversidad biótica del suelo: el secuestro de carbono en suelos. en bioprospección y para promover mejoras sustentables en la pro18 Manual de biología de suelos tropicales . desde luego. cubre casi la totalidad de la gama de biodiversidad biológica. la provisión de nutrientes en las plantas y el control de patógenos en plantas como contribuciones específicas de los organismos del suelo a la fertilidad de éste. entonces. la capacidad de retención de agua del mismo. las relaciones entre la biodiversidad del suelo y la ocurrencia y magnitud de los procesos ecológicos son inciertas. el mantenimiento de la estructura física del suelo. En última instancia. únicamente. El objeto explícito en este caso es práctico: proveer de una herramienta definitiva para establecer una línea de base y luego documentar la pérdida de biodiversidad de suelo. El propósito de este manual es proveer de métodos estándares internacionales para el inventario de comunidades bajo suelo y la caracterización del uso de suelo en el trópico húmedo. además. por lo que representa el resultado publicado de más de una década de intensa discusión y un amplio trabajo de campo por parte de un gran número de expertos investigadores de muchos países. pero constituye uno de los principales objetos de investigación en todos los niveles. sino también en países de primer mundo. no solamente en regiones en vías de desarrollo.

consecuentemente. Finalmente.ducción agrícola. esto implica la reconciliación de los intereses y preocupaciones de los agricultores pobres. Una de las más importantes es que la mayoría de los colaboradores pertenece a los países que se encuentran más afectados por la deforestación y el cambio en el uso de suelo. tanto nacionales como extranjeros. son de interés no sólo para expertos en taxonomía. no obstante. Muchas de las técnicas asociadas con una evaluación de diversidad dentro de grupos específicos microbianos han surgido a partir de P rólogo 19 . Otro aspecto notable de este manual es que la biota del suelo está agrupada en ocho categorías. manuales metodológicos de muestreo para organismos del suelo. sin embargo. sino también para biólogos en general. representan a instituciones académicas y gubernamentales en las que se requiere poner en práctica nuevas políticas para el manejo del suelo que han de ser validadas. considerado importante o esencial en la función del suelo y. cada una con amplia identidad taxonómica. los objetivos nacionales de desarrollo y calidad de nuestro ambiente. a muchos servicios ambientales que los suelos proveen. Durante los últimos cincuenta años se han publicado. porque la verdadera biodiversidad es tan amplia que queda fuera del marco de cualquier sistema científico para que se pueda documentar totalmente. los métodos han sido desarrollados y monitoreados en condiciones de campo. En segundo lugar. en doce localidades como puntos de referencia. distribuidos en siete países y tres continentes. no obstante. por lo tanto. también donde es necesario. el presente manual contiene notables diferencias respecto de los anteriores. especialmente en el caso de los pueblos más pobres del mundo. por lo que algunos taxa han sido excluidos. ofrece la ventaja de traer consigo los medios para poder hacer una evaluación aproximada de la salud del suelo. dentro del alcance de la población que se encuentra relacionada con su productividad. especialistas en agricultura y empleados técnicos de todos los niveles. En la medida de lo posible esto aplica a la identificación: las claves recomendadas son los más funcionales. se aconseja referir los especímenes a especialistas. los métodos presentados en este manual contemplan también los ecosistemas terrestres en general. con cierta frecuencia. Tal selección es inevitable cuando se trata del suelo. pero que también corresponde a un grupo funcional mayor. los autores han incluido la revolución en metodología molecular que ha incursionado en las ciencias biológicas durante los últimos diez años. si es que aún estamos a tiempo de parar la pérdida de la biodiversidad tropical. El proceso responde a una necesidad selectiva. Inevitablemente.

Wall Natural Resource Ecology Laboratory Colorado State University Mayo de 2008 20 Manual de biología de suelos tropicales .discusiones entre colaboradores y durante talleres específicamente pensados para la publicación del presente manual. Diana H.

al PNUD/ 21 . y para su puesta en marcha. y. del Programa de Naciones para el Medio Ambiente (PNUMA/UNEP). India e Indonesia. al NERC por el Reino Unido (UK). El proyecto se inició en 2002 con el objeto de generar información y conocimientos que puedan ser utilizados para un mejor manejo y conservación de la BGBD en espacios de agricultura tropical. para mantener la productividad agrícola y reducir la extensión de la agricultura en paisajes naturales. asimismo. constituye una actualización de los métodos y protocolos que fueron inicialmente propuestos por investigadores afiliados al Instituto de Biología y Fertilidad del Suelo Tropical del CIAT. Este proyecto es ejecutado por el Instituto de Biología y Fertilidad del Suelo Tropical (TSBF). El proyecto se lleva a cabo en México. El manual describe métodos de muestreo y laboratorio para evaluar la biodiversidad de una gama de grupos funcionales básicos de biota de suelo. recibe apoyo para su financiamiento del Fondo Global del Medio Ambiente (GEF por sus siglas en inglés). Kenia. sobre todo. que permitan la comparación de resultados de inventario en áreas específicas de países tropicales con validez científica y estadística. institución que pertenece al Centro Internacional de Agricultura Tropical (CIAT). al (TIGER). Costa de Marfil. Uganda.Prefacio Este manual es uno de los resultados del proyecto PNUMA/GEF “Conservación y Manejo Sostenible de Biodiversidad Bajo Suelo” (CSM-BGBD) que surge como respuesta a la necesidad de crear métodos estándares e instrucción práctica para el inventario de la biodiversidad bajo suelo. a la Red de Macrofauna financiada por la Unión Europea (EU). Brasil.

dentro del trópico húmedo. Colombia. al programa DIVERSITAS. Manaus. Un manual formal de técnicas para organismos de suelo y organismos que viven en agua dulce y sedimentos marinos fue publicado en 1996. o la actualización de métodos para evaluar la diversidad de nematodos. dentro del alcance de laboratorios nacionales. provee detalles adicionales en el caso de grupos funcionales específicos: como el uso de trampas Winkler para hormigas y trampas Pitfalls para escarabajos en muestras de hojarasca. Los métodos estándares propuestos contienen avances tecnológicos recientes en genética molecular. en el de 2004 (Embu. termitas. HMA y Ectomycorrhiza. Hall. tales como el registro de huellas genéticas del BFNFNL. Kenia. La definición de métodos estándares aprovecha la experiencia obtenida con la implementación de los métodos utilizados en los siete países participantes en el proyecto. Indonesia) y. por parte de la UNESCO. Brasil. También cubre. India 2005. en donde también se habla del principio de grupos funcionales del inventario de organismos de suelo. Una 22 Manual de biología de suelos tropicales . elaborado por Anderson e Ingram (1993). Países Bajos). bacterias formadoras de nódulos en leguminosas (BFNFNL) y sus plantas hospederas. Bangalore. S. diciembre 2004. febrero 2005. Los métodos que se describen en este manual reflejan una amplia gama de actividades del proyecto CSM-BGBD. en términos de grupos funcionales. octubre 2003). Ésta fue la contribución. Dado que muchas especies aún son desconocidas o no se han descrito.UNDP-GEF con el apoyo financiero destinado al Proyecto Alternativas de RozaTumba-Quema (ASB). Brasil mayo/2004 y Nairobi. en especial. agosto 2004. ampliamente. en su caso. termitas y hormigas. saprófitos y patógenos y una amplia gama de artrópodos mayores. cuya evolución se muestra en los reportes de 2002 (Wageningen. 2003 (Sumberjaya. Los métodos para una evaluación de biodiversidad de suelo fueron descritos en el ASB (Nota de Lectura 6B). Londrina. Los métodos para algunos de los grupos funcionales de organismos de suelo fueron incluidos en un manual pionero. al igual que en varios talleres temáticos de taxonomía específica (técnicas moleculares con énfasis en T-RFLP. y en varios talleres llevados a cabo desde el inicio del proyecto. Cali. al igual que métodos que no han sido considerados en las publicaciones mencionadas. lombrices de tierra. la gama completa -geográfica y biogeográfica. una evaluación de la diversidad de especies resulta un proceso poco práctico. Kenia). editado por Swift y Bignell (2001). además. como es el caso de aquéllos que se refieren a la mesofauna. editado por G. Nairobi. Los métodos fueron discutidos y posteriormente perfeccionados en reuniones anuales celebradas entre los años 2002 y 2005. hongos entomopatógenos.

poco se sabe de las relaciones entre ambos factores o sobre los mecanismos por los cuales ocurren cambios en la BGBD. La premisa es que la diversificación agrícola (en varios niveles) genera biodiversidad en el suelo y que la producción agrícola sustentable (en los márgenes de la selva tropical) se mejora significativamente. nivel de nutrientes y densidad). en contra de una productividad sustentable. la erosión del suelo significa la más catastrófica de las alteraciones. Es por esto que el control de la erosión y la rehabilitación de suelos fuertemente erosionados deberá considerarse parte de las estrategias para conservar y sustentar un buen manejo de la BGBD. Aun si se pudiera regresar a sus condiciones originales. La mayoría de los organismos del suelo se encuentran en los primeros 20 centímetros de su perfil. van acompañadas por reducciones drásticas en la diversidad de plantas. hay otros asociados con un incremento en la intensidad del uso de suelo. dejándolo como estaba antes de ser alterado. estos cambios de uso de suelo. frecuentemente provocan una reducción de materia orgánica del suelo que forma el sustrato básico para la mayoría de los organismos que en él habitan y. Para responder a algunas de las preguntas mencionadas se requiere: P refacio 23 . de manera que causará un impacto inmediato en la BGBD que fácilmente se antepondrá al efecto combinado de todos los factores mencionados. esto se traduce en una alteración del suelo como hábitat. por lo tanto. Además de estos efectos.mejor opción sería investigar la pérdida de grupos funcionales básicos dentro de la BGBD que muestran un cambio en el uso de suelo o una intensidad del mismo. provoca una pérdida de servicios del ecosistema. tenga implicaciones en la BGBD. como consecuencia del labrado o del creciente uso directo de agroquímicos. restablecer la BGBD no implica precisamente devolver los servicios del ecosistema. que se espera. La hipótesis actual es que una intensificación en el uso de suelo trae consigo una reducción de la biodiversidad del suelo y a su vez. generalmente. La conversión de uso de suelo y la intensificación de su uso. sin embargo. así. Quedan muchas interrogantes en cuanto al manejo de BGBD. la erosión puede llegar a nulificar todos los demás procesos degenerativos. llega a influir sobre la abundancia y diversidad de dichos organismos. no necesariamente se lograría restaurar la BGBD. Los efectos en BGBD son condiciones compuestas por el medio ambiente y por características físicas y químicas del suelo (por ejemplo: pH. por lo tanto. interpretar esos procesos en el contexto ecológico. Además. así se podrían entender las consecuencias de una pérdida en el BGBD y. Al mismo tiempo.

pdf. I. S. Bogor. 2nd edition. G. desde una parcela (agrícola. desde bosque natural hasta agricultura de monocultivo. 24 Manual de biología de suelos tropicales . M. D. caracterizada por un cultivo continuo y un elevado uso de químicos y mecanización. Swift. Se espera que los métodos descritos en este manual sean útiles para el diseño y la ejecución de estudios para inventario y monitoreo de la BGBD en todos los niveles. International Centre for Research in Agroforestry.fao. • Identificar “puntos de entrada” para mejorar el manejo de la tierra. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. Hall. y observar cómo esta relación se modifica y se altera por las condiciones prevalecientes en el medio ambiente (incluyendo condiciones de suelo). e Ingram. Jeroen Huising y David. S. Moreira. CAB International. • Establecer una relación entre la biodiversidad de la superficie y bajo del suelo en los actuales y alternativos sistemas de uso de suelo. Bignell ReFERENCIAS Anderson.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. ASB Lecture Note 6B. y Bignell. un conocimiento más amplio de prácticas existentes y un uso más efectivo de tecnologías disponibles que no requieran altos insumos. (ed) (1996) Methods for the Examination of Organismal Diversity in Soils and Sediments. Wallingford. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. CAB International. E.• Una caracterización de la biodiversidad del suelo en un amplio rango de uso de suelo de varias intensidades. South East Asian Regional Research Programme. Fátima M. J. E. Estos “puntos de entrada” pueden incluir un mejor entendimiento del uso de prácticas indígenas. mediante la introducción y/o manejo de biota de suelo (se experimenta con varios manejos alternativos). Indonesia. J. Wallingford. S. M. www. experimental o de muestreo) hasta un paisaje natural.

Lista de acrónimos y abreviaturas AC ADP AFLP AHM AM ANOVA ARISA B BFNFNL cPCR CSM-BGBD BGBD DGGE ea EBI ERA FID FURB GEF Análisis de correspondencia Agar dextrosa y papa Polimorfismo en el tamaño de fragmentos amplificados Agar con harina de maíz Agar extracto de malta Análisis de varianza Análisis automatizado del espaciador intergénico ribosomal Bacteriófagos Bacterias fijadoras de nitrógeno. formadoras de nódulos en leguminosas Reacción en cadena de la polimerasa competitiva Conservación y Manejo Sustentable de Biodiversidad Bajo Suelo Biodiversidad Bajo Suelo Electroforesis en gel con gradiente de desnaturalización Equivalente de ácido European Bioinformatics Institute Ensayo de reducción de acetileno Detector de ionización de flama Universidade Regional de Blumenau Global Environment Facililty 25 .

GF HMA ia ICRAF IFP IM INPA ITS KOH LCCS M MAS MOS NCBI Nd NMP P Pc PCA PCR PFGE PNUMA PP RAPD Rep-PCR RFLP RIA SR SSCP TGGE TRF T-RFLP TROF TSBF-CIAT 26 Grupo funcional Hongos micorrizógenos arbusculares Ingrediente activo World Agroforestry Centre Índice fitoparasítico Índice de madurez National Institute for Amazonian Research (Instituto Nacional de Pesquisas da Amazônia) Espaciadores de trascripción interna Hidróxido de potasio Sistema de clasificación de cobertura de suelo Micófagos Muestreo aleatorio simple Materia orgánica del suelo National Center for Biotechnology Information Nivel de dilución Número más probable Perturbación Porcentaje de colonización Análisis de componentes principales Reacción en cadena de la polímerasa Electrofóresis en campos pulsados Programa de las Naciones Unidas para el Medio Ambiente Parásitos de plantas DNA polimórfico amplificado al azar De fragmentos repetidos palindrómicos-éxtragenicos Polimorfismo de longitud de fragmentos de restricción Resistencia intrínseca a los antibióticos Sensores remotos (imagen) Polimorfismo de conformación de cadena sencilla Electroforesis en gel con gradiente de temperatura Fragmentos de restricción terminal Polimorfismo terminal de la longitud del fragmento de la restricción Árboles en finca Tropical Soil Biology and Fertility Institute of the International- Manual de biología de suelos tropicales .

UC UFAM UFC UFLA UFMG UnB VA VB Center for Tropical Agriculture Unidad de colonización Universidad Federal de Amazonas Unidades formadoras de colonias Universidad Federal de Lavras Universidad Federal de Minas Gerais Universidad de Brasilia Volumen alto Volumen bajo A crónimos y abreviaturas 27 .

.

000 en el caso de procariontes. 1998). cuando se hace una evaluación biológica de la salud de los suelos (Lawton et al. Wall. 1996. Bardgett. Ya que no es ni práctico ni coherente tomar en cuenta todos los organismos presentes. Cavalier-Smith. Swift. Wall. 1998.1 se enlistan los principales fila de organismos eucariontes y procariontes que son o pueden ser representativos en la comunidad del suelo. 2006). con más de 1. la diversidad de la biota del suelo es elevada en todos los niveles de análisis (véase Swift et al.Estos procesos apoyan a los servicios del ecosistema.. Bignell. Moreira y E.. especialmente cuando se trata de los taxa a ser creados en altos niveles y los números de tales categorías altas (como reinos) a ser consideradas. Sin embargo. En la Tabla 1. 2004.5 millones de especies de eucariontes y con una riqueza de especies estimada muy por encima de 10... contri29 . David E. 1979. 1998. Jeroen Huising Organismos y servicios del ecosistema del suelo El suelo es un hábitat que alberga una amplia gama de organismos dentro de los tres dominios taxonómicos (sensu Woese et al. La clasificación taxonómica de organismos vivos aún se encuentra en una situación polémica (Margulis y Schwartz. 1990) y muchos fila.Capítulo 1 El inventario de la biodiversidad biológica del suelo: conceptos y guía general Mike J. Brussaard et al. 1997. Moreira et al. 2005. S. Fátima M. Lavelle. cualquiera que sea el sistema de clasificación utilizado. la biota (relativa a agentes no bióticos y entre ellos mismos) será evaluada por su contribución relativa a los procesos del ecosistema (sensu Daily. 2004).. 1997.2004).

4 muy raro en el suelo 3.4 2. biota del suelo y principales grupos funcionales a los que pertenecen.000 Filum Annelidad (lombrices segmentadas) Clase Polychaeta 9. 4 4 común localmente 5 - 30 Manual de biología de suelos tropicales .000 Monocotiledoneas 65.000 Reino Plantae [12 fila] Filum Bryophyta (musgos) 10.000 Filum Hepatophyta (plantas 6.000 hepáticas) Filum Filicinophyta (helechos) 12.000 Clase Malacostracad (incluye orden Decapoda con un esqueleto externo calcificado) Orden Isopoda (ácaros de la madera y >11.000 Dicotiledoneas 130.000 Clase Gastropodad (incluye babosas y caracoles) 18.000–40.000 Filum Cycadophyta (gimnospermas) 185 Filum Coniferophyta (gimnospermas) 550 Filum Gnetophyta 70 Filum Anthophyta (angiospermas) 235.000 cochinillas) Filum Mandibulata (Artropoda) Grupo funcionalb 1 1 1 1 1 1 1 1 1 2. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Dominio Eucarionte 255.000 Filum Crustacead [>6 clases] 25.000 >10 millones Reino Animalia [37 fila] 750 Filum Tardigradad (osos de agua) d 99.800 y Enchytraeidae) Clase Hirudinea (sanguijuelas) 500 45.000 Clase Oligochaeta(lombrices de tierra 8.1 Número de especies descritas en las principales categorías taxonómicas de plantas.000 Filum Mollusca 35.Tabla 1.

000 Clase Chilopoda (ciempiés) 2. 9 3. 7. 3.000 Orden Collembola (colémbolos) 7.000 Orden Isoptera (termitas) 2. 6 2. 23.500 Orden Diplura (doble cola) 659 Orden Protura 500 Subfilum Myriapoda (milpiés y 15.Tabla 1.826 Orden Lepidoptera (mariposas. 6. grillos. 7 2. 4. 9 4.500 Clase Symphyla 200 Clase Pauropoda 700 El Grupo funcionalb 4 4. 4 2.000 gegenes.9 Sólo en la rivera 4. 6 4. 6. polillas. 9 2. 7 4. 9 2.000 Orden Diptera (moscas. 6 2. 115. 9 6 2.800 Orden Orthoptera (saltamontes.000 Orden Dermaptera (tijerillas) 1.800 Orden Hemiptera (chinches) >80.000 langostas) Orden Thysanoptera (trips) 6.000 Orden Coleoptera (escarabajos) >350. 9 2.) Orden Trichoptera 12. 9 2. 9 2. escamas) Suborden Heteroptera 25. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Subfilum Hexapoda (Insectos) >900. afidos. >125. mosquitos pequeños) Orden Hymenoptera (hormigas.162 ciempiés) Clase Diplopoda (milpiés) 10. 180. pulgones. abejorros) Familia Formicidae (hormigas) 11. 4.000 etc.6 4 2. peri55.000 quitos. mosquitos.000 abejas. 9 2.000 Suborden Homoptera (cigarras. 7 31 inventario de la biodiversidad biológica del suelo .000 Orden Archaeognatha (pececillos de 350 cobre ó bristetails) Orden Thysanura 700 Orden Blattoptera (cucarachas) 4.1 Continúa. 4. avispas.

235 (Pseudoescorpiones) Orden Araneae (arañas) 40. 7.000 Filum Discomitochondria (flagelados 800 y zooflagelados) 10. 7. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos critas en el taxón (todos de organismos de suelo/nombre los hábitats) común Subfilum Cheliceratad [3 clases] >100.6 7 1. 7 Muy raros en suelo 2.000 briz redonda. 6. lom15.100 Grupo funcionalb 6 2.7 7 1. 4.000 Filum Plathyheminthesd (Helmintos. 9 1 32 Manual de biología de suelos tropicales .000 Order Scorpionida (escorpiones) 2000 400 Filum Gastrotrichad (gastrotricha) d 1000 Filum Acanthocephala (lombrices con cabeza espinuda) 2000 Filum Rotiferad (animales de ruedas) 900 Filum Nemertinad (gusanos planos) Filum Nematoda (nematodos.000 Filum Diatomacead (diátomos) Filum Oomycota (Oomycetes) Cientos Filum Rhodophyta (alga roja) 4. 7 1 5. alfilerillos) 25. lombrices enterobius.1 Continúa. 9 6 6 6 7 Parásitos artrópodos 4.455 Orden Palpigradi (micro-escorpiones) 80 Orden Acari (ácaros.000 Clase Arachnida [11 órdenes] 93. 6.Tabla 1.000 Orden Pseudoscorpionida 3. garrapatas) 45. incluidas planarias) Número sin Reino Protoctistac [30 fila] determinar Filum Rhizopoda (amibas) Número sin determinar 4000 Filum Dinomastigotad (dinoflagelados) Filum Ciliophora (ciliados) 10. 9 2.

(2006). la riqueza correspondiente arrojará 3090 y 79.342. reino.9 5 5. c) Considerados por algunos autores como Protistas o Protozoos y Chromistas.100 204 >22. filum. 2008). Dichos procesos pueden ser agrupados de acuerdo a cuatro funciones agregadas del ecosistema: El inventario de la biodiversidad biológica del suelo 33 . 8 5. 1997.nlm.1 Continúa..gov.000 >70. (1990). b) Grupos funcionales. excluyendo organismos no clasificados. e) Rappé y Giovannoni (2003). d) Incluye organismos acuáticos y del suelo. Categorías taxonómicasa (número total de fila existentes) ejemplos de organismos de suelo/nombre común Filum Chlorophyta (alga verde) Reino Fungi [6 fila] Filum Microsporídia Filum Chytridiomycota (Hongos quitridios) Filum Zygomycota (mohos) Filum Glomeromycota (hongos micorrízicos arbusculares) Filum Basidiomycota (incluidos hongos y algunas levaduras) Filum Ascomycota (incluidas levaduras) Dominio Archaead [4 fila] Dominio Bacteriad [52 fila]e Número de especies des.000 >344f >8. Brussard et al.. respectivamente. Kibblewhite et al.398f 1 sólo parásitos 5. 8 10 1. Reinos de Eucariotas clasificadas de acuerdo con Margulis y Schwartz. Procariotas (Dominio Archaea y Bacteria). 1996. Clasificación. sin cultivo y no especificados.500 1.. 9.Grupo funcionalb critas en el taxón (todos los hábitats) 16.000 1.Tabla 1. f) National Center for Biotechnology Information: (www. 10 Nota: a) Considerando las categorías taxonómicas. 1998. de acuerdo con la Tabla 1. 5. por su influencia en la calidad y salud del suelo (Hoavelle. consultado el 13 de mayo de 2007). desde el más bajo hasta el más alto nivel: dominio. clase. cuando éstos se incluyen. Fuente: Moreira et al.000 1.. orden.2 (de este capítulo). familia.250 >30. de acuerdo con Woese et al. género y especies. 2006. buyendo al mantenimiento y a la productividad de los mismos.nih. Hongos de acuerdo con James et al. 8. 8 5.ncbi.

siempre que no se incluya a los ingenieros del ecosistema (véase más abajo). sin embargo. mediante la formación de asociaciones simbióticas como las micorrizas y la fijación de N2 en nódulos de raíces. milpiés. en gran parte realizada por animales del suelo como ácaros. 2. hormigas y algunos otros de la macrofauna del suelo. aunque el atributo “transformadores de hojarasca” es el más utilizado hoy en día para describirlos. que no dependen directamente de la materia orgánica como fuente de alimento. pero también es incorporado en diferentes reservorios en forma de materia orgánica (MOS). sin embargo. aunque en un tipo de suelo y medioambiente determinados existe un equilibrio entre el contenido del MOS y las entradas y salidas de carbono en el sistema. principalmente como CO2 o CH4. estrechamente asociado con la descomposición orgánica.1. poros. 3. Aquí también los microorganismos son mediadores de la mayor parte de las transformaciones. Microorganismos específicos del suelo también incrementan la cantidad y eficiencia de absorción de nutrientes por la vegetación. Las raíces de plantas. agregados y montículos. lombrices de tierra. es decir. Ciclo de nutrientes. colémbolos y ácaros. y moviendo partículas de un horizonte a otro. La descomposición de materia orgánica. el carbono orgánico es liberado en la atmósfera. termitas. Como resultado de la descomposición. por la biota del suelo. es esencial para todo tipo de agricultura y silvicultura. lombrices de tierra y termitas. que ocurre principalmente por actividad enzimática de bacterias y hongos. Algunos grupos de bacterias del suelo están involucrados en transformaciones elementales autotróficas. nematodos. porosidad y contenido de carbono. los microorganismos y los animales involucrados se llaman “descomponedores”. Animales más grandes mejoran algunos procesos porque proveen nichos para un crecimiento microbiano dentro de sus intestinos o excremento. los cuales trituran los residuos de plantas y animales. tales como protoctistas. El ciclo de nutrientes. Juntos. lo que controla el resto de la biota. Bioturbación. se mantienen físicamente activos dentro del suelo formando canales. crean y modifican microhábitats para otros organismos más pequeños y determinan propiedades del suelo como aireación. Estos procesos de “bioturbación” influyen y determinan la estructura física del suelo y la distribución de materia orgánica del suelo. estos grupos son afectados indirectamente por factores como el contenido de agua. Así. estabilidad de agregados 34 Manual de biología de suelos tropicales . Estas fracciones de MOS varían en su estabilidad y longevidad. el paso que marca la operación del proceso se determina mediante micropredadores. y dispersan los propágulos microbianos. drenaje. estabilidad del suelo.

Especialmente. hongos y animales invertebrados capaces de invadir plantas y animales. capacidad de almacenaje y drenaje) y tiene una fuerte influencia sobre la susceptibilidad a la erosión. debido a una diversidad biológica disminuida y/o en cambios ambientales del suelo. bioturbación y ciclo de nutrientes determinará el equilibrio entre la cantidad de carbono secuestrado en el suelo (véase arriba) y entre las emisiones de gases invernadero (principalmente CO2. brotes intensivos de enfermedades en el suelo y plagas.1 muestra la contribución de la biota del suelo a servicios ambientales. bacterias. y de causar enfermedades y muerte. En ecosistemas naturales.. que incluyen microbívoros y micropredadores que se alimentan de las plagas microbianas y de animales. como miembros de la comunidad del suelo. CH4. La estructura y las propiedades del suelo también están influenciadas por la producción de excretas de animales. En suelos saludables. N2O). pueden ser asignados dentro de una o más de las cuatro categorías funcionales genéricas descritas. 1994. La Figura 1. 1997). Los organismos del suelo juegan un papel importante en la regulación de la composición atmosférica y. se le ha denominado “ingenieros del ecosistema del suelo” (Stork y Eggleton. Para poder interrelacionar El inventario de la biodiversidad biológica del suelo 35 .. son relativamente raros. 4. La biota del suelo incluye un amplio rango de virus. Jones et al. incluyendo complejos organominerales estables durante meses o periodos más largos (Lavelle et al. por tanto.y capacidad de retención de agua. en el cambio climático. La bioturbación juega un importante papel en la regulación del equilibrio del agua en el suelo (infiltración. tales como los causados por un contenido de MOS más bajo. todos los organismos enlistados. 1992. y hasta humanos. basándose en la función particular que desempeñan o en el proceso específico del suelo del que son mediadores. y también una amplia variedad de interacciones antagonistas microbianas. como resultado de los procesos anteriores. respectivamente. 1997). En los agroecosistemas. A este conjunto de organismos. debe hacerse notar que la interacción entre la descomposición de materia orgánica. Enfermedades y control de plagas.. Lavelle et al. Grupos funcionales de la biota del suelo En principio. las actividades de plagas potenciales y patógenas son reguladas por interacciones con otros miembros de la biota del suelo. este rango de interacciones puede encontrarse reducido. pero tales epidemias sí son comunes en la agricultura. NOX. por lo tanto.

Mantenimiento de estructura del suelo 2..36 Funciones agregadas del ecosistema 1. Regulación de la población biológica 3. Fuente: Kibblewhite et al. Transformaciones C Ensamblaje funcional Descomponedores: Hongos Bacterias Microherbívoros Detrívoros Procesos de entrega basados en el suelo Mantenimiento de la estructura del suelo Ciclaje de nutrientes Mantenimiento de la estructura del suelo Dinámica de la MOS Descomposición Ciclaje de nutrientes Regulación de población biológica Provisión de hábitat Regulación de población biológica 4. Ciclaje de nutrientes Transformadores de nutrientes: Descomponedores Transformadores de elementos Fijadores de nitrógeno Micorrizas Ingenieros del ecosistema: Megafauna Macrofauna Hongos Bacteria Biocontroladores: Predadores Microherbívoros Hiperparásitos Figura 1.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. 2008 Servicios agrícolas Procesos de entrega basados en el suelo Alimentos y fibras Captura y ciclaje de nutrientes Descomposición de la MO adicionada Dinámica de MOS Mantenimiento de la estructura del suelo Regulación de la población biológica Manual de biología de suelos tropicales Servicios no agrícolas Calidad y suministro de agua Control de erosión Regulación de la composición atmosférica y del clima Degradación y disminución de contaminantes Control de enfermedades y plagas no agrícolas Conservación de la biodiversidad .

Productores primarios (plantas superiores e inferiores): organismos fotosintéticos que asimilan bióxido de carbono del aire y penetran en el suelo mediante sistemas de raíces. transformadores de hojarasca. de alguna manera. normalmente definido por criterio trófico (Brussaard. haciéndolo más accesible para los descomponedores o favoreciendo el crecimiento microbiano de excretas en forma de gránulos.organismos específicos del suelo (biodiversidad colectiva) con las categorías genéricas funcionales y. 3. Herbívoros: animales que consumen y parcialmente digieren tejidos vivientes de plantas. Microrreguladores (microfauna como nemátodos): animales que regulan ciclos de nutrientes mediante forrajeo y otras interacciones con los microorganismos descomponedores. por lo tanto. El inventario de la biodiversidad biológica del suelo 37 . ni de cuántos de estos grupos deberán definirse dentro de un ambiente de suelo típico. 6. 4. 1998) pero también calificado en función de la respuesta fisiológica. Predadores (mucha macrofauna y mesofauna): animales que regulan a los herbívoros. de comportamiento bioquímico o ambiental y. alguna microfauna): invertebrados que se alimentan de desechos orgánicos originados por microbios y por trituradores de este material. Esta actividad puede ocurrir a varias escalas espaciales. con los servicios del ecosistema (Setäla et al. Microsimbiontes (hongos micorrícicos. No existe acuerdo preciso en la definición de grupos funcionales. 2. incluyendo el ciclaje de nutrientes. 5. morfológica. Descomponedores (hongos o bacterias degradadores de la celulosa): microorganismos que poseen las enzimas polímero-degradadoras. por ejemplo.2 Principales grupos funcionales de la biota del suelo. Transformadoras de hojarasca (mucha macrofauna y mesofauna. ingenieros del ecosistema.. 1998) es necesario tomar en cuenta el concepto de grupos funcionales básicos. descomponedores y microrreguladores por depredación. Ingenieros del ecosistema (macrofauna como termitas y lombrices de tierra): organismos que causan un impacto físico mayor en el suelo mediante su transporte. Pueden incluir predadores. rizobia): microorganismos asociados con raíces que facilitan la absorción de nutrientes. el Tabla 1. 1. en última instancia. 7. también de acuerdo con sus características taxonómicas. muchas hormigas. que incluyen minadores de hojas y de tallos. 8. construcción de estructuras agregadas y formación de poros. translocando compuestos orgánicos sintetizados arriba del suelo. y que son los responsables de la mayor parte del flujo de energía en la red alimenticia de los descomponedores. y chupadores de sabia.

invertebrados. no obstante. Éstos son grupos taxonómicos que fueron tomados en cuenta en el proyecto Conservation and Sustainable Management of Below-Ground Biodiversity (CSM-BGBD).2 Continúa.: depredadores. incluya todos los grupos funcionales considerados como importantes. Véase que algunos grupos funcionales incluyen una amplia gama de taxa relacionados y. existen pocos estudios sobre la salud del suelo agrícola.. enlistadas en la Tabla 1. aislado e identificado (Figura 1. existe un argumento válido que establece por lo menos diez categorías. Los grupos taxonómicos propuestos a continuación son seleccionados de acuerdo con su significado funcional diverso. 2005). 9.. 10. no relacionados. S o P (nitrificación y fijación de nitrógeno). también es importante buscar dentro de los grupos funcionales para descubrir los taxa que alcancen el criterio de ser considerados como ingenieros del ecosistema (sensu Jones et al.2 y se usan para anotar las categorías taxonómicas. (razón por la cual se emplea el término “taxa seleccionado”) y por su facilidad relativa a ser muestreado. no obstante.Tabla 1. mientras que otros son muy específicos en cuanto a su taxonomía. uno de los principales desafíos es seleccionar un subgrupo de la biota del suelo que refleje adecuadamente el espectro taxonómico anticipado y que. Transformadores procariontes: Archaea y bacterias que transforman de manera específica el carbono (metanotrofa) o elementos nutricionales como N. Plagas y enfermedades del suelo (hongos patógenos. Grupos selectivos de biota de suelo En el diseño de trabajo de campo. en donde el espectro taxonómico completo ha sido objeto de un muestreo representativo en el mismo lugar y al mismo tiempo (Bignell et al. 38 Manual de biología de suelos tropicales . a veces. plagas) especies de control biológico también pueden incluirse (ej. Por esta razón y porque muchos componentes de biota de suelo son taxonómicamente difíciles de identificar.2). cuyos métodos de inventario y caracterización se describen en los siguientes capítulos. en cuanto a la fertilidad y calidad del suelo. concepto es heurístico y puede modificarse en función del propósito analítico necesario.1. 2003). La importancia funcional de cualquier especie o de grupos de especies. 1994) y especies clave (sensu Davic. al mismo tiempo. Éstas están representadas formalmente en la Tabla 1. probablemente se relaciona con su abundancia relativa y con la biomasa. parasitoides e hiperparásitos de plagas y enfermedades).

2 Principales grupos funcionales. trituradores de hojarasca. promotores de crecimiento Nota: la fauna se clasifica de acuerdo con el ancho de cuerpo: macrofauna >2. patógenos. y microfauna <0. especialmente protoctistas Archaea y Bacteria El inventario de la biodiversidad biológica del suelo 39 . parásitos de Micropredadores.1-2.0 mm. clasificados de acuerdo con dominios y reinos. antagonistas.MACROFAUNA Lombrices de tierra I Escarabajos Otros Hormigas Termitas Diversidad y biomasa alta Diversidad alta Ingenieros del ecosistema.Figura 1. macropredadores ANIMALES. un grupo que incluye muchos organismos con papeles especiales y una diversidad de descomponedores genéricos MICROBIOTA GENERAL Microfauna. mesofauna 0. trituradores de hojarasca. Por su parte.MICROFAUNA Y MESOFAUNA Nematodos Ácaros Colémbolos Otros Biomasa alta II Alta diversidad y biomasa Micropredadores. transformadores procarióticos. tamaños y procesos de ecosistemas ANIMALES. estudiados en el proyecto CSM-BGBD.0 mm. patogénos y antagonistas IV Omnipresentes con diversidad alta indeterminada Descomponedores.1 mm. transformadores de hojarasca.transformadores de hojarasca plantas HONGOS Y BACTERIAS MUTUALISTAS Hongos micorrizógenos Bacterias formadoras de nódulos en leguminosas Omnipresentes con especificaciones típicas de variedad de hospederos (a varios grados) III Omnipresentes Microsimbiontes mejoran la absorción por la raíz y la fijación de nitrógeno Hongos saprotróficos. nematodos y protoctistas pueden considerarse como componentes de la microbiota general.

también representan factores de interés y preocupación. probablemente. que intervienen en la porosidad del suelo y en sus nutrientes. por ejemplo.1). milpiés (Diplópoda) y otros tipos de larvas de insectos que actúan como transformadores de hojarasca con una importante acción trituradora sobre el tejido de plantas muertas y sus depredadores (ciempiés. la introducción de especies exóticas e invasivas. al construir galerías y al cavar túneles e ingerir suelo. de esta manera contribuyen en procesos orgánicos de trituración a pequeña escala y ejercen un importante papel regulatorio dentro de la biota del suelo. c) el control biológico como depredadores. nematodos y. hormigas. c) normalmente representan una riqueza genérica y de especies muy alta d) juegan un papel importante en la regulación de abundancia y actividad microbiana. escarabajos. b) ocupan espacios que existen en pequeños poros. Algunas especies también resultan perjudiciales porque se convierten en plaga. bacterias y depredadores de otros animales del suelo). al cavar sus túneles y mediante la ingestión de materia mineral y orgánica. En este contexto. Enchytraeidae. la distribución geográfica. 5 Microfauna: nematodos y protoctistas que. omnívoros y depredadores. y la pérdida de especies endémicas. hormigas y escarabajos que intervienen en: a) la porosidad y la textura del suelo. la trituración y digestión de materia orgánica. b) el ciclo de nutrientes. ácaros. varios de estos grupos taxonómicos son muy importantes por sí mismos como contribuidores a la diversidad biótica en general.Además. al compararse con otros grupos taxonómicos superiores (Tabla 1. mediante el transporte. micófagos. por ejemplo. a escala pequeña. e) 40 Manual de biología de suelos tropicales . en los que viven dependientes de películas de agua. arácnidos grandes y otros tipos de insectos). protoctistas. Algunas especies de ácaros y formas de larvas de muchos artrópodos de suelo son lo suficientemente pequeñas como para clasificarse dentro de la microfauna. bacteriófagos. 2 Macrofauna: termitas. a) influyen en la tasa de recambio por su papel como forrajeros de raíces (parásitos de plantas). Los grupos incluidos en la selección son: 1 Macrofauna: lombrices de tierra. también actúan como reguladores de las poblaciones de biota del suelo. microfauna y microsimbiontes. de la mesofauna. todos ellos conforman un gran número de especies. 4 Mesofauna: colémbolos y ácaros que actúan como transformadores de hojarasca y micropredadores (forrajeros de hongos. arañas. 3 Otra macrofauna: cochinillas (Isópoda). lombrices de tierra.

hongos y animales invertebrados. por ejemplo. utilizando el concepto de grupos funcionales clave como los descritos anteriormente. Los métodos empleados para la extracción de diferentes grupos de organismos del suelo también son muy diferentes de un grupo a otro. aunados a la inmensa escala de diversidad encontrada en el suelo. la mayoría de las especies aún son desconocidas. representan un importante control biológico. 7 Bacterias formadoras de nódulos en leguminosas y. En los casos de Archaea y bacteria. de esta manera. requieren de un enfoque selectivo para llevar a cabo un inventario de la biodiversidad bajo suelo. En muchos Fila. y enfermedades de las plantas. que dependen de grupos funcionales. y contribuyen al potencial control biológico de plagas y enfermedades. entre bacterias. rotación de carbono orgánico en descomposición. reducen ataques patógenos en plantas y mejoran la tolerancia al estrés del medio ambiente. Hasta donde se conoce. 8 Hongos fitopatógenos. sean los más vulnerables ante situaciones de estrés y perturbación que afectan a dichos grupos funcionales. composición funcional (la naturaleza de los grupos funcionales) y ocurrencia e intensidad de los procesos ecológicos.2). lo anterior aplica para los trituradores de materia orgánica (véase transformadores de hojarasca en Tabla 1. saprotróficos y antagonistas: que determinan o median (en diferentes casos) la viabilidad de cultivos.como insectos patógenos. Métodos para inventario de la biodiversidad bajo suelo: principios generales La metodología actual no permite la identificación de todas las especies en el suelo. 6 Hongos micorrizógenos arbusculares: se asocian con las raíces de las plantas y mejoran la disponibilidad de nutrientes. compuestos por relativamente pocas especies y/o especies altamente especializadas. en NH3. En la biota del suelo. el concepto de especies también es muy variable. bacterias que nitrifican y denitrifican (como parte de los transformadores procariotas). Se espera que los servicios de ecosistema. que es asimilable para las plantas. diversidad funcional (el número de grupos funcionales). Estos factores. Aún sigue siendo una pregunta sin respuesta la relación existente entre diversidad de especies. bacterias involucradas con el compuesto El inventario de la biodiversidad biológica del suelo 41 . otros fijadores de nitrógeno microsimbiontes que transforman el nitrógeno atmosférico N2. en ocasiones. la caracterización molecular y bioquímica reemplaza al enfoque de identificación tradicional.

contaminación y cambio climático. el impacto que provoca la intensificación agrícola.C1 y en las transformaciones de hidrógeno (metanogénicas y metilotróficas). En el prefacio se plantea una breve descripción del proyecto. esto conlleva a una serie de interrogantes como ¿cuál es el número mínimo de especies dentro de los grupos funcionales que garanticen la resistencia del suelo contra el estrés del ecosistema natural y antropogénico. Si éste es el caso. hongos micorrizogenos (entre los microsimbiontes) y bioturbadores (ingenieros del ecosistema). centrándose en los grupos funcionales que permitan la evaluación de la diversidad. Este manual aborda métodos para el inventario y caracterización de la biodiversidad del suelo. La evaluación de la composición de la comunidad biótica depende de la identificación de los especímenes recolectados. las consecuencias pueden ser negativas. aunque se dan referencias de claves para la identificación de especies de varios grupos funcionales. escogidos y modificados. Esto debería servir como respuesta a un gran número de preguntas en contextos similares. Los métodos han sido desarrollados. de manera que sea posible evaluar. deforestación. y en relación con que “especies clave (si existen) en los grupos funcionales?. Inventario de biodiversidad bajo suelo en escalas de espacio y tiempo Cambio de uso de suelo como la causa principal del cambio de diversidad biológica del suelo Un inventario puede demostrar si la biota del suelo responde a intervenciones humanas como prácticas agrícolas. Los métodos estándar son necesarios para describir los ecosistemas de manera consistente. cuando se adopta el concepto de los grupos funcionales principales. la fragmentación de hábitat y el manejo de cultivos en la diversidad biológica del suelo. para el cual se han desarrollado y probado los métodos. Por lo tanto. lo que exige un alto nivel de conocimientos taxonómicos. para su aplicación en paisajes con diferentes usos de suelo. especialmente. preguntas como las anteriores deberían ser consideradas en la definición del propósito del objetivo de la investigación de la biodiversidad bajo suelo. que para algunos grupos y en algunos países es un desafío importante. por ejemplo. En este manual no se abordan problemas taxonómicos. cobre y azufre quimiolitotrofos. en términos de una dis42 Manual de biología de suelos tropicales . puesto que se reflejarán en los métodos a utilizarse. abundancia y composición de las especies. hierro.

En los trópicos. varias frecuencias). la complejidad de los agroecosistemas ha sido drásticamente reducida. retener una buena cantidad de diversidad sobre el suelo. los procesos de disturbio -y recuperación. al mismo tiempo. Sin embargo. la biodiversidad y complejidad arriba del suelo favorecen el restablecimiento o protección de la diversidad de organismos bajo suelo. muchas veces enlazadas entre sí. lo cual implica una reducción de la biodiversidad bajo suelo y. un gran número de agricultores tienen acceso limitado a insumos. Se presume que de esa forma se reducirá la diversidad bajo suelo y que. Para qué muestrear.que afectan la biodiversidad bajo suelo. 2008). además. incluso puede producirse la pérdida de la productividad primaria. Una solución alternativa sería intensificar y. la regulación biológica de los servicios de ecosistema basados en el suelo. dónde y cuándo Aunque éste es un manual de instrucción práctica. El suministro global de alimentos depende de la agricultura intensiva. para mejorar la complejidad estructural y diversidad funcional. de los que puedan realizar las funciones biológicas esenciales. Dichas funciones regulatorias frecuentemente se describen como “sustitutos” por insumos. produciendo efectos indeseables. en la medida de lo posible. especialmente. Este hecho puede considerarse tanto a nivel de campo como de paisaje. tales como cultivo mecánico.minución de los servicios del ecosistema. fertilizantes químicos y pesticidas (Kibblewite et al. El principio central es que el significado funcional de la diversidad biológica cambia de acuerdo con las escalas de El inventario de la biodiversidad biológica del suelo 43 . escalas que determinan la predicción de servicios ecosistémicos. puede causar pérdidas de función y reducir la habilidad de los sistemas agrícolas para soportar periodos inesperados de estrés. debería reflejar un consenso de la teoría ecológica y del pensamiento actual sobre estructuras de la comunidad en diferentes escalas espaciales y temporales. en la medida que proceda la intensificación.. interrupción de los ciclos elementales globales y respuesta ante los efectos de los gases invernadero y de la erosión. pérdida del potencial para la limpieza de los residuos y contaminantes. también se manifiestan en diferentes escalas espaciales y temporales (por ejemplo. la biodiversidad arriba del suelo se verá reducida. especialmente en suelos degradados. por ende. debido a cambios en la fertilidad del suelo y/o incrementos de enfermedades en el mismo. si se acompaña de la extinción de especies individuales. El mantenimiento de una variedad de cultivos y otras plantas es aceptado como una práctica que protege al agricultor contra los riesgos a corto plazo. a pesar de que la producción se ha intensificado.

no obstante. los ciclos de vida de diferentes 44 Manual de biología de suelos tropicales . los números o diversidad pueden mantenerse estables. o bien. en número y diversidad de lombrices de tierra al moverse de un lugar a otro. la erosión de finas partículas de suelo y la reducción al mínimo de materia orgánica compleja que. es cómo definir estos “grupos” en relación con niveles de escala. la pérdida progresiva de macroporos. 2002. que combina estos elementos dentro de un sistema de uso de suelo. a la existencia de termitas o cualquier otro ingeniero del ecosistema que haya presentado mayor actividad en un lugar que en otro. Lavelle et al. se puede esperar una variación grande. pero en el caso de dos campos colindantes. La formación del suelo. incluso. de manera general. De la misma manera. esto quiere decir qué se mide. constituye uno de los servicios del ecosistema que integra procesos en todas las escalas. 2004). mientras que en el caso de la zona de uso de suelo. Entre dos paisajes o dos regiones. puede que se deba al drenaje o manejo previo del lugar. El mayor reto.. si el objetivo del inventario es conservar la biodiversidad bajo suelo. a los servicios del ecosistema en diferentes tipos de comparaciones. Asimismo. tomando en cuenta los aspectos de la biodiversidad que puedan afectar. En términos generales. destruir la capacidad productiva. si uno o más grupos funcionales importantes estuvieran ausentes o permanecieran en baja presencia en una de las localidades o si el ecosistema original de bosque se hubiera reducido a una presencia mínima en uno de los lugares. a escala regional. al punto de llegar a hacerla ser irrecuperable. en un mismo paisaje. Las escalas temporales son importantes en los procesos de degradación. en un lugar específico. puede quedarse corto en relación con el propósito de evaluación de la diversidad de toda el área. El clima. probablemente es cuestión de saber cuáles microorganismos existen en cada una.espacio y tiempo (Swift et al. mientras se mantuviera en un paisaje mixto. puede haber una influencia biótica significativa. como se podría esperar. Esto quiere decir que.. por ejemplo. dónde y cuándo se mide. Por ejemplo. se pensaría que el material parental y el clima fueran los factores determinantes en el proceso de formación del suelo. los materiales parentales y los suelos serán los principales determinantes de todos los servicios del ecosistema a nivel paisaje. o bien. con el propósito de lograr lo anterior. El objetivo debería ser reducir la variabilidad intragrupo y maximizar la variabilidad entre grupos. del campo hacia setos que delimitan el terreno. entonces. en caso de rehabilitación. espaciales y temporales. la diferencia que puede ocurrir en la descomposición o la fijación de nitrógeno simbiótico entre dos paladas de suelo del mismo campo. en otro lugar. en última instancia podría. el inventario de especies de lombrices de tierra.

son usados en el proyecto CSM-BGBD (véase prefacio) y están considerados como ejemplo. que afectan a la biodiversidad bajo suelo (y servicios ambientales asociados) y el componente de la biodiversidad bajo suelo. para explicar las posibles variaciones en la biodiversidad bajo suelo. En el nivel más alto. ampliamente discutidos. más útil como indicador de la respuesta del suelo al manejo. La Tabla 1. Los cuatro niveles de escala espacial en muestreo. al igual que en los protocolos de medición. será un determinante más de dicho nivel. por lo tanto. en este caso. A nivel paisaje es difícil evaluar el efecto de la biodiversidad bajo suelo sobre algunos servicios del ecosistema. a escala de paisaje. El impacto en el diseño de muestreo. incluyendo el descubrimiento de especies invasivas exóticas es. (2006). como se indica más adelante. El inventario de biodiversidad bajo suelo. El patrón de uso de suelo superpuesto en función de dichos efectos de clima. cada proyecto necesitará determinar su propia escala en función de sus objetivos. también tendrán una importante influencia en la biodiversidad. No obstante. deberá capturar la distribución. Paisaje. vegetación y tipo de suelo. al igual que los procesos de cambio relacionados. en el caso del ecosistema de suelo y sedimentos (Wall. el tiempo requerido para que una población creciente alcance un tamaño crítico mínimo donde es autosuficiente. 2004).taxa de biota varían de horas a años y pueden incorporar estados obligados de inactividad. mientras que las fecundidades también varían y. comparado con los efectos que produce la vegetación misma. tamaño y forma de estos gradientes y fragmentaciones. Los principales conceptos teóricos que corresponden a estos criterios son: apertura y conectividad. la distribución espacial de la biodiversidad bajo suelo estará fuertemente influenciada por los gradientes de altitud y temperatura. 1. Las características espaciales de la distribución de uso de suelo (“parches” de uso de suelo. como puede ser dentro de los bosques). como calidad y suministro de agua o control de erosión y no parece que éste juegue un papel importante. La biodiversidad bajo suelo. se enfatiza en el capítulo 2 de este manual. geología. de gran relevancia en ese nivel.3 muestra un resumen de niveles jerárquicos modificados a partir de los propuestos por Lavelle et al. derivados de la base mineral y vegetal. por los gradientes o transiciones de las condiciones de humedad o por los gradientes de las propiedades del suelo. La protección y conservación de los principales agroecosistemas y hábitats representa la mejor El inventario de la biodiversidad biológica del suelo 45 . también será diferente de un organismo a otro.

Cambios en la arquitectura del suelo. éste es el caso de algunos árboles donde ciertos organismos de suelo hacen uso de sus nichos. sobre todo. A nivel de parcela.. una combinación específica de tipos de cobertura. 2. Las interacciones laterales son componentes muy importantes para la biodiversidad bajo suelo. normalmente. respecto al cambio de uso de suelo. por lo tanto. 2006). La escala de tiempo de estos procesos (cambio de la composición de uso de suelo y configuración de paisaje) para ser observable necesitaría de varios o. queda dentro de los dominios funcionales de los ingenieros del ecosistema. pertenecientes a varios niveles tróficos y grupos funcionales que gobiernan la estabilidad de redes alimenticias y la provisión de funciones de apoyo. En este nivel.. la composición y actividades funcionales de la biota son de gran interés y. rompevientos. La biodiversidad sobre el suelo se determina por la variedad de cultivos encontrados en el área y por los elementos vegetales asociados con barbechos. Área de uso de suelo.. los cambios relacionados con el uso y cobertura del suelo. son visibles en escalas de tiempo más cortas que pueden abarcar desde pocos años hasta varias décadas. típicamente. pero son asociados con el manejo. describen los gradientes de la fertilidad del suelo en función de los recursos destinados al terreno. y para la manera en cómo funciona el sistema. si no es demasiado grande. de manera que la relación entre el patrón de distribución espacial de la biota sobre el suelo con la de bajo suelo son particularmente interesantes. tendrán un 46 Manual de biología de suelos tropicales . El terreno o parche. aunque sean provocados por cambios en la composición funcional y actividad de los ingenieros del ecosistema o del arado del suelo. de cientos de años. La intensificación de uso de suelo. cuando se trata de agrosilvicultura. Parcela o parche. incluyendo a las raíces de suelo. Estas áreas muestran. en el caso del inventario de biodiversidad bajo suelo. la estructura comunitaria y sus interacciones son reguladas por la arquitectura del suelo del lugar en específico (Lavelle et al. 2006 y Tittonell et al. Vanlauwe et al. es en este nivel donde la biodiversidad bajo suelo debería estudiarse de manera minuciosa. 2007. 1993). también lo es la abundancia de especies relativas. tramos de bosque y otros elementos de manejo de paisajes. incluso. tal es el caso de un área con plantaciones comerciales de té o la caracterizada por la agricultura de autoconsumo. Los gradientes de las propiedades de suelo sí ocurren en este nivel. 3. A este nivel. Las áreas de uso de suelo se definen en función de su uso y régimen de manejo (Huising. que implican una pérdida de sus aportes e impactos. por ejemplo.opción para dicha intervención. se asocia con la extracción de elementos vegetales como árboles. cercos vivos.

2001. Tal intervención debería apoyarse en el inventario y la abundancia relativa de especies. también despiertan gran interés. termitósferas. en relación con esto. dado que ésta es la unidad fundamental de la función del suelo. Las opciones para intervenciones de manejo en una escala de subparcela son actualmente limitadas. no es necesariamente exhaustiva. los procesos involucrados. Éstos existen en la escala de los horizontes de suelo. subparcela o microhabitat. etc. El inventario de la biodiversidad biológica del suelo 47 . Este nivel se refiere a los microhábitats que alojan a los microbios y a los componentes de la microfauna del sistema de suelo que los regulan. en la estructura de la red alimenticia. 4. Cualquier tipo de inoculación causará un impacto directo sobre la diversidad bajo suelo y. del agregado individual y de la partícula individual. la introducción de depredadores para el control de una enfermedad en particular. El manejo de materia orgánica y el uso de agroquímicos causarán un mayor impacto en la estructura de la red alimenticia. reflejándose la dependencia de los organismos más pequeños en los ingenieros del suelo para el suministro de sus sustratos (véase Lavelle y Spain. para mayores detalles y terminología). por lo tanto. sino más bien ilustrativa. Las “intervenciones” enlistadas en la Tabla 1. pertenecientes a grupos funcionales definidos o a niveles tróficos dentro de la cadena alimenticia. la competencia y la eficiencia son de particular relevancia y. pero un entendimiento de los procesos e interacciones es vital. A nivel parcela.3 son parcialmente derivadas del concepto “el manejo jerárquico de la biota del suelo”. Cambios estructurales en la comunidad biótica (conexiones en la cadena alimenticia. como en la cadena alimenticia. el grado de diversidad genética. composición funcional) pueden necesitar de varios años. por ende. condicionados por los organismos de suelo en la producción de servicios de apoyo tales como mantenimiento de la estructura de suelo y la descomposición de materia orgánica introducida. dentro de los microorganismos. puede servir para corregir desequilibrios en la composición funcional o para mejorar algunas funciones en particular. drilósferas.. Nicho.efecto sobre las interacciones tróficas y. La redundancia funcional entre los transformadores primarios (especies o familias diferentes que cumplen una misma función). son segregados en los dominios funcionales: rizósferas. según lo describe Swift (1998). La lista de intervenciones y mediciones correspondiente a la biodiversidad bajo suelo. la inoculación con especies microbianas. tienen escalas de tiempo relativamente cortas y mostrarán variaciones estacionales. principalmente.

de suelo.relacionada con diversidad arriba ingenieros de clasificación). funcional. del suelo. parches de selva.existiendo una superposición entre niveles de escala dentro de los parámetros a medir.cas e invasoras. de detalle de la biológicas y bio.3 Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. de relevancia específica para la biodiversidad y mantenimiento de la provisión de servicios de ecosistema. Tabla 1. Número de cla. manejo ecosistemas: integrado de patrón de distrirecursos naturales bución espacial. mancífico (depentenimiento de de especies y régimen de especialmente diente del nivel áreas de refugio manejo. dentro de degradación diversidad y tico y patrón de composición cobertura de suelo un paisaje espe. unidades de referencia. de un país. por ejemplo. 3–20 tipos de Intensificación Diversidad Área con uso de áreas de uso de de uso de suelo. corredores biológicos. suelo caracteríssuelo.Proceso/ ses o unidades intervención Área de uso de suelo 48 Manual de biología de suelos tropicales . cuenca mayor. saje. varias suelo: protección lógica de suelo: uso de suelo y de por bioma o por de usos de suelo y especies exótiecosistemas como región dentro elementos de pai. Capa de nivel de agregación Paisaje Tipo de unidad Medida/ parámetro de biodiversidad Área caracterizada Sin especificar: Cambio de uso de Diversidad biopor un mosaico de tal vez. y prácticas de conservación del suelo. procesos asociados de cambio y componentes relevantes de la biodiversidad.

campo agrícola. utilizando los métodos previstos en este manual. erosión. parcelas de vegetación.Proceso/ ses o unidades intervención Medida/ parámetro de biodiversidad Intensificación de Abundancia manejo de suelo y relativa de cultivos. inoculación.3 Continúa. proveen un gran número de parámetros para la evaluación de la biodiversidad bajo suelo. el inventario bajo suelo de la biodiversidad. inoculación con microsimbiontes. de agentes de control biológico. especies. diversidad introducción genética.área de uso de jo particular. • Proporciones relativas de GF. etc. selva. materia orgánica. dependiendo del tipo de análisis realizado: En cuanto a la biodiversidad: • Riqueza taxonómica a nivel de especie. Capa de nivel de agregación Parcela. los datos tendrán que ser acumulados en cada punto de muestreo. microhábitat horizontes de suelo. etc. • Abundancia (total) y biomasa (en el caso de animales) de taxa. composición labranza mínima. El inventario de la biodiversidad biológica del suelo 49 . Nicho Por ejemplo. funcional. ejemplo.Tabla 1. dentro mejoramiento de y entre grupos funcionales y sistemas de cultivo y manejo de niveles tróficos. Por regla general. • Abundancia y biomasa de los grupos funcionales (GF). por suelo. rizósfera. na. parche Tipo de unidad Número de cla. Datos requeridos Los métodos expuestos en este manual. 10 a 100 por Área con un uso particular y mane. o a nivel más alto o más bajo (por ejemplo. Biomasa y actiManejo de vidad microbiabiota clave. que consisten en el uso oportuno de tiempo y recursos. provee los siguientes datos e información. para lo cual se indican en los capítulos 3 y 9 los mejores métodos. drilósfera. Sin tomar en cuenta los objetivos específicos y el diseño experimental de cualquier estudio. cepas para microsimbiontes).

functional groups and ecosystem processes’. New York. Applied Soil. D. Daily. J. (2005) ‘Belowground diversity assessment: developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. A pattern recognition approach to land use inventory at the sub-regional scale 50 Manual de biología de suelos tropicales .. Oxford University Press. L. Características de vegetación. X. E. pp. Hattori. B. (1998) ‘Soil fauna. (1981) ‘Effects of animals on soil’. vol 73. P. A. D. Conservation Ecology. Nwaga. J. T. Bignell. Tiedje. T.• Índices cuantitativos generales de riqueza y equitatividad. E. C. Brussaard. J. Didden. S. En cuanto al suelo.. vol 271. pp. pp. y Swift. W... R. T. Susilo. J. Propiedades físicas y químicas básicas: pendiente y aspecto del suelo.. intensidad de uso y cobertura de suelo: • • • • • • Cultivo aparente o uso de barbecho. S... M. F.. Biological Reviews. C.. Moreira. Brown. D. 123–135.Rusek. D.. Dibog. Bignell. Klopatek. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. pp. P. in C. L. (2005) The Biology of Soil. J. Lavelle. R. V. P. Prácticas actuales de manejo de suelo y cultivos. Gupta. Hawksworth. Vosti.. vol 26. (ed) (1997) Nature’s Services. vol 7. A. (1997) ‘Biodiversity and ecosystem functioning in soil’. F.. uso del suelo. Ambio. Freckman.. Folgarait. Island Press. P. issue 1. Palm. y Virginia. vol 5. Cavalier-Smith.. Hole. Oxford. Proceedings of the Royal Society of London Series B..Ecology. 1251–1262. Huang... A.. Promedio de datos climáticos y precipitación real hasta la fecha de muestra. guilds. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives.. G. Brussaard. Referencias Bardgett. (2003) ‘Linking keystone species and functional groups: A new operational definition of the keystone species concept’. D. V. Huising. Tondoh. Geoderma. F. C. Davic. Malloch. Historia precisa del uso de suelo desde su estado de selva no perturbada hasta otro tipo de vegetación pre-cultural. D. P. Washington DC. D.. (1998) ‘A revised six-kingdom system of life’. Behan-Pelletier. 75–112. (2004) ‘Only six kingdoms of life’. D.. Columbia University Press. Cavalier-Smith. response 11. D. 563–570. Fragoso... L. 203–266. B. V. pp. Sanchez. vol 9.. Pashanasi. R. Soderstrøm.

vol 33... M.. P. vol 98. Longcore. (2004) ‘Connecting soil and sediment biodiversity: The role of scale and implications for management’. Stork. Volters. W. Higashi (eds) Biodiversity. P.. Lavelle. Brown.D. E. Oikos. T.. D. New York. Wageningen Agricultural University. J. y Dillion. Springer.. Nature (Lond). G. W. J. D. 685–701. D.. H. Lawton. G. pp. F. Lawton..using remote sensing and GIS applying an object oriented and data-driven approach’. Blouin. Wallingford. Dordrecht Lavelle. pp.. Lavelle. M. y Paul. V. Kibblewhite.. 159–193. y Shachak. Lawton. Siqueira. G. J.. Spain. Decaëns. 860–871. K. H. A. Y. (1996) ‘Diversity of soil fauna and ecosystem function’. C. Island Press. S.vol 69. Wall (ed) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments... P. M. (2008) ‘Soil health in agricultural systems’. (1997) ‘Soil function in a changing world: The role of invertebrate ecosystem engineers’. Bloemers. S. Thesis. Bignell. pp. (2001) Soil Ecology. Barot. in D. K.... V. F. T. M. E. (1998) ‘Biodiversity inventories. V. L.. y Watt.. V. Roger. P.. (1996) ‘The role of species in ecosystems: Aspects of ecological complexity and biological diversity’. M. 3–16. Mozley-Standridge. pp. M.. Biology International. in T. C. J. R. 72–76. Levin y M. G. M. S. y Brussaard. CAB International. Srivastava. (2006) ‘A molecular phylogeny of the flagellated fungi (Chytridiomycota) and a proposal for a new phylum (Blastocladiomycota)’. N. M. N. Berlin. Bignell. D.. Moreira... (2006) ‘Soil invertebrates and ecosystems services’. H.. Boulton. A. E.. A. P. P.S. pp. M.. Mawdsley. Eggleton. Letcher. D. J-P. Margerie. E. Jones. A. Lavelle. European Journal of Soil Biology. El inventario de la biodiversidad biológica del suelo 51 . D. indicator taxa and effects of habitat modification in tropical forest’. P.. Larsen. S. J. DC Lavelle. E. Kluwer Academic Publishers. Mora. G. V. E. P. Holt. W. F. Washington. Powell. P. M... Ritz. B. Aubert.. J. J. Lepage.. The Inventory of Soil Biological Diversity 15ES_HTSB_11-6 13/6/08 18:14 Page 15 European Journal of Soil Biology. pp. D. an Ecological Perspective.. Hammond. James. K. (1994) ‘Organisms as ecosystem engineers’. (1998) Five Kingdoms – An Illustrated Guide to the Phyla of Life on Earth. Bureau. Ph. P. vol 42. H. H. Behan-Pelletier. Margulis.Griffith. 3rd edition. O. R.. J..J. G. 373–386. Hodda. H. T. Porter. The Netherlands. Freeman. R. Hunt. vol 391. y Vilgalys..pp. Ineson. Philosophical Transactions of the Royal Society Series B. St John. P. Brown. M. L. S.. A. Mycologia. M. y Rossi. Abe.. Garey. S. y Schwartz.. y Swift. M. B. (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. P. Bignell.. E. Austen.. vol 363. Hawkins. Heal. P. W.. Giller... S. S3–S15. vol 33.

N. V.. 113–134. N. (1998) ‘Towards the second paradigm: Integrated biological management of soil’. A. D. vol 87. M. S. Blackwell. M. y Huhta. N. 25–31. y Van Noorwidjk. R. Moreira.. y Giller. (1998) ‘Functional diversity of decomposer organisms in relation to primary production’. y Giovannoni.. pp. 11–24. Kandler. K. M. C. J. G.. J. M. L. (1990) ‘Towards a natural system of organisms: Proposal for the domains Archaea. H. J. Carvalho (eds) Soil Fertility. J. Bacteria. (1979) Decomposition in Terrestrial Ecosystems. 376–390. M.. P. O. vol 94. M. E.Rappé. M. Island Press. vol 57. Izac. B. inJ. pp. Woese. J. (2002) ‘Biodiversity and ecosystem services in agricultural landscapes – are we asking the right questions?’ Agriculture. Vanlauwe B. 171–182. Lopes. (2007) ‘Heterogeneity of crop productivity and resource use efficiency within smallholder Kenyan farms: Soil fertility gradients or management intensity gradients’. Swift. F. Guilherme. y Wheelis. pp. R. J. O. Tittonell. Soil Biology and Plant Nutrition interrelationships. S. S. Setäla. P. Tittonell. Furtini Neto y J. vol 76. (1992) ‘Invertebrates as determinants and indicators of soil quality’. (2003) ‘The uncultured microbial majority’. Stork. 23–32 Swift. de Ridder.. Annual Review of Microbiology. Wall. y Mukalama. A. 52 Manual de biología de suelos tropicales . E. vol 104.. Swift. (2006) ‘Within-farm soil fertility gradients affect response of maize to fertilizer application in western Kenya’. American Journal of Alternative Agriculture. (ed) (2004) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. Ecosystems and Environment. 4576–4579. Vanlauwe. Brazil. P. Proceedings of the National Academy of Sciences USA. J. Heal. Siqueira. Washington.. Lavras. Laakso. W. M. J. pp. Faquin. y Anderson. SBCS/UFLA/DCS. A. Mikola. vol 7. vol 9. V. Oxford. Nutrient Cycling and Agroecosystems. E. L. Agricultural systems. 369–394. pp. H. N. and Eucarya’. G. pp. S. pp. Applied Soil Ecology. M. y Eggleton. pp. O.

Ronald Zanetti. también incluye cómo determinar la localización de estos sitios de muestreo: lo que se discutirá más abajo. Además. en los cuales se llevarán a cabo los protocolos de medición. Louzada. Cares. que aplica en todos los casos (Cochran. se cuenta con una teoría de muestreo bien establecida. en otra. el problema gira en torno a cómo escoger el número y localización de los puntos de muestreo en el paisaje en cuestión. Juvenil E. 2000. se encuentra el problema de la elección de los sitios. 2007). por tanto. en un punto predeterminado del paisaje.Capítulo 2 Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo E. Julio N. mismos que se describirán en los siguientes capítulos. Souleymane Konaté. Jeroen Huising. En cuanto al argumento es más complicado que una mera elección al azar. En algún punto entre estos dos. Fátima M. Susilo. Gregoire y Valentine. Richard Coe. Hay numerosos textos que describen la teoría y su aplicación (ej. Entonces ¿para qué se necesita otro capítulo que discuta las técnicas de muestreo de la biodiversidad del suelo? A pesar de los conocimientos y experiencias en rela53 . 1977). Moreira. es necesario escoger el lugar dónde se tomarán las muestras de suelo para los análisis químicos. Francis-X. Southwood y Henderson. En una primera escala. S. Huang (†) INTRODUCCIÓN Gran parte de este manual contiene instrucciones de cómo tomar mediciones una vez que se tiene un sitio de muestreo. una gran experiencia al respecto. Existe una larga tradición de muestreo en la ecología de campo y. se necesita determinar en dónde va a estar localizado todo el estudio. La base del problema radica en el muestreo. Meine van Noordwijk y Shiou P. El problema de localizar los puntos de muestreo se presenta a diferentes escalas.

entonces esta variación es desconocida. 4 Los objetivos del estudio determinan el diseño. entonces tratan de entenderlo” y aquéllos que “empiezan con una hipótesis y tratan de probarla”. 54 Manual de biología de suelos tropicales . Ford (2000) hace referencia a una amplia discusión de los objetivos de investigación en ecología. Si datos similares no han sido colectados antes. o bien. el tamaño de muestra requerido depende de la variación entre las muestras. Por ejemplo. en cualquier proyecto habrá desacuerdos y discusiones en cuanto a las estrategias de muestreo. Comúnmente hay malos entendidos de algunos de los principios básicos. Sin embargo. 5 Los investigadores toman diferentes posturas filosóficas relacionadas con el enfoque de muestreo. se presenta un ejemplo del enfoque utilizado en el proyecto CSM-BGBD. tales como por qué el trabajo de muestreo debe ser de manera aleatoria. o qué es una réplica. pueden discrepar en lo referente al carácter práctico del estudio que está siendo diseñado. 3 Puede haber límites en cuanto a la teoría. están los que “Ven lo que está ahí. En este capítulo se describen algunas opciones para muestrear la biodiversidad del suelo y las ventajas o desventajas de los diferentes enfoques. debido al tiempo y al costo. (1989) lo explican con detalle en el contexto de muestreo ecológico. 2 La aplicación de una teoría de muestreo puede requerir de información con la que no se cuenta hasta que los datos han sido colectados. Son varias las razones para ello: 1 La aplicación de una teoría completa o de métodos tan extensivos como los utilizados en otros estudios. Kenkel et al. estos podrían no estar completamente desarrollados o los objetivos múltiples podrían sugerir diferentes enfoques para el muestreo. el acceso a sitios de muestreo ideales puede ser restrictivo. A continuación. OBJETIVOS DEL ESTUDIO Y BASES DEL MUESTREO La mayoría de los autores que escriben sobre diseños de investigación puntualizan que el diseño se determina en función de los objetivos. Muchos de los debates sobre los métodos apropiados de muestreo se deben a diferencias de opinión en cuanto a los objetivos exactos del estudio. Por ejemplo. es posible que no sea fácil tomar tantas muestras como se desearía.ción con el tema.

se han hecho imD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 55 . y en cada estrato tomar una muestra aleatoria). situado en el lindero entre el bosque y la pradera. su imaginación y descubrimientos potenciales podrían estar restringidos. indica cómo la precisión de la estimación puede ser controlada mediante la elección de la muestra. Piense en un nicho raro en el paisaje (por ejemplo. Si el objetivo del estudio es estimar la biomasa media de escarabajos en general. Un enfoque de muestreo consiste en colectar datos usando el método de MAS o mediante una cuadrícula. Otra alternativa es formular algunas hipótesis predictivas para explicar los patrones en la biodiversidad. Los seguidores del primer enfoque pueden argumentar que no quieren ser prejuiciados por hipótesis previas. y luego diseñar un estudio cuyo objetivo específico sea probar estas hipótesis. intentan entender los patrones en la biodiversidad.El muestreo aleatorio simple (MAS) constituye el punto de partida para la discusión sobre cómo muestrear. La media de la muestra es una estimación imparcial de la media poblacional. pero si el propósito es realizar un inventario de especies. La teoría. No obstante. por lo que prefieren mantener la mente abierta y partir de la observación. Si el objetivo es estimar la media poblacional (la biomasa media de escarabajos por m2 dentro del área de estudio. dividir la población en sub-poblaciones o estratos. y su error estándar puede ser estimado sin hacer supuestos acerca de la variación dentro de la población (técnicamente. Intuitivamente. existirá solamente una pequeña porción del área de estudio ocupada por este tipo de nichos. Por supuesto. Cuando el objetivo es identificar todas las especies de un grupo dado en el área de estudio entonces el MAS resulta inapropiado. no importará si los nichos raros son omitidos o no. intentando describir patrones (por ejemplo. y la precisión aumenta con un tamaño de muestra fijo. Otra alternativa al MAS consiste en usar un muestreo sistemático usando una cuadrícula. encontrando correlaciones con variables ambientales). esto es atractivo. entonces. existen pocos estudios ecológicos cuyo objetivo sea estimar la media poblacional. a través de la estratificación (es decir. Un ejemplo de un objetivo que requiere diferentes enfoques de muestreo son los inventarios. argumentando que si se empieza partiendo de un objetivo limitado. el caso de las orillas de un estanque. La mayoría de los estudios. análisis de conglomerados y ordenación) y luego explicarlos (por ejemplo. entonces los nichos raros deben ser incluidos. en ecología. incluyendo los del proyecto CSM-BGBD. o el número promedio de especies de hongos en 1 cm3) el MAS adquiere propiedades relevantes. lo que se discutirá en la sección de muestreo aleatorio y sistemático. existe una estimación del error de muestreo basada en el diseño).

entonces es probable que: • La mayoría de los sitios de muestreo tengan valores de P y MOS alrededor de la media con. sin seguir estudios planeados. relativamente. es imposible elegir cuáles. sin alguna noción de los factores ambientales que puedan controlar la biodiversidad. Entonces es difícil y hasta imposible. el estudio podría ser diseñado para incluir específicamente algunas muestras con valores altos de P y de MOS y otras muestras con valores bajos de P y de MOS. parcelas con un valor alto de P. frecuentemente. 3 Si se parte de hipótesis específicas. por ejemplo. haciéndolo más eficiente. además. Se requiere de estudios minuciosamente planeados para poder probar dichas explicaciones. 56 Manual de biología de suelos tropicales . entre un número infinito de factores. cada investigador debería estar abierto a la posibilidad de observaciones no anticipadas y explicaciones verdaderamente nuevas. no obstante. No obstante. separar los efectos de las dos variables. pocos puntos con valores altos o bajos. 2 De hecho.1). es posible mejorar el diseño del estudio. está determinada por el nivel de Perturbación (P) y el nivel de Materia Orgánica del Suelo (MOS) y se colectan los datos por medio del MAS o por muestreo de cuadrícula. • La MOS y la P pueden estar correlacionadas. aunque ésta sea implícita. deberían ser medidos en los sitios de muestreo. La estratificación puede usarse para incrementar el número de puntos con MOS más extremos y mejorar la estimación de la relación sin incrementar el número de muestras. los que proponen el enfoque “no hipotético” en realidad parten de alguna forma de hipótesis. si se trata de entender la relación entre la biodiversidad del suelo y la MOS o la P. frecuentemente. existen tres razones para tratar de diseñar un estudio con objetivos específicos que incluyan hipótesis comprobables: 1 Los descubrimientos inesperados usualmente tienen la naturaleza de formulación de hipótesis observacionales que sugieren explicaciones. son los puntos más extremos los que proporcionan más información (Figura 2.portantes descubrimientos por casualidad. Si las hipótesis implícitas se hacen explícitas el diseño de los estudios pueden ser mejorado. Este último punto subraya o enfatiza gran parte de lo que sigue en este capítulo. Por ejemplo. tienen valores bajos de MOS. Sin embargo. Si suponemos la hipótesis de que la biodiversidad del suelo en parcelas agrícolas.

es hacer justamente el cambio y esto precisamente constituye la base de un enfoque experimental. generalmente. en lugar del experimental. El objetivo global del proyecto CSM-BGBD fue comprobar la hipótesis de que un incremento en la intensidad del uso del suelo cambia la biodiversidad del suelo (más específicamente. pero aún puede resultar útil cuando se enfoca con un diseño de muestreo. sin embargo. Cuando se determina la distancia entre los sitios de muestreo y el tamaño total del área de estudio. no siempre resulta viable. lo ideal sería llevar a cabo un estudio longitudinal. Se espera que las correlaciones entre la intensidad de usos de suelo y la biodiversidad del suelo reflejen alguna conexión causal.1 y las relaciones pueden ser más complejas que el caso de dos líneas rectas. como en muchos otros.Entonces. tampoco es viable en un proyecto de duración fija y corta. muchas veces es la única opción disponible. Si tenemos que utilizar un diseño de estudio observacional. entonces se abren nuevos debates con una probabilidad de mejorar el diseño del estudio. La única manera cierta para determinar el efecto de un cambio. En la práctica. en donde las parcelas sean monitoreadas a través del tiempo para observar si los cambios en la biodiversidad del suelo pueden ser correlacionados con cambios en el uso del suelo. Este planteamiento es muy amplio. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 57 . se utiliza una aproximación transversal. los efectos de ambas variables. Otro ejemplo de una hipótesis implícita en muchos de los estudios es la escala espacial en la que ocurren los patrones interesantes. puede que sea imposible o inútil producir un solo índice de biodiversidad del suelo. el investigador hace una selección de las escalas importantes para su estudio. dicha investigación iría acompañada de un experimento. señala una pérdida de biodiversidad del suelo). Lo anterior. sin embargo. y sus efectos combinados pueden ser estimados. En el presente estudio. considerando un rango de usos de suelo en un momento específico de tiempo. se aplican los mismos principios de diseño. Si éstas se seleccionan explícitamente. Aunque la validez de este enfoque puede ser cuestionable. puesto que se desconoce el tiempo necesario para el monitoreo. que indiquen lo que pasaría con la biodiversidad del suelo si los usos de suelo cambian en el futuro. En términos ideales. Las discusiones en este capítulo sólo consideran esquemas alternativos de muestreo para datos colectados por el método transversal. como el que se observa en la Figura 2.

Paso 1: Defina objetivos Como se indicó en la sección de objetivos del estudio y bases de muestreo. desde un principio deberán ser expresados de manera clara y precisa. o bien. los objetivos determinan todos los aspectos del diseño. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. por estratificación. esto aumentará la precisión de la estimación de la pendiente. Escríbalos y compártalos con otros para 58 Manual de biología de suelos tropicales . por lo tanto.1 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. tiempos y disponibilidad de expertos. Requiere de un entendimiento profundo. Asimismo. podría surgir una serie de restricciones adicionales. b) si se incluyen de manera deliberada valores de MOS más extremos. ENFOQUES PRÁCTICOS El diseño de un esquema de muestreo exitoso y práctico es todo un arte. no obstante. la necesidad de transportar con rapidez las muestras desde el campo hasta el laboratorio. con base científica y de las propiedades que ofrecen los diversos métodos. dando un estimado pobre de la pendiente. es posible que se especifiquen algunos pasos del proceso en general que se deben seguir en cualquier estudio. serán diferentes para cada estudio y darán a cada investigación un aspecto único. Sin embargo. es necesario que se combine con las restricciones prácticas impuestas por costos.Figura 2. el acceso limitado a localidades deseadas para muestrear. Los detalles de cómo dichos factores prácticos y teóricos pueden mezclarse. por ejemplo.

. diseños utilizados en otros estudios y su imaginación. imágenes de detección remota (ej. Imagínese que ha finalizado el estudio y ha obtenido resultados ¿Qué tablas y gráficas le gustaría presentar?. Paso 4: Elabore un diseño Elabore un diseño tentativo utilizando una combinación de principios generales. o bien. Anote específicamente el tamaño de las muestras utilizadas y la variación de los resultados. Estos incluyen: mapas topográficos (ej. La Figura 2. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 59 . Después deberá comprobar con cuidado que: a) los resultados realmente logren los objetivos y b) que el diseño de muestreo simulado realmente pueda mostrar estos resultados.. su propia experiencia. para identificar los principales usos del suelo que se incluirán en el estudio). ¿Cuáles cumplen con sus objetivos y proveen evidencia para su hipótesis?. Paso 2: Consulte otros estudios Consulte los estudios relacionados con su investigación. Paso 3: Reúna datos relacionados Reúna información o antecedentes que serán necesarios para diseñar los detalles del muestreo. Si bien puede haber aspectos sobre los cuales tenga poca idea. anótelas y numérelas.. datos meteorológicos (ej. otros que han trabajado en el mismo sitio.. Una herramienta que ayuda a refinar los objetivos es la presentación de resultados simulados. mapas de cobertura del terreno). Consiga el mayor número de comentarios y sugerencias de los expertos en la materia.1 es un ejemplo simple.que pueda discutir algunas sugerencias. siempre deberá plantear un proyecto realista. Cada estudio cuenta con aspectos únicos y siempre habrá estudios previos de los cuales puede aprender: ésto le permitirá entender qué aspectos de los métodos utilizados han tenido éxito y cuáles limitan la eficiencia y calidad de los resultados. Escriba el diseño con tantos detalles como sea posible. indican la estratificación por altitud o nos permiten entender los problemas de acceso). Estos expertos pueden ser investigadores que trabajan sobre temas similares en otros lugares. otros que tienen experiencia en los métodos que va a utilizar. mapas de uso de suelo (ej. para ayudar a decidir cuáles son las temporadas idóneas para el muestreo de campo).

pero deberás seguir adelante. considerará algunos aspectos que pueden pasar desapercibidos por el ecólogo. un error común es obtener información que sugiere que los objetivos son inalcanzables. revise los objetivos a la luz de nueva información. procedimientos de manejo de datos. Trate de incluir un estadista con experiencia en investigación en ecología. probablemente. esto dará una indicación de la variabilidad. En cada área. JERARQUÍA. Paso 7: Revise los pasos En cualquier paso. El proyecto CSM-BGBD es un buen ejemplo. uno o más sitios de estudio (etiquetadas como “ventanas”) fueron seleccionados. etc. procese algunos datos hasta llegar a un análisis estadístico. Asimismo. que han usado métodos similares o que han trabajado en la localidad o simplemente. Una investigación piloto abre la posibilidad de evaluar el aspecto práctico del esquema de muestreo. Un buen estadista. permita probar y refinar los protocolos de medición. Paso 6: Realice una prueba piloto Pruebe su enfoque. De ser posible. De nuevo. también permita estimar el tiempo del muestreo y el procesamiento de las muestras. REPLICACIÓN Y TAMAÑO DE MUESTRA La mayoría de los diseños de estudio son jerárquicos y el problema de muestreo no sólo consiste en seleccionar el sitio de muestreo dentro del área de estudio. En particular. que expresan su opinión acerca de su tema. lo que puede ser útil para ayudar a decidir el tamaño final de la muestra. puede ser que tenga que retroceder a un paso anterior para volver a intentar. puesto que involucra varios países. éstos pueden ser personas que han trabajado con temas similares. fueron seleccionadas una o más áreas de estudio.Paso 5: Revise su diseño Comparta su diseño con otros investigadores para que expresen su punto de vista y sus comentarios.. Dentro de cada sitio de estudio alrededor de 100 puntos de muestreo fue60 Manual de biología de suelos tropicales . Dentro de cada país.

Como ejemplo. El objetivo de la investigación es encontrar algunos patrones. ¿cuáles son? En los niveles más altos. Por lo tanto. relacionados con los usos de suelo. puede concluir (con un grado conocido de incertidumbre. en algún nivel. La intención es saber a qué se refieren sus resultados. Lo primero es centrarse en la idea de una teoría de muestreo de una “población”.ron seleccionados y en cada punto se tomaron muestras (el protocolo de medición determina más capas en la jerarquía. Suponga que cuenta con diez muestras tomadas de un bosque y diez en las cercanías de campos cultivados y que las muestras de bosque tienen consistentemente una alta biodiversidad del suelo ¿qué podría concluir? Si las muestras fueron seleccionadas de manera apropiada. Sin eso. lo que requerirá de una muestra de fincas pertenecientes a esta localidad. La terminología es confusa y no tiene nada que ver con una población biológica. Los patrones de interés son los que mantienen una consistencia a través de un número de casos. es necesario repetir observaciones con el fin de determinar si los patrones son realmente consistentes. Si se desean resultados que apliquen a los límites del bosque de África del Este en general. se podría estudiar la biodiversidad del suelo en fincas alrededor de los límites del bosque en el monte Kenia. las respuestas no necesariamente estarán basadas en la ciencia. sólo podemos hacer afirmaciones sobre el monte Kenia con base en los datos obtenidos y no es posible extrapolarlos a otros lugares. que trata de mantener la consistencia de patrones y relaciones. El muestreo implica que el conjunto sobre el que nosotros queremos hacer inferencias (“la población”) necesita ser delimitado antes de que un esquema de muestreo pueda ser planteado. ya que estos patrones pueden utilizarse para hacer predicciones y pueden reflejar algunas reglas o procesos. entonces también se necesitará una muestra de otros bosques. En cada capa jerárquica. La selección de algunos países puede estar basada en función de su política o de los intereses de algunas agencias financiadoras e investigadores que dirigen el proyecto. dicha selección se deberá basar en los objetivos del estudio y en la aplicación de algunos principios. pero. aunque. estrictaD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 61 . como consecuencia de la extracción de cuatro muestras tomadas para la caracterización del suelo y sub-muestras de éstas para los análisis químicos). tales como los patrones de la diversidad del suelo. se plantean las mismas preguntas: ¿cuántas unidades deberían de ser seleccionadas?. La segunda idea es la de replicación. evaluada mediante un análisis estadístico) que las muestras de bosque contienen mayor diversidad que las de los campos cultivados.

para poder examinar las diferencias en la biodiversidad del suelo. entonces en algún momento se perderán las ventajas posibles de muestrear por cuadrícula y se terminará con un diseño que podría parecer un muestreo aleatorio de sitios individuales. Si busca una conclusión válida para los bosques. representan una “regla” aplicable ampliamente.2c). sólo podrá concluir que ese bosque en particular es más diverso y no. patrones consistentes entre sitios. Dentro de cada sitio de estudio se podrán establecer conclusiones más contundentes si por ejemplo. Algunas de las implicaciones de estas ideas en el muestreo de cuadrícula son ilustradas a través de un ejemplo simplificado que se muestra en la Figura 2. Dentro de un estudio jerárquico. Un enfoque más certero es asegurar una replicación válida y algunos resultados genéricos. Una respuesta a esto es definir una nueva categoría de “límites de bosque” y asegurar ventanas en los tres sitios de muestreo (Figura 2.2. determina el nivel jerárquico donde se requiere tener réplicas.2a. Si este proceso de reducir el tamaño de las ventanas mientras se incrementa su número se continúa. varios bosques son muestreados. La palabra “escala” es confusa y controversial en la ecología (Peterson y Parker. El que muestras repetidas dentro de un bosque sirvan para ser interpretadas de igual manera que las muestras de diferentes bosques depende de las propiedades de los datos y no. 1998). Nótese que no es necesario muestrear todos los usos de suelo en cada ventana. En la Figura 2. como los sitios de estudio pueden proveer un nivel de replicación.2b se pueden observar tres ventanas más pequeñas para muestrear tres diferentes parches de bosque y no uno solo. a través de un diseño que replique bosques y otros elementos de uso de suelo. Sin embargo. ha sido construida una cuadrícula de tal manera que incluya los dos usos de suelo. pero queda claro que la escala en que se anticipan o hipotetizan los patrones.2d). probablemente. Por ejemplo. La replicación puede aumentarse y abarcar más área total observada. los bosques en general. utilizando más ventanas y más pequeñas (Figura 2. del diseño de muestreo. la 62 Manual de biología de suelos tropicales . Una crítica a este tercer tipo de diseño es que todos los sitios de muestreo en tierras agrícolas quedan cerca de un límite de bosque. por lo que no pueden ser considerados representativos del uso de suelo. deberá buscar una consistencia en varias de ellos. etiquetados como: “bosque” y “agricultura”. las unidades de nivel más alto. En la Figura 2. por lo tanto. puesto que representan “pseudo-réplicas”.mente hablando. muestras múltiples de un mismo bosque no sirven al mismo propósito. Dicha cuadrícula es una “ventana” con 77 puntos de muestreo (intersecciones) definidos. El objetivo es muestrear un paisaje con dos usos de suelo.

Para poder evaluar la biodiversidad del suelo dentro de un 1 km². se requerirá de más muestras. los objetivos de un proyecto de biodiversidad del suelo pueden incluir “análisis del paisaje”. pero no es relevante para afirmar la consistencia del patrón a través de la unidad de 1 km² necesaria para examinar las hipótesis. hipótesis puede ser “la biodiversidad del suelo en parcelas agrícolas decrece con el aumento a la distancia del límite del bosque”. con varios niveles de cobertura de bosque. se necesita definir el significado de “en el paisaje”. por lo tanto. La réplica dentro de la unidad es importante para determinar la precisión con que la biodiversidad del suelo es medida para cada unidad. factores del paisaje como la fragmentación del bosque. afectan los procesos. suponiendo que fue definida como áreas de 1 km². utiliza datos en el nivel de parcela y el otro. Entonces la hipótesis necesita una muestra de una unidad de 1 km². d) reconociendo los límites como otra categoría. con réplicas en cada distancia. En otras áreas de la ecología. se basan en datos de diferentes niveles jerárquicos: uno. no queda claro el diseño de muestreo que se necesita. Lo anterior. puede ser investigado con parcelas (sitios de muestreo) en un intervalo de distancias. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 63 . c) incrementando la replicación. con la definición de algunos sitios dentro de cada unidad. Ahora es la réplica quien determina la necesidad de varias áreas en cada nivel de cobertura de bosque. sin embargo.2 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. b) tres cuadrículas que muestrean tres diferentes parches de selva. Una hipótesis diferente sería “la biodiversidad del suelo en parcelas agrícolas decrece con la reducción de la cobertura del bosque en el paisaje”. es decir. la escala espacial en que se evaluó la cobertura del bosque. En este caso. si se intenta hacer un “análisis en el nivel de paisaje”.Figura 2. Los dos ejemplos del párrafo anterior son análisis que utilizan factores del paisaje. datos en el nivel de unidades de 1 km². El mensaje es claro: “el nivel de paisaje” no está bien definido y.

1993) permiten continuar con el muestreo hasta que algunos criterios se cumplan. Si bien existe cierta atracción por esta idea. No obstante. Aunque sean teóricamente atractivos. requieren puntos más lejanos. como la diversidad de diferentes grupos funcionales. biomasas y proporciones de estos grupos funciones o especies. pero saber qué relevancia tendrá en nuevos ambientes puede ser desconocida. se incluyen ambos 64 Manual de biología de suelos tropicales . Una estimación aproximada de la varianza puede ser obtenida de estudios previos. muchas veces no es posible especificar un tamaño de muestra que resulte importante. es improbable que sean prácticos para los estudios de biodiversidad del suelo porque el trabajo necesita planearse en distintas fases de campo y de laboratorio. dada la necesidad de planear campañas de campo por adelantado. Otra complicación surge a partir de las respuestas multivariadas de interés. a diferentes escalas. 1996) permite que el diseño responda a patrones que se detecten. sin embargo. la diversidad del suelo entre dos usos de suelo) que es importante detectar. con muchas mediciones que sólo están disponibles después de un largo periodo de muestreo en campo. El muestreo adaptativo (Thompson y Seber. medida de diferente manera. y estudios previos similares y pilotos. Una variedad de diseños a multi-escala han sido utilizados en estudios ecológicos. la respuesta de un cultivo a un fertilizante) entonces es viable especificar la respuesta mínima que es importante detectar. pero normalmente resulta difícil especificarlos. de tal manera que los patrones. Enfoques secuenciales (Pedigo y Buntin. en la práctica. y la variabilidad entre réplicas del mismo uso de suelo. cuando el objetivo de la investigación es detectar y entender algunos procesos. Los métodos estándares presumen que existe una respuesta medible de la biodiversidad del suelo que se puede utilizar para obtener el tamaño de muestra. el tamaño de muestra se ha basado en una combinación de información de métodos formales (lo que puede indicar los órdenes de magnitud requeridos). los métodos estándares están disponibles para ayudar a seleccionar el tamaño de muestra. Cuando la investigación es dirigida a medir respuestas económicas para decisiones de manejo (por ejemplo. es improbable su viabilidad. al igual que el software para iniciar el análisis. ningún estudio real ha multiplicado las respuestas de interés. Por lo tanto. La idea de estos diseños es elegir posiciones de muestreo. Los métodos requieren conocimiento de dos cosas: de la magnitud de las diferencias (por ejemplo. números. Queda claro que la decisión sobre el tamaño de muestra depende de esto. Los patrones a escala fina requieren puntos muy cercanos.Una vez que se sepa lo que hay que replicar. puedan ser investigados. Por lo tanto. etc. Patrones a escala más grande.

Cuando varios grupos de especies están siendo evaluados. se requiere tomar muestras (ver esquema de puntos de medición abajo). podrá alterar otros grupos. normalmente sólo resulta posible examinar un grupo en una muestra de suelo dada y la extracción de la muestra de un grupo. sino de una parcela. antes de cuantificar la biodiversidad del suelo. los estratos son áreas con diferentes usos de suelo y la idea es obtener. lo que asegura que se obtengan muestras realmente representativas. Si los datos se usan para hacer afirmaciones sobre el área de estudio en general (por ejemplo. existen dos razones para ello: una. En este sentido. y los diferentes usos de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 65 . Piense en un lugar seleccionado. 2003). Algunas veces se piensa que este enfoque puede estar “sesgado” porque los tipos de uso de suelo para tomar las muestras se determinan a priori. El objetivo de descubrir y entender los efectos del uso de suelo en la biodiversidad del suelo.y los diseños eficientes tienen una estructura en forma de conglomerado (Urban et al. de tamaños adecuados. quizá en un área del orden de 100 m². todas las mediciones se realizan a nivel de parcela. dentro de cada parcela se reúnen las muestras. simplemente es práctica. No obstante.. requieren establecer comparaciones en diferentes usos de suelo. no en función de un punto. seguramente las relaciones entre ellos son importantes. se sugiere que un buen enfoque en los objetivos de un estudio mejorará la eficiencia en su diseño e incrementará la posibilidad de lograrlos. responde a la necesidad de contar con mediciones iguales de diferentes grupos funcionales del suelo. 2002. En cada sitio de muestreo seleccionado. Necesitará muestrear dentro de toda esta parcela. Un buen enfoque para mejorar el diseño de muestreo es el uso de la “estratificación”. puesto que habría demasiadas muestras para procesar si no fuera así. lo que quiere decir que se mezclan varias muestras de suelo. entonces los resultados pueden estar sesgados. pero únicamente un volumen de suelo muy limitado puede ser examinado en la mayoría de las mediciones de biodiversidad del suelo y se toman varias muestras para poder representar toda la parcela. esto significa que la variación y los patrones en la escala dentro de la parcela (por ejemplo. para cada uso de suelo. la segunda. muestras de cada uno de ellos. Normalmente. Así. esto quiere decir que se tiene que medir en el mismo lugar. el número promedio de escarabajos por m2) sin tomar en cuenta un diseño. <10 m) no se han examinado. de manera deliberada. Stein y Ettema. ENFOQUE DE OBJETIVOS: ESTRATIFICACIÓN En la introducción de este capítulo.

no es deseable excluir algunos usos de suelo. sin embargo. Sin embargo. El primer aspecto hace que algunos investigadores se sientan incómodos ante la idea de que una predefinición de uso de suelo para la investigación excluya el descubrimiento de patrones potencialmente importantes. el diseño no es parcial para el objetivo de comparar los usos de suelo y además es eficiente. Si los objetivos incluyen investigación en límites entre áreas de diferentes usos de suelo o de nichos raros. En un enfoque estratificado. entonces existen dos prerrequisitos: 1 Se necesita saber cuáles son los usos de suelo a comparar y contar con definiciones precisas de ellos. Si se cuenta con un total de N muestras para comparar dos usos de suelo entonces. tiene que considerarse en algún momento. Resulta más eficiente incluirlas en un número 66 Manual de biología de suelos tropicales . Por ejemplo. éstos deberán ser incluidos específicamente en el muestreo. tiene sentido excluir tales sitios. por ejemplo. La predefinición.suelo pueden no estar representados en las muestras. de no ser así. en ausencia de alguna otra información. con frecuencias proporcionales a su ocurrencia en el área de estudio. Por supuesto. pero si el objetivo es investigar los efectos de uso de suelo. Si se emplea este enfoque. ¿dónde se encuentra el límite entre “pastizales con árboles” y “bosque secundario”?. Con un enfoque de muestreo estratificado. Si un diseño de muestreo no toma en cuenta el uso de suelo. rasgos lineales. ¿cuándo se debe uno de mover a lo largo de un gradiente para incrementar la cobertura de árboles? Aquí tenemos otra ganancia potencial en la eficiencia del pensamiento a través de estos requerimientos en el diseño y no sólo en la etapa de análisis. al igual que la necesidad de definir con precisión. es probable que la muestra incluya únicamente algunas observaciones de estas categorías. entonces probablemente muchos de los sitios de muestreo seleccionados terminarán siendo posiciones ambiguas en lo que se refiere a la definición de uso de suelo. si el objetivo es hacer un inventario del paisaje. a partir de las cuales no se podrán establecer conclusiones. podemos elegir un tamaño idóneo de muestra para cada uso de suelo. el mejor diseño es tener N/2 en cada uno de los dos grupos. las áreas ambiguas pueden ser excluidas del muestreo. 2 Las localizaciones de estos usos de suelo deben ser conocidas. ni aquellas zonas de transición que puedan ser importantes. puesto que no habrá certeza en cómo clasificarlas. Se requiere de un mapa de uso de suelo del área bajo estudio.

por ejemplo. que frecuentemente sirven como base para seleccionar unidades de muestreo a niveles jerárquicos más altos. entonces dicha área queda representada por esa ventana y el hecho de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 67 . tales como la MOS o la frecuencia de fuego. excluirlas (dándoles un equivalente de tamaño cero). Un enfoque común no aleatorio es una selección subjetiva de los sitios de muestreo. ya que existe la posibilidad de la interpretación de imágenes por sensores remotos (SR). o en imágenes de SR y utilizar esto para definir los estratos. de la propiedad inherente del diseño. o bien. Ello queda. cuando una “ventana” única se coloca en un área. cuando se toman muestras en lugares considerados interesantes o importantes. Cuando se usan variables como la MOS en la estratificación. Por ejemplo. El muestreo aleatorio estratificado requiere hacer lo mismo en cada estrato. y seleccionar los sitios de muestreo de manera aleatoria. Sin embargo. influenciadas por el uso de suelo. no son usos de suelo per se. si los objetivos no lo requieren. esto es equivalente a limitar el área de estudio. sino variables ambientales.suficientemente grande. calibrarlo en un mapa de uso de suelo. resultan muy útiles en la práctica. El no contar con un mapa de usos de suelo. Aunque a veces es necesario. MUESTREOS ALEATORIO Y SISTEMÁTICO Las razones esenciales para utilizar el muestreo aleatorio simple (MAS) fue descrito anteriormente y son detalladas en textos tales como Cochran (1977). si los objetivos lo requieren. la limitante de este enfoque es la posible falta de “representatividad” del área de muestreo (la medida en que los resultados pueden razonablemente ser asumidos para aplicarlos a una población más grade) porque ésta depende de la percepción del ejecutor y no. abierto al debate cuando los resultados son presentados. puede ser útil hacer un monitoreo rápido de la MOS. los estudios ecológicos no siempre usan un muestreo aleatorio. Para la implementación del MAS es necesario delimitar el área de estudio. Nótese que muchos de estos argumentos también aplican cuando los factores hipotéticos que influyen sobre la biodiversidad del suelo. no es una limitante. por lo tanto. de tal modo que: a) cada punto tenga las mismas posibilidades de ser seleccionado. el que estos no tengan una resolución idónea. Si se toma un tamaño de muestra subjetivo igual a 1. y b) la selección de un punto no cambie la probabilidad de incluir cualquier otro punto. El uso de un software para ayudar en la aleatorización y un GPS para localizar los puntos de muestreo en el campo. algunas veces por una buena razón.

que esa área sea o no, representativa dependerá únicamente de la habilidad del ejecutor. El muestreo sistemático tiene muchas aplicaciones en la ecología, usando transectos de una dimensión o cuadrículas de dos dimensiones. En el caso de los transectos, las muestras son seleccionadas en puntos que se encuentran a una distancia fija entre sí, a lo largo de una línea predeterminada. Para un muestreo de cuadrícula, una cuadrícula rectangular (usualmente) es definida en el área y las muestras son tomadas en cada punto de intersección. Las ventajas potenciales de este tipo de muestreo sistemático se derivan de la teoría y de la práctica. Las ventajas de la práctica incluyen:
• La facilidad de localizar puntos de muestreo, describir su ubicación y los medios de llegar a los puntos de muestreo; por ejemplo, el protocolo puede ser algo tan simple como “desde el punto de partida, camino al norte y muestreo cada 50 m”. • La facilidad de planear el trabajo de campo; por ejemplo, de estimar el tiempo requerido para muestrear un número fijo de puntos. La razón estadística para utilizar muestreos sistemáticos es que pueden ser eficientes (Webster y Oliver, 1990). Si se considera un estudio con el propósito de calcular la media o el total de algún parámetro (por ejemplo, el carbono total en el suelo en el área de estudio o la media de escarabajos por m2). Si la cantidad medida no es constante, una muestra que utilice la cuadrícula dará una mejor estimación que una simple muestra al azar del mismo tamaño, lo que frecuentemente es el caso de variables ambientales y biológicas. La eficiencia se basa en el hecho de que puntos cercanos son similares, por tanto, no proporcionan mucha información nueva; mientras que en la cuadrícula las muestras están de manera uniforme en toda el área de estudio. Por razones similares, el enfoque de cuadrícula resultará útil para compilar el inventario de un área bajo estudio, salvo que puede excluir nichos raros (véase abajo). Sin embargo, hay aspectos negativos: • Algunos puntos de la cuadrícula tendrían que ser excluidos del estudio, tales como caminos o cuerpos de agua. • Las cuadrículas incluyen muestras de diferentes usos de suelo, con un tamaño más o menos proporcional en cada tipo de uso de suelo. En particular, tipos de uso de suelo raros pueden ser omitidos, lo que se puede compensar moviendo
68
Manual de biología de suelos tropicales

la ventana y añadiendo puntos, aunque el proceso podría llegar a ser arbitrario y subjetivo. • Algunas veces no es posible caracterizar el uso de suelo claramente en cada punto de muestreo. Estos puntos están relacionados con el problema discutido en la sección “enfoque de objetivos: estratificación”. Si el objetivo del estudio es comparar clases de uso de suelo, entonces el muestreo por cuadrícula, a veces, no los captura de forma óptima, de manera que las cuadrículas y los transectos probablemente son más apropiados para muestrear la biodiversidad del suelo, cuando a) no existe ningún objetivo explícito o hipótesis que involucre comparaciones o relaciones con variables ambientales, o b) la hipótesis se refiere a una unidad espacial de un nivel más alto que la escala en que el muestreo por cuadrícula o por transecto fue hecho. Por ejemplo, Swift y Bignell (2001) recomiendan transectos de 40 m de largo, pero éstos quedan dentro de cada clase de uso de suelo. Cuando se comparan usos de suelo, se hacen réplicas de los transectos y se asignan aleatoriamente los estratos definidos por diferentes usos de suelo. De esta forma, el muestreo sistemático por cuadrícula o transecto, normalmente, es combinado con un muestreo aleatorio. Por ejemplo, puede haber varias cuadrículas definidas como se aprecia en la Figura 2.2d, con una localización y orientación hecha al azar. De manera similar, el punto de inicio y la orientación de los transectos que se repiten pueden ser hechos aleatoriamente. Los transectos también pueden ser útiles cuando se alinean con gradientes ambientales considerados importantes; esto se conoce como “gradsectos” (Wessels et al., 1998). Con la aleatorización en algún nivel en la jerarquía, es posible hacer un análisis estadístico basado en las propiedades aleatorias del diseño; por ejemplo, si un número de cuadrículas pequeñas es colocado aleatoriamente en el área de estudio, entonces contamos con las réplicas necesarias para establecer una consistencia, a través de patrones encontrados. El análisis estadístico elegido para una muestra tomada en un diseño sistemático no puede estar basado en la aleatorización, porque los sitios no fueron seleccionados de manera independiente dentro de cada cuadrícula. Existen dos posibles enfoques para el análisis: el primero asume que los datos se comportan de forma aleatoria (por ejemplo, las propiedades estadísticas son las mismas, como si el punto hubiera sido localizado aleatoriamente); el segundo, es utilizar un modelo explícito de patrones espaciales. En la mayoría de los análisis que buscan relaciones entre variables ambientales y la biodiversidad del suelo se usa el primer análisis,
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

69

principalmente, porque las alternativas son complejas. Las consecuencias de suponer esto son raramente investigadas. Es claro que la distancia y el tamaño total de la cuadrícula determinan la escala de los patrones que pueden ser detectados. No es posible observar patrones (por ejemplo, agregación de la biodiversidad del suelo) a escalas espaciales menores que las distancias entre los puntos de la cuadrícula; de la misma manera, tampoco será posible detectar patrones más grandes que el tamaño total de la cuadrícula. Sólo se pueden reconocer los patrones cuando existen varias repeticiones dentro de la misma cuadrícula. Es este aspecto de escala de patrones, definido por los objetivos del estudio, el que debería determinar los espacios y el tamaño total de la cuadrícula. Algunas veces se sugiere que los espacios deben ser de tal manera que los puntos vecinos no estén correlacionados. Esta noción de correlación espacial es importante, pero también confusa. La correlación entre las mediciones de una determinada distancia, no es una cantidad absoluta, pero es una medida relativa a un promedio (técnicamente, el problema tiene que ver con el recambio). Para poder ver esto, piense en analizar datos de una sola ventana en Kenia, donde los puntos de una distancia de más de 200 m entre sí, pueden no indicar similitud en la biodiversidad del suelo, pero si juntamos los datos con otra base de datos global se esperaría encontrar similitud, no sólo en los puntos que pertenecen a una misma ventana, sino entre todos los puntos dentro de Kenia. HABLANDO DE VARIABILIDAD La experiencia de estudios pasados sugiere que se debería de esperar un alto nivel de variación en muchas de las mediciones principales de la biología del suelo. Aún cuando se trata de distancias cortas, se puede esperar una variación grande en número y diversidad de diferentes grupos funcionales. En paisajes agrícolas tropicales la variación dentro de una categoría de uso de suelo puede ser debida a las prácticas de manejo, la variación en las características de la vegetación, las diferencias históricas en el uso de suelo de la parcela, efectos de borde, posición topográfica y características biofísicas. Si los métodos formales para determinar los requerimientos del tamaño de muestra fueran seguidos, probablemente indicarían un tamaño de muestra mucho más grande de lo es viable o costeable, ¿Qué se debe hacer entonces? Primero, ¡no tiene sentido no hacer nada! Simplemente, si se sigue con un tamaño de muestreo preconcebido, no se alcanzarán los objetivos; si el plan original fue
70
Manual de biología de suelos tropicales

trabajar con diez muestras por cada uso de suelo dentro de un sitio de referencia, y las indicaciones son que se necesitan alrededor de 100 muestras por cada uso de suelo, no tiene sentido continuar, puesto que se terminarán obteniendo resultados vagos y no concluyentes, los cuales se traducirán en errores estándares altos y sin efectos significativos cuando se analizan los datos. Tres son las posibles opciones: 1. Incrementar el tamaño de muestra. 2. Utilizar métodos de muestreo para reducir la variabilidad. 3. Reducir la amplitud del estudio. La primera opción no resulta práctica en la mayoría de los casos, pues siempre hay limitaciones de tiempo, dinero, recursos y experiencia. Existen varios métodos para reducir la variabilidad de las muestras; los más útiles consisten en la estratificación y la congruencia. Nótese que el uso del término “estratificación” se usa para el muestreo, pero es diferente a cómo se aplica en “enfoque de objetivos: estratificación” (arriba). Si algunas fuentes de variabilidad pueden ser previstas, éstas pueden ser usadas para definir estratos y removerlas del análisis. Por ejemplo, si el sitio de estudio cubre un rango de altitudes, se puede esperar una variación en la biodiversidad del suelo dependiendo de la altitud. La estratificación, entonces, divide el sitio de estudio en zonas de altitud y los sitios de muestreo dentro de cada una de ellas. En esta fase del análisis de datos, la variación de los usos de suelo se compara dentro y entre estratos para no oscurecer los resultados. Este enfoque requiere que algunos (no todos) de los diferentes usos de suelo estén localizados dentro de zonas de altitud. Si el uso de suelo únicamente varía con la altitud, entonces los dos factores están confundidos y sus efectos en la biodiversidad del suelo no se distinguen. Dado que existe una variación ambiental, la variabilidad en la biodiversidad del suelo estará en respuesta a la variación ambiental. Consecuentemente, los estratos pueden ser útiles para definir puntos de muestro cercanos geográficamente. Las ventanas en la figura 2.2 pueden ser vistas de esta manera. Comparar conlleva la idea de la estratificación a un extremo. Imagine que si dos de los usos de suelo a comparar son bosque y campos de maíz, se puede esperar que la biodiversidad del suelo dependa de muchas variables ambientales, tales como el clima, topografía, y geología. Estas variables ambientales varían típicamente de manera irregular, con sitios cercanamente similares. De esta manera, si seleccionamos parcelas de bosque y maíz que están cercanas, las diferencias entre ellas, principalmente, se deberán al uso de suelo y no, a otros factores, lo que nos
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

71

permite eliminar las variables que “meten ruido” en el análisis. Entonces, el enfoque sería identificar y muestrear, por ejemplo, diez pares de sitios, donde cada par esté formado por parcelas de bosque y maíz cercanas, situadas a cada lado de un lindero de uso de suelo. Formalmente, cada par constituye un estrato de tamaño 2. Más de dos usos de suelo pueden incluirse en el diseño. Las ideas de diseño para experimentos de bloques incompletos son relevantes para seleccionar pares de usos de suelo similares. Controlar la variabilidad mediante la reducción del área de estudio, muchas veces es la mejor solución. El área podría ser reducida, si se reduce el tamaño del sitio de muestreo, reduciendo naturalmente la heterogeneidad, lo que puede ser insatisfactorio porque también reduce la generalidad de los resultados. Si únicamente tomamos muestras en un área pequeña, entonces no existe una base para asumir que se han encontrado patrones ampliamente aplicables. Otras maneras de reducir el ámbito del sitio de estudio son: No incluir todos los usos de suelo encontrados en el área de estudio, sino una selección que cubra un gradiente de intensidades de uso de suelo o que represente alguna transición típica en el uso de suelo. Ajustarse a la definición de una clase de uso de suelo. Por ejemplo, en lugar de tomar un “campo de maíz” como uso de suelo, se podrá limitar la atención a campos de maíz que han sido cultivados continuamente durante los últimos diez años, que no han sido fertilizados en los últimos tres años y que son trabajados con azadón. Evitar tomar muestras en sitios ambiguos, como aquellas que se encuentren cerca de linderos. Mientras esto ayudará a detectar y medir el efecto de la intensidad de uso de suelo en la biodiversidad del suelo, pueden ser inconsistentes con los objetivos del inventario de las especies. Un compromiso entre los dos objetivos puede ser necesario. Esto es común en el diseño de proyectos y, en resumidas cuentas, no se puede esperar encontrar todo en un tamaño limitado de muestra. ESQUEMA DE MEDICIÓN DE PUNTOS Una vez localizados los puntos de muestreo, tiene que ser definido un protocolo de medición, lo que implica la necesidad de un muestreo adicional. El esquema básico
72
Manual de biología de suelos tropicales

de muestreo por puntos adoptado por el CSM-BGBD se presenta en la Figura 2.3, que a la vez se complementa con la Tabla 2.1. Aunque el esquema de medición utilizado para el muestreo de grupos funcionales que son descritos por los procedimientos del proyecto alternativas de roza, tumba y quema (Swift y Bignell, 2001), es diferente de lo que fue propuesto por Swift y Bignell para adecuarse al enfoque basado en la cuadrícula. Por ejemplo, los pocos monolitos en cada punto de muestreo son compensados por el gran número de puntos de muestreo, que resulta en aproximadamente el mismo número de eventos de muestreo. No obstante, los resultados preliminares han indicado que con un pequeño monolito por punto de muestreo no todas las especies pueden ser capturadas. Si éste es el objetivo para llevar a cabo el muestreo, se prevén opciones adicionales para incluir monolitos más grandes. Macrofauna: un solo monolito, trampas de caída (pitfall) y, por lo menos un transecto de 20 m son colocados en cada sitio de muestreo. El muestreo por transectos se amplía para incluir hormigas y escarabajos, en adición a las termitas. En un esquema alternativo adicional los monolitos pueden ser excavados para mejorar el muestreo de lombrices de tierra y se puede introducir un sistema simple para tomar muestras de termitas. Nótese que en las parcelas pequeñas, los sistemas de cultivo pueden estar altamente disecados o los terrenos son difíciles, por lo tanto, no es necesario que el transecto sea lineal. Un transecto puede tener un ángulo de 90 grados, y muestrear parcelas de forma irregular o para evitar arroyos, fuertes pendientes o rocas. Los árboles caídos deben incluirse en el transecto si estos quedan sobre la línea (Swift y Bignell, 2001). Mesofauna: 12 extracciones de suelo tomadas en círculos concéntricos alrededor de un solo monolito a 3 y 6 metros de radio, y extraídas utilizando el método Berlese. Adicionalmente, las trampas pitfalls sin cebo abiertas durante un periodo de 24 horas sirven para colectar mesofauna y macrofauna que viven en la superficie. Las trampas pitfalls generalmente son apropiadas para hormigas, algunos escarabajos, algunos saltamontes, milpiés y arañas. Muestras de suelo extraídas con sacabocado por el método de Berlese contienen colémbolos, ácaros y en sitios húmedos enquitreidos. Microfauna: muestreos con sacabocado de manera similar en 12 extracciones de suelo de dos círculos concéntricos, a 3 y 6 metros de radio del monolito. La “microfauna”, principalmente se refiere a nematodos, aunque también a pequeños ácaros (y larvas de ácaros) extraídos de las muestras de suelo; por el método Berlese pueden cuantificarse.
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

73

Figura 2.3 Esquema de muestreo por puntos para toda la biota. El muestreo se puede ampliar si se usa uno o dos transectos para termitas, hormigas y escarabajos, mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.

Monolito Núcleo de suelo para mesofauna Núcleo de suelo para nemátodos y microbios Muestras para análisis físicoquimicos Transecto 1 m2 para muestra de hojarasca (Winkler) Trampa pitfall

Microsimbiontes y hongos del suelo: muestreos de manera similar mediante 12 extracciones de suelo con sacabocado, puestas en dos círculos concéntricos alrededor de un solo monolito, a 3 y 6 metros de radio. Parámetros físicos y químicos del suelo: cuatro extracciones de suelo con sacabocado puestas en un círculo de 6 metros de radio de un monolito. En el caso de estudios de co-ubicación, una extracción adicional de suelo puede tomarse de la pared exterior de la zanja del monolito (véase Capítulo 3, muestreo de macrofauna). En un esquema alternativo (Figura 2.4) los usos de suelo pueden ser muestreados por una combinación de monolitos principales y subsidiarios, transectos de 50 metros, cuadrantes de hojarasca espaciadas y trampas pitfalls. El muestreo casual alrededor de los transectos puede ser empleado y también trampas Malaise colocadas para capturar insectos voladores mayores. El protocolo difiere de la propuesta anterior, en lo concerniente a los puntos del transecto, cuadros de hojarasca, trampas pitfalls y monolitos subsidiarios colocados en líneas paralelas de 50 m, con una separación lateral de 10 m. Este protocolo debe ser tomado básicamente como una extensión del propuesto anteriormente y se considera aplicable en donde se le dé más importancia al muestreo de todas las especies que existen dentro del área y en los casos donde la frecuencia de muestreo es baja (número de parcelas muestreadas) por las razones explicadas anteriormente. Estas modificaciones
74
Manual de biología de suelos tropicales

resultan más adecuadas cuando se encuentran diferentes usos de suelo en todos los sitios. CONSIDERACIONES PRÁCTICAS EN LA ORGANIZACIÓN DEL TRABAJO DE CAMPO La colecta de muestras o la medición directa en el campo deberían, en la medida de lo posible, realizarse de forma secuencial y durante una sola salida. En el caso de parámetros físicos y químicos del suelo que permanecen estables en el tiempo, el muestreo puede hacerse en un momento diferente. Lo anterior, por supuesto, no se aplica en el caso de características dinámicas del suelo, por ejemplo, el contenido de agua en el suelo.
Figura 2.4 Esquema alternativo para muestrear macrofauna, utilizando un transecto de 50 m.
Extracción Winkler Transecto Mini-monolito

Trampa pitfall Monolito adicional
12 muestras de suelo (12 x 12 x 10 cm)
MS MS MS MS

Monolito principal 10 m

10 m 10 m 5m 50 m
MS MS MS

MS MS

Monolito adicional

MS MS MS

30 cm Hormigas de hojarasca Hormigas endogeas Termitas

2m

D iseño

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

75

Tabla 2.1 Grupos de organismos del suelo colectados utilizando diferentes métodos de captura.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Manual de biología de suelos tropicales
Suelo Mesofauna Descripción X X X X X X X X

76
Trampas pitfall con cebo* - 3 trampas por punto de muestreo. Las trampas se deben quitar después de 48 horas en campo. Transectos semi-cuantitativos 2 x 20 m uno por punto de muestreo, perpendicular a la pendiente Trampas Winkler para muestras pequeñas de hojarasca (1 x 1 m) a lo largo del transecto, 3 Winkler por punto de muestreo Núcleos de suelo con hojarasca (3.5 x 3.5 x 5 cm),12 submuestras por punto de muestreo (profundidad de 0-5 cm). Para mesofauna se hace una muestra compuesta (1er opción), o 4 muestras compuestas por 3 submuestras de cada cuadrante (segundo opción) o 3 muestras compuestas por 4 submuestras. Núcleos de suelo para microbios de 0-20 cm de profundidad sin hojarasca. En círculos a 3 y 6 m, del punto de muestro, una muestra compuesta de 12 submuestras por punto de muestreo.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

Trampa (pitfall)

X

X

X

Transecto

X

X

Trampa Winkler

X

X

X

Embudo de Berlese

X

X

X

Varios

Tabla 2.1 Continúa.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Monolito X

X

X

X

X

X

X

Mesofauna

D iseño
Suelo Descripción Monolito (25 x 25 x 30 cm), incluyendo hojarasca, una muestra por punto método TSBF. Muestra de suelo, una muestra compuesta de suelo por al menos 4 submuestras para análisis físicos y químicos, profundidad 0-10; 10-20; 20-30 cm.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

*Nota.- El cebo sugerido para las trampas pitfall es excremento de monos o de humanos, el cual es muy efectivo para extraer escarabajos coprófagos (Coleoptera) y, al mismo tiempo, no interfiere con la captura de escarabajos saprofíticos (Scarabaeidae, Aphodidae, Trogidae) y predadores (Sistiridae, Staphilinidae). El excremento de omnívoros, resulta más adecuado, en el caso de áreas de selva tropical porque los omnívoros predominan en estos ambientes

77

La colecta de muestras de los principales grupos funcionales de organismos del suelo, requiere de la colaboración de mucha gente en cada punto de muestreo, con el riesgo de lastimar el cultivo en pie, al igual que afectar el inventario, especialmente de aquellos organismos con alta motilidad o sensibles a la intromisión humana. Por ejemplo, las lombrices de tierra epígeas y algunos tipos de termitas comedoras de tierra son sensibles al disturbio, y especialmente a las pisadas, por lo que se alejarían rápidamente. Por lo tanto, es importante reducir el número de personas involucradas en la colecta de las muestras, aunque se necesita un número suficiente de manos para poder manejar y procesar las muestras. Durante el entrenamiento de técnicos y asistentes de campo, es necesario prestar atención a los riesgos que pudieran surgir en cada grupo específico de organismos de suelo. El riesgo de contaminación cuando se trata de microorganismos debe ser entendido y la importancia de utilizar procedimientos adecuados para evitar la contaminación debe ser enfatizada, especialmente en las personas inexpertas. El mismo principio rige cuando existe la posibilidad de que dichos organismos escapen de los sitios de muestreo, como consecuencia de una severa perturbación. Otra preocupación es el gran volumen de suelo que será colectado durante el muestreo y la necesidad de reducir dicho volumen para transportarlo. Desde este punto de vista, la extracción de especímenes de las muestras se hace mejor en, o cerca, del sitio de muestreo. También, en el sitio de muestreo se deben agrupar todas las muestras y extraer sub-muestras para su posterior análisis. El tiempo y la temperatura a la que se almacenan las muestras juegan un papel importante, dado que muchos organismos del suelo pueden morir a temperatura ambiente, en la superficie del suelo, o cuando son guardados en bolsas o contenedores durante unas cuantas horas. Para poder evitar dichos riesgos es importante identificar una instalación local adecuada antes de colectar las muestras o, hacer la extracción inmediata in situ de los especímenes. En algunas ocasiones, por ejemplo, el embudo de Berlese para la mesofauna y de Winkler para la extracción de hormigas y escarabajos de la hojarasca, pueden instalarse en el campo para su uso inmediato; en otros casos, cuando los organismos necesitan ser cultivados in vitro o cuando las propiedades del suelo necesitan ser determinadas, es necesario disponer de un transporte rápido para su traslado hacia el laboratorio. Bajo ninguna circunstancia las muestras deberán permanecer bajo el sol, ni aun cuando el protocolo de extracción requiera de un secado final de la materia. Otros detalles sobre las precauciones a tomar en cuenta y consejos
78
Manual de biología de suelos tropicales

sobre la logística general, se pueden encontrar en los capítulos que tratan grupos y métodos específicos.

MUESTREO EN EL PROYECTO CSM-BGBD
La jerarquía de muestreo
En el proyecto fueron seleccionadas áreas de siete países tropicales, con el propósito de evaluar la pérdida de biodiversidad del suelo con el incremento en la intensidad del uso de suelo. Los sitios se localizaron en las principales regiones biogeográficas de los trópicos, desde la selva tropical húmeda Amazónica hasta la selva montañosa del Himalaya, en la India; áreas que presentan una biodiversidad global importante. Cada sitio incluyó un intervalo de usos de suelo desde selvas prístinas relativamente no perturbadas, hasta tierras agrícolas sometidas a uso intensivo, para determinar tendencias comunes, que puedan ser observadas en el cambio de la biodiversidad del suelo en relación con la intensidad del uso del suelo. El uso de métodos estándares de muestreo en los países y sitios de estudio, permite hacer comparaciones entre los sitios. Se adoptó un enfoque para el muestreo dentro de los sitios que hace uso del muestreo por medio de ventanas. Una ventana es (usualmente un rectángulo) una parcela de tierra que incluye en el estudio varios usos de suelo locales y se consideran “representativos” de los sitios de estudio. Típicamente, las ventanas miden entre 2 y 5 km²; estas ventanas de muestreo varían en tamaño y número debido a la configuración del uso del suelo en cada sitio, y sólo se presentó un caso donde el acceso fue problemático. Por ejemplo, se utiliza una ventana más grande para incluir los usos de suelo relevantes en el área y hasta seis ventanas más pequeñas se distribuyen dentro del área para los diferentes usos de suelo requeridos. Una cuadrícula regular (con espacios variables, véase a continuación) se utiliza para identificar un conjunto de posibles puntos de muestreo dentro de cada ventana; los puntos corresponden a las intersecciones de las líneas en la cuadrícula. El muestreo de cuadrícula se usó por las razones descritas anteriormente, eficiencia estadística y para racionar el trabajo de campo. Además, el inventario es de naturaleza exploratoria, sin tomar en cuenta la hipótesis general formulada, pues quedan pendientes las siguientes preguntas: ¿cuáles de los factores que determinan las prácticas intensivas de uso de suelo influyen en la distribución y riqueza de la biota del suelo? y, ¿a qué escala los patrones de distribución espacial se manifiestan? Este
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

79

enfoque es similar al usado para el proyecto de BioAssess, financiado por la Unión Europea, cuyo objetivo, similar al de éste proyecto, fue evaluar la biodiversidad en función de la intensidad del uso del suelo en paisajes agrícolas (véase Ponge et al., 2003; Federoff et al., 2005). La biodiversidad del suelo se muestrea en el nivel de parcela (punto de muestreo o sitio). La cuadrícula define una serie de parcelas, con un objetivo de cerca de 100 a 200 parcelas por ventana. La parcela es un área de, por lo menos, 25 x 25 m determinada por el área mínima requerida para colectar todas las muestras necesarias y realizar su medición, tal y como se describió anteriormente. El principio de co-ubicación es adoptado para análisis de muestras físicas y químicas del suelo y para los inventarios de la biodiversidad del suelo. Al mismo tiempo las ventanas permiten comparar la biodiversidad del suelo entre los componentes del paisaje.

Localización y definición de las ventanas de muestreo y cuadrícula
La posición de las ventanas dentro del sitio de estudio se hace de tal modo que abarque los diferentes usos de suelo. Generalmente, una ventana no puede abarcar los diferentes usos del suelo, por lo que son necesarias otras ventanas más pequeñas. La Figura 2.5 describe las distintas configuraciones utilizadas. La Figura 2.5a ilustra el uso de una ventana de 9 x 11 puntos de muestreo (además de algunos puntos adicionales de muestreo). La figura 2.5b ilustra el uso de 6, 3 y 2 ventanas separadas. En el caso donde se usan seis ventanas separadas, una ventana medirá 1 km², dependiendo de la distancia entre los puntos de la cuadrícula. En sitios caracterizados por fuertes pendientes se esperaría que el gradiente del uso del suelo esté orientado en la misma dirección, y las ventanas estarán entonces localizadas a lo largo del gradiente (Figura 2.5b). En los linderos de la selva en los trópicos, frecuentemente se observa que el patrón de distribución de usos de suelo refleja un gradiente de intensidad de uso de suelo, con un uso más intensivo a mayor distancia de la selva. En tales casos, las ventanas de muestreo se localizan a lo largo de tal gradiente. Se necesita, por lo tanto, contar con suficientes conocimientos de la región antes de seleccionar los sitios de muestreo. Cuando algunos gradientes no son obvios, la selección de las ventanas deberá cubrir dos o tres de los usos de suelo más importantes y, por tanto, también las transiciones observadas con mayor frecuencia de un tipo a otro tipo de uso de suelo. Por ejemplo, en los márgenes del bosque puede darse la transición de bosque a pastizal, bosque a tierras de cultivo o bosque a grandes plantaciones, en donde
80
Manual de biología de suelos tropicales

a) cuadrícula completa. b) ilustración de la división de una cuadrícula entre seis. Lo anterior se obtiene mediante varias configuraciones de ventana(s) D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 81 . con puntos de muestreo adicionales. antes que un cambio de uso de suelo per se. según se requiera. se hace una selección manual por interpretación visual. Figura 2. el área ocupada por cada uso de suelo. Cuando únicamente están disponibles materiales análogos. Cuando se encuentran disponibles mapas digitales de uso de suelo. utilizando un papel traslúcido sobre la fotografía. se introduce un elemento de replicación. De esta forma. Esto permitirá un análisis comparativo de transiciones de uso de suelo (por medidas relativas). lo que facilitará la selección de las ventanas. dentro de una ventana definida puede ser determinada utilizando software de Sistemas de Información Geográfica (SIG) estándar. tres y dos ventanas. Para la selección de las ventanas de muestreo se utilizaron fotos aéreas o imágenes de satélite de alta resolución. Mapas detallados de uso de suelo y de vegetación también son adecuados para este propósito.una ventana cubre cada transición típica de uso de suelo. Número de parcelas de muestreo y tamaño de la cuadrícula El número total de puntos de muestreo por área de referencia se mantiene fijo entre 100 y 120.5 Ejemplos de diferentes configuraciones de ventanas de muestreo. dispuestas a lo largo del gradiente. mientras minimiza los cambios en la biodiversidad del suelo que surgen de los diferentes usos. variaciones topográficas o climáticas.

En un muestreo basado en transectos la idea de replicación recomendada por Swift y Bignell (tres transectos por cada uso de suelo) casi nunca se logra. y el procedimiento recomendado por el proyecto ASB (Swift y Bignell. el esfuerzo de muestreo promedio probablemente varía. es que únicamente se toma un monolito y una muestra agrupada para los microsimbiontes por parcela. un transecto de 40 x 5 m. En este sentido Swift y Bignell (2001) argumentan. otra opción es ensamblar de una manera sinóptica por combinación de transectos a lo largo de diferentes años o en proyectos no relacionados (ej. El número total de puntos de muestreo concuerda con otras estrategias de muestreo propuestas en ejercicios similares de evaluación de la biodiversidad. el número de puntos de muestreo deberá incrementarse de 5 a 8 por transecto (es decir. Mientras el tamaño de muestra sigue siendo más o menos igual en los transectos y cuadrículas. Se añaden puntos de muestreo donde el uso de suelo es altamente variable. De esta manera.. con un transecto extendido en el caso de algunos grupos (por ejemplo. 2003) recomienda un número similar de puntos de muestreo. más puntos en la misma parcela).de muestreo y las dimensiones de las cuadrículas. termitas y hormigas). En este último. La captura adicional de especies requiere de un esfuerzo de muestreo considerable. el proyecto BioAssess (Ponge et al.. descritos anteriormente. Davies et al. 2003). Con 100 a 200 puntos por área de referencia generalmente se llega al punto donde la curva de acumulación de las especies para grupos de macrofauna es asintótica.. Los resultados del inventario del proyecto CSM-BGBD indican que es necesario un esfuerzo mínimo de muestreo de 100 a 120 puntos para poder capturar la mayoría de las especies dentro del sitio. Por ejemplo. La principal diferencia con el enfoque de muestreo de cuadrícula. el diseño 82 Manual de biología de suelos tropicales . suponiendo que existan entre seis y siete usos de suelo distintos por cada área de referencia (correspondientes a seis o siete clases de usos de suelo generalmente definidos en el sistema de clasificación de usos de suelo) donde cada uso de suelo es muestreado por tres transectos. que para incrementar la confiabilidad de los datos del esquema basado en transectos. en el caso de por lo menos algunos de los grupos funcionales (ej. 2001) tendrá un esfuerzo de muestreo comparable. en parte por consideraciones logísticas. Eggleton et al. 2002. dando un total de 90 a 105 monolitos muestreados (y el mismo número de muestras agrupadas para evaluar los microsimbiontes) aproximadamente igual al número de puntos en la cuadrícula. termitas). por lo menos. cada uso de suelo es evaluado en. del cual un mínimo de cinco monolitos son cavados para muestrear la macrofauna y cinco muestras conjuntas para los microsimbiontes.

etc. Se aconseja hacer una prueba piloto para informar el diseño de muestreo. La colecta de muestras rara vez es el paso que limita la evaluación de la biodiversidad porque la extracción. 1998). identificación y catalogación de especímenes son los pasos que requieren mayor tiempo en el proceso (Lawton et al. La experiencia del proyecto CSM-BGBD indica que el procesamiento de 100 a 120 muestras es viable con los recursos generalmente disponibles. el procedimiento correcto para reducir el número total de puntos de muestreo deberá ser estimado. es importante considerar el número mínimo de puntos requeridos para cada categoría de uso de suelo. Con menos categorías de uso de suelo presentes. Reducir el número de puntos de muestreo por categoría de uso de suelo mientras se mantiene el número de categorías de uso de uso de suelo investigado puede comprometer el objetivo de obtener resultados estadísticamente verificables. un promedio alrededor de 15 puntos por clase de cobertura de suelo resultan de muestrear la cuadrícula. normalmente no todas las especies son capturadas y hará más difícil demostrar las diferencias en biodiversidad del suelo entre los tipos de usos de suelo que normalmente se caracterizan por una alta variabilidad en la riqueza de especies. Número de puntos de muestreo por categoría de uso de suelo Con seis o siete tipos de uso de suelo en cada área determinada. Si la capacidad para procesar y analizar esta cantidad de muestras no está disponible. pero aun así se requiere de una campaña organizada en el campo y de instalaciones establecidas para poder procesar y analizar las muestras. si esta prueba confirma alta variabilidad en la biodiversidad del suelo dentro de las D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 83 . el número de puntos por categoría de uso de suelo aumenta. restringir el número de usos de suelo de manera que el esfuerzo total sea compatible con la capacidad de procesamiento. en lo que concierne a la evaluación de la diversidad de especies. basándose en otros datos o en un estudio piloto.. Se le da prioridad al tipo de agricultura de subsistencia a la hora de incrementar el número de muestras porque es precisamente en esta categoría dónde se espera que ocurra una mayor variación debido al manejo. En números pequeños o en una distribución irregular de puntos de muestreo en los diferentes usos de suelo.de muestreo se ajusta a los objetivos del inventario del área de estudio. Dado el alto nivel de variación en las medidas de los componentes de la biodiversidad del suelo. El número de muestras requeridas por uso de suelo deben ser representativas de la biodiversidad del suelo presente y entonces. historia.

Esta estrategia implica incluir ventanas de muestreo irregulares. Cuando éste no es el caso. de acuerdo con los principios detallados en “Hablando de variabilidad” (arriba). Esta opción se puede observar en la Figura 2. El enfoque de la cuadrícula asume un acceso libre al terreno o parcela donde se localizan los puntos de muestreo. mientras se cumplen los requerimientos para el número mínimo de puntos de muestreo para cada categoría de uso de suelo. de forma separada hasta que se cumpla con el requerimiento del número mínimo de puntos de muestreo. se necesita una 84 Manual de biología de suelos tropicales . De la misma manera.categorías de uso de suelo. posteriormente.6. Este procedimiento permitirá eliminar los puntos que caigan en tipos de uso de suelo no especificados. Esto implica adoptar un nivel más alto de detalle en el sistema de clasificación de uso de suelo y. Para este propósito. La definición de un sistema de clasificación de uso de suelo se detalla en el Capítulo 11. deberán hacerse algunos intentos para aleatorizar la selección de los puntos originales para ser divididos en dos. La segunda opción es seleccionar puntos adicionales dentro de las ventanas entre los puntos existentes de la cuadrícula para aquellas categorías de uso de suelo que están siendo muestreadas. Posteriormente.5a. se aplica un procedimiento no-sesgado para restar un número de puntos que permitan contrarrestar el incremento en el número total de puntos de muestreo que resulta de ampliar la cuadrícula. se puede partir de una cuadrícula vacía (que únicamente contenga posibles puntos de muestreo). Para poder seleccionar o eliminar sitios de muestreo (parcelas) es necesario conocer los usos de suelo en cada punto de la cuadrícula y se requiere de un inventario de uso de suelo previo al muestreo de la biodiversidad del suelo. Aunque la inserción de puntos adicionales es conveniente. con el propósito de seleccionar aleatoriamente puntos de muestreo para cada categoría de uso de suelo. seleccionar las clases de uso de suelo que cubren un claro gradiente en intensidad de usos de suelo. donde la distancia mínima entre puntos necesita ser respetada. entonces se hace un ajuste de la definición de clases de uso de suelo. Una estrategia es usar una “cuadrícula estratificada” según lo ilustrado en la Figura 2. se define una cuadrícula mayor (resaltando el número de intersecciones). Adaptación del enfoque de muestreo a condiciones de campo Hay dos estrategias disponibles para asegurar una representación de los usos de suelo y clases de cobertura en el muestreo. de tal manera que se cumpla el criterio para un mínimo número de puntos de muestreo en cada uno de los tipos de uso de suelo.

de una a tres ventanas fueron colocadas en cada comunidad disponible. En el área determinada en La Amazonia en Brasil.Figura 2. En este caso las tierras seleccionadas fueron aquéllas que pertenecían a agricultores que sí permitieron el acceso y se adoptó un patrón específico para muestrear dentro de estas tierras.6 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. con D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 85 . debido al aislamiento de las comunidades. en lugar de utilizar una cuadrícula regular que cubriera un área mayor. el acceso a las tierras de los agricultores estuvo restringida. Por ejemplo: en un área determinada en México. aquéllos de carbono orgánico y prácticas de cultivo. Los patrones de distribución de los organismos del suelo puede correlacionarse con la topografía. colocando una cuadrícula fija dentro de dichas ventanas. estrategia de muestreo alterna. Distancia entre los puntos de muestreo La distribución de los organismos del suelo puede reflejar gradientes. por ejemplo.

si las parcelas individuales miden más de dos a cuatro hectáreas. Por otro lado. se debe considerar aumentar la distancia entre los puntos. con gradientes de recursos del suelo. tales como las lombrices de tierra. con muchos grupos diferentes de organismos del suelo estudiados. los espacios en la cuadrícula fueron reducidos en el área determinada en Brasil. que las termitas siguen patrones espaciales en un intervalo de hasta 330 m y que la distribución de especies de nematodos muestra tamaños de parches entre 6 a 80 m. el muestreo en cuadrícula permite examinar patrones espaciales a escalas entre la distancia inter-muestra y el tamaño de la cuadrícula. dependiendo de los organismos implicados. No obstante.los parches de vegetación. atravesar de un punto a otro. Al mismo tiempo reduce la dependencia espacial de las observaciones para la mayoría de los principales grupos de organismos del suelo. en la mayoría de los casos. a 100 m. en el caso de paisajes altamente fragmentados. al mismo tiempo permite. vegetación secundaria muy densa dentro de parcelas barbechadas). o bien. reproducción y competencia (Lavelle y Spain. Una distancia de 200 m parece aceptable porque permite un área relativamente mayor de muestreo a través de la cuadrícula y es probable que refleje los usos de suelos más dominantes en la muestra. Existen varias teorías para explicar la riqueza extremadamente alta de las comunidades del suelo y el bajo grado de especialización en recursos. la investigación de la distribución de patrones específicos no representa un objetivo deseado. En la literatura se pueden encontrar varios ejemplos de la estructura espacial de la biota de suelo sobre distancias de menos de un centímetro hasta de cientos de metros en el campo. Sin embargo. 86 Manual de biología de suelos tropicales . En el caso del proyecto de la biodiversidad del suelo. Ettema y Wardle (2002) mencionan que la biomasa microbiana y los colémbolos son espacialmente dependientes en intervalos de más de 200 m. la distribución y agrupación de organismos de suelo también son gobernadas por fuerzas intrínsecas de procesos poblacionales tales como dispersión. con la ubicación de árboles individuales. 2001). También se registra una distribución parchada en una escala miniatura de centímetros a metros.5 ha) y donde no es posible atravesar (ej. se pueden reducir los espacios en la cuadrícula. con parcelas muy pequeñas (menos de 0. razón por la que no fueron considerados esquemas de muestreo adecuados para llevar a cabo un análisis de la distribución espacial. Por estas razones. anidadas en estructuras más grandes. en la Amazonia.

la diversidad del suelo es inventariada independientemente a lo largo de un gradiente de intensidades de usos de suelo para cada área seleccionada. Por lo tanto. y debido a que las características completas del sitio no pueden ser obtenidas solamente por la apariencia del uso del suelo. Sin embargo. así como las características de uso y manejo del suelo pueden variar considerablemente entre regiones. cationes D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 87 . deberían registrarse para la ventana e incluso para el área seleccionada. El conjunto básico de las propiedades físicas y químicas del suelo debería incluir densidad aparente. y de las características del suelo. con referencia especial al uso del suelo también es importante de conocer (aunque no siempre se cuenta con este dato). las condiciones bióticas y abióticas. uso de químicos. junto con la altitud. pendiente y aspecto. días de lluvia. temperatura y humedad media. etc.Inventario de uso del suelo y caracterización del sitio La hipótesis central plantea que la mayor variación en la biodiversidad del suelo está asociada con la diferencia en la intensidad de usos de suelo. Es posible que la variabilidad en abundancia y diversidad de organismos del suelo dentro de una categoría de usos de suelo pueda ser mayor que la variabilidad entre categorías de uso de suelo. especialmente en sistemas tan diversos como los representados en los trópicos. Existn un número de factores interrelacionados: bióticos y abióticos (ej. La historia del sitio. La definición de clases de uso de suelo resulta importante y se discute en el Capítulo 11 de este manual. la información sobre la precipitación anual. descrita a nivel de las principales categorías de uso de suelo. a fin de permitir un análisis completo de los datos para identificar los parámetros que explican la variabilidad en la biodiversidad del suelo. Debido a que se sabe muy poco sobre la importancia relativa de los factores antes mencionados. asumir que una categoría de uso del suelo está en una escala correcta para acomodar su variación puede ser incorrecto. Al mismo tiempo. como parte del proceso del inventario. textura (la proporción arcilla/arena/limo). duración de secas y la precipitación acumulada hasta la fecha de muestreo. lo indicado será incluir una descripción detallada de uso y cobertura del suelo. diversidad de plantas. en términos de los factores que determinan la biodiversidad del suelo.) que afectan la distribución de organismos del suelo y se asume que las principales categorías de uso de suelo proporcionan una diferencia significativa. pH. C y N total. materia orgánica del suelo) y características de manejo (tipo de labranza. pF (tensión de humedad del suelo).

por esta razón se hace el muestreo al final de la época de lluvias 88 Manual de biología de suelos tropicales . área basal. La producción de esporas responde a la fenología de las plantas y. en áreas de bosque. características como la altura media del dosel. Para el muestreo de otras variables relacionadas con la caracterización del sitio. dependiendo de los métodos utilizados.intercambiables. 1993). Sin embargo. Idealmente. cobertura dominante/abundancia de flora en el nivel del suelo. Respecto de hongos micorrizógenos arbusculares. P. la evolución de las estructuras y ciclos reproductivos (como la formación de esporocarpos) se sincronizan con los cambios estacionales que ocurren dentro del hospedero y son mejor observados durante y hacia finales de la época de lluvias. por ejemplo. especies de plantas y la riqueza de géneros. Muestras de suelo son tomados de suelos no perturbados. cuando el método depende del conteo e identificación de esporas. la época seca será la más apropiada para muestrear. por ejemplo. acumulación y abundancia de hojarasca. los inventarios deberían elaborarse durante la época de lluvias y también en la época de seca. Épocas de muestreo Los organismos del suelo responden a cambios estacionales. 2005). Una descripción de los sitios puede ser completada por el tipo de vegetación. debido a la senescencia de las raíces. La diversidad y abundancia de especies de leguminosas son de particular importancia en relación con la presencia de las bacterias formadoras de nódulos en leguminosas. en la práctica. en el caso de cultivos anuales las esporas son más abundantes durante la época seca. Al3+ y H+. y los resultados del inventario de la riqueza de especies y abundancia (relativa) mostrarán marcadas diferencias entre las épocas. CIC. no siempre suele ser factible. Además. la actividad de las lombrices de tierra es mayor al final de la época de lluvias (Tondoh y Lavelle. ayudan a elegir sitios a lo largo de un gradiente de diversidad botánica que tiene alguna relación con sus posiciones actuales en las cronosecuencias e intensidades de perturbaciones. puesto que de esta manera surge la posibilidad de correlacionar las propiedades del suelo con la presencia o ausencia de un taxa en particular y grupos funcionales (véase Anderson e Ingram. lo que puede ser diferente. pero inmediatamente adyacentes a la zanja de cada monolito (la zanja exterior probablemente sea el mejor lugar). También. el porcentaje de cubierta vegetal. En los casos de hongos fitopatogénos y hongos ectomicorrízicos. El Capítulo 11 proporciona más detalles sobre los requerimientos respecto de usos de suelo específicos. ver Anderson e Ingram (1993).

pp. Bignell. Jones. S. G. P. H.E.. E. Kenkel.. Mawdsley. Federoff. L. F. G. vol 17. E. T. y Spain. Norgrove. R. Peterson. Holt. Hauser. P. vol 83. C. L.. P. E. 89–202.. D . L. London... Eggleton. D. (1989) ‘On sampling procedures in population and community ecology’. Bloemers. y Buntin. (1998) ‘Biodiversity inventories. vol 391. (2000) Scientific Method for Ecological Research. Agriculture. J. R. Srivastava. Ecosystems and Environment. J. T. F. Vegetatio. P. I. Stork. 847–877. E. Ponge. N. pp. G.con la opción de tomar muestras adicionales durante la época de secas. L. M. T.. Columbia University Press. Trends in Ecology and Evolution. REFERENCIAS Anderson.. Nature (Lond). A. H. M. pp. B. Cambridge University Press. (2002) ‘Spatial soil ecology’. D.. Davies. 2nd edition. vol 30. Kluwer Academic Publishers. CRC. C. T. Cochran W. Boulton.. Wiley. Gregoire. New York. D. Dordrecht Lawton. D... Dibog. Chapman and Hall/CRC Press. P. J-F.. N. y Madong. New York. N. Agriculture. Hodda. e Ingram. Hammond. T.. 283–290. D. Pedigo. vol 105. S. D.. (eds) (1998) Ecological Scale: Theory and Applications. (2001) Soil Ecology. (2003) ‘Evolution of termite functional diversity: Analysis and synthesis of local ecological and regional influences on local species richness’. Ettema. P. J. y Podani. (2005) “Small-scale response of plant species to land-use intensification”. P. y Watt. pp. 72–76. (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. F. y Hernandez. S. D. indicator taxa and effects of habitat modification in tropical forest’. 195–207. G. Eggleton. V. vol 90. Wallingford. y Lavelle.. Bignell. CAB International. Larsen.. pp177-183. y Wardle. (eds) (1993) Handbook of Sampling Methods for Arthropods in Agriculture. B. Dubs. Gathorne-Hardy. Ford. y Valentine. Journal of Biogeography.. New York. Ecosystems and Environment. F. pp. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 89 . (1977) Sampling Techniques. Cambridge. (2007) Sampling Strategies for Natural Resources and the Environment. M... D. G. y Parker. L.. A. Lavelle. A. 3rd edition.. A. Juhfisz-Nagy. Lo último puede realizarse con el objetivo específico de investigar cambios temporales en la biodiversidad del suelo. D. Eggleton. B. Fernández-González. (2002) ‘Termite diversity across an anthropogenic disturbance gradient in the humid forest zone of West Africa’. P. J.

Wessels. A.. E. International Centre for Research in Agroforestry.. y Ettema. F. R. Haese. Soil Biology & Biochemistry. Webster. T. E. Gillet. pp. (2002) ‘Extending community ecology to landscapes’. 1093–1121. A. (1990) Statistical Methods in Soil and Land Resource Survey. Sousa. P. 493–500. Eudrilidae) in Ivory Coast’. T. (2003) ‘Collembolan communities as bioindicators of land use intensity’. vol 7. (2003) ‘An overview of spatial sampling procedures and experimental design of spatial studies for ecosystem comparison’. 813–826. vol 94. www. J.Ponge. 31–47. Tondoh. F. A. M. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. Thompson. Southwood. y van der Linde.worldagroforestrycentre. y Henderson. Ecoscience. E... C. South East Asian Regional Research Programme. vol 35. van. Wiley. E.. D. D. pp.. Biodiversity Conservation. Stein. Pierce. D. P. Blackwell Science. pp. Urban. 3rd edition. y Bignell. A. S. J. J. Agriculture. Oxford University Press. M. L. (2000) Ecological Methods. vol 21. y Lookingbill. y Lavelle. J. 200–202. Grimbeek. Goslee.org/SEA/Publications. Indonesia. J. pp. (eds) (2001) Standard Methods for the Assessment of Soil Biodiversity and Land-use Practice. New York. y Oliver. pp. Oxford. Oxford. A. (1996) Adaptive Sampling. S. Bogor. Federoff. J. K. R. Jaarsveld. K.. P. S. G.. y Lavelle. 90 Manual de biología de suelos tropicales . M. P. K. S. (1998) ‘An evaluation of the gradsect biological survey method’. Ecosystems and Environment. vol 9. ASB-Lecture Note 6B . Journal of Tropical Ecology. y Seber. F. Swift. Dubs.

Julio Louzada. indicativos de la biodiversidad de suelo y de los efectos del cambio de uso y prácticas de manejo del mismo. aunque éste se concentra en los grupos más significativos: lombrices de tierra. 91 . Mucha macrofauna desempeña un importante papel en los ecosistemas del suelo. como ingenieros del suelo. Csaba Csuzdi. Susilo. Souleymane Konaté. en la creación de macroporos y en la transformación y redistribución de materia orgánica. probablemente. Además. Jérôme Ebagnerin Tondoh y Ronald Zanetti INTRODUCCIÓN Este capítulo describe los métodos para realizar el inventario de la macrofauna del suelo. Reginaldo Constantino. Las lombrices de tierra son. se consideran un componente determinante de la biota del suelo. Debido a su importante papel en los procesos del ecosistema y a su sensibilidad ante condiciones ambientales. los invertebrados más importantes en el suelo de regiones templadas. sin embargo. Una diversidad de organismos de suelo se incluye en esta categoría (capítulo 1).Capítulo 3 Macrofauna David E. debido a su biomasa. hormigas y escarabajos. o que tienen una anchura o diámetro de más de 2 mm. termitas. Francis-X. el grupo macrofauna incluye aquellos animales del suelo que miden más de un centímetro de largo. por tanto. sobre todo. que habitan especialmente en ambientes tropicales. Bignell. e influyen de manera notable en las propiedades físicas y químicas de los suelos. Otros son trituradores que deshacen la materia orgánica y un buen número de estos grupos son macropredadores. predominan las termitas y las hormigas. los grupos de macrofauna frecuentemente son utilizados o propuestos como indicadores de la calidad biológica del suelo. Agus Karyanto. en ambientes tropicales.

con la extracción de los insectos de los marcos de hojarasca por el método Winkler (Bestelmeyer et al. Como en el caso de otros grupos de biota de suelo. en cada una de las siguientes secciones que describe un método en particular. en la generalidad de la macrofauna. sin embargo. cuyo énfasis se concentra en un grupo específico de organismos asociados y. el método de transecto es más adecuado para un inventario de termitas. que sirvan como indicadores para monitorear el cambio de efecto de uso de suelo. algunos grupos representativos de macrofauna específica son capturados. por lo tanto. abundancia y biomasa. y no simplemente tres páginas que fueron impresas en los métodos originales “TSBF”. demuestra cómo ha crecido durante los últimos años nuestra percepción de la importancia de estos organismos. los que generalmente se refieren como métodos “TSBF”. utilizando cualquiera de los métodos enlistados en el capítulo 2. No obstante. el hecho de que se pueda dedicar un capítulo entero al muestreo de macrofauna. Nuevos esquemas son propuestos en el diseño de monolitos para mejorar el muestreo de lombrices de tierra. el punto de partida de desarrollo de los protocolos han sido los procedimientos de Anderson e Ingram (1989. se explica que no existe un sólo método para llevar a cabo un inventario de un grupo específico de macrofauna. Generalmente. mientras que las trampas pitfall con cebo son apropiadas para la captura de escarabajos.generalmente alta. Un avance mayor consiste en utilizar el principio de transecto para hormigas y escarabajos. por ende. se requiere de métodos estándares en el muestreo para diversidad. en un transecto corto (20-40 X 2m) al que ahora han sido añadidas trampas pitfall (principalmente para escarabajos) y otras guías para muestreo casual. al mismo tiempo. 1993) consolidados y mejorados por Swift y Bignell (2001). En este capítulo se describen métodos propuestos para realizar un inventario de macrofauna. en el caso de termitas. tal y como fueron aplicados en el proyecto CSM-BGBD. este capítulo se estructura de acuerdo con el método utilizado y no tanto en función del grupo funcional. forman un importante componente de la red alimenticia en el suelo. podrán ser utilizados más ampliamente. En el capítulo 2. 2000). Se entiende que los métodos propuestos son aplicados en ambientes tropicales. y la extracción Winkler es el método más idóneo para la captura y extracción de hormigas de muestras de hojarasca. cada uno de los métodos descritos es idóneo para un grupo en particular: los monolitos son especialmente escogidos para el inventario de lombrices de tierra. Para poder contar con datos de diversidad y abundancia de lombrices de tierra. 92 Manual de biología de suelos tropicales . Éstos están basados en monolitos de suelo y.

con la adición de trampas pitfall (Swift y Bignell. con dimensiones de 50 x 50 x 20 cm de profundidad para lombrices de tierra. 2001) y las extracciones con trampas Winkler (Bestelmeyer et al. Su abundancia y biomasa podrán ser calculadas con base en las muestras de 0. esto se puede hacer de manera sencilla. una charola de plástico grande de cocina. utilizando un machete o parang tomado de forma horizontal y agarrado por ambos lados. Primero se coloca un marco de 25 x 25 cm para marcar la posición del monolito y cualquier hojarasca o madera dentro de él es removida e introducida en una charola (Figura 3. son dictados por Anderson e Ingram (1993).INVENTARIO DE MACROARTRÓPODOS DE SUELO. es decir. pero que representan una biomasa importante. con un reborde. Se divide el bloque del monolito en tres capas. UTILIZANDO MONOLITOS DE SUELO Macroartrópodos de hojarasca y de suelo.1c y 3. 10-20 cm y 20-30 cm. véase el capítulo 2. de 0-10 cm.1b). sirve como un buen recipiente para la M acrofauna 93 . Se utiliza un transecto adicional de 20 x 2 m para muestrear las termitas.50 m². HOJARASCA Y LOMBRICES DE TIERRA EN PARTICULAR. éstos. en su mayor parte. Para revisar el suelo es conveniente utilizar la superficie de una mesa grande de campo para llevar a cabo la extracción. aunque es mejor si se muestrea la hojarasca delimitada por marcos dispuestos en una línea paralela. hay que meter la muestra en un bote de 19 L y llevarla al laboratorio. todos los invertebrados mayores de 10cm de largo. Monolito TSBF Los procedimientos generales.. preferentemente en el lugar y bajo sombra. Para la discusión del número y posicionamiento de monolitos. serán milpiés y lombrices de tierra con bajas densidades de población.1d). En una variante del método. de manera que puedan trabajar varios asistentes en la misma muestra de suelo o en muestras diferentes. Se revisa manualmente la hojarasca y cada capa de monolito por separado. En el caso de la hojarasca. La muestra de suelo en botes se debe guardar alejada del sol directo y deberá ser revisada antes de 24 horas. junto con monolitos extraídos del suelo. Se aísla el monolito utilizando una pala a unos pocos centímetros fuera del marco y luego se cava una zanja a su alrededor de 25 cm de ancho y 30 cm de profundidad. 2000).1a y 3. aislando el monolito como un pilar no perturbado (Figuras 3. la anchura aproximada del monolito más dos anchuras de zanja. Si no hay mucho tiempo o si la luz es insuficiente (colectar en selva cerrada es difícil porque la luz disminuye muy temprano). excavados de la zanja y la hojarasca pueden ser colectados. Este transecto también puede ser utilizado para hormigas y escarabajos.

en la que se anotan los datos siguientes (con lápiz o tinta indeleble.2. cuando se hace la extracción durante un tiempo determinado.revisión. de 5 mm. • El microhábitat en cuestión (madera nueva. pasándolo a través de un tamiz de malla grande. madera podrida. generalmente. Para evitar confusión en lugares ricos. en el caso de las termitas. sin embargo. madera seca. suelo. La información es importante para establecer la naturaleza de los organismos encontrados (especialmente la diversidad de grupos funcionales) y para construir una curva de acumulación de especies. termitas y escarabajos colectados.). se conservan en formol (formaldeído) al 4% para evitar la supuración de la mucosa. en una charola. como en el caso de un transecto. Se añadirá una etiqueta dentro del alcohol o formaldehído. Protocolo de muestreo alternativo para evaluar la abundancia y diversidad de lombrices de tierra en ecosistemas tropicales Introducción Este protocolo alternativo combina el llamado monolito de suelo TSBF (25 x 25 x 30 cm) y tres grandes monolitos (50 x 50 x 20 cm) para evaluar la abundancia y diversidad de lombrices de tierra a nivel local y de paisaje en ecosistemas tropicales. el periodo destinado deberá incluir el tiempo para el llenado de la etiqueta. al igual que obreras. se incluirán soldados. no usar bolígrafo o pluma): • Fecha y clave de identificación del lugar. Se deberá utilizar un tubo o frasco por cada especimen o población encontrada (o colonia aparente). las pequeñas ramas deberán romperse y ser golpeadas en la charola para que se desprenda cualquier insecto que contengan. En otros casos. las etiquetas deberán escribirse en el momento en que los especímenes sean introducidos en los tubos o frascos. Las hormigas.3 ó 4). • En el caso de transectos o monolitos alineados. hojarasca. Se diseccionarán los pedacitos de madera en diferentes piezas para ver si hay termitas. El tamiz retiene las hormigas que pueden ser aspiradas. Las hormigas pueden ser extraídas tomando un puñado de suelo. montículo. hormigas o escarabajos. Las lombrices de tierra y moluscos. las etiquetas se pueden hacer cuando se ha completado la extracción en cada sección del transecto. suelo de raíz de árbol. 94 Manual de biología de suelos tropicales . deberán preservarse en alcohol al 80%. etc. el número de la sección en el transecto en donde se encontró el espécimen (1.

(2000) para Asia y Decaëns et al.1 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). un monolito cuadrado de suelo de 25x25 cm y de 30 cm de profundidad. (1995). para ejemplos de América del Sur. siendo la unidad de muestreo. (2004). por lo menos. (2003). satisface el requerimiento de rapidez y la necesidad de tomar en cuenta la heterogeneidad del suelo a nivel parcela. Barrios et al. 1993) para macroinvertebrados. véase Bhadauria et al. la mayoría de los estudios sobre lombrices de tierra han sido elaborados utilizando el método TSBF (Anderson e Ingram. Dlamini y Haynes (2004) para el muestreo de lombrices de tierra en África. M acrofauna 95 . (1994. los monolitos se distribuyen a lo largo de un transecto corto (40 m) con. La ilustración C muestra un monolito grande (50 x 50 x 30 cm) y la D un monolito pequeño (25 x 25 x 30 cm) y la excavación de la zanja. Haymes et al. 2004). (2002) y Mathieu et al. Por más de una década. cinco monolitos por parcela bajo estudio. véase Gilot et al. En todos los casos. antes de muestrear el monolito.Figura 3. A B C D Nota: las ilustraciones A y B muestran la colocación de un marco de madera para delimitar el monolito y la limpieza de hojarasca suelta.

en cada tipo de uso de suelo. Fragoso et al.A pesar del éxito relativo del método TSBF para estimar la abundancia y diversidad de los macroinvertebrados del suelo. 2005). utilizando grandes monolitos de suelo de 1 m² x 40 cm de profundidad. permite tomar en cuenta la variación a 96 Manual de biología de suelos tropicales .. 1997. el muestreo debería realizarse al final de la temporada de lluvias. Decaëns y Jiménez. una combinación más eficiente de 100 x 100 x 40 cm para grandes y de 25 x 25 x 30 cm para monolitos pequeños de suelo. cubriendo grandes áreas. aunque pocas investigaciones se han enfocado a la evaluación de la abundancia y diversidad de lombrices de tierra en paisajes agrícolas.. que combina pequeños y grandes monolitos. 1997. 1969. 2002). respectivamente. Recientemente. el reto será desarrollar un protocolo de muestreo rápido para muestrear a nivel paisaje. 2002). 1999. se estudió la demografía de lombrices de tierra. 1998) porque las lombrices de tierra son reconocidas por presentar sensibilidad ante la perturbación antropogénica (Fragoso et al. Originalmente. Como las prácticas agrícolas contemporáneas muestran un mosaico de tipos de uso de suelo. Protocolo de muestreo De manera ideal. Este esquema de muestreo estratificado. 10-20 cm y 20-30 cm. Eggleton et al. Burel et al. Decaëns y Jiménez. Los monolitos de tamaño medio (50 x 50 x 40 cm) fueron utilizados por Ortiz-Ceballos y Fragoso (2004) para evaluar el impacto de una cobertera en poblaciones de lombrices de tierra. debido a su especificidad de grupo funcional. pero consumen mucho tiempo y resultan tediosos. Vincent. Tal avance será crucial para desarrollar indicadores de degradación de suelo (Moreno y Halffter. Lavelle. Las lombrices de tierra son colectadas a mano. cuando se sabe que las lombrices de tierra son más activas (Tondoh y Lavelle. en cada punto de muestreo se extrae un pequeño monolito de 25 x 25 x 30 cm que se rebana en tres capas: 0-10 cm. Se seleccionan cinco puntos de muestreo al azar. aunque pequeños monolitos han sido utilizados con éxito para identificar cambios importantes en la diversidad de lombrices de tierra a nivel parcela. por ejemplo. ha sido reportada para monitorear la dinámica de población de la lombriz peregrina Hyperiodrilus africanus (Tondoh y Lavelle.. Se pueden usar argumentos similares para justificar un muestreo más extensivo de lombrices de tierra. la carencia relativa de centros de colonias y su distribución altamente parchada. 2001. (1999) y Agosti et al. bajo diferentes prácticas de manejo de suelo (Fragoso et al. han propuesto protocolos de muestreo más exhaustivos para muestrear termitas y hormigas. 1978). 2005). (2000).

1993). Cada monolito mayor se separa en dos capas (0-10 y 10-20cm) y no en tres.2. perpendicular a la pendiente. En cada punto seleccionado. Anderson e Ingram. porque la mayoría de los especímenes (57-99%) son localizados en los primeros 20cm durante la temporada de lluvias (Tondoh y Lavelle. como en los pequeños monolitos. las lombrices de tierra son muestreadas. Monolitos grandes (50x50x20 cm) Monolito pequeño (25x25x30 cm) nivel parcela de las poblaciones.3) y son almacenadas en una solución de formol al 4% para su posterior identificación. El transecto aparece representado esquemáticamente en la Figura 3.2 Esquema de alineación de monolitos complementarios de lombrices de tierra. en intervalos de 5 m. con un punto de partida elegido al azar. cuando se considere apropiado (TSBF modificado. se extraen tres grandes monolitos de 50 x 50 cm y de 20cm de profundidad. mientras la variación a nivel paisaje se hace con un muestreo en los usos de suelo más representativos. 2005). M acrofauna 97 . De manera adicional. a lo largo de un transecto. 1993). contados y pesados. Monolitos adicionales son extraídos para poder tomar en cuenta la heterogeneidad a nivel de la parcela. Los individuos después son identificados. Las lombrices de tierra se colectan a mano (Figura 3.Figura 3. de acuerdo con el procedimiento de TSBF (Anderson e Ingram.

no existen a la fecha monografías disponibles para la identificación de lombrices de tierra de América Central y América del Sur. las monografías de Gates (1972).3 Separación a mano de lombrices de tierra en charolas de plástico. utilizando las claves desarrolladas por Blakemore (2005). cuando sea necesario. 2005) son los principales puntos de referencia. que se encuentran distribuidas en toda la región tropical. se debe consultar la descripción original de especies. Identificación de lombrices de tierra y estimaciones de su abundancia Especímenes de lombrices de tierra. debido a la carencia de guías comprensivas para su identificación. previamente agrupados como morfoespecies. pueden ser identificados a nivel de familia. Easton (1979) y Julka (1988) son las apropiadas. Para la identificación de lombrices de tierra de la India y del Sureste de Asia. Sims e Easton (1972). son identificables a nivel especie utilizando las guías y descripciones dadas por Blakemore (2002). 1971. sin embargo. La abundancia de lombrices de tierra se estima 98 Manual de biología de suelos tropicales . 1995. las especies nativas requieren de la pericia específica del país. la revisión de Eisen (1900) y estudios seleccionados de varios autores (Righi. por lo tanto. 2001. 1994. Para las especies africanas de Eudrilidae y Acanthodrilidae (Benhamiinae) se pueden utilizar las revisiones de Sims (1980. 1987) y Csuzdi (1996) y. Zicsi. Fragoso y Rojas-Fernández. Las especies de lombrices de tierra peregrinas comunes.Figura 3. Desgraciadamente.

La diversidad de lombrices de tierra se estudia en dos niveles complementarios: diversidad taxonómica y funcional (Bouché. Lavelle 1983. en cada tipo de uso de suelo. a nivel de la superficie del suelo. Lavelle.. 1997). La estructura de las comunidades de lombrices de tierra puede ser caracterizada por la densidad y biomasa de lombrices nativas y exóticas La importancia de la diversidad funcional en las lombrices de tierra ha sido ampliamente documentada (Lavelle. El segundo nivel de diversidad taxonómica trata de la biogeografía de lombrices de tierra (Fragoso et al. Desde el punto de vista ecológico. 2) la diversidad promedio expresada en términos de la media de número de especies por cada tipo de uso de suelo y 3) el índice ShannonWiener de diversidad (Pielou. se lleva a cabo mediante la identificación en cada tipo de uso de suelo de especies nativas y exóticas o peregrinas... con este enfoque. dos grupos de lombrices de tierra pueden ser distinguidos de acuerdo con su origen: especies nativas o exóticas. La relación nativas vs exóticas puede utilizarse como un índice para calcular la extinción de especies nativas o como un claro indicador de la invasión de especies exóticas o peregrinas. en casi todos los casos.como el número de individuos por m² y la biomasa como g de individuos por m². Se pueden utilizar tres categorías de expresión de la riqueza de especies: 1) el número de especies registrado en todos los monolitos. 1987). M acrofauna 99 . Blanchart et al. 1997. El aspecto funcional de la diversidad resulta de gran interés para evaluar la relación entre diversidad y servicios del ecosistema. 1977). con pigmentación y que viven en la hojarasca. 1997). éstas han sido llamadas peregrinas para indicar su amplia distribución a niveles regionales y continentales (Lee. 1981): 1. Fragoso et al.. mientras que las especies exóticas son. no pigmentadas y que viven dentro del suelo. Como resultado de su actividad. El análisis de comunidades de lombrices de tierra. El primer nivel de diversidad taxonómica trata del número y de la identidad de especies de lombrices de tierra. 1977. 2. 1996). producen excretas dentro del perfil del suelo y sobre la superficie. Fragoso et al. Lombrices endógeas: de tamaño medio. Los servicios que proveen las lombrices de tierra al ecosistema se relacionan con el impacto de su actividad en el sistema de suelo (Lavelle et al. 1983. Especies nativas son las caracterizadas por una distribución restringida a nivel local. Lombrices epígeas: de tamaño pequeño. 1997). 1977. 1997 y Lavelle et al. regional y continental. las comunidades de lombrices de tierra pueden dividirse en tres grupos (Bouché. Dentro de un ecosistema dado... introducidas por interferencia humana.

para el proyecto CSM-BGBD y a 50 m en el esquema alternativo de muestreo (véase Capítulo 2). presentan una alta resolución. marcada en secciones de 5 m. pero comen en la superficie. Swift y Bignell (2001). Cada persona lleva un machete o parang afilado. y sigue las descripciones formales de Jones e Eggleton (2000). ESCARABAJOS Y LOMBRICES de tierra Introducción Este método utiliza un transecto de 100. se basa en un transecto de 100 m. La mayoría de las lombrices de tierra que pertenecen a los tipos endógeos y anecicos son destacados ingenieros del ecosistema (Lavelle et al. Sus actividades forman una red densa de túneles dentro del suelo. una 100 Manual de biología de suelos tropicales . relativamente. modificando así las propiedades hídricas y químicas del mismo. HORMIGAS. Los datos obtenidos son cualitativos (identificación y número de especies) y/o semi-cuantitativos (abundancia relativa de especies y/o grupos funcionales específicos). sin pigmentación y viven en el suelo. Equipo requerido Brújula. 50 o 20 x 2m. cinta métrica de 30 m o preferiblemente cuerda de nylon o mecate. Este método se considera de bajo impacto y resulta idóneo para ser usado por aquellos que no son especialistas en termitas y puede ser completado en cada punto de muestreo por dos personas en un día (dos días para un transecto de 100 m).. tumba y quema. tal y como se describe y desarrolla más adelante. A las lombrices de tierra se les puede asignar una categoría ecológica o grupo funcional y posteriormente comparar dichos grupos con base en su densidad y biomasa. El método. fue desarrollado para bosques o localizaciones recientemente derivadas como en la agricultura de roza. MÉTODOS DE TRANSECTO PARA TERMITAS. por lo que los transectos se tratan separados de los monolitos y de las trampas pitfall. aunque se ha acortado a 20 m en el protocolo estándar. utilizando cinta naranja o amarilla fluorescente o a prueba de agua y un palo de 2 m. Lombrices anecicas: de tamaño grande.3. aunque se considera que. 1997) porque son activas mezclando y cavando el suelo.

El tiempo requerido para realizar transectos de 20 m es de 30 minutos de muestreo por dos personas. Las líneas de transecto no necesariamente tienen que ser rectas. pero los dos “brazos” principales de la línea del transecto deberán encontrarse. pueden inclinarse para alcanzar ángulos de hasta 90°. para poder replicar un monolito) los transectos deberán posicionarse para evitar interferencia mutua y separarse. de modo subjetivo. puede ser útil para picar madera o suelo. El muestreo se estratifica por M acrofauna 101 . con alcohol al 80% (se necesitarán más para hábitats ricos en termitas). de alrededor de 8-10 cm. por lo menos. el transecto se puede desviar hacia un lado. alrededor de 40 frasquitos de aproximadamente 1 x 5 cm. acantilados o caminos en uso que no sean hábitats adecuados para termitas. Frecuentemente se necesita evaluar. sin embargo. en diferentes secciones. a una distancia suficiente para evitar cualquier perturbación durante el muestreo. dos pares de pinzas. para evitar obstáculos naturales. en cada sección de 5m. En una parcela pequeña. especialmente en los casos de pequeñas parcelas. ese tiempo podrá reducirse si se trabaja con varios equipos de dos personas. de área basal muy grande. una charola de plástico o metal con reborde alto. siempre que no se crucen con ellas mismas. tales como pendientes. estrechas zanjas con arroyos o cortes en el dosel. Alternativamente. Se coloca el transecto de manera que visualmente atraviese los alrededores de manera homogénea. Procedimiento Se traza una línea de transecto de 20. el transecto puede incorporar otros fenómenos naturales del ambiente biótico que contribuyen a su heterogeneidad física. Es necesario anotar el punto de partida. Si se emplean otros transectos en la misma parcela (por ejemplo. un transecto puede curvarse sucesivamente por dos ángulos de 90° para que corra hacia atrás hasta su punto de partida. No obstante. evitando grandes arroyos. siempre que por lo menos una parte del sistema de raíces quede dentro de la cinta de muestra de dos metros de ancho.cuchara de albañil. cuando se trata de decidir sobre la línea ideal. Si la línea atraviesa un árbol. dirección del transecto con la brújula y cualquier cambio de dirección. de manera simultánea. Un equipo de dos personas será capaz de muestrear entre 8 y 12 secciones por día (2 a 3 transectos). a 15m de distancia. un cuchillo de campo de hoja fija. Se debe asegurar que las líneas de pitfall se mantengan sin perturbación en todo momento. para evitar pisadas excesivas en un solo lugar. 50 o 100 m junto al monolito. se pueden colocar dos transectos de 50m (o de 10 m) para que queden en paralelo.

Los pedazos más grandes de madera deberán cortarse tomando en cuenta que pueden estar infectados en alguna parte. por esta razón y para poder minimizar la necesidad de tener que trabajar con escasa luz. debería muestrearse la primera vez bajo la supervisión de un colector experimentado. incorporada en el suelo de superficie. El suelo. Idealmente. Es imposible muestrear con lluvia fuerte. o cubierta de pedazos de suelo. de 50 ó 100 m. se recomienda completar no más de 12 secciones en un día. esto ayuda mucho a ver las termitas (Figura 3. sin necesidad de usar una escalera o tener que trepar (alrededor de 2 m). posiblemente. nidos subterráneos epígeos y arbóreos y montículos de una altura de hasta 2 m sobre la superficie del suelo (incluyendo nidos de bolsitas suspendidos en la vegetación). por ello se permite interrumpir la labor 102 Manual de biología de suelos tropicales . frecuentemente contiene termitas. En la mayoría de las localizaciones no es necesario colectar cada termita y las especies más comunes podrán ser ignoradas después de muestrearse inicialmente para poder buscar las formas más raras o crípticas o para buscar soldados en especies que tengan una relación relativamente baja de soldado/obrero (tomando en cuenta que algunas especies no tienen soldados). nidos de termitas o pistas de tierra en troncos de árboles y otra vegetación. El tronco de un árbol vivo puede ser investigado para ver si contiene túneles de termitas a una altura accesible. Otras especies pueden habitar montículos y nidos o podrán coexistir con los que están construyéndolos. Normalmente se requiere de un corto periodo de entrenamiento u orientación para que colectores sin experiencia puedan muestrear con la misma eficiencia que un experto. es aconsejable comprobar la periferia y la base de la estructura. un transecto de entrenamiento. La madera podrida. madera en todas sus etapas de descomposición. También resulta de ayuda descansar unos minutos entre secciones. escarabajos y lombrices de tierra en nichos crípticos o cuando escasea la luz. acumulaciones profundas de hojarasca y suelo entre grandes raíces que funcionan como retenedores. otros invertebrados. junto con sus cámaras centrales. Los colectores deberán trabajar de manera constante (no frenética) en cada uno de los periodos de muestra de 30 minutos y tratar de mantener el mismo nivel de eficiencia de muestreo en cada sección del transecto.4). la hojarasca y los restos de madera pueden diseccionarse rápidamente en charolas.nichos. sin olvidarse de las ramificaciones o de los helechos que pueden acumular suelo que contenga termitas. lombrices de tierra y. Los palitos deberán romperse en pedazos y golpearse moderadamente en las charolas para desplazar cualquier termita u hormiga que contengan. por lo tanto. Los siguientes micronichos son investigados con detalle: hojarasca y la superficie del suelo hasta una profundidad de alrededor de 5 cm.

en el M acrofauna 103 . sin interrumpir el trabajo. El trabajo puede dividirse entre los colectores. Alternativamente. previo acuerdo. Esto dependerá de la naturaleza del lugar y de la topografía. Se recomienda que el suelo se extraiga en. contener soldados y obreros. sección a sección. el otro examina el suelo y las raíces de los árboles.Figura 3. hasta que mejoren las condiciones climatológicas.5 x 2 m. en lo posible. En los transectos donde se encuentran pocas termitas. Procesamiento de especímenes Los especímenes representativos de las termitas encontradas deberán ser preservadas en alcohol al 80% y. a pesar de que se trate de una pequeña cosecha. Se debe destinar un tubo de especímenes para cada población (o colonia aparente). por ejemplo. en lados opuestos de la línea. por lo menos. de manera que mientras uno muestrea la madera.4 Extracción de termitas de una muestra de suelo en una charola de aluminio. sin dañarlos. se puede usar un pincel de artista humedecido con alcohol para depositar el espécimen en el frasco colector. una docena de lugares separados en cada sección del transecto. Nota: las pinzas finas son idóneas para atrapar insectos con cuidado. cada persona trabaja en una cinta de un metro de ancho. para dividir cada sección en dos subsecciones de 2. es importante observar el protocolo de muestreo con precisión.

La información referente al micronicho en donde se encuentra cada espécimen es importante para poder establecer la naturaleza de la comunidad de termitas (especialmente la diversidad funcional del grupo) y para construir una curva de acumulación de especies. • Número de sección en el transecto donde se encontró el espécimen (1. En otros lados. que se cortarán y pegarán en una libreta de campo.).cual se introducirá una etiqueta. por lo que se podrán leer con mayor facilidad. se deberán escribir las etiquetas (o las notas de campo) tan pronto como se hayan colocado las termitas en los tubos de especímenes. utilizando una impresora láser. madera seca. etc. Los especímenes pueden resultar dañados o afectados en su color por el suelo o basura contenido en el frasquito. con pluma o bolígrafo. • El micro hábitat en cuestión (madera fresca. por morfoespecies o especies nombradas. como una muestra independiente. se podrán escribir etiquetas o notas. 2. se podrá construir una curva de acumulación por especies basada en especímenes o simplemente por especies. para los taxónomos expertos. 3. Lo anterior hace que el procesamiento sea más eficiente. Todas las notas de campo se guardan en la libreta y. Al tratar cada sección de 5 m. sin embargo. los números de las etiquetas estarán relacionados. por lo tanto. razón para destinar un mínimo de dos días a cada transecto de 100 m (proporcional para transectos más cortos). Las termitas deberán separarse en unidades taxonómicas reconocidas. reduciendo así las posibilidades de cometer errores en la numeración. lo que facilitará el trabajo. Para evitar la confusión. suelo. montículo. en el campo únicamente se añaden las etiquetas a los frasquitos y se toma nota en la libreta de campo de los números por sección y del transecto. el mismo día en que son colectados o tan pronto como sea posible. razón por la cual deben limpiarse lo antes posible (se separan las termitas del suelo o de la hojarasca. Se generan diez secuencias al azar de las secciones por 104 Manual de biología de suelos tropicales . se añade alcohol fresco y se escriben las etiquetas nuevas). los treinta minutos para el trabajo deberían incluir el etiquetado. en orden secuencial. Alternativamente. se podrán imprimir etiquetas numeradas. en lugares ricos en termitas. con lápiz o tinta indeleble y no. donde se anotan. los siguientes datos: • Fecha y clave del transecto. todas las etiquetas seguirán el mismo patrón. madera podrida. suelo a raíz de árbol). al completar cada sección del transecto. hojarasca.

M acrofauna 105 . debería subir y posteriormente inclinarse. es decir. será identificar cuáles son las que están presentes en la muestra. para cada selección de las diez secuencias. se identificaría a nivel género y. tales como Jackknife de primer orden y Jackknife de segundo orden. 2004). parcialmente compuesta por especies identificadas y. en el lugar 2. La colección entera deberá ser preservada durante un tiempo después de la identificación para su posterior confirmación y se debe de depositar. Una taxonomía pobre podría resultar en una baja o sobreestimación de diversidad y similitud de especies y hacernos llegar a establecer conclusiones erróneas. de manera permanente. indicando que se encontrarían pocas o nuevas especies con transectos adicionales en el área. También es importante que las morfoespecies “A”. finalmente. sean las mismas que “A”. o bien. Las especies y morfoespecies encontradas por transecto pueden ser desde sólo unas cuantas hasta más de 50. pero esto muchas veces no es posible para algunos grupos de organismos de suelo. en el lugar 1. Una manera más realista sería obtener la lista final. un subjuego en una colección de una institución nacional. 2000. 2004) que son implementados por el software libre EstimateS (Colwell. Identificación El primer paso para compilar una lista de especies y organizar los datos del ensamble de las especies encontradas.medio de un trazo (en cada secuencia) de 20 secciones al azar. se separaran en morfoespecies. trabajando desde niveles altos como órdenes hasta familia. lo que resulta muy laborioso en términos de tiempo. el resto. Una curva ideal debería ser asintótica. Chao y ACE. Cuando se comparan datos de diferentes hábitats o localidades. normalmente requiere una pericia taxonómica alta. la identificación consiste en la determinación de la posición de un espécimen en la clasificación existente. Lo ideal sería que todos los especímenes fueran identificados hasta especie. dependiendo del lugar y de la región biogeográfica. El número de especies encontradas en cada sección se usa para calcular el número acumulativo de especies. género y especie. es importante utilizar el mismo esfuerzo de identificación y métodos. entre otros (Magurran. La riqueza específica del lugar puede ser estimada utilizando métodos de extrapolación. Las muestras y los especímenes necesitan ser etiquetados y organizados cuidadosamente. se calcula la media acumulativa de especies de los diez juegos de 20 secciones para cada sección y se construye una curva de acumulación de especies. en un museo. La identificación de organismos de suelo. sin reemplazo. a nivel especie.

pero no es obligatorio. 2000). Nota que las abreviaciones “sp” y “cf” no aparecen en cursivas. N. de manera particular. No obstante. El paréntesis que abarca el nombre de los autores indica que la especie fue originalmente descrita en otro género y después se transfirió al género actual. el Código Internacional de Nomenclatura de Bacterias (Sneath. nunca se deben utilizar nombres manuscritos no publicados. técnicas moleculares para la identificación de microorganismos. Se utilizan. Los paréntesis. (abreviación del latín confer. para plantas. y para bacterias. Termes sp.Los métodos comunes de identificación de la fauna del suelo incluyen: a) uso de claves de identificación publicadas. Se trata de una lista organizada en orden alfabético. si existen. En el caso de animales. los Códigos de Nomenclatura contemplan reglas muy estrictas de formato para nombrar autores. Lista de guías y catálogo de identificación Se puede consultar una lista integrada de claves de identificación para termitas. A y Termes sp.1 presenta un ejemplo de una lista de especies. se utilizan con la misma connotación o de manera similar. para grupos de organismos diversos o poco conocidos. por ejemplo. El formato de los nombres deberá seguir el código respectivo de nomenclatura. Otras abreviaciones. 1999). lo cual generalmente resulta más práctico que un “orden taxonómico” subjetivo. Se muestran tres niveles de identificación. El dato de autor y año de publicación no forma parte de un nombre de especies y su uso es opcional. b) comparaciones con descripciones. ocasionalmente. compare). corniger y N. que deberán ser respetadas: los géneros y especies se imprimen en cursiva. hormigas y escarabajos en el apéndice 1 y listas más especializadas en las publicaciones 106 Manual de biología de suelos tropicales . el Código Internacional de Nomenclatura Botánica (Greuter et al. La Tabla 3. por lo tanto. Tal abreviación se usa para indicar que la identificación es incierta. tienen un significado y su uso se determina de acuerdo con las reglas de nomenclatura. excluyendo animales. Consulta un catálogo taxonómico que te permita comprobar la validez y cómo se deletrean los nombres. c) comparaciones con colecciones de referencia y d) envío de especímenes a un experto taxónomo. 1992). similis. La abreviación “cf” en el caso de Coatitermes y Armitermes. será el Código Internacional de Nomenclatura Zoológica (Comisión Internacional de Nomenclatura Zoológica. fueron identificadas plenamente a nivel especie. B fueron identificadas únicamente a nivel género y morfoespecie. a modo de rutina. aunque frecuentemente se recomienda.

19 Araujotermes nanus Armitermes holmgreni Armitermes minutus Armitermes teevani Atlantitermes osborni 1 1 1 13 9 13 46 2 2 1 15 7 1 1 1 1 1 2 2 6 1 7 3 4 1 3 1 2 1 1 5 1 1 1 1 1 4 14 1 6 1 6 25 8 1 1 2 19 20 3 1 9 4 10 71 47 3 10 1 2 16 7 1 3 Armitermes cf. Angularitermes sp. 18 Angularitermes sp. 6 Angularitermes sp.1 Ejemplo de lista de especies. 15 Angularitermes sp. 2 Angularitermes sp. 17 Angularitermes sp.Tabla 3. 11 Angularitermes sp. 16 Angularitermes sp. 14 Angularitermes sp. 5 Angularitermes sp. 7 Angularitermes sp. 9 Angularitermes sp. 3 Angularitermes sp. No. 10 Angularitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Kalotermitidae Angularitermes nasutissimus Angularitermes sp. peruanus Caetetermes taquarussu Constrictotermes cavifrons M acrofauna 107 . 13 Angularitermes sp. 1 Angularitermes sp. 12 Angularitermes sp. 4 Angularitermes sp. 8 Angularitermes sp.

I 5 1 10 9 10 1 22 4 1 1 1 3 85 1 6 29 1 35 6 1 89 4 2 8 3 2 7 4 1 10 7 1 18 2 2 3 15 1 12 17 21 1 56 29 6 2 11 1 9 1 5 29 1 1 2 16 1 1 1 37 19 1 Nasutitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 Coptotermes testaceus Cornicapritermes mucronatus Cornitermes pugnax Cornitermes sp. Curvitermes odontognathus Cylindrotermes flangiatus Cylindrotermes parvignathus Embiratermes parvirostris Heterotermes tenuis Labiotermes psilus Microcerotermes strunckii Nasutitermes callimorphus Nasutitermes corniger Nasutitermes gaigei Nasutitermes guayanae Nasutitermes octopilis Nasutitermes sp. Neocapritermes talpa 1 2 6 1 1 1 108 Manual de biología de suelos tropicales . J Nasutitermes surinamensis Nasutitermes unduliceps 1 Nasutitermes wheeleri Neocapritermes pumilis Neocapritermes sp.Tabla 3. A Nasutitermes sp.1 Continúa. No.

8 203 18 13 2.01 . 3 Subulitermes baileyi Subulitermes microsoma Syntermes molestus Syntermes spinosus Syntermes territus Termes hispaniolae Termes medioculatus Triangularitermes sp.1 25.3 52. 3 Triangularitermes triangulariceps Velocitermes sp.3 50. Ruptitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Neocapritermes taracua Neocapritermes villosus Obtusitermes sp.91 .Tabla 3.90 25.1 3 119 15 10 2. No.3 17. Planicapritermes planiceps Rhinotermes hispidus Rhinotermes marginalis Rotunditermes bragantinus Rugitermes sp.4 3 2 1 229 35 18 2.2 18.4 M acrofauna 109 . 2 Ruptitermes sp.4 1 5 2 2 1 3 8 7 471 50 39 2.80 . 1 6 8 1 1 1 2 1 1 1 2 3 9 3 6 5 1 1 5 1 1 1 9 9 259 52 20 3.41 0.7 Estimación de Jackknife 1 74.04 .81 14.1 Continúa.90 26.6 4 Muestras Especies Transectos Índice Shannon(H) Índice Simpson Rarefacción (100 muestras) Estimación de Chao 86.80 14.96 34. 1 Ruptitermes sp.6 81.3 25.8 72.

Las termitas distribuidas en el perfil de suelo. por lo tanto. antes de tomar las muestras. formar un grupo funcional (GF) uniforme y su composición también puede verse afectada por los métodos de muestreo utilizados. por ende. con un grado de selección de limos y fracciones de ar110 Manual de biología de suelos tropicales . al final del presente capítulo. La caracterización de un ensamble de especies involucra varios pasos. Invariablemente. Una de las principales propiedades de un ensamble es “la diversidad de especies”. la disponibilidad de claves adecuadas publicadas. pueden consultarse en la lista de literatura. Las termitas pueden colocarse dentro de las siguientes categorías tróficas: • Las que se alimentan del suelo. es necesario extrapolar de la muestra y utilizar estimaciones comparables de la diversidad local. Interpretación de resultados Los ensambles de especies son grupos de especies relacionadas taxonómicamente. Casi siempre la muestra no contiene todas las especies presentes en el hábitat. Si los detalles bibliográficos no están incluidos en la tabla. de un hábitat o área geográfica específica. conferencias y documentos producidos por proyectos de desarrollo internacional sin una distribución global. en los apéndices 2 y 3. junto con su calidad. varían entre el taxa y entre regiones. en relaciones ecológicas actuales. desde muestreo en campo hasta identificación y análisis de datos. pues dichos ensambles son delimitados por una clasificación taxonómica basada en historia y filogenia y no. la capa de hojarasca orgánica y/o montículos epigeos se alimentan del suelo mineral. esto se obtiene como resultado de la anotación del número de especies y morfoespecies. pero este término no es correcto. Los ensambles de diferentes hábitats o localidades pueden compararse con varias estimaciones o índices y agruparse de acuerdo con sus similitudes. Algunas veces se refieren a “comunidades de especies”. Lo más importante es la diversidad funcional del grupo. que se centran en una sola región. Existe también una “literatura gris” extensiva de reportes de talleres. cuentan con sus propios manuales. otra información puede ser obtenida del transecto. Los ensambles pueden o no. la cual se puede definir y estimar por varios métodos. aparentemente. por lo que muchos museos o instituciones científicas dedicadas a la taxonomía y conservación de la biodiversidad. El mejor enfoque para identificación. será el entrenamiento o bien que el procesamiento de especímenes esté a cargo de un taxónomo con experiencia.taxonómicas para termitas. Aunque la información básica generada es la de riqueza especifica. los cuales no están disponibles para el público en general.

por razones de las numerosas galerías o placas de suelo que construye encima de la madera. Las que se alimentan de madera. quedan proporciones más altas de materia orgánica del suelo y sílica. Este grupo es sinónimo de “alimentadores medios” sensu DeSouza y Brown (1994).raíces. pastos vivos o secos y pequeños pedazos de madera. Las termitas que se alimentan de madera muy podrida. que pueden volverse centros de colonias. todos menos los que se encuentran en una fase de descomposición terminal.. briofitas y líquenes en la corteza de los árboles (por ejemplo. El término “madera” incluye ramas muertas. debajo de troncos o en suelo adherido a la superficie de troncos en estado de putrefacción. y menos tejidos de plantas reconocibles que en otros grupos (Sleaford et al.• • • • cilla. algas. Las termitas que buscan hojas muertas. reconocida por Collins (1989). Este tipo de termita forrajera usualmente es más conspicua que otros tipos alimenticios. todavía unidas del árbol viviente y árboles muertos en pie. o bien. 1996). Las termitas de alimentación especializada o incidental. pero no en la misma categoría de “alimentadores de madera podrida”. Las termitas que se alimentan de madera y que cavan túneles en piezas más grandes de madera. al igual que otros que se han caído y se conservan aún frescos. normalmente compuestas por obreros y soldados forrajeros. subterráneos o epígeos. Las que se alimentan del suelo y de madera. provenientes de pasajes subterráneos o la formación de columnas descubiertas de individuos. Ruptitermes y otras especies de Constrictotermes en América del sur que se M acrofauna 111 . normalmente cortan el material antes de consumirlo o lo llevan a sus nidos. o mezclada con hojas podridas en complejos de limo . Aunque el material digerido es altamente heterogéneo. incluye especies que se alimentan de hongos. Esta categoría sigue la lista de alimentación de termitas de acuerdo con Wood (1978). Este grupo incluye algunos Macrotermitinae subterráneos y constructoras de montículos y otras Nasutiterminitinae y algunas otras que se alimentan en la superficie del suelo. Hospitalitermes hospitalis en el sureste de Asia. la cual se ha vuelto fácilmente desmenuzable y que se asemejan al mismo suelo o que predominan dentro del suelo. junto con por lo menos una termita inferior del sur de África Hodotermes mossambicus con un hábito similar. pero que se alimentan en otro lado y muchas Macrotermitinae que cultivan jardines de hongos. Las que forrajean la hojarasca (Termitas forrajeras). Este grupo incluye termitas con nidos arbóreos. hojarasca y superficie del suelo y porque hace agujeros que se abren en la superficie.

alimentan de líquenes). que habitan dentro de los nidos de Constrictotermes). Algunas termitas también se alimentan de tejido de planta viva. la ausencia de soldados (generalmente indica las que se alimentan del suelo) y la afiliación taxonómica (por ejemplo. es posible comparar ensambles de termitas en base a tipos de nidos. etc. Eggleton y Bignell. Si se dificulta la selección de un grupo funcional. 1970. La forma de distribución de dichas categorías indica la estructura de la comunidad de termitas. generalmente. Termitas cuyos centros de colonia quedan bajo el suelo. pero la perturbación o un periodo de secas. La identificación del grupo funcional puede hacerse de acuerdo con el color abdominal en especímenes vivos (las alimentadas de suelo y suelomadera son más oscuras). aunque el excremento se puede considerar como forma de basura descompuesta) y también ciertas habitantes secundarias de montículos de termitas que se alimentan de los forros hechos de rica materia orgánica. de manera similar. aunque ninguna especie es realmente fitófaga. Inquilinitermes. incrementa las proporciones de otros grupos funcionales.Gay y Calaby. Los centros son pocos definidos y amorfos (especialmente en 112 Manual de biología de suelos tropicales . la mayoría de la Apicotermitinae se alimentan de suelo o de suelo y madera). una aproximación útil se obtiene dividiendo las especies en “alimentadas de suelo” o geófagas (alimentadas de suelo. las Macrotermitinae no se alimentan del suelo. Las termitas cuyos centros de colonia normalmente se concentran en troncos muertos o árboles en pie. en África oeste y central. Algunas veces la madera muerta es gradualmente reemplazada por material acartonado o por panales de hongos. 1997. el lugar de su descubrimiento (en madera. encontrada en las cámaras interiores como inquilinas obligadas (Por ejemplo: Ahamitermis y Incolitermis. las que se alimentan de excrementos o las carroñeras de cuerpos de vertebrados (probablemente consumidos oportunamente. y “las que no se alimentan de suelo” (todas las demás). y suelo y madera) como las definidas arriba. otros aspectos biológicos como el lugar donde anidan (las que anidan en árboles normalmente no se alimentan de suelo). suelo.). Las categorías no son mutuamente excluyentes y muchas especies toman sus alimentos de por lo menos dos fuentes diferentes. Ophiotermes y Tuberculitermes. en Australia. especialmente bajo condiciones desfavorables. • Las que anidan de manera hipogea. según las siguientes categorías: • Las que anidan en madera. las comunidades de selva son frecuentemente dominadas por las que se alimentan de suelo.

pero excluyen montículos arbóreos. Figura 3. • Montículos epigeos. Estos montículos. M acrofauna 113 .los Apicoterminotenae que no tienen soldados). hechas de acuerdo con especificaciones típicas de la especie. que se forman por sí solos o que se asocian con los contrafuertes de los árboles. pero con una tendencia a volverse más irregulares con el paso del tiempo por razones de erosión. Nidos que se sujetan a árboles y que se localizan en diferentes alturas.5 Ejemplo de curva de acumulación de especies con una desviación estándar. adiciones y ocupación por parte de habitantes secundarios. usualmente construidos con material de apariencia acartonada (cartón). • Montículos arbóreos. Este grupo incluye especies que son habitantes secundarias facultativas de montículos epigeos. utilizando permutaciones de datos al azar. aunque algunas forman nidos subterráneos complejos (por ejemplo Marcotermitinae). Termitas cuyos centros de colonia se sitúan arriba del suelo. con estructura interna poco obvia. En la mayoría de los casos. estos nidos están conectados con el suelo mediante pistas cubiertas que pueden ayudar a distinguir algunos nidos de termitas arbóreas de los de hormigas. normalmente están bien definidos y constituyen estructuras altamente complejas.

trampa. se pueden obtener utilizando permutaciones (reiteraciones) de los datos al azar (Figura 3. Los análisis de multivariados. en la secuencia en que fueron anotadas en el campo. en todos los paisajes agrícolas (Thioulouse et al. tiempo (o persona por tiempo). HORMIGAS. UTILIZANDO EL MÉTODO WINKLER Introducción Las hormigas pueden clasificarse en grupos funcionales o gremios. Para más análisis estadísticos. muestra.. La prueba Kruskal-Wallis ANOVA puede utilizarse para probar si existe un efecto significativo de los tipos de uso de suelo en relación con la abundancia de lombrices de tierra. Aunque algunos autores consideran estos nombres como sinónimos. tienen diferentes sig114 Manual de biología de suelos tropicales .5) u otros métodos que normalmente requieren de programas computacionales especializados. es únicamente una gráfica del número de especies acumuladas. El esfuerzo de muestreo puede ser medido por espécimen. en el caso de lombrices de tierra. con un 5% de nivel de probabilidad. tales como el de componentes principales (PCA). con desviaciones estándar. En el caso de un esfuerzo de colecta grande. la curva es asintótica y tiende a inclinarse. Otro método será normalizar la densidad y la biomasa de las lombrices de tierra antes de llevar a cabo el análisis paramétrico de varianza (ANOVA). La forma más simple de estas curvas es conocida como la curva del colector. en relación con el número de unidades de muestreo. OTRA MACROFAUNA Y MESOFAUNA EN HOJARASCA.Curvas de acumulación de especies Las curvas de acumulación de especies son gráficas que representan la relación entre el esfuerzo de muestreo y el descubrimiento de las especies en un hábitat o región. se establece la comparación de la media del índice Shannon-Wiener. el de correspondencia (AC) y el de co-inercia pueden ser útiles para determinar factores que afectan la densidad y la diversidad de lombrices de tierra. mediante la prueba Fisher. Las curvas de acumulación de especies pueden ser obtenidas reiterativamente mediante remuestreo al azar de los monolitos de suelo o por secciones de transectos. número de especies y. hasta 500 veces. utilizando el software de EstimateS versión 6. Las curvas más sofisticadas. producción de excretas por cada tipo de uso de suelo. o área. 1997). 2000). La relación entre abundancia de lombrices de tierra y el índice de uso de suelo se comprueba utilizando regresiones.0b1 (Colwell.

Crematogaster y Pheidole.) muestran adaptaciones fisiológicas.. Aphaenogaster spp. hormigas no especialistas que frecuentemente viven en ambientes perturbados (Rhytidoponera spp. morfológicas y de comportamiento que reducen su interacción con la dominante Iridomyrmex spp. debido al tamaño relativamente grande de su cuerpo y a su comportamiento sumiso..).. • Especies crípticas: especies de hormigas forrajeras que normalmente anidan bajo el suelo (en la capa de suelo y hojarasca). Paratrechina spp. Aunque han sido varias las propuestas de esquemas de clasificación de grupos funcionales. pues es la más usada en diferentes paises. • Especies generalistas myrmicines: especies que pertenecen al género Monomorium.. Eurhopalothrix spp. 2000). • Especies oportunistas: escasamente competitivas. se recomienda utilizar el de Andersen (1997). Meranoplus spp. y Notoncus spp. las pertenecientes al género Camponotus. son cosmopolitas. Los siguientes son ejemplos de gremios en la selva brasileña de la Costa Atlántica (Delabie et al.nificados: los gremios son un grupo de especies que utiliza el mismo tipo de recurso para su supervivencia (Terborgh y Robinson. M acrofauna 115 . • Especies subordinadas asociadas: incluyen. 1986).. Ejemplo: Iridomyrmex spp. • Especies dominantes: especies muy abundantes y agresivas que influyen sobre la distribución y el comportamiento de otras especies de hormigas.). • Especies especialistas en clima y suelo: estas especies (Melophorus spp.. no especialistas y altamente competitivas. que pueden coexistir con la dominante Iridomyrmex spp. • Especies forrajeras solitarias de tamaño relativamente grande: predadoras solitarias que manifiestan muy poca interacción con otras especies de hormigas (especies dentro de los géneros Myrmecia. de modo que minimizan el contacto con otras hormigas que no ocupan este hábitat (Brachyponera spp. mientras que los grupos funcionales se refieren a especies que utilizan estrategias similares para explotar el recurso y pueden estar formados por más de un gremio. originalmente diseñado para hormigas australianas. en su mayoría. Bothroponera y Odontomachus).

Apterostigma. para trabajo de campo práctico. Sericomyrmes y Trachymyrmex. • Especies de hormigas arbóreas dominantes: especies omnívoras que anidan en árboles. por ejemplo. b) verdaderas omnívoras: Brachymyrmex. Anochetus e Hypoponera. Pheidole y Solenopsis. probablemente comedoras de larvas de termitas del género Syntermes (Delabie. • Especies predadoras de suelo: especies que se establecen en el suelo y en la hojarasca. incluyendo los restos de animales muertos. ejemplo: Acropyga. También existen otras clasificaciones funcionales. • Especies de hormigas legionarias: también conocidas como “formigas da correição”. Labidus (predadoras generalistas) y Neivamyrmex y Normamyrmex. • Especies cultivadoras de hongos: especies que utilizan hongos simbióticos. ejemplo: Amblyopone (predadoras de termitas) y Thaumatomyrmex (predadoras de miriápodos) y Strumigenys (predadoras de colémbolos). • Especies de hormigas dominantes en suelo u hojarasca: hormigas forrajeras de hojarasca y suelo o de la superficie. normalmente miembros de Attini. por ejemplo. son generalistas o especialistas dentro de las especies predadoras. ejemplos: Eciton. 1995). Solenopsis (especies grandes) y Wasmannia. carroña y restos de plantas para cultivar sus hongos. ejemplos: Acromyrmex. forrajean toda la vegetación arriba de la superficie y en la hojarasca. son altamente agresivas y presentan una influencia competitiva sobre otras especies. Pachycondyla y Centromyrmex (inquilinas de nidos de termitas). ejemplo: Odontomachus y Ectatomma. Cyphormyrmex. Atta. la empleada en el taller CSM-BGBD (2005): 116 Manual de biología de suelos tropicales . ejemplo: Azteca y Crematogaster. predadoras especialistas que comen otras hormigas. ejemplo: Megalomyrmex. • Especies predadoras especialistas: especies que se alimentan de un solo tipo de presa. Utilizan hojas frescas. • Especies predadoras generalistas: especies que se alimentan de diferentes tipos de presas. Campanotus. Paratrechina. Mycocepurus. donde son forrajeras. • Especies de hormigas subterráneas: dependen de gotitas de aguamiel y comen secreciones de azúcar de otros insectos. es conveniente escoger las clasificaciones más cortas. ejemplos: Gnamptogenys (hormigas y otros insectos depredadores). Myrmicocrypta.• Especies omnívoras: especies que se alimentan de varias fuentes. se subdividen en dos grupos: a) predadoras generalistas grandes.

con un centro de colonia subterránea. • Carnívoras (especialistas o generalistas). • Herbívoras. por lo menos.• Carnívoras (especialistas o generalistas). con un centro de colonia epigeo o arbóreo. trabajando desde el borde hacia el centro. 1999). Se tamiza cada muestra de hojarasca para remover pedazos grandes. Una vez en el laboratorio. c) extraer las hormigas dentro de la trampa Winkler. Se utiliza un marco para delimitar un área de un 1 m2 y se remueve la hojarasca a mano. cerrado pero ventilado. lentamente las hormigas y otros insectos migran hacia afuera y se caen en el alcohol. con el fin de maximizar la recuperación de los especímenes (Delabie. Procedimiento de muestreo El procedimiento completo se lleva a cabo en tres fases: a) tamizar en campo para separa la hojarasca fina (con hormigas) de la materia más gruesa. • Herbívoras. ventilado y bajo condiciones ambientales. • Herbívoras. preferentemente colocados a lo largo de la línea de transecto. conforme se seque la hojarasca. cuando los Winklers no se encuentren disponibles. con un centro de colonia en las capas superficiales de hojarasca. se puede pasar la hojarasca burda por una malla de 2 mm. posteriormente. como complemento o alternativa. junto a la coordenada GPS y al monolito (Ilustración 1. en alcohol al 70%. tres cuadrantes de 1 m2. b) transportar al laboratorio dentro de una bolsa segura. con un centro de colonia subterráneo. Se almacenan los especímenes en tubos cerrados y etiquetados. de manera que se puedan separar los fragmentos más gruesos. Se recoge primero la hojarasca. Se coloca un frasco con alcohol al 70% en la base de la trampa Winkler. junto con las hormigas y se transfiere a bolsas en campo. • Carnívoras (especialistas o generalistas). de manera que no escape ningún insecto. se mantiene la trampa durante por lo menos 72 horas. los cuales son colgados en un lugar cubierto. con guantes de cuero. véase también el Capítulo 2). La fracción fina queda en el fondo de la bolsa del tamiz. el contenido de las bolsas de campo se transfiere a redes. realizando movimientos laterales. Este procedimiento permite separar la macrofauna pequeña y alguna de la mesofauna M acrofauna 117 . estas redes se fijan dentro de la trampa Winkler. sobre una sábana blanca. que se encuentra en. con el centro de su colonia en las capas superficiales de hojarasca. hacia arriba. Esto debe hacerse con suficiente habilidad. con el centro de colonia epigeo o arbóreo.

• La trampa Winkler consiste en una bolsa porosa de algodón o nylon. por ejemplo. utilizando un aspirador manual (pooter). • Tamiz de malla grande. las cuales se usarán en campo para transportar el material tamizado.. latas.5 m de largo. tazas. La lista completa de los materiales para la extracción con trampas Winkler (Bestelmeyer et al. ESCARABAJOS. hasta el lugar donde se encuentren las trampas Winkler. • Redes. el cual contiene alcohol al 70%. de esta manera. Se achica el fondo de la bolsa para que se pueda colocar un frasco de aproximadamente 200 ml de capacidad. La hojarasca seca.50 m de largo. a prueba de insectos y mide 1. deberá ser pesada al final de la extracción. se pueden recolectar los especímenes de la sábana. dichas trampas están hechas de envases profundos relativamente pequeños. de aproximadamente 1. que se entierran de manera que la parte superior del envase quede exactamente al ras del suelo. botellas de plástico. en este caso. las cuales serán llenadas holgadamente con la hojarasca trasportada en las bolsas del campo y se colocaran en el centro de la trampa Winkler para dar paso a los invertebrados. que entre dentro de una bolsa resistente de nylon o tergal. una por cada trampa.del material orgánico y. contenida en la trampa Winkler. • Bolsas de nylon. de aproximadamente 34 cm de ancho x 55 cm de largo. de alrededor de 5 mm. se marca un límite de búsqueda de 30 minutos por cada metro cuadrado de hojarasca muestreada. después de limpiar la hojarasca suelta en el punto donde se va a colocar la trampa. la parte superior del envase puede situarse a 1 cm más arriba de 118 Manual de biología de suelos tropicales . 25 cm de ancho y 20 cm de profundidad central. plástico o aluminio para delimitar el área de muestreo. OTRA MACROFAUNA Y MESOFAUNA QUE SE ENCUENTRAN EN LA HOJARASCA: TRAMPAS PITFALL CON Y SIN CEBO Introducción Las trampas pitfall o de caída constituyen un método efectivo de recolección de muestras de los invertebrados meso y macro que viven en la hojarasca. vasos. Como variación de este método. 2000) es la siguiente: • Marco con una medida de 1 x 1 m de madera. tarros. de 25 cm de ancho y 37 cm de largo.

Las trampas se colocan bajo cubierta para evitar que entre la lluvia y funcionan como colectores de artrópodos que viven en el suelo y que caen en el envase. ahogándose en agua contenida en el fondo de la trampa. puesto que en ambas existe un alto grado de autocorrelación entre muestras adjuntas. Las trampas normalmente se limpian y se recolocan una vez al día. al igual que a actos de vandalismo. de manera simultánea. colémbolos). Una típica trampa pitfall puede observarse en la Figura 3. miriápodos. las pitfall son proclives a sufrir daños ocasionados por mamíferos y aves.6. Nota: frascos con diámetro de 10 a 20 cm generalmente son efectivos. se encuentran dispuestas de manera lineal (para facilitar la instalación y el retiro) sufren la misma desventaja que los transectos. No obstante.la superficie y se construye una rampa de suelo suelto a su alrededor. las dimensiones no son fundamentales. El diámetro más pequeño ofrece la ventaja de sufrir menos perturbación al momento de insertar la trampa. Las trampas pitfall no son cuantitativas y dado que. Además. se pueden utilizar específicamente para atrapar animales nocturnos. pero la trampa debe ser lo suficientemente amplia como para poder colectar un número razonable de especímenes y suficientemente profunda Figura 3. mientras que los insectos alados se escapan). arañas y otros arácnidos grandes tienden a dominar. por lo que se utilizan frecuentemente en los trabajos de inventario de la biodiversidad. normalmente. de fácil instalación. M acrofauna 119 . presentan algunas desventajas: sobre todo que no muestrean todos los grupos taxonómicos con la misma eficiencia (escarabajos. éstas ofrecen ventajas adicionales: se puede muestrear. Las pitfall son baratas.6 Esquema de una trampa pitfall con cebo. hormigas. ortópteros juveniles. la macrofauna y parte de la mesofauna (especialmente.

una caja Petri de vidrio invertida. éstos pueden ser improvisados en el campo. sin embargo. 120 Manual de biología de suelos tropicales . Entre 1 o 2 cm de agua en el fondo y un poquito de detergente serán suficientes para ahogar o inmovilizar a la mayoría de los animales y el detergente contrarrestará las propiedades hidrofóbicas de muchas cutículas de artrópodos. hecha con un vaso.7 Trampa pitfall improvisada. Un aditamento usual a las trampas es un techo inclinado para protegerlas de la lluvia.para impedir la fuga. Los clavos galvanizados o de madera son la mejor opción para elevar el techo hasta dos Figura 3. ésta descansará sobre palitos o clavos. cuatro palitos pequeños y una cubierta de celofán. es lo ideal.

al mismo tiempo que ayuda a mantener el contenido fresco. madera u otro material lo suficientemente pesado como para que no lo eleve el viento o que pueda ser afectado por la lluvia o el sol y que además no sea comestible para las termitas. En algunas variaciones de este procedimiento se añade sal como conservador. retardando así la descomposición. de manera que no atraiga insectos voladores. de manera alternativa. ajenos a la fauna del suelo. pero deberán evitarse siempre que se pueda. Se puede argumentar que cuando se trata de sol directo. una solución de hidrato de cloruro al 5% o una mezcla de ácido láctico/ácido acético (10% de cada uno de ellos. El número de réplicas puede basarse en curvas de acumulación de especies y ha de ser seleccionado para lograr un 85% o más de las especies buscadas. Las trampas pitfall pueden usarse en cualquier sustrato a nivel del suelo. En estudios referidos a riqueza de especies. ¿cuál sería el número apropiado de trampas pitfall requeridas para colectar el 85% o más de las especies capturables en una unidad vegetal dada? En el muestreo basado en transectos (Swift y Bignell. El vidrio pesa más que el plástico. El uso de envases de color fuerte o con dibujos puede mejorar la captura de parasitoides u otros insectos voladores que serán atraídos por los colores. En otras palabras.7). las pitfall normalmente se colocan en paralelo y M acrofauna 121 . Pueden emplearse para muestrear artrópodos en madrigueras. el techo debería ser opaco para evitar un efecto invernadero dentro de la trampa. plástico. dentro de un rango de unidades vegetales. muestran que un nivel de captura aproximada puede obtenerse mediante la replicación de trampas pitfall. 2001). el número de especies obtenidas por medio de las trampas pitfall se incrementa cuando éstas son colocadas en un máximo de unidades vegetales. pueden ser útiles para la estimación de la diversidad alfa. aunque su aplicación más común es en un sustrato de suelo para la fauna de artrópodos activa en la superficie del suelo (Figura 3. de manera que permitan el acceso a las trampas. hojarasca.o tres centímetros. pero se puede utilizar. lo que resulta atractivo para los artrópodos diurnos activos en la superficie. con una respuesta negativa a la luz. madera podrida y turba. El techo puede hacerse también de loseta de cerámica. también crea un microhábitat como si fuera una cueva. Estudios que se enfocan a la abundancia. combinados con un poco de glicerina) para mejorar su conservación. con la excepción de agua y roca. Colocación de trampas Mientras las pitfall son estrictamente no cuantitativas. éste deberá ser gris claro. por lo que el techo se mantendrá más estable.

122 Manual de biología de suelos tropicales . 1 Se utiliza una cuchara de albañil para cortar y sacar las raíces y suelo. capítulo 2. el monolito. podrá hacerse en cualquier momento. puede soplarse hacia afuera. pero esto no trata de ser prescriptivo. colocados en la superficie del suelo. a una distancia de alrededor de 5 m. las partículas más grandes. deberán ser extraídas a mano. se sugiere que las pitfall sean colocadas a lo largo de la línea de transecto y a un lado de los cuadrantes de 1 m² del muestreo para hojarasca. sugerido por Southwood (1978) hace uso de tablas de madera o de algunos obstáculos similares de hasta 30 cm de alto. de manera que los animales caminen sin obstáculos hacia el borde de la trampa. una precaución sensata sería. con el fin de hacer un hoyo del tamaño del vaso a introducir. No se especifica el número. se aplana con cuidado para mantener el mismo nivel que el borde de la trampa. Se muestrea. ordenar el lugar entero. por lo tanto. donde se puede colocar una colección de pitfall de manera cercana (véase "cercas movibles”). cualquier microhábitat de interés podrá ser investigado. Cuando una parcela es botánicamente compleja y varias unidades vegetales pueden ser reconocidas. las pitfall pueden ser distribuidas de la misma manera que en el muestreo casual para hormigas y termitas. especialmente a pisadas. de manera que se minimice al máximo la perturbación del microhábitat adjunto. Se usa el relleno para construir una rampa. finalmente. en forma de “V” o de embudo. 2 Se coloca la trampa pitfall en el hoyo y el borde externo se llena de tierra procedente de la excavación. se canalizan los animales móviles hacia la base de la “V” o embudo. que cae en la trampa durante su colocación. Un muestreo ocasional. fuera del área principal de actividad. es decir. En el sistema de muestreo recomendado para el proyecto CSM-BGBD. Un esquema variable de muestreo con pitfall. Instalaciones de las trampas pitfall Las trampas pitfall deben ser introducidas en el suelo con el borde superior del envase al ras del mismo o de la superficie de la hojarasca. según el orden de vulnerabilidad decreciente: primero las pitfall (de un día para otro) seguidas por los transectos. De esta manera. extracciones de núcleos de mesofauna y de microsimbiontes y. 3 El suelo fino. Se debe tener especial cuidado para evitar remover suelo y raíces. ello depende del largo del transecto.a cada lado. El número recomendado es de 3 a 5 trampas por cada punto de muestreo. La colecta de las pitfall es sensible a la perturbación.

esta película es difícil o hasta imposible retirar una vez que los ejemplares quedan conservados. Se añade un poquito de detergente como agente tensoactivo. si se les introduce directamente en alcohol. El lavado de ejemplares en agua fresca es esencial porque el detergente y la suciedad forman una película sobre los insectos. a no ser que la frecuencia de mantenimiento sea de 24 horas o menos. siempre se necesitará sal u otro tipo de conservador en climas tropicales. Para poder retener los colémbolos. 5 Se llenan las trampas hasta alrededor de ¼ de su capacidad con agua y suficiente sal como para lograr una solución saturada (en caso de escoger una solución salina). durante varios minutos. resulta útil para identificar la localización de la trampa y para prevenir pisadas accidentales. un palito. dejando así 2. animales más grandes. 6 Se coloca el techo sobre los soportes. Los especímenes deberán procesarse el mismo día en laboratorio o la base de campo. Se retira cualquier basura grande restante y se trata de retirar al máximo la tierra u otra basura orgánica. situado en su parte superior. se utiliza por separado un colador de 53 µm. Cada trampa se debe procesar de manera separada y se coloca en la bolsa o frasco una etiqueta con la identificación del lugar. Se extraen los elementos grandes. trampa y fecha de recolección. arriba del substrato. lo que dificulta que sean manipulables y visibles bajo M acrofauna 123 . enjuagando el contenido de cada bolsa en la red. ver abajo). con el fin de remover la suciedad. El mantenimiento y el procesamiento de especímenes El mantenimiento de las trampas se lleva a cabo de la siguiente forma: se quita el techo y se levanta el vaso interior que contiene el cebo (en el caso de que lo contenga. se agita suavemente el contenido restante del vaso para levantar los especímenes del fondo y se filtra con una red de acuario. que hayan caído en la trampa. El detergente facilitará la inmovilización por ahogamiento de animales activos. utilizando un frasco para enjuague o pipeta de agua.4 Se insertan tres soportes de techo en el suelo alrededor de la trampa. tales como hojas. etc. colocado verticalmente con un pedazo de cinta o banderín amarillo o naranja.5 cm de cada soporte visible. Se transfieren los especímenes en bolsas de plástico o frascos desde la red. lo que servirá para separar los últimos ejemplares. la sal y el detergente. utilizando un flujo suave de agua. palitos. 7 Se coloca un indicador con el número de lugar y trampa (en tinta indeleble o lápiz) cerca de la trampa.

Se recomiendan dos trampas de este tipo más tres de diseño convencional por cada punto de muestreo. El uso de cebos resulta controversial porque el muestreo se sesga hacia los animales con un marcado olfato. esto se lleva a cabo con la suspensión del cebo en un pequeño bote colocado en la boca del envase principal.microscopio. cebos de color (amarillo. se lava suavemente el contenido de la red y los lados de la bolsa o frasco con el fin de que los ejemplares caigan hasta el fondo. Se cubre con alcohol la muestra hasta la altura de los ejemplares que se encuentran dentro de la muestra. Para el procesamiento de ejemplares de colémbolos véase Capítulo 4 (Mesofauna). lleno de alcohol. Una variante de este proceso es usar dos filtros para colémbolos (malla 53 µm y 38 µm) se utilizan para separar estos animales de la otra fauna (ver Capítulo 4). Después de este lavado. Después de siete días se debe cambiar el alcohol y. carroña. rojo o azul) para atraer moscas o parasitoides. se encuentra fácilmente disponible. se invierte el contenido de la red en una bolsa de especímenes y con un atomizador o piseta. Las trampas con cebo no podrán utilizarse en una evaluación semi-cuantitativa como medio de captura (por ejemplo. La principal modificación en el diseño consiste en agrandar su diámetro. el porcentaje de todas las trampas estará ocupado por una sola especie) porque no se puede determinar 124 Manual de biología de suelos tropicales . Para mejorar la capacidad de captura con trampas pitfall Es posible mejorar la capacidad de captura con las trampas pitfall haciendo varios cambios en el diseño de la trampa o usando cebo atractivo para artrópodos. feromonas). por supuesto. El excremento humano fresco también es apetecible para una gran variedad de escarabajos y. si es posible. porque la capacidad de captura de las pitfall está en función del tamaño de su circunferencia. se refrigeran o se congelan las muestras. Las muestras almacenadas deberán quedarse en una bolsa doble o frasco. El hecho de usar cebos atractivos implica un mejoramiento general para la captura de una gran variedad de artrópodos. y se introducen las etiquetas (escritas con tinta indeleble o con lápiz). El cebo deberá separarse del líquido conservador. frutos caídos u hongos en descomposición que resultan indistintamente atractivos para los detritívoros y algunos otros tipos de artrópodos. se usa alcohol al 95% en el caso de colémbolos y al 70% para otros especímenes. El cebo puede ser estiércol. en espera de futuros procedimientos. Se pueden preparar trampas pitfall adicionales (opcional) con un contenido de 120 ml de etanol al 95% + glicerina (9:1) que se dejan en campo durante 72 horas. o sustancias sintéticas atractivas (por ejemplo.

• Cubeta o envase para agua. se combinan los resultados de los monolitos. 2 o 6B) • Etiquetas tipo tarjeta. sino también de la movilidad relativa. por lo menos. M acrofauna 125 . Para completar la lista. pesados después de un secado con papel absorbente. • Detergente puro: detergente líquido no perfumado para platos. Si no se cuenta con una balanza disponible en el campo. • Soportes del techo: clavos de madera o galvanizados de 152 mm (seis pulgadas). hasta el nivel de determinación taxonómica y funcional más alta posible. trampas pitfall junto con un muestreo casual. • Indicadores de plástico o de madera. REGUISTRO E INTERPRETACIÓN DE DATOS Parámetros Registre el número y peso fresco de todos los organismos e identifique. trampas Winkler. transectos. Lista de materiales requeridos • Trampas pitfall: vasos de plástico de 1000 ml (con dimensiones de 180 mm de diámetro superior x 120 mm de profundidad). • Agua: agua de la llave o de una fuente natural. se puede estimar el peso fresco para ejemplares conservados.el área en donde se llevó a cabo el muestreo y la captura no sólo depende de la abundancia de animales. sin embargo. La presencia y el peso de hongos cultivados por las termitas (si los hay) también deberán anotarse. utilizando el nombre genérico y por orden alfabético. • Red de acuario o similar (de malla fina). siempre que sea posible agruparlas en familias o subfamilias. • Bolsas de plástico para muestreo con sello (tipo ziplock son las más convenientes para el almacenamiento de especímenes de campo) o frascos. no. se hace una lista de especies. loseta de color gris claro. • Alcohol al 70 al 90%. esto es aplicable para las lista de especies de la localidad. • Sal. • Lápiz de grafito (ej. • Techo de 200 x 200 mm (uno por trampa).

se multiplica el número crudo de cada monolito x 16. Cassava 26 Media aritmética Nivel del estrato (Promedio de todas individuos m-2 (n=5) las localidades) 46 0–10 cm 106 10–20 cm 55 20–30 cm 49 Media geométrica individuos m-2 (n=5)* 971 65 47 11 25 2 10 Media geométrica individuos m-2 (n=5)* 15 80 44 4 95% de confianza 347-12. Tabla 3.Las especies plenamente identificadas deberán enlistarse con su nomenclatura binomial (género y especie) y la autoridad que las describió completas: Ejemplo Dorylus laevigatus Smith.772 0-20 2-534 95% de confianza 3-64 43-148 24-78 1-50 * Datos retrotransformados. Incorpore la lista de especies en una tabla que muestre las localidades donde fue encontrada cada una. Alang-alang 3 BS14.445 2-1.892 BS3. 2003. con la excepción de las lombrices de tierra y milpiés. La abundancia se estima como número o individuos por m2.2 Densidad numérica (individuos m2) de termitas en siete localidades. Sitio Media aritmética individuos m-2 (n=5) BS1. Por ejemplo. Las especies identificadas únicamente a nivel género. Es importante que la designación de letra sea consistente entre las localidades. Las morfoespecies deberán enlistarse por letra: Ejemplo Crematogaster sp. Selva de hule 211 BS12. Fuente: datos de especies de Jones et al.046 2-9. y Crematogaster sp. a través de un gradiente de perturbación de la selva. de cada monolito y de cada estrato. la especie A es la misma especie en toda el área de muestreo. B. Hule 128 BS10. Paraserianthes 512 BS8. Selva primaria 2. A. Árboles talados 163 BS6. en la provincia Jambi del centro de Sumatra. deberán enlistarse sin letras: Ejemplo Colobobsis sp..827 22-977 5-16. los cuales se muestrean en el mo126 Manual de biología de suelos tropicales .

En casos difíciles. se calculan las medias aritméticas. es posible asignar dominancia y. También partiendo de que un transecto completo representa una muestra única y grande. Los datos transformados pueden usarse para histogramas y comparaciones de lugar a lugar (Eggleton et al. existe un método alternativo que consiste en calibrar la biomasa viva con el ancho de cabeza. y prepare una tabla resumida. también para cada grupo taxonómico superior y se combinan los datos de todas las especies. los datos primarios deberán transformarse en log10(x+1). Se estima la biomasa en g. Para la información completa obtenida de transectos. Jones e Eggleton (2000). se utiliza peso fresco o la masa de un espécimen parcialmente seco. o para otros grupos individuos separados a lo largo del transecto completo. etc. se puede probar una transformación loglog. datos transformados y los límites de confianza para log10(x+1). Se evita el uso del peso seco debido a las diferentes temperaturas de los hornos que usan algunos investigadores y por el contenido variable de agua de los diferentes tipos de organismos. Woodcock (2005) y Jones et al. finalmente. derivar en índices de diversidad de especies y de equitatividad. (2005). El peso de los desconocidos puede entonces estimarse desde la curva. si es posible. también es posible que el número total de encuentros. Se aplican estadísticas descriptivas al juego de datos transformados. Este concepto no se puede aplicar de la misma manera para las pitfall.m-2 de manera similar a como se calcula la abundancia.. en especímenes representativos que cubren todo el rango de tamaños.nolito y la zanja (véase monolitos arriba). Donde se dispone de especímenes de insectos de varios tamaños. por lo tanto. 1996). resulta más conveniente M acrofauna 127 . Para poder estimar el 95% de límite de confianza. tal y como se muestra en la tabla 3. número de pitfall respecto al total. En el caso de transformaciones a log de los datos. o sea. Se citan las medias para datos no transformados. junto con las medias geométricas. puedan ser parámetros útiles de población. Algunos indicadores de la abundancia relativa se pueden obtener a partir de la frecuencia de encuentro de diferentes especies (número de secciones de un transecto en donde se localizó la especie con respecto al número total muestreado. Eggleton et al. se determina la abundancia para cada taxón.). (1997). el número de veces que se descubren colonias separadas en el caso de hormigas o termitas. Cuando no hay demasiados ceros (muestras sin organismos) este procedimiento debería normalizar los datos y producir varianzas homogéneas de grupo a grupo. incluyendo el 95% de los límites de confianza y con los datos transformados se obtiene una media geométrica.2). véanse las discusiones en Eggleton y Bignell (1995).

Este grupo incluye. Nota: determinar solamente la abundancia resulta fácil. una variedad de artrópodos (hormigas. Los dos grupos principales son las lombrices de tierra y las termitas que se alimentan del suelo. Especies anécicas son las que retiran hojarasca de la superficie del suelo a través de su actividad alimenticia. Las lombrices de tierra y las termitas que no se alimentan de suelo constituyen los principales grupos dentro de esta categoría. definido por su hábito alimenticio y su distribución en el perfil del suelo. el efecto de estos invertebrados es fraccionar y despedazar la hojarasca. Se prepara una tabla resumida. pero no redistribuyen activamente materiales de las plantas (aunque el material despedazado sea más fácilmente transportado por el viento o el agua que el material de donde deriva). de manera que monitorear datos sin estimaciones de biomasa proporciona información incompleta y. Cantidades considerables de suelo. ciempiés. cochinillas y grillos). elementos minerales y materia orgánica se redistribuyen con esta actividad y también se acompañan de efectos físicos sobre la estructura del suelo y las propiedades hídricas. Ensambles pueden ser comparados por la proporción relativa de especies o unidades taxonómicas (morfoespecies).trabajar en (mg+1) y luego se transforman y se expresa en gramos. en su mayoría. pero también algunos arácnidos. es decir. Análisis Los análisis se deben llevar a cabo por grupo funcional. ingiriendo grandes cantidades de materia mineral. menos informativa. muchas tasas de procesos en el ecosistema son proporcionales a la biomasa y no a la abundancia. como arriba. puesto que no implica pesar especímenes individuales o hacer otras medidas para estimar la biomasa. Especies endógeas que viven en el suelo y se alimentan de materia orgánica y de raíces muertas. las cuales pueden ser incluidas en una o más 128 Manual de biología de suelos tropicales . y liberar nutrientes. Especies epigeas que viven y se alimentan en la superficie del suelo. abundancia y biomasa en forma gráfica. cucarachas. la clasificación de lombrices de tierra (ya mencionada) puede aplicarse a todos los invertebrados del suelo. La macrofauna activa en la superficie incluirá a los organismos muestreados en las trampas pitfall. escarabajos. caracoles y pequeñas lombrices de tierra completamente pigmentadas. Para poder establecer una comparación. por tanto. sin embargo. milpiés. Se debe mostrar riqueza de especies/morfoespecies.

utilizando las siguientes categorías: Los ingenieros del ecosistema (normalmente hormigas. ICE y EstimateS. Los índices de diversidad y de similaridad útiles incluyen: ShannonWiener. normalmente procedentes de varios grupos de artrópodos).2 a 1cm). 1998). Se recomienda probar la clasificación de un grupo funcional (GF) adicional para la macrofauna. Las especies clave (termitas y posiblemente algunos transformadores de hojarasca) proveen oportunidades físicas de nichos para organismos de nivel más bajo y determinan la estructura de la comunidad de estos organismos. M acrofauna 129 . Simpson. Lista por familia de los otros escarabajos.categorías funcionales. pero ocasionalmente más pequeños) ingieren una mezcla de materia orgánica y minerales. y forman heces longevas y estables. termitas y escarabajos capturados con cebo. Este grupo incluye invertebrados grandes (> 1cm) y medianos (0. pero algunos animales más pequeños (varios ácaros) pueden tener funciones análogas. CONJUNTO mínimo DE DATOS El conjunto mínimo de datos puede ser expresado por cada punto de muestreo. Los grandes invertebrados (> 1cm. La riqueza de especies actual puede ser estimada por medio de Sob. que son complejos organominerales. 1978 y Krebs. Nota: los términos “ingeniero de ecosistema y especies claves” con frecuencia son utilizados. Conjunto mínimo de datos por punto muestreado De todo el muestreo Lista de especies/morfoespecies para hormigas. lombrices epigeas y ácaros grandes) ingieren una mezcla de materia orgánica y biomasa microbiana y forman heces holorgánicas de corta vida.2 cm. Transformadores de hojarasca (normalmente artrópodos no sociales o semisociales. por categoría de uso de suelo y por ventana de muestreo. ACE. Macropredadores (especies predadoras >0. como sinónimos. Jackknife. según se explica a continuación. Jacquard y Sorensen (véase Southwood. de forma incorrecta. termitas y lombrices anécicas y endógeas).

números totales por cada grupo funcional (GF1. el número de encuentros. En el caso de las hormigas. Se pueden juntar los datos obtenidos de diferentes transectos en puntos de muestreo separados.Lista de los otros invertebrados en la resolución taxonómica la más alta posible. Todos los escarabajos Otros invertebrados Todos los invertebrados. Abundancia total en número m2 de forma separada para: Todas las hormigas (y por grupo funcional GF1. GF2. Todas las lombrices de tierra (además por GF 1. en su defecto las que se alimentan de madera o de suelo). con la excepción de lombrices de tierra). Nótese que un encuentro es un evento en una sección de 5 m del transecto. Se hace un cálculo para cada GF. Desde el transecto o los transectos Abundancia relativa de termitas. varía de 0 a 4 para transectos de 20 m y de 0 a 20 para transectos de 100 m. 130 Manual de biología de suelos tropicales . Datos de abundancia para hormigas y escarabajos (número de individuos m²). GF 2. etc.. Para cada taxón se indica el método de muestreo empleado: C = casual T = transecto W = Winkler P = pitfalls M= monolito (Para el monolito no observar estratificaciones de 3 x 10 cm.) también pueden estimarse. por lo tanto.). De las trampas Winkler Frecuencia de especies por muestra. GF2. GF 2. Todas las termitas (y por GF 1. La abundancia relativa para cada GF está dada por el número de encuentros de divididos entre el número total de encuentros de todos los GFs.). utilizando todas las secciones de transectos disponibles para el muestreo. etc. etc. etc.

etc.. GF 2. o en su defecto las que se alimentan de madera o de suelo). etc. todos los escarabajos. GF 2. De los transectos Abundancia relativa media de termitas GF 1. separado para hormigas (y para grupos funcionales GF1. utilizando las mismas claves que las especificadas anteriormente: C= Casual. como % ± SD. W= Winkler.De las trampas pitfall Se desglosa los taxa no muestreados por otros medios (únicamente).). todas las termitas (y para los grupos GF 1. lombrices de tierra y escarabajos capturados con cebos. etc. donde n = número de puntos por uso de suelo. Lista de familias para los demás escarabajos Lista de invertebrados en la resolución taxonómica la más alta posible Para cada taxón se indica el método de muestreo empleado. termitas. De todo el muestreo Listas de especies/morfoespecies para hormigas. T = Transecto. etc. otros invertebrados y todos los invertebrados (igual a lo indicado para datos mínimos por punto de muestreo). GF 2. P= Pitfalls y M= Monolito De los monolitos Es necesario proveer la abundancia media como: a) Número de individuos m² ±SD b) Media geométrica ± 95% de intervalo de confianza c) Media aritmética ± 95% de intervalo de confianza donde n = número de puntos por uso de suelo. M acrofauna 131 . todas las lombrices de tierra (y por grupos GF 1. GF 2. Conjunto mínimo de datos por uso de suelo Las categorías de uso de suelo son anotadas y cuando esto no es posible se clasifican de acuerdo con la intensidad de uso de suelo.).

incluyendo los resultados de intensificación de uso de suelo. se argumenta que los organismos se deben asignar únicamente como ingenieros del ecosistema. se dice que la abundancia de individuos no se debe usar en el caso de hormigas porque son insectos sociales que se organizan en colonias formadas por miles de individuos que se alimentan en grupos. El uso de datos crudos de abundancia y de biomasa en la interpretación de la función del ecosistema resulta controversial..) como individuos m² ± SD. Abundancia media de escarabajos como individuos m² ± SD. Desafortunadamente. no obstante. donde n = número de puntos por uso de suelo. Lawton et al. GF 2. será sobreestimada (Colwell y Coddington. existen contra argumentos de que los insectos sociales pueden evaluarse correctamente en cuanto a su abundancia y biomasa. muestreo anidado y estratificado ejemplo Eggleton et al. ejemplo Diversidad β. Conjunto mínimo de datos por ventana de muestreo De todos los métodos de muestreo Recambio de especies a lo largo del gradiente como la β de Whittaker. si el régimen de muestreo es suficientemente robusto (incluyendo réplicas adecuadas. De manera similar. 132 Manual de biología de suelos tropicales . el cálculo retrospectivo hasta llegar a la densidad numérica. cuando su abundancia o biomasa lo justifique.De las trampas Winkler Abundancia media de hormigas (y como GF 1. 1995.. Para todas las abundancias medias totales y las abundancias medias relativas de los GF Correlación con parámetros individuales del gradiente. 1996) y que la biomasa es tan importante para la determinación del impacto ecológico que no se puede prescindir de ella o sustituirla. en base de lugar a lugar. La frecuencia de especies por muestreo presenta un parámetro alternativo. etc. 1994). la escala del esfuerzo requerida para poder evaluar la biomasa es enorme (véase Eggleton y Bignell. si el muestreo se hace en una colonia. Por ejemplo.

H. Kaneko and M. B. 433–460. (2002) ‘Effects of land-use system on the soil macrofauna in western Brazilian Amazonia’. N. Andersen. 29. REFERENCIAS Agosti. N. D. Biology and Fertility of Soils. S. Blanchart. Australia. I. S. Environmental & Ecology. Brandão. DC. Bhadauria T. Wallingford. e Ingram. F.ynu. in N.. vol.. (1977) ‘Stratégies lombriciennes’. E. in U. E. y Saha. (2002) Cosmopolitan Earthworms – An Eco-Taxonomic Guide to the Peregrine Species of the World. 24. L. C. vol. J. M acrofauna 133 . (eds) (2000) Measuring and Monitoring Biological Diversity. B. vol. Persson (eds) Soil Organisms as Components of Ecosystems. CAB International. Ito (eds) A Series of Searchable Texts on Earthworm Biodiversity. Ecological Bulletins.. y Lavelle.. W. Barrios. I. A. Brown. E. J. P. E.. Blakemore. pp. Lebissonnais. Journal of Biogeography. C. M. T. Blakemore.. J. Bhattacharya. pp. Alonso L. (2000) ‘Soil microarthropods of a rubber plantation and a natural forest’. 2nd edition. Smithsonian Institution. R.htm. Ecology and Systematics from Various Regions of the World. pp. pp.. Anderson. Pashanasi. R. Soil Biology and Biochemistry. T. (1997) ‘Regulation of soil structure by geophagous earthworm activities in humid savanna of Côte d’Ivoire’. P. Ramakrishnan. vol. www. Halder.jp/eng/index. J. Standard Methods for Ground-living Ants. Wallingford. 35. T. 143–147. J. Leeanne. J. Y. (1997) ‘Functional groups and patterns of organization in North American ant communities: A comparison with Australia’. 32. M. G.338–347. 1st edition. e Ingram. 2045–2054. (2000) ‘Diversity and distribution of endemic and exotic earthworms in natural and regenerating ecosystems in the central Himalayas. Anderson. (eds) (1989) Tropical Soil Biology and Fertility: A Handbook of Methods. CAB International. Lohm and T.. y Schultz T. C. R. D. Soil Biology and Biochemistry. K. India’.ac. Yokohama National University. Lavelle. 3. 25.1998). S. Agosti.. Constantino. Delabie. pp. Washington. Bestelmeyer... J. K..T.bio-eco. Braudeau. J.. pp. 431–439. 122–132. VermEcology. Kippax. lo que compromete la caracterización de la heterogeneidad del paisaje porque restringe el número de puntos de muestreo que pueden ser utilizados. P. vol.. Alonso. y Valentin. (2005) ‘Introductory key to revised earthworm families of the world’.. Japan. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. T. Majer. D. y Srivastava. R. COE Soil Ecology Research Group.. vol. M.eis. R. M. Bouché.

A. Agosti.5: Statistical Estimation of Species Richness and Shared Species from Samples. J. in H. C. (1999) ‘Comunidades de formigas (Hymenoptera: Formicidae): Métodos de estudo e estudos de casos na Mata Atlântica’. S.. 345. J... 39. T. C. Butet. Amsterdam. Barros.Burel. Paillat.. (1994) ‘Impact of land management on soil macrofauna in the Oriental Llanos of Colombia’. T.ucon. y Coddington. Termitidae. Chauvel. J. 19. 347–367. Sociedade Nordestina De Zoologia. R. Delettre.. M. Schultz 134 Manual de biología de suelos tropicales . 157–168.-C. Philosophical Transactions of the Royal Society (Series B). Nairobi. pp. vol. T.. J. Alonso and T. K. Jiménez. 58–68. E. Resumos Feira De Santana. Thenail. Colwell. J. C. Lavelle. A. 240. J. http://viceroy. (2002) ‘Earthworm communities under an agricultural intensification gradient in Colombia’. G. vol. São Paulo. H. (1996) ‘Revision der Unterfamilie Benhamiinae MICHAELSEN. Brunel. N. 605–609.. Collins. vol. Jiménez. Delabie. E. P. pp. y Lavelle. Encontro De Zoologia Do Nordeste. Decaëns. Agriculture. Majer. Version 6. vol. L. European Journal of Soil Biology. H. Version 7. Werger (eds) Tropical Rain Forest Ecosystems. Dubs. pp.. (2005) ‘EstimateS. C. Petit. Acta Oecologia. (1994) ‘Estimating terrestrial biodiversity through extrapolation’. F. vol. C. J.. Baudry. y Nascimento. vol. Csuzdi. Software and User’s Guide’. Feira De Santana. H.. F. Mitteilungen aus dem Zoologischen Museum in Berlin. 103. and Rippstein.. (2000) ‘Litter ant communities of the Brazilian Atlantic rain forest region’. (1995) ‘Inquilismo simultâneo de duas eespécies de Centromyrmex (Hymenoptera.edu/estimates. Fragoso. A. (Isoptera. T. y Jiménez. uconn. Le Coeur. Elsevier Science Publishers. 301–312 Decaëns. Plant and Soil. J. E.eeb. Leith and M. pp. pp. G.eeb. J. Escobar. Colwell. Revista Brasileira De Entomologia. pp133-143. (2000) ‘Statistical Estimate of Species Richness and Shared Species from Samples.. (1989) ‘Termites’. D. Blanchart.. pp. 72.. Ponerinae) em cupinzeiros de Syntermes sp. N.. 1897 (Oligochaeta: Acanthodrilidae)’. Clergeau. Delabie. Agosti. D. in D. J. (1998) ‘Comparative biodiversity along a gradient of agricultural landscapes’. Delabie. 101–118.edu/EstimateS. 47–60. Nasutermitinae)’. A. Decaëns.... Formicidae. P. K. Morvan. S. pp. Y. J. P. (2004)‚‘Soil macrofauna communities in permanent pastures derived from tropical forest or savannas’. Ecosystems and Environment. 12. Tropical Soil Biology and Fertility Institute of CIAT. I. C.. Kenya. vol. R. D. J. 30. vol.0b1’. http://viceroy. CSM-BGBD (2005) Global workshop on ant and termite sampling and identification. J. Colwell. J. y Lefeuvre. K. C. R. G..

abundance and biomass of termites under differing levels of disturbance in the Mbalmayo Forest Reserve. Washington. pp. C. East Malaysia’.. 3. C. 489–498. Sands. y Maryati. vol. New Acanthodriline genera and species (Megascolecidae. (1994) ‘Earthworms from Southeastern Mexico. vol. pp. 87–276. y Bignell. E. Smithsonian Institution. Proceedings of the Californian Academy of Sciences. R. London. Haynes. 354. Eggleton. 77–88. N.. 27. V. G. P. Lawton. G. Bignell. Philosophical Transactions of the Royal Society of London. y Brown. Stork (eds) Insects in a Changing Environment. D. and its biological significance’. Bignell. Journal of Tropical Ecology.. D. pp. D. Ecotropica. Philosophical Transactions of the Royal Society of London.. pp. Eggleton. East Malaysia’. Eggleton. D. P. 6. Jeeva. R. Davies. E. 197–206. 1–128. C. (1994) ‘Effects of habitat fragmentation on Amazonian termite communities’. (2004) ‘Influence of agricultural land use on the size and composition of earthworm communities in northern KwaZulu-Natal. 111. E. Wood. South Africa’. y Rojas-Fernandez. Eisen. P. pp. Eggleton. T. 1–12. (1997) ‘The incidence of secondary occupation of epigeal termite (Isoptera) mounds by other termites in the Mbalmayo Forest Reserve. P.. E. Series B. pp. vol. H. 35. G. vol. D. vol. M acrofauna 135 . Eggleton. Bulletin of the British Museum (Natural History) Zoology. 1791–1802. (1900) ‘Researches in American Oligochaeta with especial reference to those of the Pacific Coast and adjacent islands’. 10. Mawdsley. J. D. (1979) ‘A revision of the ‘acaecate’ earthworms of the Pheretima group (Megascolecidae: Oligochaeta): Archipheretima. 51–68. DeSouza. vol. M. O. Southern Cameroon. F. y Bignell. 351. K.(eds) Measuring and Monitoring Biological Diversity: Standard Methods For Groundliving Ants. (1997) ‘The species richness and composition of termites (Isoptera) in primary and regenerating lowland dipterocarp forest in Sabah. Oligochaeta)’. A. forest disturbance and greenhouse gas fluxes in Sabah. M... 119–128. T. y Maryati. in R. vol. DC. A.. Southern Cameroon’. pp. pp. R. R. P.. Series B. Fragoso... T. Homathevi.. Metapheretima. Planapheretima. Jones. vol.. Homathevi. P.. (1999) ‘Termite assemblages. (1995) ‘Monitoring the response of tropical insects to changes in the environment: troubles with termites’. Easton. G. Jeeva. A. J. Pleinogaster and Polypheretima’.. Jones. MacDonald. Dlamini. D. W. (1996) ‘The diversity. Davies. Megadrilogica. pp. E. vol. Journal of African Zoology. y Bignell. N. F. 2. J. Academic Press. Applied Soil Ecology. Harrington and N.. G. E. R. D.

Filgueiras.. pp.. Keli. J. (1988) The Fauna of India and the Adjacent Countries. y Eggleton. E. W. J. C. D. soil biodiversity and agroecosystem function in the tropics: The role of earthworms’. P. pp. Transactions of the American Philosophical Society. in S. Ecosystems and Environment.. pp. H. Academic Press. Brussard and P. F. vol. Calcutta...-M. M. J. y Guillaume. R. E. Applied Soil Ecology. Pashanasi. P. Hendrix (eds) Earthworm Management in Tropical Agroecosystems. G. G. T.. Blackwell. E.. Susilo. 40. Oxford. International Trust for Zoological Nomenclature.. M.. A. Gay. (2003) ‘Termite assemblage collapses along a land-use intensification gradient in lowland central Sumatra... J. Kouassi. South Africa’. structure and influence of management pratices’. McNeill. CAB International. H. 191–203. H. S. E. T. P. H. F. L. Julka. P. Haynes. C. T. T. Jones.. T. Agriculture.. Koeltz Scientific Books. 196. C. 186–189. Suryo.. J. pp. W. 4th edition. J. J. Blanchart.. vol. y Eggleton. vol. Demoulin. pp. Gilot. Gillison. B. C. 380–391. (2005) ‘Methods for sampling termites’. R. Weesner (eds) Biology of Termites. (2000) ‘Sampling termite assemblages in tropical forests: Testing a rapid biodiversity assessment protocol’.. P. T. New York. Silva. y Eggleton. D. Decaëns. 95. D. London. Jones... P. K. Zoological Survey of India. Fragoso. Gates. J. (2003) ‘Effect of agricultural land use on soil organic matter status and the composition of earthworm communities in KwaZuluNatal. Konigstein. J. (1999) ‘Earthworm communities of tropical agroecosystems: Origin. M. J. Leather (ed) Insect Sampling in Forest Ecosystems. Senapati... Wallingford. F. Megadrile Oligochaeta (Earthworms) Family Octochaetidae. (1995) ‘Biological activity of soil under rubber plantation in Côte d’Ivoire’. P. (2000) International Code of Botanical Nomenclature (St Louis Code). Jones. y Hawksworth. (1972) ‘Burmese earthworms. B. V. Patron.. G.. Journal of Applied Ecology. Bignell. Indonesia’. Krishna and F. Dominy. Turland N. Acta Zoologica Fenica. vol. vol. 62. Lavelle. Skog. Martinez. Verkerk.. Greuter. R. Lavelle. Senapati. Burdet.. (1997) ‘Agricultural intensification. C... D. A. J. Journal of Applied Ecology. B. vol. E. pp.. 136 Manual de biología de suelos tropicales . F. Brown. y Tondoh.. G. P. 453–464 International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature.. Nicolson. 17–35. S. L. Blanchart... Lavelle. C. in K. 37. y Calaby. in P. y Graham. M. J. Lavelle. D. E. (1970) ‘Termites of the Australian region’. Blanchart.-X. J.Fragoso. P. Trehane.. Barrie. y Kumar. E. D. 1–326. Jiménez.. H. 6. an introduction to the systematics and biology of Megadrile oligochaetes with special reference to South-East Asia’.

Mucchi. pp. 213–226. R. Lavelle. Lawton. pp. vol. D. P. Modena. (1971) ‘Sobre a familia Glossoscolecidae (Oligochaeta) no Brasil’. J. D. A. London. vol.. Lavelle. 485–607. (1997) ‘Soil function in a changing world: The role of the invertebrate ecosystem engineers’.. y Halffter. A.. P. (2001) ‘Spatial and temporal analysis of. Boulton. M. pp. O. Oxford. P. vol. Wolters. 20. Blackwell Science. Bignell. France. G. M. M acrofauna 137 . Mora. and diversities of bats in a fragmented landscape’. y Halffter.. pp. Moreno. P. M.. 72–76. Bloemers. 10. C. P.. G. Lavelle. vol. (2004) Measuring Biological Diversity. y Rouland-Lefèvre. J.Krebs. N. 40. J. Studies on Tropical Andean Ecosystems. 1–95. (1996) ‘The measurement of diversity in different types of biological collections’. C. M. E. D. V. Laboratoire de Zoologie. P. and Fragoso. E. G. E. H. 2nd edition. Grimaldi. A. pp. Lepage.. indicator taxa and effects of habitat modification in tropical forest’.. vol. J. C. Thèse de Doctorat. Biology and Fertility of Soils. pp. (1998) Ecological Methodology. in A. vol. (2000) ‘Assessing the completeness of bat biodiversity inventories using species accumulation curves’. P. pp. G. Pielou. Omodeo (eds) On Earthworms: Selected Symposia and Monographs. Bourlière (ed) Tropical Savannas... P. pp. Rossi. European Journal of Soil Biology. Moreno. I. E. Holt. vol. Stork. (1995) ‘Colombian earthworms’. y Dhillion. Bonvicini and P. in F. Roger. pp. Biology and Fertility of Soils.. (1983) ‘The soil fauna of tropical savannas. Journal of Applied Ecology. Mathieu. Righi. (1981) ‘Strategies de reproduction chez les vers de terre’. 117–133. E. C. 37. pp367–382 Ortiz-Ceballos. Hodda. S. Heal. 4. Lavelle.. D. Larsen. B. Mawdsley. 33. (1998) ‘Biodiversity inventories. Elsevier Publishing Company. Unione Zoologica Italiana 2.. N. populations et fonction dans l’écosystème’. E. Righi. 2. D.. 149–158. G. vol. Biodiversity and Conservation. Magurran... A. II The earthworms’. T. F. C. (2004) ‘A multi-scale study of soil macrofauna biodiversity in Amazonia pastures’. y Watt. E. M. Bignell. Srivastava. (2004) ‘Earthworm populations under tropical maize cultivation: The effect of mulching with velvet bean’. 438–445. Lavelle. vol. Arquivos de Zoologia.. 391. 39. Acta Oecologia – Oecologia Generalis. B. Eggleton. 13. Nature (Lond).. Lee.-P. Pearson Education.. Hammond. C.. P. (1978) ‘Les vers de terres de la savane de Lamto (Côte d’Ivoire): Peuplements. 300–305. Journal of Theoretical Biology. S. K. Ecole Normale Supérieure 12. (1987) ‘Peregrine species of earthworms’. Université Paris VI. vol. Amsterdam. 159–193.

Cambridge University Press. S. (1996) ‘A pilot analysis of gut contents in termites from the Mbalmayo Forest Reserve. Kikkawa and D. 103–124. y Robinson. R. A. Biological Journal of the Linnean Society. S. pp. V. Unione Zoologica Italiana 2. (1969) ‘Recherche sur le peuplement en Oligochète de la savane de Lamto (Côte d’Ivoire)’. A. Indonesia. 138 Manual de biología de suelos tropicales . Pattern and Process. P. 2nd edition. R. 39. in A.Sims. D. (1986) ‘Guilds and their utility in ecology’. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’.pdf. (1980) ‘A classification and the distribution of earthworms. Sleaford. Terborgh. Journal of Tropical Ecology. ASM Press. (2005) ‘Pitfall sampling in ecological studies’. P. J. Zicsi. D. y Lavelle. 33. (1978) Ecological Methods with Particular Reference to the Study of Insect Populations. Université Paris VI. Southwood. Herndon. E. France. M. G. selected symposia and monographs’. Cambridge. F. pp. 493–500. vol. Ecological Entomology.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. T. P. 4. Oxford. Blackwell. vol. Blackwell Science. R. J. in M. (2001) ‘Revision der Untergattung Martiodrilus (Maipure Righi. Bogor. G. M. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. 279–288. Bulletin of the British Museum (Natural History) Zoology. B. Regenwürmer aus Südamerika’. Thioulouse. 113–131. (1987) ‘A review of the Central African earthworm family Eudrilidae (Oligochaeta)’. Thèse de 3e cycle. Vincent. Opuscula Zoologica Budapest. Pagliani and P. 21. Brian (ed) Production Ecology of Ants and Termites. Sims. Tondoh. 7. Cameroon’. vol. R. (1978) ‘Food and feeding habits of termites’. VA. Dolédec. W. Bignell. in J. Mucchi. London. International Centre for Research in Agroforestry. Omodeo (eds) ‘On earthworms. (1997) ‘ADE: A multivariate analysis and graphical display software’. Modena. 75–83. pp. 21. J. suborder Lumbricina (Haplotaxida: Oligochaeta)’. vol. y Eggleton. A. pp.fao. T. E. (1972) ‘A numerical revision of the earthworm genus Pheretima auct. Woodcock. Swift. Eudrilidae) in Ivory Coast’. pp. pp. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition’. Sneath. Wood. Anderson (eds) Community Ecology. Oxford. y Olivier. R. Chessel. Sims.. W.. www. M. Statistics and Computing. P.. y Easton. D. vol. 1995) (Oligochaeta: Glossoscolecidae). Chapman and Hall. in S. 169–268. 1990 Revision. y Bignell. South East Asian Regional Research Programme. Leather (ed) Insect Sampling in Forest Ecosystems. vol. J. E.. H. E. ASB Lecture Note 6B. W. E. (1992) International Code of Nomenclature of Bacteria: Bacteriological Code.

95–130. vol. M acrofauna 139 . Berichte des Naturwissenschaftlicher-Medizinischer Vereins in Innsbruck. A. Regenwürmer aus Südamerika 39. (2005) ‘Über den heutigen Stand der Regenwurmfauna (Oligochaeta) Ekuadors mit einem Bestimmungsschlüssel der Glossoscoleciden-Arten’. 92.Zicsi. pp.

36. pp. P. (1992) ‘Termites of peninsular Malaysia’ en L. pero no cubre toda la diversidad de animales que se alimentan del suelo.E. 2003. Universidad Malasis Sabah. with descriptions of one new genus and new species and including a key to genera’ Journal of Natural History. de Asia. 35 pp. útil para Sumatra. 140 Manual de biología de suelos tropicales . Y. vol. XXVI. M. de fácil manejo. ‘Termites of Sabah’ Forest Record 12. (2 003). Kirton (ed) Malaysian Forest Records. protocolos de muestreo por región. Trabajo estándar. pp1-244. 30. Bien ilustrada clave de fácil identificación para los soldados. vol. dentro del clado Termes. N. Publicación clave para géneros de la región Neotropical. 1485-1506. (1984) Collins. 1-398. pp 95162. ‘Introducción a las hormigas de la región Neotropical’ Instituto de Investigaciones de Recursos Biológicos. 65-87. taxonomía y la importancia económica de las hormigas. Kepong. Y. (2003) Termitas del S. Tho. vol. escarabajos y hormigas. ‘The termites (Isoptera) of Gunung Mulu National Park with a key to the genera know from Sarawak’. Forest Research Institute of Malaysia.G. Clave moderna y de fácil interpretación. F. Fácil de usar. E.R. Claves de identificación de termitas.E. Región y autor Hormigas del S. Bogota. Hormigas Neotropicales Fernández. Borneo Java y Sulawesi. incluyendo Indonesia). Notas Clave de géneros de hormigas de Borneo (útil en el S. S. (1984). Bien ilustrada con sinopsis genérica. de Asia Thapa. de Asia Hashimoto. pp. 12-26 octubre. Colombia. Clave un poco obsoleta de géneros de termitas del Norte de Borneo. Alexander von Humboldt. Título y referencias ‘Manual for Bornean Ant (Formicidae) Identification’. ‘A review of the South-east Asian Nasutitermitinae (Isoptera Temitidae). pp. R. 1-374. Sarawak Museum Journal. Incluye una revisión de la biología ecología. Disponible y económica. y Homathevi. Gathorne-Hardy.Apéndice 1. (2001). F. Preparado por “Tools for Monitoring Soil Biodiversity in the ASEAN Region”.

W. (2003). Booth. Y. Lo que opera actualmente sobre esta subfamilia en África. Coleoptera. 2003. 1-374. Trabajo estándar. Hormathevi. 3. de fácil manejo. pp. (1965). (2003) Título y referencias ‘Manual for Bornean Termites (Isoptera)’ preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. M acrofauna 141 . Webb. 1–384. Thapa. London pp. Bien ilustrada. G. 36 p. Sabah Forest Record 12 pp. Octubre 2003. Adaptación de Chung. Ibadan University Press. ‘Manual for Bornean beetle (Coleoptera) family identification’. ‘A revision of the termite subfamily Nasutitermitinae (Isoptera. Clave bien ilustrada a nivel género de soldados.Apéndice 1. con muchas referencias que incorporan descripciones taxonómicas recientes. 2006. Clave moderna. R. Supplement 4. corta y bien ilustrada de familias con una sinopsis diagnóstica de más de 100 familias y casi 50 subfamilias. R. preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Sands W. Nigeria. (1990). y Madge R. A. Explicación detallada de la IIE Guides to insects of importance morfología y agrupaciones de to Man. (1981). The Natural History Museum. fácil de usar. (1959). Clave de géneros de imagos y soldados. 18-22 Septiembre. 2–38. pp. Termitidae) from the Ethiopian region’. ‘A review of the termites of the genus' Antitermes the Ethiopian region. R. Coleoptera. tanto para imagos como soldados. 1-28. C. Un poco anticuado. Claves hasta especies. 129-156 Keys to the Genera of the African Termites. 1–172. Región y autor Homathevi. Notas Clave inédita de géneros de termitas en el S. La autoridad estándar del momento para este genero. S. A. Continúa. L. CAB International). Universiti Malaysia Sabah. 12–26 Octubre 2003. Bulletin of the British Museum (Natural History).. C.E. de Asia. curation and data management. incluyendo Indonesia. Universiti Malaysia Sabah. (1961). pp.Cox. M. Termitas africanas Sands. Training course on Arthropod preservation. (2006). Escarabajos de Asia Chung. 12–26. “Termites of Sabah”. A. B. G. vol 8. pp. International Institute of Entomology (and Institute of escarabajos. Bulletin of the British Museum (Natural History). Universiti Malasia Sabah. Escarabajos en general. R.

W. R. pero recomendada para formarse. Clave hasta género para soldados y muchos géneros ilustrados de manera detallada a nivel de especies (en francés). 365–444. A. ‘Taxonomy and phylogeny of termites’. Kluwer Academic Publishers. Incluye una sinopsis de familias y subfamilias en forma de clave con notas e identifica caracteres diagnósticos. Zootaxa. “The Identification of Worker Castes of Termite Genera from Soils of Africa and the Middle East”. de difícil manejo. S. Sociality. vol 67. Ruelle. obreros y soldados. 1–40. pp. y Eggleton P. más 32 referencias. Clave corta. Termites. anticuada. en: T. E. Región y autor Bouillon. pp. (1971). no muy útil como clave. Abe. Clave completa muy ilustrada y detallada. pero útil para confirmaciones. CAB International. incluye detalles del enrollamiento del intestino y de cómo está conformada la válvula entérica para identificar algunas Apicotermitinae. London. muy útil para termitas subterráneas crípticas. pp 1–23. Lo que opera actualmente este género. Harris W. J. (2002). soldados mayores y soldados menores. Título y referencias Quel est ce termite Africain? Zooleo. (1998). ‘Report on a survey of the termites of Zimbabwe’. Mitchell B. 187–323. utilizando imagos. Kambhampati. G. Sands. especialmente Apicotermitinae y todas las que se alimentan del suelo. ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. 1–115. Occasional Papers of the National Museums of Rhodesia. A. Estudio comprensivo que incluye claves hasta géneros de soldados. únicamente para géneros principalmente en el contexto africano. Wallingford. (1980). Symbioses Ecology. Estudio prestigiado. 142 Manual de biología de suelos tropicales . L. (1966). vol. (1970) A revision of the termites of the genus Macrotermes from the Ethiopean (Isoptera: Termitidae) Bulletin of the British Museum (Natural History) Entomology vol. Longman. Natural Science 6. Termitas neotropicales Constantino. Notas Clave a nivel familia de imagos y soldados. 24. (2000). Their Recognition and Control. y Mathot. pp. E. 1. Series B. D. Higashi (eds) Termites: Evolution. pp..Apéndice 1. Bignell and M. 500 pp. Continúa. V. Clave de especies para imagos.

(2001). Chhotani. (2003). Guías para caracterización del sitio y anotaciones relacionadas con el muestreo de hormigas. (1983). C. ‘Taxonomy of Termites’. Listas de material requerido para un muestreo de hormigas con precios en $US del 2001. No publicado. vol. géneros y especies para imagos y soldados. utilizadas en taxonomía. India. Calcutta. UC Davis. (sin fecha). Sands W. Región y autor Claves inéditas de termitas y listas de comprobación Wanyoni. (J. incluye claves hasta familias y subfamilias. imagos y soldados. ‘Equipment specifications’ Department of Entomology. pero sí un listado Checklist of the Species of Termites que identifica la distribución entre (Isoptera) Recorded from East Africa. subfamilias. Título y referencias Notas No es una clave. Bibliografía completa. The Fauna of India and Adjacent Countries: Isoptera (Termites). Zoological Survey of India. Clave detallada y de fácil manejo A Key to the Genera of the Termitinae by the Soldier Caste. Kenia. 672 pp. (1989). miento avanzado. O. No publicado. (sin fecha). Continúa. Ward. B. Centre for Overseas para géneros de África del Oeste y Central. Department of Entomology. Documentos variados Roowal. M acrofauna 143 . Darlington. II. L. Harvard University.Apéndice 1. vol. y Williams. C. Entomology department. y Chhotani.Uganda. B. K. C. ed) International Centre of Insect Physiology and Ecology. Tanzania y Zanzibar. I. B. incluyenCountries: Isoptera (Termites). E. (1997). Los volúmenes I y II cubren todo el The Fauna of India and Adjacent subcontinente de la India. Williams R. eje de muchas claves privadas de museos nacionales. Excelente para entrenaPest Research. Harvard University. S. R. P. 'Guidelines for data collection for ants’. (Family Termitidae) Zoological survey of do Sri Lanka. Centre for Overseas Pest Research. Los volúmenes I y II contienen claves hasta familias. Documento de base. M. 801 pp. A. B. reporte detallado con definiciones de características morfológicas. Sinopsis ilustrada de subfamilias y su distribución. (2001). M. 'Ant subfamilies’. P. con una amplia bibliografía. Fisher. O. M. Calcutta. Fisher.

Apéndice 1. Título y referencias ‘Tools for the Rapid Assessment of Soil Invertebrate Biodiversity in the ASEAN Region’. termitas. lectura obligatoria. pp. lombrices de tierra diplópodos. Región y autor Jones. Completo. No publicado. escarabajos del suelo. Continúa. T. 1–39. Isópteros y arañas (Araneae). (ed) 2003. prepared for ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Harvard University Entomology. 2003. Bibliografía amplia y actual. Notas Revisión moderna y completa de la naturaleza de la biodiversidad del suelo y métodos de evaluación rápidos para hormigas. “Glossary of morphological characters used in ant taxonomy”. (Anónimos. 12–26 October. pero sin ilustraciones. Department of Entomology. sin fecha). D. Harvard University 144 Manual de biología de suelos tropicales . Universiti Malaysia Sabah.

Revisión y claves. Revisión de mapas de distribución de especies del Nuevo Mundo con clave de soldados y alados. Nasutitermes Parvitermes Procornitermes Holmgren (1910). Revisión y claves (anticuado). Scheffrahn and Krecek (1993). Género KALOTERMITIDAE Cryptotermes Eucryptotermes Procryptotermes Bacchus (1987) Scheffrahn y Krecek (1999). Araujo (1954). Neocapritermes Parvitermes Krishna y Araujo (1968). Constantino (2001). M acrofauna 145 . Claves de soldados de especies de Las Antillas (anticuado). Clave de soldados. Revisión de Labiotermes sensu stricto. Clave de soldados. con claves. Revisión y claves de soldados (en portugués). Scheffrahn y Krecek. Las claves hasta género son dadas en Krishna (1961. Clave de soldados de Paracomitermes (anticuado).Apéndice 2. Clave de soldados de América del Sur. Revisión y claves. Revisión y claves. Emerson (1952). Revisión y claves (anticuado y en alemán). Emerson (1952). Fontes (1985). Clave de soldados. Revisión y claves. Revisión mundial con revisión de claves de las especies antillanas con claves hasta la diagnosis de los soldados. Constantino (1997). Claves de soldados de especies de Las Antillas (anticuado). Referencia Contenido RHINOTERMITIDAE Heterotermes TERMITIDAE Amitermes Anoplotermes Atlantitermes Cornitermes Cyranotermes Cyrilliotermes Labiotermes Light (1932). Clave de alados (anticuado). Scheffrahn y Krecek (2001). Mill (1983) y Constantino (1999. únicamente Kalotermitidae). 2002). Emerson y Banks (1965). Constantino et al. Constantino (1990). Cancello (1986). Constantino y DeSouza (1997). (2006). Snyder (1926). Trabajos taxonómicos con claves de especies de algunos géneros neotropicales.

Claves de soldados (anticuado). 146 Manual de biología de suelos tropicales . Fontes y Bandeira (1979). Constantino (1995). Rhynchotermes Rotunditermes Syntermes Fontes (1985). Revisión y claves de soldados (en portugués). Contenido Revisión y claves. Revisión y claves. Claves de soldados. Continúa. Revisión y claves (anticuado). Género Procornitermes Referencia Emerson (1952).Apéndice 2. Emerson (1945) . Cancello (1986).

vol. R. Bulletin of the American Museum of Natural History. 55. E.. Goeldiana Zoologi. A. 1–40. 1. pp. 30.Apéndice 3. y DeSouza. distribution and ecology (Isoptera. pp. Termitidae)’. 427–472. vol. pp. (1952) ‘The Neotropical genera Procornitermes and Cornitermes (Isoptera. E. Constantino. Insect Systematics and Evolution. Literatura especializada en termitas neotropicales Araujo. (1987) ‘A taxonomic and biometric study of the genus Cryptotermes (Isoptera: Kalotermitidae)’. Bulletin of the American Museum of Natural History. Constantino. R. 475– 540. vol. pp. vol. (1990) ‘Notes on Cyranotermes Araujo with description of a new species (Isoptera. pp.. (1954) ‘Notes on the genus Paracornitermes Emerson 1949 with description of two new species (Isoptera. O. R. 99. Papéis Avulsos de Zoologia (São Paulo). 7. (1965) ‘The Neotropical genus Labiotermes (Holmgren): Its phylogeny. Bacchus. 189–236. pp. Emerson. 1–44. Constantino. (1986) ‘Revisão de Procornitermes Emerson (Isoptera. M. A. Revista Brasileira de Entomologi. C. pp. 2. K. Zootaxa. Constantino. (2002) ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. y Vasconcellos. S. (1945) ‘The Neotropical genus Syntermes (Isoptera: Termitidae)’. A. A. F. 1–33. Tropical Pest Bulletin. R. (2001) ‘Key to the soldiers of South American Heterotermes with a new species from Brazil (Isoptera: Rhinotermitidae)’. 181–189. Sociobiology. L. H. M acrofauna 147 . Cancello. Tropical Zoology. y Banks. Nasutitermitinae)’. Termitidae. 125–131. N. F. 83. Nasutitermitinae)’. 36. Constantino. Carvalho. (1995) ‘Revision of the Neotropical termite genus Syntermes Holmgren (Isoptera: Termitidae)’. vol. vol. F.. Cuezzo. Schmidt. 463–472. vol. pp. (2006) ‘A taxonomic revision of the Neotropical termite genera Labiotermes Holmgren and Paracornitermes Emerson (Isoptera: Termitidae: Nasutitermitinae)’.. paper 67. (1997) ‘Key to the soldiers of Atlantitermes Fontes 1979. R. 10. Termitidae. R. 455–518. A. Emerson. Emerson. American Museum Novitates. University of Kansas Science Bulletin. 1–11. A. with a new species from Brazil (Isoptera: Termitidae: Nasutitermitinae)’. 1–91. S. vol. 205–213. Nasutitermitinae)’. E. paper 1340. E. Termitidae. R. vol. pp. vol. (1997) ‘Notes on Eucryptotermes with a new species from central Amazonia (Isoptera: Kalotermitidae)’. Acioli. Constantino. pp. 31. Zootaxa. Termitidae. Constantino. R. pp. no 2208. pp. pp. Nasutitermitinae)’. A.

Mill. E. vol. Scheffrahn. Scheffrahn. G. pp. H. (1985) ‘New genera and new species of Nasutitermitinae from the Neotropical region (Isoptera. K. 68. 603–607. pp. H. 94. R. (1968) ‘A revision of the Neotropical genus Neocapritermes (Isoptera. J. a new subterranean termite (Isoptera: Termitidae) from Cuba and the Dominican Republic’. 122. 530–539. 9. Bulletin of the American Museum of Natural History. E. (1910) ‘Versuch einer Monographie der amerikanische Eutermes – Arten’. vol. 179–190. 303–408. (1932) ‘Contribution toward a revision of the American species of Amitermes Silvestri’. Snyder. Light. J. Holmgren. Bulletin of the American Museum of Natural History. Revista Brasileira de Entomologia. 171–325. vol. Termitidae)’. pp. 13. 107–110. H. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten. y Araujo. 27. Proceedings of the US National Museum. y Bandeira. 5. vol. R. pp. 84–138. N. A. pp. pp. R. vol. L. (1979) ‘Redescription and comments on the Neotropical genus Rotunditermes (Isoptera. Systematic Entomology. y Krecek. Nasutitermitinae)’. Nasutitermitinae)’. (1926) ‘Termites collected on the Mulford Biological Exploration to the Amazon Basin 1921–1922’. Krishna. (1999) ‘Termites of the genus Cryptotermes Banks (Isoptera: Kalotermitidae) from the West Indies’. (1993) ‘Parvitermes subtilis. vol. 148 Manual de biología de suelos tropicales . Krishna. Annals of the Entomological Society of America. 7–25. (2001) ‘New world revision of the termite genus Procryptotermes (Isoptera : Kalotermitidae)’. pp. S. vol. 335–414. J. R. R. A.Fontes. Fontes. (1961) ‘A generic revision and phylogenetic study of the family Kalotermitidae (Isoptera)’. Scheffrahn. vol. vol. 1–76. vol. 138. Revista Brasileira de Zoologia. 111–171. K. T. 76. pp. University of California Publications in Entomology. L. Termitidae. vol. L. pp. 3. Insecta Mundi. R. y Krecek. pp. Florida Entomologist. F. pp. y Krecek. 23. Termitidae. (1983) ‘Generic keys to the soldier caste of New World Termitidae (Isoptera: Insecta)’.

149 . y se complementan con pitfall. Francis-X. mientras las trampas pitfall se utilizan para colectar los que habitan en la superficie del suelo. bien por el método Berlese-Tullgren o por el de Berlese modificado. sirven para colectar mesofauna que habita en el suelo mineral. en principio. sin embargo. acari y otra mesofauna del suelo: el método Berlese Agus Karyanto. por debajo de la hojarasca de la superficie y en la hojarasca en sí. En cada punto de muestreo. localizadas a por lo menos 14 m del centro del monolito.2 y 2. descrito en el Capítulo 2. Pauropoda y otros Nematodos son típicos representantes de la mesofauna. El muestreo de la mesofauna (y otra biota del suelo) se encuentra integrado como parte de la estrategia global del inventario de la biodiversidad bajo del suelo.0 mm. Los núcleos de suelo. Collembola (colémbolos). los núcleos de suelo se localizan en dos círculos concéntricos. La mesofauna se colecta utilizando dos métodos de muestreo: a) una muestra compuesta que contiene varios núcleos de suelo y hojarasca extraída de la superficie. a 3 m y 6 m de radio del monolito. b) del contenido líquido de las trampas pitfall. respectivamente. Susilo y Jose Wellington de Morais INTRODUCCIÓN La mesofauna está conformada por animales cuyo tamaño de cuerpo oscila entre 0. Elizabeth Franklin. formas de larvas de especies de macrofauna también caen dentro del rango de tamaño de mesofauna. y cuya abundancia no puede ser evaluada con exactitud por medio de la selección manual del suelo. Enchytraeidae. Cahyo Rahmadi.Capítulo 4 Collembola. Acari (ácaros). Protura.

) es suficientemente eficaz como para poder capturar colémbolos que viven en la superficie del suelo (edáficos). constituyen un componente integral de la estructura del suelo. a su vez. por ejemplo. asimismo. y algunos son predadores. después de muertos. son sedentarios (con la excepción de algunas familias como Galumnidae y Scheloribatidae). 1990). forrajean en hongos y algas. con una diversidad de especies también muy alta y. En 1918. en suelos no perturbados. fue desarrollado por Antonio Berlese. se pueden encontrar entre 50 y 100 especies (Norton. Debido a su papel regulador en la descomposición y el reciclaje de nutrientes. su abundancia. Lo anterior es aplicable para los grupos mayores de microartrópodos del suelo o a partir de las proporciones de abundancia y diversidad entre los grupos de mesofauna del suelo. Estos ácaros se alimentan de materia de plantas vivas o muertas y de carroña. se convierten en un importante desecho nitrogenado. 2004). su densidad puede alcanzar cientos de miles de individuos por m². al igual que en la formación de la estructura de suelo. Los ácaros oribátidos (también conocidos como Cryptstigmata a los que se refieren como ácaros escarabajos o ácaros de caja) son artrópodos numéricamente dominantes en los horizontes orgánicos de la mayoría de los suelos. de manera que la muestra se seca lentamente. a finales del siglo XIX. se alimentan de nematodos vivos (Siepel. En este sistema circula agua caliente entre las paredes dobles de latón del embudo (o embudos). El método pitfall (Capítulo 3. en contraste con los grupos más oportunistas como los colémbolos. Tullgren modificó el método Berlese.El método Berlese es un sistema de extracción por embudo para separar los pequeños artrópodos del suelo. reemplazando la envoltura de agua por un foco de luz eléctrica. MÉTODOS DE MUESTREO Los protocolos aquí descritos abordan principalmente los de los ácaros y colémbolos presentes en los horizontes minerales y en la hojarasca. 1990). composición de especies y diversidad en un hábitat específico son buenos indicadores de un suelo “sano” (Minor. El principio es colectar pequeños núcleos o bloques y combinarlos para hacer una sola muestra compues150 Manual de biología de suelos tropicales . Sus heces fecales proporcionan una amplia superficie para la descomposición primaria por hongos y bacterias y. no resulta útil para colectar ácaros oribátidos (Acari: Oribatida) porque estos animales. sin embargo. Se sugiere que para un muestreo normal ambas extracciones de embudo y pitfall deben emplearse de manera conjunta. normalmente.

Las muestras de suelo. Se ha observado que los costales de tela son muy eficientes para almacenar temporalmente y transportar las muestras durante largas distancias y tiempos. y toma muestras a una profundidad de hasta 5cm que posteriormente se transfieren a un recipiente de plástico de 300 ml de volumen (Figuras 4. tanto la luz solar como el calor del motor. son dañinos para los animales que se encuentran en la muestra. acari y otra mesofauna del suelo 151 . De manera alternativa. porque si éstas se mojan o humedecen demasiado. C ollembola .ta. el suelo de 12 sub-muestras se coloca entonces en una bolsa de 5 kg como una muestra compuesta. Ahora las muestras estarán listas para su traslado al laboratorio. se colocan todos los costales de tela bajo techo. la fauna también puede morir. para ello es recomendable utilizar un vehículo con aire acondicionado.5 x 3. se debe evitar que la muestra se exponga a sol directo durante el encostalado en el campo. Enseguida se empacan las muestras en una caja de cartón. utilizando una pequeña cuchara que tome un volumen constante de aproximadamente 100 ml. se colectan en el campo.5 cm de ancho y 10 cm de alto. De la misma manera. De manera alternativa. utilizando un sacabocados. se etiquetan y se transfieren a un costal de tela de 30 x 35 cm de tamaño.1a y b). No se debe usar un costal de plástico porque la temperatura del suelo puede aumentar sustancialmente.5 x 5 cm de profundidad. porque la tela permite que circule el aire. de acuerdo con su localidad de muestreo. la cual es entonces sub-muestreada por extracción por el método de BerleseTullgren. Así. con o sin hojarasca. Una vez en el laboratorio. se utilizan tres o cuatro muestras compuestas y no sólo una. con un promedio de un kilo por bolsa. Este aparato mide 3. lo que provocaría la muerte de la mesofauna antes de su extracción. donde serán identificadas. Dichas muestras deben permanecer alejadas del calor del motor del vehículo y de su sistema de escape. el suelo deberá someterse de inmediato a su extracción. las muestras del suelo pueden ser colectadas en muestras de 3. ésta deberá situarse en el asiento del pasajero. para evitar que la mesofauna muera. Si se transporta la muestra sin aire acondicionado. también se deben proteger de la lluvia durante el traslado. con una capa de papel para mantener un ambiente de humedad estable dentro de la caja. evitando que la temperatura se eleve.5 x 3. El siguiente paso es almacenar las muestras en cajas grandes para transportarlas hasta el laboratorio. Al llegar al campo de base o laboratorio. La muestra compuesta de suelo se divide en 10 bolsas de nylon.

W. dividido en compartimentos superiores e inferiores. Se coloca un tamiz (de 8 cm de diámetro y 5 cm de altura) con muestras de suelo y hojarascas encima del embudo. de 1. utilizando para ello focos eléctricos (los de 25 W son ideales). b) se utilizan guantes como precaución contra enredaderas. A B EXTRACCIÓN Método Berlese-Tullgren El aparato Berlese-Tullgren (Figura 4. cada compartimento contará con un marco para sostener los embudos de plástico (Figura 4. La manera ideal es utilizar un contenedor de madera de alrededor de 160 x 50 cm.Figura 4. utilizando una pequeña cuchara o cuchillo de campo. hormigas. se mantiene el aparato en el laboratorio del campo de base. deberá contener cuatro agujeros de 4 mm de diámetro para permitir que animales mayores escapen hacia abajo. arañas y otros artrópodos. dejando los focos encendidos cada vez 152 Manual de biología de suelos tropicales . Se calientan ligeramente los embudos. se debe incrementar el calentamiento de manera gradual cada día.2 a) al igual que puertas.5 mm. Cortesía de: J. Franklin. éstos se suspenderán a 14 cm por encima del tamiz. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado.1 Sacabocados de metal para muestrear la mesofauna en la hojarasca y en el suelo mineral.2) es utilizado para extraer la mesofauna activa que habita en las muestras de suelo y en la hojarasca. para evitar que otros insectos voladores pasen a formar parte de la muestra. El tamaño de malla del tamiz. cerca del área de referencia. Morais y E. aunque también se podrían usar los de 40 W.

Franklin. Las muestras se quedan en el aparato hasta que estén completamente secas. por un periodo de hasta 8 días. Figura 4. de modo que los animales que caen por la malla lo hagan de manera rápida hasta llegar a la botella que los recibe. Cortesía de: J. si se dejan durante más tiempo nacen los C ollembola . el embudo deberá presentar una superficie lisa y una fuerte pendiente. en una botella que los recibe hasta la base del embudo. evitando así que las especies que se mueven con mayor lentitud queden atrapadas en las capas secas y duras del suelo.durante mayor tiempo. b) sistema Berlese–Tullgren en operación. Se ajusta la posición de la lámpara para asegurar que la temperatura del suelo suba gradualmente. es decir. la temperatura de la muestra se aumenta gradualmente de 27°C hasta aproximadamente 40-45°C. por lo tanto. para una mayor efectividad. Morais y E. para evitar que el material de la muestra se seque demasiado rápido. Nota: nótese que las patas están sumergidas en agua para evitar la invasión de hormigas y de otros insectos. acari y otra mesofauna del suelo 153 . Típicamente. esto inmovilizará a la mesofauna antes de que se escape. El principio básico del aparato Berlese-Tullgren es que los organismos de suelo responden al incremento de temperatura o sequedad en el suelo migrando hacia abajo hasta que finalmente caen a través de la malla. la cual contiene un conservador.W.2 a) contenedor de apoyo para embudos Berlese–Tullgren. hasta que mantengan un peso seco constante que generalmente tarda unos 8 días.

dependiendo de las condiciones de humedad inicial del suelo.3. por lo que las muestras serán menos representativas. El aparato Berlese sensu stricto puede transformarse en un modelo Berlese-Tullgren. En la presencia de luz. el tiempo de espera será de 7 a 14 días. generalmente. 154 Manual de biología de suelos tropicales . un embudo de aluminio modificado de Berlese. cuando se compara con otros métodos de muestreo. A pesar de una eficiencia menor. es uno de los más usuales para la extracción en la evaluación de la diversidad y densidad de microartrópodos del suelo (André et al. en este caso. pueden moverse con facilidad desde el lugar del muestreo y ser ajustados para acomodar un gran número de muestras. El método Berlese modificado Cuando no se cuenta con electricidad. Son baratos y sencillos. con la colocación de una bombilla de 10 a 40W. Como líquido conservador. el de Berlese. 2002). aun en regiones remotas (Frankin y Morais. lo único que se requiere es un embudo más grande y un tiempo de secado más largo.. que se muestra en la figura 4. se utiliza formol al 4% o etanol. Un sistema Berlese que opera sin luz muchas veces permite una mejor extracción. el embudo se coloca sin luz y el proceso de calentamiento-secado se lleva a cabo simplemente a temperatura ambiente. es el adecuado para el secado sin electricidad. el tiempo de incubación (tiempo necesario para extraer la fauna del suelo) es aproximadamente de 4 a 5 días. el sistema Berlese-Tullgren y. éste se cerrará con una tapa para prevenir la entrada de otros insectos. en cierta manera. El envase receptor se llena con etanol al 96% para su conservación y durante intervalos de 4 a 5 días se cambia el envase receptor.huevos y las formas inmaduras se vuelven adultos. al 96%. El uso de un foco puede atraer insectos nocturnos. especialmente si el embudo Berlese no está perfectamente cerrado. arriba de las muestras de suelo. 2006). en donde se coloca un tamiz con una malla de 2 x 2 mm (malla 13).5). el equipo completo requerido es barato y puede ser fácilmente improvisado (Figura 4. el agujero de ventilación de la tapa deberá cerrarse durante la noche. Una ventaja de dichos sistemas es que se pueden operar a diferentes escalas. Para evitar lo anterior. aunque tomará más tiempo. al tiempo que utilizan el mismo principio para extraer un solo núcleo o una muestra conglomerada mayor. Asimismo.

Figura 4. PROCESOS DE ACLARADO Y MONTAJE DE ESPECÍMENES Para su identificación. Suhardjono LIPI Bogor. Fuente: cortesía del Dr.4 Embudo Berlese modificado. con embudo superior de 40 cm de diámetro. hecho de aluminio. de 50cm de altura. El proceso de montaje debe realizarse bajo un microsC ollembola . acari y otra mesofauna del suelo 155 . después de su aclarado. R. Y.3 Embudos Berlese llenos de suelo y hojarasca. Figura 4. los especímenes de mesofauna son montados sobre laminillas.

mediante el lavado y removido de las grasas y pigmentos del cuerpo. Proceso de aclarado El aclarado consiste en volver más transparente el tejido de los especímenes. este método es más barato. Un método más simple de aclarado es utilizando ácido láctico.Figura 4. se transfieren los especímenes a una solución de cloral fenol. Para ello. Los especímenes pueden ser aclarados con un 15% de KOH. la observación de la morfología. Después de la inmersión en KOH. fácil y seguro. con o sin calentamiento. durante dos a cinco minutos. 2008). como algu156 Manual de biología de suelos tropicales . Cortesía de: M. hasta neutralizar la reacción. durante unos minutos... normalmente. en donde se sumergen y calientan durante los diferentes periodos de tiempo. y da buenos resultados (Greenslade et al. Coelho.R. dependiendo del pigmento y de la grasa del cuerpo del animal. normalmente se usa una solución de Nesbitt (su composición se describe a continuación). Los taxa con cutículas delicadas. (2008) propusieron una solución de KOH 10% durante 1 a 5 minutos. requiere de un microscopio compuesto. dependiendo del tamaño. aunque Greenslade et al. aunque el hidróxido de potasio (KOH) y el ácido láctico son alternativas efectivas. copio de disección.5 Equipo básico requerido para llevar a cabo extracciones Berlese-Tullgren núcleo por núcleo.

Algunos grupos necesitan ser disecados o disectados antes del montaje. muchos ácaros oribátidos se guardan en viales etiquetados. Symphypleona y Neelipleona. la posición indicada es látero-lateral.. tales como cabeza.1). tubo ventral y en los segmentos V y VI abdominales. estos especímenes deberán sumergirse en una mezcla de 50% de ácido láctico/etanol durante unas horas. Para un almacenaje permanente. Los ácaros también pueden aclararse y conservarse trasladándolos del alcohol a un medio de Hoyer. como característica clave. también pueden usarse para el proceso de montaje (Tabla 4. En el caso de especímenes mutilados. Para dicho montaje se requiere de una solución Berlese. para que puedan ser bien identificados. mientras que las partes del cuerpo de los Symphypleona grandes se montarán de la siguiente manera: cabeza (dorsoventral). siete días. con alcohol 70%. Las especímenes son montados en laminillas y secadas en el horno a 70°C durante. Después de su identificación. en el C ollembola . los colémbolos Poduromorpha se deben colocar en posición dorso-ventral. acari y otra mesofauna del suelo 157 . por lo menos. cristales de fenol y agua destilada. sin calentamiento.nos Diplura. patas. abdomen grande (látero-lateral). los especímenes pueden destruirse o desarticularse. al que se añade un 5% de glicerina. En cada caso se debe regular y controlar el tiempo. 2008). si no se hace. con el propósito de identificarlos viendo la quetotaxia de cada parte. es aconsejable montar todas las partes del cuerpo en una sola preparación. Normalmente. De nuevo. se recomienda la disección en el caso de Symphypleona y de las Paronellidae y Entomobrydae mayores (6 a 8mm). abdomen pequeño y fúrcula (dorsoventral). Los ácaros esclerotizados pueden ser aclarados con lactofenol (compuesto por ácido láctico. mientras que para los Entromobrymorpha. Protura y Pauropoda no deben meterse en una solución concentrada de ácido. en proporciones 50:25:25) o simplemente con ácido láctico (frío o caliente). La posición de los especímenes sobre el portaobjetos difiere entre los órdenes: por ejemplo. el medio líquido Hoyer. por ejemplo. La disección se realiza en varias partes del cuerpo. porque el ácido láctico continúa aclarándolos y ablandándolos. Las partes diseccionadas del cuerpo de los Entromobrymorpha deberán colocarse de forma dorso-ventral sobre el portaobjetos. Montaje No existen métodos totalmente satisfactorios para el montaje (Greenslade et al. utilizando el ejemplo de los colémbolos. Otras soluciones. los especímenes deben transferirse a otro medio. fúrcula.

tales como los de Bachelier (1978) y Dindal (1990).1 Composición química para aclarar y montar especímenes.nz/key. hacia el borde de la depresión. ofrecen una buena discusión de fondo acerca de cómo aclarar y montar ácaros. El espécimen se traslada a unas gotas de ácido láctico o glicerina en un portaobjetos excavado. 10 g de glucosa y 5 ml de ácido acético glacial. se hace un montaje temporal. de donde se pueden obtener guías de ayuda para la identificación. Krantz (1978) y Norton (1990).ncsu. El espécimen puede rodarse suavemente hasta conseguir la orientación deseada.php. sin embargo. 50 ml de agua destilada. resulta difícil.massey. la pericia taxonómica quizás sea el factor determinante en la selección de una taxa para su estudio posterior. una identificación más allá de este nivel. Trave (1965). 200 g de hidrato de cloro y 20ml de glicerina. Se coloca de manera parcial un cubreobjetos sobre la depresión y se empuja el espécimen por debajo del recubrimiento. Por ejemplo. www. 40 g de hidrato de cloro y 2. Tabla 4. en el caso de la mayoría de los grupos de artrópodos de suelo.htm o http://soilbugs.5 ml de ácido hidroclórico 20 ml de agua destilada.cals. Para aclarar especimenes solución Nesbitt’s 10% KOH ó NaOH Montaje de especimenes : medio líquido de Berlese 25 ml de agua destilada. Montaje de especimenes: medio líquido de Hoyer Nota: montaje Berlese: calentar a 70°C durante 7 días. 50 g de hidrato de cloro. El medio líquido de Hoyer es un agente temporal y no se endurece con calentamiento. A nivel de especies. 5 ml de glicerina.ac. esta última dirección también concentra la literatura principal. donde se indican las características distintivas de varios grupos de invertebrados. 158 Manual de biología de suelos tropicales . 30 g de goma arábiga. 15 g de goma arábiga. aunque también se puede usar para otros grupos de mesofauna. Se encuentran disponibles varias páginas en la web. pero las preparaciones pueden hacerse semipermanentes sellando el recubrimiento con barniz de uñas transparente.edu/course/ent591k/kwikey1.caso de ácaros de suelo. IDENTIFICACIÓN DE ESPECÍMENES Y ANÁLISIS DE DATOS Identificación La mayoría de los invertebrados del suelo pueden identificarse hasta orden o familia con la ayuda de trabajos estándares de referencia.

Enchytraeidae. Symphyla. algunas veces. una vez conocida su morfología y características básicas (Crossley y Coleman. son escasas las guías específicas para este grupo en los trópicos. Chilopoda.1982b y 1983) pueden utilizarse para identificar colémbolos a nivel especies. están disponibles en Kranz (1978) y Dindal (1990). son combinadas para crear una muestra compuesta que se somete a extracción. Bachelier (1978) ofrece buena información de fondo dentro de las amplias unidades taxonómicas de artrópodos del suelo e incluye guías ilustradas para varios grupos. se encuentra disponible en Greenslade et al. Coleoptera. por lo menos. Desafortunadamente. ya que contiene guías de identificación ilustradas. Collembola. la identificación a nivel género y/o especies. Balogh y Balogh (1990) ofrecen una breve caracterización y claves de identificación para ácaros oribátidos que habitan en la región neotropical. Balogh y Mahunka (1983) y Balogh y Balogh (1992). 1981b. C ollembola . 2008. Asimismo. El libro contiene claves de identificación para todas las clases. Balogh (1972). Publicaciones de Yoshii (1981a. al igual que referencias de la taxonomía actual de estos grupos. Adis (2002) ofrece guías ilustradas para principiantes y cualquier persona interesada en Arachnida y Myriapoda Neurotropicales. a nivel familia. 1999).. Diptera y Hymenoptera. Isóptera. Las muestras colectadas. Araneae.permitiendo así. Los subórdenes de ácaros y muchas familias de colémbolos son de fácil identificación. Un estudio completo de la biología. órdenes. acari y otra mesofauna del suelo 159 . Los recursos para la identificación de ácaros. la identificación de colémbolos. El libro se escribió para un fácil manejo. Pauropoda. La base de identificación y clasificación se encuentra resumida en las referencias que se citan a continuación. Diplura. hasta nivel de familia y. Protura. a nivel genérico. taxonomía y ecología de grupos de la biota del suelo. familias. es mostrado en Dindal (1999). utilizando pequeños núcleos o bloques. es utilizado para estimar su abundancia. en las familias Entomobryidae y Paronellidae. Mites. quienes ofrecen guías y figuras a nivel genérico para ácaros que pertenecen a la suborden Oribatida. Isopoda. Opiliones. por ejemplo. de especies para algunos grupos como Nematoda. algunos géneros y listas de especies terrestres conocidas. Análisis de datos El número de individuos en cada orden y en cada lugar. al igual que una lista de comprobación y bibliografía de especies descritas en esta área. Scorpiones. por lo que es recomendable tanto para principiantes como para profesionales. 1982a. Pseudoscorpionida.

utilizando el método Berlese-Tullgren. Paris. 2005. M. Sofia-Moscow. Este procedimiento mejora la eficiencia de la extracción porque maximiza las posibilidades de captura de grupos o especies representativos.. (2002) Amazonian Arachnida and Myriapoda. H. no 38. Pensoft. 96. o bien. un nuevo estimador estadístico que toma en cuenta especies compartidas no detectadas. ORSTOM. Bachelier. 2003). también pueden detectar los efectos de la perturbación con poca pérdida de información y llegar a ser una herramienta preliminar para describir patrones y sucesiones en ecosistemas del suelo perturbado por humanos (Caruso y Migliorini. G. 2006). vol. 1988). X. pp. basada en la correspondencia estadística entre combinaciones de singletons y de otras especies raras (estimador de abundancia Chao-SØrensen) fue desarrollada por Chao et al. J. por lo tanto. y Lebrun. REFERENCIAS Adis. Este índice resulta especialmente útil para eliminar invertebrados hiper-diversos.). Este estimador. junto con otros índices de diversidad. 2006). tales como colémbolos. Initiations et Documents Techniques. (2002) “Soil biodiversity: Myth. pueden ser calculados utilizando el programa EstimateS (Colwell. puede usarse para calcular los índices de riqueza de especies. Se ha demostrado que datos a nivel género y familia.. ácaros oribátidos y hormigas. ejemplo: ácaros oribátidos. de acuerdo con su función ecológica mayor (detritivoros. 2006. predadores. Ph. los taxa escasamente conocidos también se pueden clasificar a niveles taxonómicos más altos (orden o familia). etc. (1978) “La faune des sols. son écologie et son action“. fitofagos. del paquete de metodología ecológica para Windows. La comparación de la composición de taxa entre usos de suelo debería llevarse a cabo utilizando un análisis jerárquico de agrupación y la unión promedio de agrupaciones de los datos transformados. También puede llevarse a cabo un análisis adicional como rarefacción y estadística multivariada. 160 Manual de biología de suelos tropicales . Los datos obtenidos deben.. Ducarme. Dado que los grupos de lugares similares ofrecen una fauna similar y que la mayoría de animales del suelo pueden distribuirse en los grupos funcionales básicos (Ruf et al. 3–24. El número de individuos normalmente se transforma de forma logarítmica log: x’=log10 (x+1) para evitar dar mayor peso a las especies dominantes en el análisis de datos (Ludwig y Reynolds. reality or conning?” Oikos. incluir la riqueza de especies en el caso de los taxa seleccionada para la identificación a nivel especies. con numerosas especies raras. André. El programa DIVERS.

J. Leiden (in press). y Shen. vol. y Mahunka. Elsevier. 361–371. (2004) ‘Soil mites and other animals’. Colwell. M. New York. A. CABI Publishing. M. Sumner (ed) Handbook of Soil Science. John Wiley & Sons. Mahunka (eds) The Soil Mites of the World. accessed 10 January 2008.. vols 1 and 2. Franklin. in F. L. K. A. 142–162. (1972) The Oribatid Genera of the World. C ollembola . Krantz. Amsterdam. Minor. John Wiley and Sons. pp. W. in M. y Morais. L. y Balogh. Dindal. Biometrics.. Y. Budapest.. J. Oregon. (2005) ‘A new statistical approach for assessing compositional similarity based on incidence and abundance data’. Chazdon. F. R. 46–53. www. P. (2006) ‘EstimateS: Statistical estimation of species richness and shared species from sample. pp. T-J. Version 8 User’s Guide and Application’.edu/estimates. R. 2. pp. D. html. Fauna Malesiana. New York. J. Norton. y Migliorini. Oregon State University Book Store Inc.ac. 779–803. Ecology Letters. no. acari y otra mesofauna del suelo 161 . (1983) Primitive Oribatids of the Palaearctic Region. (1988) Statistical Ecology: A Primer on Methods and Computing. (1990) Soil Biology Guide. 62. O.. D. R. (2006) ‘Micro-arthropod communities under human disturbance: Is taxonomic aggregation a valuable tool for detecting multivariate change? Evidence from Mediterranean soil oribatid coenoses’. S Moreira.eeb. Colwell. Brussaard (eds) Soil Biodiversity in Amazonian and Other Brazilian Ecosystems. (1978) A Manual of Acarology. T-J. S. pp. Acta Oecologica. 8. P. y Coleman. 148–159. Brill. G. Amsterdam. 59–65. Chazdon. Ludwig. J. Dindal (ed) Soil Biology Guide. P. Balogh. A. in D. http://viceroy. K. Chao. W. R. L.. y Reynolds. pp. Chao. (1990) ‘Oribatid Mites of the Neotropical Region II’. Bedos. R. R. y Shen.massey. Balogh and S. E. in J. (1999) ‘Microarthropods’. Elsevier.nz/~maminor/mites. (2006) ‘Abundance-based similarity indices and their estimation when there are unseen species in samples’. vol. (1990) ‘Acarina: Oribatida’. J. John Wiley and Sons. 30. no 1. D.. y Balogh. y Suhardjono. R.. L. J. A. uconn. A. Wallingford. Balogh. Crossley. pp. no. (2006) ‘Soil Mesofauna in Central Amazon’. L. CRC Press. Colwell. vol. Caruso. Greenslade. 2. Akadémiai Kiadó. Hungarian Natural History Museum Press. Siqueira and L. Boca Raton.Balogh. M. T. (2008) Handbook to Collembola of Indonesia. New York. (1992) The Oribatid Mite Genera of the World. E. J. K. Balogh. J. Budapest. Deharveng.

no. 1–38. J. Biol.Ruf. 98. Entomological Report from the Sabah Forest Research Centre No. Japan International Cooperation Agency.. vol. 3. 1–28. L. d’observation et de conservation des Oribates (Acariens) et autres microathropodes”. 6. 81-12. 7. Entomological Report from the Sabah Forest Research Centre No. Revue d’Écologie et de Biologie du Sol. Ecosystems and Environment. 139–144.. Entomological Report from the Sabah Forest Research Centre No. (1965) “Quelques techniques de récolte.. Oribatida. Siepel. (1982b) ‘Studies on the Collembolan Genera Callyntrura and Dicranocentroides’. Entomological Report from the Sabah Forest Research Centre No. Yoshii. R. EX-1 JR. Travè. Yoshii. pp. R. Japan International Cooperation Agency. Beck. Agriculture. J. pp. 8112. 5. 1–70. Fert. R. pp1–38. pp. 2. 1–3. 4. Camisiidae)’. Nothridae) and Platynothrus peltifer (Koch) (Acari. Soils. Yoshii. pp. H. P. y Spelda. pp. (2003) “A biological classification concept for the assessment of soil quality: “Biological soil classification scheme” (BBSK)’. 23–47. 162 Manual de biología de suelos tropicales . Japan International Cooperation Agency. R. no.. Dreher. (1981a) ‘Paronellid Collembola of Sabah’. Japan International Cooperation Agency. Oribatida. Nothrus silvestris Nicolet (Acari. de triage. Yoshii. (1982a) ‘Lepidocyrtid Collembola of Sabah’. J. 1–70. pp. vol. K. pp. R. A. (1983) ‘Studies on Paronellid Collembola of East Asia’. 2. (1981b) ‘Neanurid Collembola of Sabah’. 263–271. vol. Römbke. Japan International Cooperation Agency. 9. Hund-Rinke. Entomological Report from the Sabah Forest Research Centre No. Yoshii. EX-1 JR. (1990) ‘Niche relationships between two panphytophagous soil mites.

otros nematodos y microinvertebrados. 1982). ellos juegan un papel importante como agentes de ciclado de nutrientes y como reguladores de la fertilidad del suelo mediante el flujo de energía y la movilización y utilización de nutrimentos (Procter. los nematodos parásitos tienen la capacidad de colonizar y alimentarse de tejidos de plantas y animales. los nematodos se adaptaron a la exploración de una amplia variedad de fuentes de alimento. Derivado de su evolución. 1980. La palabra nematodo deriva del griego “nema” que significa “forma de un hilo”. ellos son responsables del 10 a 15% de la respiración de los animales del suelo (Sohlenius. los cuales se consideran uno de los grupos de animales más abundantes y más diversos en el planeta.Capítulo 5 Nematodos del suelo Juvenil E. Cares y Shiou P. ya que poseen un cuerpo alargado y cilíndrico. Petersen. Los nematodos en una primera aproximación. Huang (†) INTRODUCCIÓN Los nematodos del suelo son pequeños invertebrados dependientes del agua. además de estos bene163 . los nematodos están presentes en cualquier lugar donde exista carbono orgánico. son conocidos como una amenaza para la salud humana. De esta manera. animal y de plantas. protozoarios. Aunque la biomasa de nematodos en el suelo es pequeña (10¹ a 104 mg peso seco m-2). algas. 1990). sin embargo. mientras que las formas de vida libre se alimentan de microorganismos (bacterias y hongos). en todas las latitudes del planeta y desde fondo del mar hasta la cima de las montañas. Debido a su gran capacidad de adaptación.

una condición que puede interpretarse como indicador de la fertilidad del suelo (Ferris et al. Los nematodos depredadores tienen la cavidad bucal equipada con una o más estructuras en forma de dientes (Ilustración 2d). depredadores y omnívoros (Ilustración 2). Los micófagos. influir en la nodulación por parte de bacterias tipo Rhizobium. también participan en importantes servicios del agroecosistema al fungir como agentes de control biológico de plagas de insectos.ficios para el ecosistema. algunos nematodos micófagos son pueden comportarse como parásitos facultativos de plantas. tal es el caso de los nematodos entomofílicos Deladenus siricidicola o los entomopatógenos Steinernema carpocapsae y Heterorhabditis bacteriophora. el aparato bucal incluye un estilete tipo aguja (lustración 2a). bacteriófagos. pueden alimentarse de bacterias y esporas de hongos. patogénicos. En el caso de nematodos parásitos de plantas. los nematodos bacteriófagos pueden incrementar su población ante cualquier perturbación del suelo o bien. Se distinguen también entre ellos mismos por su 164 Manual de biología de suelos tropicales . benéficos y micorrízicos. los califican como poderosos bioindicadores de condiciones ecológicas (Huang y Cares. en la mayoría de los casos la identificación de los diferentes grupos funcionales puede lograrse en base a la morfología de su aparato bucal. Como típicos estrategas r. así como su ciclo de vida corto y sensibilidad ante alteraciones ambientales. mismos que carecen de estilete (Ilustración 2c). mediante el cual puede causar pérdidas significativas en varios cultivos. 2001). 2006). Por tal motivo. Los nematodos del suelo viven en grupos o gremios. con la capacidad de alimentarse de cualquier fuente. bajo condiciones de enriquecimiento de nutrimentos. compuestos por lo general de cinco grupos funcionales principales: parásitos de plantas. equipados en su mayoría con un estilete pequeño y delicado (Ilustración 2b). por lo que pueden fungir como micófagos. pueden regular el nitrógeno y el fósforo disponible para las plantas. Aunque la identificación de estos organismos requiere de intenso entrenamiento. micófagos. o en algunos casos. en algunos casos. microinvertebrados y protozoarios. bacteriófagos. Su omnipresencia y abundancia en todo tipo de suelos y hábitats acuáticos. Los nematodos bacteriófagos. Algunos nematodos viven en un amplio rango de ambientes. poseen un estilete que les permite alimentarse de otros nematodos. son polífagos. mientras otros ocupan áreas más restringidas. los nematodos están bien representados a lo largo de la red trófica del suelo. se alimentan de las hifas de hongos saprofíticos. así como alimentarse y diseminar bacterias benéficas y fitopatógenas. herbívoros y también como depredadores al alimentarse de otros nematodos. Los omnívoros tienen la cavidad bucal armada con un estilete hueco (Ilustración 2e).

y los nematodos se colectan directamente en un tamiz de 400 mallas (tamaño de malla de 37 µm) (Figura 5. producen pocos huevillos.1). EXTRACCIÓN DE NEMATODOS La muestra de suelo se mezcla completamente y se toma una submuestra de 300 ml. tomando en cuenta su diversidad. los nematodos colonizadores (similares a los estrategas r) típicamente poseen un tiempo de generación corto.sensibilidad a la perturbación del suelo y a los contaminantes químicos. respectivamente). se agita durante 30 segundos y se deja reposar otros 2 minutos para que las partículas del suelo se sedimenten. lo cual deberá hacerse con la mayor rapidez posible. Las muestras son transportadas al laboratorio en una caja aislada y almacenadas a 4° C hasta su extracción. un análisis apropiado de la comunidad de nematodos. Esta suspensión se pasa a través de tamices de 40 a 60 mallas (tamaño de malla de 250 a 350 µm. se trazan dos círculos concéntricos. puede presentar un índice de sistemas de uso de suelo y cambios de uso de suelo y medir los niveles de perturbación provocados por contaminantes y otros factores. respectivamente. además son los más resistentes a la perturbación del suelo y a contaminantes químicos. abundancia y estructura de comunidad. con un radio de 3 m y 6 m. y ocho puntos en el círculo grande. Los doce núcleos de suelo se depositan en una bolsa de plástico que deberá sellarse para evitar su desecación y además protegerla de la luz solar. pero más grandes. una ausencia de dauerlarva y sensibilidad ante contaminantes y otros factores de perturbación. poseen una baja movilidad. todos los núcleos de suelo se deben tomar a una profundidad de 20 cm. A esta última suspensión de nematodos se le pueden eliminar aún más partículas de N ematodos del suelo 165 . producen muchos huevecillos pequeños. Para colectar el suelo se utiliza un nucleador de acero y las muestras se toman en cuatro puntos equidistantes en el círculo pequeño. la cual se vacía a una cubeta con 2 litros de agua. muestran la presencia de dauerlarva e incrementan sus poblaciones cuando existen condiciones ricas en alimentación. MUESTREO DE SUELO En cada punto de muestreo dentro de un sistema de cuadrícula (véase Capítulo 2). Según lo propuesto por Bongers (1990) y Bongers y Borgers (1998). Por otra parte. los nematodos persistentes (similares a estrategas k) se caracterizan por necesitar un largo tiempo de generación. por tal motivo.

suelo mediante un método modificado de centrifugación con flotación de azúcar (Jenkins. En este procedimiento. para luego colectarse en un vaso de precipitados (Figura 5. la suspensión acuosa se centrifuga primero a 3. el sedimento o botón dentro del tubo de centrífuga se resuspenden en solución de sacarosa (456g L-1) (Figura 5. y a la derecha. se distribuye en tubos de ensayo para su fijación. Posteriormente. 1964). suspensión de suelo en reposo. Posteriormente.1 A la izquierda. posteriormente se fijan con solución Golden 2X (Hooper. contenida en el vaso.500 rpm durante 5 minutos y el sobrenadante se descarta. 1970).2a) y se centrifuga de nuevo a 1. dejando así una suspensión de nematodos de 10 a 20 ml. FIJACIÓN Y CONTEO DE NEMATODOS Los nematodos extraídos se matan con agua caliente a 50-60°C durante un máximo de un minuto (Figura 5. Una vez calentados los tubos. 166 Manual de biología de suelos tropicales .000 rpm durante uno a dos minutos. La suspensión. se añade un volumen igual de solución Golden Figura 5. éstos se dejan reposar durante 30 minutos y se remueve el exceso de sobrenadante utilizando una pipeta o por medio de succión al vacío (preferentemente).2b).3b) y. los nematodos se colectan a partir del sobrenadante utilizando un cernidor con tamaño de malla de 37 µm (Figura 5. Los especímenes que se hallan sobre la malla se lavan y arrastran con agua.3a). juego de tamices de metal (de tamaño de malla 45 arriba y 400 abajo).

con lo que se obtiene una concentración final de formol 3. 2X. a b Figura 5. La suspensión resultante se ajusta a un volumen de 15 ml y se cuenta el total de nematodos en la población mediante la toma al azar. b) muerte de nematodos en agua caliente. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. de alícuotas de 1 ml.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos.3 a) Nematodos recuperados mediante el lavado de malla de 400. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa.2%. N ematodos del suelo 167 .Figura 5. el número total se obtiene de multiplicar la media de tres conteos de manera que el número total representará el número medio de 3 conteos de submuestras x 15.

aunque en la última ocasión no es necesario añadir solución Seinhorst II pero sí incubar a la misma temperatura durante otras 48 horas para evaporar todo el alcohol.1.1) y el volumen resultante se vacía por completo en una caja Petri de 5 cm de diámetro. 1991. se coloca una tira de cinta adhesiva para evitar que el cubreobjetos aplaste a las especímenes. Jairajpuri y Ahmad. 1992. 168 Manual de biología de suelos tropicales . El volumen de la caja se reestablece con solución Seinhorst II. 1991. 1959) suele modificarse para evitar la laboriosa tarea de pescar individualmente cada nematodo y elaborar numerosas preparaciones permanentes. Bongers. 1996. en esas condiciones se retira la tapa de la caja para que se reduzca por lo menos a la mitad de su volumen.. Raski. 2001). la caja se coloca en un desecador a 43°C durante la noche (Figura 5. Decraemer.6). 1991.7). Maggenti. Geraert.INFILTRACIÓN CON GLICERINA Y OBSERVACIÓN DE NEMATODOS El método de Seinhorst (Seinhorst. 1991. May et al. la caja se retira del desecador y se deja evaporar a la misma temperatura durante un mínimo de cuatro horas. Anderson y Potter. El procedimiento se ilustra en la Figura 5. 1993. 1988. Estos pasos se repiten tres veces. utilizando un microscopio compuesto (se requiere un aumento de 400 a 1. utilizando una gota de glicerina deshidratada como medio de montaje. 1991. luego se añaden 7 ml de la solución Seinhorst I (Figura 5. 1951. Al segundo día. 1988.1974. 1991. Después de este proceso.5. al final. 1961. Smart Jr y Nguyen. mientras que la composición de las soluciones se puede observar en la Tabla 5. Antes de colocar el cubreobjetos de vidrio sobre la gota..4). La identificación de nematodos por caracteres morfológicos se basa en la literatura taxonómica especializada (Goodey. Smart Jr y Nguyen. 1991. se tapa la caja y se deja nuevamente en el desecador durante la noche. 1983. Thorne. Baldwin y Mundo-Ocampo. 1991. Andrássy. 1991. Fortuner.000 x). Nickle y Hooper. la preparación se sella utilizando bálsamo de Canadá (Huang et al. Goseco et al. 1984) (Figura 5.5. Loof. Hunt. La modificación consiste en reducir a 3 ml el volumen de la suspensión (Figura 5. 1991. 1994. los nematodos de la caja se montan en laminillas. 2000. Tabla 5. Cares y Huang. Se hace una selección al azar de aproximadamente 100 nematodos montados para su identificación a nivel de género.

Figura 5. Las cajas Petri no deben contener más de una tercera parte de líquido.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos Figura 5. Evaporación a 43°C durante 4 hrs para reducir a la mitad del volumen Completar volumen con Seinhorst II Evaporación a 43°C durante 4h para reducir el volumen a la mitad Desecador a 43°C durante la noche N ematodos del suelo 169 .5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos. Nematodos en: Golden (3 ml) + Seinhorst I (7 ml) Evaporación a 43°C durante 4h para reducir el volumen a la mitad Completar volumen con Seinhorst II Desecador a 43°C durante la noche Desecador a 43°C durante la noche Desecador a 43°C durante la noche Evaporación a 43°C durante 48 horas.

Foto Francisco Franco. Foto: Marcella A.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. Nota: el fondo del contenedor se mantiene a 43°C.7 Charola con montajes permanentes de especímenes de nematodos.Figura 5. Teixeira. Figura 5. 170 Manual de biología de suelos tropicales .

empleando las fórmulas que se mencionan líneas adelante. su número poblacional se divide entre dos para cada hábito. micófagos. cuando un nematodo tiene dos tipos de hábitos alimenticios. Si un nematodo posee dos tipos de hábito alimenticio. todos ellos basados en los criterios de Yeates et al. (1993). Índice de Riqueza de Género [d = (S – 1)/log N. Índice de Diversidad de Simpson [Ds = 1 – Σ(pi)². N ematodos del suelo 171 . bacteriófagos.Σpi log2 pi]. abundancia total y abundancia relativa de cada uno de los géneros. donde pi = porcentaje de género ‘i’ en la abundancia total]. Los datos sobre frecuencia absoluta.Tabla 5. depredadores y omnívoros. Índice de Diversidad de Shannon [H’ = . Golden X Formol (+ 40% formaldehído) Glicerina Agua destilada Alcohol 96% Glicerina Agua destilada 8 partes 2 partes 90 partes Seinhorst I 20 partes 2 partes 78 partes Golden 2X 16 partes 4 partes 80 partes Seinhorst II 95 partes 5 partes ÍNDICES Y PARÁMETROS PARA LA CARACTERIZACIÓN DE POBLACIONES DE NEMATODOS Los nematodos identificados a nivel de género pueden dividirse en cinco grupos tróficos: parásitos de plantas. donde S = número de géneros y N = número total de nematodos].1 Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina. Equitatividad del Índice de Diversidad de Simpson [Es = Ds/Ds max’ donde Dsmax = 1 – 1/S Equitatividad del Índice de Diversidad de Shannon (J’= H’/H’max’ donde H’max = Log2 S]. pueden utilizarse para calcular índices de diversidad y equitatividad. Los datos de frecuencia y abundancia de los diferentes grupos tróficos se usan para calcular el Índice de Diversidad Trófica y varios cocientes que consideran la abundancia relativa de los grupos tróficos.

el Índice de Madurez (IM) (que incluye únicamente nematodos de vida libre) (Tabla 5. Bongers y Bongers (1998) propusieron IM2–5 (igual que IM. 1998). siempre están activos. La relación micófagos/bacteriófagos (M/B) y (micófagos+bacteriófagos)/parásitos de plantas [(M+B)/PP]. asignándoles un “valor cp” en una escala de 1 a 5. baja movilidad. véase Norton. y el cociente IFP /IM como un indicador de fertilidad del suelo.2) y el Índice Fitoparasítico (IFP) (que incluye únicamente parásitos de plantas) (Tabla 5. se han utilizado varios índices para la evaluación del suelo. 1978. Tabla 5. Porcentajes de criconematidos y de dorylaimidos en la población. 1994]. Krebs. Índice de Diversidad Trófica [T = 1/ Σ(pi)². Por el contrario. respectivamente). ausencia de dauerlavae y elevada sensibilidad ante la presencia de contaminantes y otros factores de perturbación (Bongers y Bongers. En base a estos conceptos. la producción de pocos huevecillos pero muy grandes. 1988. presentan dauerlarvae o estadios de sobrevivencia y crecen bajo condiciones de riqueza de alimento. Σ(vi x fi) (donde vi = valor c-p de 1 a 5 para el género ‘i’. donde pi = abundancia relativa de un grupo trófico . producen muchos huevecillos pequeños.3). Para medir el nivel de perturbación del suelo (Bongers. Bongers (1990) dividió a los nematodos del suelo en una serie desde los colonizadores (c) hasta los persistentes (p) (similar a los estrategas r y k. y fi = frecuencia relativa del género ‘i’). Magurran. Yeates (1994) amplió el Índice de Madurez para incluir a todos los nematodos del suelo (mIM).2 Familias y valores cp utilizados para el índice de madurez* Familia Neotylenchidae Anguinidae Aphelenchidae Aphelenchoididae Rhabditidae 172 valor cp 2 2 2 2 1 Familia Achromadoridae Ethmolaimidae Cyatholaimidae Desmodoridae Microlaimidae valor cp 3 3 3 3 3 Manual de biología de suelos tropicales . Los colonizadores cp1 se caracterizan por tener tiempos generacionales cortos. pero excluyendo a los nematodos cp1) para evaluar factores de estrés inducidos por contaminación. los persistentes cp5 se distinguen por tiempos generacionales largos. 1990).

3 Familias y valores cp utilizados para el índice fitoparasítico cp2 Tylenchidae Psilenchidae Tylodoridae cp3 Dolichodoridae Hoplolaimidae Pratylenchidae cp4 Trichodoridae cp5 Longidoridae N ematodos del suelo 173 Nota:*modificado de Bongers (1990).Tabla 5. Tabla 5. .2 Familias y valores cp utilizados para el índice de madurez* Familia Alloionematidae Diploscapteridae Bunonematidae Cephalobidae Ostellidae Panagrolaimidae Myolaimidae Teratocephalidae Diplogasteridae Neodiplogasteridae Diplogasteroididae Tylopharyngidae Odontopharyngidae Monhysteridae Xyalidae Linhomoeidae Plectidae Leptolaimidae Halaphanolaimidae Diplopeltidae Rhabdolaimidae Chromadoridae Hypodontolaimidae Choanolaimidae valor cp 1 1 1 2 2 1 2 2 1 1 1 1 1 1 2 3 2 3 3 3 3 3 3 4 Familia Odontolaimidae Aulolaimidae Bastianiidae Prismatolaimidae Ironidae Tobrilidae Onchulidae Tripylidae Alaimidae Bathyodontidae Mononchidae Anatonchidae Nygolaimidae Dorylaimidae Chrysonematidae Thornenematidae Nordiidae Qudsianematidae Aporcelaimidae Belondiridae Actinolaimidae Discolaimidae Leptonchidae Diphtherophoridae valor cp 3 3 3 3 4 3 3 3 4 4 4 4 5 4 5 5 4 4 5 5 5 5 4 3 Nota: *Bongers (1990).

529–586. L. y Potter. Marcel Dekker. pp. 46. y Huang. Schoorl. Oecologia. 9. 239–251. in F. J. vol. pp. P. CABI Publishing. E. (1991) ‘Stunt nematodes: Tylenchorhynchus. S. W. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian amazon and savanna vegetation’.and non-cyst-forming nematodes’. M. vol. in W. pp. (1990) ‘The maturity index: An ecological measure of environmental disturbance based on nematode species composition’. New York. 10. Pirola. in W. 8. Koninklijke Nederlandse Natuurhistorische Vereniging. 275–362. R. (2001) “Taxonomia de fitonematóides. Schoorl. Applied Soil Ecology. The Netherlands. REFERENCIAS Anderson. Pirola. 3. S. (1983) A taxonomic review of the suborder Rhabditina (Nematoda Secernentia). 185–223. 83. 2nd edition. Nickle (ed) Manual of Agricultural Nematology. T. M. M. E. Cares. G. (1991) ‘Heteroderinae cyst. pp. and related genera’. (2000) “Taxonomia atual de fitonematóides. Bibliotheekuitgave no 46. New York. Koninklijke Nederlandse Natuurhistorische Vereniging. pp. Revisão Anual de Patologia de Plantas. y Bongers. vol.Tabla 5. y Mundo-Ocampo. pp. R. V. pp. (1994) De Nematoden van Nederland. Bongers.3 Continúa cp2 Ecphyadophoridae Paratylenchidae Anguinidae cp3 Heteroderidae Hemicycliophoridae cp4 cp5 Nota: * modificado de Bongers (1990). Eötvös Lorand University. y Huang. (1988) De Nematoden van Nederland. J. Revisão Anual de Patologia de Plantas. T. Moreira. Bongers. London. J. P. y Huang. no. 177–235. 163–183. Baldwin. Cares. T. Bibliotheekuitgave no. O. T. J. Chave sistemática simplificada para gêneros Parte II”. (eds) (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. Siqueiera and Brussaard. J. Cares. Bongers. Bongers. (1998) ‘Functional diversity of nematodes’. Merlinius. Budapest. R. I. P. S. J. 174 Manual de biología de suelos tropicales . The Netherlands. Chave sistemática simplificada para gêneros Parte I”. Andrássy. 14–19. Marcell Dekker. vol. E. Nickle (ed) Manual of Agricultural Nematology.

C. pp. pp. S. R. pp. in W. Loof. (1991) ‘Stubby root and virus vector nematodes: Trichodorus. M. Technical Bulletin No 2. Marcel Dekker. J. Ferris. New York. (1991) ‘Nemata: Higher classification’. Nickle (ed) Manual of Agricultural Nematology. (1984) ‘Preparing nematode permanent mounts with adhesive tapes’. Marcel Dekker. 669–720. Brussaard (eds) Soil biodiversity in Amazonian and other Brazilian ecosystems. 16. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian Amazon and savanna vegetation’. (1991) ‘Tylenchidae in agricultural soils’. R. N ematodos del suelo 175 . F. y Goede.. M. vol. London. y Cares. E. Plant Disease Reporter. (1994) Ecology: The Experimental Analysis of Distribution and Abundance. Bittencourt. H. (1964) ‘A rapid centrifugal flotation technique for separating nematodes from soil’.. Goseco. Wallingford. 147–190. Maggenti. Marcel Dekker. M. 34–39. vol. E. Indiana. J. R. y Ferris. CAB International. Nickle (ed) Manual of Agricultural Nematology. Ltd. pp. Hunt. Marcel Dekker. F. no 3. 587–626. Nickle (ed) Manual of Agricultural Nematology. 1st edition. 18. (1974) Revision in Leptonchoidea (Nematoda: Dorylaimida). Nickle (ed) Manual of Agricultural Nematology. New York. Moreira. pp. G. Ferris. (1970) ‘Handling. P. Marcell Dekker. in W. New York. J. New York. Leiden. Southey (ed) Laboratory Methods for Work with Plant and Soil Nematodes. in W. Jenkins. (1951) Soil and freshwater nematodes. (1993) Aphelenchida. Applied Soil Ecology. Huang. Wallingford. and Trichodoridae: Their systematics and bionomics. Huang. R. pp. and Monotrichodorus’. E. J. R. T. S. O.. Goodey. Jairajpuri. Bongers. Nickle (ed) Manual of Agricultural Nematology. (1991) ‘The family Pratylenchidae Thorne. Journal of Nematology. Methuen and Co. M. staining and mounting nematodes’. (1992) Dorylaimida: Free-living. C.Decraemer. G. in J. vol. pp. and Ahmad. E. 662–665. R. J. 1949’. Fisheries and Food. y Silva. 48. in F. D. in W. (1991) ‘The Hoplolaimidae’. J. Brill. W. R. Krebs. pp. Fortuner. C. pp. New York. Harper Collins College Publishers. Ministry of Agriculture. W. C. Allotrichodorus. CAB International. fixing. W. Predaceous and Plant Parasitic Nematodes. A. 363–422. S. no 9. Siqueira and L. in W. T. (2001) ‘A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept’. P. pp. Purdue Nematode Collection Department of Entomology. D. A. Paratrichodorus. V. 163–183. S. R. 795–826. New York. 341–342. 4th edition. 13–29. M. R. F. Purdue University. Geraert. West Lafayette. no 1. Hooper. Longidoridae. R.

Nickle (ed) Manual of Agricultural Nematology. K. 627–668. Marcell Dekker. G. (1991) ‘Sting and awl nematodes: Belonolaimus spp.. 1. Smart Jr. J. W. 39. 67–69. and Nguyen. pp. S. (1982) ‘Structure and size of soil animal populations’. University of Florida. vol. Mullin. R. 34.. 97–101.. no. 38. Cambridge. New York. (1996) Pictorial Key to Genera of Plant Parasitic Nematodes. B. Procter. New York. biomass and contribution to energy flow by soil nematodes in terrestrial ecosystems’.an outline for soil ecologists’. in W. May. no. New York. Seinhorst. (1991) ‘Tylenchulidae in agricultural soils’. pp. T. Nickle (ed) Manual of Agricultural Nematology. R. (1991) ‘The Aphelenchina: Bud. B. J. K. pp. Oikos. W. Freckman. 176 Manual de biología de suelos tropicales . G. (1978) Ecology of Plant Parasitic Nematodes. Gainesville. H. F. vol.Magurran. W. in W. Bongers. John Wiley and Sons. pp. G. vol. no. S. 761–794. Yeates. pp. Nickle. D. in W. Lyon. 4. leaf. Yeates. W. R. y Georgieva. y Nguyen. H. Cornell University Press. 25. C. New York. pp. Pedobiologia. G. (1988) Ecological Diversity and its Measurement. Cambridge University Press. H. (1961) Principles of Nematology. A. 186–194. New York. 306–329. 5th edition. B. R. Marcel Dekker. D. 315–331. pp. (1994) ‘Modification and quantification of the nematode maturity index’. (1980) ‘Abundance. D. P. (1988) Illustrated Key for Identification of Common Nematodes in Florida. pp. pp. D. D. and Dolichodorus spp. C. 2. vol. y Hooper. 3. Marcel Dekker. G. Oikos. Journal of Nematology. y Loeffer. (1990) ‘Global overview of the functional roles of soil-living nematodes in terrestrial communities and ecosystem’. 22. Raski. L. M. McGraw Hill Co.. de Goede. Nickle (ed) Manual of Agricultural Nematology. 465–508. (1959) ‘A rapid method for the transfer of nematodes from fixative to anhydrous glycerin’. 1–7. C. vol.. G. vol. Norton. W. G.. Journal of Nematology. J. New York Petersen. and insect nematodes’. Thorne.’. W. Smart Jr. K. C. Sohlenius. E. (1993) ‘Feeding habits in soil nematode families and genera . R. Nematologica.

f y g) Se fijan las redes al interior de la trampa Winkler previamente colgadas en un espacio bien aireado con un frasco colocado en el fondo.Ilustración 1. por un marco. b) Colecta de la hojarasca utilizando guantes de cuero. que contiene alcohol al 70%. desde el borde hacia el centro. e) Cada muestra de hojarasca tamizada se transfiere a una red. Sistema de extracción de hormigas y escarabajos con trampas Winkler a) Delimitación de un metro cuadrado de hojarasca. i . d) Transferencia del material tamizado a bolsas de nylon en campo. c) Introducción de la hojarasca en un tamiz para separar los fragmentos más gruesos.

Fotos: Juvenil Cares. D) depredador. B) micófago. Fotomicrografías de la región anterior en las que se muestra el aparato bucal (flechas) de nematodos de suelo pertenecientes a diferentes grupos funcionales: A) parásito de plantas. C) bacteriófago. A y B: Estoma con estilete C: Estoma sin estilete D: Diente dorsal E: Odonto estilete ii Manual de biología de suelos tropicales . E) omnívoro.Ilustración 2.

cr CL CL d) Características de dos aislamientos de Bradyrhizobium (CL de crecimiento lento) y de R. PAB vol 319. Moreira excepto e) de Lima et al. 2009. tropici (CR crecimiento rápido) creciendo en YMA f) Perfiles de Rep-PCR de e) Perfiles de proteínas totales obtenidos por electroforesis diferentes cepas. Pasos de la metodología para caracterizar a las bacterias fijadoras de nitrógeno y formadoras de nódulos en leguminosas (BFNFNL) aplicada en el proyecto CSMBGBD. Fotos: F. b) Plantas de Prosopis juliflora en agar inclinado con solución de nutrientes. I lustraciones a color iii .. en gel de poliacrilamida.Ilustración 3. a) Siratro en bolsa de plástico con solución de nutrientes Pheseolus vulgaris c) Pruebas en plantas de Pheseolus vulgaris para ver la eficiencia de aislamientos en Jarras de Leonard.

c) detalle de la ornamentación de la pared de la espora (verrugas) de Scutellospora coralloidea. mostrando algunos sáculos esporíferos todavía fijados a la espora (flecha).Ilustración 4. Fotos: Sidney Stümer. h) esporas de Acaulospora sp. pared germinal 1 (gw1) y pared germinal 2 (gw2) con su capa más interna en reacción con el reactivo Melzer. g) espora de Acaulospora scrobiculata mostrando la cicatriz (flecha) que queda en la espora después de que se suelta el sáculo esporífero. iv Manual de biología de suelos tropicales . obsérvese el escudo redondo de germinación de color café que contrasta con el color hialino de la espora. b) espora de Scutellospora scutata con la célula suspensora bulbosa (flecha). típica de la familia. f) espora de Entrophospora colombiana mostrando las dos cicatrices (flecha). Esporas y estructuras producidas por especies de hongos micorrizógenos arbusculares de la familia Gigasporaceae: a) espora de Gigaspora albida mostrando la célula suspensora bulbosa (flecha). d) células auxiliares nudosas diferencias por miembros del género Scutellospora. Esporas y estructuras producidas por especies de HMA de la familia Acaulosporaceae: e) espora de Entrophospora colombiana mostrando la pared de la espora.

brasilianum que fueron tomadas de http:// invam. Esporas y estructuras producidas por especies de HMA de la familia Archaeosporaceae (e y f) y Paraglomeraceae (g y h): e) espora de Archaeospora Leptoticha con sáculo esporífero. h) Espora de Paraglomus brasilianum mostrando la estructura de la pared de la espora formada por tres capas (L1. L2 y L3) (obsérvese que la capa L2 está ornamentada con pequeñas crestas). f) Detalle de Archaeospora Leptoticha mostrando salientes y depresiones en las capas 2 y 3 de la pared de la espora (flecha).caf. b) Espora de Glomus sp. I lustraciones a color v . g) Espora de Paraglomus occultum mostrando la estructura de la pared de la espora formada por tres capas (L1. Esporas y estructuras producidas por especies de HMA de la familia Glomeraceae: a) Espora de Glomus clarum mostrando la hifa de sostén. Fotos: Sidney Stümer.Ilustración 5. c) Esporocarpo de Glomus clavispora.wvu. excepto de Paraglomus occultum y P. L2 y L3). obsérvese que la capa más profunda de la pared de la espora se separa y se asemeja a la pared germinal.edu. d) Esporocarpo de Glomus sp. mostrando la pared de la hifa de sostén de manera continua con la pared de la espora.

Aislamientos de hongos zoospóricos de muestras del ambiente (Oomycota y Chytridiomycota): a) muestra de suelo con cebo. e) Oogonio y anteridio de Pythium. vi Manual de biología de suelos tropicales . f) Pythium liberando zooesporas.Ilustración 6. d) esporangio de Phytophthora. b) muestra de agua con cebo. c) cultivo puro en cebo.

b) tamices con diferentes mallas. Técnica de lavado del suelo para el aislamiento de microhongos del suelo: a) Pre-lavado. Abreu. g) placa con partículas de suelo para su incubación. f) medio de cultivo en placas. c) suelo pre-lavado. Fotos: Lucas M.Ilustración 7. h) colonias de hongos en medio de cultivo para retardar el crecimiento. d) continuando con el procedimiento de lavado. I lustraciones a color vii . e) partículas de suelo lavado.

A C Banda costal Banda “s” Banda “s” D B E Cabeza Punta del oviducto Mesonoto Aculeo Mediotergio Abdomen Terminalia viii Manual de biología de suelos tropicales . D) Extracción del aculeo. A) Larvas y pupas de la mosca de la fruta en el suelo. C) Patrones alares típicos con bandas. E) Adulto de mosca de la fruta y detalle del aculeo.Ilustración 8. B) Trampa MacPhail con cebo.

S. donde se cosecharon cerca de 57 millones de toneladas de soya.3 billones de gastos en fertilizantes mediante la aplicación de esta biotecnología. Moreira LA IMPORTANCIA ECONÓMICA Y ECOLÓGICA DE LA SIMBIOSIS DE BACTERIAS FORMADORAS DE NÓDULOS EN LEGUMINOSAS (BFNFNL) La fijación biológica de nitrógeno es uno de los procesos más importantes para mantener la vida en el planeta. debido a las múltiples interacciones que se dan entre organismos del suelo y plantas. La inoculación con cepas de BFNFNL altamente eficientes y adaptadas a las condiciones ambientales dominantes. En el año 2006. 177 . al mismo tiempo. considerando un área de 21 millones de hectáreas.Capítulo 6 Bacterias formadoras de nódulos en leguminosas Fátima M. Las cepas. en el caso de la soya. provienen de una diversidad que se encuentra en el suelo. se ahorraron alrededor de US$ 3. la inoculación con cepas de Bradyrhizobium reemplaza completamente la aplicación de fertilizantes sintéticos. 1975). por lo tanto. se utiliza en algunos países con un pequeño y selecto grupo de leguminosas con el propósito de reemplazar el uso de fertilizantes químicos de nitrógeno. manteniendo así la armonía con el medio ambiente. un conocimiento de la diversidad de BFNFNL en el suelo deberá ser el primer paso para el manejo y la conservación de este recurso genético de tanto valor. pues proporciona alrededor del 70% de todo el nitrógeno requerido en los ecosistemas naturales y agroecosistemas (Burns y Hardy. usadas para la inoculación. En Brasil. la biodiversidad del suelo puede afectar el comportamiento de la formación de nódulos de manera positiva o negativa.

1984 Lindström... 2001. (Ulmaceae).. Chen et al. 2003) (Tabla 6. 2002. etli R. El término rhizobia se deriva de Rhizobiaceae (Conn. 1998 Wang et al. huautlense R.. galegae R. 1989 Martinez-Romero et al. 2004 Rivas et al. etli biovar mimosae 178 Manual de biología de suelos tropicales Frank.. Las citas referidas describen a las especies y/o comprueban su capacidad de nodulación. 2001. Jourand et al. 1998 Wang et al. conocidas anteriormente como rizobios.Familia/Género/Especie α-Proteobacteria-Orden Rhizobiales Referencia Rhizobiaceae Rhizobium R. Género. mongolense R. Tabla 6. Jordan. 1991 Segovia et al. 2001. 1997 Chen et al. tropici R. por esta razón. el nombre ”rhizobia” ya no resulta idóneo para describir bacterias formadoras de nódulos. giardinii R. giardinii biovars phaseoli. 1997 Amarger et al. leguminosarum biovars phaseoli.proteobacteria (por ejemplo. Una extensión reciente de conocimientos acerca de las bacterias formadoras de nódulos en leguminosas fue el descubrimiento que estableció que las bacterias pertenecientes al β-proteobacteria (género Burkholderia y Ralstonia/Cupriavidus) y a otras familias de la α. hainanense R.TAXONOMÍA ACTUAL DE BFNFNL Las bacterias fijadoras de nitrógeno. 1997 van Berkun et al. Sy et al.1). Methylobacterium Methylobacteriaceae y Dovosia Hyphomicrobiaceae) también pueden formar nódulos en leguminosas (Moulin et al. viceae R. una taxa a nivel familia de bacterias creada expresamente para acomodar organismos que pueden formar nódulos en leguminosas. gallicum R. 1993 Amarger et al. Familia. 1999a . 1889. trifolii. Especie de bacterias formadoras de nódulos en leguminosas. Filum/Orden. 1879. aunque se continúa usando en alguna literatura. 1938).1 Filum/Orden. forman nódulos en las raíces (y algunas veces en los tallos) de algunas especies de leguminosas y en las raíces de Parasponia spp.

2011 Zhang et al. miluonense R. oryzae R. 2003 Quan et al. 1994 de Lajudie et al. 2003 Scholla & Elkan. 2002 Toledo et al. 2001 Squartini et al. mesosinicum R. Chen et al. de Lajudie et al. tibeticum R. kummerowiae E. de Lajudie et al. 2008 Han et al. indigoferae R. pisi R. 2003 B acterias formadoras de nódulos en leguminosas 179 . morelense E. kostiense E. 1988. 2009 Li et al. teranga E. loessense R. fredii E. 1999 Nick et al. 1926. 1994. multihospitium R. 1984. daejeonense R. meliloti E. 2002 Wei et al. selenireducens R. Filum/Orden. xinjiangense E.1 Continúa. 2008 Ramirez-Bahena et al. 2002 Wei et al. 2008 Peng et al.Familia/ Género/Especie R. sullae R. tubonense Ensifer (Sinorhizobium) E. 1999 Wei et al. 1984. 1988 de Lajudie et al. 1988. Jordan et al. americanum Referencia Tan et al. 2011 Dangeard. 2009 Lin et al. saheli E. arboris E. medicae E. vignae R. lusitanum R. alkalisoli R. 2009 Hou et al. 1996 Nick et al. yanglingense R. 2008 Ren et al. 1994 Rome et al. 1994 Chen et al. Chen et al. Young. 2006 Hunter et al. 2005 Valverde et al. 2002 Wang et al. fabae R. 2008 Berge et al. 2007 Gu et al.Tabla 6. 2009 Tian et al. alamii R.

garamanticus E. iriomotense Bradyrhizobium (Blastobacter) B. 1997 Chen et al. 1997 Manual de biología de suelos tropicales . 1984 Kuykendall et al. pachyrhizi B. 2009 Lin et al. 2003. 2008 van Berkun & Eardly. 2006 Jordan et al. 2002 Vinuesa et al. huakuii 180 Referencia Casida. 2009 Merabet et al. (Rhizobium) undicola Agrobacterium* A (Rhizobium). liaoningense B. elkanii B. Young. chiapanecum E.Tabla 6.Familia/Género/ Especie E. adhaerens E. van Berkun et al. doebereinerae Phyllobacteriaceae Mesorhizobium M.canariense B. kummerowieae Bradyrhizobiaceae Bradyrhizobium B. Jarvis et al. denitrificans** Xanthobacteraceae Azorhizobium A.adiobacter/ tumefasciens Shinella S. 2008 Jordan. 2007 Rincon-Rosales et al. mexicanus E. japonicum B. 1982. Filum/Orden. 2002. 1998a. yuanmingense B. (2010) Merabet et al. 1992 Xu et al. 2001 Cummings et al. jicamae B. 2003 Lloret et al. Jarvis et al. (2010) de Lajudie et al. 2006** Dreyfus et al.1 Continúa. 1995 Yao et al. 1988 Moreira et al. 1984. loti M. caulinodans A. 2009 Ramírez-Bahena et al. Jarvis et al. 1991. Willems et al. 1982. Young et al. 2009 Islam et al. 2005a Ramírez-Bahena et al. numidicus Allorhizobium* A.

1997 Nour et al. trifolii P. 2009 Chen et al. shangrilense M. Jourand et al. 2001. 2010 Valverde et al. albiziae M. 2004 Wang et al.Familia/Género/ Especie M. opportunistum M. Jarvis et al. mediterraneum M. chacoense M. 1997 Chen et al. 2006 Sy et al. plurifarium M. 2010 Rivas et al. australicum M.Tabla 6. tarimense M. leguminum*** Methylobacteriaceae Methylobacterium M. Jarvis et al. 1998b Wang et al. 1994. temperatum M. 2004 Gao et al. 2008 Li et al. septentrionale M. caraganae M. Jarvis et al. 1995. neptuniea Referencia Nour et al. gobiense M. 2001 Gao et al. 1997 De Lajudie et al. amorphae M. metallidurans M. 2002. 2009 Nandasena et al. 2009 Vidal et al.1 Continúa. 2007 Gu et al. 2003 B acterias formadoras de nódulos en leguminosas 181 . 1999b Velásquez et al. ciceri M. cytisi O. 2005 Mantelin et al. 2007 Imran et al. 2005 Zurdo-Pineiro et al. 1995. 2009 Nandasena et al. lupini O. tianshanense M. 2008 Han et al. ifriqiyense*** P. 2004 Trujillo et al. ciceri Hyphomicrobiaceae Devosia D. Filum/Orden. 2006 Mantelin et al. 2008 Han et al.alhagi Phyllobacterium P. nodulans Brucellaceae Ochrobactrum O.

2002. Vermis et al.cepacia genomovar VI) B. subtrópico y zona templada) y Papilionoidae (13. rhizogenes. ** Estos autores no describieron estas especies. distribuidas en las subfamilias Caesalpinoideae (2250 spp. 2004) y más tarde del género Cupriavidus (Vandamme y Conye. mimosarum B.. Vandamme et al. únicamente el 57% del género y el 20% de las espe182 Manual de biología de suelos tropicales . 2002 Vandamme et al.1 Continúa. caribensis B. 2005). vitis y (Young et al. El alcance de la simbiosis con BFNFNL entre leguminosas queda todavía sujeta a investigación. del trópico. dolosa (B. 2001) y A. yakushimensis β-Proteobacteria Orden Burkholderiales Burkolderiaceae Burkholderia **** B. (Ralstonia) taiwanensis ***** Referencia Bautista et al. 2002 Vandamme et al. pero descubrieron que pueden formar nódulos en leguminosas y la propusieron para que se incluyera en el género Bradyrhizobium. *** Fueron aislados de nódulos.. Las leguminosas contienen alrededor de 20 mil especies. Mimosoideae (3270 spp.Familia/Género/ Especie D. **** Estos autores no describieron el género. 2004) fueron propuestos para acomodar dichas especies de Ralstonia. A. pero su capacidad de nodular no fue comprobada. phymatum B. 2002 Achouak et al. 2001 Vandamme et al. pero descubrieron que pueden formar nódulos en leguminosas ***** El género Wautersia (Vaneechoutte et al. Hasta 1989. tuberum B. nodosa B. en su mayoría plantas tropicales leñosas). en su mayoría herbáceas) (Lewis et al. 2006 Chen et al. adiobacter).Tabla 6. plantas leñosas. 2010 Moulin et al.. 2007 Chen et al. 2008 Chen et al. tumetaciens (syn. larrimoorei (Young 2004) en Rhizobium. 2004 Chen et al. Arubi y A. Filum/Orden. 1999.. A. sabie Cupriavidus (Ralstonia) C. Vandamme & Conye 2004 Notas: * Se propuso incluir a las especies Agrobacterium como A.800 spp. 2001..

los nódulos pueden muestrearse en plantas cultivadas en el campo (colecciones in situ). Sin embargo. la taxonomía del BFNFNL estaba basada en cepas aisladas de cultivos de zonas templadas. 1992). únicamente el 25% de las especies existentes han sido examinadas. De esta manera. 1992. para poder estimar la población de BFNFNL en el suelo. 1982. y se esperan más revisiones en un futuro.cies habían sido examinadas por la formación de nódulos y los porcentajes de las especies que sí podían formar nódulos se encontraron en porcentajes de 23. El cultivo posterior y caracterización de BFNFNL y de los nódulos. en selvas tropicales). como la que surge en el suelo. 1989.. es posible que nuevas simbiosis se identifiquen en el futuro. en 1984 (véase Tabla 6. Odee et al.. 1989). Para poder aislar o enumerar BFNFNL en una población microbiana diversa. de leguminosas hospederas. se requiere de un método que separe claramente BFNFNL de otras especies bacterianas y que permita un muestreo fácil y sistemático de los nódulos. muestran una B acterias formadoras de nódulos en leguminosas 183 . Tres especies de los géneros descritos de BFNFNL no fueron incluidas en la tabla porque no fueron aisladas de nódulos ni la capacidad de nodulación se comprobó hasta el momento: Rhizobium cellulosilyticum (García-Fraile et al.. Aunque algunas plantas hospederas se consideran muy promiscuas. especialmente en Brasil (Magalhães et al. Bradyrhizobium betae (Rivas et al.. Aunque se han llevado a cabo búsquedas extensivas para nuevos géneros y especies formadoras de nódulos. respectivamente (Faria et al. se estima que hoy en día. ahora que se encuentran disponibles las que han sido aisladas de otras especies y regiones. puede proveer información sobre la composición taxonómica de poblaciones de BFNFNL y determinar el grado de especificidad entre cepas específicas y candidatos hospederos. 2006) EVALUACIÓN DE DIVERSIDAD DE BFNFNL EN EL SUELO Los estudios sobre poblaciones y diversidad de BFNFNL dependen de un aislamiento exitoso de nódulos de raíces y ocasionalmente de tallos.. por ejemplo. Mimosoideae y Papilionoidae. en ecosistemas naturales (por ejemplo. 2007). aunque este método puede resultar difícil en el caso de hospederas perennes o leñosas (Moreira et al.. y que han sido desarrolladas nuevas técnicas de genética molecular..1).. 90 y 97% entre Caesalpinoideae. tradicionalmente. 2004) y Mesorhizobium thiogangeticum (Ghosh et al. Faria et al. 1995). El proceso de infección de la planta es el resultado de la formación de nódulos en sí. Moreira et al. ha ocurrido una revolución en la taxonomía con 90 especies y 10 géneros adicionadas a las 4 especies y a los 2 géneros originales enlistados por Jordan..

tiene una especificidad muy baja y puede ser nodulada por Rhizobium spp. representa una comprobación útil de la exactitud del procedimiento en el laboratorio. 1970). acetileno a etileno (Dilworth. siratro (Macroptilium atropurpureum) atrapa BFNFNL en los 98 puntos de muestreo del proyecto CSM-BGBD (Lima et al. Resultados preliminares de Taita. Lima et al. 2002.. De manera similar. 1988a). la comparación de BFNFNL. entre otros sustratos. se reporta que suele estar nodulado por la especie Bradyrhizobium (Woomer et al. Pereira.. 1997. pero. indican que M.. en la mayoría de los casos. 2000). punto de referencia CSM-BGBD. de manera natural. normalmente considerada como hospedero de Badyrhizobium. Odee et al. Moreira.. Antes de escoger las plantas hospederas para realizar un bioensayo. aisladas de nódulos formados de manera natural. El bioensayo para BFNFNL puede hacer uso de hospederos promiscuos. no existe ninguna cepa de BFNFNL que sea lo suficientemente promiscua como para nodular a todas las especies leguminosas. también cabe la posibilidad de que sea nodulado por especies de rápido crecimiento como Rhizobium (Pereira. Aunque algunas de las asociaciones mencionadas pueden ser relativamente específicas. 2000. También reduce. de manera contraria.. por Bradyrhizobium spp. cultivados en muestras de suelo tomadas del campo o inoculadas con suspensiones del suelo (Moreira et al.. Resultados obtenidos en Brasil (Alto río Solimões) muestran que caupí (Vigna unguiculata) captura más especies que M. Lewin et al. atropurpureum y que el frijol Phaseolus vulgaris. donde sea posible. de crecimiento lento. 2009). entre otras (Moreira et al. Lima. más variedad resultará de cepas de BFNFNL. únicamente. aisladas e identificadas. de rápido crecimiento. Para poder evaluar la diversidad de BFNFNL en el suelo. se recomienda llevar a cabo experimentos preliminares para cada tipo de suelo.. 1966. La nitrogenasa es la enzima responsable de la reducción del gas nitrógeno a amoniaco.. 2007) y Burkholderia. 1987 demostraron que Vigna unguiculata. 2006 y 2008. en Kenia. es deseable hacer uso de una variedad de especies de plantas hospederas candidatas y cuantas más sean empleadas. ningún hospedero promiscuo puede ser nodulado por todas las especies o cepas existentes de BFNFNL y. debería incluirse una especie leguminosa nativa como trampa hospedera. 2009). y. Por lo anterior. Las especies encontradas posteriormente deberían compararse con las especies que forman nódulos en el lugar.baja especificidad. de hecho. por ejemplo: Macroptilium atropurpureum es uno de los hospederos ampliamente conocido (Vicent. 184 Manual de biología de suelos tropicales . con los que se muestrea con el bioensayo.. 1993. en la mayoría de los casos. atropurpureum fue nodulado.

Una descripción previa fue hecha por Moreira en 2004. dado lo afanoso del procedimiento. con esto se B acterias formadoras de nódulos en leguminosas 185 . Paso 1A: recoger muestras de suelo del campo. METODOLOGÍA APLICADA EN EL PROYECTO CSM-BGBD: UNA REVISIÓN GENERAL Los pasos utilizados en la metodología para la caracterización de BFNFNL. resulta idóneo Macroptilium atropurpureum (siratro). cuyos seis pasos a seguir se muestran en la ilustración 3a hasta la 3f. dado que la anatomía de los nódulos varía ampliamente en forma y en tamaño.Schollhorn Burris. puesto que deben quedarse intactos para su aislamiento posterior o secarse cuando requieran ser almacenados durante un largo periodo. Los nódulos sin actividad de la nitrogenasa pueden estar senescentes o ser inefectivos. Esta reacción se utiliza como técnica para medir la actividad de la nitrogenasa. dentro de cámaras de crecimiento o invernadero. La actividad de la nitrogenasa constituye una información invaluable porque en muchos casos es imposible verificar que los nódulos aún son efectivos y viables (color interior rojo). deben utilizarse semillas de la misma procedencia. Por ejemplo. la gran ventaja de un ensayo de reducción de acetileno (ERA). el personal que no posee la suficiente experiencia podrá confundirlos con estructuras no inducidas por BFNFNL. como trampas para aislar las BFNFNL de las muestras del suelo. el uso de especies múltiples no es viable con un gran número de puntos de referencia (por ejemplo 100). 1966). sin embargo. El ensayo también puede usarse para confirmar una nueva simbiosis de BFNFNL o en el caso de nódulos no usuales (Moreira et al.. Paso 2A: para el proyecto se utiliza el método convencional de uso de especies promiscuas. 1987). Aunque el uso de ERA para obtener estimaciones cuantitativas de fijación de nitrógeno a la nutrición de la planta ha sido ampliamente discutido (Boddey. ya que posee pequeñas semillas y resulta fácil de manipular bajo condiciones controladas en bolsas de plástico y jarras de Leonard. tal y como se describe a continuación. se encuentran resumidos en la Figura 6. 1987. con una solución nutritiva. Bajo estas circunstancias. es barato y fácil de realizar aun en condiciones de campo. 1992). Giller. es que destaca por su gran sensibilidad y velocidad. aplicados en el proyecto CSM-BGBD. Es por ello que se emplea una única especie promiscua como trampa. resulta muy útil para la detección simple de fijadores de nitrógeno.1. y estará limitado por el tiempo disponible y las facilidades que ofrezca el laboratorio. Cuando se llevan a cabo varios experimentos.

Aislamiento de NLB de nódulos ** en YMA/79 con azul de bromotimol (Ilustración 3. Caracterización de cultivos (son necesarios los experimentos preliminares con suelo de selvas y cultivos de leguminosas para determinar el número de aislamientos requeridos para caracterizar las comunidades de simbiontes en su conjunto. d) caracterización de cultivo 3 A. Caupí (opcional) 3. dos controles sin inoculación (con o sin mineral N). basados en una 186 Manual de biología de suelos tropicales . 1A. más un control de una cepa conocida. Bioensayos con aislados: verificación (postulados de Koch) y propiedades simbióticas (número de nódulos y peso seco de materia). tales como dnaK. Claves de identificación de plantas. con la muestra de suelo. agar inclinado (Ilustración 3. capturadas con suspensiones de suelo 1:1. Jarra de Leonard.1 Evaluación de bacterias formadoras de nódulos en leguminosas. Nódulos de especies de plantas locales 5. * Puede usarse para conteo NMP (opcional). Doce muestras en cada punto de muestreo (véase esquema global CSM-BDBG. capturando BFN: técnica de infección de planta: inoculación de especies promiscuas. colectadas bajo condiciones asépticas Área de referencia /Uso del suelo/ Puntos de muestreo 1B. ** Algunos nódulos pueden guardarse en gel de sílice para su aislamiento. 3A. Origen del hospedero. Capítulo 2). Frijol (opcional) 4. Dos controles sin inoculación (con o sin mineral N) más un control con un tipo eficiente (Ilustración 3. (Ilustración 3. Nota: 1A. tamizar según características de cultivo y REP-PCR o perfiles de proteína (Ilustración 3. b). 2e) 1C. c) 2 B. Eficiencia de poblaciones nativas: número de nódulos. 12 muestras compuestas de suelo por punto. a). La eficiencia de poblaciones nativas es evaluada con la floración. otros genes. peso de materia seca y peso seco de planta (contenido N). 6. Captura de BFN. resumida en seis pasos. Caracterización de aislados verificados. eficiente. cuando se aprecian diferencias significativas entre tratamientos 4. Especies nativas (opcional) Bolsas de plástico (Ilustración 3. 2A.Figura 6.55% 1. especialmente para Bradyrhizobium). Almacenaje en frascos con gel de sílice o CaCl2 4. en caso necesario. Ensayo de reducción con acetileno (opcional) 3 B. índices de diversidad. representativos de grupos previos. f (ii). contenido de N por planta (opcional). peso seco de materia aérea de planta. secuencia del gen (16S rRNA para todos los géneros. fijadoras de nitrógeno en diversos sistemas de uso de suelo. 2A. solución de nutriente de suelo o NaCl a 0. Siratro* 2. utilizando la técnica de infección de planta.

B acterias formadoras de nódulos en leguminosas 187 . Las muestras de suelo en macetas pueden usarse únicamente cuando haya disponibilidad en los laboratorios y se deben seguir todas las técnicas asépticas normales de la microbiología. Para poder capturar BFNFNL. Las especies-trampas pueden usarse para capturar y contar BFNFNL o simplemente para capturarlas. por supuesto. es fácil de medir y proporciona información útil sobre la variabilidad y eficiencia de las poblaciones nativas. aunque también se puede aplicar a otros géneros). Los suelos con un alto contenido de N deberán evitarse. esto puede servir como un punto de referencia. jarras de Leonard o en macetas que contengan las muestras de suelo. Paso 3 A: aunque la eficiencia bajo condiciones controladas no refleja lo que está pasando in situ. Bradyrhizobium. éste no es obligatorio. en el tamizado de la colección entera de aislamientos (para conseguir racimos) y elementos repetitivos extragénicos palindrómicos/secuencias de DNA (REP-PCR) (u otros métodos como perfiles de proteínas por electroforesis con SDS-PAFE/poliacrilamida gel puede ser complementario). las cuales se describen a continuación. Después de las tres especies mencionadas (siratro. Se selecciona Phaseolus vulgaris con base en que en varios países existen datos. incluyendo algunas especies nativas que. Las dos especies fueron escogidas por ser bastante promiscuas y porque se cultivan en muchos países. pueden cultivarse especiestrampas en bolsas de plástico. caupí y frijol) se pueden seleccionar otras. incluso puede indi- curva de extinción de especies). otros factores limitantes como deficiencias de macro y micronutrientes. sobre poblaciones de BFNFNL donde se utiliza el frijol común como especie-trampa. para trampas promiscuas adicionales se recomienda usar Vigna unguiculata (como segunda especie) y Phaseolus vulgaris (frijol) como tercera especie. pueden ser diferentes en cada país. ni forma parte de la metodología estándar. Las semillas que se encuentren disponibles en la localidad proveerán información útil para agricultores del lugar. Representantes de racimos. deberán corregirse para los ensayos. Dada la complejidad del primer ejercicio. basados en características de cultivo (si este es el caso) y/u otro método deben ser secuenciados para 16SrRNA y otros genes como dnaK (por ejemplo. aún dispersos. acidez y un alto contenido de Al. El criterio para la selección debe basarse en que la especie-trampa sea ecológica y económicamente relevante para el país. aunque sería imposible estandarizar esta selección. Incluye características de cultivos obtenidos en el paso número 4.evita cualquier variación de NFNLB debida a las plantas. Cuando un equipo puede manejar más de una trampa de especies. debido a diferentes relaciones simbióticas (diferentes especies de plantas) y condiciones ambientales.

2001) porque los tipos de BFNFNL capturadas pueden variar también con la dilución (Bala et al.. 188 Manual de biología de suelos tropicales . en caso de no alcanzarlo. Se sabe que la diversidad genética en poblaciones naturales de las NFNLB del mismo lugar puede presentar diferencias entre los aislados de nódulos. a los del bioensayo y a los nódulos colectados en campo. formados en el campo. 2005).. en condiciones de laboratorio (Bala et al.2). proporcionarán los datos de la diversidad. Se necesitará aplicar las curvas de muestreo a todos los aislados. por ejemplo. pertenecientes a los diferentes sistemas de uso de suelo en cuestión. para una especie hospedera en particular. Una comparación de BFNFNL aisladas de nódulos del campo y de nódulos introducidos en una especie-trampa. por lo menos. con una inoculación de suspensiones de suelo. de ocho metros de radio alrededor de cada punto de muestreo. junto con los de nódulos recogidos de plantas nativas que naturalmente forman nódulos. de esta forma estarán disponibles para futuros aislamientos. Considerando que estas curvas se obtienen con base en el número de diferentes cultivos que todavía pueden mostrar características genéticas variables. lo que permite la construcción de curvas de muestreo para evaluar si la diversidad en un lugar ya ha sido completamente caracterizada. se necesitan entre 30 y 50 nódulos. los aislados de estos nódulos. es decir. se necesitarán más aislamientos para obtener una buena resolución.car la existencia de cepas eficientes en las poblaciones del suelo. tal y como se explicó anteriormente. deben ser inventariadas para que las relaciones con poblaciones naturales de BFNFNL puedan determinarse. en los diferentes sistemas de uso de suelo. Paso 1C: las especies de leguminosas en un área específica. Paso 4: después de la aparición y crecimiento de nódulos. y quizá más de 100 por uso del suelo (Jesús et al. 2001). Las curvas de muestreo (acumulación o escasez) pueden revelar el número de aislados requeridos para evaluar correctamente la diversidad. Los nódulos se almacenan en sílica gel (Figura 6. Paso 1B/2B. Cuando se usa la técnica de infección por planta. En la literatura se ha discutido que. los nódulos deberán muestrearse a partir de plantas que nodulen y representen niveles secuenciales de diluciones (Moreira y Pereira. 3B: se recomienda también que las BFNFNL sean aisladas de especies leguminosas (nativas e introducidas) que nodulan naturalmente. esto indica que no se han detectado todas las especies y que muestras adicionales (aisladas de nódulos) deberán ser analizadas. Este número se encuentra en el punto (asíntota) donde la curva alcanza su mayor nivel. cultivadas en una serie de diluciones de suelo.. 2001). hará posible la mejor evaluación de diversidad y de eficiencia de la especie-trampa. y los de plantas. las BFNFNL deben ser aisladas.

El aislamiento de BFNFNL de nódulos deberá hacerse en el medio 79 con azul de bromotimol (Fred y Waksman, 1928). El medio 79 se conoce también como YMA (Vincent, 1970) (anexo 6.1); esto permite la caracterización completa del cultivo (tasa de crecimiento, cambio de pH, producción de exo-polisacáridos, morfología de colonia, color, tamaño, etc.). Para obtener grupos a partir de estas características de cultivo. La diversidad genética de poblaciones de BFNFNL puede evaluarse al agrupar los perfiles que resultan de rep-PCR, utilizando un software como Gelcompar (Brujin et al., 1997) o mediante el uso de otra técnica: perfiles de proteínas por electroforesis con gel de SDS-Poliacrilamida; que dan una buena resolución a nivel cepa (Paso 6); sin embargo, esto puede ser opcional, de acuerdo con los recursos disponibles en cada país y debe llevarse a cabo después del paso 5 para evitar perder el tiempo con contaminantes. Finalmente, los representantes de cultivos de los clados generados mediante el agrupamiento por Rep-PCR u obtenidos mediante otros métodos se secuenciarán para obtener el gen 16SrRNA (Paso 6). Cuando existen recursos suficientes, dnaK u otros genes involucrados en el mantenimiento de la bacteria, tales como atpD, rpoB, recA, glnII (Parker, 2004; Vinuesa et al., 2005b; Gaunt et al., 2001), pueden ser probados para algunas cepas de género que no hayan sido bien discriminadas por 16 SrRNA, como en el caso de Bradyrhizobium.
Figura 6.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. Fuente: Moreira y Pereira, 2001.
1 ml de C2H2 Muestra de gas Tapón de goma (a) Vial (10 ml) 30 minutos a 1 hora Tapón de goma Tubo al vacío

Nódulo Nódulo efectivo Nase C2H2+2H++2e 2C2H4 Tubo de ensayo 8.5 ml (b)

Tapón de rosca Tapón de rosca, nódulo, algodón y sílica gel o CaCl2

B acterias

formadoras de nódulos en leguminosas

189

REQUERIMIENTO DE MATERIALES PARA TRABAJO DE CAMPO Y LABORATORIO Trabajo de campo: para muestrear suelo: alcohol al 95%, agua para eliminar el suelo del equipo de muestreo antes de la esterilización con alcohol, caja refrigeradora, bolsas de plástico esterilizadas (300 ml), espátula, bolsas grandes de plástico (5 l) y un pequeño sacabocados. Para muestrear nódulos: tijera pequeña, cuchara, azada y azadón, pinzas, pala, tubos de tapón de rosca, sílica gel o CaCl2 anhidro. Para resguardo de plantas: alcohol, prensa y periódico. Trabajo de laboratorio para aislar y enumerar BFNFNL: pipetas de 1 ml y 5 ml, solución para dilución, matraces Erlenmeyer de 1 L y 125 ml, agitador orbital, bolsas esterilizadas de plástico (125 ml) para crecimiento, tubos de ensayo (150 x 20 ml ó 200 x 30 mm), o botellas de cerveza recicladas, rejillas para bolsas de crecimiento o tubos, solución de nutrientes, semillas de plantas leguminosas hospederas promiscuas o nativas, temperatura ambiente controlada de luz y humedad. Trabajo de laboratorio para aislamiento de BFNFNL y caracterización de cultivos: cajas Petri, alcohol al 95%, HgCl2 al 0.1% (acidificado con HCl concentrado a 5ml/L) (Hipoclorito de Na o Ca; puede usarse H2O2 para sustituir al HgCl2), agua esterilizada, pinzas, medio de cultivo que contiene levaduras, manitol y sales minerales (hipoclorito de sodio o calcio, o H2O2 (pueden sustituir al HgCl2), agua esterilizada, pinzas, medio de agar con sales, levadura-manitol-mineral, pH6.8. Para la actividad de nitrogenasa mediante reducción de acetileno: matraces Kitasato Erlenmeyer, globo de hule, jeringas de 1 ml a prueba de gas, tubos de vacío de 5 ml, frascos de 10 ml o de mayor capacidad con tapones de goma, carburo de calcio CaC2, cromatógrafo de gases equipado con un detector de ionización de flama (FID) y columna RN Poropak para determinaciones de acetileno/etileno. Nota: los ensayos de nitrogenasa pueden llevarse a cabo en campo. MÉTODOS DETALLADOS Muestreo del suelo. Se saca una muestra de suelo a una profundidad de 20 cm, en 12 puntos, distribuidos alrededor de cada parcela de muestreo (véase Capítulo 2, Figura 2.3). Se utiliza el mismo esquema de extracción del núcleo para el muestreo en todos los grupos microbianos, incluyendo el BFNFNL. Se junta cada juego de 12 muestras, para formar una muestra compuesta de alrededor de 300 g que, posteriormente, se introduce en una bolsa plástica esterilizada. De manera alter190
Manual de biología de suelos tropicales

nativa, cuando lo permitan los recursos, se pueden obtener tres o más muestras compuestas en cada punto. Todas las herramientas: sacabocados, espátulas, azadón, etc. deberán lavarse muy bien con agua para remover partículas de suelo y ser esterilizadas mediante alcohol y flama antes y después de cada muestreo, con el fin de evitar la introducción de BFNFNL exóticas. Se deben minimizar las pisadas cerca de los puntos de extracción y la hojarasca deberá ser removida justo antes de que se lleve a cabo el muestreo. Las muestras de suelo se trasladan al laboratorio lo antes posible, utilizando un envase con aislamiento (preferiblemente debe permanecer a 4° C). Una segunda muestra compuesta de alrededor de 200 g será recogida en una bolsa de plástico no estéril para su análisis físico-químico. Muestreo de nódulos. Se deberán identificar plantas leguminosas dentro de un radio de 8 m (lo mismo que para un inventario de vegetación) en el punto de muestreo y se recogerá el material vegetal resultante. Será de gran ayuda contar con información previa acerca de cuáles son las especies que pueden nodular, de manera que se confine el muestreo a estas especies en concreto; sin embargo, hay que aclarar que existe un enorme potencial para el descubrimiento de nuevas especies de leguminosas de este tipo. En el caso de plantas herbáceas, se puede extraer todo el sistema de raíces del suelo, utilizando una azada, un azadón o una pala, cuidando no romper nódulos de manera accidental. Los nódulos de plantas leñosas deberán descubrirse extrayendo las raíces y poniendo gran atención para no dañar las ramificaciones delgadas en donde éstos normalmente se encuentran. Se debe verificar, con extremo cuidado, que las raíces delgadas pertenezcan a la planta leguminosa identificada; por este motivo, se recomienda empezar la excavación junto al tallo; se extirpan los nódulos (dejando un pedazo de raíz para facilitar la manipulación) y se guardan en tubos de tapón de rosca con un desecador (Figura 6.2b). Antes del almacenaje, las partículas de suelo deberán removerse, bien por sacudido o bien mediante lavado, retirando el exceso de agua con una servilleta. Por lo menos se recogerán 50 nódulos por cada punto de muestreo y la muestra será representativa de todas las especies nodulantes existentes en la parcela de muestreo. En ocasiones, algunos nódulos pueden ser demasiado grandes para los tubos normales de rosca: deberán ser almacenados en un recipiente de mayor capacidad. Actividad nitrogenasa. La actividad de nitrogenasa puede medirse en el campo o a partir de cada nódulo, justo después del muestreo o en el laboratorio (Figura 6.2). Se introduce el nódulo en un frasco de tapa de goma de 10 ml o de mayor capacidad, en caso necesario. Se produce acetileno en un matraz Kitasato Erlenmeyer
B acterias
formadoras de nódulos en leguminosas

191

por la reacción de CaC2 con agua (Figura 6.3). Si se lleva a cabo el trabajo en laboratorio, se obtiene acetileno de cilindros de gas comerciales. Se inyecta 1 ml de este gas en el frasco que contiene el nódulo. Después de una hora aproximadamente, se remueve 1 ml de gas de la superficie y se transfiere a un tubo al vacío para su posterior análisis de etileno por cromatografía de gases (Figura 6.2a). Especímenes de resguardos de plantas. Los especímenes de resguardos de plantas nodulantes, deberán recogerse en el área que se encuentra alrededor del punto de muestreo (radio de 8 m). Se debe poner especial atención en el etiquetado (véase a continuación) y si es posible, incluya flores y frutas. Enseguida, los especímenes se mandan al herbario para su identificación junto con una tarjeta de identificación de las mismas: Proyecto: CSM-BGBD Colector: Fátima Moreira Fecha: 2 de abril de 2005 Localidad: Benjamin Constant Altitud: 500 m Nombre vulgar de la especie: faveira Nombre científico de la especie: ¿? Número de vale: 05 Características del nódulo: crecimiento medio, tamaño 0.5 a 1.5 cm Descripción del lugar: pastizales abiertos con ganado y troncos de madera Tipo de suelo: limo arenoso
Figura 6.3 Producción de acetileno en campo o laboratorio.
Agua Globo de hule CaH2

Tubo de goma

CaC2

CaC2 + H2O ⇒ C2H2 + Ca (OH)2 Sólido Gas Sólido

192

Manual de biología de suelos tropicales

Características de la planta: herbácea con frutos maduros Otros comentarios: se recogieron semillas; flores amarillas. El conteo de BFNFNL. Se someten muestras de suelo a una serie de diluciones antes de la inoculación de las plantas hospederas candidatas (Figura 6.4). La correlación de diluciones varía entre 2.0 (1:2) y 14.5 (1:14.5), según la concentración de células esperada en la muestra. Esto significa una mayor dilución para suelos con más BFNFNL; sin embargo, aún es necesario inocular plantas hospederas en todas sus diluciones (véase a continuación). Asimismo, en cada dilución se debe emplear una réplica del bioensayo (2 a 5 veces). Las plantas se cultivan en condiciones controladas (Vicent, 1970) y después de 15 días, se les examina para ver si han formado nódulos. Las poblaciones de BFNFNL se estiman por el método del Número más Probable (Cochran 1950; Woomer et al., 1988b, 1999). En el caso de inocular las plantas únicamente para capturar las BFNFNL, las muestras de suelo deberán resuspenderse en agua esterilizada o en una solución de nutrientes (la misma que se utiliza para un medio de cultivo o crecimiento de plantas) (véase anexo 6.1 y 6.2) en una correspondencia 1:1. Las plantas pueden cultivarse en bolsas de plástico, jarras de Leonard u otro tipo de frasco. Se deben utilizar tres tipos de controles sin inoculante de suelo: el primero comprueba la presencia de contaminación durante los procedimientos experimentales. Si no se mantienen de manera correcta las condiciones axénicas, este control resultará en nódulos y el experimento se invalidará (aún cuando nódulos ocurren en una sola réplica). Se recomienda que el número de réplicas dentro de este control sea mayor que las réplicas de tratamientos de inoculación y el control debe localizarse dentro de diferentes posiciones en el protocolo. Los otros dos controles permitirán comprobar la eficiencia de las comunidades de BFN. Las comunidades que nodulan la planta hospedera indican si las condiciones del experimento (temperatura, concentraciones de nutrientes) son adecuadas para que se lleven a cabo la nodulación y la fijación de nitrógeno en las plantas y su crecimiento. El primero de los controles se complementa con nitrógeno mineral (para jarras de Leonard, 70 mg N-NH4NO3) cada semana desde la tercera hasta la penúltima, pero no se inocula. Para bolsas de plástico o recipientes de pequeños volúmenes, se utiliza una sola aplicación de 70 mg N-NH4NO3). De esta manera el caupí, que alcanza su nivel de floración en dos meses, con el uso de jarras de Leonard recibirán un total de 350 mg N-NH4NO3, mientras que los frijoles con un periodo de crecimiento de mes y medio, en jarras de Leonard, recibirán 280 mg de N-NH4NO3. El otro control se inoculará con un inoculante recomendado para esta
B acterias
formadoras de nódulos en leguminosas

193

especie de planta; por ejemplo, CIAT 899 para Phaseolus vulgaris en Brasil, pero no se añade nitrógeno. Aislamiento y caracterización de BFNFNL. Las BFNFNL son aisladas de los nódulos recogidos en campo y por bioensayo en el laboratorio. En el último caso, los nódulos obtenidos en cada dilución sucesiva pueden indicar cuáles son las cepas menos frecuentes en la muestra de suelo y cuáles, las más comunes. El primer paso será esterilizar la superficie de los nódulos con una breve inmersión en 95% de alcohol, seguida de una inmersión más larga de tres a cuatro minutos en HgCl2 (hipoclorito de Na o Ca, o H2O2 pueden usarse como sustitutos) y lavado mediante varios enjuagues con agua estéril (Vicent, 1970). A continuación se aplasta el nódulo dentro de unas gotas de agua estéril, utilizando pinzas y esto se vierte sobre un medio de agar. En el caso de los nódulos disecados, éstos deben remojarse en una solución de agua esterilizada para mejorar la absorción de la solución desinfectante. Los tiempos de inmersión en HgCl2 u otros desinfectantes, deberían ajustarse al tamaño del nódulo (más corto para nódulos pequeños). En la composición del medio de agar: levadura-manitol-sales minerales (Fred y Waksman, 1928) (Anexo 6.1), especialmente el pH y la fuente de carbohidrato pueden variarse, tomando en cuenta las condiciones específicas del suelo (Date y Halliday, 1979; Souza et al., 1984; Elkan y Bunn, 1991). Puede incluirse azul de bromotimol como indicador porque los cambios en el pH, causados por la formación de BFNFNL, pueden resultar útiles en la identificación de género. Otros caracteres incluyen: la tasa de crecimiento (tiempo TAIC de aparición de colonias aisladas), la cantidad de polisacáridos celulares, forma y tamaño de colonia, diámetro y color según lo descrito por Moreira et al. (1993) y Jesús et al. (2005). Los principales descriptores de cada género son: Allorhizobium, Rhizobium y Sinorhizobium: colonias circulares, de 2 a 4 mm de diámetro, normalmente unidas debido a la copiosa producción de polisacáridos extracelulares, convexas, semitraslúcidas, elevadas y mucilaginosas, la mayoría con el centro de color amarillo (debido al indicador de pH), de crecimiento rápido (TAIC: de 2 a 3 días). Mesorhizobium: igual que Rhizobium, pero normalmente de crecimiento más lento (TAIC: de 4 a 5 días). Bradyhizobium: colonias circulares que no exceden de un milímetro de diámetro, producción extracelular de polisacáridos de abundante a escasa (esto último, generalmente en el caso de los tipos que toman más de diez días para su crecimiento), opacas, raramente traslúcidas, blancas y convexas, granulares en textura y que producen un cambio de pH a alcalino, de crecimiento lento o muy lento (TAIC: de 6 a más días).
194
Manual de biología de suelos tropicales

Figura 6.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.

Paso de dilución

Nivel de dilución

El porcentaje base de la dilución (Nd) puede variar de 1:2 hasta 1:14.5 y el numero de replicas por dilución (N) de 2 a 5. Fuente: adaptado de Woomer, 1993 y Vincent, 1970 por Moreira y Pereira, 2001.
B acterias
formadoras de nódulos en leguminosas

195

1983). también conocidas como huellas 196 Manual de biología de suelos tropicales . contienen gránulos refráctiles de poly-β-hidroxibutirato en microscopio de contraste de fases. generalmente.. bajo condiciones bacteriológicas controladas. 1996). (1991) aportaron estándares mínimos para la descripción de nuevos géneros y especies. Recientemente. 1988. lo que puede ser muy útil para numerosos estudios.Azorhizobium: colonias circulares. secuencia de la subunidad pequeña del RNA ribosomal (Young y Haukka.. con la excepción de modificación de pH porque pueden producir una reacción ácida o alcalina (dependiendo de la edad). dentro de la especie puede ser genéticamente y fenotípicamente alta. 1993). en sus características simbióticas. de 0. con un poco más de producción extracelular de polisacáridos. lo que mejora no sólo la clasificación bacteriana. será necesario definir el nivel apropiado de diversidad que permita caracterizar géneros y especies específicos. En la Tabla 6. sino también la capacidad de discriminación dentro de diferentes taxas: cada una tiene un nivel específico de resolución para la clasificación bacteriana. perfiles de plásmidos (Giller et al. muy poca producción extracelular de polisacáridos (mucho menos que en el caso de Bradyhizobium). 1989). 1988). Graham et al. morfológicas y fisiológicas. de acuerdo con los postulados de Koch.. se han descrito nuevas técnicas para la caracterización de los procariotes. 1988).. por lo tanto. crecimiento en diferentes fuentes de carbono (Dreyfus et al. Las BFNFNL son bastoncillos Gram negativos que no forman esporas y que. por ejemplo Rhizobium. 1986). a veces. de color cremoso. mediante una demostración en la que formen nuevos nódulos en una planta hospedera de prueba. La diversidad de cepas.. hibridación rRNA-DNA y polimorfismos en los tamaños de fragmentos de restricción del DNA. lipopolisacáridos celulares (De Maagd et al. hibridación DNA:DNA.. Moreira et al. patrones totales de proteína por SDS-PAGE (Dreyfus et al.. Cupriavidus: similar a Azorhizobium. al mismo tiempo. 1988). resistencia intrínseca a los antibióticos (RIA) (Kingsley y Bohlool. donde incluyeron serología (Dudman y Belbin. Burkholderia: con características de crecimiento muy similares a las de crecimiento rápido. por ejemplo. Las cepas aisladas deben reconfirmarse como BFNFNL. Estas técnicas.5 mm de diámetro. composición de bases de DNA (%C + G).1 se pueden observar referencias que ofrecen amplios detalles de las características de especies de NFNLB. producen un cambio de pH a alcalino. de crecimiento rápido a medio (TAIC: de 3 a 4 días). electroforesis de enzimas metabólicas (Selander et al.

) (Rademaker y Bruijn. por otro lado. Extracción de DNA: el DNA genómico es aislado de cultivos de fases log en 79/YMA durante diferentes periodos de incubación. homología DNA:DNA) requiere de mucho tiempo y de equipo especializado y. en la actualidad. para cada tipo se suspende una azada con bacterias de una colonia aislada en 1 ml de agua B acterias formadoras de nódulos en leguminosas 197 . si se piden las placas completas de 96 muestras. AFLP (Polimorfismo de Tamaño de Fragmentos Amplificados) para el análisis de todo el genoma. la purificación y secuenciación de un fragmento de genes (una muestra) ya amplificada por PCR. Se pueden utilizar el kit “Ultraclean” para el aislamiento de DNA de suelo de los laboratorios MOBIO o cualquier otro kit recomendado por el productor. si existe disponibilidad de recursos. Empresas privadas dan buenos servicios para productos PCR y su purificación y secuenciación. Bruijn et al. Los métodos basados en la reacción de Polimerasa en Cadena (PCR). El número total de placas de 96 muestras cuesta alrededor de US $350 para la secuenciación. tales como ARDRA (Análisis de Restricción del rDNA Amplificado). REP-PCR (Huellas Genómicas de Elementos Genómicos Repetidos de DNA. incluyen: la digestión de DNA genómico con endonucleasas que cortan sitios (de restricción) poco frecuentes seguido por PFGE (Electroforesis en Gel en Campos Pulsados) y otros métodos de RFLP. dependiendo de la tasa de crecimiento específica para cada cepa (de 2 a 10 días). Los análisis numéricos con un número adecuado de cepas y la comparación con las cepas de BFNFNL permiten la caracterización de grandes poblaciones. la secuenciación de genes específicos puede aplicarse directamente a un número de cepas determinado por las curvas de rarefacción o acumulación. en algunos casos. 1997). 1997. Los costos y beneficios de una caracterización previa y secuenciación de representantes versus una secuenciación directa de un número mayor de aislados.. deben tomarse en cuenta. Los costos de la secuenciación de DNA se han reducido notablemente durante los últimos años y. Se cuantifica el DNA a A260 nm con un espectrofotómetro o se estima por comparación con diferentes estándares de concentraciones de DNA en geles de agarosa. La caracterización genética de DNA (secuencia del 16S. puede costar alrededor de US $6. tRNA-PCR o ITS (Amplificación y Análisis del tRNA y de Regiones Intergénicas del 16S-23S rRNA).genómicas. normalmente. 23S rARN u otras secuencias de genes. la secuenciación directa de 16S rARN u otros genes puede ofrecer ventajas económicas. Por ejemplo. RAPD (DNA polimórfico amplificado al azar): AP-PCR (PCR Con Arimers Arbitrarios). Alternativamente. se restringe únicamente a representantes de grupos.

Un paso de secuenciación del PCR amplificado se obtiene con el primer 27F. seguido por 30 ciclos de desnaturalización a 94°C durante 40 segundos.. pero también con el primer reverso 1492R. Sin embargo. respectivamente. Los genes casi completos del 16S rDNA se amplifican con un par de oligonucleótidos 27F (pA: 5`AGAGTTTGATCCTGGCTCAG) y 1492R (5´GGTTACCTTGTTACGACTT). 1990). del gen 16S del RNA ribosomal de Escherichia coli (Wilson et al. lo que produce una suspensión ligeramente turbia que posteriormente se hierve durante cinco minutos para lisar las células. Cuando se requiere la secuencia de todo el gen se deben elegir otros primers internos y usarse para amplificar y secuenciar el fragmento del gen que falte después de utilizar 27F y 1492R. 2. apareamiento a la temperatura de 55°C.esterilizada. 0. los cultivos puros se mantienen en agar inclinado dentro de tubos de tapa rosca en el mismo medio de cultivo. Se comparan las secuencias con otras conocidas contenidas en las bases de datos. o bien. durante 7 minutos. Las concentraciones finales en las mezclas de reacción (100 ml) son: 1 x PCR Buffer.jsp).cme.5 mm MgCl2.2 μm de cada oligonucleótido y dos unidades de la enzima Taq polimerasa (DNA extraído o cultivos líquidos): 6 μl. Análisis filogenético. El programa para PCR incluye un paso inicial: desnaturalizar a 94°C durante 5 minutos. Otros oligonucleótidos pueden utilizarse si permiten la síntesis de un gen 16S rARN casi completo. similares a los presentados en la Figura 6.nih. el European Bioinformatics Institute (EBI) secuenciación de base de datos (www. MANTENIMIENTO Y COLECCIÓN DE CULTIVOS PUROS Normalmente. se utiliza un volumen de esta suspensión como templado para el PCR.uk) y el Ribossomal Database Project (RDP) (http://rdp.ac. La purificación de los productos PCR se hace con filtros Microcon™ (Millipore) o mediante otros métodos de purificación.nlm. 198 Manual de biología de suelos tropicales . perfiles REP-PCR. La extensión final se lleva a cabo a 72°C. usando los aislamientos representativos de diferentes grupos (obtenidos bien por caracterización de cultivo.2 mm de cada dNTP. 0. tales como la del National Center for Biotechnology Information (NCBI) (www.gov/). la viabilidad de dichos cultivos no es larga: los métodos como liofilización y almacenaje en un congelador (–80°C) garantizan una larga conservación de las células viables.ncbi.edu/index. con extensión a 72°C durante 90 segundos. por otras técnicas).2. Secuenciación 16S rDNA.ebi. durante 40 segundos.msu. Estos pares de oligonucléotidos corresponden a posiciones 8-27 y 1507-1492.

nov. F.. (1975) Nitrogen Fixation in Bacteria and Higher Plants.. an exopolysaccharide-producing bacterium isolated from vertisol microaggregates in Martinique‘. A.. Bautista.. (2001) ‘Genetic diversity of rhizobia varies from natural populations with the soil dilution sampled’. (1987) ‘Methods for quantification of nitrogen fixation associated with Graminae’.. nov. Chen... N.. International Journal of Systematic Bacteriology. Christien. R. Y. Elliot. y Achouak. Sprent. . W. Chou. New York. V. Soil Biology and Biochemistry. nov... M..: A bacterial predator of bacteria in soil’. M.H. y Yakta. J...AGRADECIMIENTOS Agradecimientos especiales por sus comentarios y revisiones a los Drs. G. Chou. M. from Phaseolus vulgaris nodules’. P... J.... W. Boddey. Bontemps. (2009) ´Rhizobium alamii sp. C. nov.P. vol 32. S. David Odee y Nancy Karanja.. REFERENCIAS Achouak. Giller.. L.V. (2008) ´Burkholderia sabiae sp. International Journal of Systematic Bacteriology. I.. James. K. isolated from root nodules of Mimosa caesalpiniifolia´ International Journal of Systematic and Evolutionary Microbiology vol 58. A. De Faria..H. Marlet. pp2174-2179. James. W.. E. P. N. Sprent.. y Laguerre. Santealla. G.pp367-372. K. (2007)´ Burkholderia nodosa sp. S. Brandelet. W. De Faria. Cnockaert. K. Murphy. C. Monsalud. W. R. R. E. Bala. G.. nov. Casida Jr. Y.G.. Macheret. M. M. (1997) ‘Rhizobium gallicum sp. y Vandamme. T. pp841–843. C.) Ohwi´ International Journal of Systematic and Evolutionary Microbiology vol 60.. P. Lodhi. isoled from root nodules of Pueraria lobata (Willd.. nov. and Rhizobium giardinii sp. J. vol 47. B acterias formadoras de nódulos en leguminosas 199 . y Heulint. R. nov.. (2010) ´Devosia yakushimensis sp. M. (1999) ‘Burkholderia caribensis sp.787-749. pp627-632. Young. vol 33. E.. vol 16. Heulin. Lin. Chen. Burns. Christen. S. G. Berge. J. A. R. M. V.. Critical Reviews in Plant Sciences. nov.W y Vandamme. y Hardy. Sheu. I.. N.. pp996–1006. Elliot. pp339–345. Amarger. International Journal of Systematic and Evolutionary Microbiology vol 49.. O. pp209–266.. Esperanza Martínez. R. (1982) ‘Ensifer adhaerens gen.. M. Barakat. E.. M. Springer-Verlag. pp. K. J. sp. Roncato. nov. an exopolysaccharide-producing species isolated from legume and non-legume rhizospheres´ International Journal of Systematic and Evolutionary Microbiology vol 59. J. T.

Y. H. T. vol 11. D. Wang. Bontemps. W. Lee. Vos. 200 Manual de biología de suelos tropicales . S. vol 57. K. isolated from wild Alhagi sparsifolia in north-western China´. Li. Biometrics. E. M. nov. Y. pp105-116. International Journal of Systematic Bacteriology. Gyaneshwar.. H.. pp1729–1735. vol 16.. from Taiwan and South America’. J. S. International Journal of Systematic Bacteriology. Mergeay. W.F.. Chen. W.P.. nov.’. Cummings. y Li. vol 38.. y Wang..isolated from root nodules of the woody Brazilian legumes Mimosa bimucronata and Mimosa scabrella´ International Journal of Systematic Bacteriology. T. nov. L.M. y Li. W. (2009) ´Nodulation of Sebania species by Rhizobium (Agrobacterium) strain IRBG74 and other rhizobia´Environmental Microbiology. F. L. International Journal of Systematic Bacteriology. pp153–159. E.M. M.P. F. W. Wang. Laevens.. J. pp2510-2525. Barrios. vol 41.W y Wei.. Tan.. I. X. S. International Journal of Systematic and Evolutionary Microbiology.I..P. M. (2006) ‘Burkholderia mimosarum sp. J. Chen. A. Li. Y. vol. P. G. J. Andrews. y James. J... (1926) ‘Recherches sur les tubercles radicaux des légumineuses’. International Journal of Systematic and Evolutionary Microbiology vol 60 pp958962. y Vandamme. Young. Wang. People’s Republic of China’... Botaniste (Paris).W.. pp392–397. L. G. M. S. Chen. Chen. (1995) ‘Characteristics of Rhizobium tianshanense sp.. S.. D. M. (1988) ‘Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned to Sinorhizobium gen. Viniesa. J. P. vol 47. X. (2010) ´Mesorhizobium alhagi sp.. 6. L.... L. Li. (2001) ‘Ralstonia taiwanensis sp. Yan. pp1–275. Zhu.. G.G. E. P. isolated from the root nodules of Astragalus sinicus’. P. C. J.T.. nov. Sprent. W. P.. T. Z.. International Journal of Systematic and Evolutionary Microbiology vol 51. pp275–280. Moreira... G. Chen. y Li. Sprent. Coenye. International Journal of Systematic Bacteriology. nov. pp10551059. isolated from nodules of Mimosa spp. Qi. M. W. Yuan. Y. vol 45.. T. W... J. isolated from nodules of Mimosa species and sputum of a cystic fibrosis patient’. pp870–873. Chen.. Young. (1950) Estimation of bacterial densities by names of the “most probable number”.. Shen. James. E. S.. Chen. Farruggia.. nov. W. (1997) ‘Rhizobium hainanense sp. X. Y.. Dangeard. Odee. X..K. pp1847–1851. nov. P. M. T. E. Elliot. E. isolated from tropical legumes’. y Vandamme. Gao. N. Coenye. Humphry. vol 56. Chen... Chou.S. Cochran. a moderately and slowly growing root nodule bacterium isolated from an arid saline environment in Xinjiang. Faria. (1991) ‘Rhizobiumhuakuii sp. X.

F. (1988) ‘Recognition of individual strains of fast-growing rhizobia by using profiles of membrane proteins and lipopolysaccharides’. J. C. pp1825–1830. The Prokaryotes.. y Gillis. B.. Collins. B. Balows. J.. pp89–98. Nature.. International Journal of Systematic Bacteriology. E. M. M. Millcamps. and Sinorhizobium teranga sp. Kersters. Schlegel and H. L. J.. D. Sinorhizobium saheli sp. (1988) ‘Numerical taxonomic analysis of some strains of Rhizobium spp.. B. vol 48. van Rossum. Hoste. M.. L. B acterias formadoras de nódulos en leguminosas 201 . y Belbin. De Lajudie. A. pp715–733. De Bruijn. vol 54. H. H. Dreyfus. Moreira. (1994) ‘Polyphasic taxonomy of rhizobia: Emendation of the genus Sinorhizobium and description of Sinorhizobium meliloti com. Willems.. Schultz. Collins. nov.Date. D. Struffi... P. B. U..’. L. sp. A. pp369–382. P. M.. J. Garcia.. U. y Gilles. (1997) ‘Molecular approaches in microbial ecology to assess genomic diversity and stress-induced gene expression in plantassociated diazotrophs’. G. in C.. J. Dreyfus. vol 44. Truper (eds). nov.. Dworkin.. Neyra. Dudman. isolation. A. Elkan (ed) Symbiotic Nitrogen Fixation Technology. (1987) ‘Collection. Applied and Environmental Microbiology. M. pp1277–1290. D. R. International Journal of Systematic Bacteriology.. Elmerich.. 2nd Edition. B. Pot. M. Molouba. vol 48. (1966) ‘Acetylene reduction by nitrogen fixing preparations of Clostridium pasteurianum’. F.. Maestrojuan. y Gillis. nov.. P. Date. a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata’. nov... Newton (eds) Biological Nitrogen Fixation for the 21st Century. R. H.. M. Kondorosi and W. F. Marcel Dekker Inc.. (1998a) ‘Allorhizobium undicola gen. Springer-Verlag. y Halliday.’. G. nov. De Lajudie. F. E. pp62–64. E. Neyra. A. Dordrecht. International Journal of Systematic Bacteriology. Torck. in G. (1979) ‘Selecting Rhizobium for acid. pp285–294. W... A.. vol 127. International Journal of Systematic Bacteriology. Laurent-Fulele. Willems. Ragatz.. Kluwer Academic Publishers. R.. y Lugtenberg. Willems. vol 277. M. in A. vol 170. nitrogenfixing bacteria that efficiently nodulate Neptunia natans in Senegal’. New York. G. that uses a qualitative coding of immunodiffusion reactions’. D. P. Dreyfus. Dilworth. De Maagd.. cultivation and maintenance of rhizobia’ . J. Collins. K. (1988) ‘Characterization of Azorhizobium caulinodans gen. y Gillis. infertile soils of the tropics’.. y Bunn. De Lajudie. Journal of Bacteriology. L. J. McSpadden-Gardener... Torck. Dreyfus. (1991) ‘The Rhizobia’. (1998b) ‘Characterization of tropical tree rhizobia and description of Mesorhizobium plurifarium sp. Davey. Dewettinck. B. Coopman. W. M. B. Kersters. M. Rademaker. Berlin. Lindstrom. J. sp. M. nov.. R. K. Nick. y Stoltzfus. Elkan. y Halliday.. D. vol 38. R. A.. G. pp3782–3785. A. A.. Biochemica et Bioophysica Acta.. M. C. nov. M. nov.. K.

. B. (2008) Rhizobium miluonense sp. Turner.P. E.Faria. Gu.. M. (1987) ‘Use and abuse of the acetylene reduction assay for measurement of “associative” nitrogen fixation’. X. y Waksman. Ghosh. J. Jarvis. J. vol 37. W. S. Inc. y Velázquez. pp332–346. P. Willems.. Giller. W. A. J.. New Phytologist. Turner. Y. W. vol 56. Graham. nov.. S. pp 844-848.. R. (1879) ‘Ueber die Parasiten in den Wurzelan-schwillungen der Papilionaceen’. P. Barnet. Soil Biology and Biochemistry. B. J.. Martens. J. S. pp 841–848. New York and London. Rigottier-Gois. Lloyd-Macgilp. vol 41. Bradley. International Journal of Systematic and Evolutionary Microbiology. R. S. Martínez-Molina.. Wang. W. W.. B. y Young..F.. Cooper. Young. L. y Young. H.F.X. M. E..and stem-nodulating bacteria’.. Tan. M.. Gao. and Mesorhizobium temperatum sp. (1989) ‘Occurrence of nodulation in the Leguminosae’. nov. Berichte der Deutschen Botanischem Gesellschaft. W. Lewis. K.. G. P. International Journal of Systematic and Evolutionary Microbiology. isolated from sawdust of Populus alba’.. A. P. (1991) ‘Proposed minimum styards for the description of new genera and species of root. J. Strijdom. (2006) ´Mesorhizobium thiogangeticum sp. S. L. L. P.F. W. pp 607–619. y Sutherly... nov. E.. P. Qiu. E. B. vol 21. (1889) ‘Ueber die Pilzsymbiose der Leguminosen’. W. S.T. Giller. Wang. Keyser. E. y Chen. vol 111. Sui.M. E. pp2037–2048. K. Frank. B. pp376–387.. McGraw-Hill Book Company. a novel sulfur-oxidizing chemolithoautotroph from rhizosphere soil of an Indian tropical leguminous plant´. pp2003–2012. P. H. J. García-Fraile. M. Frank. I. McGrath.. R. Soil Biology and Biochemistry. pp 582–587. pp91-97. (2004) ‘Mesorhizobium septentrionale sp. Lindstrom... vol 19. W. nov. Rivas. E. a symbiotic bacterium isolated from Lespedeza root 202 Manual de biología de suelos tropicales .nov.. vol5.. 394–399. (1989) ‘Absence of nitrogen fixation in clover grown on soil subject to long-term contamination with heavy metals is due to survival of only ineffective Rhizobium’.. vol 7. Sprent. Z. International Journal of Systematicand Evolutionary Microbiology. H. y Hirsch. F. Chen. T. W. T. Botanik Zeitung.T.. Han. Y. Z. B... J. Terefework.. L. E.. J. Roslycky. M. D.. X. International Journal of Systematic Bacteriology. International Journal of Systematic and Evolutionary Microbiology. K. y Roy. Gaunt. vol 57. Sadowsky.. P. vol 51.. Mateos. C.. isolated from Astragalus adsurgens growing in the northernregions of China’. S. H. (2007) Rhizobium cellulosilyticum sp..X.H. R. A. y Chen. Peix. E. Y. Fred. pp783–784. (2001) ‘Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia’. L. Tian. (1928) Laboratory Manual of General Microbiology. C. de Ley. A. Kan...

X. Y.. Rodrigues.pp3051-3057. International Journal of Systematic and Evolutionary Microbiology. vol 58. E. nov..T. Chen... (2008) ‘Bradyrhizobium iriomotense sp.s.. J. Y. pp1416-1429. W.. Oliveira. International Journal of Systematic and Evolutionary Microbiology. Hafeez.... L. Jarvis.nodules‘.H.K. International Journal of Systematic Bacteriology.(2008) ‘Rhizobium multihospitium sp. Kuykendall. nov. W. M. E. and Mesorhizobium tarimense sp. D.. isolated from multiple legume species native of Xinjiang.F. Rhizobium mediterraneum and Rhizobium tianshanense to Mesorhizobium gen. 895–898. nov.. vol 58. vol58. Biotechnol. X. Biosci. nov.F. Y. R...1553. W. W. y Patel. Biochem vol 72. Muramatsu. Tian C.C. B. X.J. W. W.. C. Florentino. M. Rhizobuim huakuii. Wu. B.X. pp1693-1699. (1997) ‘Transfer of Rhizobium loti.H. A. S.T. (1982) ‘Rhizobium loti. China‘. D. nov.X. C.) Vassilcz´. Jarvis.. J. B. (2009) ´Rhizobium tibeticum sp. a novel rhizobial species nodulated with Caragana spp. E. Chen.. Lu. Jesus. Mesorhizobium caraganae sp. F. Kawasaki. a new species of legume root nodule bacteria’. M. Wang. Han. Isolated from a Tumor-Like Root of the Legume Entada koshunensis from Iriomote Island in Japan‘. Islam. Wang.J. y Stackebrandt. E. M. (2008) Mesorhizobium gobiense sp. Wu.T. Cleyet-Marel.. International Journal of Systematic Bacteriology. J. Gu. L.. Y. E. Y. pp455-460..vol 59.R. nov. L. Chen.. P. Wang. P. T. I. Frühling. e Seky.International Journal of Systematic and Evolutionary Microbiology.. Nour. L.T.. vol 55... Imran.’. Gu. Gu.. in China ‘. International Journal of Systematic and Evolutionary Microbiology. M.. W.. pp378–380. Nakagaka. A. (2010)´Ochrobactrum ciceri sp. y Chen. J. K. pp2646-2653.X. D. nov. C. Li. y Manter D.F. Han.... T... Jia. Yan. Dong.. (2005) ‘Leguminosae nodulating bacteria diversity from three different land use B acterias formadoras de nódulos en leguminosas 203 . E. W. Chen. Schumann. Fernyez. y Gillis. Zhang.. L. van Berkum. Hunter.G. M. a symbiotic bacterium isolated from Trigonella archiducis-nicolai (irj. X.B.X. vol58. vol 32.F. vol 60: 1548 . y Chen. Gao. Y. pp1364-1368. Sui. C.F.. Wang.. isolated from nodules of Cicer arietinum´. isolated from wild legumes growing in desert soils of Xinjiang. W.. nov.: a selenite-reducing (alpha)-Protobacteria isolated from a bioreactor´Current Microbiology. y Moreira. y Chen. Chen.G.. T.. F. vol 47.T. S. J.J.. Rhizobium ciceri. A.. R.I. W. E.. China‘. A.X. International Journal of Systematic and Evolutionary Microbiology. (2008). P. (2007) ´ Rhizobium selenireducens so. Hou. pp2610-2618. Pankhurst. Malik. y Chen. W.L. X. S.J.Z. H. M. nov.. Guan. International Journal of Systematic and Evolutionary Microbiology...X.. W. Han.

. vol 54.. B.H.. B. Canadian Journal of Microbiology. Han. W. Li. G. L. D... (2009) ´ Mesorhizobium shangrilense sp.T. pp769–776. Jordan. W. M. D. nov. F.. vol 59.H. Hu. D. W. legume root-nodule-forming and nitrogen fixing bacteria’. International Journal of Systematic and Evolutionary Microbiology. N. D. W. F. (1992) ‘Genetic diversity in Bradyrhizobium japonicum and a proposal for Bradyrhizobium elkanii sp. G. vol 29.. y Udell. J. (1984) ‘Rhizobiaceae Conn 1938’. Chen. Sui.. C. y de Lajudie. y Chen. Schrire. isolated from Caragana intermedia growing in saline-alkaline soils in the north of China´. Pesquisa agropecuária Brasileira. He. (1987) ‘Multiple host-specificity loci of the broad host-range Rhizobium sp. Saxena. B.. (2008) ´ Shinella kummerowiae sp. H. E. W..F. Lewin. T. Han. Wang. isolated from root nodules of Caragana species ‘. vol 8. (2009)´Rhizobium alkalisoli sp.. (1983) ‘Characterization of Rhizobium sp. (Cicer arietinum L. C. X. C. J. Kew. Meyer.. pp30123018. Mackinder. Tang. pp3006-3011. B. Plant Molecular Biology. Willems. y Chen.. NGR234 selected using the widely compatible legume Vigna unguiculata’..R. Krieg and J. a symbiotic bacterium isolated from root nodules of the herbal legume Kummerowia stipulacea ‘. W. (2009)´Rhizobium mesosinicum sp.F.X. Sy. y Chen.T. H. International Journal of Systematic and Evolutionary Microbiology. nov.Y. S. Holt (eds) Bergey’s Manual of Systematic Bacteriology. Wang E. vol 59: 1919 ..Y.) by immunofluorescence. Lin. Wang E. M. Wong. y Lock. y Bohlool. P. Rosenberg..T.. Chen. Jourand... vol 59. Li. Bena. A. A. Wang E. Wang. J.L. Hu. Y.. D.systems in Brazilian Western Amazon’. isolated from root nodules of three different legume´. R. (2004) ‘Methylobacterium nodulans sp. Giraud. pp1409-1413.. B.Q. London.. B. Lewis.. Guan.. vol 40.. Wang.X.H. W.... Nelson. Williams and Wilkins. D. A. Dreyfus. International Journal of Systematic and Evolutionary Microbiology. Royal Botanic Gardens. in N.1923.X. y Broughton. E.. S.’.X. Dowling.. 204 Manual de biología de suelos tropicales . Chen. pp518–526. vol 58. P.. F. y Chen. International Journal of Systematic and Evolutionary Microbiology. Canadian Journal of Microbiology.nov.. nov. W. L. vol 38. Lin. T...X. Gillis. for a group of aerobic facultatively methylotrophic. Sui. J.Q.L. L. H. pp447–459.. International Journal of Systematic and Evolutionary Microbiology.X. Kingsley...F. X. T. L. Devine.T..X. Manen.. Kuykendall. pp2269–2273.. E. D. nov. nov.. immunodiffusion and intrinsic antibiotic resistance’. D. Stanley. pp501–505. Dénarie. (2005) Legumes of the world. M.

(1982) ´Ocurrência de nodulacão en leguminosas florestais notivas de terra firme da região de ManausAM´. A. F.´.. Domergue. Mahdhi. PP.. F.M. y de Lajudie. Llorente. Rogel-Hernández.... K. M. Argyrolobium uniflorum and Medicago sativa (Tunisia) and description of Ensifer numidicus sp. and Ensifer garamanticus sp. L. A. nov. International Journal of Systematic Bacteriology. International Journal of Systematic and Evolutionary Microbiology. A. (2007)´Ensifer mexicanus sp.. nov. J. pp417– 426. (1989) ‘Rhizobium galegae. Magalhães. and Phyllobacterium brassicacearum sp. Martínez-Romero. Willems. Annual meeting report 4. B acterias formadoras de nódulos en leguminosas 205 .. M.. y Martínez-Romero..S. vol 30. Silva. G. eficiência e diversidade de bactérias fixadoras de N2 que nodulam o siratro (Macroptilium atropurpureum) de solos sob diferentes usos na Amazônia Ocidental’. pp827-839. Lindström. L. H.M. Martínez-Romero. (2006) ´Emended description of the genus Phyllobacterium and description of four novel species associated with plant roots: Phyllobacterium bourgognense sp. C.S. S. (2009) ´Nitrogen-fixing bacteria communities occurring in soils under different uses in the Western Amazon Region as indicated by nodulation of siratro (Macroptilium atropurpureum)´ Plant and Soil. L.. R. Ferreira..A. Acta Amazônica. nov.A. nov. Lotus creticus. M.) Kuntze in Mexico. F. P. nov. y Cleyet-Marel. E... vol 12.. Barberi. (1991) ‘Rhizobium tropici. Merabet. (2007) ‘Densidade. J. Lima. D. E. Le Roux. International Journal of Systematic Bacteriology. Oliveira. F.Lima. Mercante. Zakhia. O.. pp509-514. P. S. M. C. vol 319. Systematic and Applied Microbiology.. B. E. Franco.. A. M.. R. Nairobi. A. F. J. a new species of legume root nodule bacteria’. PhD Thesis.. vol 60: 664 . K.127-145.. pp280-290. y Döbereiner. beans and Leucaena trees’. Phyllobacterium ifriqiyense sp.F. S. M.M. a new specie nodulating Acacia angustissima (Mill. Ormeno-Orrillo.S. Minas Gerais. A. Jeder. International Journal of Systematic and Evolutionary Microbiology. Phyllobacterium leguminum sp. Martens. Conservation and Sustainable Management of Below-ground Biodiversity CSM-BGBD. Magalhães. A.A. Sy. Universidade Federal de Lavras. P. Rincon.. Moreira. (2004) ‘Methodology for the inventory of nitrogen-fixing Leguminosae nodulating bacteria’. Nóbrega.. Coopman... Kenya.. Mantelin. Bekki.. S. y Moreira. Béna.674. M. Zakhia. vol 41. a new species nodulating Phaseolus vulgaris L. Mars. vol 56. pp365–367.. F. nov. Fischer-Le Saux.. Segovia. de Lajudie.S. Brasil.. Graham.C.. A. vol 39.M. y Pardo.R. A. L.. (2010) Multilocus sequence analysis of root nodule isolates from Lotus arabicus (Senegal). Bonneau. nov´.

S. O. M.. microsymbiont of Sesbania virgata (Caz. F. (2009) Mesorhizobium australicum sp. Moreira. International Journal of Systematic Microbiology. vol 49. Nour. S. (1994) ‘Genotypic y phenotypic diversity of Rhizobium isolated from chickpea (Cicer arietnum L. K. Marsh. M. M.nov.. J. Systematic and Applied Microbiology. (2006) ‘Azorhizobium doebereinerae sp. S. O’Hara.. O. F. nov.. Moulin. M. Bogor. nov. Martínez-Romero.W. (2002) ‘Burkholderia spp. pp135–146.. S... 768pp. M. pp345–354. Moreira. Gillis.. S. M. M. in M. (1999) ‘Sinorhizobium arboris sp. Moreira. M. Siqueira and L. (2008) ‘Bactérias fixadoras de nitrogênio que nodulam Leguminosae’. L. y Pereira. A. W.. F.G. y Marsh. M. G. Memorias da XXI Reunión Latinoamericana de rhizobiologia. L. Kersters. M. M. A... B. Canadian Journal of Microbiology. Moreira. y Lidstrom. S. S. pp2140-2147. (2001) ‘Nodulation of legumes by members of the b sub-class of Proteobacteri’. F.. G.. T. J. Wallingford. vol 40. K. Eardly. F. Faria. International Journal of Systematic and Evolutionary Microbiology.. in F. vol 16. A. Moreira. Systematic and Applied Microbiology. M. S. isolated from Biserrula pelecinus L.. UFLA. New Phytologist. M. 206 Manual de biología de suelos tropicales . M. J. Willems. Zhang. pp948–950. B. y Franco. F.Moreira. R. M. de Lajudie. Brussaard (eds) Biodiversidade do solo em ecossistemas brasileiros. (1992) ‘Occurrence of nodulation in legume species in the Amazon region of Brazil’. vol 59. M. Tiedje. S.) Pers.’. Silva. K. P. F. G. Tiwari. O. y Young. Swift and D. Munive. y Howieson.)’. isolated from leguminous trees in Sudan and Kenya’.. A. T. Nature. Suomalainen. in F. CAB International. Paulin. Gillis. E. Editora. C. International Centre for Research in Agroforestry. Siqueira and L. M. y Fernandez. L.. Bignell (eds) Standard Methods for Assessment of Soil Biodiversity and Land Use Practice.. nov. Cruz. C. Moreira. Beck. Dreyfus. L. X. and Sinorhizobium kostiense sp. y Bolvin-Masson. vol 29. Pitard. pp1359–1368. A. E. Effosse. Cocoyoacan.org/AG/agl/agll/soilbiod/docs/manual-soil%2).. y Faria. pp197–206. (2001) ‘Microsymbionts: rhizobia’. P. S. in Australia´. Nick. S. (2006) ‘Nitrogen-fixing Leguminosae nodulating bacteria’. 280pp.. vol 121. R. and Mesorhizobium opportunistum sp. Moreira. México. Pot.. S. B. J. Lavras. P. S... (1993) ‘Characterization of rhizobia isolated from different divergence groups of tropical Leguminosae by comparative polyacrylamide gel electrophoresis of their total proteins. Pedrosa.. pp563–570.. F. F. D. Moreira.. D.. Indonesia (available at http://fao.P. J. Cleyet-Marel. Brussaard (eds) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. vol 411.. Nandasena.G. nov. are among fast growing symbiotic diazotrophs isolated from diverse land use systems in Amazônia and from Brazilian Leguminosae forest species’. J.

J. Z. and Overviews. Plant and Soil. McInroy.. M. J. I.H... International Journal of Systematic and Evolutionary Microbiology. Martínez-Molina. (1997) ‘Phenotypic characteristics and composition of rhizobia associated with woody legumes growing in diverse Kenyan conditions’. G..N. J.. Gresshoff (eds) DNA Markers: Protocols. W. Ramírez-Bahena. Normy. Parker. W. vol 188. Lavras. Im. Peix. A. (2009)´ Bradyrhizobium pachyrhizi sp. Rhizobium phaseoli Dangeard 1926AL and Rhizobium trifolii Dangeard 1926AL.H. y Lee. R. Yuan. E. J. leguminosarum DSM 30132 (=NCIMB 11478) as Rhizobium pisi sp. Odee. pp65–75. R. M. L. R. T. P. E.. Zhang. (2008)´Revision of the taxonomic status of the species Rhizobium leguminosarum (Frank 1879) Frank 1889AL. nov. isolated from effective nodules B acterias formadoras de nódulos en leguminosas 207 . nov. A. Kimiti. Sutherland. Igual. A..F. S.. Ramírez-Bahena. S. F. vol 55. H.. P. Martínez-Molina.. M. International Journal of Systematic and Evolutionary Microbiology. pp2158-2163. García-Fraile. trifolii is a later synonym of R.. y Sprent.nov. nov. nodule bacteria from four Papilionoid legume trees in Costa Rica’. E. Camacho. Bae. Peng. and Bradyrhizobium jicamae sp. and P. M. nov. (2000) ‘Diversity of rhizobia isolated from different land use systems in Amazon region’. Rodríguez-Navarro.. Li. J. W. nov. (1995) ‘Genomic heterogeneity of strains nodulating chickpea (Cicer arietnum L.. pp640–648. J. Cleyet-Marel. New York. I. G. Rivas. y Velázquez.Nour.. Quan. (1995) ‘Natural rhizobial populations and nodulation status of woody legumes growing in diverse Kenyan conditions’. pp2543–2549. A. y Fernandez. G.. Valverde.M. D. pp334–342. (2005) ‘Rhizobium daejeonense sp. M.. (2008) ´Rhizobium oryzae sp.. vol 58. (1997) ‘Characterization and classification of microbes by rep-PCR genomic fingerprinting and computer-assisted pattern analysis’. y Sprent. H. Peix.. M. D.. Universidade Federal de Lavras. Makatiani. vol 58. in G. Willems..) and description of Rhizobium mediterraneum sp. John Wiley and Sons Inc. vol 173. W... pp211–224.. S. M.. isolated from a cyanide treatment bioreactor’. pp2484-2490.. Pereira. isolated from the wild rice Oryza alta´. Odee. P. P. Rademaker. M. E. PhD Thesis. Rivas. A. (2004) ‘rRNA and dnaK relationships of Bradyrhizobium sp. Sutherland.. E. leguminosarum. J. M. P.. J. M. Chen. Z. W. Applications. y Velázquez.F... y de Bruijn. Reclassification of the strain R.’. y Tan. Mateos. International Journal of Systematic Bacteriology. C. E. J.. Baek. D. Mateos. Systematic and Applied Microbiology.. Q. vol 45. Caetano-Anollés. D. Brazil. vol 27. Plant and Soil. International Journal of Systematic and Evolutionary Microbiology. W.

International Journal of Systematic Bacteriology. pp1271-1275. Llorente. pp484–486. T. FEMS Microbiology Ecology Vol 68. y Burris. W.. R.. H. E. vol 34. D. D. Selyer... M. R.. M.. E.. (1986) ‘Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics’. 208 Manual de biología de suelos tropicales . N.nov. S. B. y Velázquez. J. R.. F. F. y Martínez-Romero. M. (2003) ‘Description of Devosia neptuniae sp. vol 54. Gilmour. Mateos.W.. Ochman. Ponce. International Journal of Systematic Bacteriology. (2011)´Rhizobium vignae sp. y Vizcaíno. pp5217–5222. vol 68. vol 26. Systematic and Applied Microbiology. G. H.) Druce’. pp374–377. Rivas.of Pachyrhizus erosus’. Dazzo.’. Dazzo. Willems. L... J. Young.. K. M. International Journal of Systematic and Evolutionary Microbiology.. Scholla.. E. P. Gillis. N. nov.. Vizcaíno. P. X.. Normy. y Chen. pp873–884.T. vol 61. pp5217-5222. Kroppenstedt. Sui. W. Caugant. E. an aquatic legume from India’. F. vol 43. isolated from annual Medicago spp. which has common symbiotic genes with Sinorhizobium mexicanum´. isolated from roots of Beta vulgaris affected by tumour-like deformations´ International Journal of Systematic and Evolutionary Microbiology. Fernadez. D. y Elkan.. Schollhorn. P. N.. J.. a fast-growing species that effectively nodulates soybeans’. P.L. (2004) Bradyrhizobium betae sp.. Willems. A. E. Velázquez. pp255. Martinez-Molina... Applied and Environmental Microbiology. Gillis. R. Rincón-Rosales. E. y Cleyet-Marel. pp580-586. pp47–53. Subba-Rao. C. Rivas. A. P. N. W. N..F.f.. Musser.F. Willems. International Journal of Systematic Bacteriology.. H. P.. nov. Rivas. E. International Journal of Systematic and Evolutionary Microbiology.. Mateos. A.’. Gillis. R. Brunel. Chen. Ren. Wang. Palomo. M. Mateos. R. nov.. y Martínez-Romero. pp972–980. A. E. (2002) ‘A new species of Devosia that forms a unique nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (L.. (1993) ‘Reclassification of American Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp. R... a symbiotic bacterium isolated from multiple legume species´. H. J. Proceedings of the Federation of American Societies for Experimental Biology. vol 46. F. y Martinez-Molina. Rome. (1984) ‘Rhizobium fredii sp. Martínez-Molina.. nov. nov. P. M. that nodulates and fix nitrogen in symbiosis with Neptunia natans.. M. Applied and Environmental Microbiology. (2009)´ Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico. y Whittam. vol 24.. including Sinorhizobium chiapanecum sp. Subba-Rao. vol 51. vol 59.. p710 Segovia.H. nov. S. M. E. (1966) ‘Study of intermediates in nitrogen fixation’. (1996) ‘Sinorhizobium medicae sp. García-Benavides.X. L.. D. R.

(2006) ‘Rhizobium lusitanum sp.. Van Berkum. B. Fernández-Santos... vol 68. A. vol 51. International Journal of Systematic and Evolutionary Microbiology....G. y Chen.. Valverde. Z. (2005) ‘Nodulation of Lupinus albus by strains of Ochrobactrum lupine sp. (2003) ‘Sinorhizobium americanum sp.. W. Beyene.T. (2001) ‘Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes’. Pesquisa Agropecuária Brasileira – Ediçao Especial 19. Rivas. 2631-2637.. Sy. Struffi. Abril. Trujíllo. pp1267–1276. Tian.T. T.. s/n.X. J.F. Casella. isolated from arid and semi-arid regions in China’. Applied and Environmental Microbiology. W. Lloret.X. y Oliveira. E. L. G. A.’. L.. (2005) ‘Phylobacterium trifolii sp. M. F. F. y Chen.. P.. International Journal of Systematic and Evolutionary Microbiology‘.nov.. vol 52. Gu. A. R. Wang. Y. E. Garcia. Magalhaes.J. a bacterium that nodulates Vicia faba.. Giraud. Systematic and Applied Microbiology. M... Willems. Cervantes.. (1984) ‘Avaliaçao do crescimento de rhizobium de leguminosas florestais tropicais em diferentes meios do culura’. P. S. (formely ‘Rhizobium hedysari’). pp. L...nov.. Mateos. A.. Gillis. Valverde. A. B. y Nuti. C. y Eardly. Reinhold-Hurek. F.. Dazzo. Vendramin. P. a bacterium that nodules Phaseolus vulgaris´. y Velazquez. M.. E. vol 56.. (1998) ‘Rhizobium mongolense sp..’. E. S. A. J. Ludeña. de Lajudie. G. nov. A. E. Toledo. Selnska-Pobell. Döring. T. Velázquez.. P.. International Journal of Systematic Bacteriology. the root-nodule microsymbiont of Hedysarum coronarium L. P. C. H. y Martínez-Molina. nov. Velázquez. Igual. E. E.. pp1132–1136. Kan.. nov. N. I. E. Giacomini.. E. Applied and Environmental Microbiology. nov. (2001) ‘Rhizobium yanglingense sp. E. A. E. Wu. Han. A. A. y Mateos. vol 183. B. Planchuelo. y Dreyfus. Rivas. E.. Y. vol 71. y Eardly. Wang. Matínez-Molina. F. F. nov.. nodulating Trifolium and Lupinus in Spanish soils’. X.M. 58: pp 2871-2875. A. Campbell.. Journal of Bacteriology. Neyra. B. pp54–64. vol 26. Van Berkum. Tola. a new Sinorhizobium species nodulating Acacia spp. R. D. A. Peix. Boivin-Masson. E. (2002) ‘The aquatic budding bacterium Blastobacter denitrificans is a nitrogen-fixing symbiont of Aeschinomene indica’.. is one of three rhizobial genotypes identified which nodulate and form B acterias formadoras de nódulos en leguminosas 209 . vol 55.. Gu. Squartini.G. M. Chen. (2002) ‘Rhizobium sullae sp.. G. pp1985– 1989. M. International Journal of Systematic Bacteriology.. X. Tan. P. D. (2008) ‘Rhizobium favae sp. pp1318–1327.. International Journal of Systematic and Evolutionary Microbiology. Willens. M. Vizcaíno. Mateos. L. nov. A.. F. N. W... y Martínez-Romero. P.. D. Joury. Bao. Prin. pp901–914. B.Souza.. in Mexico’.F. P.. pp214–220. C.... P.

Brunel. C. B. Oxford. nov.. Werner. Jarabo-Lorenzo.... (2005a) ‘Bradyrhizobium canariense sp. (2004) Proposal to accommodate Burkholderia cepacia genomovar VI as Burkholderia dolosa sp. sp. Cervantes. Pérez-Galdona. P. pp507–512. P.. pp207–215. L. C. M. D. y Martínez-Romero.J. y Vandamme. Munoz. J.. nodulate the roots of tropical legumes’.. P.. y Verschraegen. T. O. W.nitrogen fixing symbioses with Medicago ruthenica [(L. M. P. M. A.J. nov. 1990) comb. nov. an acid tolerant endosymbiont that nodulates endemic genistoid legumes 210 Manual de biología de suelos tropicales .. Systematic and Applied Microbiology. pp317–327. vol 51. vol 29. vol 54. 1985) to the genus Bradyrhizobium as Bradyrhizobium denitrificans (comb. E. International Journal of Systematic and Evolutionary Microbiology. P. International Journal of Systematic and Evolutionary Microbiology. LiPuma.. F. de Baere. Vermis. a novel species that nodulates Prosopis alba in the Chaco Arido region (Argentina)’.. Vincent..C. Velazquez. Vaneechoutte.) Ledebour]’. G... nov. P.. nov. (Aeschynomene indica) with Blastobacter denitricans and to transfer Blastobacter denitrificans (Hirsh and Muller. Leibold. Willems.. y Martinez-Molina.. H. Van Berkum.. Normy.-M.. Chen. and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al.. Abril. Nelis. a new genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species.. y CleyetMarel. nov. J.. (2002) ‘Burkholderia tuberum sp.. (2009)´Mesorhizobium metallidurans sp. M. E. K.. Chantreuil. vol 48. Toro. (2004) ‘Taxonomy of the genus Cupriavidus: A tale of lost and found’. vol 54... Mateos.. (2004) ‘Wautersia gen. International Journal of Systematic Bacteriology vol 54. A. Gillis. a metal-resistant symbiont of Anthyllis vulneraria growing on metallicolous soil in Languedoc. M. Berge. E. nov. A. (2006) ‘Proposal for combining Bradyrhizobium spp. Igual. nov. Vinuesa. T. Béna. y Willems. Escarré. P. J. J. Mahenthiralingam. A.... A. G... pp1011–1021. E. Goris... Silva. pp850-855. vol 59. pp2285–2289.. International Journal of Systematic Bacteriology. P. France´. M. Kamfer. E. Willems. and Burkholderia phymatum sp. E. C. Blackwell Scientific Publications. J. Coenye. nov. y Conye. nov. International Journal of Systematic and Evolutionary Microbiology. M. Vidal.’. Mauré. de Vos. M. T.)’. Vandamme. (1970) A Manual for the Practical Study of Root-Nodule Bacteria. D.. vol 25. Léon-Barrios. N. P.. J. J. Falsen. pp689691. Vandamme. R. P. y Eardly. International Journal of Systematic and Evolutionary Microbiology. Systematic and Applied Microbiology. Fernyez. B. (2001) ‘Mesorhizobium chacoense sp.. pp13–22.

Chen. P. D. (1999a) ‘Rhizobium etli bv.. Wang.. E. Z. Wang. W. Sui.. y Chen. A. M. International Journal of Systematic and Evolutionary Microbiology. (1998) ‘Rhizobium huautlense sp. pp1575–1583 B acterias formadoras de nódulos en leguminosas 211 . E. G. International Journal of Systematic and Evolutionary Microbiology.. (2002) ‘Rhizobium indigoferae sp. International Journal of Systematic Bacteriology. (2005b) ‘Population genetics and phylogentic inference in bacterial molecular systematics: The roles of migration and recombination in Bradyrhizobium species cohesion and delineation’. E. Y. T. G.T. Wei. J. Z.. Zhu. nov. W. Dorado. Chen.. W. along with Bradyrhizobium japonicum bv.. H. H.. nov’. T.. D. Martínez-Romero. (2003) ‘Characterization of rhizobia isolated from legume species within the genera Astragalus and Lespedeza grown in Loess Plateau region of China and description of Rhizobium loessense sp. Tan. H.. W. vol 34. Sui.. Wang. pp1687–1693. P. E. nov. (2007)´Mesorhizobium albiziae sp. pp569–575. Wei. E. nov. nov. y Martínez-Romero. Rogel-Hernández.. P. Werner. y Chen... T. and Sinorhizobium kummerowieae sp. M. Q. E.. E... Fernández-López. Chen. Beyene. W. Wang. van Berkum. vol 52. International Journal of Systematic Bacteriology. A. E... Beyene. vol 53. E. Vinuesa. Wang. a novel biovar isolated from Mimosa affinis’. X. pp2231–2239. E.. genistearum. E. Santos. Wang. a Leucena leucocephala-associated bacterium that is highly resistant to multiple antibiotics’. Zhu. E. pp1479–1491. X.... nov. Rinhold-Hurek. (2002) ‘Sinorhizobium morelense sp. M. and Kummerowia stipulacea’. respectively isolated from Indigofera spp..Q. y Chen. T. (1999b) ‘Diversity of rhizobia associated with Amorpha fruticosa isolated from Chinese soils and description of Mesorhizobium amorphae sp.. Molecular Phylogenetics and Evolution. Wang. M. X.. vol 48. E. T... y Martínez-Romero. nov. van Berkum.F. Wang. pp51–65... X.X. a symbiont of Sesbania herbacea that has a close phylogenetic relationship with Rhizobium galegae’. vol 57. mimosae. X. X. X. Han. vol 52.. y Martínez-Romero.. E. pp29–54. International Journal of Systematic Bacteriology. Wang. Bradyrhizobium genospecies a and Bradyrhizobium genospecies b’.. J. Liu. y MartínezRomero. International Journal of Systematic and Evolutionary Microbiology. International Journal of Systematic Microbiology.H. A. pp1192-1199. International Journal of Systematic and Evolutionary Microbiology. T. E. Silva. vol 49. E.. vol 49. H. B. F. M. A.. O. S. pp687–699.’. W. D. a novel bacterium that nodulates Albizia kalkora in a subtropical region of China´. Sui.(Papilionoideae:Genisteae) from Canary Islands. y MartínezRomero. Cevallos. vol 55. Chen. Tan. Willems. T. C. G..

P. M. CAB International. pp2107–2110.. J. y Bohlool. M. H. (1988b) ‘Reliability of the most-probable technique for enumerating rhizobia in tropical soils’.. Yao. Journal of Clinical Microbiology. P. M. vol 82. International Journal of Systematic and Evolutionary Microbiology. pp1942–1946. Singleton. X. H.´ International Journal of Systematic Evolutionary Microbiology. Woomer. W. Wilson. pp1207–1217. in J. L. vol 54 pp149. Cui. J. International Journal of Systematic Bacteriology. (1990) ‘Amplification of bacterial 16S ribossomal DNA with polymerase chain reaction’.. nov. Toro. M. M. I. (2004) Renaming of Agrobacterium larrymoorei Bouzar and Jones 2001 as Rhizobium larrymoorei (Bouzar and Jones 2001) comb. P. P. Z. Muñoz-Adelantado.. Vos. vol 53. pp1494–1497. (1993) ‘Most Probable Number Counts of Rhizobia in Soils’. Ingram (eds) Tropical Soil Biology and Fertility: A Handbook of Methods... Kan. y Bohlool. T. International Journal of Systematic and Evolutionary Microbiology. Ge. vol 52. J. B.Willems. B. (1995) ‘Bradyrhizobium liaoningense sp. W. (2003) ‘The genus name Ensifer Casida 1982 takes priority over Sinorhizobium Chen et al 1988 and Sinorhizobium morelense Wang et al 2002 is a junior synonym of Ensifer adhaerens Casida 1982. y Green. pp706–711. Singleton. E. Goris. Woomer. y Fan.. Applied and Environmental Microbiology. F. W. Blitchngton. Is the combination “Sinorhizobium adhaerens” (Casida 1982) Willems et al 2002 legitimate? Request for an opinion’. C. Fernández-Lopez.. R. nov. Wallingford.. (1988a) ‘Ecological indicators of native rhizobia in tropical soils’. L. P. nov. J. M. nov. B. Request for an opinion’. Applied and Environmental Microbiology. R. J. C.. Y.’. Li. vol 54. Bennet.. pp2219–2230. pp172–178. (2002) ‘Characterization of rhizobia that nodulate legume species within the genus Lespedeza and description of Bradyrhizobium yuanmigense sp. y Chen. Wang. R. Woomer. S.. isolated from the root nodules of soybeans’. Young. (1990) ‘Agroclimatology and modeling – overcoming the inflexibility of most-probable-number procedures’. vol 28.. Xu. Woomer. P. E. A. vol 54. Young. K. y Yost.. vol 45. 212 Manual de biología de suelos tropicales . vol 53.. P. N. pp1112– 1116. Agronomy Journal. Yerson and J. International Journal of Systematic Bacteriology. pp349–353. Z. B. E.. y Gillis. B. (2003) ‘Description of new Ensifer strains from nodules and proposal transfer Ensifer adhaerens Cassida 1982 to Sinorhizobium as Sinorhizobium adhaerens comb. MartínezRomero.

P. R....vol 133. M. Mateos. . vol 61. Trujillo. Kuykendall. M. R... Wang.. (1996) ‘Diversity and phylogeny of rhizobia’. H. E. B acterias formadoras de nódulos en leguminosas 213 . y Haukka. with an emended description of the genus. L. Zhang. A. R.A. 1998 as new combinations: Rhizobium radiobacter. P. Carrasco. Palomares. rubi.. M. Rivas. y Chen.X.. R. Martínez-Molina. pp512-517.. E. B.C. Y. Chamber.. pp87–94. E. rhizogenes. nov. A.L. Hou. pp784-788. N. New Phytologist. K. Li.T. Vizcaíno. E.. undicola and R. R. nov. Kerr. (2001) ‘A revision of Rhizobium Frank 1889. vitis’. Young J. pp89–103. and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. International Journal of Systematic Evolutionary Microbiology. y Velázquez. D. J. isolated from nodules of Cytisus scoparius in Spain´ International Journal of Systematic Evolutionary Microbiology. Zhang. W. vol 51. J. (2007)´Ochrobactrum cytisi sp.. Martínez-Romero..E. X. J. Zurdo-Piñeiro.. y Sawada.Young..F.X. isolated from root nodules of Oxytropis glabra´International Journal of Systematic Evolutionary Microbiology.. vol 57.. (2011)´Rhizobium tubonense sp.J. W. E.

APÉNDICE 6. 1970): 10g manitol o sacarosa 1ml sol. K2HPO4 (10%) (o 0. Cuando pH <5.2 N KOH. Medio sólido: 15g Agar Medio semisólido: 1.4 gl–1) 2ml sol. 0. para hacer 1000 ml con agua destilada pH 6. 7H2O (10%) (o 0. NaCl (10%) (o 0. KH2PO4 (10%) (o 0.0 se reemplaza azul por Azul de Bromotimol por Verde de Bromocresol y se aumenta agar hasta 20 gl–1. MgSO4. 214 Manual de biología de suelos tropicales .1 Composición de medio 79 para el crecimiento de Bfn Medio 79 (Fred y Waksman.1 gl–1) 4ml sol.0. 1928) (similar a medio YMA – Vincent.5% azul de bromotimol en 0.1 gl–1) 100ml extracto de levadura (o polvo 0.2 gl–1) 1ml sol.8–7.4 gl–1) 5ml sol.75g Agar Autoclave a 120°C durante 15 minutos.

. las concentraciones más altas (>0...08 g Na2MoO4.. H3BO3 .03 g ZnSO4. Diluir solución a 1:4.. o entre 7 a 10 días después de plantar.. ajustar con KOH.......86 g MnSO4. Si al final del experimento esto resulta insuficiente para el crecimiento sostenido y el color verde de las plantas control. diluida de la misma manera. * Solución de micronutrientes (para 1 l de agua). 0.7...2 Solución de nutrientes Jensen’s para el crecimiento de espe- cies de leguminosas en bolsas de plástico y jarras de Leonard Componentes K2HPO4 (2%) MgSO4.000 ml pH = 6...... Normalmente. los controles nitrogenados no presentan nódulos.7% KNO3) pueden ser tóxicas...7H2O ........... entonces la concentración puede aumentar o hacer una suplementación dividida.... pues las dosis elevadas inhiben la nodulacíon....7H2O (2%) NaCl (2%) CaHPO4(10%) FeCl3.... por lo tanto..... los controles absolutos.. Vicent (1970) recomienda la mezcla para una solución de nutrientes.... También después se usa la solución con sirato en bolsas de plástico. Sin embargo.....7 % o FeCl3 1% Solución de micronutrientes* Agua destilada (completar a) Volumen 10 ml 10 ml 10 ml 10 ml 10 ml 1 ml 1...... Esto puede añadirse a la solución de nutrientes al principio del experimento.05% KN03 o NH4 NO3).. Control Se proveen los controles con nitrógeno a una concentración final de aproximadamente 70 ppm N (0.H2O ...6H2O 1... 0.. 2. 2.. sin inoculación del suelo B acterias formadoras de nódulos en leguminosas 215 ......APÉNDICE 6.5H2O ..22 g CuSO4...... 0...4H2O ...... es decir.09 g El mismo protocolo que para agar con semillitas.

Otro control importante.son necesarios para comprobar las condiciones asépticas del experimento. no mencionado por Vincent. éstas deberán utilizarse. 216 Manual de biología de suelos tropicales . Si existe la disponibilidad de las cepas recomendadas. es el uso de una cepa eficiente como un control positivo para la nodulación y la fijación de nitrógeno.

se ha demostrado que las plantas micorrizadas tienen mayor tolerancia a metales tóxicos. Bagyaraj y Sidney L. tales como fosfato. cobre y zinc. 1981. sequía. 1991). producción de cultivos redituables o plantaciones forestales industriales provoca cambios en las características quí217 . 1995). Además.Capítulo 7 Hongos micorrizógenos arbusculares (HMA) Joseph D. dunas de arena. En los trópicos. el fósforo disponible es muy bajo. Stürmer INTRODUCCIÓN Actualmente. Bagyaraj. La conversión de estos dos ecosistemas en agro-ecosistemas ya sea para agricultura de subsistencia. En la mayoría de los suelos tropicales. hortícola y forestal. altas temperaturas. por lo tanto. aumenta significativamente la captación de iones relativamente inmóviles. esto limita el desarrollo de las plantas. se encuentra bien documentado que los hongos micorrizógenos arbusculares (HMA) mejoran la salud y el crecimiento de las plantas de importancia agrícola. pH desfavorable del suelo y al choque por trasplante que sufren las plantas no micorrizadas (Mosse et al. patógenos de la raíz. la agricultura se practica en áreas previamente ocupadas por dos principales ecosistemas naturales ricos en especies vegetales: bosques tropicales y sabanas. huertos y cultivos agrícolas (Brundrett. salinidad. 1990.. selvas tropicales. salinas y sistemas manejados como praderas. provee una mayor superficie de absorción que los pelos radiculares y. Bagyaraj and Varma. La red de hifas producidas por los HMA en el suelo durante su asociación con la planta huésped. Los HMA han sido registrados en ecosistemas naturales como desiertos.

En estos sitios. (1987) observaron un descenso en el número de esporas y un cambio en la composición de especies después del disturbio en algunos lugares de Australia. 1996) y también en desiertos (Stutz and Morton. físicas y biológicas del ambiente edáfico. La infectividad micorrízica se determina fácilmente por el método del número más probable (NMP) y puede servir para propósitos comparativos (Porter. 1996). como los hongos dominantes. 1985). La medición de la diversidad taxonómica de HMA se ha hecho. 1979) y la determinación de las unidades de colonización (UC) (Franson y Benthlenfalvay.. las medidas de diversidad taxonómica deberían estar acompañadas de algunas evaluaciones de la actividad de la comunidad micorrízica. pastizales (Bever et al. estas determinaciones no detectan a las especies crípticas de HMA que no están esporulando en el momento del muestreo (pero que están asociadas con las plantas hospederas) e impiden la adecuada identificación de algunas especies. De igual forma. encontraron una riqueza similar de especies en la selva tropical seca y en praderas con dominio de una especie. a través de una cuenta directa y de la identificación de esporas recuperadas del campo. Asimismo. sin embargo. por lo general. se siembran con una sola especie de la misma edad. No obstante. usualmente. (1992) encontraron que el número de esporas de HMA en una plantación de Terminalia ivoriensis en Camerún disminuyó notablemente después de tres meses de una desforestación.. Johnson y Wedin (1997). especialmente de los géneros Glomus y Gigaspora. 218 Manual de biología de suelos tropicales . La conversión de los ecosistemas naturales para distintos usos de suelo influye en la abundancia de esporas y composición de especies de HMA. Picone (2000) demostró que la densidad de esporas y la comunidad fúngica disponible para la formación de micorrizas eran relativamente similares entre praderas y bosque tropical lluvioso. Jasper et al. Mason et al. Aunque comúnmente no es reportado.micas. También notaron un cambio en la composición de especies. se eliminan muchas especies vegetales de todas las edades y. generalmente. en donde se detectaron 28 morfotipos de HMA con Glomus aggregatum y dos especies de Glomus no descritas. 1979). La medición del porcentaje de colonización (PC) (Moorman y Reeves. 1989) son también adecuadas. Las macetas trampa preparadas con suelo de campo han sido usadas exitosamente para detectar y recobrar especies crípticas durante estudios de diversidad en huertos de manzano en regiones templadas (Miller et al.

MÉTODOS PARA EVALUAR PROPÁGULOS INFECTIVOS DE HMA Y COLONIZACIÓN MICORRÍZICA Número más probable (NMP) El protocolo propuesto para estimar la diversidad de HMA (descrito en el Capítulo 2) es el mismo que se sigue para todos los microorganismos y no será discutido aquí..TAXONOMÍA Y CLASIFICACIÓN DE HMA Debe establecerse un esquema taxonómico antes de cualquier estudio de diversidad. especialmente. colocando a este grupo de hongos en el mismo nivel que Basidiomycota y Ascomycota. cuando se requieren comparaciones entre los sistemas de uso de suelo. Este género es incluido en el orden Diversisporales en la filogenia molecular propuesta por Schüßler et al. Morton y Benny (1990) transfirieron todas las especies de HMA al orden Glomerales (División Zygomycota) con tres familias y seis géneros. 2000) y para erigir dos nuevos géneros en dos familias distintas (Morton and Redecker. Redecker et al. También incluyeron en el Nuevo esquema de clasificación tres nuevos órdenes y varias familias.1).. (2001). Recientemente. Gerdemann y Trappe (1974) incluyeron todas las especies de HMA dentro del orden Endogonales en la familia Endogonaceae (División Zygomycota). La taxonomía y clasificación de los hongos micorrizógenos han cambiado radicalmente en los últimos años. Datos moleculares y morfológicos fueron usados para transferir a los miembros del género Sclerocystis a Glomus (Almeida y Schenck. Se basa en una serie de diluciones decimales H ongos micorrizógenos arbusculares 219 . 2001). con aquellos de Morton y Redecker (2001) y Schüßler et al. (2001) transfirieron todas las especies de HMA a una nueva división monofilética: Glomeromycota.. Aunque se han aplicado técnicas moleculares para aclarar la clasificación filogenética entre las especies de HMA. (2001) (Tabla 7. Por lo tanto. La formación de esporas en este género es similar a la de Glomus pero éste diferencia paredes germinales internas. Schüßler et al. El método del Número Más Probable se ha utilizado para estimar el número de propágulos infectivos de HMA en varios suelos. la identificación de especies está basada principalmente en las características morfológicas de las esporas. un género nuevo llamado Pacispora fue propuesto por Oehl y Sieverding (2004). se propone un esquema de clasificación para estudios de diversidad que surge de los esquemas de Morton y Benny (1990). 1990.

1 Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales. en agregados laxos o en esporocarpos. Familia Acaulosporaceae Morton y Benny Acaulospora Gerd. flexible. Las vesículas y células auxiliares no están diferenciadas. Germinación a través del lumen de la hifa de sostén o a través de la pared de la espora. Vesículas. plana. La micorriza se tiñe débilmente. Se presentan especies dimórficas formando esporas acaulosporoides y glomoides. La pared germinal más interna tiene una superficie con excrecencias. División Glomeromycota Schüßler. 220 Manual de biología de suelos tropicales . Vesículas de pared delgada y elipsoides. La pared de la espora esta formada por tres o cuatro capas y no se forma una verdadera bicapa germina. Familia Archaeosporaceae Morton y Redecker Archaeospora Morton y Redecker (una especie) Esporas formadas terminalmente de una hifa de sostén o como una ramificación de una estructura que semeja un sáculo esporífero. Esporas con la pared esporal formada por un número variable de capas todas originadas a partir de la hifa de sostén.Tabla 7. conectada a una hifa ramificada. No se observan paredes germinales diferenciadas. Hifas intrarradicales rectas o enrolladas cerca de los puntos de entrada. Las vesículas varían en forma con protuberancias y concavidades. Otras estructuras subcelulares de la espora y germinación idéntica a la de Acaulospora. Entrophospora Ames y Schneider (cinco especies) Esporas formadas dentro de un cuello de un sáculo esporífero el cual deja dos cicatrices sobre la superficie de la espora. Los arbúsculos e hifas intrarradicales se tiñen débilmente. Esporas con la pared esporal formada por dos capas. Arbúsculos con troncos aplanados o cilindricos adelgazándose sucesivamente en las ramificaciones. Scharzott y Walker Orden Glomerales Morton y Benny Suborden Glomineae Morton y Benny Familia Glomeraceae Pirozysnki y Dalpé Glomus Tulasne y Tulasne (85 especies) Esporas formadas blásticamente sobre una hifa de sostén. Germinación a través de una estructura de germinación esférica. solitarias. arbúsculos. Hifas intrarradicales raramente enrolladas. Berch (31 especies) Esporas formadas a los lados del cuello de un sáculo esporífero el cual deja una cicatriz en la superficie de la espora. La micorriza se tiñe muy obscuro. hifas intrarradicales y micorriza se tiñen como en Acaulospora. y Trappe emend.

Las paredes de la hifa de sostén son continuas con la primera y segunda capa de la pared esporal. Familia Paraglomeraceae Morton and Redecker Paraglomus Morton y Redecker (dos especies) Esporas formadas terminalmente de una hifa de sostén como en Glomus.Tabla 7. La segunda capa de la pared germinal generalmente reacciona con el reactivo de Melzer. Los arbúsculos y las hifas intrarradicales se tiñen débilmente. Esporas con la pared esporal formada por dos capas permanentes. Las estructuras subcelulares de la espora y la germinación como en Glomus. No se forman vesículas. no se diferencian paredes germinales. Al germinar. células auxiliaries que van de casi lisas a nodosas. Schüßler y Schwarzott Pacispora Sieverding y Oehl (siete species) Esporas formadas terminalmente de una hifa de sostén (como en Glomus). células auxiliares finamente papiladas o equinuladas.1 Continúa Familia Ambisporaceae Walter. Scutellospora Walker y Sanders (30 especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. No se forman vesículas. Blaszkowski. especialmente. Suborden Gigasporineae Morton y Benny Familia Gigasporaceae Morton y Benny Gigaspora Gerd. Hifas intrarradicales frecuentemente enrolladas. Esporos acaulosporoide formado un apéndice hifal emergiendo lateralmente del cuello de un sáculo esporífero. y germinan atreves de hifa suspensora. se diferencia una capa delgada con verrugas esparcidas y crece un tubo germinativo a través de la pared esporal. Vestberg & Schüßler (ocho especies) Especies generalmente dimórficas con asociaciones micorrizicas produciendo morfotipos acaulosporoide y glomoides. Arbúsculos e hifas intrarradicales similares en morfología a las de H ongos micorrizógenos arbusculares 221 . Arbúsculos con troncos hinchados angostándose abruptamente en las ramificaciones. Germinación de la espora directamente de la pared germinal a través de la pared de la espora. y Trappe (cinco especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. Vestberg & Schüßler Ambispora Walter. Las vesículas y células auxiliares no están diferenciadas. cerca de los puntos de entrada. Esporos glomoides de forma aislada en el suelo o agregados en racimos. Pared de la espora generalmente formada por tres capas distintas y la pared germinal compuesta también por tres capas. Vesículas y arbúsculos las raíces teñidas en azul franco con azul tripano. Familia Pacisporaceae Walker. a menudo nodosas o con proyecciones.

.Tabla 7. se pueden utilizar gramíneas C4. que se diferencia sobre la superficie de la última pared germinal.wvu. el método es apropiado para comparaciones entre sistemas con diferente uso del suelo si los ensayos del NMP se establecen de forma simultánea.edu. 2006 y http://invam. Esporas con una pared formada por dos capas permanentes y de una a tres paredes germinales internas. si tiene cierta dependencia micorrízica. se puede utilizar cualquier otro hospedero. como el sorgo y el Paspalum. Materiales necesarios • • • • tubetes para plantas (150 X 2. El tubo de germinación crece a partir de un escudo flexible plano. La ventaja es que.caf.5 cm) y gradillas bolsas de plástico (30 X 20 cm) diluyente esterilizado (arena: mezcla de suelo 1:1) semillas de cebolla.1 Continúa Gigaspora. Oehl y Sieverding. Fuente: compilado de Morton y Benny. Sin embargo. de suelo en donde la presencia o ausencia de colonización micorrízica se registra y da como resultado el número más probable de propágulos infectivos. cada una con dos capas. basándose en una tabla estadística. Spain et al. 222 Manual de biología de suelos tropicales . Si no contamos con semillas de cebolla. ya que es dependiente de la micorriza y las raíces son fáciles de teñir. 2004. La planta hospedera recomendada para el ensayo del NMP es la cebolla. el análisis de las raíces de las plantas trampa para comprobar la colonización es fácil y rápido. pero el número calculado tiene hasta un 95 por ciento del nivel de confianza (Adelman y Morton. 1990. Como el resultado es un solo número. 1986). Una de las desventajas de esta prueba es que se requiere mucho tiempo para la preparación del bioensayo. y puede llevarse a cabo por cualquiera que esté familiarizado con la morfología de la micorriza.

3. de Fisher y Yates (1963) o Alexander (1965). El procedimiento para el cálculo del NMP. lavar el suelo de las raíces y teñirlas con azul de tripán (véase más abajo). Supongamos que. 6. 5. hacer cinco replicas por cada dilución. 7. Después de emerger. 4. se obtiene la siguiente secuencia de números de tubetes positivos: 5. N2 = 3 y N3 = 2. El número de tubetes positivos (los que contienen colonización) en diluciones diferentes se utilizan para calcular los valores de NMP. Retirar 30 g de la dilución anterior y colocarlo en otra bolsa que contiene 270 g del diluyente estéril. si es necesario). 3. Al cosechar. 2. sólo tres números de una secuencia dada son necesarios. dejar una sola planta por tubete y dejarlas crecer en un invernadero o en una cámara de crecimiento durante seis semanas. si el número de tubetes positivos es el mismo en diluciones posteriores). Pesar 30 g de suelo de campo en una bolsa de plástico y añadirle 270 g del diluyente esterilizado. Distribuir el suelo de cada dilución en los tubetes para plantas. El primer número (N1) corresponde al número de tubetes positivos para la colonización micorrízica en la dilución que muestra el mayor número de tubetes positivos (se toma la serie menos concentrada. Sembrar las semillas de cebolla en cada tubete. En este ejemplo. H ongos micorrizógenos arbusculares 223 . Utilice las tablas de Cochran (1950). determinar la presencia o ausencia de colonización micorrízica en cada réplica. 2. la combinación sería: N1 = 5. Esto significa que las cinco réplicas fueron positivas para la colonización micorrízica en las diluciones 10-1 y 10-2. Para el cálculo del NMP. hacer más diluciones decimales hasta la dilución 10-4 (o más. Bajo un microscopio de disección. 5. se ilustra con el siguiente ejemplo. 10-2. Agitar bien para obtener una dilución decimal. Agitar bien para obtener una dilución 10-1. si no se dispone de las semillas de cebolla puede utilizar cualquier otro hospedero (ver arriba).Procedimiento 1. 10-3 y 10-4). Los otros dos números (N2 y N3) son los correspondientes a las próximas dos diluciones. considerando las cinco réplicas (tubetes) para cada una de los cuatro diluciones (10-1. tres réplicas fueron positivas en la dilución 10-3 y dos réplicas fueron positivas en la dilución 10-4.

mientras que Koske y Gemma (1989) modificaron el procedimiento mediante la eliminación de ácido láctico de estas soluciones sin interferir con la intensidad de la tinción.4. 50 ml de de HCl al 1%) • azul de tripano 0.5 g/l) • H2O2 alcalinizada (3 ml NH4OH al 20%. el suelo tiene 1.4 X 10-3 propágulos infectivos g–1. Lavar las raíces para eliminar residuos de suelo y enjuagar con varios cambios de agua. Procedimiento 1. Para obtener el NMP de propágulos infectivos de HMA en la muestra. Por lo tanto. Materiales necesarios • solución de KOH al 10% (hidróxido de potasio) • solución de HCl al 1% (ácido clorhídrico) • solución acidificada de glicerol. 567ml de agua).Usando la tabla del NMP el valor dado para esta combinación de tubetes positivos es 1. 2. este valor debe de ser multiplicado por la dilución media. Kormanik y McGraw (1982) eliminan el fenol en las soluciones para tinción y decoloración. para detectar y medir la colonización micorrízica. Tinción de raíces para observar la colonización micorrízica La colonización de las células corticales de la raíz por HMA. El método más ampliamente utilizado es el descrito por Philips y Hayman (1970). no altera la morfología de la raíz. 30 ml de H2O2 al 3%. se propone para la tinción de raíces el método de Philips y Hayman (1970) modificado por Koske y Gemma (1989). en contraste con las asociaciones ectomicorrízicas.05 % en solución de glicerol (0. Sumergir las raíces en KOH a 90°C por una hora o a 120°C por 15 minutos en autoclave. Teniendo en cuenta el costo de los productos químicos y el ahorro al reducir el número de productos químicos sin interferir con la calidad de la tinción. las raíces son sometidas a un procedimiento de clareo y tinción. 224 Manual de biología de suelos tropicales . (en este caso 10-3). 450 ml de H2O. Por lo tanto. (500 ml de glicerol.

5. es usado comúnmente para medir la longitud de la raíz y el porcentaje de la colonización micorrízica. No enjuague las raíces en esta paso ya que éstas deben estar acidificadas para una tinción adecuada. Enjuagar nuevamente las raíces con agua. Tiña las raíces en una solución de glicerol ácido con azul de tripano a 90°C por una hora o a 120 °C por cinco minutos. Comentarios: si lo desea. 40ml de glicerol y 40 ml de agua destilada). la solución de agua oxigenada alcalinizada debe de prepararse justo antes de su uso. Para almacenar por un tiempo largo.1 x 1. Para los pasos 2 y 7. El método de intersección de cuadrante (Giovannetti y Mosse. • Agujas de disección. Descargue la solución colorante y mantenga las raíces en glicerol acidificado (sin azul de tripano) o agua a temperatura ambiente o 4°C. crecidas bajo condiciones del invernadero. Si las raíces están demasiado pigmentadas se deben sumergir en agua oxigenada alcalinizada durante 10-30 minutos. H ongos micorrizógenos arbusculares 225 . Esta medida estima el crecimiento de un aislamiento de un hongo o de una comunidad fúngica dentro de la corteza de la raíz.1 cm. 1980) que se presenta a continuación. El paso 4 puede ser omitido si las raíces no están muy pigmentadas. 4. un baño de agua a 90°C es apropiado para mantener las muestras. Material necesario • Cajas de Petri cuadriculadas en la base con cuadrados de 1.01%. las raíces pueden guardarse en agua adicionada con unas gotas de azida de sodio al 0. la solución de glicerol acidificada puede ser reemplazada por una solución de lactoglicerol (20 ml de ácido láctico. Sumerga las raíces en HCL al 1% por cinco minutos. Medición de la colonización micorrízica La determinación de la colonización micorrízica de la raíz.3. 6. Elimine el HCl. 8. Eliminar el KOH y enjuagar las raíces con agua (dos o tres veces) para quitar el exceso de KOH. 7. se realiza con frecuencia en raíces colectadas de campo (sacadas directamente del suelo o de plantas individuales) o en plantas experimentales.

3. 1963). con las líneas de la cuadricula separadas en 1.Procedimiento 1. De esta manera. 4. las esporas son la única parte del organismo del hongo que puede utilizarse para delimitar las especies. La morfología del micelio interno y externo durante la asociación micorrízica es prácticamente indistinguible entre las especies del mismo género y entre géneros.htm.. Registre: a) el número total de intersecciones de las raíces y las líneas de la cuadricula y b) el número de intersecciones con raíces micorrizadas. también se pueden utilizar para determinar las longitudes tanto de la raíz completa como de la raíz micorrizada. con estructuras micorrízicas. 1995). 226 Manual de biología de suelos tropicales . Comentarios: los datos obtenidos en el paso 3. Es posible calcular la longitud total de la raíz y la longitud de la raíz micorrízada de la planta completa.edu/ methods/mycorrhizae/rootlengths. seguido por centrifugación en un gradiente de sacarosa. En contraste. se teñirá y se medirá en el microscopio con este método. Las esporas se extraen del suelo mediante un tamizado húmedo (Gerdemann y Nicolson. representan la longitud total de la raíz en cm.1 cm. el número total de raíces que interceptan las líneas de la cuadricula. Por lo tanto.wvu. Bajo el microscopio de disección explore las líneas horizontales y verticales de la cuadrícula. Si se toma una muestra pequeña de toda la raíz. Si toda la raíz se extiende en la caja de Petri. Métodos para evaluar la diversidad de HMA Extracción de esporas del campo La Identificación de las especies de HMA está basada en el análisis de estructuras subcelulares de las esporas asexuales. 2. usando la relación entre el peso seco de la planta y la submuestra. En una caja de Petri extienda al azar las raíces teñidas. Para más detalles ver http://invam.caf. las estructuras subcelulares de las esporas están altamente conservadas y son fenotípicamente estables independientemente del ambiente y la planta huésped (Morton et al. el total de la longitud de la raíz micorrizada será el número de intersecciones. Calcule el porcentaje de colonización micorrízica (% CM) utilizando la siguiente fórmula: % CM = (Número total de intersecciones con raíces micorrizadas/ Número total de intersecciones entre la raíz y las líneas de la cuadrícula) X 100.

• Tubos para centrífuga y centrífuga. Nota. • Soluciones de sacarosa (20 % y 60%).Figura 7. el largo de la raíz = 43 cm (25 + 18) y el largo de la raíz micorrizada=12 cm (Seis intersecciones positivas sobre líneas horizontales y seis intersecciones positivas sobre líneas verticales). • Por lo tanto. • Cubeta de plástico o un vaso de precipitados grande.9%. En el diagrama las infecciones de micorrizas son representadas con puntos negros. después de expander las raíces.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea.1 provee una ilustración del método de intersección de línea. cajas de Petri. • Vasos de precipitados. Ejemplo. • El porcentaje de colonización micorrízica= (12/43) x 100=27. H ongos micorrizógenos arbusculares 227 . vidrio de reloj. Figura 7. Materiales necesarios • Un juego de tamices anidados que tengan al menos 710 µm y 45 µm de abertura de malla. el numero de intersecciones entre una raíz y las líneas horizontales y verticales tendríamos: • 25 intersecciones (Línea horizontal) • 18 intersecciones (Línea vertical) y • 12 intersecciones (Puntos negros) presentando colonización micorrizica.

1M (Fogel y Hunt. al menos. Coloque el material retenido en el tamiz de 710 µm en una caja de Petri grande y observe bajo el microscopio de disección para observar esporas grandes (esporas de Gigaspora y Scutellospora) y esporocarpos.Procedimiento 1. las esporas se pueden separar por morfotipos de acuerdo con su color y tamaño y si las esporas están en buen estado se pueden identificar hasta género y especie.000 rpm durante 60 segundos. 2. Pasar la suspensión repetidamente a través de dos tamices anidados con abertura de malla de 710 µm y 45 µm. en el fondo. se puede agregar una pequeña cantidad de pirofosfato de sodio a 0. 228 Manual de biología de suelos tropicales . después transfiera este material a un tubo de centrífuga que contenga un gradiente de sacarosa de 20–60%. Los tamices recomendados (con mallas de 710 µm y 45 µm) son adecuados para recuperar la mayoría de especies. Colocar 100 g de la muestra de suelo en la cubeta /vaso de precipitados y suspender en. 7. 6. comprada en el supermercado. Comentarios: en el paso 3. La solución de sacarosa se hace con azúcar comercial. 8. 4. Centrifugue a 2. Transferir las esporas y el material retenido en el tamiz 45 µm a una caja de Petri y bajo el microscopio colecte las esporas en un vidrio de reloj limpio. 3. Esto separa a las esporas por tamaños pero incrementa la cantidad de trabajo ya que el material retenido en cada tamiz debe centrifugarse por separado. Coloque el material retenido en el tamiz de 45 µm en una vaso de precipitados con una pequeña cantidad de agua. agregue otros 15 ml de la solución al 60% . agregue 15 ml de la solución de sacarosa al 20% en un tubo de centrífuga de 50 ml y después. Los suelos con alto contenido de arcilla pueden obstruir los tamices. Vacíe el sobrenadante en el tamiz de 45 µm y lave con agua corriente para quitar el exceso de sacarosa. es preferible vaciar la suspensión de suelo a través de un tamiz de 1 mm antes de pasar por el tamiz de 710 μm. si hay demasiados pedazos de raíz y otros desechos. Para preparar el gradiente de la sacarosa. 1979) para dispersar las partículas de arcilla y liberar las aberturas del tamiz. Sin embargo. Agitar hasta que las esporas queden suspendidas y dejar reposar 30 segundos . En este momento. Las esporas pueden separarse de los residuos orgánicos y recogerse de la caja de Petri usando unas pinzas finas o una pipeta Pasteur adelgazada en la punta. 500 ml de agua. se pueden anidar otros tamices entre los dos recomendados. ya que el tamaño de las esporas de HMA para la mayoría de las especies está en un intervalo de 40 a 600 μm. 5.

c y d) y Acaulosporaceae (e. 2. y h).. 1979. el tamaño de las esporas y una descripción estandarizada de las especies de HMA. Poland) en http://www. b) espora de Scutellospora scutata con la hifa de sostén bulbosa (note el escudo de germinación redondo. en estos sitios web se describen 79 y 55 especies respectivamente.wvu. Janusz Blaszkowski (Department of Plant Pathology of the Agricultural University of Szczecin.ar. b.Identificación de especies y montaje de preparaciones En la mayoría de los casos. c) un detalle de la ornamentación de H ongos micorrizógenos arbusculares 229 . de 160 especies de HMA descritas en total. las esporas extraídas del campo no son identificables bajo el microscopio de disección. 1990) y comparando con las descripciones e ilustraciones de las especies proporcionadas por el Dr. contrastando con el color hialino de las esporas). USA) sitio web (http://invam. f.pl/~jblaszkowski. Algunas claves de identificación para HMA (por ejemplo Hall y Fish. Koske y Walker (1985) proponen una clave para algunas especies de Scutellospora con esporas con paredes ornamentadas.edu) y por Dr. 3 y 4 se proporcionan los nombres de las especies y los autores.caf. y por consiguiente.V. Fotografías de esporas de especies representativas de diferentes géneros se muestran en las ilustraciones 4 y 5. la INVAM y el sitio de Blaszkowski poseen excelentes fotografías con detalles de la estructura subcelular de las esporas. W. La ilustración 4 muestra las esporas y las estructuras producidas por las especies de la familia Gigasporaceae (fotografías a. El manual de Schenck y Pérez es una copia de las descripciones originales de las especies y por lo tanto.szczecin. g. Sin embargo. a la vez que Bentivenga y Morton (1995) proponen una clave para identificar las cinco especies de Gigaspora. La identificación de especies de HMA se puede hacer por comparación con la descripción original de la especie. La fotografia a) muestran una espora de Gigaspora albida con la hifa de sostén bulbosa típica de esta familia. West Virginia University. Joseph Morton en la INVAM (Colección Internacional de hongos micorrizógenos arbusculares. 1982) se publicaron antes de algunas revisiones de taxonomía recientes e importantes. deben ser montadas en portaobjetos y observadas en un microscopio compuesto. falta de buenas fotografías para las comparaciones y las descripciones están hechas con esporas extraídas del suelo de campo por lo cual pueden no incluir características taxonómicas importantes). Por otro lado. usando como referencia al Manual para la identificación de HMA (Schenck y Pérez. este manual incorpora en un solo volumen toda la descripción de las especies hasta 1990. café. Trappe.agro. alberga todos los problemas inherentes a esas descripciones (falta de estandarización de las estructuras subcelulares de las esporas. En los anexos 1.

Las características taxonómicas importantes que pueden observarse bajo el microscopio de disección son tamaño de las esporas. la pared germinal 1 (gw1) y la pared germinal 2 (gw2) con su capa más interna reaccionando al reactivo de Melzer. Foto a): espora de Glomus clarum indicando la hifa de sostén (note que la capa más interna de la pared de la espora se desprende y se ve parecida a la pared germinal. En el microscopio compuesto pueden observarse algunas características taxonómicas importantes como son la presencia y tipo de ornamentación sobre la pared de la espora. d). la foto g) ejemplifica la estructura de la pared formada por tres capas (L1. de células suspensoras y del sáculo esporífero (raramente observado en esporas recolectadas directamente del campo). color. c. Las esporas necesitan montarse en líquidos de montar permanentes como son el PVLG (alcohol polivínilico lactoglicerol) y PVLG mezclado con reactivo de Melzer. La ilustración 6 muestra a las esporas y estructuras producidas por especies de la familia Glomeraceae (a. esporas de Acaulospora sp.la pared de las esporas (verrugas) de Scutellospora coralloidea. se observan. En la foto e) se muestra una espora de Entrophospora colombiana (familia Acaulosporaceae) con la pared de la espora. cubreobjetos y etiquetas • Agujas de disección 230 Manual de biología de suelos tropicales . también con la pared formada por tres capas (L1. b. La foto b) muestra la pared de la hifa de sostén continua con la pared de la espora de un Glomus sp. Materiales necesarios • Portaobjetos. número de paredes germinales y grosor de la pared de la espora. finalmente. Un esporocarpo de Glomus clavispora se observa en la foto c) y un esporocarpo de Glomus sp. la foto f) muestra un detalle de Archaeospora leptoticha en donde se observan protuberancias y depresiones de las capas 2 y 3 de la pared esporal (indicada con flechas). en la foto d). La foto e) muestra un espora de Archaeospora leptoticha con el sáculo esporífero. forma. Archaeosporaceae (e y f) y Paraglomeraceae (g y h). y d) células auxiliares nodosas que diferencian a los miembros de Scutellospora. L2 y L3) de Paraglomus occultum y en la foto h) se muestra una espora de Paraglomus brasilianum. L2 y L3) (la capa L2 está ornamentada con pequeñas crestas). reacción al Melzer. presencia de hifa de sostén. en la foto h). mostrando algunos sáculos esporíferos adheridos a las esporas. Una espora de Entrophospora colombiana mostrando las dos cicatrices características se ve en la foto f). La fotografía g) representa una espora de Acaulospora scrobiculata que muestra la cicatriz que queda en la espora después de que el sáculo esporifero se desprende.

16. Usando una aguja de disección. Este paso es importante para exponer las paredes germinales y sus capas. 4. Mezclar el reactivo de Melzer con el PVLG (1:1) para preparar la solución de PVLG + Melzer. En un porta objetos. 5 g de yoduro de potasio. Además. mezcle las esporas en la solución de PVLG y de PVLG + Solución de Melzer y deje secar la superficie de la gota por lo menos cinco minutos. Colocar las esporas al centro de cada gota usando un pinza fina o una micropipeta (en este caso. Establecimiento de cultivos trampa Los cultivos trampa se utilizan con más frecuencia en estudios de diversidad de HMA porque revelan las especies que no están esporulando en el campo.5 g Iodo. 10 ml de glicerol. ofrecen esporas nuevas y saludables que pueden ser utilizadas para establecer cultivos puros de HMA. Con una aguja de disección. Comentarios: el paso 2 es crucial para el montaje de las esporas sobre el portaobjetos. 7. y fecha. Guardar las preparaciones a temperatura ambiente durante cinco días y luego incubar a 40-60ºC. género y especie (si se conoce). 6. 3. 2. colocar una gota de PVLG y una gota de la solución de PVLG + Melzer. 5. Etiquetar las preparaciones incluyendo número de muestra. 1. en el momento del muestreo. rompa cada espora individualmente bajo el microscopio de disección. las esporas se deslizan hasta los bordes cuando se coloca el cubreobjetos en la parte superior de cada gota.6 g de alcohol polivínilico (PVA) • Reactivo de Melzer (100 g de hidrato de cloral. Procedimiento 1. Coloque suavemente un cubre objeto sobre la gota de PVLG y otro cubreobjetos sobre la gota de PVLG + Solución de Melzer. H ongos micorrizógenos arbusculares 231 . durante dos días para endurecer el medio de montaje. El método propuesto se basa en los protocolos de Stutz y Morton (1996). si se agrega demasiada agua. 100 ml de agua destilada. tenga cuidado de no agregar demasiada agua).• Solución de PVLG (100 ml de agua destilada. 100 ml de ácido láctico.

Wisconsin. Bever et al. Soil ScienceSociety of America. (1965) ‘Most-Probable-Number Method for Microbial Populations’. Mycologia. colecte uno o dos núcleos de suelo de 50 ml de cada maceta. homogeneizar el suelo de campo con arena estéril (50% de suelo de campo y 50% de arena). Madison. B. si el sorgo y frijol no están disponibles. 7–13. vol. 82. otras plantas hospederas pueden utilizarse.5 kg Bandejas o bolsas de plástico Semillas de Sorghum sudanense (Sorgo) y Vigna unguiculata (Frijol) Procedimiento 1 En una bandeja de plástico (o en una bolsa de plástico). in A. donde las plantas intactas colectadas del campo se trasplantan a una maceta con un sustrato libre de HMA y se evalúa la esporulación después de tres a cuatro meses. T. 2 Colocar esta mezcla en macetas de plástico de 1. En el paso 2. Se recomienda cualquier gramínea C4 y/o leguminosa como hospederas.Soil Biology and Biochemistry. Klute (ed) Methods of Soil Analysis. Part 2: Chemical and Microbiological Methods. durante el muestreo de suelo de campo. J. 18. Alexander. llamado “cultivos trampa de trasplante”. M. pp. J.5 kg y sembrar abundantemente con una mezcla de semillas de sorgo y frijol (40-50 semillas por maceta). (1986) ‘Infectivity of vesicular-arbuscular mycorrhizal fungi: Influence of host-soil diluent combinations on MPN estimates and percentage colonization’. T. Cubrir las semillas con la mezcla de suelo y arena.Materiales necesarios • • • • Arena estéril Macetas de plástico de 1. REFERENCIAS Adelman. Almeida. pp . (1996) utilizan un procedimiento diferente para establecer cultivos trampa. 1467–1472. y Morton. Después de tres a cuatro meses. extraer las esporas e identificarlas. pp. y Schenck. según lo explicado arriba. 703–714. (1990) ‘A Revision of the Genus Sclerocystis (Glomaceae. 3. N. 232 Manual de biología de suelos tropicales . Glomales)’. vol. bajo condiciones del invernadero. R. se incluyan las raíces de las plantas ya que también sirven como propágulos para iniciar los cultivos trampa. Comentarios: es importante que. M.

J. 720–732. in D.. pp. y Nicolson. Advances in Microbial Ecology. W. D. Mukerjii and G. 1–76. Cochran. 71–82. vol. 35. 261–270. Giovannetti. M. 53. J. y Schultz. Fogel. (1979) ‘Fungal and arboreal biomass in a Western Oregon Douglas-fir ecosystem: Distribution pattern and turnover’. J. vol. y Fish. S. Oliver and Boyd. R. pp. pp. vol. Soil Science Society of America Journal. (1996) ‘Host-dependent sporulation and species diversity of arbuscular mycorrhizal fungi in a mown grassland’. Knudsen (eds) Handbook of Applied Mycology: Soil and Plants. C. (1963) ‘Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting’. T. 9. Agricultural and Medical Research. R. pp. y Hunt. New York. 87. L. y Yates. G. R. J. 235–244. B. Bagyaraj. Bever. vol.. Antonovics. vol. 641–652. J. W. (1995) ‘Interaction between arbuscular mycorrhizal fungi and plants: Their importance in sustainable agriculture and in arid and semiarid tropics’. y Bethlenfalvay. J. y Varma. Transactions of the British mycological Society. (1979) ‘A key to the Endogonaceae’. Journal of Ecology.Bagyaraj. K. P. y Trappe. vol. 75–78. K. Rai. 84. Edinburgh. F. H. y Morton. pp. pp. vol. (1995) ‘A monograph of the genus Gigaspora. 46. I. 84. pp. B. Canadian Journal of Forest Research. pp . A. A. G.. Morton J. 6. B. B. L. D. Fisher. (1989) ‘Infection unit method of vesicular-arbuscular mycorrhizal propagule determination’. G. 245–256. 21. R. 171–213. (1974) ‘Endogonaceae in the Pacific Northwest’. M. Australian Journal of Botany. pp. vol. Jasper. pp. Gerdemann. J. Gerdemann. H ongos micorrizógenos arbusculares 233 . 73. Transactions of the British Mycological Society. Robson. (eds) (1963) Statistical Tables for Biological. P. (1990) ‘Ecology of vesicular-arbuscular mycorrhizae’. y Mosse. New Phytologist. D. (1991) ‘Mycorrhizas in natural ecosystems’. A. Biometrics. pp. Marcel Dekker Inc. Advances in Ecological Research. A. (1980) ‘An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots’. 14. vol. (1950) ‘Present status of biometry’. Brundrett. R.. K. J. J. Arora. Hall. y Abbott. Franson. M. pp. G. A. Mycologia Memoir. vol. vol. vol. D. 5. Mycol ogi a. incorporating developmental patterns of morphological characters’. 754–756. D. 489– 500. W. (1987) ‘The effect of surface mining on the infectivity of vesicular-arbuscular mycorrhizal fungi’. Bentivenga. 119–142. J.

702–720. (1989) ‘A modified procedure for staining roots to detect VA mycorrhizas’. based on concordant molecular and morphological characters’. 234 Manual de biología de suelos tropicales . with an emendation of Glomaceae’. 92. Alexander (eds) Mycorrhizas in Ecosystems. vol. y Walker.Johnson. Morton. J. Read. vol. Lewis. (1990) ‘Revised classification of arbuscular mycorrhizal fungi (Zygomycetes): A new order. D. D. y Benny. (1992) ‘Short-term changes in vesicular-arbuscular mycorrhizal spore populations in Terminalia plantations in Cameroon’. A.. 181–195 Morton. E. J. J. Acaulosporaceae and Gigasporaceae. (1970) ‘Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection’. pp. nutrients and mycorrhizae during conversion of dry tropical forest to grassland’. Kormanik. T. Bentivenga. 73 (suppl. A. 5.. Schenck (ed) Methods and Principles of Mycorrhizal Research. Fitter and I. D. Transactions of the British mycological Society. 77. D. vol. D. vol. C. N. y Sieverding E. American Phytopathological Society. A. Koske. y Wedin. Mycologia. E. y Reeves. P. CAB International Wallingford. B. (2004) ‘Pacispora. B. vol. F. B. Archaeosporaceae and Paraglomaceae. D. 171–182. y Hayman. y Last. Miller. (1985) ‘Species of Gigaspora (Endogonaceae) with roughened outer walls’. Journal of Applied Botany. (1995) ‘Discovery. B. (1985) ‘Mycorrhizal fungi at eighteen apple rootstocks plantings in the United States’. Oehl. 55. Musoko. Philips.. F. T. Ecological Applications. 78. (1979) ‘The role of endomycorrhizae in revegetation practices in the semi-arid West. Morton. vol.. D. with two new genera Archaeospora and Paraglomus. pp. C. Zygomycetes)’. M. C. 93. P. II: A bioassay to determine the effect of land disturbance on endomycorrhizal populations’. pp. pp. 158–161. 1). pp. E. pp. D. 37. pp. R. measurement. pp. M. 14–18. and interpretation of diversity in arbuscular endomycorrhizal fungi (Glomales. P. J. 379–391. C. G. pp. in N. vol. pp. Mycotaxon. 137–210. A. S25–S32. Moorman. Mycologia. 66. (2001) ‘Two new families of Glomales. Koske. and two new families. L. 72–82. (1997) ‘Soil carbon. Paul. Advances in Microbial Ecology. P. H. a new vesicular-arbuscular mycorrhizal fungal genus in the Glomeromycetes’. Glomineae and Gigasporineae. S. two new suborders. 486–505. R. vol. vol. pp. O. 261–267. 100. J. C. Stribley. Mason. J. St. H. y McGraw. vol. Mycological Research. y Bever. J. Domoto. (1982) ‘Quantification of vesicular-arbuscular mycorrhizae in plant roots’. Mosse. P. y Le Tacon. (1981) ‘Ecology of mycorrhizae and mycorrhizal fungi’. American Journal of Botany. J. F. 7. pp. in D. y Walker. y Gemma. y Redecker. New Phytologist. vol. N. Glomales. 471–491. P. S. A. Canadian Journal of Botany. B.

17. W. (1982) ‘Synoptic key to the genera and species of Zygomycetous mycorrhizal fungi’. pp. 3rd Edition. T. C. Mycological Research.. (1979) ‘Most Probable Number method for enumerating infective propagules of vesicular arbuscular mycorrhizal fungi in soil’. 1413–1421. M. J. pp. J. Morton. Porter. J. Biotropica. y Oehl. C. Schwarzott.Picone. pp.. the Glomeromycota: Phylogeny and evolution’. Schenck. Canadian Journal of Botany. F. pp. D. pp515–519. Sieverding. Mycotaxon vol 97. USA. y Morton. M. (2000) ‘Molecular phylogeny of the arbuscular mycorrhizal fungi Glomus sinuosum and Sclerocystis coremioides’. N. Australian Journal of Soil Research. vol. C. pp. vol. 734–750. 163-182. D. Redecker. 105. Spain. Gainesville. E. 1883–1889. (2001) ‘A new fungal phylum. 1102–1108. J. vol. 72. 282–285. Phytopathology. Synergistic Publications. (1990) Manual for Identification of VA Mycorrhizal Fungi. Mycologia. y Bruns. vol. 74. Y. y Pérez. 2006.. 32. Trappe. (2000) ‘Diversity and abundance of arbuscular-mycorrhizal fungus spores in tropical forest and pasture’. Appendicispora: a new genius in the arbuscular micorrhiza-forming Glomeromycetes. C. J. 92. D. with a discussion of the genus Archaeospora. B. B. H ongos micorrizógenos arbusculares 235 . vol. (1996) ‘Successive pot cultures reveal high species richness of arbuscular endomycorrhizal fungi in arid ecosystems’. y Walker. vol.L. Schübler. A. pp. Stutz.

y Trappe G. y Schenck G. Tadych y Madej G.1. ambisporum Smith y Schenck G.. antarticum Cabello G. multisubstensum Mukerji. corymbiforme Blaszkowski G. macrocarpum Tulasne y Tulasne G. Blanke. y Gerd. Sieverding y Schenck G. claroideum Schenck y Smith G. y Trappe G. género Glomus Género/Especies Glomus G. microcarpum Tulasne y Tulasne G. nanolumen Koske y Gemma G. albidum Walker y Rhodes G. canadense (Thaxter) Trappe y Gerd. y Gerd. mortonii Bentivenga y Hetrick G.) Gerd. G. aggregatum Schenck y Smith G. manihotis Howeler. cerebriforme McGee G. Bhattacharjee y Tewari G. microaggregatum Koske. magnicaule Hall G. clarum Nicol. callosum Sieverding G. Gemma y Olexia G. laccatum Blaszkowski G. multicaule Gerd. y Trappe G. y Ellis) Trappe y Gerdemann 236 Manual de biología de suelos tropicales . invermaium Hall G. coremioides (Berk. caledonium (Nicol. przelewicensis Blaszkowski G. convolutum Gerd. Bhattacharjee y Tewari G. delhiense Mukerji. pallidum Hall G. lacteum Rose y Trappe G. aurantium Blaszkowski. citricola Tang y Zang G. constrictum Trappe G. mosseae (Nicol.) Trappe y Gerd.Apéndice 7. boreale (Thaxter) Trappe y Gerd. minutum Blaszk. G. Especies de HMA de la familia Glomeraceae. pansihalos Berch y Koske G. pubescens (Sacc. clavisporum (Trappe) Almeida y Schenck G. australe (Berkeley) Berch G. y Broome) Redecker y Morton G. y Bakshi G. arborense McGee G. coronatum Giovannetti G. maculosum Miller y Walker G. Renker y Buscot G. proliferum Dalpe y Declerck G. liquidambaris (Wu y Chen) Almeida y Schenck G. monosporum Gerdemann y Trappe G. botryoides Rothwell y Victor G. melanosporum Gerd. G.

G.1. G. heterosporum Smith y Schenck G.edu. y Trappe) Almeida y Schenck G. glomerulatum Sieverding G. y Broome) Trappe y Gerd. dominikii Blaszkowski G. geosporum (Nicol. Blanke. G. dimorphicum Boyetchko y Tewari G. Renker y Buscot G. tortuosum Schenck y Smith G. Friese. tenue (Greenhall) Hall G. y Trappe G. Walker y Koske G. y Gerd. trimurales Koske y Halvorson G. Walker y Dalpe G. fulvum (Berk. y Trappe emend. Bloss y Menge G. fasciculatum (Thaxter) Gerd. taiwananse (Wu y Chen) Almeida y Schenck G. G.caf. segmentatum Trappe.) Trappe y Gerdemann G. fuegianum (Spegazzini) Trappe y Gerdemann G.wvu. warcupii McGee H ongos micorrizógenos arbusculares 237 .) Walker G. diaphanum Morton y Walker G. deserticola Trappe. viscosum Nicol. intraradices Schenck y Smith Fuente: tomado de http://invam. flavisporum (Lange y Lund) Trappe y Gerd. fragile (Berk. y Bakshi) Almeida y Schenck G. pustulatum Koske. reticulatum Bhattacharjee y Mukerji G. hoi Berch y Trappe G. y Broome) Trappe y Gerd. G. globiferum Koske y Walker G. sterilum Mehrotra y Baijal G. sinuosum (Gerd. versiforme (Karsten) Berch G. pulvinatum (Henn. vesiculiferum (Thaxter) Gerd. formosanum Wu y Chen G. halonatum Rose y Trappe G. fragilistratum Skou y Jakobsen G. xanthium Blaszk. tubiforme Tandy G. McGee G. etunicatum Becker y Gerdemann G. tenerum Tandy emend.. tenebrosum (Thaxter) Berch G. insculptum Blaszkowski G.Apéndice 7. G. Spooner y Ivory G. radiatum (Thaxter) Trappe y Gerd. rubiforme (Gerd. Continúa Género/Especies G.

morrowiae Spain y Schenck A.edu. rugosa Morton A. schenckii Sieverding y Toro 238 Manual de biología de suelos tropicales .wvu. Pfeiffer y Bloss A. paulineae Blaszkowski Fuente: tomado de http://invam. mellea Spain y Schenck A.2. longula Spain y Schenck A. colombiana Spain y Schenck E. rehmii Sieverding y Toro A. delicata Walker. spinosa Walker y Trappe A. Reed y Sanders A. bireticulata Rothwell y Trappe A. foveata Trappe y Janos A. splendida Sieverding. koskei Blaszkowski A.caf.Apéndice 7. Chaverri y Rojas A. polonica Blaszkowski A. thomii Blaszkowski A. undulata Sieverding A. elegans Trappe y Gerdemann A. taiwania Hu A. myriocarpa Spain. A. excavata Ingleby y Walker A. kentinensis Wu y Liu E. infrequens (Hall) Ames y Schneider4 E. laevis Gerdemann y Trappe A. scrobiculata Trappe A. cavernata Blaszkowski A. denticulata Sieverding y Toro A. baltica Blaszkowski E. nicolsonii Walker. sporocarpia Berch A. lacunosa Morton A. Sieverding y Schenck A. capsicula Blaszkowski A. tuberculata Janos y Trappe A. walkeri Kramadibrata y Hedger Entrophospora E. dilatata Morton A. gedanensis Blaszkowski A. Especies de HMA de la familia Acaulosporaceae. géneros Acaulospora y Entrophospora Género /Especies Acaulospora A.

trappei (Ames y Linderman) Morton y Redecker Ar. coralloidea Sieverd.wvu. y Oehl P. H ongos micorrizógenos arbusculares 239 . emend. y Oehl P. y Oehl P. Sieverd. boliviana Sieverd. robigina Sieverd. gerdemannii (Rose. Especies de HMA de las familias Archaeosporaceae(Género Archaeospora). y Oehl P. dominikii Sieverd. franciscana Sieverd. y Oehl Fuente: tomado de Oehl y Sieverding. brasilianum (Spain y Miranda) Morton y Redecker P. y Oehl P. scintillans Rose y Trappe emend. Sieverd. Daniels y Trappe) Morton y Redecker Ar. 2004 y http://invam. Paraglomeraceae (Género Paraglomus) y Pacisporaceae (Género Pacispora) Género /Especies Archaeospora Ar.3. chimonobambusae Blaszk. y Oehl P.caf.edu.Apéndice 7. occultum (Walker) Morton y Redecker Pacispora P. leptoticha (Schenck y Smith) Morton y Redecker Paraglomus P.

rosea Nicol. fulgida Koske y Walker S. calospora (Nicol. erythropa (Koske y Walker) Walker y Sanders S.) Walker y Sanders S. gilmorei (Trappe y Herd. reticulata (Koske. nodosa Blaszkowski S. y Schenck) Walker y Sanders S. Gerd. gregaria (Schenck y Nicol.) Walker y Sanders 240 Manual de biología de suelos tropicales . castanea Walker S. minuta (Ferr.4. aurigloba (Hall) Walker y Sanders S. persica (Koske y Walker) Walker y Sanders S. y Herr. coralloidea (Trappe. y Gerdemann) Walker y Sanders S. y Gerd. albida Schenck y Smith Gi. y Trappe Gi.) Walker y Sanders S. margarita Becker y Hall Gi. alborosea (Ferr.) Walker y Sanders S. heterogama (Nicol.) Walker y Sanders S. gigantea (Nicol. géneros Gigaspora y Scutellospora Género /Especies Gigaspora Gi. savannicola (Ferr. y Herr.Apéndice 7. y Herr. y Schenck Scutellospora S. Especies de HMA de la familia Gigasporaceae. y Ho) Walker y Sanders S. Sieverding y Toro S. armeniaca Blaszkowski S. nigra (Redhead) Walker y Sanders S. cerradensis Spain y Miranda S. arenicola Koske y Halvorson S. dipapillosa (Walker y Koske) Walker y Sanders S.) Walker y Sanders S. pellucida (Nicol. decipiens Hall y Abbott Gi. Miller y Walker) Walker y Sanders S. y Gerd. dipurpurascens Morton y Koske S. biornata Spain. hawaiiensis Koske y Gemma S.) Gerd.

spinosissima Walker. tricalypta (Herr. verrucosa (Koske y Walker) Walker y Sanders S. y Ferr. weresubiae Koske y Walker Fuente: tomado de http://invam. scutata Walker y Diederichs S.4. H ongos micorrizógenos arbusculares 241 .) Walker y Sanders S. Continúa Género /Especies S.edu.wvu. Cuenca y Sanchez S.caf.Apéndice 7.

.

El uso de organismos indicadores. 1997a y b). debido al tiempo y la limitación de los recursos.Capítulo 8 Hongos del suelo saprófitos y patógenos de plantas Ludwig H. Los hongos son una parte importante de la cadena alimenticia en el suelo. Las investigaciones deben ser diseñadas en forma de estudios a largo plazo donde intervengan especialistas en taxonomía y micología. En el suelo. 1993). podrían ser una alternativa (Hyde. (Wainwright. junto con una metodología precisa. actinomicetos (actinobacterias) y pequeños invertebrados. Las actividades agrícolas pueden afectar la diversidad de organismos presentes en el suelo. Lodge. grupos específicos o un conjunto de predictores. La evaluación de la diversidad de hongos en suelos tropicales bajo diferentes usos de suelo es. causando una notable reducción en las cosechas y afectando su calidad. Para poder obtener una evaluación confiable de la diversidad de los hongos del suelo. 2000). existen dos condiciones básicas. principalmente para la mesofauna que habita en el suelo (Bonkowski et al.. 1988. los patógenos de plantas actúan en el suelo y en la rizósfera. los hongos interactúan con una compleja comunidad microbiana que incluye: bacterias. Pfenning y Lucas Magalhães de Abreu INTRODUCCIÓN Los hongos del suelo juegan un papel clave en los procesos de descomposición que mineralizan y reciclan nutrientes de plantas. Cuando un estudio de largo plazo involucra varios especialistas no resulta viable. los cuales juegan un importante papel en el reciclaje de nutrientes o son mediadores del equilibrio entre los patógenos y sus antagonistas. por lo 243 . En los ecosistemas agrícolas.

tanto.. 1990. Los métodos utilizados para el aislamiento del suelo. deben ser capaces de crecer en cultivos axénicos.. han sido revisados por varios autores (Frankland et al. y su crecimiento en un medio de cultivo axénico para su posterior identificación y cuantificación. 2000. medios de cultivo parcialmente selectivos y adictivos que reducen el crecimiento de ciertos grupos de hongos. Singleton et al. 244 Manual de biología de suelos tropicales . un grupo monofilético de organismos de hongos obligados asociados a las raíces de las plantas (véase Capítulo 7). (1992).. Bridge y Spooner. Muyzer et al. 1992. Se ha progresado considerablemente utilizando técnicas de lavado.. debido a que los medios de cultivo imponen nuevas condiciones selectivas y pueden introducir un sesgo en los análisis (Liu et al. tales como fila de Eubacterias. con diferentes medios de cultivos y estrategias de aislamiento. 1990. un objetivo del proyecto CSM-BGBD. 1992. Dentro de este grupo se encuentran grupos filogenéticamente diversos. 2004). 1993. Gray. Incluso el análisis de abundancia relativa de especies cultivables recuperadas del suelo.. la mayoría de los hongos que habitan en el suelo pueden ser considerados saprotróficos. Bills et al.. Los procedimientos clásicos microbiológicos para estudiar los hongos del suelo se basan en cultivos que implican el aislamiento de propágulos microbianos o hifas activas que crecen en el suelo.. rizósfera y hongos rizoplanos. 1983. 1997). Una visión global de los métodos para estudiar hongos patógenos de plantas en el suelo fue descrita por Singleton et al. afirmaciones genéricas de que únicamente el 1% de los “microorganismos” del suelo son cultivables aumentan la dificultad y no tienen en cuenta la inmensa diversidad biológica que realmente representan dichos microorganismos (Rondon et al.. Cannon. No obstante. Los métodos estándares aceptados para inventariar la diversidad de hongos o para evaluar su impacto en varias prácticas agrícolas u otras actividades humanas. que cubran las diferentes idiosincrasias de la diversidad taxonómica y grupos fisiológicos de hongos presentes en los ecosistemas del suelo. 2000). Gams. Las metodologías para aislar y cultivar hongos de ecosistemas complejos. aún no están disponibles. Sin embargo. Davet y Rouxel. Una medida confiable de las comunidades de hongos en el suelo sin prejuicios requiere del seguimiento de un laborioso programa de aislamientos sistemáticos. por lo tanto. tales como suelos que muestran limitaciones inherentes debido a la naturaleza de las especies y la inhabilidad de los medios de cultivo para copiar con exactitud los hábitats del suelo (Tsao et al. junto con muchos grupos homogéneos como el filum Glomeromycota. 2001). 1996. puede no ser representativo de la dinámica de las comunidades del suelo.

cada método presenta ciertas preferencias a ciertos grupos específicos de hongos. sino un ecosistema compuesto por una mezcla de sustratos más diversos que incluyen partes de las plantas vivas y muertas. es necesario adoptar métodos similares dentro de los proyectos cooperativos o multidisciplinarios para garantizar la comparación de los datos en un futuro. Los resultados obtenidos de un estudio de hongos del suelo dependen. En general. intenta ofrecer una visión global de los procedimientos disponibles. se deberá tomar en cuenta que el suelo no es un sustrato. por sí solos. reciclaje de nitrógeno y contenido de ácidos grasos del hongo o de observaciones directas del crecimiento del micelio en partículas de suelo (Widden y Parkinson. raíces vivas. poca información acerca de las especies de hongos involucrados en dichos procesos. para un mejor entendimiento de la estructura y función de las comunidades de hongos del suelo. En este capítulo se hace referencia a algunos de los métodos más comunes y también a algunas técnicas menos conocidas para la evaluación y monitoreo de comunidades de hongos del suelo. estos métodos proporcionan. 2003. Las fracciones orgánicas se componen de material de plantas en diferentes fases de descomposición. generalmente aceptados. junto con minerales y agua. respiración del suelo. y no existe ninguna estimaHongos del suelo saprófitos y patógenos de plantas 245 . exudados. 1973. LA IMPORTANCIA ECOLÓGICA DE LOS HONGOS DEL SUELO El suelo es un hábitat o ecosistema. el suelo alberga una parte considerable de la biodiversidad total de hongos. Por ello. animales y otros microorganismos. También son tomados en cuenta los principios y aplicaciones de herramientas moleculares en los estudios de comunidades de hongos del suelo. Brodie et al. se han aplicado métodos que dependen del análisis de la biomasa microbiana del suelo. principalmente. además. Aunque este enfoque no es exhaustivo. 2003). El objetivo principal es contribuir al establecimiento de una serie de métodos estándares. Por esta razón. se requieren los procesos de aislamiento e identificación tradicionales (Brodie et al. 2006).. Houston et al.Otras metodologías que han sido desarrolladas se enfocan en el análisis de la actividad de los hongos y su papel en los procesos biogeoquímicos que ocurren en el suelo. porque el suelo representa una mezcla compleja de fracciones orgánicas e inorgánicas con agua y organismos vivos. por lo tanto... y no un sustrato. Malosso et al. 1998. de los métodos utilizados. No obstante. Con estos fines.. esta característica complica las definiciones y la metodología. pequeños invertebrados y contenidos intestinales. microorganismos.

tales como la incorporación de materia orgánica. o Coniothyrium minitans pueden reducir la incidencia de una variedad de enfermedades en el suelo (Whipps et al. Los patógenos de plantas actúan en el suelo. cabe mencionar que los hongos son responsables de la degradación de xenobióticos y contaminantes orgánicos introducidos en el suelo (Bordjiba et al. 1997. mineralizando y reciclando los nutrientes de las plantas (Wainwright. causando que las plántulas se marchiten y.. Éstos pueden ser específicos. 1997). 2003).. 2002. 1997). mediante el suministro de nutrientes. Lodge. especialmente en el caso de la mesofauna (Bonkowski et al. los zygomycetes usan carbohidratos simples.. En sistemas agrícolas. los patógenos de plantas y sus antagonistas son particularmente importantes. en la rizósfera o infectan tallos. El mantenimiento de la diversidad de hongos del suelo debería. por ejemplo. plantas utilizadas como cubierta vegetal y la diversificación de cultivos. La supresión de patógenos de plantas puede resultar intrínseca en los suelos. Algunos elementos biológicos han sido identificados como los principales factores de la supresión de enfermedades (Chet y Baker. Existen evidencias de que las prácticas agrícolas causan más alteraciones cuantitativas que cualitativas en la comunidad de microhongos del suelo (Pfenning. 1996. Hawksworth y Rossman. 2003. Beare et al. Silva et al. Lodge. Se ha demostrado experimentalmente que la introducción de antagonistas específicos como Trichoderma spp... 2000). por ende. 2007. Los hongos también constituyen una parte importante de la cadena alimenticia dentro del suelo. 1991. Los hongos del suelo juegan un papel clave en los procesos de descomposición. mientras los ascomycetes descomponen principalmente celulosa y hemicelulosa (Domsch et al. Schneider. Zak y Visser. 246 Manual de biología de suelos tropicales . 1997). 2004). 2001). provocan grandes pérdidas. Con relación al papel de los organismos descomponedores. Los saprófitos tienen una especificidad limitada por sustratos. 2001. Mazzola. Rodrigues-Guzman.. una mejor estructura física del suelo y el control de antagonistas de los patógenos de las plantas en el suelo. 1988. 1980. por tanto. pero también es posible que se mantenga o incremente con algunas prácticas agrícolas específicas. 1984. 1993)..ción fidedigna del número de especies de hongos del suelo (Hawksworth. 1993. aunque la mayoría ataca una amplia gama de plantas hospederas. beneficiar directamente la agricultura sustentable. Barratt et al.

como se discutió en el Capítulo 7.ASPECTOS DE SISTEMÁTICA MODERNA Protozoa Los organismos conocidos como hongos actualmente se agrupan en tres reinos.. tales como Spongospora subterranea. 2002). 2001). 2001. Dentro de este reino se reconocen cinco fila: los géneros que pertenecen al filum Glomeromycota forman micorrizas arbusculares y no crecen en ausencia de su planta hospedera (Schußler et al. Mientras que algunos son verdaderos hongos acuáticos asociados con restos de plantas en agua o con patógenos de otros organismos acuáticos. La detección de estos organismos requiere de bioensayos o cebos. así como otros géneros patógenos de plantas. Hongos del suelo saprófitos y patógenos de plantas 247 . con un sistema de clasificación filogenético (Kirk et al. Plasmodiophora brassicae o Polymyxa graminis. Kirk et al.. 2001. Estas especies se clasifican en la clase Plasmodiophoromycetes.habitan en restos de plantas. las cuales se presentan en la sesión “Procedimientos basados en cultivos”. Glomeromycota Los hongos clasificados en el reino Fungi se caracterizan por tener quitina como el mayor componente en su pared celular. aunque algunos de ellos son importantes patógenos de las plantas del suelo. Dentro del grupo de los Oomycetes del suelo es posible encontrar saprófitos. su hábitat e importancia ecológica son variables. Por sus características biológicas requieren de técnicas específicas para su aislamiento y caracterización. 2001). Chromista Los hongos que son derivados de algas y que contienen celulosa como el mayor componente en su pared celular pertenecen al reino Chromista Filum Oomycota (Dick. Los hongos del reino Protozoa no son numerosos. Moreira y Siqueira. otros habitan en el suelo. A pesar de que estos hongos representan un grupo delimitado de acuerdo con sus características y filogenia. Los hongos llamados mohos mucosos -un grupo de organismos heterogéneos y polifilético.. Trabajar con este grupo de simbiontes biotróficos obligados requiere del uso de diferentes técnicas específicas. aunque también pueden encontrarse en el suelo.

Cunninghamella. La evaluación de la diversidad de estos hongos y el monitoreo de su impacto en la comunidad requieren de técnicas específicas (Rossman et al. tales 248 Manual de biología de suelos tropicales . Zygomycota Representan el filum Zygomycota y se consideran como hongos de azúcar por su preferencia por carbohidratos simples y por su crecimiento vigoroso en un cultivo axénico. Basidiomycota El filum Basidiomycota se caracteriza por el basidium. Gongronella. en el suelo y en restos de plantas. El micelio vegetativo se desarrolla. Varias de estas especies se conocen como trasmisores de virus patógenos de plantas (Krik et al. La filogenia de este grupo aún es objeto de discusión y de revisión. Especies de los géneros Absidia. un meiosporangio en el que generalmente se forman cuatro esporas sexuales (Bauer et al. 2008). 2006) y en la mayoría de los casos por la formación de un cuerpo fructífero. una estructura formada durante la fase sexual de su ciclo de vida. Mortierella o Rhizopus son muy comunes en el suelo y se encuentran en casi todos los estudios de hongos de suelo. Para fines prácticos. Mucor. pero normalmente son acuáticos y viven como saprófitos o parásitos de otros organismos como nematodos.Chytridiomycota El único grupo dentro del reino de los hongos que forma esporas flageladas es el filum Chytridiomycota... La fase asexual de los ascomycetes se llama anamórfica y es la fase más comúnmente encontrada. plantas u otros hongos. Muchos de ellos forman ectomicorrizas en asociación con el sistema de raíces de árboles forestales.. Los patógenos de plantas importantes en el suelo son especies de Rhizoctonia y Sclerotium. distinguir los grupos más importantes. insectos. Se caracterizan por la formación de las ascas. Ascomycota El filum Ascomycota representa el grupo más abundante de hongos. algunos de estos hongos habitan en el suelo. 1998) que no son consideradas en este manual. por lo general.

Probablemente. si los recursos lo permiten. etc. debido a que la micobiota de la rizósfera es altamente influenciada por las especies de plantas. a una profundidad de 20 cm en 12 puntos distribuidos en cada parcela de muestreo de acuerdo con el esquema mostrado en el Capítulo 2. Para la extracción del DNA. Todos los materiales de muestreo (nucleador. preferentemente a 4°C y congelarse lo más pronto posible para su futuro procesamiento. Debido a su pequeño tamaño y estructura poco diferenciada.como plectomycetes. utilizando plantas altamente susceptibles. con el fin de evitar la contaminación entre puntos de muestreo.) deberán lavarse antes y después de tomar las muestras. Hongos del suelo saprófitos y patógenos de plantas 249 . Cada juego de 12 muestras se homogenizan para formar una muestra compuesta de alrededor de 500 g que se coloca en una bolsa de plástico. MUESTREO DE SUELO Utilizando un nucleador se extraen pequeñas cantidades de suelo. discomycetes. La rizósfera también contiene una alta concentración de bacterias que. De manera alternativa. en caso de que se haya previsto realizar otros análisis físicos y químicos del suelo.. pertenecen a los plectomycetes. La hojarasca deberá ser removida justo antes de extraer la muestra. espátula. pyrenomycetes y loculoascomycetes puede ser útil. pueden resultar contraproducentes para la recuperación de especies de hongos. EVALUACIÓN DE LOS HONGOS DEL SUELO: PROCEDIMIENTOS BASADOS EN CULTIVOS Todos los métodos propuestos dependen de muestras del suelo y no contemplan el uso de raíces para aislar hongos del suelo. azadón. la detección y el monitoreo de los hongos de organismos protistas como Spongospora y Plasmodiophora puede llevarse a cabo mediante bioensayos. tres o más muestras compuestas podrán colectarse en cada punto de muestreo. el grupo más grande de hongos encontrados en el suelo son los pyrenomycetes anamorfos (Krik et al. También se recogerá una segunda muestra compuesta de alrededor de 200 g. Algunos de los ascomycetes como Aspergillus y Penicillium que habitan en el suelo. las muestras del suelo deberán trasladarse al laboratorio utilizando un recipiente con aislamiento. 2008). ascomycetes que forman un asca en un cuerpo fructífero cleistotecal. a pesar del uso de antibióticos en los medios de cultivo.

en la sección de color de este manual. Alícuotas de 2 g de suelo se traspasan a cajas Petri que contienen agua estéril destilada. Las hojas de zacate como cebo pueden ser sustituidas por pedazos de frutas o verduras como pepino. se observa la liberación de zoosporas de Pythium. Edena et al. Especies de Pythium y Phytophthora pueden causar serios daños a plantas cultivadas.Oomycota: uso de cebos para el aislamiento de Pythium y Phytophthora Para poder recuperar del suelo los oomicetes es aconsejable el uso de plantas susceptibles o tejidos vegetales. en la última ilustración F). mientras que el oogonio y anteridio de Pythium se ilustran en E)”. El aislamiento de hongos zoospóricos (Oomycetes. Se añaden granos de sorgo como cebo y se incuban por cinco días. agar dextrosa y papa (ADP) o agar de papa y zanahoria (en el caso de Pythiaceae) (véase Apéndice 8. Este procedimiento deberá continuarse durante varias semanas. 250 Manual de biología de suelos tropicales . 1983. 1998..5 g colocadas en tubos de ensayo de vidrio esterilizado con 3 ml de agua estéril. El micelio del hongo formado en el sustrato deberá traspasarse a charolas con el medio MP5 (en el caso de Saprolegniaceae) y agar con harina de maíz (AHM). Se esterilizan en autoclave fragmentos de hojas de zacate y se añaden a los tubos como tejidos para recuperar el Pythium spp. La ilustración A) representa una muestra de suelo con cebo. Pueden llevarse a cabo ensayos cuantitativos utilizando la frecuencia de la colonización relativa de los tejidos del cebo entre las réplicas de cada muestra de suelo. la B) una muestra de agua con cebo.1 para la composición del medio). Otra técnica con sustrato susceptible utiliza muestras de suelo húmedo de 0.. Las muestras son incubadas durante tres a cinco días a 25°C en la oscuridad. tomate o papa. Al final de dicho procedimiento se deberá observar que se obtiene únicamente un aislamiento para cada placa. Gams et al.. 2000). Después de incubar durante tres a cinco días. las porciones de agar que contengan micelio serán transferidas a placas con agua estéril destilada y con dos mitades de semillas de sorgo. 1970. Tsao et al. El micelio en crecimiento se verifica directamente mediante montajes con agua en un microscopio o se transfiere del cebo al medio de aislamiento (AHM) que contiene cloranfenicol (50 mg L-¹) y benomil (10 mg L-¹) (Marks y Mitchell. la C) muestra un cultivo puro en el cebo y en la D) se observa el esporangio de Phytophthora. finalmente. Chytridiomycetes) de muestras ambientales aparece en la ilustración 6. Los tejidos infectados deben transferirse en agua estéril con el antibiótico cloranfenicol durante unas horas. después se comprueba la presencia de micelio en el cebo.

y pedazos de frutas y verduras (Gams et al. Un método para evaluar la densidad de inóculo de Rhizoctonia spp. Como el aislamiento de colonias individuales en un medio de cultivo axénico es difícil.5 mm. El suelo retenido se resuspende y se pasa varias veces por el tamiz. se presentan dos métodos de aislamiento útiles. se evalúa la frecuencia de la colonización en las partículas del suelo y el micelio se transfiere a ADP para su eventual caracterización (Sneh et al. A continuación. Técnica de cebo Se mezcla 1 g de semillas de betabel con 100 g de suelo húmedo en cajas Petri. compilados por Sneh et al. Método de partículas de suelo Una suspensión de 10 g de muestra de suelo y agua de la llave es agitada. los cebos pueden transferirse a viales. a 25°C. en suelos de jardines de eucaliptus clonados fue descrito recientemente por Sanfuentes et al.. Las partículas de suelo retenidas se secan con papel absorbente estéril y se transfieren a una caja Petri de 15 cm de diámetro que contenga un medio de agar con agua acidificada (al 2%) con 250 mg L-¹ de cloranfenicol. 1998). Después de un periodo de incubación de 24 a 48 horas.Uso de cebos para el aislamiento de Chytridiomycota Para evaluar los Chytridiomycota se usan las mismas técnicas empleadas para los oomicetos. la caracterización e identificación se hace directamente en el cebo. piel de serpiente. alas de insectos.. se recuperan las semillas con un tamiz de 1. (2002). después decantada usando un tamiz de 0.5 mm. (1991). Para su preservación. posteriormente. 1991). Los cebos más apropiados incluyen cáscara de camarón. se describen varios métodos. se lavan con agua destilada durante Hongos del suelo saprófitos y patógenos de plantas 251 . se verifica el crecimiento típico de Rhizoctonia. Después de un periodo de incubación de 48 horas a 25°C. Basidiomycota – Rhizoctonia: técnica de cebo y aislamiento directo de partículas de suelo Para evaluar este género de basidiomicetes anamórficos del suelo.

que contenga 100 mg L-¹ de cloranfenicol. como la amplificación de DNA ribosomal de Rhizoctonia con iniciadores (en inglés. 1975). La técnica de lavado de suelo es un método adecuado para el aislamiento de estas especies. para la inhibición de hongos de rápido crecimiento. fitopatógenas y sus antagonistas. Los coloidales de suelo y granos de arena son removidos del último tamiz. se secan con papel absorbente estéril para ser transferidas a un medio de agar con agua al 2%. más estreptomicina plus (50 mg L-¹) para la inhibición de bacterias y ciclosporina (10 mg L-¹) o rosa de Bengala (70 mg L-¹). secados con papel absorbente esterilizado y transferidos (7 partículas por placa) a 5 cajas Petri (90 mm) que contienen el medio de aislamiento AHM (30 g L-¹). De esta manera.. Después de la sedimentación de las partículas del suelo durante 2 minutos. 0. La frecuencia de colonización de partículas de suelo para cada especie de hongos es utilizada en ensayos cuantitativos. Cuando se emplea ciclosporina se logra una supresión casi completa 252 Manual de biología de suelos tropicales . El crecimiento de Rhizoctonia se verifica y se transfiere micelio a ADP para su aislamiento y caracterización (Papavizas et al. A pesar del uso común de varios métodos para el aislamiento de Rhizoctonia de muestras de suelo agrícola. el sobrenadante se desecha y se repite el procedimiento dos veces. por el grupo de investigadores involucrados en el proyecto. en estos suelos. Técnica de lavado Una muestra de 10 g de suelo mineral se agita con 200 ml de agua destilada en una centrífuga a 180 rpm durante 10 minutos. 2002).0 mm. utilizando un juego de tamices de 1. 0. el empleo de técnicas de cultivo independiente. ha mostrado severas limitaciones debido a la continua presencia de Trichoderma spp.20 minutos.21 mm usando agua destilada (alrededor de 2 litros) por 2 minutos.5 mm y 0. Las partículas de suelo prelavadas son filtradas. entomopatógenas.7 mm.. su aplicación en el estudio de suelos bajo vegetación natural. Todas estas especies exhiben una fase saprotrófica en el suelo y pueden ser aisladas utilizando una metodología con placas de suelo. primers) específicos y su análisis cualitativo e incluso cuantitativo puede resultar idóneo bajo circunstancias específicas (Lees et al. Ascomycota: técnica de lavado del suelo y filtración de partículas Éste es el mayor grupo de hongos del suelo que incluye especies saprófitas.

Kacprzak y Stanczyk-Mazanek. 2004). El método de dilución del suelo en placa Este es el método de uso más común para el aislamiento y estimación cuantitativa de bacterias y hongos. Un factor final de dilución de 10-4 ó 10-5 se considera adecuado para el aislamiento de hongos (Dhingra y Sinclair. De esta suspensión se prepara una serie de 10 diluciones. 1985). cuando se trata de estudiar este último grupo de hongos. Tsao et al. la cual se mantiene en agitación durante unos momentos. Existe una preocupación generalizada porque el método de dilución en placas muestra un sesgo hacia los hongos que son capaces de producir grandes cantidades de esporas y que crecen muy rápido en un medio de cultivo rico. 1985.. Por lo tanto. éstos pueden contener fuentes de carbono preferiblemente metabolizados por algunos grupos fisiológicos de hongos o pueden modificarse con químicos que inhiben el crecimiento de organismos no deseados. por el factor de dilución empleado. Las alícuotas de la dilución final son distribuidas en cajas Petri que contienen un medio de agar generalmente. Básicamente. Bååth. rutinariamente se utilizan medios selectivos. y que tienen poca habilidad de competir con especies de rápido crecimiento en medios axénicos son subestimados por esta técnica (Bååth. Este método se puede observar en la ilustración 7. la diversidad de hongos que normalmente existen en forma de micelio que crece activamente en el suelo. 1988. modificado con antibióticos como cloranfenicol. 1983). Bills y Polishook. 1992. La técnica es muy simple y se han descrito varias modificaciones. el resultado es una estimación del número de propágulos de hongos por gramo de suelo (Bills et al. 1988. Un gran número de medios selectivos ha sido desarrollado para el aislaHongos del suelo saprófitos y patógenos de plantas 253 . Ascomycota: medios selectivos y técnica con cebo Para un aislamiento selectivo de grupos blanco o especies de hongos del suelo.. Se pueden lograr medidas cuantitativas multiplicando el promedio de las unidades formadoras de colonias (UFC) en las placas. 1998. 2003). Gams et al. una cantidad conocida de suelo es suspendida en agua estéril. Lang y Jagnow. Gams.de zygomycetes saprotróficos. estreptomicina o penicilina para inhibir el crecimiento de bacterias. hasta lograr la dilución final. Por lo tanto. se toma 10% de la suspensión. 1994. 1986.. se debe evitar el uso de ciclosporina (Dhingra y Sinclair.

2003.. Barratt et al.. Thorn et al. Como el Cylindrocladium y probablemente otros géneros son sensibles a la ciclosporina. el tejido cebo es incubado con una muestra de suelo durante unos días.. 254 Manual de biología de suelos tropicales ...miento de varios géneros de ascomycetes. 1991. 1996. 2002. varios materiales de plantas adecuados para su aislamiento fueron descritos en una monografía reciente (Crous.. Sneh et al.. 1985. Ejemplos de cebos utilizados para el aislamiento selectivo de hongos del suelo son tejidos de plantas para el caso de patógenos de plantas.. 1998). La colonización del cebo por un hongo clave también puede llevarse a cabo mediante la observación directa al microscopio (Gams et al. En el laboratorio se utilizan hojas de ricino (Ricinus communis) como cebo para el aislamiento de hongos del complejo Cylindrocladium de manera rutinaria. en particular. 1991.1987. 2001). basidiomycetes y oomycetes del suelo. 1975... Sneh et al.. 2001. aquéllos que contienen especies patógenas de plantas. Papavizas et al. el medio usado es Komada (Masago et al. mientras que para Fusarium spp.. A pesar de ello. 2002b). 2003). 2000.. por ejemplo. 1977. cuyo protocolo se describe a continuación. 1998. Pettitt et al. Procedimiento para el aislamiento para el aislamiento de Cylindrocladium y géneros afines del suelo. Edel et al. cabello para las especies queratinofílicas. después se transfiere a un medio selectivo de agar para su posterior aislamiento de los hongos deseados... En la mayoría de los casos. 1970. Dackman et al. 1983. Dhingra y Sinclair. Edena et al. El aislamiento selectivo de los hongos del suelo también puede llevarse a cabo con cebos que son colonizados por grupos fisiológicos específicos de hongos. especies de Cylindrocladium y de las especies relacionadas Cylindrocladiella y Gliocladiospsis raramente son reportadas en muestras de suelo que emplean el método de dilución del suelo por placas. Hojas jóvenes y frescas se recogen y se lavan bajo agua de la llave para posteriormente ser sometidas a una desinfección con etanol al 70% durante un minuto. larvas de insectos para los entomopatogénos y nematodos para los hongos nematófagos (Marks y Mitchell. para el aislamiento de Rhizoctonia solani se utiliza agua-agar acidificada. utilizando como cebo hojas de Ricinus communis Cylindrocladium es un género conformado por especies saprotrófitas y patógenas de plantas comúnmente encontradas en el suelo. Gams et al. Gonçalves et al. Wellington et al. Tsao et al. quitina para los productores de quitinasa. deberán aislarse selectivamente usando cebos.

Cylindrocladiella. endófitos y patógenos de plantas. utilizando agujas finas de cristal. Después de más de 20 años. 1998. Los tejidos de plántulas infectadas se esterilizan con hipoclorito de sodio (al 2%. donde diariamente se verifica la esporulación típica de Cylindrocladium. Las dificultades de identificar a nivel de especie se ilustran con el género Fusarium. que es un grupo heterogéneo que incluye saprófitos. Crous. bajo un microscopio estereoscópico (Gams et al. por lo tanto. IDENTIFICACIÓN DE HONGOS DE SUELO La identificación de hongos que habitan el suelo puede causar problemas para aquéllos que no tengan suficientes conocimientos de micología. Las hojas enteras se colocan un una caja Petri de 15 cm y se cubren con una capa de suelo húmedo. síntomas de podredumbre. (2007) aún sigue siendo una fuente importante para todos los involucrados en el estudio de hongos del suelo. durante dos minutos. después de tres días de incubación se lavan las hojas cuidadosamente con agua destilada y se transfieren a una cámara húmeda. El aislamiento del hongo se logra con la transferencia de esporas a un medio de cultivo. Gonçalves et al. Las hojas utilizadas sin desinfección previa tienden a ser degradadas con mayor rapidez y a ser colonizadas por bacterias.. el amplio trabajo de Domsch et al. 2002b). es recomendable para su aislamiento el uso de plántulas de tomate como cebo. este compendio contiene claves para especies de varios géneros importantes y una recopilación de la literatura. Gliocladiospsis y otros géneros relacionados. Las semillas de tomate se germinan en 100 g de suelo y se verifica si las plántulas manifiestan o no. El trabajo de Barnett y Hunter (1998) es usado para unos pocos de los muchos saprófitos. enseguida se lavan con agua destilada y se secan en papel absorbente esterilizado para ser transferidas a un medio de aislamiento. incluyendo hongos del suelo. Hongos del suelo saprófitos y patógenos de plantas 255 . Además de las claves y monografías de alrededor de 250 géneros. Técnica de cebo para el aislamiento de patógenos fúngicos de plántulas Una amplia gama de hongos patógenos de plantas en el suelo puede causar la muerte prematura de las plántulas. tal como ADP y AM (agar extracto de malta) que contiene cloranfenicol (250 mg L-¹).seguida de hipoclorito de sodio al 3%. 2001.. durante 30 segundos).

. Una lista de referencias de guías y manuales para la identificación de grupos de hongos de suelo puede consultarse al final de este capítulo. EVALUACIÓN DE HONGOS DEL SUELO: TÉCNICAS ESPECÍFICAS DE DNA Una medida confiable de las comunidades de hongos del suelo. Para más instrucciones acerca de cómo identificar hongos o grupos específicos de hongos. éstos incluyen técnicas específicas de DNA. 1981) y para Phytophthora (Waterhouse.. Penicillium (Pitt. Las herramientas moleculares basadas en el análisis del DNA han sido aplicadas con éxito en el estudio de complejos bacterianos y. 2000). 1983. Se pueden utilizar otras metodologías para complementar los enfoques tradicionales usados para un mejor entendimiento de la diversidad y dinámica de los hongos del suelo. sí. 1976) y coelomycetes anamórficos (Sutton.. 1967. 1971. se puede consultar el Dictionary of the Fungi (Kirk et al. b. La monografía de Sheh et al. 1968. 1996).. 1970. Tsao et al. Si se trata de identificar ascomycetes. No son específicas para el caso de hongos del suelo. 1983. 2001). recientemente. Samuels et al. c. (1998). sin embargo.. Fusarium (Leslie et al. 1984. algunos tipos de hongos como Basidiomycota son difíciles de aislar y pueden no esporular en un medio axénico (Thorn et al. van der Plaats-Niterink. 1980. Bills et al.Monografías y páginas web se encuentran disponibles para identificar las especies de Aspergillus. de mucha utilidad para este tema otras recopilaciones y monografías como la de Ellis y Ellis (1985).. 1993. en ensambles de hongos a partir de muestras ambientales. (2000) o el manual de Gams et al.. Bridge y Spooner. Nag Raj. (Klich y Pitt 1988).. requiere de un laborioso programa de aislamientos sistemáticos con diferentes medios de cultivos y estrategias de aislamiento que reflejen la inmensa diversidad taxonómica y fisiológica de grupos de hongos que habitan en el suelo (Tsao et al. 2006). 1998a. Trichoderma (Bissett. Las secuencias de DNA son amplificadas directamente desde el suelo por medio de la reacción en cadena de 256 Manual de biología de suelos tropicales . (1991) resulta útil para trabajar con Rhizoctonia. 2001. Existen monografías disponibles para chyrids (Karling 1977) y también para el género Pythium (Waterhouse.. 1993). No obstante. (página web). Muyzer et al. hifas anamórficas pigmentadas (Ellis. Samson et al. b) pueden ser un buen punto de partida. Cylindrocladium (Crous. las monografías y claves de Hanlin (1990. Erwin y Ribeiro. 1991a.. 1996). 2004). 2002b).

El rDNA también contiene espaciadores entre las regiones codificantes conocidos como espaciadores internos de transcripción (ITS) que presentan secuencias de bases menos conservadas y que pueden utilizarse para la diferenciación entre especies relacionadas o para evaluar Hongos del suelo saprófitos y patógenos de plantas 257 . Las muestras muy pequeñas (menores a un gramo) deben usarse con precaución porque tienen mayor probabilidad de error. El polimorfismo en la longitud del DNA y la variación en la secuencia de las bases pueden utilizarse para agrupar organismos de acuerdo con su origen y relación evolutiva.8S y 28S se considera que son altamente conservados entre los organismos eucarióticos y normalmente se emplean como marcadores moleculares. Las células de los hongos presentes en la muestra del suelo.. Los kits para la extracción de DNA del suelo están comercialmente disponibles. Uso de Primers específicos para “hongos” El grupo de genes para las moléculas de RNA Ribosomales 18S. Los protocolos de extracción se basan. incluso como micelio o esporas. tienen que estar correctamente lisadas. 2001). 2001).la polimerasa (PCR) y posteriormente caracterizadas utilizando varios enfoques (Bridge y Spooner.. El total de DNA obtenido debe estar completamente purificado para eliminar sustancias húmicas y fenólicas que interfieren con el PCR. 1997.. Reacción en cadena de la polimerasa. este paso se logra mediante separaciones a través de columnas de separación o con el uso de kits comerciales de purificación de DNA (Liu et al. principalmente. debido a una variabilidad más alta dentro de la muestra (Ranjard et al. La identificación de secuencias de DNA desconocidas también puede realizarse comparándolas con bases de datos de secuencias de nucleótidos de taxones conocidos. Bridge y Spooner. es la extracción del DNA directamente del suelo. 2000. Varias copias del DNA ribosomal (rDNA) se encuentran en el genoma eurocariota. 5. en los procesos físicos de macerado asociado con calor y lisis química. Viaud et al. 2001). facilitando la amplificación de pequeñas muestras de DNA. Extracción de DNA Un paso crucial antes del PCR. La heterogeneidad encontrada a nivel de micro-escala en el suelo debe ser considerada cuando se selecciona el tamaño de la muestra de suelo sometida a la extracción total de DNA.

2000. Lees et al. conectados a vectores plásmidos y clonados en células bacterianas. Estos procedimientos son caros. Los Primers permiten la amplificación de una amplia gama de especies de hongos sin perder la especificidad de este grupo clave. los Primers que son específicos para amplificar PCR del DNA de hongos de muestras complejas de suelo. 2002. 2001). 2000. el obtener Primers o iniciadores de rDNA de hongos específicos constituye un paso fundamental en la amplificación del PCR. Baayen et al. La detección y/o cuantificación de pocas especies específicas de hongos es requerida generalmente en el campo de la fitopatología. El DNA clonado es secuenciado y comparado con las bases de datos que contienen secuencias oligonucleotídicas del rDNA fúngico mediante análisis de software. algunos de estos Primers específicos han mostrado que amplifican DNA no fúngico o muestran preferencia hacia la amplificación de grupos taxonómicos específicos dentro del reino de los hongos (Smit et al. no son adecuados para la evaluación de muestras ambientales complejas. 2002.. tales como especies de Phytophthora. son difíciles de detectar por métodos moleculares. extraídos de matrices de gel. utilizando Primers específicos para Géneros y/o especies de interés (Nechwatal et al. 2002). además. Algunos hongos que están presentes en muy bajas densidades en suelos naturales.. ya que el PCR tiende a amplificar moléculas del DNA que son dominantes en el extracto del DNA total. Como el suelo contiene un gran número de organismos. Borneman y Hartin. 1999. Filion et al.. 2003). Por 258 Manual de biología de suelos tropicales . la detección molecular de muestras de suelo puede ser mejorada mediante el uso de técnicas de cebo en conjunto con PCR. Para este tipo de investigación se han desarrollado varios iniciadores especie-específicos para una detección directa y el monitoreo de patógenos de estas plantas a partir de muestras del suelo (Cullen et al. han sido desarrollados y compilados por Anderson y Cairney (2004). En el caso de estos hongos... 2000.divergencias genéticas intraespecíficas (Viaud et al. Basándose en las secuencias de genes de RNA ribosomal disponibles en bancos de datos especializados para varias especies de hongos. consumen tiempo y.. Secuenciación del DNA Para poder conocer las identidades del DNA de los hongos amplificados por PCR. Anderson et al. Down.. purificados. Sin embargo. los amplicones de tamaño correcto pueden separarse en geles de agarosa.. 2003).

Los amplicones tienen exactamente el mismo número de nucleótidos. contienen un DNA con bases repetitivas de GC que resultan menos propensas a la desnaturalización debido a su alta estabilidad química... 2000. presentan diferentes comportamientos de desnaturalización y migran hacia diferentes puntos en el gel (Muyzer et al. al igual que para monitorear modificaciones o impactos debidos a prácticas agrícolas o actividades industriales (Smit et al. Los patrones de bandeo generados son utilizados para analizar complejas comunidades de hongos del suelo. Vandenkoornhuyse et al. El gradiente de desnaturalización en DGGE puede variar con el uso de diferentes cantidades de urea y de formamida en la matriz del gel. Bajo estas condiciones de desnaturalización.ello. 2000. Varias combinaciones de Primers han sido propuestas para amplificar DNA de distintos grupos de hongos como Ascomycota. 2003. Viaud et al. generalmente. el DNA se extiende a la misma longitud (como resultado del PCR). 2003). Hongos del suelo saprófitos y patógenos de plantas 259 . En esta técnica.. 1999. Los iniciadores usados en el PCR. moléculas de DNA con diferentes secuencias en sus pares de bases.. 2004). Elsas et al. pero difieren en su contenido de Guanina-Citosina (GC). En varios estudios se ha usado esta técnica para evaluar la estructura de la comunidad de hongos y otros microorganismos. pero con diferentes secuencias de pares de bases.. Método de huella molecular TGGE y DGGE La electroforesis en gel con gradiente de desnaturalización fue introducida en estudios sobre ecología microbiana por Muyzer y Smalla (1998). 1993). Basidiomycota... lo que determina el modo de desnaturalización y la movilidad electroforética al migrar en el gel desnaturalizante. 2002. Anderson et al. se han desarrollado técnicas moleculares de huella o rastreo molecular (en inglés fingerprint) para estudiar la diversidad a nivel de comunidad (Borneman y Hartin. Las restricciones y limitaciones están representadas en la selección de Primers utilizados en el primer paso de amplificación después de la extracción total del DNA de las muestras. las moléculas 18S DNA amplificadas por PCR son sometidas a una electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) o con un gradiente desnaturalizante (DGGE). Por lo tanto. Gomes et al. Milling et al. 2000. parcialmente desnaturalizadas debido a las diferencias de la desnaturalización de los dominios menos estables en las moléculas. y se llaman dominios de fusión..

2003). tales como TGGE y DGGE. Después de la amplificación.. la técnica puede proporcionar un estándar altamente reproducible de un gran número de muestras ambientales durante un periodo de tiempo relativamente corto. En el T-RFLP. T-RFLP Liu et al. Para incrementar el polimorfismo de la banda y mejorar la resolución.. la comigración de diferentes moléculas de DNA hacia un mismo punto en el gel. El uso de un PCR anidado puede arrojar aún mejores resultados e incrementar la resolución en la separación de los productos del PCR (Oros-Sichler et al. Otra limitante es que el DNA obtenido de organismos filogenéticamente distantes puede producir productos de PCR con una movilidad electroforética idéntica (Gomes et al. después de la amplificación del DNA por PCR directamente extraídos del suelo utilizando Primers género-específicos (Nechwatal et al. Las especies de hongos relacionadas pueden identificarse de acuerdo con sus patrones típicos de RFLP.Chytridiomycota. Los fragmentos de restricción terminal (TRFs) se marcan con fluorescencia y pueden ser detectados y cuantificados en un secuenciador automático. (1997) desarrollaron una versión complementaria del PCR-RFLP. los enfoques polifásicos que incluyen la construcción de bibliotecas de fragmentos clonados. Técnica PCR-RFLP La escasa variabilidad de rDNA de hongos puede resultar desventajoso en la técnica de huella molecular. 2004).. Zygomycota y Oomycota (Nikolcheva y Bärlocher. No obstante. 2006). 2000)..l. el DNA es amplificado por PCR con uno de los dos Primers marcados con fluorescencia.. el DNA es tratado con enzimas de restricción y los fragmentos de restricción separados en un gel de acuerdo con su tamaño. son la mejor opción (Malosso et al. 2006). llamada polimorfismo de longitud de fragmentos de restricción terminal para el análisis (T-RFLP) de comunidades bacterianas de muestras ambientales. Se puede construir una base de datos de TRFs a partir de especies de hongos conocidos y utilizarla en corre260 Manual de biología de suelos tropicales . 2001). Singh et a. el método de huella molecular. la restricción enzimática del DNA antes de la electroforesis puede utilizarse en una técnica conocida como polimorfismo de longitud de fragmentos de restricción (RFLP) del DNA amplificado por PCR (Viaud et al. 2006. los análisis bioquímicos y las técnicas de aislamiento. Recientemente. por ejemplo.

Las moléculas de una sola hebra de DNA adquieren estructuras con dobleces únicos dictados por sus secuencias nucleotídicas y migran hacia puntos específicos en el gel.. La Tabla 8. 2005). 2005). 1997. 1996. pero disímiles en su secuencia de pares de bases pueden ser fácilmente separados en SSCP por su diferencial de migración en el gel cuando existe la conformación de una sola hebra (Lee et al. 2004. 2000. En estos esHongos del suelo saprófitos y patógenos de plantas 261 . 2005. He et al. Como consecuencia. 2003. Singh et al. En el análisis automatizado del espaciador intergénico ribosomal (ARISA). Lowell y Klein 2001. En el polimorfismo de conformación de cadena sencilla (SSCP). sin embargo. el DNA fúngico es extraído del suelo y amplificado por PCR utilizando Primers específicos para la región ITS con uno de los Primers marcados con fluorescencia.. Kennedy et al. Después de la amplificación. Kennedy et al.... ARISA El polimorfismo natural de la región ITS del rDNA entre especies de hongos puede utilizarse para la evaluación de comunidades de hongos de suelo.. los fragmentos de DNA del mismo largo.laciones taxonómicas con los haplotipos detectados en el análisis T-RFLP (Brodie et al.. están enfocados en una o en pocas especies de hongos presentes en el suelo. 2001). el polimorfismo intra-específico del ITS puede presentar problemas en la separación de distintas especies filogenéticas (O’Donnell y Cigelnik. el DNA amplificado es completamente desnaturalizado antes de ser sometido a una corrida de electroforesis. Viaud et al.. especialmente con hongos patógenos de plantas. El ARISA de hongos es una técnica altamente sensible. SSCP Otro estudio de huella molecular utiliza la migración diferencial de moléculas de una hebra de DNA en un gel para poder estudiar a las comunidades microbianas más complejas. 2006).. los diferentes fragmentos de ITS son separados en un gel y posteriormente detectados y cuantificados en un secuenciador automático (Ranjard et al. PCR cuantitativo Algunos estudios. Edel-Hermann et al.1 muestra algunos ejemplos de técnicas moleculares empleadas para el estudio de comunidades de hongos del suelo publicadas en años recientes.

Lees et al. Filion et al. fragmentos de DNA que contienen los mismos sitios iniciadores que la muestra de DNA son añadidos en cantidades conocidas a las reacciones del PCR y coamplificados con el DNA específico. Esta técnica es más rápida y más sencilla que cPCR porque no existe la necesidad de construir un competidor de DNA y no se requiere de ningún análisis post-PCR (Cullen et al. 2003). No obstante. Li y Hartman. 2002. Después de un número definido de ciclos de PCR éstos se usan para cuantificar el DNA directamente de muestras de suelo.. En el cPCR. La cantidad de DNA en la muestra puede calcularse con la adición de diferentes cantidades de DNA competitivos.. 1998. han sido desarrolladas modificaciones del PCR convencional como PCR competitivo (cPCR) y PCR en tiempo real. Las sondas fluorescentes son capaces de emitir fluorescencia en la presencia de DNA de dos hebras. Sondas fluorogénicas o colorantes adicionados al PCRs permiten el monitoreo correcto de los productos obtenidos durante la amplificación. el PCR convencional es inapropiado para enfoques cuantitativos porque cualquier pequeña variación durante la fase exponencial en la reacción de amplificación puede alterar drásticamente las cantidades de los productos del PCR. 2000. 2003. 1992. Mauchline et al. los distintos productos de PCR son cuantificados por separado de acuerdo con sus intensidades de bandeo relativas en geles de agarosa. 2002). Mauchline et al. se deben diseñar Primers de PCR específicos para obtener la amplificación correcta del DNA de la especie clave y otros marcadores moleculares pueden ser empleados como secuencia del gen β-tubulina o el factor de elongación de traducción del gen EF 1-α (Baayen et al. Además de la detección molecular. por lo tanto.. Una curva estándar puede construirse con cantidades conocidas de DNA e intensidades de fluorescentes.tudios. lo cual puede calibrarse y medirse con precisión. Después de esta amplificación. Baek y Kenerley. la cuantificación del DNA de hongos en el suelo es requerida frecuentemente para estudios epidemiológicos y ecológicos. 2003). Otro método empleado en aproximaciones cuantitativas es el de PCR en tiempo real. En el caso de ensayos cuantitativos.. 2002.. a una cantidad estándar de una muestra de DNA en una serie de PCRs y con el monitoreo de productos PCRs competitivos producidos en cada reacción (Siebert y Larrick. el incremento de moléculas de DNA durante la amplificación conlleva un incremento en la intensidad de la emisión fluorescente.. 2002. 262 Manual de biología de suelos tropicales .. Filion et al.

.. Suelos con diferentes propiedades fisicoquímicas.. Rizósfera de dos cultivos de maíz durante el periodo de ciclo de vida de la planta. 2003 Agnelli et al. 2000 Lowel y Klein. 2005 Yergeau et al.. Campos de espárragos. 2004 Edel-Hermann et al.. los efectos de cambiar el suelo al añadir composta o excremento.. amplificados del DNA total... 2004 He et al... 2003 Brodie et al. Suelos con diferentes propiedades fisicoquímicas. Suelos bajo cultivos de papa transgénica y no transgénica.. Pastizales bajo diferentes tipos de vegetación. 2000 DGGE DGGE y TRFLP DGGE y restricción de DNA amplificado DGGE T-RFLP Anderson et al. 2001 Ranjard et al. Suelo estepario con pasto corto con o sin presencia de nitrógeno..Tabla 8.. Diferentes horizontes de un suelo de selva. Tres diferentes suelos cultivados con Lolium perenne. Una muestra de suelo por métodos de cultivo y molecular. Análisis de la dinámica de comunidades de hongos del suelo vía PCR hongoespecíficos del DNA del suelo. Técnica* TGGE PCR-RFLP SSCP ARISA DGGE Evaluación de comunidades de hongos en Rizósfera y suelo compuesto con trigo. Referencias Smit et al. 1999 Viaud et al. 2006 Hongos del suelo saprófitos y patógenos de plantas 263 . análisis de detección y diversidad de especies de Fusarium. 2003 Gomes et al.. seguido por DGGE.2005 DGGE SSCP y TGGE ARISA y T-RFLP DGGE con iniciadores específicos para Fusarium DGGE y T-RFLP Singh et al. Gradiente de suelo desde llanuras hasta bosques de pino escocés. Suelos de bosque natural y plantaciones de pino hoop. 2005 Kennedy et al. 2004 Milling et al. Gradiente de pastizales semi-naturales a suelos agrícolas mejorados. 2001 Elsas et al.1 Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes.

no se aplica en el caso de hongos saprófitos. Incluso la mayoría de los hongos patógenos de plantas no son parásitos obligados. este método no se describe para cada ejemplo. CONCLUSIONES Las herramientas moleculares para ensayos de comunidades de hongos del suelo fueron extraídas. exagerado. lo que origina errores en identificaciones morfológicas. 2002a. los enfoques taxonómicos de hongos basados únicamente en datos moleculares. requieren de una secuenciación y comparación utilizando bancos de datos de DNA al alcance del público. 2003. 2006 Nota: * la clonación del DNA y la secuenciación fueron usadas por todos los autores para la identificación de haplotipos dominantes amplificados del DNA total.Tabla 8. huella molecular y técnicas de clonación. de estudios sobre la diversidad bacteriana y. Sin embargo. pero una mejor caracterización y análisis filogénico de taxas dominantes. Técnica* DGGE y ARDRA Evaluación de comunidades de hongos en Diversidad de hongos en suelos antárticos que combinan cultivo de aislamiento. en la secuenciación de quimeras (Crous. 1992. Muchos obstáculos para la identificación basada en cultivos han sido superados con la llegada de técnicas de aislamiento más sofisticadas como. invariablemente. como hongos micorrízicos arbusculares. contienen las mismas limitaciones que las técnicas de cultivos para hongos (Selenska y Klingmüller. por ejemplo. Lo que puede ser verdad para organismos estrictamente simbióticos. Referencias Malosso et al. 2004b). por lo tanto. 1994).. tal y como ha sido discutido. los métodos de lavado del suelo y la filtración de partículas.. No obstante. Bridge et al. generalmente. pueden presentar algunos problemas debido a que los bancos de datos pueden estar incompletos y puede que las secuencias de DNA se encuentren mal identificadas.. Tsai y Olson. sin duda. 1992. amplificación y secuenciación de contaminantes de hongos e incluso.1 Continúa. principalmente. Hawksworth. Las técnicas de huella molecular en comunidades puede monitorear composiciones complejas de hongos de suelo. O’Donnell et al. en el caso de los hongos el número de especies no cultivables es. Otra limitación del enfoque molecular basada en la amplificación del DNA es la falta de conocimientos acerca de la actividad de crecimiento o grupos funcionales 264 Manual de biología de suelos tropicales .

generalmente. un enfoque más confiable es realizar un análisis de varianza (ANOVA). Por el momento. tales como logaritmo o raíz cuadrada pueden aplicarse antes del análisis (Houston et al. Como se ha discutido. por lo tanto. Las curvas de acumulación de especies o curvas de rarefacción pueden proporcionar comparaciones gráficas de la riqueza de especies entre muestras. 2006). y también dan información sobre el esfuerzo de muestreo empleado en la investigación. donde el número total de cepas de cada muestra se usa en comparaciones pareadas.. por ejemplo. por ejemplo. Sokal y Rohlf. Otra opción consiste en llevar a cabo un análisis de varianza no paramétrico. 1994. de acuerdo con la acumulación de las cepas muestreadas. Cuando están disponibles datos sobre variaciones cuantitativas entre las repeticiones dentro de las muestras. 2006. los protocolos de extracción del DNA son capaces de lisar y extraer ácidos nucleicos ya sea de micelio en crecimiento activo o de esporas latentes. pueden añadirse al ANOVA para evaluar sus efectos y sus interacciones con otros datos cuantitativos (Setälä y McLean. La pendiente de las curvas muestra cuáles son las muestras con mayor riqueza de especies. el análisis de Kruskall-Wallis (Rodrigues. Singh et al. Adicionalmente. 1998). las transformaciones de datos. Se verifica el número de cepas de cada muestra y este dato puede ser usado para comparar entre sitios. 2004). otros factores. 1995). dado que algunos de los datos no tienen una distribución normal. Para solucionar ese problema. 1995). El conjunto de datos preliminares usualmente no es adecuado para hacer los análisis de ANOVA.. haciendo difícil la diferencia del crecimiento activo o grupos funcionales basados únicamente en el producto del análisis del PCR. constituye el primer conjunto de datos. además del número de cepas. las curvas que se forman con más facilidad. Por medio del ANOVA es posible derivar variaciones entre diferentes muestras y dentro de las muestras (error).de hongos del DNA total extraído del suelo. La prueba de independencia de Chi cuadrada puede usarse para este análisis. ANÁLISIS DE DATOS Una lista de especies o agregados de especies aisladas y su abundancia relativa en cada muestra.. como parámetros físicos y químicos del suelo bajo análisis. La forma de las curvas indica si el número Hongos del suelo saprófitos y patógenos de plantas 265 . fechas de colecta o diferentes tratamientos de suelo. un entendimiento más completo sobre las comunidades de hongos del suelo deberá centrarse en enfoques polifásicos con ensayos basados en cultivos y taxonomía molecular en asociación con el estudio de los procesos biogeoquímicos que ocurren en el suelo (Malosso et al. resulta ser un análisis robusto y confiable (Sokal y Rolf.

1994. común o rara y a la complejidad de los modelos matemáticos que se basan en la distribución de las especies. Los resultados se muestran gráficamente y permiten el análisis de tendencias generales de la estructura de la comunidad (Gauch. Los índices de similitud (disimilitud) de diversidad para realizar comparaciones pareadas entre diferentes muestras también son usados con frecuencia (Magurran. al igual que en otras técnicas de ordenación. Muchos índices se han obtenido para evaluar y comparar la diversidad de especies.). por ejemplo. 1994). En el caso de AC. el análisis multivariado no se lleva a cabo en el total de comunidad debido a la naturaleza “ruidosa” de la frecuencia y a la distribución de especies raras. las relaciones multidimensionales entre muestras y especies se reducen a un número reducido de ejes que. 1995).. Curvas que no tienden a una asíntota indican que el número de especies podría aumentar si se aumenta el esfuerzo de muestreo (Bills y Polishook. De esta manera. Bettucci et al. 1988. La información sobre la estructura de la comunidad es mejor si se usa un análisis multivariado. 1995). Los índices de diversidad son puramente numéricos y no proporcionan información sobre la estructura de la comunidad. análisis de correspondencia sin tendencia. 1993. 1998. El índice Shannon-Wiener se basa en la riqueza y equitatividad de la diversidad de las especies y se encuentra frecuentemente en la literatura (Dighton. idealmente. Howard y Robinson. 1995). datos generados de conteos.. son métodos de ordenación adecuados para la clase de datos generados de hongos y de otras comunidades. 2003). matrices de datos de gran tamaño (llenas de ceros) y datos de distribución no paramétricos.. El porcentaje de la varianza total explicada por el primer eje del AC y la contribución de las especies y muestras a la varianza (inercia) de cada eje apoya la designación de especies que ocurren en la comunidad como clave y “casual” (Howard y Robinson. Grishkan et al. y existen casos en donde dos comunidades distintas pueden tener el mismo índice de diversidad. tales como los métodos de ordenación. La diversidad de especies de cualquier sistema está compuesta por dos componentes: la riqueza de especies (el número de especies) y la equitatividad o equidad de la frecuencia de especies (Kennedy y Smith. si las curvas tienden a llegar a una asíntota. 1982. basándose en su riqueza o equitatividad o tomando ambas variables y éstos cambian en función de la importancia relativa que se da a la especie dominante. De manera general. El análisis de correspondencia (AC) y su versión modificada. se elige un límite (por ejem266 Manual de biología de suelos tropicales .de especies es estable después de la acumulación de todas las cepas. por ejemplo. explican la mayoría de la variabilidad de datos. Persiani et al.

1996). Las colecciones de referencia deberían ser apoyadas por países con una política fuerte en ciencia y tecnología dado que contienen información acerca de la distribución geográfica y de los hospederos. PRESERVACIÓN Y COLECCIÓN DE RECURSOS GENÉTICOS Los inventarios de biodiversidad proporcionan argumentos y algunas bases científicas para la preservación de hábitats y el uso sustentable de suelos. Los métodos de ordenación de análisis de componentes principales y análisis de correspondencia. Bettucci et al. Oros-Sichler et al. 1% ó 5% del número total de aislamientos) y únicamente aquellas especies con una frecuencia de aislamientos igual o superior a este límite son incluidas en el análisis (Gauch. 1982. 1992. así como el análisis de conglomerados (cluster). En el futuro. Sheila Okoth por sus comentarios y discusiones durante la preparación del capítulo. 2004). 2004a. Hongos del suelo saprófitos y patógenos de plantas 267 . Ryan y Smith. Las colecciones de recursos genéticos hoy en día son solicitadas en todo el mundo. 2006). para la preservación a largo plazo de especímenes de resguardo será fundamental validar las entradas de secuencia y bases de datos genómicas. Hawksworth..5%. por lo que proveen material de trabajo básico para quienes estudian las características y la variación.plo.. 1995. al igual que las aplicaciones prácticas y económicas de las especies (Smith y Waller. 2003). son normalmente empleados para derivar resultados procedentes de los métodos de huella molecular. por lo tanto. El estatus actual de las colecciones de recursos genéticos de hongos y los retos para apoyar la necesidad de la genómica de hongos. la biología molecular y la conservación de hongos han sido revisados recientemente (Hawksworth.. 1993. 2002. en donde las matrices son construidas con datos de presencia o ausencia de bandas distintivas (de manera ideal para especies diferentes) en los geles y la estructura de la comunidad es analizada posteriormente (Fromin et al. 1996. Agradecimientos Al profesor Richard Mibey y a la Dr.. es necesario que sean recopilados. Kirsop. como en el caso de la publicación de nuevos nombres (Agerer et al. 0. Bettucci y Alonso. con el objetivo de la preservar las especies ex situ y de suministrar a instituciones de investigación e industrias de este material. 2002).

. (2003) ‘Potential bias of fungal 18S rDNA and internal transcribed spacer polymerase chain reaction primers for estimating fungal biodiversity in soil’. 769–779. (1997) ‘Agricultural intensification. 891–900. 419–428. C... Baek. Kroon. K. pp. S. E. E. vol. G. (1988) “A critical examination of the soil washing technique with special reference to the effect of the size of the soil particles’. C. R. 66. Anderson. G. y Watling. 642-644. J. R. 268 Manual de biología de suelos tropicales . vol. 39. C. Triebel. D. M. M. vol. D. Ceccherini. pp. pp. (1998) ‘Detection and enumeration of a genetically modified fungus in soil environments by quantitative competitive polymerase chain reaction’. Vikram Reddy. R. Anderson. S. P. Begerow. N. Campbell. Cortia.E. J. Courtecuisse. Blanz. Pedobiologia. A. Korf. pp. M. Greenhalgh. Mueller. Environmental Microbiology. pp. Bååth. F. C. L. Agnelli. O’Donnell. 90. (2000) ‘Gene genealogies and AFLP analyses in the Fusarium oxysporum complex identify monophyletic and nonmonophyletic formae speciales causing wilt and rot disease’. C. 104. Bonants.. 5.. P. G. D. pp. y Waalwijk. J. R. R. Beare. Horak. 36–47. the role of decomposer organisms’. C. M. vol. W. 5.. (2006) ‘The simpleseptate basidiomycetes: A synopsis’. 6. Sampaio.. R. D.. Canadian Journal of Botany. 6. vol. Weiss. (2004) ‘Diversity and ecology of soil fungal communities: Increased understanding through the application of molecular techniques’.. G. T. P. J. y Kenerley. Roebroeck. vol.... 25. G. vol. vol... y Alonso. 87–108. L. W... y Handley. vol. vol. Bettucci. Gams. (2004) ‘Distribution of microbial communities in a forest soil profile investigated by microbial biomass. M. P. (2003) ‘Fungi are the predominant micro-organisms responsible for degradation of soil-buried polyester polyurethane over a range of soil water holding capacities’. Rambold.. 95. soil biodiversity and agroecosystem function in the tropics. 859–868. y Prosser. pp. Baayen. I. pp. pp. y Cairney.. pp. Barratt. y Srivastava.. D. R. 470–480.. vol. FEMS Microbiology Ecology. S. Cigelnik. H. Halling.. (2003) ‘Always deposit vouchers’ Mycological Research. (1995) ‘The effect of wildfire on the opportunistic decomposer fungal community of Uruguayan Eucalyptus spp. Mycological Progress. 1566–1569. Journal of Applied Microbiology. I. M. I. R. forest’. Applied Soil Ecology. R. Hallenberg. A. y Oberwinkler. J.. Tian... Ammirati.. Robson. Summerbell. J. E... R. 41–66.. P. Oberwinkler.. Ennos. J. Phytopathology. y Pietramellar. Bauer. A. Dejardin.. 36. 78–85.. Hawksworth. pp. Environmental Microbiology. Nannipieri. N.REFERENCIAS Agerer. Ascher. L. C. soil respiration’. R. Soil Biology and Biochemistry. D.. E. P..P. F. M. G. M. J. G. P.

W. (2002a) ‘Adhering to good cultural practice’. Roberts. Bridge. 160. B. pp. 13. 127–145. D. y Guiraud. y Panchal. P. Amsterdam. F. O. in G. Bordjiba. K. Bonkowski. Rodriguez. M. J. Mycologia. Bills. P. M. pp.. L. Brodie. FEMS Microbiology Ecology. G. D. M. Phytopathology. 4356–4360. C. 418–426. pp. (2000) ‘PCR primers that amplify fungal rRNA genes from environmental samples’.. K. 51. P. y Clipson. 44. B. K.. (1994) ‘Abundance and diversity of microfungi in leaf litter of a lowland rain forest in Costa Rica’. J.. Steiman. G. (2002b) Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. Dackman. vol.. Microbial Ecology. S.. 37. vol. Foster (eds) Biodiversity of Fungi: Inventory and Monitoring Methods. 89–93. G. F. P..W. K. y Duncan. Bury. 30. ppv147–154. (1993) ‘Fungal communities of two grazing-land soils in Uruguay’. pp. Lees. Journal of Environmental Quality. Powell. R. y Spooner. Crous. E. Christensen. y Hartin. Dupont. P. A. Bills. Plant and Soil. y Polishook. vol. pp. Semadi. P. pp.. pp. L. Pedobiologia. Spooner. Pedobiologia. B. pp994–998. I. y Ritz. (1996) ‘Filamentous fungi’. Applied and Environmental Microbiology. P. Pedobiologia. 232. 45. vol. S. vol. S. Olsson. y Thorn. vol. 666–676. J. J. M. F. vol. C. Borneman. pp. Chet. Hongos del suelo saprófitos y patógenos de plantas 269 . (2000) ‘Food preference of earthworms for soil fungi’. I. H. diversity and detection’.. Edwards. vol.. B. Wallingford. B. pp. Plant Pathology. 43–48. Malvarez. pp. M. I. G. pp1378–1379. Griffith. vol. Bills y M. J. F. 105–114. New Phytologist... Bridge. 46. (2001) ‘Soil fungi. Mueller. Crous. Jansson. M. 72–82. vol. vol. R. (2001) ‘Removal of herbicides from liquid media by fungi isolated from a contaminated soil’. y Nordbring-Hertz. in G. Mycological Research. 86. (2003) ‘On the unreliability of published DNA sequences’. F. E. Hall (ed) Methods for the Examination of Organismal Diversity in Soils and Sediments. A. (1980) ‘Induction of suppressiveness to Rhizoctonia solani in soil’. N. 281–292. vol.Bettucci.. (1987) ‘Quantification of predatory and endoparasitic nematophagous fungi in soil’. J. M. 606–623.. vol. St Paul. 66. y Roquebert. S. (2002) ‘Detection of Colletotrichum coccodes from soil and potato tubers by conventional and quantitative real-time PCR’. MN. Lundgren. 271–302. D. G. pp. D. 187–198. 70. W. M. (2004) ‘Saprobic soil fungi’. (2002) “Paraná river delta wetlands soil microfungi’. APS Press. Elsevier. 106. M. Cannon. F. (2003) ‘Soil fungal community structure in a temperate upland grassland soil’. Toth.. pp. CAB International. Kadri. y Baker.. Cullen... y Indarte. Bettucci. R.

. G. Enfield. Dighton. S. London. pp. 397– 404. (2000) Detection and Isolation of Soil Fungi. 53. M. Grigorova y J. H. A. y Smit. (2001) Straminipilous Fungi.. y Steinberg. (2000) ‘Analysis of the dynamics of fungal communities in soil via fungal-specific PCR of soil DNA followed by denaturing gradient gel electrophoresis’. Boca Raton. F. vol. Down. Edel. y Rossi. Dighton. pp. Elsas. CRC Press Inc. 61–71. Jourdain-Miserez.. 515–522. vol. y Alabouvette. R. Hillb. T. FEMS Microbiology Ecology. Aragno. Dreumont. pp. The Netherlands. Duarte. pp. (1985) Basic Plant Pathology Methods. 270 Manual de biología de suelos tropicales . S. 49. M. Academic Press. R. Eching. H. Dhingra. pp.. Dick. G.. M. (2000) ‘An efficient baiting assay for quantification of Phytophthora cinnamomi in soil’. Fromin. Hamelin. 51–58. W. K. Mycological Research. vol.. IHW Verlag. N. M. Journal Microbiological Methods. Mycologist. y Jabaji-Hare. vol. 47. F. W. (2002) ‘Fungal family trees: Finding relationships from molecular data’. K. Journal of Microbiological Methods. Forestier.. C.. B.Davet. y Boddy. y Sinclair. Gautheron.. (1990) ‘Methods for studying fungi in soil and forest litter’. 634–643.. Gillet. Keijzer-Wolters. Steinberg. Environmental Microbiology. G. D. vol. N. P. J. (2003) ‘Direct quantification of fungal DNA from soil substrate using real-time PCR’. J. E.Cuvelle. G.. y Anderson.. pp67–76. M. 22. C. pp. 36. M. M. 98. 2nd edition. 343–404. Filion. pp. Science Publishers. (2004) ‘Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils’. A. V. Dordrecht. in R. St-Arnaud. Teyssier. D. G. vol. Norris (eds) Methods in Microbiology. Gams. Edena. 133–151.. (2007) Compendium of Soil Fungi. 11. vol. J. J. Edel-Hermann. V. F. C. J. 43. y Rouxel.. A. 16. Domsch. D. S. Pérez-Piqueres. J. Frankland. y Galpoththage... (2002) ‘Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns’. vol. pp. Plant Pathology. N. (1994) ‘Analysis of micromycete communities in soil: A critique of methods’. (2001) ‘Genetic diversity of Fusarium oxysporum populations isolated from different soils in France’. 796–798. Tarnawski. A. Kluwer Academic Publishers. vol. Recorbet... L. O. Roesti. FEMS Microbiology Ecology..

Gomes. L. C.. in S. Isaac. A. 41. 26–35. A. (1997) ‘Where are all the undescribed fungi?’. (1996) ‘Microbial collections as a tool in biodiversity and biosystematic research’. D. Hawksworth. A. pp. Cambridge. J. y Rossman. 50. in R. Gray. vol. vol. L. 22. A. Wasser. A. P. R. Stouthamer (eds) Culture Collections to Improve Quality of Life. E. (1990) ‘Methods for studying the microbial ecology of soil’. R. W. Academic Press. O. Frankland. y Hughes. Whalley (eds) Aspects of Tropical Mycology. J. 3758–3766.. 261–264. (1993) ‘The tropical fungal biota. pp. J. Grigorova y J. Watling y A. G. 888–891. L. CBS. FEMS Microbiology Letters. prophylaxis. Mendonça-Hagler. 95. Jr (1982) Multivariate Analysis in Community Ecology. Lower Nahal Keziv. C. vol. (2001) ‘Evaluation of bioassays to quantify Cylindrocladium inocula soil’. y Smalla. pp.. vol. G. W.. C. Hawksworth. S. A. (2004b) ‘“Misidentifications” in fungal DNA sequence databanks’. significance and conservation’. 527–539. R. Gams. pp. Baarn. Proceedings of the International Congress for Culture Collections. W. vol. Xu. 310–342. (1992) ‘The analysis of communities of saprophytic microfungi with special reference to soil fungi’. pp. E.. Phytopathology. Fagbola. and prognosis’.... London. pp. Rumjanek. Cambridge University Press. D. He. P. y Aptroot. (2004a) ‘Fungal diversity and its implications for genetic resource collections’. Grishkan. (1991) ‘The fungal dimension of biodiversity. Buchner. Hoekstra. 161. vol. N. Biological Journal of the Linnean Society. J. G.. N. L. Stalpers. Gauch. Cambridge University Press. Mycological Research. D. vol. 4th edition. western Upper Galilee. S. van der Mei y A. Gonçalves. Alfenas. H. pp. (2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. 69. Hawksworth. census. Hawksworth. Nevo. y Beharav.. J. pp. A. New Phytologist. L. 87. Mycoscience. Kluwer Academic Publishers. Samson.Gams. L. (2005) ‘Analyses of soil fungal communities in adjacent natural forest and hoop pine plantation ecosystems of subtropical Australia using molecular approaches based on 18S rRNA genes’. pp13–15. C. 78. Hawksworth. pp. R. S. (1998) CBS Course of Mycology. D. 247. vol. The Netherlands. H. R. Hawksworth. Winterhoff (ed) Fungi in Vegetation Science. I. Studies in Mycology. pp. 183–223. Baarn. A. Norris (eds) Methods in Microbiology. New York. Hongos del suelo saprófitos y patógenos de plantas 271 .. L. y Crous. (2003) ‘Adaptive spatiotemporal distribution of soil microfungi in ‘Evolution Canyon’ II. in W. T. Dordrecht. 91–100. Israel’. 9–18. D. Applied and Environmental Microbiology. L.. M. G. magnitude. 641–655. Costa. D. Y. K. CBS. in R. Maffia. vol. Z. D. pertinence.

Howard. vol.. (2003) ‘Changes in the structure of fungal communities of soil treated with sewage sludge’. Kennedy. J. S. T. (1996) ‘Nonradioactive method to study genetic profiles of natural bacterial communities by PCR single-strand-conformation polymorphism’. L. Edwards. pp. 518–527. (2001) Dictionary of the Fungi. Hong Kong. pp. 463–473. pp. J. C. (1998) ‘Microbial processes and fungal community structure in soils from clear-cut and unharvested areas of two mixed wood forests’. Microbial Ecology. (1997) ‘Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16s rRNA’. D.. P. Frankland.. Wallingford. 38. Applied and Environmental Microbiology. P. S. pp. 3112 –3120. y Stalpers. Canadian Journal of Botany. pp. N. Zo. Kacprzak. K. World Federation of Culture Collections. L. y Lautenschlager.. H. vol. (1986) ‘Fungi of a forest soil nitrifying at low pH values’. vol. pp. H. D. J. P.Houston. Kirsop. J. Cullen. CAB International. Pedobiologia. (1997b) ‘Can we rapidly measure fungal diversity?’. Lodge. 76. pp. Whalley (eds) Aspects of Tropical Mycology. 9th edition. (ed) (1997a) Biodiversity of Tropical Microfungi. (ed) (1996) Access to Ex-situ microbial genetic resources within the framework to the convention on Biological Diversity. FEMS Microbiology Ecology. D. (2005) ‘Soil bacterial and fungal community structure across a range of unimproved and semi-improved upland grasslands’. y Smith. 51. A. G. y Jagnow. 50.. (1993) ‘Nutrient cycling by fungi in wet tropical forests’. M. glycines in soybean roots and soil’. K. Li. pp293–302. Lee. L. vol. C. 74–83. vol. David. y Clipson. 170. Lang. Cannon. E.. A. (2003) ‘Molecular detection of Fusarium solani f. Watling y A. N. sp. 630–640. y Forney. G. vol. Visser. S. P. 89–95. A. Kirk. Mycologist. y Hartman. Cambridge. Hyde. Plant Pathology. S. M. C. L. E. 52.. D. 75–86. 176–178. 4516–4522. 62. R. pp. pp. (1995) ‘Soil microbial diversity and the sustainability of agricultural soils’. J. vol. 63. Hong Kong University Press. 11. 37–58. C. Kennedy. Cheng. C. 257–265. 272 Manual de biología de suelos tropicales . Biology and Fertility of Soils. J. pp. Applied and Environmental Microbiology. J. vol. (2002) ‘Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil’. Isaac. y Kim. vol. Plant Pathology. 38. A. 39. Marsh. Y. D. R. vol.. K. Cambridge University Press. pp. L. M. (1995) ‘The use of correspondence analysis in studies of successions of soil organisms’. B. y Nicholson. S. Lees. in S. A. Plant and Soil. W. y Robinson.. F. y Stanczyk-Mazanek. Liu. K. Sullivan. Hyde. W. WFCC. vol. A.

molecular fingerprinting and cloning techniques’. Phytopathology. N. H. vol. K. (2004) ‘Assessment and management of soil microbial community structure for disease suppression’. (2006) “Fungal diversity in maritime Antarctic soils determined using a combination of culture isolation. Moreira. X. O. (2002) ‘Mechanisms of natural soil suppressiveness to soilborne diseases’. W. vol. M. 81. Applied and Environmental Microbiology. G. M. Editora UFLA.. 68. pp. M. vol. Annual Review of Plant Pathology. Magurran. vol. 557–564.Lodge. Kerry. 1846–1853. 36. Muyzer. y Hirsch. vol. 425–428. pp. 127–141. (2004) ‘Effects of transgenic potatoes with an altered starch composition on the diversity of soil and rhizosphere bacteria and fungi’. A. Malosso. M. Biodiversity and Conservation. M. S. Milling. vol. Fukada. G. Phytopathology. Antonie van Leeuwenhoek.. (2002) ‘Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating’. D. Muyzer. S. de Waal. Lavras. R.. C. Maidl. y O´Donnell. Plant and Soil. y Smalla.. J. Waite. A. 42. y Uitterlinden. Hopkins. (1993) ‘Profiling of complex microbial populations by denaturing gradient electrophoresis analysis of polymerase chain reacHongos del suelo saprófitos y patógenos de plantas 273 . J. A. C. Brazil. E. 681–688 Lowell. I. Schloter. 552–561. C. vol. E.. P. y Nakanishi. 67. (1998) ‘Application of denaturing gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology’. pp. 60. 23–39. F. on a medium for direct isolation of Phytophtora spp. y Siqueira. (1988) Ecological Diversity and its Measurement. J. 266. pp. H. isolation and pathogenicity of Phytophthora megasperma from soils and estimation of inoculum levels’. pp. from soils and plants’. R. Mauchline. F. y Mitchell. D. T. Princeton. G. G. E. Masago. (2001) ‘Comparative single-strand conformation polymorphism (SSCP) and microscopy-based analysis of nitrogen cultivation interactive effects on the fungal community of a semiarid steppe soil’. B. 6. vol. 85–92. vol. pp. 29. Marks. K. English. J (1997) ‘Factors related to diversity of decomposer fungi in tropical forests’. Mazzola. y Munch.. J. (2002) Microbiologia e bioquímica do solo. Antonie van Leeuwenhoek.. A. vol. Yoshikawa. A. Polar Biology. pp. G. pp. 1687–1690. 73 pp. y Klein. L. Mazzola. pp. FEMS Microbiology Ecology. M.. (1970) ‘Detection. Princeton University Press. (1977) ‘Selective inhibition of Pythium spp. Smalla. D. 35–59. L.. E..

103–116. Wainwright. Persiani. vol.. Gomes. R. K. L. (1994) ‘Theoretical and practical aspects of the quantification of biodiversity among microorganisms’. J. Nikolcheva.. Neuber. pp. biological and methodological variability’. Ranjard. y Nazaret. y Osswald. and Bärlocher. D. F. Lata. (2001) ‘Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints. 871–877. 59. M. F. (1997) ‘Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous’. 274 Manual de biología de suelos tropicales . L. A.. vol. O’Donnell. vol. J.. Thioulouse. 720–727. D. L. 51. Oros-Sichler. H. A. pp. K. J. Mouguel. A. Hyde (ed) Biodiversity of Tropical Microfungi. 67. F. y Kantzer. 6. 4479–4487. N.. Maggi. y White. Poly. M. G. y Pineda.. pp. A. R. A. and bait methods for detection of Pythium and Phytophthora zoospores in water’. Forest Pathology.. J. 85–97. Philosophical Transactions Royal Society London. (2006) ‘A new seminested PCR protocol to amplify large 18S rRNA gene fragments for PCR-DGGE analysis of soil fungal communities’. 695–700. E. W. (1998) ‘Diversity and variability in soil fungi from a disturbed tropical rain forest’. culture. Molecular Phylogenetics and Evolution. Plant Pathology. (2002) ‘Comparison of serological. 345. C. Rodrigues. Nechwatal. C. 86. (2004) “Taxon-specific fungal primers reveal unexpectedly high diversity during leaf decomposition in a stream’. D. R. Dow. Applied and Environmental Microbiology.. Mycological Progress. C. W. Schlenzig. pp. Casado. L.. citricola in soil samples from oak stands’.. y Cigelnik. Papavizas. S. vol. T. D. L. Lews. M. 90. E. 65. J. O. 63–75. O´Donnell. 41–49. F. T. 341–365. Ayers. pp. in K. Hong Kong University Press. J. Lomsden. P. vol. (1994) ‘The foliar fungal endophytes of the Amazonian palm Euterpe oleraceae’. pp... vol. pp.tion-amplified genes coding for 16S rRNA’. vol. A. vol. M. 376–385. M.. J. pp. pp. B. Biological Sciences. F. C. M. G. A. Duncan. Wakeham. (1975) ‘Ecology and epidemiology of Rhizoctonia solani in field soil’. D. vol. 206–214.. L. G. M. y Smalla. J. Jung. G. B. 3. G. Pettitt. Mycologia. Cooke. pp. Phytopathology. K. vol. Mycologia. 65–73. 31. Adams.. F. Goodfellow. 7.. vol. Journal of Microbiological Methods... y Hawksworth. Applied and Environmental Microbiology.. pp. (2001) ‘A combination of baiting and PCR techniques for the detection of Phytophthora quercina and P. Pfenning. Hong Kong.. pp. (1997) ‘Soil and rhizosphere microfungi from Brazilian tropical forest ecosystems’. G.

L. R. Parkway Publishers. K.. (2004) ‘Fungal genetic resource centres and the genomic challenge’. y van Elsas. Alfenas. vol. St. y Rohlf. (1992) ‘Culture collections of microorganisms. Setälä. Glandorf.. Maffia. Munro. MN. Paul. biochemical and molecular fingerprinting methods’. 1. Boone. APS Press. vol. Smit. R. 17. Singh. J. M. Canhos. 3rd edition. (2004) ‘Decomposition rate of organic substrates in relation to the species diversity of soil saprophytic fungi’.. J. Siebert. Soil and Sediment contamination. W. E. MN. NC. J. R. vol. P. 108. 105. Freeman. pp. (1984) Suppressive Soils and Plant Disease.. 5–12. E. D. Sokal. J. pp. D. 41–46. Reid. M. New York. 2614–2621. F. y Silveira. European Journal of Soil Science. P... M. P. 57. Y.. Ord. S. H. 359. APS Press. (1992) ‘Competitive PCR’. A. vol. C. O´Dell. (2001) ‘A new fungal phylum. Paul. (1995) Biometry: The Principles and Practice of Statistics in Biological Research.. E (2003) ‘Filamentous fungi isolated from estuarine sediments contaminated with industrial discharges’. Hongos del suelo saprófitos y patógenos de plantas 275 . the Glomeromycota: Phylogeny and evolution’. in Eucalyptus clonal garden soils’. H. A. (2006) ‘Investigating microbial community structure in soils by physiological.. Mycological Research. pp. 98–107. H. Nature. Mihail. 31. G. (1992) Methods for Research on Soilborne Phytopathogenic Fungi. Rossman. vol. 12. Leeflang. pp. pp. C. pp. Potts. Sanfuentes. L. D. (2001) “Biodiversidad de los hongos fitopatógenos del suelo de Mexico’. Singleton. Schuessler. A. 53–78. y Thorn. vol. A. 72–82. J. W. Acta Zoológica Mexicana. Umbuzeiro. (1999) ‘Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes enconding 18S rRNA and temperature gradient gel electrophoresis’.. A. E. y McLean.. R. Sneh B. M. Smith. 66. Oecologia. pp. 139. Microbial Releases. E. P. A. vol. D.. P. pp. Burpee. St. y Smith. Ryan. (2002) ‘Comparison of baits to quantify inoculum density of Rhizoctonia spp.Rodrigues-Guzman. Applied and Environmental Microbiology. G. (1991) Identification of Rhizoctonia Species. 557–558. J. 1351–1362. y Walker C. 345-356. M. R. y Larrick. D. V. Paterson. y Waller. Mycological Research. F. S. 177–183. B. vol.. their importance in tropical plant pathology’. y Ogoshi. B. vol. T. A. M. 1413–1421 Selenska. W. St Paul. Fitopatologia Brasileira. S. Tulloss. (1998) Protocols for an All Taxa Biodiversity Inventory of Fungi in a Costa Rican Conservation Area. Schneider. y Klingmüller. pp. Pfenning. pp. L. Schwarzott.. L. y Esposito. E. y Rush. (1992) “Direct recovery and molecular analysis of DNA and RNA from soil’. MN. pp. J. y Millard.. D. APS Press. Silva. vol... E. L. special issue no 1. W. B. Australasian Plant Pathology. M.

. (1992) ‘Rapid method for direct extraction of DNA from soil and sediments’. G. M. P. D. J. its Biology. (2000) ‘Diversity of soil fungi studied by PCR-RFLP of ITS’. Yergeau. 143– 154. vol. 4288–4292. P. Canadian Journal of Botany. pp.. MN. J. A. 104. Zak. 1027–1032. pp. A. H. 90. (1984) ‘A revision of the genus Trichoderma. McQuilken. Reddy. vol. y Parkinson. 51. 924–931. S. y Hunter. Pasquier. 295–301. R. 2357–2372. M. II. C.Thorn. Filion. P.’. V. Erwin. Bissett. P. Vujanovic. C. nov. y Visser. E. exploiting genomics and stable isotope probing’. pp. Paul. Tsao. Tsai. B. Biodiversity and Conservation. M. C. M. vol.. vol. J. E. MN. (1998) Illustrated genera of imperfect fungi. (1983) Phytophthora. y Bartnicki-Garcia. I. S. 309– 317. (1973) ‘Fungi from Canadian coniferous forest soils’. pp. Journal of Microbiological Methods. C. H. Straczek. (1988) ‘Metabolic diversity of fungi in relation to growth and mineral cycling in soil: A review’. Infrageneric classification’. vol. y Krsek. (1993) ‘Use of fungal antagonists for biocontrol of damping-off and Sclerotinia disease’. pp. (2003) ‘Resolving functional diversity in relation to microbial community structure in soil. Leyval. y Olson. P. Applied Environmental Microbiology. Widden. 2051.. Canadian Journal of Botany. vol. (1996) ‘An appraisal of soil fungal diversity: The crossroads between taxonomic and functional biodiversity’. 2275–2290. 169–183. M. Section Longibrachiatum sect. Vandenkoornhuyse. Wellington. y Budge. 60. y Young. H. 62. APS Press. 5. J. 4th edition. APS Press. p. y St-Arnaud.. Baldauf. y Paul. Wainwright. Harris. A. 1070–1074. St Paul. Canadian Journal of Botany. y Brygoo. Bissett. pp. 159–170. St.. Whipps.. vol.. Taxonomy. S.. M. 6. Transactions of the British Mycological Society. 62. Viaud. M. L. W. vol. pp. vol. pp. D. M. Mycological Research. Y. 69. Ecology and Pathology.. 58. J. Pesticide Science. 295. vol.. vol. vol. B. Y. Applied Environmental Microbiology. S. 37. (1991a) ‘A revision of the genus Trichoderma. pp. H. Current Opinion in Microbiology. (1996) ‘Isolation of saprophytic basidiomycetes from soil’. (2002) ‘Extensive fungal diversity in plant roots’. pp. E. pp. P. Manuales para identificación Barnett. D. E. Berry. (2005) ‘A PCR-denaturing gradient gel electrophoresis approach to assess Fusarium diversity in asparagus’. Science. A. 276 Manual de biología de suelos tropicales . L. J.

. (1998a) Illustrated Genera of Ascomycetes. Bissett. J. (1971) Dematiaceous Hyphomycetes. A. A. (2002b) Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. B. H. London. St Paul MN. Eching. CBS.. American Phytopathological Society. P. Croom Helm. Illustrated genera of Ascomycetes. J. J. C. Additional notes on section Longibrachiatum’. y Anderson. Co. W. S.. Cramer. W. expanded reprint (Richmond Publ. (1991b) ‘A revision of the genus Trichoderma.. Australia. I. 1997). Vaduz. London. Rondon.. (1996) Phytophthora diseases worldwide. IV. C. M. Gams. y Aptroot. Domsch. 3rd edition. Liles. vol. P. American Phytopathological Society. y Goodman. Malden. I. Minor.. J. I.. (2006) The Fusarium Laboratory Manual. T. B. L.. Kew. Ellis. W. y Pitt. Baarn. Ellis. y Bullock. R. IHW Verlag.. J. American Phytopathological Society. Hanlin. Section Pachybasium’. CSIRO. K.. (1991c). David. 69. Ellis. pp. (1985) Microfungi on Land Plants: An Identification Handbook. APS Press. 9th edition. M. y Ellis. (1976) More Dematiaceous Hyphomycetes. Erwin. J. Mycologue Publications. E.. Osburne. Lynch. Hanlin. M. The Netherlands. S. J. A. R. I. (1998b) Combined Keys to Illustrated Genera of Ascomycetes. B. CSIRO. St Paul. MacNeil. F. J... Waterloo. vols I and II. II. 1990. Hanlin. H. (1993) Coelomycetous Anamorphs with Appendage-bearing Conidia. 2373–2417. S. North Ryde. Cannon. A. August. B. A. St Paul. 4th edition. Summerell. MN.T. MN. D. (1977) Chytridiomycetarum Iconographia. M. S. T. 69. Grossman. A. St Paul. y Ribeiro. T. CAB International. vol. K. Tiong. London. O. T. A. Nag Raj. Wallingford. St Paul. vol. M.. North Ryde. CMI. (2000) A Laboratory Guide to Common Penicillium Species. M. Gilman. R. P. D. Hoekstra. (2007) Compendium of Soil Fungi. R.. T. MN. Pitt. (1988) A Laboratory Guide to Common Aspergillus Species and Their Teleomorphs. APS Press. R. Klich. Kew. M. Handelsman. Brady. M. Karling. (1998) CBS Course of Mycology. K. MN. III. C. J. Betterman. J. M. 2418–2420. (2001) Dictionary of the Fungi. Canadian Journal of Botany. MA. M. 2nd edition. ‘A revision of the genus Trichoderma. Gams. vol. C. S. P. CMI. Blackwell Publishers. Canadian Journal of Botany. B. R. Leslie. R. L. Crous.. Australia.. F. A. R. Liechtenstein Kirk. Loiacono.. P. (2000) ‘Cloning the soil meHongos del suelo saprófitos y patógenos de plantas 277 .. F. y Stalpers. J.Bissett.. pp. J. Clardy.

APS Press. Systematic Botany & Mycology Laboratory. B. Mycological Papers. y Padgett. Frisvad. E. T.uncw. Waterhouse. D. D. Tsao.. pp. M.. Sneh. 66. 2541–2547. y Ogoshi. E. ARS. H. y McCray. E. (1980) The Coelomycetes. Jr. Burpee. 278 Manual de biología de suelos tropicales . A. Applied Environmental Microbiology. St Paul. Sutton. (1970) ‘The genus Phytophthora de Bary: Diagnoses or descriptions and figures from the original papers’. (1968) ‘The genus Pythium Pringsheim: Diagnoses or descriptions and figures from the original papers’. USDA.. Seymour. vol. G. Mycological Papers. M. pp. y Bartnicki-Garcia. (1991) Identification of Rhizoctonia species. B.. L.. Samson. Farr. Erwin. Kew. R. (1983) Phytophthora: Its biology. Waterhouse. J. vol. APS Press. CBS.cfm. P. Hoekstra. accessed November 2002. S. F. 1–59. CMI. vol.ars-gring. (2002) ‘Biology and systematics of Saprolegniaceae’. ecology and pathology. A. 122. C. O. G. G. MN. W. The Netherlands. L. (1967) ‘A key to Pythium Pringsheim’. pp1–15. taxonomy. y Filtenborg. (2000) Introduction to Food and Air-borne Fungi. pp. St Paul. Waterhouse... J. Chaverri.edu/people/padgett/book. C. D. www. MN. R.tagenome: A strategy for accessing the genetic and functional diversity of uncultured microorganisms’. Mycological Papers. P. Samuels. (undated) ‘Trichoderma Online’. M. http://nt.gov/ taxadesciptions/keys/Trichodermalndex. 1–50. S. London. 110. B. G. Baarn. 6th edition. vol. 109. Sitios web Johnson. C.

p.0g agar 18g Antibióticos.02g estreptomicina 0.1g Hongos del suelo saprófitos y patógenos de plantas 279 .2g pimaricina 0.p. cubitos 200g dextrosa 20g agar 18g PCA.s.agar extracto de malta extracto de malta 20g agar 18g SNA – agar sintético pobre en nutrientes KH2PO4 1.5g KCL 0.5g glucosa 0. si es necesario penicilina 0.02g estreptomicina 0.2g pimaricina 0. MA2% .02g estreptomicina 0.0g MgSO4 x 7H2O 0.2g sacarosa 0. (1998) y Erwin y Ribeiro (1996).0g KNO3 1.1g V8 agar V8 100 Ml CaCO3 2. molida 100g agar 18g penicilina 0.s zanahoria.0g peptona 1.2g pimaricina 0.Apéndice 8.1g agar 18g MP5. molida 100g agar 18g CA + p.agar maltosa peptona maltosa 4.0g penicilina 0.0g agar 18g agua destilada 900 ml PARP harina de maíz 17g pimaricina 10mg ampicilina 250mg rifampicilina 10mg pentacloronitrobenceno 100mg himexazol 50mg AHM + p. –agar con harina de maíz harina de maíz 8.agar papa zanahoria papa 20g zanahoria 20g agar 18g CA – agar zanahoria zanahoria.1 Medios de cultivo y aditivos: cebos Las recetas son para un litro. basados en Gams et al.2g agar 18g OA – agar harina de avena Copos de avena 30g Agar 15g ADP – agar dextrosa y papa papa.

exoesqueleto de camarones. zanahoria o pepino. hojas secas de maíz. trozos de manzana. alas de insectos. 280 Manual de biología de suelos tropicales . Sustratos quitinosos: piel de serpiente. papa. los de origen animal son esterilizados usando luz UV por una hora. Sustratos celulósicos: semillas de Sorghum.Cebos El uso de cebos es imprescindible para la recuperación de zoosporas formadas por hongos de sustratos complejos como el suelo. Dependiendo del tipo de hongo pueden ser utilizados cebos específicos. Sustratos queratinosos: cabellos de niños rubios. papel celofán. granos de polen de Pinus. epidermis de cebolla. Los cebos de vegetales pueden ser lavados.

volviéndola 281 . debido al gran impacto económico que causan. 1996. preservación e identificación de moscas de la fruta Neliton Marques da Silva INTRODUCCIÓN Entre las plagas de la fruta de América tropical. las moscas de la fruta son consideradas una de las más preocupantes. Se distinguen cinco géneros importantes de esta plaga: Anastrepha. Algunos estudios han acentuado aspectos ecológicos y etológicos de las moscas de la fruta. excepto en la Antártida (White y ElsonHarris. 1992). Zucchi et al. Se trata de insectos multivoltinos con un potencial biótico relativamente alto y una gran capacidad para infestar diferentes especies de frutos nativos y exóticos.. el periodo durante el cual la larva destruye la pulpa de la fruta. Rhagoletis y Dacus. y a la familia Tephritidae. Las características taxonómicas que permitan distinguir sexos entre pupas y larvas aún no se han determinado (Salles. Ceratitis. 1996). en su mayor parte. con una punta larga y delgada. Su clasificación se basa exclusivamente en los caracteres morfológicos del adulto. éstas pertenecen al orden Díptera. enfocados a las fases de pupa y larva (Silva et al.. Steck y Wharton. Las moscas de la fruta muestran un comportamiento y una taxonomía complejos (Bateman. Bactrocera. Los daños que producen las moscas de la fruta se dan durante la fase inmadura. que se extienden globalmente. 1988). ya que representan plagas primarias para la mayoría de los cultivos frutales. 2000). y su sexo es fácilmente distinguible debido a que las hembras tienen un prominente ovopositor. 1972.Capítulo 9 Muestreo. al final del abdomen.

las larvas se mueven sobre la superficie del suelo buscando condiciones adecuadas para su desarrollo y penetran hasta una profundidad aproximada de 10 cm para entrar en la fase de pupa. el uso de trampas con cebos alimenticios es lo más recomendable. removidos. En el caso de la mosca adulta. las larvas migran de la fruta para pupar en el suelo (Ilustración 8a).inservible para cosecha o consumo. la mosca de la fruta se puede considerar un organismo del suelo. azúcar al 10% o jarabe de caña de azúcar al 10%. Debido a que el ciclo de vida involucra las partes aéreas de la planta hospedera. de ahí que. hongos y nematodos. 282 Manual de biología de suelos tropicales . por ello. Aun cuando las larvas son parasitadas dentro de los frutos. sin embargo. Antes de llegar al estado adulto. resulta de suma importancia que en el diseño de la estrategia del manejo integrado de plagas se tome en cuenta la biodiversidad del suelo como un factor fundamental que influye en la mortalidad de larvas y pupas. MUESTREO DE LA MOSCA DE LA FRUTA El muestreo de adultos de moscas de la fruta se lleva a cabo utilizando trampas McPhail (Ilustración 8b) con atrayente alimenticio. Los cebos deberán reemplazarse cada semana y los especímenes capturados. junto con el suelo. esta técnica representa una relación ambigua entre la mosca y su hospedero. en función de la temperatura. la mosca de la fruta es un habitante temporal del suelo. se puede utilizar jugo de fruta al 10%. puesto que ésta sólo se puede establecer usando frutos infectados. pues sólo permanece ahí durante una etapa de su vida. la humedad y la textura. durante una parte de su ciclo de vida. por lo tanto. normalmente. La fase pupal dura de 8 a 10 días. en su mayor parte depredadores y entomopatógenos como bacterias. los procedimientos para muestrear varían de acuerdo con la fase y el propósito. El desarrollo de la pupa ocurre en el suelo. 200 ml de proteína hidrolizada de maíz (5% en agua preservada con tetraborato de sodio con un pH entre 8. el parasitoide adulto puede emerger en el suelo. Esta profundidad varía dependiendo de las condiciones físicas del suelo. y constituye una de las fases más vulnerables al estrés abiótico y a muchos enemigos naturales.5 y 9). dependiendo de la temperatura y de la humedad. De manera alternativa. que es diurna y responde a estímulos visuales y olfativos. Después de que la fruta infestada cae. sobre todo. Estos antagonistas juegan un papel importante en el control biológico de las moscas de la fruta. que también forman parte de la biota del suelo (véase Capítulo 10). ramas o semillas en donde las larvas de la mosca residían previamente.

N.5 mm para remover las moscas y separarlas de otros grupos taxonómicos utilizando unas pinzas curvas. Cuando los cebos son reemplazados. primero será necesario separar las moscas de la fruta de otros especimenes. M. Si el objetivo es monitorear plagas. el contenido de la trampa deberá pasarse por una malla de nylon de 1.Las trampas se instalan en el centro del dosel de los árboles y su localización será tomada con GPS. Las trampas deberán ser colocadas de manera equidistante. una trampa cada cuatro hectáreas resulta suficiente. COLECCIONANDO LOS ADULTOS CAPTURADOS Debido a la probabilidad de que distintos grupos taxonómicos de insectos sean capturados. con alcohol al 70% para su identificación posterior. 60° 04´W 23/Marzo/2006 Silva. esto se puede llevar a cabo en el campo o en el laboratorio. la densidad deberá ser de tres a cinco trampas por hectárea o estar de acuerdo con el tipo de uso de suelo existente en el predio. mientras que. si lo hay. Trampa No 5 • • • • • También deberá ser registrada la identidad de individuos de otros grupos taxonómicos capturados en las trampas. En el caso de plantas herbáceas. es decir. colocarse sobre un árbol adyacente. Cuando el objetivo es el manejo integrado. la trampa puede utilizar como soporte tres palitos. Hasta cinco trampas por hectárea pueden ser instaladas en áreas con arbustos o árboles (jardines caseros). preservación e identificación de moscas de la fruta 283 . o bien. cada tipo de uso de suelo existente debe ser monitoreado con la misma densidad de trampas. El número de trampas por unidad de superficie puede variar de acuerdo con los objetivos del proyecto. La etiqueta deberá incluir la información básica de muestreo y el número de la trampa. Por ejemplo: Manaus-AM Brasil 04° 05`S. Muestreo. Se anota el sexo y se colocan en frascos de vidrio (de alrededor de 50 ml) etiquetados. hasta tres por hectárea son las recomendadas para plantaciones herbáceas. dispuestos en forma de trípode.

las charolas se cubren con una tela de gasa y se aseguran con ligas de plástico para prevenir que se escapen las moscas adultas al emerger. se recogen frutos al azar en diferentes agroecosistemas y en diferente estado de de maduración. los especimenes recuperados son fijados en una solución de alcohol al 70%. Estas jaulas deberán ser examinadas diariamente.5 mm. Finalmente. Los frutos deberán ser colectados directamente de los árboles o inmediatamente después de caer al suelo. Posteriormente. con sus respectivas etiquetas de identificación. Los adultos emergidos serán retenidos. La determinación de la relación de sexos hembra-macho (SR) para moscas adultas y parasitoides se hace de acuerdo con Silveira-Neto (1976) en función de la siguiente ecuación: Número de hembras SR= Número de hembras + Número de machos IDENTIFICACIÓN DE ESPECIES La identificación taxonómica de especies de Tephritidae se basa en un examen ventral de la región apical. se protegen con bolsas de tela y se transportan en cajas térmicas hasta el laboratorio. se cuentan y se separan para cada sitio de muestreo. las moscas adultas son alimentadas con una solución de miel disuelta en agua al 10% que será cambiada cada día. Después de emergidas.MUESTREO DE LA FRUTA Para poder establecer la relación entre las especies Anastrepha con sus plantas hospederas. para permitir la salida de las moscas adultas y/o parasitoides. Las fechas de emergencia. durante 48 horas para permitir el endurecimiento cuticular y la pigmentación completa de los patrones alares (Ilustración 8c): características de gran importancia para la identificación taxonómica. de 1. OBTENCIÓN DE LAS PUPAS La vermiculita o arena fina deberá pasarse por una malla galvanizada. el aculeo de la hembra bajo un microscopio estereoscó284 Manual de biología de suelos tropicales . Los frutos muestreados se separan por especie. para separar las pupas que posteriormente serán colocadas en jaulas. se pesan. se depositan en charolas de plástico con una capa de vermiculita o arena fina como substrato de pupación. Finalmente. el número y el sexo deberán quedar registrados con relación a las moscas o parasitoides.

Pennsylvania. no. N. como las de Lima (1934). mesonoto. Federal University of the Amazon (UFAM) and National Institute for Agricultural Research (INPA). São Paulo. las características morfológicas del aculeo (Ilustración 8e) con especímenes de museo o usando claves taxonómicas. Manaus. in A. (2002) “Ocorrência e flutuação populacional de espécies de moscasdas-frutas eparasitóides com ênfase para o Gênero Anastrepha (Diptera: Tephritidae) na Amazônia Brasileira’. C. 1868 (Diptera: Trypetidae)’. A. Departamento de Zoologia. (1934) “Moscas-de-frutas do gênero Anastrepha Schiner. tergito medio. Es recomendable que se depositen ejemplares de referencia en colecciones de museo. (1972) ’The ecology of fruit flies’.)’. REFERENCIAS Bateman. University of São Paulo. São Paulo. vol. A. Brazil. Stone (1942). Norrbom. Lima. A. Steyskal (1977). Zucchi (eds) Moscas-das-frutas de importância econômica no Brasil: Conhecimento básico e aplicado. Secretaria da Agricultura. H. M. La identificación de especies del género Anastrepha se logra para las hembras adultas. 17. R. Vanzolini (ed) A Catalogue of the Diptera of the Americas South of the United States. Annual Review Entomology. 493–518. 28. PhD Thesis. Holos. o que éstas sean incorporadas a la colección institucional del laboratorio. Escola Superior de Agricultura “Luiz de Queiroz”. L. Brazil. En primer lugar. preservación e identificación de moscas de la fruta 285 . (1985) ‘Phylogenetic analysis and taxonomy of the cryptostrepha. especialmente. utilizando un microscopio de transmisión (100X). Ronchi-Teles. Muestreo. comparando el patrón alar. A. coloración de cuerpo. PhD thesis. Memórias do Instituto Oswaldo Cruz (Rio de Janeiro). in M. (1967) ‘Family Tephritidae’. Foote. pp. 4. vol. Malavasi and R. daciformis. L. Silva. Zucchi (1978 y 2000) y Norrbom (1985). M. The Pennsylvania State University. Salles. (1993) “Levantamento e análise faunística de moscas-das-frutas (Diptera: Tephritidae) em quatro locais do Estado do Amazonas’. como lo describe Zucchi (1988). PhD Thesis. pp. Ribeirão Preto. Silva (1993). B.pico (40X) o mediante el montaje sobre laminillas para examinar estas estructuras. Ronchi-Teles (2002). es necesario extraer completamente el aculeo de la funda del ovipositor con ayuda de agujas o pinzas (Ilustración 8d). abdomen y. 487–575. A. (2000) ‘Biologia e ciclo de vida de Anastrepha fraterculus (Wied. robusta and schausi species groups of Anastrepha Schiner (Diptera: Tephritidae)’. Foote (1967).

(1988) ‘Description of immature stages of Anastrepha interrupta. Zucchi. A. (1977) Pictorial Key to Species of the Genus Anastrepha (Diptera: Tephritidae). (1978) “Taxonomia das espécies de Anastrepha Schiner 1868 (Diptera: Tephritidae) assinaladas no Brasil’. N. (1992) Fruit Flies of Economic Significance: Their Identifications and Bionomics. Silveira Neto. y Nova. Holos Zucchi. 1–112. Malavasi and R. J. R. S. 6. A. Tephritidae) no Brasil: taxonomia. R. vol. Boca Raton. no. A. C.Silva. (1996) ‘The natural hosts plants of Anastrepha (Diptera: Tephritidae) in the State of Amazonas. São Paulo. R. Wallingford. Brazil’. A. in G.. vol. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management.. Entomological Society of Washington. Zucchi. Zucchi. (1996) ‘Anastrepha species (Diptera: Tephritidae) from the Brazilian Amazon: Distribution. Ribeirão Preto. limae. pp. Ceres.. M. Barbin. 439. y Elson-Harris. CRC Press. G. N. A. S. (2000) ‘Taxonomia’. M. y Wharton. M. distribuição geográfica e hospedeiros”. São Paulo. pp. (1942) ‘The fruit flies of the genus Anastrepha’. de Souza (ed) Moscas-das-frutas no Brasil. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. Zucchi (eds) Moscas-dasfrutas de importância econômica no Brasil: Conhecimento básico e aplicado. Steyskal. J. A. Boca Raton. grandis (Diptera: Tephritidae)’. Washington DC. PhD Thesis. Nakano. A. A. S. Steck. L. A. R. Fundação Cargill. Stone. Zucchi.. I. Escola Superior de Agricultura ‘Luiz de Queiroz’. Steck and B. (eds) (1976) Manual de Ecologia dos Insetos. Annals of the Entomological Society of America. 286 Manual de biología de suelos tropicales . CRC Press. White. 994–1003. A. N. R. R. O. in H. M. in G.. (1988) “Moscas-das-frutas (Dip. V. M. A. A. United States Department of Agriculture Miscellaneous Publications. and Silveira Neto. in A. Steck and B. and A. hosts and lectotype designations’. Campinas. 81. y Silveira Neto. D. CAB International. University of São Paulo. J. M. Silva.

ello da la idea de la potencial importancia del estudio de estos patógenos de insectos en el contexto de control de plagas y de biodiversidad. El control microbiano es una forma de control biológico cuyo principio es el uso racional de entomopatógenos sin que necesariamente se eliminen las poblaciones de plagas. con el fin de utilizarlas como mecanismos de control de especies que son plaga.Capítulo 10 Hongos y nematodos entomopatógenos Alcides Moino. aproximadamente. 1992). el 10% pueden considerarse plagas agrícolas forestales o urbanas. Esto es similar a la dinámica natural que sucede en el campo entre el patógeno y su hospedante. aunque la cifra verdadera de diversidad puede ser mucho mayor (Groombridge. Los principales microorganismos utilizados. prevenir su ocurrencia en insectos benéficos. Jr y Ricardo Sousa Cavalcanti INTRODUCCIÓN Existe alrededor de medio millón de especies de insectos descritas en la tierra. el primero para llevar a cabo el proceso de infección y el segundo. pero sí manteniéndolas en niveles por debajo del umbral de daño económico. y que han demostrado su 287 . De éstas. o bien. Las enfermedades son procesos dinámicos en donde el patógeno (microorganismo) y el hospedante (insecto) están adaptados morfológica y fisiológicamente. para resistir la enfermedad. La patología de insectos es la ciencia que estudia las enfermedades de insectos. Si se asume que cada especie de insectos es susceptible a por lo menos un microorganismo patogénico. sin intervención humana. frecuentemente hospedante-específico.

Leger. 1995): los organismos producen fases infectivas que son liberadas al ambiente cuando muere el hospedante 288 Manual de biología de suelos tropicales . los nematodos y los protozoarios. aunque esta tecnología no se ha adoptado por completo en la práctica.potencial en el control microbiano de insectos son: los hongos. causar la muerte rápida del hospedante y provocar grandes niveles de mortandad en las poblaciones de éste) y causar epizoóticas periódicas (Chandler et al. aparece una nueva generación de estadios infectivos (Kaya y Gaugler. en donde pueden ser excepcionalmente virulentos (o decir. invadiendo su cuerpo y matándolo de cuatro a diez días posteriores a la infección. y convirtiéndose posteriormente en adultos. Roy et al.. éstos aparentemente son componentes diversos y universales de las biotas del suelo. debido a su alto costo. Existen dos familias. Los nematodos entomopatógenos miden alrededor de 0. permitiendo que los nematodos crezcan y maduren sobre el tejido en descomposición.. las bacterias que se introducen junto con el parásito se multiplican rápidamente y matan al hospedante. baja persistencia e inactividad a bajas temperaturas (en el caso de los nematodos). Los estadios juveniles parasitan a sus hospedantes. con varios grados de especificidad con su hospedante (Hajek y St. la Sterneinematidae y la Heterorhabditidae que son parásitos obligados de insectos y que son la base de varios plaguicidas biológicos diseñados específicamente para su uso en contra de plagas del suelo como los gorgojos y las larvas de mosca. Myers y Rothaman. como es el caso de Lecanicillium logisporum. a pesar de ello. 1997. se producen miles de nuevas esporas que se dispersan y continúan su ciclo de vida en nuevos hospedantes. los basados en toxinas). A pesar del éxito limitado de hongos y nematodos entomopatógenos como productos biocidas. 1993). Un pequeño número de especies generalistas con capacidad para ser cultivadas y producidas de manera masiva. se han utilizado como biopesticidas para su uso contra poblaciones de plagas. pobre persistencia (especialmente bajo condiciones tropicales) y su baja eficacia cuando se compara con los insecticidas químicos (por ejemplo. Se conocen cientos de especies de hongos entomopatógenos que atacan una amplia gama de insectos y ácaros. ambos presentan desventajas debido a su alto costo. 1995). Después de una a dos semanas posteriores a la invasión del hospedante. los virus. 1994. 2006). Los hongos producen esporas que germinan al contacto con el hospedante.5 mm de largo. penetrando directamente la cutícula o a través de las aperturas naturales como los espiráculos. las bacterias. La mayoría de los patógenos poseen una estrategia de transmisión de “sentar y esperar” (sensu Ewald. Una vez muertos los insectos.

el reservorio de las fases infectivas. Aunque los artrópodos que viven por encima del suelo. Después de la infección exitosa de un hospedante. Estas estructuras vegetativas son llamadas hifas. Aschersonia aleyrodis. sin duda. que constan de células alargadas provistas de una pared que contiene celulosa y quitina. debido a que ofrece un microambiente estable con una estructura de poros favorable para nematodos y recursos orgánicos para hongos. y hongos del orden Entomophthorales (Zoophthora. Entomophaga.. Hirsutella thompsonii. son susceptibles a hongos y nematodos. Los hongos poseen una gran variabilidad genética y un amplio rango de hospedantes. aunque su eficiencia competitiva en comparación con otros saprótrofos de vida libre puede ser baja. BIOLOGÍA DE HONGOS Y NEMATODOS ENTOMOPATÓGENOS Hongos Los hongos son microorganismos unicelulares (levaduras) o multicelulares (especies filamentosas). 2001). Las fases de diapausa y latencia reducen la dependencia en la movilidad de su hospedante y pueden complementarse con la capacidad para vivir saprotróficamente en suelo. Lecanicillium lecanii. Entomophthora. lo que les permite mayor distribución geográfica de la población y alta movilidad. Los hongos de mayor interés por su potencial como patógenos de insectos son: Beauveria bassiana. En el caso de los hongos entomopatógenos esto se apoya en evidencia molecular que muestra que poblaciones en suelo no son totalmente clonales. el suelo es. Metarhizium anisopliae.. ello a pesar de la ausencia de fases sexuales manifiestas y que el significativo flujo de genes ocurre localmente (Bidochka et al. flavoviride.y tienen la capacidad de entrar en un estado de letargo o diapausa y permanecer latentes hasta que haya nuevos hospedantes disponibles. H ongos y nematodos entomopatógenos 289 . M. además de otros carbohidratos y proteínas. Esta capacidad es una adaptación a sus hospedantes artrópodos que son más grandes y con patrones de distribución en parches.. Cordyceps spp. Paecilomyces spp. se producen asexualmente estructuras reproductivas conocidas como esporas o conidias que ayudan a la diseminación del patógeno. Nomuraea rileyi. Con frecuencia no hay correlación entre la densidad del hospedante y la ocurrencia de la enfermedad. como los que habitan debajo de éste. sugiriendo de nuevo que los patógenos se distribuyen ampliamente en el suelo. Neozygites).

La población microbiana en cualquier ambiente natural es muy grande y por lo tanto. en el caso de los nematodos. parasitismo obligado y parasitismo facultativo. 1993. se basa en caracteres morfológicos del organismo en cultivo y en la estructura de los conidióforos y conidias. A continuación se describen dos técnicas básicas para el aislamiento de hongos y nematodos entomopatógenos a partir de muestras del suelo. Estas bacterias se multiplican dentro del insecto y lo matan al causarle septicemia (infección generalizada). es muy común encontrar también hongos. Sin embargo. 290 Manual de biología de suelos tropicales ... aislar poblaciones. De igual manera. 1986.. 1998A) Las muestras de suelo se colectan a una profundidad de 0 a 20 cm y se colocan en bolsas de plástico debidamente etiquetadas.Nematodos Los nematodos entomopatógenos son organismos pseudocelomados vermiformes muy similares a los que parasitan plantas y que pueden asociarse con los insectos de tres formas: forecia (adherencia pasiva y transporte). para lograr una buena identificación es necesario aislar el microorganismo en cultivos puros o al menos. en el caso de los hongos. espiráculos y ano. los nematodos entomopatógenos presentan una estrecha asociación (simbiosis) con bacterias específicas. la identificación se fundamenta en medidas hechas a partir de estructuras presentes en los estadios juveniles infectivos. las cuales son los agentes primarios que inician la infección en el hospedante. cuando el objetivo del muestreo es evaluar la biodiversidad (por ejemplo. Los principales grupos de nematodos de interés pertenecen al orden Rhabditida. también pueden obtenerse resultados semejantes y se requerirá de medidas adicionales para identificar patógenos con potencial. cuando un insecto muerto es recogido para el cultivo de inóculo infectivo. Liud et al. bacterias y otros microorganismos saprotróficos que no tienen potencial como agentes específicos para el control de plagas. Por lo general. en el suelo). En cada sitio de muestreo. Alves et al. Los nematodos transportan internamente bacterias específicas que son liberadas en el interior del cuerpo del insecto después de que el nematodo penetra a través de aberturas naturales como boca. y dentro de éste a las familias Steinernematidae y Heterorhabditidae. La identificación correcta de un agente entomopatógeno. METODOLOGÍA PARA EL AISLAMIENTO DE HONGOS ENTOMOPATÓGENOS (Chase et al.

Beauveria bassiana y Paecilomyces spp.0 mg de tetraciclina y 10 mg de cristal violeta. El medio ADP se prepara de la siguiente manera: 15 g de agar.2) y almacenaje de conidios en condiciones de congelación utilizando tubos Eppendorf para tal fin.1). con la subsecuente purificación de los cultivos (Figura 10. H ongos y nematodos entomopatógenos 291 . se esteriliza durante 20 minutos a 120°C y se filtra. 550 mg de dodina (N-dodecilguanidina acetato). De las diluciones 10-3 y 10-4 se toman 0. El medio selectivo de dodina se prepara de la siguiente manera: 20 g de harina de avena + 1 litro de agua destilada.) puede llevarse a cabo usando un microscopio compuesto y claves de identificación basadas en caracteres morfológicos de las estructuras reproductivas. El fungicida dodina se añade en pequeñas concentraciones (cerca de 10 mg ml-¹) al medio selectivo con el fin de aislar hongos entomopatógenos a partir del suelo y preservar los aislamientos menos susceptibles al fungicida. Las cajas se incuban a 27°C (Figura 10. Estas muestras pueden tomarse mediante el método de extracción de núcleos (véase Capítulo 4: Mesofauna). A partir de estas alícuotas se preparan diluciones 10-1 sucesivamente. En el laboratorio se debe mezclar muy bien la muestra compuesta y tomarse alícuotas de 1g de suelo. conidias y fiálides (Alves et al. 5. 1998). 20 g de dextrosa. y agua destilada hasta completar el volumen total de un litro. el volumen añadido se reparte sobre la superficie utilizando una asa de Drigalski (ya sea de acero inoxidable o vidrio). 200 g infusión de papa (preparada a partir de papas rebanadas y hervidas para extraer el almidón).se toma una muestra compuesta a partir de seis submuestras tomadas en puntos localizados alrededor de un monolito central (véase Capítulo 2). Esto suele ser efectivo especialmente con Metarhizium anisopliae.1ml y se colocan en medio de cultivo selectivo (el cual contiene el fungicida dodina) y en medio ADP (Agar-Dextrosa-Papa).. se añade agua destilada hasta alcanzar el volumen original de 1 litro y posteriormente se añaden 20 g de agar. utilizando agua destilada esterilizada hasta alcanzar una dilución 10-4. El crecimiento de los hongos y su esporulación se evalúan de 7 a 15 días posteriores a la inoculación. Samson et al. 1998b. la identificación de los cultivos de interés (principalmente Metarhizium anisopliae.. aunque puede prescindirse de él. Después de la incubación. tales como conidióforos.1 ml de la última dilución y se colocan sobre la superficie del medio de cultivo contenido en una caja Petri. Después de este paso se toman 0.

1 ml) en una caja petri con medio de cultivo. y transfiriéndola a una caja Petri nueva con medio de cultivo ADP (tres puntos de inoculación por caja).Figura 10. Figura 10.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) dilución seriada de la suspensión acuosa que contiene al hongo.2 Cultivos purificados de Beauveria bassiana. creciendo en medio ADP. bajo condiciones de congelación. d) almacenaje de conidios en tubos Eppendorf. b) inoculación de la suspensión (alícuota de 0. Nota: la separación de contaminantes se logra recogiendo una pequeña porción de cualquiera de las colonias del hongo de interés con una aguja. 292 Manual de biología de suelos tropicales . c) incubación bajo condiciones controladas en una cámara DBO.

Na EDTA 0. Los ejemplares de nuevas especies pueden someterse a un análisis molecular para así comparar los patrones de DNA.. La identificación se lleva a cabo con base en las claves específicas de identificación para cada familia de nematodos (Steinernematidae y Heterorhabditidae) (Alves et al. El medio “S” consiste en un litro de solución madre (0.1M NaCl. 0. H ongos y nematodos entomopatógenos 293 . 1974) Se recogen las muestras de la misma forma que fue descrita anteriormente. Las larvas de insectos infectadas se colocan en el centro del papel filtro.0. utilizando la técnica de trampas de insectos con cinco larvas de Galleria mellonela (L.. Posteriormente. Después de dos días. FeSO4. pH 6.3mM. MgSO4 0.) (Lepidoptera: Pyralidae). Una trampa de White se puede construir utilizando dos cajas Petri: una caja de 5 cm de diámetro se coloca invertida dentro de una caja de 9 cm que contiene agua esterilizada o medio “S” esterilizado y cubierta con un círculo de papel filtro de 9 cm. 2004. que contienen las muestras de suelo y se mantienen cerradas a 23°C en oscuridad. la suspensión se lava adicionando una solución de formaldehído (1%) o solución de Ringer para obtener una concentración final de 10. éstos deben colectarse y colocarse en agua destilada dentro de un frasco Becker. Figura 10. Las larvas muertas se colocan en una trampa White (Chen et al.000 estados infectivos ml-¹.7H2O 0.4M. Las larvas se colocan en cajas de plástico de 500 ml. y pueden adquirirse comercialmente. La suspensión se deja reposar para permitir que los nematodos queden en el fondo. La detección de nematodos se lleva a cabo mediante bioensayos.METODOLOGÍA PARA EL AISLAMIENTO DE NEMATODOS ENTOMOPATÓGENOS (Bedding y Arkhurst. 1998b. Adams y Nguyen.3) para colectar los estadios juveniles infectivos a partir de los cuerpos muertos. el cual cae hasta tocar el líquido en el borde de la caja inferior.6mM. ZnSO4. CaCl2 0. La mortandad de las larvas se evalúa después de cinco a siete días. Las larvas de este lepidóptero son conocidas como mealworms (o gusanos de la harina).4M. CuSO4 0 1μM. Los nematodos se almacenan en envases cerrados de 50 ml a 11°C o cercano a esa temperatura.05M KH2PO4.1mM.7H2O 0. 1μM colesterol) a la que se le añaden 26 ml de una solución nutritiva fresca que contiene citrato de K 0. 2002). si se encuentran estados infectivos en el líquido.3M.

y Nguyen. A. L. K. J. M. M. (1974) ‘A simple technique for the detection of insect parasitic nematodes in soil’. S. J.. S. (1998b) “Chaves para identificação de patógenos de insetos”. E.Figura 10. c) larvas que muestran la patología típica de infección por nematodos. A. B. Kamp. R. REFERENCIAS Adams. Gaugler (ed) Entomopathogenic Nematology. Wallingford. B. R. N. 21. B. M. Alves (ed) Controle Microbiano de Insetos. vol. Lavender. J. 2nd edition. A. CAB International. pp. Alves. (2002) ‘Taxonomy and Systematics’. Almeida. in S. in S. FEALQ. C. Alves. B. (2001) ‘Habitat association in two genetic groups of the insect-pathogenic fungus Metarhi294 Manual de biología de suelos tropicales . 2nd edition. L. B. (1998a) “Técnicas de laboratório”. Deckoning. y Castello Branco Jr. y Alves. Piracicaba Brazil. J. C. Bedding.. Bidochka.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. d) emergencia de juveniles infectivos en la trampa White. M. A. Alves (ed) Controle Microbiano de Insetos. T. B. J.. Fotos: R.. Moino Junior. in R. J. Nematologica. A. FEALQ. Piracicaba Brazil. 109–110. F. y De Croos. Ferraz. Gaugler. A.. B. y Akhurst..

(ed) (1992) Global Biodiversity: Status of the Earth’s Living Resources. y Ferguson. Liu. pp. 331–357. F. K. D. Y. 69.. Meyers. Annual Review of Entomology. E. Ewald. vol. J. (2004) Nematology. 285–292.. y Pell. pp. S. Chase. J. P. 67.. 248–251. X. y St. J. A. Milner. New York.. Wallingford. 181–206. Applied Soil Ecology. P. G.. A. R. 10. R. from soil’. (1993) ‘Entomopathogenic nematodes’. W. Kaya. 659–669. 5. L. Osborne. (2006) ‘Bizarre interactions and endgames: Entomopathogenic fungi and their arthropod hosts’. Applied and Environmental Microbiology. pp. pp. Chen. A.. (1997) ‘Sampling and occurrence of enomopathogenic fungi and nematodes in UK soils’. pp. S. Eilenberg. (1995) ‘Virulence and transmission of infectious diseases in humans and insects: Evolutionary and demographic patterns’. Leger. Advances and Perspectives. Annual Review of Entomology. E. Evans. vol. C. R.P. G.zium anisopilae: Uncovering cryptic species’. Florida Entomologist. 194–198. y Dickson. CAB International. Chapman and Hall. vol. Chen. D. Hay.. H. M. vol. J. (1986) ‘Selective isolation of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium’. A. A. pp. vol. L. 62. C. Steinkraus. D. H. World Conservation Monitoring Centre. E. (1993) ‘The use of Dodine in selective media for the isolation of Metarhizium spp.. Z. pp. y Read. pp. Y. 39. J. V. Groombridge.. 81. (1995) ‘The evolution of virulence: A unifying link between parasitology and ecology’. y Rothaman. 38. Roy. vol. B. (1988) Atlas for Entomopathogenic Fungi. Springer-Verlag. Z. Annual Review of Entomology. R. H. E. vol. y Latgé. Samson. D. 51. J. (1994) ‘Interactions between fungal pathogens and insect hosts’. Journal of Parasitology. pp. Trends in Ecology and Evolution. C. H. 1335–1342. H ongos y nematodos entomopatógenos 295 . y Gaugler. Journal of Invertebrate Pathology. McRae. Chandler. Hajek. vol. y Lutton. vol. W. 293–322. Hajek. 133-141. London. K. R.

.

Cuántas clases de uso de suelo pueden ser definidas con respecto a la intensidad de usos de suelo se ilustra a continuación. Jeroen Huising RESUMEN DE LA METODOLOGÍA PARA LA DESCRIPCIÓN DE USO DE SUELO Este capítulo muestra una lista estructurada de atributos de uso de suelo que sirve como guía para la observación de características de uso de suelo en el campo.Capítulo 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo E. pero las clases finales de uso de suelo dependerán de la selección de dichos atributos a considerar para la clasificación. dependiendo de los datos disponibles. lo cual requiere solamente el valor adecuado por evaluar en el campo. los dominios de los valores de los atributos se especifican. entrevistas o preguntas. cuando se precise un alto nivel de detalle. en función del propósito y del contexto de la clasificación misma. Esto se lleva a cabo mediante la observación directa. La clasificación de uso de suelo se facilita por una estructura jerárquica donde se ordenan los atributos. Este método ofrece varios niveles de detalle que describen las características. 297 . en los puntos de muestreo. se necesitarán mediciones reales. En la mayoría de los casos. Solamente en algunos casos.

a través de puntos de referencia de los países tropicales involucrados. y al mismo tiempo. y en particular la intensidad de su uso. Lo último. basadas en un común denominador en todas las áreas bajo estudio. Para comprobar esta hipótesis. razón por la cual fue adoptado un sistema regular en cuadrícula para muestrear la biodiversidad del suelo con un inventario detallado de su uso y cobertura en los lugares de muestreo. lo que facilita el análisis de los factores determinantes actuales y una clasificación a posteriori. la hipótesis central del proyecto CSM-BGBD (Giller et al. 1975).ANTECEDENTES Y PRINCIPIOS DE DISEÑO Propósito de la clasificación del uso de suelo y de su cobertura vegetal El uso de suelo. pero dependen de los clasificadores o atributos seleccionados para la asignación de la clase de usos de suelo a cualquier observación particular. dada la variación en los cultivos y sus posibles combinaciones. se requiere de un sistema que permita el registro de las características de uso de suelo en las parcelas de muestreo y su clasificación posterior. de modo que se puedan reflejar las diferencias en la intensidad de uso de suelo. 2005). En lugar de utilizar clases predefinidas de uso de suelo. de manera que se puedan definir las clases de uso de suelo. se considera uno de los factores determinantes de la abundancia y riqueza de poblaciones de organismos del suelo. implica que las clases de uso de suelo no están definidas a priori. y es por lo tanto. La idea general es que el contenido de un estudio depende de la naturaleza de la región (Vink. Los procesos dominantes que determinan la presencia e incidencia de la biota del suelo y la escala espacial donde éstos se manifiestan no se conocen completamente. Este capítulo presenta una estructura que provee el registro sistemático de las características de uso de suelo. la historia de uso de suelo y las prácticas de manejo de los mismos. especialmente en las regiones tropicales. el enfoque que se describe a continuación se aleja de la idea de que las clases de uso de suelo sean definidas de acuerdo con la identificación de las características relevantes de uso de suelo (atributos) que permiten una 298 Manual de biología de suelos tropicales .. en cuanto al uso de varios recursos como fotos aéreas o imágenes satelitales para el propósito de la clasificación. Dicha estructura necesita ser flexible. proporciona una estructura para la clasificación de usos de suelo. Las clases de uso de suelo predefinidas no son necesariamente aplicables o relevantes para todas las áreas involucradas porque será muy difícil definir un grupo estándar de clases de usos de suelo.

forma del paisaje. El método no incluye una estructura para la descripción de los atributos ambientales. aunque contiene elementos añadidos relacionados con el manejo de suelo y cultivos. Las clases de usos de suelo obtenidas de esta manera pueden ser utilizadas para la extrapolación de los resultados más allá de los lugares de estudio. es diferente al monitoreo usado con frecuencia que incluye en la descripción de uso de suelo y el estudio de las condiciones naturales y socioeconómicas del suelo como un primer objetivo (Vink. 1975). Asimismo. generalmente se traduce en el registro de la ocurrencia de cultivos. La descripción detallada de uso y la cobertura de suelo deberán formar parte del inventario. El enfoque del inventario de uso de suelo aquí descrito se apoya principalmente en ese sistema de clasificación. El método que se presenta pretende ser de utilidad para la descripción de uso de suelo a nivel parcela. especialmente en su intensidad. El sistema de clasificación de uso y cobertura del suelo ayuda a la armonización de los procedimientos para la recolección de datos y al manejo de los mismos. Lo anterior.discriminación entre clases de usos de suelo. Un segundo objetivo para los inventarios de uso de suelo es proveer información básica para definir los usos de suelo alternativos y las prácticas de manejo que mejoran la sustentabilidad de la producción agrícola y conservan la biodiversidad del suelo. como clima. Los objetivos mencionados arriba fueron también citados en el programa Africover. los métodos descritos en este capítulo se aplican únicamente en paisajes agrícolas terrestres (p. La estructura de las descripciones del uso de suelo actual no ha sido hecha para registrar el uso de suelo histórico. El objetivo del inventario para proveer datos que permitan evaluar cambios en la biodiversidad del suelo en relación con el uso del suelo.. Para la clasificación y descripción de las áreas de vegetación (semi) natural se puede seguir el LCCS. ej. los fenómenos relacionados con la forma en que se está utilizando el suelo (p. el manejo de los cultivos y del suelo) son de particular importancia porque impactarán notablemente sobre la distribución de los organismos del suelo. áreas cultivadas y manejadas) mientras que el marco del LCCS incluye sistemas terrestres vegetales (semi) naturales. No obstante. aunque atributos relacionados con la historia del uso de suelo o condiciones ambientales podrían ser adicionados o modificados del sistema de clasificación. ej. que desarrollaron el Sistema de Clasificación de Cobertura de Suelo (LCCS) por Di Gregorio y Jansen (2000). para el propósito actual. sistemas acuáticos y principalmente áreas sin vegetación. etc. sin incluir elementos relacionados con el manejo de ganaD escripción y clasificación de uso de suelo en puntos de muestreo 299 .

Muchos sistemas de clasificación utilizan a priori definiciones descriptivas de uso de suelo y clases de cobertura del suelo. ni incluye elementos relacionados con el sistema de cultivo. son limitados cuando se les compara con otros sistemas. utilizados para definir una clase. a no ser la cobertura del suelo per se. basada en la interpretación de fotografías aéreas con el propósito de elaborar mapas de uso y cobertura del suelo. porque esto no está particularmente relacionado a nivel de parcela. por ejemplo. Obsérvese. Nivel 5: Características de uso de suelo del área directamente circundante a Manual de biología de suelos tropicales 300 . resultarían de gran utilidad. Cuantos más clasificadores se añaden. Nivel 3: Características relacionadas con aspectos culturales como irrigación y cultivo de temporada. Existen cinco niveles en la jerarquía de clasificación: Nivel 1: Características relacionadas principalmente con el cultivo y el campo Nivel 2: Características relacionadas con la combinación de cultivos. Dicho sistema a menudo carece de una definición clara de los límites de clases. Nivel 4: Características relacionadas con el manejo de prácticas del suelo. aunque se reconoce que para los estudios a una escala mayor o para considerar opciones alternativas de uso de suelo. dispuestos en un sistema jerárquico. el sistema de clasificación de uso de suelo y de su cobertura del US Geological Survey. Concepto y principios de diseño Los conceptos y principios de diseño del LCCS adoptados utilizan criterios diagnósticos ordenados de manera jerárquica para permitir un sistema de clasificación consistente con límites claros para las clases. no resulta apropiado para la descripción y mapeo de áreas más grandes. más detallado queda el nivel de clasificación. El método que se describe a continuación. El principio básico se apoya en el uso de clasificadores que refieren a criterios de diagnósticos o atributos independientes. La jerarquía de clases es construida sobre un conjunto de clasificadores. representan un subconjunto de un rango de posibles usos y coberturas de suelo) y debido a que no existe un sistema de clasificación de referencia. descrita por Lillesand y Kiefer (1987). por lo tanto. son rígidos y de capacidad limitada para incorporar nuevas clases. no son exhaustivos (es decir. donde cada jerarquía se relaciona con diferentes niveles de detalle temático y espacial. Estos “sistemas” de clasificación básicamente representan leyendas.do. por lo tanto.

Estos tres primeros niveles forman la base para la clasificación de uso de suelo y la colecta de datos en relación con dichas características se sugiere representan los datos mínimos requeridos. pero con algunos antecedentes de uso de suelo y de los sistemas de cultivo habituales. se refieren a las operaciones realizadas en una parcela en particular. como setos. el manejo de los campos agrícolas (es decir. Las características no siempre son fácilmente observables. 1993). pero que se consideran importantes en relación a la intensidad del uso y pueden tener un impacto directo sobre la biodiversidad del suelo. el deshierbe y la fertilización del mismo. El quinto nivel en los sistemas de clasificación se relaciona con elementos de vegetación leñosa (semi) permanentes dentro de la parcela y en los campos aledaños. Esta información puede ayudar a determinar si la parcela bajo consideración representa una característica (o patrones) del uso de suelo o tipo de cobertura. Estos elementos de vegetación se relacionan con características permanentes en el paisaje. Las subclases pueden definirse basándose en otros cultivos que forman parte del sistema del cultivo general. cercas vivas. se han añadido clasificadores que relacionan el manejo del suelo y cultivos que permiten la determinación del nivel de intensidad de uso. Las características de rotación de cultivos se consideran en otros estudios. El tamaño del campo generalmente es indicador del tamaño de la finca. Este último determina si el campo forma parte de un sistema de cultivo migratorio. lo que sirve para D escripción y clasificación de uso de suelo en puntos de muestreo 301 . en secuencia. Asimismo. Otros aspectos que se deben considerar son la distribución. tales como la preparación del suelo. ej. En el siguiente nivel de la clasificación jerárquica se consideran las prácticas culturales relacionadas con el suministro de agua y factores de cultivos de temporada. éstos pueden ser evaluados. patrones de campo) y los cultivos asociados. especialmente en relación con elementos leñosos de la vegetación que no se reconocen como cultivo y en relación con cultivos en campos adyacentes. un sistema de barbecho o un sistema de cultivo permanente. Esto puede ser señal de cultivos simultáneos o. la clase mayor es definida por el tipo de cultivo principal (p. o basados en los datos proporcionados por el agricultor. junto con el tamaño de las áreas de los campos. “cultivo de árboles” para un sistema basado en árboles). incluyendo arreglos espaciales de los campos agrícolas. barreras de viento y otras estructuras semipermanentes. Dichos clasificadores. normalmente. que muchas veces es referencia de la clase social y del tipo de manejo (Huising. son características que no se evalúan en los primeros niveles de clasificación. Por ejemplo.la parcela de muestreo.

Los principios de las clasificaciones jerárquicas son explicados por Molenaar (1991. información más específica se remite a variedades y esto representaría un mayor nivel de detalle (especificidad). Estos nuevos atributos ofrecen información más específica sobre el objeto de observación. a su vez. el cultivo principal puede describirse a un nivel más general (de género) como Zea o a un nivel de familia como Gramineae (pastos). Los atributos. pueden añadirse sin mayores consecuencias para el sistema de clasificación. los dominios de valor no son específicos para permitir la definición de 302 Manual de biología de suelos tropicales . Estos atributos técnicos específicos. Los niveles de clasificación definen un eje de la clasificación jerárquica en donde atributos adicionales (conjuntos de ellos) en cada nivel subsecuente definen las subclases (que representan un mayor nivel de detalle). En el caso de algunos de estos atributos. son consideradas observaciones a nivel de parcela. Los valores de datos posibles (dominios de valor) para la mayoría de los atributos son dados para proporcionar una descripción estándar de las características de uso de suelo. el patrón del campo ofrece información sobre la fragmentación del suelo y constituye otro aspecto de la intensidad de uso de suelo que puede impactar directamente sobre la biodiversidad del suelo. 1998) y Huising (1993). como los refiere el LCCS. sirven para trazar la cartografía del uso de suelo (mediante la interpolación de puntos de observación que complementan un mapa). Si se conoce el valor de clase a un nivel más específico. por lo tanto. La transformación de las listas de atributos a formatos para registrar los datos en el campo resulta fácil. la descripción cuantitativa de la intensidad del uso del suelo. que pueden incluir. por ejemplo. el valor de clase a un nivel más detallado de generalización puede ser inferido. Éstas sirven para guiar las observaciones en el campo en los puntos de muestreo y sus áreas circundantes. Además de este eje existe uno más en la clasificación jerárquica que hace referencia al nivel de precisión con que se describen las características de uso o añade información específica (detalles técnicos) de las características de uso de suelo descritas. por ejemplo. no son independientes y pueden involucrar algún tipo de medición con un nivel más alto de detalle. Por otro lado. Los atributos técnicos específicos permiten una definición más precisa de clases de uso de suelo asociados. por lo tanto.identificar posibles asociaciones de usos de suelo que. el cultivo principal se puede describir como maíz (Zea mays). Registro de datos en campo y observaciones adicionales En las siguientes secciones se presenta la lista de atributos para la descripción de usos de suelo. Además.

junto con la información relacionada con el tercer nivel (es decir.6b). es aceptable clasificar la tasa de aplicación como baja. Las clases de datos deben indicar una discriminación relevante (significativa) de objetos y el subconjunto de clases debe ser extensivo (no exclusivo). Los atributos pueden agregarse para facilitar la descripción de características específicas de un área en particular. La situación contraria sería con el conocimiento de la práctica común en el área. los datos relacionados con niveles muy detallados de observación son muy difíciles de obtener. o bien. clases de tamaño estándar definidas en campo con límites fijos no podrán ser significativas por esa razón. se debería poder inferir información sobre el manejo de la parcela en particular. relacionada con el manejo. La información de estas fuentes de datos puede resultar incorrecta. una tasa particular de aplicación (baja. media o alta. La información en el cuarto nivel. como documentos). Por ejemplo. la información puede generalizarse para la clase de “fertilizante aplicado” (implicando el uso de fertilizante inorgánico). no se obtiene a través de observaciones directas en el campo. Las observaciones para los tres primeros niveles del sistema de clasificación se pueden hacer directamente en el campo. basada en observaciones secundarias. Sin embargo. sino que requiere del acceso a fuentes adicionales de información (a través de entrevistas a los agricultores. Si éste no es el caso. si la información sobre la tasa de aplicación de un fertilizante inorgánico en particular no se considera confiable o correcta. o bien. A menudo. A priori. a personas externas.valores de datos en los rangos de observación y distribución de los valores de datos. esto no es prescriptivo en el sentido de que los datos necesitan ser colectados en todos los niveles de detalle. simplemente. a partir de la observación directa en el campo. con los conocimientos de un sistema habitual de cultivo y las prácticas de manejo en el área. utilizando otros recursos. pero éstos deberán añadirse a los niveles más bajos de la clasificación jerárquica para evitar que interfieran con la estructura de la misma. Sin embargo. El sistema para describir el uso de suelo muestra varios niveles de detalle. características culturales) obtenida de un informante o derivada de la información general de las prácticas culturales en el área. pero ello se compensa con la aplicación de la jerarquía en la precisión de los datos (referidos anteriormente como el segundo eje en el sistema de clasificación). basados en la definición de la clase adoptada (ver Tabla 11. El nivel de detalle al cual la información es reunida depende del propósito del inventario de uso de suelo y de la posibilidad de obtener D escripción y clasificación de uso de suelo en puntos de muestreo 303 . sus fuentes no son totalmente confiables. media o alta) puede ser asumida.

El uso de una cuadrícula regular para el muestreo permite que se tomen puntos de muestreo en cualquier lugar dentro de la parcela y posibles efectos de borde deben tomarse en cuenta. fecha. Se deberá registrar la localización específica del punto de muestreo dentro del campo (por ejemplo. siempre y cuando la cobertura del suelo no se clasifique como escasa. El sistema para la descripción de uso de suelo requiere de una estructura que pueda implementarse a detalle y que se considere viable bajo las condiciones reales. Estas observaciones secundarias sirven. la cobertura del dosel deberá clasificarse como “abierta” o “cerrada”. para la selección entre un cultivo de árboles y un cultivo anual en el mismo campo. dependiendo de la experiencia del encargado del proyecto.la información requerida. donde el cultivo de árboles se considera como el principal. al mismo tiempo. ya que puede tener un efecto en la distribución de la biodiversidad del suelo. la información sobre el tipo de lindero se debe registrar. El hecho de que el encargado del proyecto se encuentre familiarizado con el uso de suelo y con las prácticas de manejo en el área. por lo tanto. pueden ser incorporadas fácilmente a las libretas de campo en caso necesario. (por ejemplo. nombre del encargado del proyecto y nombre de la persona que toma los datos. sí pueden aportar información para el análisis de datos. será siempre una ventaja. Se recomienda revisar el trabajo de Stocking y Murnaghan (2001) para los indicadores relevantes de observaciones en el campo. el centro o los linderos). como el elemento de vegetación más dominante. además de los datos administrativos como hora. Estas observaciones no se consideran como clasificadores y. Observaciones secundarias pueden relacionarse con el estatus del cultivo o con la presencia de maleza. como un mecanismo para la validación de los datos en atributos y clasificadores e incluso para los resultados de clasificación finales. Para este propósito. Si bien estas observaciones no se incluyen en la clasificación del uso de suelo. Este tipo de información deberá registrarse en la libreta de campo. sin embargo. OBSERVACIONES DE USO DE SUELO: CLASIFICADORES Y ATRIBUTOS Observaciones respecto del cultivo principal y tamaño del campo El primer nivel del sistema de clasificación se reserva para las observaciones del cultivo principal. la explicación de posibles datos atípicos). Si la selección se realiza entre dos 304 Manual de biología de suelos tropicales . el segundo. no se incluyen en las listas de atributos que se detallan a continuación.

más de 10 años] 305 D escripción y clasificación de uso de suelo en puntos de muestreo . no se enlista bajo el título “Atributos técnicos 1” en la Tabla 11. para madera o leña).o más cultivos de la misma forma de vida. ancha] Propósito [vivero. “forrajes o fibras”. es conocido el tipo de cultivo. En la Tabla 11. En el caso de cultivos herbáceos. “leguminosas o vegetales”. deciduo] Tipo de hoja [aguda. o gramíneas] Atributo técnico 1 Atributo técnico 2 Cultivo de árboles o arbusto Tipo de cultivo (especies y Fenología de la hoja [siem. arbusto. hierba. entre 1 y 3 años. ej. Cuando se considera relevante. La clasificación se basa en la forma de vida del cultivo. pero en lugar de dejarlo abierto. se puede añadir un cuarto nivel que ofrezca información sobre la variedad específica del cultivo. es mejor definir una lista de Tabla 11. nueces y otros. entre 3 – 10 años. una especificación con más detalle indica si el cultivo pertenece a la categoría de “raíces o tubérculos”.1 los valores posibles (clasificadores o atributos) se enlistan entre corchetes. En el caso de un cultivo de árboles o arbustos se puede añadir información sobre el aspecto (es decir. 1 año.variedades) pre verde. el cultivo con el mayor porcentaje de cobertura califica como el cultivo principal. árboles de sombra] Duración del cultivo [Estación (parte del año). cosecha de toda la planta (p.1 Clasificadores y atributos técnicos para el cultivo principal Nivel 1a – Clasificador Forma de vida [árbol. La información más concreta sería entonces el tipo específico de cultivo. La categoría de cultivo herbáceo representa un nivel adicional en la clasificación jerárquica (nivel de especificación) y. Se prevé para una descripción de un segundo y tercer cultivo.1. por ejemplo. dependiendo. proporcionando una mayor especificación de la forma de vida a nivel de detalle. El valor de dominio no se especifica aquí. por lo tanto. Los atributos técnicos son específicos para cada una de las diferentes formas de vida. porque su apariencia (características de vegetación) puede ser muy distinta. Generalmente. el propósito) y duración del cultivo. de la edad de la plantación. cosecha de frutas.

IV. Aquí se incluye la “cobertura de los cultivos”.lúpulo y otras enredaderas perennes] Herbáceas Categoría de cultivos [raíces y tubérculos. II. 2000).1 Continúa Nivel 1a – Clasificador Atributo técnico 1 Gramíneas Tipo [bambú. puesto que ello dependerá del contexto de estudio. 1993) con la opción de utilizar diferentes definiciones para cada una de las distintas regiones en donde se esté llevando a cabo el estudio. sirve como indicador del grado de organización y mecanización de las prácticas de manejo.2).Tabla 11. cereales. La forma del campo se añade principalmente como una preocupación respecto a posibles efectos de borde y. no obstante. La definición de clases de tamaño de campo “pequeña”. La cobertura del cultivo se anexa aquí. pastos] Si no son gramíneas Categoría del cultivo [I. además. véase la lista LCCS (Di Gregorio y Janssen. a manera de ejemplo. mediano y grande. III-cultivos de cobertura. es mejor definir clases significativas basadas en un estudio piloto del rango de tamaño de campo presentes en el área de estudio (Huising. El siguiente nivel en la clasificación jerárquica se determina por las características espaciales de la parcela en observación (Tabla 11. aunque está más relacionada con las características del cultivo que con las características del campo. caña. fibras] (si se conoce. legumbres y vegetales.plátanos y otras plantas herbáceas arbóreas. aunque esto se relaciona más con las características del cultivo que. con las características de campo. “mediana” o “grande” no aparece. arroz. La cobertura del cultivo se usa generalmente como un parámetro para la interpretación de 306 Manual de biología de suelos tropicales .herbáceas. con el propósito de evitar cualquier confusión. pero manteniendo la distinción conceptual entre pequeño. ésta queda fuera del marco de este capítulo. forrajes. especificar el tipo de cultivo) Atributo técnico 2 Tipo de cultivo (especies o variedades) Tipo de cultivo Tipo de cultivo nombres permitidos para los tipos de cultivo.

Una cubierta “abierta” significa que la distancia entre los perímetros de las copas puede ser hasta dos veces mayor que el diámetro medio del dosel. escasa (20-10%)] Observaciones relacionadas a combinación de cultivos y prácticas culturales Las combinaciones de cultivos se consideran el segundo nivel. En el caso de cultivos anuales. En el caso de un segundo o tercer cultivos. mediana. Además. mediana (60 – 30%). En el caso de formas de vida permanentes. rectangula [chica.2 Tamaño del campo y características de la cobertura del cultivo. abierta (70-60 – 20-10%). baja (30 -15%)] Cobertura permanente: [cerrada (> 70-60%). la distribución espacial en el campo puede especificarse. generalmente. Esto puede servir para entender la importancia relativa del cultivo en sistemas de cultivos múltiples. Tabla 11. Por lo tanto.imágenes de percepción remota. su densidad puede medirse directamente en términos del número de plantas por unidad de medida (m² o ha) o en términos de espacio entre plantas (el espacio entre surcos y la distancia entre las plantas). Las clases de densidad podrían especificarse. el tipo de cobertura “cerrada”. Se pueden hacer distinciones de acuerdo con el número de cultivos y con su secuencia. pero dependería mucho del tipo de cultivo. en los casos donde un clasificador de segundo nivel “combinación de cultivos” indica que existe un segundo o tercer cultivo creciendo en el campo. Para coberturas no permanentes. multiangular. los límites de clases son ligeramente diferentes (ver Di Gregorio y Janssen. y especialmente en el caso de los cultivos anuales.Forma [cuadrada. en tira o irregular] Tamaño del campo (metros cuadrados) Atributo técnico 2 Cobertura del cultivo Cobertura no permanente: [alta (> 60%). a las diferencias en las etapas de crecimiento y otros factores. esto se refiere a que en una misma parcela y durante una sola temporada se realizan uno o varios cultivos. El segundo y tercer cultivo pueden describirse por los mismos D escripción y clasificación de uso de suelo en puntos de muestreo 307 . grande] lar. Nivel 1b -Clasificador Atributo técnico 1 Tamaño de campo o parce. 2000). se refiere a que se produce un empalme entre las copas. proporciona información acerca de la densidad del cultivo y es un indicador útil de la intensidad del uso de suelo. la cobertura del cultivo puede resultar difícil de interpretar debido a la variación en la arquitectura de las plantas. circular.

4). en los varios niveles de especificación. Un segundo tipo de cultivo puede referirse a un cultivo de sotobosque como el cardamomo. La vegetación del sotobosque también puede referirse a vegetación (semi) natural. el porcentaje de cobertura del cultivo adicional o añadido) puede alcanzar fácilmente el 100%. aspersión o goteo] Atributo técnico 2 Demanda de agua por irrigación [mm de agua suministrada por temporada de crecimiento o cultivo] 308 Manual de biología de suelos tropicales . plantaciones. igual que para el cultivo principal.atributos. El segundo tipo de cultivo se añade como un segundo atributo técnico. Tabla 11. serían suficientes. fragmentadas o dispersas] Tabla 11. por ejemplo. en cuyo caso. los cultivos de árboles (hule) en un campo grande (plantación). relacionadas con el “factor de tiempo del cultivo” para especificar esta información. también en estos casos. junto con la fenología y tipo de hoja. postinundaciones. La descripción para las características del suministro de agua es muy sencilla (ver Tabla 11. franjas alternas.3 Atributos de cultivos combiandos. como por ejemplo.4 Características del suministro de agua Nivel 3a – Clasificador Suministro de agua [lluvia. Nivel 2 – Clasificador Combinación de cultivos [simple (monocultivo). múltiple (intercalado)] Atributo técnico 1 Cultivos múltiples No. secuencial] Atributo técnico 2 (Segundo tipo de cultivo) Simultáneo o traslapado Arreglo espacial [una o dos filas intercaladas. definidas como características de suministro de agua y características relacionadas con el barbecho. la totalidad de su cobertura (es decir. con un sotobosque herbáceo cerrado. traslapar. 2 o más] Secuencia [simultáneo. El nivel tres en el sistema de clasificación se refiere a las prácticas culturales. irrigación] Atributo técnico 1 Irrigación Tipo de irrigación [superficial. El segundo (o tercer) cultivo o elemento de la vegetación puede incorporarse en la descripción de clase del sistema de uso de suelo como elemento descriptivo o como atributo. no habría un arreglo especial. de cultivos adicionales [1. Es necesario registrar cuando se practica una rotación de cultivo en particular. Se realizan previsiones al tercer nivel de clasificación. en donde la especificación de la forma de vida.

permanente] Atributo técnico 1 Cultivo migratorio Período de barbecho [corto.El cultivo post inundación se define. al empleo de técnicas de cosecha de agua (tratado por separado en la sección relacionada con el manejo de suelos y cultivos). se debe hacer la distinción entre si esto se hace con el objetivo de restaurar la fertilidad del suelo o debido a que las condiciones no permiten cultivar (bajas temperaturas o disponibilidad de agua limitada). largo] Permanente Permanente [continuo o intermitente] Atributo técnico 2 Índice de cultivo (valor del índice de cultivo Ruthenberg) Si es mejorado: Tipo de cobertura (ej. el suelo está cultivado por más de 66% del tiempo. barbechos y cultivos permanentes. mediano. de la siguiente forma: “después de que un campo ha sido inundado con agua de lluvia. natural. El cultivo migratorio se define como suelo cultivado durante menos del 33% del tiempo (Ruthemberg et al. en principio. Nivel 3b . aunque no lo mismo.5 Factor tiempo de cultivo.5. u otro tipo) Índice de cultivo (valor del índice de cultivo Ruthenberg) Intermitente No. mediano. mejorado] Duración del barbecho[corto. 1980). Los atributos técnicos se especifican en la Tabla 11. Se hace una distinción entre cultivos migratorios. la lluvia infiltrada en el suelo se usa intencionalmente como reserva para los cultivos”. Leguminosas. de acuerdo con el LCCS. o largo plazo] Barbecho Tipo de barbecho[suelo desnudo. y debido a que no trae consecuencias en la intensidad del uso de suelo. Esto es similar. Los sistemas de barbecho se definen como suelo cultivado entre el 33% y el 66% del tiempo y en los cultivos permanentes. esta distinción no se mantiene.. sin embargo.Clasificador Factor tiempo de cultivo [cultivo migratorio. de cultivos en dos años D escripción y clasificación de uso de suelo en puntos de muestreo 309 . en términos prácticos. mientras que en el sistema de barbecho Tabla 11. El factor de tiempo del cultivo indica la fracción de tiempo durante la cual el suelo es usado para el cultivo. Los cultivos migratorios típicamente se refieren a situaciones donde los agricultores abren nuevas parcelas para el cultivo. barbecho. El barbecho se refiere al periodo (estación de crecimiento) durante el cual se deja descansar el suelo.

Bajo la presión de una población en aumento. por lo tanto. Estas son evaluaciones parcialmente cualitativas y.cultivan la misma parcela o área de suelo. El periodo largo de barbecho es la situación típica en donde el suelo se deja en barbecho durante un año o más. durante el segundo año. pero eso no resulta lo suficientemente largo para clasificarlo como cultivo migratorio. lo cual es muy común en algunos lugares donde uno o dos cultivos “cortos” ocurren durante un año o donde el agricultor deja un periodo de barbecho más largo. pero necesita confirmarse y puede ajustarse con base en los datos reales sobre la duración de los periodos de barbecho en el área en cuestión. La definición de estos límites de clases se basa en la experiencia en el campo. forrajes. con un periodo de > 1–2 años. Para sistemas de barbecho. Barbecho largo. Periodo largo: > 8–9 meses El barbecho de periodo corto se refiere a situaciones donde normalmente existen dos temporadas de cultivo en un año y el suelo se deja descansar durante el resto del periodo. Si se requiere de datos más precisos. Los barbechos se consideran como “mejorados” en el momento en que se planta o se siembra para cambiar la composición de la vegetación de barbecho o para mejorar su calidad. se hace una distinción entre la duración del periodo de barbecho: Barbecho corto. la clasificación del periodo de barbecho es la siguiente: Periodo corto: < 4–5 meses. éstos se pue310 Manual de biología de suelos tropicales . con un periodo de < 1–2 años. Barbecho medio. pero < 8–10 años. pero < 8–9 meses. No se hace ninguna distinción referida al tipo de cultivo o propósito. El barbecho medio refleja la situación donde el suelo descansa durante seis a siete meses. por ello. por ejemplo. se sobreponen los límites de clases y se especifican para cubrir la variación específica de un periodo de barbecho para cualquier área que probablemente sea dependiente de las condiciones socioeconómicas y biofísicas habituales. el periodo de barbecho típicamente tiende a reducirse. con un periodo de > 8–10 años. dejándola descansar durante diferentes periodos de tiempo para restaurar la fertilidad del suelo. En el caso de cultivos migratorios. resulta relevante anotar la duración de dicho periodo. Periodo medio: 4–5 meses.

se podría prever. Hasta este momento no se han considerado las rotaciones de cultivo. el mejor momento para incluir una descripción de las secuencias de los cultivos sería en el segundo nivel de la clasificación jerárquica donde “la combinación de cultivos” puede describirse como “secuencial”. tal y como se observa en la Tabla 11. plagas y enfermedades. puesto que el barbecho a menudo forma parte de un sistema de rotación de un cultivo en particular. el “factor tiempo de cultivo”. por lo que no han sido incluidas en el sistema de clasificación. Alternativamente.5. el principal aspecto que se debe considerar sería si esto se realiza por medios mecánicos o no. sin embargo. el manejo del suelo y de los cultivos se consideran representativos de un nivel separado en el sistema de clasificación (Tabla 11. es un factor que deberá tomarse en cuenta en relación con la biodiversidad del suelo. Los mayores componentes de las prácticas de manejo discutidas se refieren a técnicas para la preparación del suelo o su cultivo. tal y como se muestra en la siguiente fórmula (Ruthenberg et al. Se añade la “preparación del suelo” por su relevancia en los márgenes de la selva en los trópicos. una opción para combinar ambos clasificadores dentro de uno que describa el grado de mecanización. donde potencialmente existe un alto impacto en la biodiversidad del suelo.6a). el manejo de las malas hierbas.. Los datos deberán especificar el número de años del ciclo de rotación de cultivos y la secuencia de los cultivos en el ciclo. Características de manejo del suelo y de cultivos Las prácticas culturales mencionadas incluyen: “manejo de agua” como una operación de manejo.den calcular utilizando el índice de cultivos de Ruthenberg. En cuanto a la preparación del suelo y la cosecha. Tf = duración del barbecho o duración del tiempo en el que no se cultiva el suelo. Esto es. la cosecha. 1980): CIr = Tc/(Tc + Tf) En donde: Tc = duración del cultivo (tiempo). como un clasificador podría ser excluida de la clasificación porque la preparación del suelo es generalmente la D escripción y clasificación de uso de suelo en puntos de muestreo 311 . por lo tanto. fertilización y cosecha. Si se practica una rotación de cultivos. De manera alternativa.

el suelo (y otras condiciones ambientales) afectarán la eficiencia de la operación. La “eficiencia” en términos de horas por hectárea requerida para la operación se añade como un atributo opcional. aquí se incluye su compatibilidad con los métodos que incorporan el uso de combustibles fósiles en los cálculos de la intensidad del uso de suelo. El tipo de animal o el tipo de maquinaria empleada es indicado en el siguiente nivel de detalle. Opcionalmente. De acuerdo con el orden mencionado. El uso de combustibles puede fácilmente estimarse si se conoce su eficiencia. comparado con animales “ligeros” o maquinaria de igual consideración. La labranza mínima se refiere a aquellos sistemas donde el arado y la siembra son típicamente una combinación de una sola operación. Se debe mencionar aquí si se practica la labranza mínima. Se presume que animales “pesados” o maquinaria pesada causan un mayor impacto en el suelo. Por lo tanto. tipo de equipo y tipo de tracción. en caso afirmativo. tales como la unidad de sembrado directo (ripper-planter) utilizada en la agricultura de conservación (de Freitas. se podría considerar combinar ambos (mecánica y química) dentro de un clasificador que describa el uso de agroquímicos (excluyendo fertilizantes orgánicos). la profundidad del arado. refiriendo su capacidad. Una distinción más detallada de acuerdo con los requerimientos reales de poder o capacidad en términos de caballos de fuerza no se considera relevante. por ejemplo. Se añade un atributo técnico que describe el tipo de arado usado. se basa en el tipo de tracción utilizada: animal o mecánica. sin embargo. porque esto dependerá de las condiciones locales. o arado de cincel. en el sentido de que una mayor o menor eficiencia no causará mayor o menor impacto en el suelo y los organismos que se encuentran en él. las opciones son: arado de vertedera. ya que no resultará un indicador directo del grado de perturbación del suelo. Se hace una distinción basada en si el suelo ha sido labrado o no. tomando en cuenta el impacto directo del peso del animal o la maquinaria y el impacto generado por los diferentes tipos de equipo operados por maquinaria o animales de diferentes capacidades. La eficiencia se refiere más a lo económico que a lo ambiental. donde la labranza del suelo se restringe a hacer agujeros para sembrar. sería más sencillo 312 Manual de biología de suelos tropicales . pero al contrario. plagas y enfermedades es el uso de agroquímicos.primera operación para ser mecanizada y tiene un profundo efecto en la biodiversidad del suelo. La principal preocupación relacionada con el control de las malezas. estos arados se presentan desde el menos eficiente en remover el suelo y dejará más estructura intacta en el suelo. 2000). el uso de combustibles debería añadirse como atributo en el siguiente nivel más alto de especificación. en lugar de labrar el campo entero o donde el grado de perturbación se minimiza con el uso de equipos especializados. arado de disco. tales como tipo de suelo.

mula/burro] Eficiencia (horas/ha) Mecánico Tipo de arado Clase de maquinaria [dos ruedas (ligera). biológico o cultural. a Deshierbe a mano Eficiencia (horas/ha) mano. con la mano] D escripción y clasificación de uso de suelo en puntos de muestreo 313 . “No quitar malezas” puede atender a situaciones donde no existe la extracción real de las malezas. estas han sido registradas de las prácticas de uso de suelo en los niveles previos del sistema de clasificación y. el barbecho. directo (ripper-planter)] vaca. labranza y deshierbe. mecánica] Alcance de la labranza [labranza completa.disco. caballo. por ello. mecánica.. labranza mínima/unidad de sembrado les usados [búfalo. buey. intermedia e intensa] Manual Atributo técnico 2 Labranza [Sin labranza. mecánico.y práctico manejarlas por separado. El clasificador para el control de malezas especifica el modo de mecanismos de control. etc. la rotación de cultivos.[vertedera. Nivel 4 – Clasificador Limpieza [Sin limpiar. tracción animal. Tracción animal Tipo (y número) de anima. cincel. no se incluyen en el valor de dominio. sea por el método de herbicidas. manual.6a Clasificadores y atributos relacionados con la limpieza de la parcela. manual (azadón). mecánico. químico] Tipo de deshierbe [con azadón. química] Atributo técnico 1 Manual Modo [desmontar y quemar.disco. por ejemplo. Respecto al deshierbe manual se hace una distinción Tabla 11. reducida o mínima] Eficiencia (horas/ha) Tipo de arado [vertedera. cincel. En el caso de medidas de control culturales (y biológicas). desmontar y cubrir con abono verde] Mecánica Grado [limpieza moderada. cuatro rue. labranza mínima/unidad de das (pesada)] sembrado directo (ripperplanter)] Eficiencia (horas/ha) Deshierbe [Sin deshierbe.

2005). VI mochila. por mucho.edu/pnw/weeds). se debería especificar el ingrediente activo (ia). que es la sustancia activa del Roundup. ingrediente activo y tasa de aplicación entre si esto se lleva a la práctica con el uso del azadón o mediante la extracción totalmente manual. orst. Una tasa de aplicación de (ea) menos de 850 gha-1 se considera un volumen bajo (VB) de aplicación. En cuanto al uso de químicos en el control de malezas.iastate.Tabla 11. si se considera el gran número de herbicidas que se encuentran disponibles en el mercado. cultivo para el control de malezas] Atributo técnico 2 Eficiencia (horas/ha) Tipo de equipo (ej. Una diferencia más. dado que el Roundup es. Si se considera de vital importancia. se recomienda implementar un sistema de clasificación para la aplicación de volumen de herbicidas que sea relevante para el área en cuestión. los cuales se convierten de libras por acre a gramos por hectárea (weeds. Las especificaciones son asignadas de manera arbitraria. azadón de presión. otros mecanismos] (entre 850 y 2500 g ia/ ha).ippc. se considera un volumen alto (VA).6a Continúa. basadas en recomendaciones generales para su aplicación en diferentes cultivos. mientras que una aplicación (ea) de más de 2500 gha-1. se basa en el volumen de la aplicación que resulta no viable. VA (> 2500 g ia/ha)] Herbicida. azadón rotatorio) Eficiencia (horas/ha) Químico Volumen de aplicación Tipo de equipo [aspersor de [VB (< 850 g ia/ha). o cualquier otro tipo de herbicida. junto con la cantidad en gramos del ingrediente activo por hectárea. Nivel 4 – Clasificador Atributo técnico 1 Mecánico Tipo de deshierbe [labranza frecuente. weeds. si se requiere información más detallada acerca del Roundup. la distinción se hace acorde con su aplicación: el uso de aspersor de mochila es el más común.edu/mgmt/2004) por la cantidad de aplicaciones especificada en gramos equivalentes de ácido (ea) por hectárea de glifosato. los diferentes tipos de ingredientes activos y las fórmulas que existen (Oregon State University. el herbicida más usado en los trópicos (www. Las especificaciones de manejo de malezas no cubren todas las medidas de control de malezas. Sin embargo. por lo 314 Manual de biología de suelos tropicales .

se presume que se requieren entre 5 y 10 toneladas por hectárea para poder mantener los niveles de humus en el suelo. Con respecto a la aplicación de fertilizantes inorgánicos. se podrían especificar cantidades reales de aplicación. (2002) y son usadas en caso de aspersión aérea. Los fertilizantes de bajo grado tienen menos del 25% de nutrientes para las plantas. P2O5 para el fósforo y K2O para el potasio) El índice toma D escripción y clasificación de uso de suelo en puntos de muestreo 315 . Dos toneladas por hectárea por año se consideran suficientes para todo tipo de cultivo. los rangos de tasas de aplicación se especifican para los límites superiores e inferiores de las clases. 1985). en caso de considerarse relevante. sin tomar en cuenta su modo de empleo.6b). Eso se hace para poder acomodar los diferentes grados de fertilizantes. Los elementos nutritivos pueden referirse a un solo elemento (por ejemplo N) en los fertilizantes simples o la combinación de elementos en mezclas incompletas o mezclas completas (el porcentaje de peso se relaciona al N para el nitrógeno. Para abonos. La frecuencia de la aplicación puede variar y en la tabla que se observa a continuación.que la libreta de campo es un buen complemento para la observación relacionada con cualquier medida específica de control de malezas. En este punto. estas cantidades se suministran una vez cada cuatro a seis años (ILACO. Las clases de volúmenes para aplicar pesticidas se obtienen de Craig et al. se deberán tomar en cuenta los valores más altos. y las mismas clases de volumen se consideran relevantes. en lugar de usar un valor en particular. estos se basan en asumir un contenido de materia orgánica del 30%. Tasas de aplicación bajas de menos de una tonelada por hectárea por año se consideran insuficientes para mantener los niveles de humus y de materia orgánica en el suelo. mientras que los fertilizantes de alto grado contienen hasta el 50% de elementos nutritivos. Se presume que el modo de aplicación no traerá muchas consecuencias para la tasa de aplicación. fungicidas u otros químicos. Los volúmenes especificados se refieren a la forma líquida en la cual el pesticida o el fungicida se obtienen. Con relación a las medidas de control de plagas y enfermedades. control biológico o mecanismos de control químico (Tabla 11. Generalmente. En cuanto a los fertilizantes orgánicos e inorgánicos. las cifras se convierten en tasas de aplicación por año. se prevén especificaciones para la tasa de aplicación. sin considerar las disoluciones hechas antes de la aplicación. Respecto al uso de pesticidas. dentro del rango especificado. se definen clases similares: control natural o medidas culturales. se hace una distinción basada en si éstos son ampliamente aplicados en todo el campo o si la aplicación se restringe a puntos específicos y también al tipo de equipo utilizado. Cuando se utilicen fertilizantes de bajo grado.

o si las tasas de aplicación altas son de particular interés. por lo tanto. Sin embargo. cuando incluyen quemas. ya sea en o alrededor del hoyo de plantación.75 kg ha-1 de N como punto de referencia para la aplicación de N. especialmente. “Sin limpieza” (ver Tabla 11. La manera en que se prepara la parcela puede tener un profundo impacto en la biodiversidad del suelo. para alrededor de tres toneladas de trigo en suelos relativamente fértiles y 25 toneladas de mandioca en suelos moderadamente fértiles. La aplicación del fertilizante. estos valores se toman como el límite superior de la clase de “tasa de aplicación de fertilizante medio”. La limpieza también es importante en sistemas de barbecho. de un fertilizante de alto grado y de 700 kg ha-1 o más de un fertilizante de bajo grado. La conversión puede incluir operaciones para nivelar el suelo. se podría considerar añadir una clase para las tasas muy altas que serían aplicaciones de 300 kg ha-1 o más. cualquier incidencia de fue316 Manual de biología de suelos tropicales . Esto sería la aplicación recomendada para un suelo moderadamente fértil que produce alrededor de cuatro toneladas de maíz (grano). será relevante en el caso de tasas bajas o muy bajas de aplicación. en donde los árboles se cortan a mano o con sierra de cadena y los troncos se remueven utilizando tractores u otra maquinaria más ligera. lo que ha ocurrido en algunos márgenes de selvas en donde opera el proyecto CSMBGBD. Esto sería particularmente relevante donde se practican cultivos migratorios o donde las selvas han sido convertidas recientemente en suelo agrícola. Una aplicación de 75 kg ha-1 de N requerirá 150 kg ha-1 de un fertilizante con N de alto grado y alrededor de 350 kg ha-1 de un fertilizante de bajo grado. en donde una tasa muy baja de aplicación representa alrededor de 10 a 15% de esta cantidad de referencia. La “limpieza intensa” significa que la tierra se limpia completamente con el uso de tractores oruga y otra maquinaria pesada. En todos los sistemas es importante registrar si la quema se lleva a cabo para eliminar la vegetación muerta o si esta vegetación se queda como abono orgánico. Si las tasas de aplicación son generalmente altas. 6a) se enlista cuando el campo ha sido convertido a partir de bosque o vegetación secundaria desde hace más de 20 años. se incluye como clasificador separado. lo cual coincide más o menos con la duración máxima de barbecho bajo sistemas de cultivos migratorios. Actualmente. Las otras clases se derivan de estas cifras. Otra distinción se hace basada en el tipo de equipo usado. se hace una distinción entre sistemas de “desmontar y quema” y “desmontar y cubrir con abonos verdes”. por lo tanto. “La limpieza moderada” está indicada cuando se utilizan medios manuales y mecánicos.

vehículos. VB (entre 10-100L/ha). alta (>2 t/ha/año)] Fertilizantes [sin fertilizante. Tabla 11. abonos. Nivel 4 – Clasificador Manejo de plagas y enfermedades [medidas preventivas y control natural. (VA >200L/ha)] Tipo de químico y tasa de aplicación Tasa de aplicación [baja (<1t/ha/año).go como parte de las prácticas de manejo deberá registrarse en esta sección como fenómeno importante. aspersor de motor. franjas. aspersión en toda la parcela] Atributo técnico 2 Volumen de aplicación [UVB (<10L/ha). franjas. mezclas incompletas. mezclas completas] Tasa de aplicación [muy baja (<20 – 60 kg/ha). media (entre 75– 175 y 150–350 kg/ha). control químico y biológico] Atributo técnico 1 Control químico Aspersión [aspersión focalizada. composta. VI (entre 100 y 200L/ha). fertilizantes y cosecha. abono verde. baja (entre 25–60 y 75–175 kg/ha). fertilizantes químicos. combinación de fertilizantes químicos y orgánicos] Equipo usado [aspersor de mochila. media (entre 1–2 t/ha/año). o de manera homogénea en la parcela] Inorgánico Clases de fertilizantes [simple. mecánica] Eficiencia (Horas/ha) D escripción y clasificación de uso de suelo en puntos de muestreo 317 . o de manera homogénea en la parcela] Cosecha [manual. aviones] Fertilizantes orgánicos Tipo de fertilizantes [residuos de cultivos.6b Clasificadores y atributos para el manejo de plagas y enfermedades. alta (>150–350 kg/ha) Aplicación [hoyos. estiércol de corral] Aplicación [hoyos.

corta vientos y otros) o medidas estructurales que incluyen terrazas. el crecimiento puede clasificarse como: crecimiento retardado. especialmente. El rendimiento del cultivo como indicador integra muchos factores. entre otras. muros de contención. por lo que es difícil obtener cifras confiables y del todo correctas. acolchonado. incluyendo las relacionadas con técnicas de recolección de agua. altura y diámetro relativos del cultivo en crecimiento (ver Stocking y Murnaghan. La información sobre el rendimiento de la cosecha es igual de útil. construcciones y empalizadas. esta información deberá adjuntarse. La información de las medidas de conservación no se captura directamente en el registro de los atributos enlistados arriba.Otras observaciones sobre el manejo de suelo y cultivos Aparte de registrar las características del manejo de suelo y de cultivos como se describió en las tablas anteriores.net). De manera general. cuando se relacionan con su manejo. Las observaciones del estatus de los cultivos podrían ser útiles para corroborar los resultados anteriores (o resultados de clasificación). Las evaluaciones del rendimiento basadas en campo deberán incluir lo siguiente: población de plantas por metro cuadrado. Las medidas de conservación de suelo y agua afectarán las poblaciones de organismos del suelo indirectamente por el almacenamiento de agua mejorada. se recomienda que las observaciones de las prácticas de conservación de suelo y agua. al igual que las del estatus del cultivo. el uso de elementos de vegetación (referido a tiras de pastizales. se incluyen como medidas estructurales. bancos. lo que aumenta la capacidad de retención y reduce la pérdida de suelo.). La World Overview of Conservation Approaches and Technologies (WOCAT). cuando se compara con un cultivo de 318 Manual de biología de suelos tropicales . las características del crecimiento del cultivo pueden utilizarse como una medida representativa del rendimiento. pero no como base de clasificación. número de macollos por planta de cereal. Estos datos proporcionan información adicional sobre el cultivo principal tal y como se especifica en el primer nivel del sistema de clasificación. que se practica en el Níger). en donde se observa que la altura del cultivo es menor. Probablemente. De manera alternativa. 2001). barreras de setos. Las técnicas de recolección de agua como cavar zanjas. si se conoce la técnica con un nombre en particular (por ejemplo “Zai”. wocat. provee una visión general en su página web de muchas técnicas existentes (www. cultivos en curvas de nivel. etc. sean incluidas. El registro debe contener la descripción de las medidas de conservación del suelo y el agua. hondonadas y otras. la mejor manera de categorizarlas es determinar si incluyen medidas agronómicas (como cultivos mixtos.

todos a nivel parcela o paisaje. Este es el caso cuando la cobertura de árboles es escasa (menos de 10 a 20%). el factor Ruthenberg se establece. Esto permite la inclusión de elementos de vegetación leñosa en la descripción que no están capturados en el sistema de descripción de uso de suelo. en principio. están disD escripción y clasificación de uso de suelo en puntos de muestreo 319 . se esperaría encontrar barbecho como parte del patrón de uso de suelo. un importante aspecto de la intensidad del uso del suelo. por sí misma. lo que resulta importante para un mapeo del uso de suelo. 2001) por signos de déficit de nutrientes en maíz. deberá enlistarse su nombre. dentro de una proporción espacial entre barbecho y el suelo cultivado en el uso de suelo actual. la primera distinción se hace en función de si éstos son continuos. frijol y col. dentro del contexto del uso de suelo en las áreas de los alrededores (esto ayuda a establecer si el uso de suelo en la parcela en observación es representativo o no). y la severidad de la infección en términos del grado en el cual la planta es afectada. La fragmentación del uso de suelo que puede ser evaluada a partir de estas observaciones resulta ser. permite una evaluación del uso del suelo en un punto de muestreo particular. por ejemplo. Respecto a la distribución de los campos (evaluación del patrón de distribución). permite la validación y la verificación de las observaciones en el lugar del muestreo. con un diámetro del cultivo menor y una decoloración generalizada en sus hojas. Queda fuera del marco de este capítulo proporcionar información más detallada sobre plagas. en el caso de cultivos migratorios o sistemas de barbecho. y finalmente. enfermedades y sus clasificaciones. Si se conoce la plaga o enfermedad específica. cercas vivas y otros elementos de vegetación importantes. Las observaciones del estatus del cultivo deberán acompañarse de observaciones acerca de la incidencia de plagas y enfermedades e incluir el porcentaje del cultivo afectado. lo cual puede ocurrir cuando los árboles están dispersos dentro de la parcela. Existen guías disponibles para registrar deficiencias específicas de nutrientes en cultivos (ver Stocking y Murnaghan. y cultivo de crecimiento vigoroso. Además. El uso de suelo en el área circundante del punto de muestreo tendrá una notable influencia sobre la biodiversidad del suelo de la parcela en observación.crecimiento vigoroso. Patrones de distribución en el campo y árboles en la finca Las observaciones relacionadas con el tipo de campo y con los elementos de vegetación leñosa dentro de la parcela bajo observación y sus alrededores están incluidas. plantas de menor vigor.

áreas acuáticas cultivadas o de inundación regular. El patrón del campo se relaciona a la forma del lugar y al arreglo espacial del mismo. La segunda distinción se refiere al tamaño. irregular] Patrón de la parcela [regular. áreas terrestres seminaturales. son las características del suministro de agua y la permanencia del cultivo.) 320 Manual de biología de suelos tropicales . etc. dispersa] Atributo técnico 1 Continuo Distribución del tamaño de la parcela [uniforme.tribuidos en forma de racimos o dispersos (ver Tabla 11. vegetación acuática (semi) natural. Tabla 11. en donde se especifican los cultivos principales. Los distintos componentes de uso del suelo pueden describirse con mayor detalle. agrupada. mediana. irregular] No continuo Parte de las tierras cultivadas [% de cultivo y área de manejo] Parte de la cobertura vegetal [% de área (semi) natual] Parte del área acuática cultivada [% de área acuática cultivada] Parte acuática no cultivada [% de área acuática no cultivada] Área urbanizada [% de superficie artificial] Atributo técnico 2 Uniforme clases de tamaño (mayoría del campo) [pequeña. utilizando las clases mayores de cobertura de suelo del LCCS. queda una opción para especificar los porcentajes del área usando varias categorías: tierras cultivadas y áreas manejadas. áreas vacías o cuerpos de agua artificiales y cuerpos de agua naturales (hielo y nieve).7 Características de la parcela y distribución del uso de suelo. forma y patrón de los campos y finalmente.7). Clasificador espacial Distribución espacial de la parcela [continua. lo que parece relevante especialmente en el caso de áreas cultivadas terrestres. grande] Cultivo principal (lista de los cultivos de cuatro parcelas vecinas ) Cultivo principal (lista de cultivos de cuatro parcelas vecinas) Cobertura del suelo (cobertura dominante de áreas no cultivadas) Tipo de cultivo o actividad Tipo de área acuática Tipo de área urbanizada (ej. industrial. Residencial. superficies artificiales.

aunque estos elementos pueden ser característicos del uso y cobertura del suelo y tener mayor influencia sobre la presencia de la biota específica del suelo. La Tabla 11. En el caso de porcentajes bajos de cobertura de árboles y árboles dispersos dentro del campo o alineados en forma de cerca viva. nueces. La información sobre los árboles pertenecientes a la familia leguminosa es útil en relación con la ocurrencia de las bacterias formadoras de nódulos. es importante registrar la localización del punto de muestreo respecto al lindero del campo. para madera. este podría no ser el caso. DESCRIPCIÓN Y CLASIFICACIÓN DE USO DE SUELO Definición y descripción de clases de uso de suelo No es el propósito de este capítulo describir cómo las clases de uso de suelo se definen. El primer atributo describe la distribución espacial de los árboles.Tabla 11. como estanques. si es posible)] El último elemento que debe ser registrado es la presencia de elementos permanentes de vegetación leñosa en el paisaje. especificado en términos del número de árboles por hectárea o longitud de los elementos lineales de la vegetación leñosa. Como se ha mencionado. para cosechar frutas. presas. a partir de los claD escripción y clasificación de uso de suelo en puntos de muestreo 321 . Clasificador espacial Atributo técnico 1 Atributo técnico 2 Suelo desnudo [% de áreas desnudas] Cuerpos de agua [% de Tipo de cuerpos de agua [arcuerpos de agua] tificial. para leña o material de construcción). Los atributos técnicos permiten una descripción del tipo de árbol (ya sea por especie u otro nivel taxonómico) y el propósito de tener árboles (por ejemplo.7 Continúa. Las “zonas verdes” se refieren a árboles espaciados en filas dispuestas como empalizadas. pantanos. natural (especificar tipo. Se entiende que los tramos de bosque y otra vegetación leñosa fueron ya cubiertos por el método de clasificación para uso de suelo. Es importante derivar las clases de manera sistemática. Más información trata de la cobertura o densidad del componente árbol.8 especifica los atributos utilizados para describir los TROF. Se hace referencia a éstos como árboles en una finca (TROF).

el diseño de la clasificación jerárquica y el atributo de los valores de clase. zonas verdes] Atributo técnico 1 Cercas vivas: especies de árboles Árboles dispersos dentro de la parcela Propósito [principalmente frutas y nueces. Nivel 5 Clasificador Tipo de TROF [sin TROF. por ejemplo.Tabla 11. Las clases se definen por la combinación particular de clasificadores y atributos (determinados por el valor de los mismos). “cultivo de temporada” y “cultivo permanente”. tipo de cultivo).8 Características de los árboles en la finca (TROF). Si únicamente se consideran los primeros tres niveles en la clasificación jerárquica. distintos grados de cobertura de árboles pueden observarse dentro de la clase “plantación de árboles” (o aun dentro de las plantaciones de teca). “parcela de tamaño grande”. árboles dispersos dentro de la parcela. una clase de uso de suelo podría ser definida en función de los siguientes valores de atributos: “cultivo de árboles”. no necesariamente tienen que implicar una definición de un conjunto adicional de clases en el siguiente nivel de la clasificación jerárquica. principalmente árboles de sombra. Esto se traduce en “plantación de árboles”. pero esto pue322 Manual de biología de suelos tropicales . cercas vivas. Los principios de la definición de usos de clase de suelo. principalmente madera. utilizando reglas de decisión. lo que determina el nivel de detalle con que se definen las clases. barreras contra el viento u otros elementos leñosos. Si se contemplan atributos adicionales del cultivo principal (por ejemplo. otros] Barreras contra el viento u otros arreglos lineales: especies de árboles Empalizadas: tipo o especie dominante Atributo técnico 2 Cobertura (% de linderos que constituyen cercas vivas) Densidad (número de árboles por ha) Longitud total por ha (m/ha) sificadores y atributos presentados aquí. de manera que un conjunto de clases definido para un área en particular puede ser fácilmente mapeado en el conjunto de clases utilizados para otra área y viceversa. No todos los atributos o clasificadores tendrán que tomarse en cuenta. es posible distinguir entre una plantación de teca y otra de hule. cuando se toman en cuenta atributos técnicos adicionales. Por otra parte. son explicados a continuación. relacionados con observaciones de campo. “cultivo único”.

en donde el factor “tiempo de cultivo” sería el parámetro en la jerarquía agregada y no. La Tabla 11. “sin irrigación”. se retiene la información sobre el porcentaje de cobertura como un valor de atributo en particular para cada observación individual (instancia u ocurrencia) del objeto clase (es decir. Los clasificadores especifican un “cultivo de árboles”. lo que D escripción y clasificación de uso de suelo en puntos de muestreo 323 . un “campo grande”. no todos los atributos pueden ser fácilmente organizados en una tabla. sin embargo.9 contiene una vista global de la estructura de la clasificación principal. Más bien.8. esta característica es general en áreas grandes y no en parcelas. Y. Las clases se asignan de acuerdo con las reglas de decisión y al mismo tiempo las clases se definen. La Tabla 11. XO y NO). decidiendo la presencia de un clasificador sobre otro. Debido a la estructura anidada.9 proporciona una lista generalizada de los clasificadores y atributos de clases de acuerdo con el nivel la clasificación jerárquica. y por ello podría usarse para realizar ejercicios de mapeo a pequeña escala. la jerarquía considera el cultivo principal como la puerta de entrada. Por ejemplo: SI (<forma de vida> igual a ‘árbol’ y <tamaño de parcela> igual a ‘grande’ y <combinación de cultivos> igual a ‘único’ y <factor tiempo de cultivo> igual a ‘permanente’) ENTONCES <clase> = ‘plantación de árboles’. tal y como se observa en la Tabla 11. ver Huising (1993). Las reglas de decisión generalmente toman la forma de un conjunto de condiciones SI – ENTONCES que aplica los atributos. O. plantación de árboles). como han sido presentados arriba.de no ser relevante para definir clases separadas de plantaciones de árboles. y “un cultivo permanente”. Debido a que el sistema que se presenta trata de áreas cultivadas y manejadas. Esto se refiere a los niveles de la clasificación jerárquica.10.1 a la 11. y no a los niveles de generalización (el segundo eje en el sistema de clasificación). en áreas donde los cultivos migratorios o permanentes se practican uno al lado del otro. combinados a través de operadores Booleanos (es decir. Una clasificación jerárquica se establece de manera similar. el factor “tiempo de cultivo” puede tener prioridad sobre el cultivo principal como la característica dominante. No obstante. hay que tomar en cuenta los valores especificados para los diferentes clasificadores y atributos técnicos. Para información precisa habrá que referirse a las Tablas 11. Para una explicación de clasificación y jerarquías agregadas. en la jerarquía de clasificación para observaciones en parcela. Para ilustrar la definición y descripción de la clase.

11 muestra los datos para una parcela imaginaria de maíz. que la parcela es cultivada de manera permanente con un pequeño periodo de barbecho cada dos años. si la plantación de árboles bajo estudio es un pequeño bosque aislado dentro de un ambiente dominado por cultivos anuales. por ejemplo. Las diferencias entre la intensidad de uso de suelo. Posteriormente. se podría definir una subclase añadiendo la descripción “intercalada con un cultivo de leguminosas” para distinguirla del maíz como único cultivo. el tercer nivel. el segundo nivel indica que entre el maíz se encuentran otros cultivos y. permitirá una distinción entre hule de “jungla”. Se pueden tomar en cuenta medidas para el control de malezas mediante corte o también el uso de químicos. Si se utiliza la información sobre la especie de árbol. se clasificará como “extensivo”. La Tabla 11. podría basarse en la clase de atributo nivel 1 “densidad de árboles” o en el atributo nivel 2 “combinación de cultivo de árboles”. enfermedades y la fertilización del suelo no tienen lugar. es importante informar sobre el uso del suelo circundante. de cacao y otras. el manejo de plagas. lo cual únicamente tendrá sentido si existe una gran variación de dichas características dentro del área y si éstas reflejan diferentes regímenes de manejo. Esto. si la información es correcta y se considera importante en el contexto de la clasifica324 Manual de biología de suelos tropicales . o si forma parte de un paisaje dominado por plantaciones de cultivos de árboles. 2002) o en lugares donde se cultivan únicamente árboles de hule. El primer nivel especifica que se trata de una pequeña parcela cuyo cultivo principal es el maíz. La principal categoría de uso de suelo a la que esta parcela en particular pertenecerá puede definirse como “cultivos permanentes a pequeña escala con maíz como cultivo principal”.200 mm de lluvia por año.significa una plantación grande de árboles. En cuanto a los clasificadores del nivel 5. con 100 árboles por hectárea y que recibe 1. El manejo de estas plantaciones. por ejemplo. por lo tanto. De manera alternativa. porque la preparación del campo. con relación a la variedad de plantaciones. a un sistema agroforestal en donde los árboles de hule (Hervea brasiliensis) crecen dentro de la selva (Joshi et al. se pueden distinguir plantaciones de frutales. Tomando en cuenta la información del cultivo principal (clasificadores del nivel 1) se describirá la parcela como grande (con 10. Algunos de los clasificadores de suelo y atributos de suelo y cultivos. se pueden distinguir plantaciones de árboles destinadas a la producción de madera para tablas o para otros fines y si se utiliza la información sobre el propósito.. frecuentemente no son relevantes para cultivos de plantación.000 m² por tamaño de la parcela). una plantación de más de 10 años de teca (que forma un dosel cerrado).

) Nivel 4 manejo Modo de cosecha y clasificación de uso de suelo en puntos de muestreo Clasificador Medios de limpieza Atributos Nivel de especie 1 Grado de limpieza Modo de limpieza 325 . Nivel 2 cultivo combinado Cultivos simples o múltiples Suministro de agua Factor tiempo de cultivo Nivel 3 prácticas culturales Cobertura del cultivo Nivel 1 características del cultivo y el campo Clasificador Forma de vida del cultivo principal Tamaño del campo Segundo Densidad o espacio entre tipo de cultivo plantas Tercer tipo de cultivo Cantidad de agua suministrada Número de Clase de cobertura del cultivos cultivo Tiempo de secuencia Arreglo espacial Tipo de irrigación Duración del período de barbecho Índice Ruthenberg Clase de tamaño del campo D escripción Modo de preparación del campo Tipo de tracción Frecuencia Tipo de operación Alcance de la operación Frecuencia Modo de deshierbe Manejo de plagas y enfermedades Prácticas de fertilización Tipo de fertilizante Volumen aplicado Atributos Nivel de especie 1 Tipo de cultivo (categoría) Forma del campo Tipo de barbecho Tipo especifico de barbecho Atributos Nivel de especie 2 Cultivo especifico (categoría o especies) Atributos Nivel de especie 3 Cultivo variedad (especie o variedad.9 Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo.Tabla 11.

3 Atributos Nivel de especie 4 Nivel 5 Configuración espacial del campo y árboles en la finca Clasificador Configuración espacial de los árboles en la finca Atributos nivel 1 Propósito de los árboles en la finca Atributos nivel 2 Tipo de especies de árboles dominantes .Tabla 11.9 Continúa. Nivel 2 cultivo combinado Tipo de equipo Ubicación. Modo de equipamiento Aplicación Nivel 3 prácticas culturales Tipo de arado Alcance de la operación Eficiencia Clasificación de la aplicación Tipo de fertilizante Tipo de químicos Tipo de herbicida Volumen Volumen aplicado Volumen aplicado aplicado Patrones de distribución del campo Cobertura de árboles (copa) Densidad de árboles o longitud de barreras Patrones de distribución del tamaño del campo Partes del área terrestre cultivadas y manejadas Partes terrestres no cultivadas Arreglo espacial del campo Forma de vida del cultivo principal Otros tipos de uso o cobertura Clasificación de la aplicación Clasificafión de la aplicación Tipo de equipo 326 Eficiencia Nivel 1 características del cultivo y el campo Atributos Nivel de especie 2 Manual de biología de suelos tropicales Atributos Nivel de especie.

Tamaño o clases de tamaño del campo Tipo de cultivo principal % cobertura Nivel 5 Configuración espacial del campo y árboles en la finca Atributos nivel 3 Especies de árboles D escripción y clasificación de uso de suelo en puntos de muestreo 327 .Tabla 11.9 Continúa.

si es relevante.Tabla 11. aunque esto por lo general se describe en las características del sitio. aunque no se discuten en este capítulo.Teca nico nivel 2 Atributo téc.000 m2 100 árboles/ ha n/a n/a 1. de hoja ancha leñoso >10 años Manual de biología de suelos tropicales Atributo téc.10 Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca. Nivel 2 Combinación de cultivos Único 328 Nivel 3 Prácticas culturales De temporada n/a n/a n/a n/a Permanente n/a Grande Regular Cerrado Vegetación natural* 10. se puede describir las plantas debajo de los árboles y estas plantas pertenecerán a la categoría de vegetación (semi) natural. ** En el caso de sistemas de temporada de ser posible debe especificarse la cantidad de lluvia. para lo cual se utilizan otros parametros.200 mm** n/a n/a Nivel 1 Características del cultivo y el campo Clasificador Árboles Atributos técnicos Nivel 1 Perenes.Tectona grandis nico nivel 3 * En este caso. .

16 1 cultivo adicional Simultaneo 2 filas alternadas NA Intermitente De temporada Permanente Mejorado Nivel 1 Características del cultivo y el campo Nivel 3 Prácticas culturales Clasificador Gramíneas Pequeño Atributos nivel de especie 1 Cereales Cuadrada D escripción Mecánica y química Labranza frecuente (2x) y fumigación una vez (1x) Aspersor de mochila VB (Roundup) Continuo n/a n/a Pequeño Uniforme 90% Regular Hierbas y gramíneas Chícharos.Tabla 11. maíz 10% n/a n/a n/a n/a Ninguno Fertilizante químico Directamente hoyos Manual VMB (muy bajo) 50 kg CAN/ha n/a Atributos nivel de especie 2 Maíz Mucuna (abono verde) Atributos nivel de especie 3 Nivel de manejo 4 n/a Tracción animal n/a 2 bueyes n/a Arado de vertedera n/a Nivel 5 Configuración espacial del campo y árboles en la finca No TROF y clasificación de uso de suelo en puntos de muestreo n/a n/a Caminos .000 m2 Mediano a grande 75 x 25 cm Frijoles NA 0. habas. Nivel 2 Combinación de cultivos Múltiple 2.11 Ejemplo de clasificadores y valores de atributos para parcelas de maíz.infraestructura 329 n/a .

El grado de interferencia con (perturbación o alteración) el ecosistema natural sería una buena medida de la intensidad del uso de suelo. Giller et al. sin que esto quede reflejado en la definición de las clases. Un esquema de clasificación estándar no funcionará porque la definición de un conjunto de clases depende del contexto y del propósito específico de la clasificación. el criterio para mejorar el barbecho podría considerarse en la definición de las subclases. con un bajo volumen de herbicidas. uso de nutrientes. más intenso será su uso). Parece que existe un consenso sobre los factores que determinan la intensidad del uso de suelo. Esta sección pretende demostrar cómo un conjunto de clases podrá definirse y organizarse en una estructura jerárquica y que el sistema es bastante flexible en cuanto a la selección de clasificadores y atributos considerados para su clasificación. pero una definición de un índice o medida de la intensidad de uso de suelo no es fácil. dependiendo de las reglas de clasificación. sin el uso de fungicidas o pesticidas y únicamente con muy baja cantidad de fertilizantes. La información específica se refiere a la densidad de la planta. Manejo y nivel de insumos: la información en el manejo del cultivo y el suelo habla de que el nivel de perturbación del suelo se considera intermedio (habiendo sido arado dos veces con el uso de tracción animal) y que el insumo de químicos ha sido bajo. el manejo tiene por objetivo modificar o establecer condiciones que propicien la producción de un cultivo. (1997) definieron un índice de intensidad de uso de suelo que considera la frecuencia de la ocupación de suelo (según lo expresado en el índice Ruthenberg). La norma general es que los sistemas culturales y manejados son más intensivos que los naturales (cuanto más insumos de manejo se requieran para mantener los sistemas. Esto podría traducirse. principalmente. insumos de ener330 Manual de biología de suelos tropicales . que indica patrones de uso de suelo fragmentados y un uso intensivo del suelo. que las parcelas son generalmente pequeñas. al arreglo específico de la combinación del cultivo y a qué especie es utilizada para mejorar el barbecho.. con escasa o sin presencia de árboles. Los clasificadores de nivel 5 y los atributos describen que el suelo es cultivado de manera continua. manejo de plagas. en “un manejo caracterizado por el uso de tracción animal y bajo insumos agroquímicos”.ción. Ordenamiento de las clases de uso de suelo respecto a la intensidad de su uso En sistemas agrícolas. con cultivos anuales.

puesto que cada índice es una expresión particular de la intensidad del uso de suelo. Lo anterior permite un arreglo de los componentes de la vegetación (objetos) a lo largo de dos gradientes. Esto se hace considerando aquellos atributos (y clasificadores) que expresen un aspecto en particular de la intensidad de uso de suelo. Para los propósitos de investigar tendencias en la pérdida de la diversidad del suelo en relación con un incremento en la intensidad de su uso. se refiere a la permanencia (o frecuencia) de operaciones y el segundo. La presencia de vegetación permanente en el sistema de cultivo limitará las posibilidades para cultivar el suelo o la proporción del suelo que puede ser cultivado. el componente de la cobertura de la vegetación (semi) permanente es un indicador útil. puesto que es difícil asignar un peso adecuado a las variables explicativas. que en el entorno de márgenes de selva se traduce en elementos de vegetación leñosa. de la misma manera como lo ilustran Kuechler y Zoonneveld (1988). aunque no directamente relacionado con la influencia de la operación del manejo. Es decir. El segundo gradiente D escripción y clasificación de uso de suelo en puntos de muestreo 331 . Además. en el caso de cultivos migratorios. En ambos casos. se requieren categorías de clases de uso de suelo en términos de la intensidad de uso de suelo (o alternativamente una definición de clases de uso de suelo que reflejen diferentes niveles de la intensidad de uso de suelo). los esfuerzos para crear un índice universal o una medida de la intensidad de uso de suelo serán inútiles. como factores relevantes. Han existido varios intentos por definir una medida de intensidad de uso de suelo. se traduce directamente en la frecuencia del cultivo.gía y manejo de agua. la presencia de vegetación permanente disminuirá la influencia de la variación climática en el ecosistema del suelo. pero éstos no han sido del todo exitosos. También. la proporción del tiempo durante el cual la vegetación del suelo se restablece de manera semipermanente. a la intensidad (o amplitud) de las operaciones. El primer gradiente representa la presencia (proporción en el espacio o tiempo) de vegetación seminatural. indicando que el sistema con una proporción mayor de vegetación permanente (ya sea como elementos de vegetación natural o cultivada) representa una intensidad menor de uso o un grado menor de perturbación. Existen dos principales ejes a lo largo de los cuales se mide la intensidad del uso: el primero. reflejando el grado en el que estos factores tienen un efecto en los ecosistemas (el grado en el que se altera o perturba el ecosistema natural) y debido a que algunas veces los datos requeridos para una evaluación cuantitativa de la intensidad del uso de suelo no son accesibles. con la relevancia de que un índice en particular dependiente del contexto o propósito para el cual se está desarrollando.

pero sobre todo. El continuo puede representarse gráficamente con un triángulo en donde los tres ángulos representan los valores extremos de la cobertura del suelo que solo pueden estar constituidos por árboles naturales (es decir. en el siguiente nivel de especificación. dentro de cada una de las clases definidas.5). la permanencia se expresa con el factor “tiempo de cultivo” y el sistema de clasificación permite un arreglo de clases de uso de suelo. sólo de árboles plantados (plantación) o sólo de cultivos anuales o pastizales. En segundo lugar. Cultivos anuales-campo Componente de le vegetación leñosa y semileñosa (natural) Componente de la vegetación leñosa cultivada Componente de la vegetación leñosa no cultivada Componente árbol Selva Tiempo de cultivo-permanencia Plantación 332 Manual de biología de suelos tropicales . y presencia o ausencia del componente arbóreo. se determina basándose en los clasificadores y atributos del sistema de clasificación. Los objetos se refieren a árboles que existen en la naturaleza (en el caso de vegetación natural).representa la cobertura de vegetación leñosa. Además de servir como una partición en el tiempo. cultivos anuales y pastizales) en el caso de elementos de vegetación cultivados.“sistemas de barbecho”-“cultivos permanentes” (véase Tabla 11. La localización a lo largo de los dos ejes. dentro del sistema de cultivo. a árboles plantados o cultivados (árboles cultivados) o elementos de vegetación no leñosos (por ejemplo. selva). como se ha especificado en el atributo técnico 1. los objetos de uso de suelo son ordenados a lo largo del segundo gradiente de intensidad de uso de suelo.“cultivos migratorios”. Se puede hacer una subdivisión adicional basándose en la duración del periodo de barbecho. de acuerdo con el componente Figura 11. de acuerdo con el incremento en la intensidad: “sin cultivar”. como en el sistema de “hule de la selva” mencionado arriba. este eje también expresa una partición en el espacio entre los elementos de vegetación natural y cultivada. para el sistema de cultivo permanente.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. lo que resulta relevante en el caso de sistemas particulares de uso de suelo. En primer lugar.

Tabla 11. porcentaje de la cobertura del cultivo. En el tercer paso.1). “lúpulo y otras enredaderas perenes herbáceas” y “cultivo de cobertura”. las plantaciones de árboles se consideran menos intensivas que cuando se trata de arbustos pequeños como el del café o té. También se podrían considerar operaciones de deshierbe con “deshierbe mecánico”. como se ve reflejado en la información sobre la categoría del cultivo (ver atributo técnico 1.árbol o arbusto en el sistema de cultivo (referido a las proporciones en el espacio o en el tiempo). el rango se lleva a cabo basado en las características de manejo (el cuarto nivel en el sistema de clasificación). las cuatro clases de intensidad se definen de acuerdo con el grado de mecanización (es decir. dentro de las clases resultado de los dos pasos explicados arriba. Existen dos aspectos que deben ser considerados en relación al manejo: uno se relaciona con el grado de perturbación física debida a las operaciones de manejo y el otro se relaciona con el grado de interferencia química con el sistema (uso de agroquímicos). Si la cobertura de los árboles es escasa. En el caso de cultivos de árboles (sistema basado en árboles) se puede considerar el número de estratos de la vegetación y el porcentaje de cobertura del suelo para una categoría posterior.2. sin cultivo. Respecto a los cultivos sin gramíneas. manual. Las clases se ordenan de acuerdo con este gradiente utilizando las características del cultivo principal (Tabla 11. los cultivos de árboles se consideran menos intensivos cuando se comparan con cultivos de arbustos. tiene que considerarse la información relacionada con los árboles en la finca (Tabla 11. se deberá considerar la intensidad de las operaciones. Los clasificadores y atributos del nivel 4 (especialmente relacionados con las operaciones de cultivo.2) y combinaciones de cultivo (Tabla 11.5). “cereales” y “arroz” (ver Tabla 11. el orden de intensidad de uso sería el siguiente: “cultivo herbáceo”. de gramíneas y con formas de vida herbáceas. Si únicamente se toma en cuenta la forma de vida del cultivo principal. como un nivel más de intensidad. Por ejemplo. Una asignación de la intensidad de clases se basa en el valor del clasificador en las operaciones de cultivo (es decir.1) junto con las características de la cobertura del cultivo (es decir. A un nivel más general.3). Una diferenciación adicional para cultivos que no son árboles se basa en la permanencia o duración del cultivo. Una vez más. D escripción y clasificación de uso de suelo en puntos de muestreo 333 . Tabla 11. Respecto al tipo de cultivo de gramíneas. deshierbe y de manejo de plagas y enfermedades) son utilizados para definir las clases de intensidad. tracción animal o medios mecánicos).1). “plátano y otras plantas herbáceas similares”. la clase “bambú” aparece antes que las clases de “pastos”. operación de cultivo) y con el grado de uso de agroquímicos (para el control de malezas y manejo de plagas y enfermedades) tal y como se indica en la Figura 11.

el arado escarificado. Esto se puede observar en la figura 11. Al final. A nivel más general.3. la clase de uso de suelo más intensiva pertenece a “cultivos migra334 Manual de biología de suelos tropicales . BAJO NIVEL DE INSUMOS QUIMICOS INTENSIDAD MEDIA: ALTO GRADO DE MECANIZACIÓN.6b). El arado de vertedera tiene un efecto más profundo en el suelo (remoción completa). ver Tabla 11. BAJO NIVEL DE INSUMOS QUIMICOS Otra diferencia podría establecerse en función del tipo de animales o maquinaria usada (de acuerdo con los caballos de fuerza) y el tipo de arado empleado. el arado de cincel y. ALTO NIVEL DE INSUMOS QUIMICOS Grado de disturbio físico INTENSIDAD BAJA: BAJO GRADO DE MECANIZACIÓN. una evaluación por pares de clases de uso de suelo individuales en la región de superposición dará la clasificación final en términos de la intensidad de uso de suelo. seguido por el arado de disco. La superposición será considerable entre las clases de sistemas de barbecho y sistemas de cultivos permanentes. INTENSIDAD MEDIA: BAJO GRADO DE MECANIZACIÓN. En cuanto al orden de categoría respecto del uso de agroquímicos. y no reconoce que puede haber una superposición considerable en términos de intensidad de uso de suelo entre las clases. considerando una plantación de árboles (cultivo permanente bajo manejo extensivo) representará un sistema menos intensivo que un cultivo manejado intensivamente bajo un sistema de barbecho corto. son considerados de manera conjunta. podría basarse en el volumen de aplicación (aplicación selectiva o localizada. únicamente se considera el “uso” o el “no uso” de agroquímicos. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos.3.2. los clasificadores para el control de malezas y manejo de plagas y enfermedades. en el primer paso de la clasificación. por último. El procedimiento jerárquico descrito arriba producirá ramificaciones claramente separadas en la clasificación del árbol. Como se ilustra en la figura 11. que representa el nivel más bajo de perturbación.Figura 11. estas clases tienen que relacionarse entre sí. pero una diferencia más. tipo de equipo o maquinaria usada en el caso de plagas y enfermedades y el volumen de aplicación. Para poder llegar a una clasificación final de clases de uso de suelo en términos de intensidad de uso. ALTO NIVEL DE INSUMOS QUIMICOS Uso de agroquimicos INTENSIDAD ALTA: ALTO GRADO DE MECANIZACIÓN.

sin distinguir. sistema de barbecho (barbecho 4-5 meses) Pte: cultivo de árboles extensivo. este pasto se considera el tipo de vegeD escripción y clasificación de uso de suelo en puntos de muestreo 335 . en primera instancia. en las regiones superpuestas entre la categoría mayor de uso de suelo. si proviene de orígenes culturales o (semi) naturales (por ejemplo. cultivo permanente Pcmi: cultivo de intensidad media. considerando que la cobertura de árboles en plantaciones puede ser entre el 60% al 70% de la intensidad de uso.3 Clasificación del uso del suelo en términos de la intensidad de uso. cultivo migratorio (barbecho < 1–2 años) Flce: cultivo extensivo. lo que se toma como el límite superior para la clase “cultivos migratorios”. se aplican los mismos criterios que en el segundo y tercer pasos de la clasificación. cultivo permanente Pti: cultivo de árboles intensivo. que se considera la forma de vida de la vegetación dominante o cultivo. Para establecer una comparación de clases de uso de suelo individual. cultivo permanente torios” y es seguida por el de menos intensidad de uso “cultivo permanente”.Figura 11. sistema de barbecho (4-5 meses < barbecho < 8-9 meses) Fsci: cultivo intensivo. cultivo permanente Pchi: cultivo intensivo. Donde: Fn: selva natural Fl: selva explorada Slce: cultivo extensivo. sistema de barbecho (barbecho > 8-9 meses) Fmcm: cultivo de intensidad media. cultivo permanente Pge: pastizales extensivos. que corresponde al 66% del tiempo que la tierra no es cultivada. cultivo permanente Pgi: pastizales intensivos. en esta fase. Esto quiere decir. donde se determina el orden a lo largo del gradiente de intensidad de uso de suelo descrito anteriormente. bajo cultivo migratorio (periodo de barbecho > 8-10 años) Smce: cultivo extensivo. bajo cultivo migratorio (1-2 años < barbecho < 8-10 años) Ssce: cultivo extensivo. si el suelo está en barbecho el 60% del tiempo y la vegetación de ese suelo es pasto.

V.. de acuerdo con los sistemas de uso de suelo en el trópico húmedo a diferencia del proyecto ASB (Bignell et al. los pastizales permanentes. En el segundo ejemplo se considera la intensidad de manejo (en relación con el cultivo más demandante del sistema.. in C. Pashanasi. G. N. L. A. (2005) ‘Belowground diversity assessment: Developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. M. Marcel Dekker Inc.tación dominante). P. si se compara con un área de cultivo permanente bajo manejo intermedio o bajo (Pcmi). Respecto a la selva. B. A. S. Pimentel (ed) Encyclopaedia of Pest Management. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. D. con la introducción de una noción de que la extracción de productos de la selva sirve como un indicador para la intensidad de uso. Peter Okoth por las discusiones en la preparación de este capítulo. Woods. (2002) ‘Aerial application’. D. y Dorr.. Strategies and Methods of Introduction.-X. L. FAO. FAO Soils Bulletin 77. Susilo. F. y Swift. J. 336 Manual de biología de suelos tropicales . Nwaga. 2005). un cultivo con un manejo intensivo bajo un sistema de barbecho corto (Fsci) puede subir una posición. A.. Huang... REFERENCIAS Bignell. Columbia University Press. y Jansen. “sistemas de barbecho” refiriéndose al componente de cultivo. Techniques and Equipment.New York. I. FAO. Agradecimientos Al profesor Ken Giller por sus comentarios y al Dr. Moreira. más que al barbecho en sí) para permitir a la clase bajo consideración subir una o dos posiciones en el orden de clasificación. Di Gregorio. Vosti. Igualmente. Palm.. M.. aun en el caso de que sean manejados intensivamente (Pgi) tendrán una clasificación más baja en términos de intensidad de uso de suelo. Rome. De Freitas. S. selva manejada y selva explotada. E. J. New York. Rome. F. (2000) Land Cover Classification System (LCCS): Classification Concepts and User Manual. es decir. De esta manera. si se compara con un cultivo anual con un sistema de barbecho corto (Fsc). H. A.. Dibog. Craig. Sanchez and P. J. J. (2002) Soil Management and Conservation for Small Farms. se hace una distinción entre selva natural. in D. P. Management and Conservation Service. P. Tondoh. GCP/RA/287/ITA Africover – East Africa Project and Soil Resources.

World Overview of Conservation Approaches and Techniques. N. 6. van Noordwijk. Oregon State University (2005) Pacific Northwest Weed Management Handbook. Iowa State University (2004) ‘Weed Science’. Barois. M. M. Bogor. S. Applied Soil Ecology. in H. G. J. J. Vincent. in M. S. ICRAF-Southeast Asia Regional Research Programme. Lavelle. (2005) ‘Soil biodiversity in rapidly changing tropical landscapes: Scaling down and scaling up’. Amsterdam. Bignell. Wageningen Agricultural University. Springer Verlag. N.V. y Huising. pp.. Akiefnawati. Zandstra. Thesis.. Ebner. D. G. Handbook of Vegetation Science. Wichman Verlag. MacArthur. Oxford. Baere. M. T. M. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. A.edu/pnw/weeds. P. Molenaar.edu/mgmt/2004/ world... Usher. www. (1987) Remote Sensing and Image Interpretation.D.. A.-M. M. L. soil biodiversity and ecosystem function’. The Netherlands.. Indonesia. M. P. A. F. Joshi.. Earthscan Publications Ltd. Kluwer Academic. D. E. E. Wibawa. A pattern recognition approach to land use inventory at the sub-regional scale using remote sensing and GIS applying an object oriented and data-driven approach’.. W. I.Giller. The Netherlands. Hopkins (eds) Biological Diversity and Function in Soils. Manurung. Taylor & Francis Ltd. (2002) Jungle Rubber: A Traditional Agroforestry System Under Pressure. (2001) Handbook for the Field Assessment of Land Degradation. Elsevier Science Publishers B. Karlsruhe. 10.. R. Dordrecht. 3–16. Karanja.. Barrios. Vink. Heipke (eds) Digital Photogrammetric Systems.weeds. John Wiley & Sons. G. R. Ruthenberg. Izac. A. www. J. M.iastate. M.. (1991) ‘Formal data structures. H. y Kiefer. y Zonneveld. Huising.org/swcmeas.. The Netherlands. W. Cambridge University Press. W. Fritsch and C.. M.asp. E. vol. E. Lavelle. Kuechler. D escripción y clasificación de uso de suelo en puntos de muestreo 337 . D. P. London.orst. New York. K. y Collinsons. object dynamics and consistency rules’. Giller.. Lillesand.. Ph.. Molenaar. D. (1980) Farming Systems in the Tropics.. Swift. P. Moreira. y Williams. J. Stocking. M.. (eds) (1988) Vegetation Mapping. Cambridge.shtml. (1997) ‘Agricultural intensification. London. van Noordwijk. Berlin WOCAT.. Boutin. vol. (1998) An introduction to the Theory of Spatial Object Modelling for GIS. J. E. R. K. ILACO (1985) Compendium for Agricultural Development in the Tropics and Sub-Tropics. D. B. www.. Clarendon Press. y Swift..wocat. H. Bardgett and D. and Murnaghan. N. H. 3rd edition. I. ippc. (1975) Land Use in Advancing Agriculture.

.

Universiti Malaysia Sabah. Universidade de Brasilia (UNB). Nairobi. dbagyaraj@vsnl. Barross str.904-970. Cx Postal 4457. J.gov. constant@unb. CEP 70910-900 Brasilia. D.ac.com. E. Manaus. R. Kenya. lmabreu@gmail. Universidade de Brasilia (UNB). (finado). beth@inpa. csuzdi-alef@nhmus. Cx Postal 4457. Coe. Institute for Tropical Biology and Conservation.bignell@qmul. Brazil.hu. Brazil. P. J. Gigiri. Departamento de Fitopatología. Huang. r. DF. Bagyaraj.br. DF. R. Brazil. C. Departament of Agricultural Microbiology. Bignell. Departamento de Zoología. D. Brasilia. H-1088 Budapest. S. 88999 Kota Kinabalu. Sabah. AM.Colaboradores L. Constantino. M.coe@ criar.904-979. Csuzdi. Instituto de Química. Instituto Nacional de Pesquisas da Amazõnia (National Institute for Amazonian Research-INPA). Malaysia. Cares. PO Box 30677-00100. Universidade Federal de Minas Gerais. 13. cares@unb. Abreu.org. CEP 70. Cx Postal 478. Instituto de Ciencias Biológicas. Brazil. Instituto de Ciências Biológicas. Universidade de Brasilia. d. Brazil.uk. Brasilia.br. E.com. Franklin. Belo Horizonte MG. CEP 70. 339 . GKVK Campus. Coordenação de pesquisas em Entomologia. United Nation Avenue. World Agroforestry Centre (ICRAF). University of Agricultural Sciences. CEP 69011-970. Hungary.br. DF. India. Systematic Zoology Research Group of Hungarian Academy of Sciences and Hungarian Natural History Museum. Departamento de Fitopatología. E. Campus Universitario Darcy Ribeiro. Bangalore.

nmarques@ufam. J. Brazil. W.br. CEP 37200-000 Lavras MG.rahmadi@lipi. PO Box 30677-00100 Nairobi. Universidade Federal de Lavras. United Nations Avenue. Manaus. Université d’Abobo-Adjamé. Abidjan. 46. X. Bogor. Cx Postal 3037. Lavras. Huising.br. Departamento de Entomología. 16001 Indonesia. Departamento de Fitopatologia. AM Brazil. Stürmer.br. Brazil. Gigiri. Jalan Suantri Brojonegoro nº1. Cibinong. c/o ICRAF.P. Skonate2@yahoo.edu.org. CEP 37200-000. L. University of Lampung. van Noordwijk. H. United Nations Avenue. E. Faculdade de Ciências Agrárias. J. J. Departamento de Ciências Naturais. Moreira. Cx Postal 478. j. M. tondohj@ yahoo. Karyanto. F.net. Instituto Nacional de Pesquisas da Amazônia (Nationale Institute for Amazonian Research-INPA). Université d’Abobo-Adjamé. L. A. CEP 37200-000. PO Box 30677-00100. alcmoino@ufla. c/o ICRAF. Côte d’Ivoire. sturmer@furb. C. Nairobi. CEP. Departamento de Ciência do Solo (Soil Science Department). A. S. Moino. CEP 89010-971.fr. MG. LIPI JI. Raya Jakarta-Bogor Km. N. cahyo. CEP 37200-000. Bandar Lampung 35145.E. C. Universidade Federal doAmazonas. PO Box 161. Departamento de Biología (Biology Department). morais@inpa. Gigiri.br.gov. fmoreira@ufla. AM.br. RC Biology. 02 BP 801. Cx Postal 3037. M. m. Indonesia. Kenya. B. Kenya.van-noordwijk@cgiar. Tropical Soil Biology and Fertillity (FSBF) Institute of CIAT.com. Cx Postal 1507. CEP 69070-000 Manaus.br.com. World Agroforestry Centre SE Asia. Swift. Abidjan 02. Morais. swiftmj2003@ yahoo. 801. Indonesia. Lavras . Centre de Recherche en Ecologie. F. 340 Manual de biología de suelos tropicales . M. M. Faculty of Agriculture.. jlouzada@gmail. Universitas Lampung. Zoology Division. N. Coordenação de Pesquisas en Entomnologia. Konaté.com.go. Jalan Sumantri Brojonegoro nº 1.com. Pfenning. Cx Postal 3037. UFR des Sciences et de la Nature. Universidade Federal de Lavras. Tondoh. MG. Department of Plant Protection. Blumenau. J. Universidade Federal de Lavras. asgknila@yahoo. Lavras.huising@cgiar. J. Susilo. Brazil. Brazil. Louzada. Tropical Soil Biology and Fertility Institute of CIAT. Brazil. Brazil. fxsusilo@tlkom. Universidade Federal de Lavras. Faculty of Agriculture. S. Bandar Lampung 35145.com. Rahmadi. Silva. 69011-970. Indonesia. Universidade Regional de Blumenau. ludwig@ufla. Cx Postal 3037. SC. S. Jr.id. Côte d’Ivoire.

Zanetti. Lavras. CEP 37200-000. Universidade Federal de Lavras.R. zanetti@ufla. Brazil. C olaboradores 341 .br. Departamento de Entomologia (Enthomology Department). Cx Postal 37. MG.

.

243. 93. de uso de suelo 302 B bacteria 39. 263 análisis de conglomerados (cluster) 267 análisis de correspondencia (AC) 266 análisis de varianza (ANOVA) 265 análisis filogenéticos198. 252-153 Asia 140–141 atributos 297. Véase análisis de correspondencia ácaros oribátidos 150 ácaros 149-159 acceso a puntos de muestreo 84.160 nematodos 171-172 AC. 280 África 141–142 agroecosistemas 43. 194-197. 191.127. 151. 290-294 alimentación especializada o incidental 111 almacenamiento de las muestras 78. 246 agroquímicos 313. 99. 247–248 arado 311. Véase servicios ecosistémicos biomasa 127. 291 análisis automatizado del espaciador intergénico ribosomal (ARISA) 261.314.Índice analítico A abundancia macrofauna 98. 126. 302-329 atributos de tamaño de unidades de muestreo campo o parcela 304-307 cuadrícula 81-82 atributos técnico. 132 mesofauna 159. 334 Ascomycota 248. 290 bacterias fijadoras de nitrógeno (BFNFNL) 177-213 Basidiomycota 248. 132 343 .164. 334 aislamiento 190. Véase atributos atributos técnicos específicos. 251-252 bienes y servicios. 217. 288. 40. 177-214.85 ácido láctico 156 aditivos 279.

319-320. 325-329 conjunto mínimo de datos 129-132 contaminación 78 control microbiano 287 cosecha 311. 298. 300. 58. cultivo 305-307 depredadores 37. 149-162 colonización 219-224 colonizadores (c) 172-174 combinación de cultivos 308-311. Véase taxonómica clasificación. Véase disturbio datos requeridos y análisis 49-50.biopesticidas 288 bioturbación 34 C C. 97. 110 nematodos 171-172 uso de suelo 42-43. 197. 171-172 cercas vivas y otros elementos de vegetación 319-321. 164 descomposición 29-35. 302-304 densidad. Véase colonizadores cálculo. 325-329 caracterización cultural 189. 307 características del cultivo 301. 102 clasificación. Véase electroforesis en gel con gradiente de desnaturalización diapausa 289 disección 157 diseños multiescala 64 diversidad BFNFNL 178-182. 194 HMA 219-222. 304307. 304-324. 101. 251 ciclo de nutrientes 34 clasificación de uso de suelo 332. 302. 125-132. 301. 317 cPCR. 313-315 determinación a priori 65. 331-332 Chromista 247 Chytridiomycota 248. 226-232 hongos 244. 265-267. 37-38. 246 descriptores genéricos 194 desmonte de la tierra 311. 310. 303 DGGE. Véase PCR competitivo CSM-BGBD. 96. 316 cultivos puros 198 cultivos secundarios 307 cultivos trampa 231-232 curvas de acumulación de especies 113. 124. 58 . 129. 243. 334335 clasificación de procesos 93. 254-255 D D. 302. 158-160. Véase enumeración cobertura. jerarquía 323 clasificadores 297. 245. 94. cultivo 305. 265 curvas de rarefacción 265 Cylindrocladium spp. uso de suelo 81 categorías tróficas 110-112. 190 caracterización de sitios 87-88 caracterización genética 197 cartografía. 325-329 colecciones de recursos genéticos 267 Collembola 123. conservación y manejo sostenible de la biodiversidad del suelo 344 Manual de biología de suelos tropicales cuadrícula estratificada 84-85 cultivo post inundación 308 cultivos de sotobosque 308 cultivos migratorios 309. 265-267 macrofauna 98-100. Véase Proyecto. 188.

113.6567. 70. 263 embudo de extracción 149. 193 equidad 266 ERA. 190. 191 enumeración 168. 128 especies trampa 185-186 esporas 88. 315. 322-323. 317. muestreo 80-81 gremios 114-115 grupos funcionales 29-41. 128 fertilizantes 314-316. 192 . 229-231. 71 etiqueta 97. 132 nematodos 165-166 extracciones núcleo por núcleo 154 F factor tiempo de cultivo 309.E eficiencia en la labranza 312-314 electroforesis en gel con gradiente de desnaturalización (DGGE) 259-260. 36. 116-125. 128 especies clave 129 especies endógenas 99. 99. Véase ensayo de reducción de acetileno escala 62 escalas espaciales de muestreo 42-50. 287. 163-165 grupos funcionales de la biota del suelo 38-41 H herbívoros 37 hidróxido de potasio (KOH) 156 hipótesis de CSM-BGBD 57 Í ndice analítico 345 . 283 extracción DNA 197. 319 enfoque sesgado 65 enfoques transversales 57 ensamble de especies 110 ensayo de reducción de acetileno (ERA) 185. 317 fertilizantes inorgánicos 315 fijación de nematodos 165-169 G glomerales 220 Glomeromycota 247 gradientes. 140 especies anécicas 100. 226-228. 257 esporas de HMA 226-228 método de Berlese 152-154 método de extracción Winkler 92. 115-117. 110-111. 114-118. 130. 104. 98 estándares para BFNFNL descripción de especies 194-196 estatus de los cultivos 318 estratificación en el muestreo 55-57. 218. 189. 94-100 esquemas de puntos de muestreo 72-75 estacionalidad 88. 85-86 escarabajos 100-113. 128 especies epigeas 78. 288 esquemas de muestreo alternativos 5789. 112125.99-100. 330-333 familia Acaulosporaceae 238 familia Archaeosporaceae 239 familia Gigasporaceae 240 familia Glomeraceae 236 familia Pacisporaceae 239 familia Paraglomeraceae 239 fase de pupa 284 fauna de la hojarasca 37. 162. 152-155 enfermedad 35. 312.

306 índice de diversidad de Shannon 171 346 Manual de biología de suelos tropicales L labranza 312. 305-306. 313. 317 J jarras de Leonard 186. patógenos de plantas 41. 185–187 huella molecular 196-198. 297-336 investigaciones piloto 60 irrigación308. muestreo de 63. 166-168 organismos entomopatógenos 290. Véase hongos micorrizógenos arbusculares hongos entomopatógenos 287-294 esquema de medición por puntos 74 grupos funcionales 39. 243-280 hongos antagonistas 41 hongos del suelo. 41 HMA 217–241 patógenos de plantas y saprofitos 41.173 índice de riqueza de género 171 índice de Shannon–Wiener 266 infiltración de glicerina 168 ingenieros del ecosistema 34. 217-241 hormigas 40. 263-264 índice fitoparasítico (IFP) 172-174 índice de madurez (IM) 172. 259-260. 302-304 manejo de la biota del suelo 47-49 muestreo 79-80 replicación y tamaño de muestra 60–65 I identificación grupos funcionales en macrofauna 112-113 HMA 226-228. 193 jerarquía clasificación 323 clasificación de uso de suelo 300-302. 129 inoculación 47. 91-92. Véase índice de madurez imágenes satelitales 67. 229-230 hongos 255-256 lombrices de tierra 98-100 macrofauna 105-110. 91. 293. 217. 301. Véase Sistema de clasificación de cobertura de suelo límites. 44. 114-118. 140-144 mesofauna 156-159 moscas de la fruta 284-285 nematodos 163-165. 64. 193 insectos 287-294 intensidad de uso de suelo agrícola 42. 140 hospederos promiscuos 178-185. 310 limpieza de malezas 313-315 listas de especies 107-109 lombrices de tierra 40. 37.93–100. 334 labranza mínima 312 LCCS. 53. Véase también taxonomía IM. 304. 46 datos requeridos 48-50 descripción y clasificación 299. 243-280 hongos fitopatógenos 41 hongos micorrizógenos 217-241 hongos micorrizógenos arbusculares (HMA) 41. 243-280 hongos saprofitos 41.HMA. 87-88. 100–113 . 330-336 inventarios 41-50. 187. 91. 100-113.

40. 214 muestreo dentro de una parcela 65 muestreo animales 39 BFNFNL185–189. 193 muestras control 193.84–85 paisajes 61-63 aleatorio y sistemático 67-68 muestreo en transectos monolitos para lombrices de tierra 97 macrofauna 75. 263 método de Seinhorst 168 método de Seinhorst modificado 169 método Winkler 92. 67-68 muestreo sistemático 67-68 N nematodos 163–176. 260. 261. 91-148 manejo 311-319.114–118. 73. 321-330 materia orgánica 29-35 materia orgánica del suelo (MSO) 34. 287–295 nematodos bacteriófagos 164 nematodos omnívoros 164 Í ndice analítico 347 . 75-77. 126. 73.118125.84–85 nematodos 165 punto de muestreo 62-63 muestreo aleatorio 55–56 muestreo en cuadrícula clasificación de uso de suelo 304 CSM-BGBD 79–80. 48-49 monolitos 94–100.M macrofauna 39. 118. 263-264 método de la cuadrícula de intersección 227-228 método de partículas de suelo251–253 método de reacción en cadena de la polimerasa (PCR) 196.256–259. 58 mecanismos de control 313-315 mecanización 311. 229–230 métodos TSBF 93–94 microfauna 37-38. 98-100. 131 monolitos complementarios para lombrices de tierra 97 moscas de la fruta 281-286 muestras compuestas 61–65. 114-118. 249. 56. 39. 97 muestreo no aleatorio 67 muestreo secuencial 64 muestreo simple aleatorio (MSA) 55. 197. 82–83. 131 número de muestras 81–83 esquema de puntos de muestreo 72–75 muestreo estratificado 67. 40. 193–195 clasificación de usos de suelo 297-336 diseño y estrategias 53-90 hongos 249 inventarios de biodiversidad 42-47 macrofauna 91-148 mesofauna 149-162 moscas de la fruta 282-285 muestreo adaptativo 64. 40. para hongos 252-255 mesofauna 39. 334 media poblacional 25 medidas de conservación 318 “medio 79” 214 medio “S” 293 medio selectivo.149-160 método de Berlese 149-160 método de Berlese modificado 154-155 método de centrifugación en azúcar 166 método de de extracción 190. 73 microhabitat 47. 290 método de filtración de partículas 252– 254. 54. 130 métodos de extrapolación 105 métodos de montaje 157–158.

249–255 proceso de aclarado 156-157 procesos de degradación 44 procesos de rehabilitación 44 productores primarios 37 programa Africover 299 propágulos infectivos 219-224 protozoa 247 proyecto. Véase persistencia paisajes 44–47. 219224 O observación directa 302 observaciones secundarias 303 Oomycota 250 organismos entomopatógenos 287–295 organismos mutualistas 39 P p.147–148 nivel regional 44. muestreo 60-62 polimorfismo de conformación de cadena única (SSCP) 261. 48-49.61-62 parcelas de muestreo y clasificación de uso de suelo 46–47. 165. 78. 132 Pythium spp. 263 polimorfismo de longitud de fragmentos de restricción (RFLP) 260 polimorfismo de longitud de fragmentos de restricción terminal (T-RFLP) 260. separación de 85-86 puntos. 126. muestreo 81.140–144 nomenclatura 106. 298 prueba de hipótesis 55–57.nematodos parásitos de plantas 164 nematos micofagos 164 nicho. 102 nivel de parche 46–47. 174 pesticidas 286. 48. 315. 307–311. 85–86. 317. 57. 314 Phytophthora spp. 325. 319 plantaciones 322–324 348 Manual de biología de suelos tropicales plantaciones de teca 328 plantas hospederas 178–182. 250 plagas 35. 219 población. 328. 38. 81. 7980. 263 prácticas culturales 301. 49. 250 . 191 nivel de nicho 47. 49 nitrogenasa 184. 329 preparación de la tierra 311-312 primers específicos para “hongos” 257258 principales grupos funcionales 35-38. Conservación y manejo sostenible de la biodiversidad del suelo (CSMBGBD) 45–47. 83–84. 49 nivel neotropical 142. 145. 41 procedimientos basados en cultura 333–245. subparcela o microhabitat 47.79–89. 244.218. 126 número más probable (NMP) 218. 330 PCR competitivo (cPCR) 262 PCR cuantitativo 261-262 PCR. 63 prueba piloto 60 pseudo-replicas 62 puntos de medición 53 puntos de muestreo 74 puntos de muestreo. Véase Método de reacción en cadena de la polimerasa permanencia de la vegetación 330–332 persistencia (p) 172. 184–186.185–198. 64-65. 300–336 patógenos fúngicos de plántulas 255 perturbación (P) 56.

79 solución de nutrientes Jensen’s 215 solución Nesbitt 158 SSCP. 325. 140. 103105. 130-132. 36-41 técnica de infección de plantas 178.124. 30–33.267 técnicas de procesamiento de muestras 78. 149 trampa White 293 Í ndice analítico S secuencia de cultivos 107 secuenciación 16S rDNA 196 selección subjetiva 67 servicios ecosistémicos 29–36. 149 trampa 118-125. 229-230 macrofauna 105 mesofauna 158-159 moscas de la fruta 281. Véase electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) 259–260. 304–319. cultivos 310-311 roundup 314 T tasas de aplicación 303. 314–316. Véase Polimorfismo de conformación de cadena única sustancias químicas 156-158 349 . 284 neotropical 145 Véase también identificación visión general 29. 145. 147 termitas que se alimentan de madera 111 termitas que se alimentan del suelo 110 TGGE. 328.249–252. 41. 155158 técnicas específicas de DNA 197. 253-255.279–280 técnicas de lavado para partículas del suelo 252. medición del estatus de los cultivos 318-319 resguardo de especímenes 192-193.R reactivo de Melzer 230-231 reglas de decisión para la clasificación de usos del suelo 323 rendimiento. 100–113. 329 sitios de muestreo 60-63.187 trampas McPhail 282 BFNFNL 190 pitfall 118-125. 91. 82. 317 taxonomía BFNFNL 177–182 HMA 219-222. 93-95. 126. 300–302. 335–336 sistemas de cultivo 42. 227 tipos de anidación 112-113 trampa de especies múltiples 185. 263 técnicas de preservación 267 técnicas de preservación 93-94. 297–299 rizosfera 249 rotación. 251 Ricinius communis 254–255 riqueza de especies 265–267. 285 respuestas multivariadas de interés 63-64 RFLP ver polimorfismo de longitud de fragmentos de restricción rhizobia 177-183 Rhizoctonia spp. 263 tinción de raíces 224–226. 188189 técnicas de cebo 119. 334. 124. 163 sistema de clasificación de cobertura de suelo (LCCS) 299 sistemas de barbecho 309–310. 256–265 termitas 40. 123. 130-132. 103.

303 BFNFNL 186 cartografía 81 definición de clases 321–324 descripción y clasificación 297–336 diversidad 42. 83. 331–333 ventanas para muestreo 60. 70–72. 320–322 vegetación semi-permanente 331 vegetación. 87 variabilidad intragrupo 51 vegetación leñosa 319. efectos de mitigación 301.trampas sin cebo 118 transecto de entrenamiento 102 transformación de datos 126. 159-160 transformadores procariotas 38 T-RFLP. 48 W WOCAT World Overview of Conservation Approaches and Technologies 318 Z Zygomycota 248 350 Manual de biología de suelos tropicales .7981. Véase polimorfismo de longitud de fragmentos de restricción terminal trituradores 260 V valores cp 171-174 variabilidad 70-72 variabilidad de datos 44. 298. 61–62. 58 hongos 243 inventarios 87-88 muestreo 65-67. 132 U uso de suelo a priori definición de clases descriptivas 65. 64. 83-84 Véase también intensidad de uso de suelo área de uso de suelo 46. 300.

Muestreo y caracterización de la biodiversidad bajo suelo . P.com. Badillo. 20 de Noviembre No 649. Col. S. Bignell se terminó de imprimir durante el mes de mayo de 2012 en los talleres gráficos PROAGRAF. Jeroen Huising y David E. editado por Fátima M.A.mx Se tiraron 1. Av. México. C. S.Manual de biología de suelos tropicales. Tel/FAX (228) 890 6204/815 1876 www. Xalapa. de C. Veracruz.proagraf. Moreira. 91190. E.000 ejemplares .V.