Manual de biología
de suelos tropicales

Esta publicación presenta parte de los resultados del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity”, implementado en siete países tropicales: México, Brasil, Costa de Marfil, Kenia, Uganda, India e Indonesia. El proyecto es coordinado por el Tropical Soil Biology and Fertility Institute del CIAT (TSBF-CIAT) con co-financiamiento del Global Environment Facility (GEF), y con apoyo para su implementación del Programa de Naciones Unidas para el Medio Ambiente (PNUMA-UNEP). Las opiniones expresadas en esta publicación pertenecen a los autores del libro y no necesariamente concuerdan con las de PNUMA-UNEP o GEF. La traducción y publicación de este libro en español fue posible gracias al apoyo financiero del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity” y al Instituto Nacional de Ecología (INE). También queremos agradecer todas las facilidades proporcionadas por Tiberious Brian Etyang del Tropical Soil Biology and Fertility Research Area of CIAT (TSBFCIAT) Nairobi, Kenia, a Teotonio Soares de Carvalho de la Universidade Federal de Lavras, Brazil, al Dr. José Antonio García Pérez por sus valiosos consejos y sugerencias, y a Caridad González Lerma por cuidar los últimos detalles.

Manual de biología de suelos tropicales
Muestreo y caracterización de la biodiversidad bajo suelo
Fátima M. S. Moreira, E. Jeroen Huising y David E. Bignell (editores )

Secretaría de Medio Ambiente y Recursos Naturales (S emarnat) Instituto Nacional de Ecología (INE)

Título original de la obra: A Handbook of Tropical Soil Biology Sampling and Characterization of Below-Ground Biodiversity © Earthscan en el Reino Unido y Estados Unidos en 2008 Hardcover ISBN: 978-1-84407-621-5 Paperback ISBN: 978-1-84407-593-5

Revisión de capítulos por especialistas en el tema: Dra. Isabelle Barois Boullard, Instituto de Ecología, A.C. Dra. Simoneta Negrete Yankelevich, Instituto de Ecología, A.C. Dra. Rocío Vega Frutis , Instituto de Ecología, A.C. M.C. José Antonio Gómez Anaya , Instituto de Ecología, A.C. M.C. Francisco Franco Navarro, Colegio de Posgraduados Dra. Esperanza Martínez-Romero, Centro de Ciencias Genómicas, UNAM Dra. Lucia Varela Fregoso, Hongos y Derivados, S.A. de C.V. Dr. Juan Rull Gabayet, Instituto de Ecología A.C. Dra. Dora Trejo Aguilar, Universidad Veracruzana

Primera edición: 2012
D.R. © Instituto Nacional de Ecología

Periférico Sur 5000. Col. Insurgentes Cuicuilco, Deleg. Coyoacán, 04530, México, D.F. www.ine.gob.mx

Coordinación General de la Publicación en Español: Isabelle Barois Boullard Coordinación editorial y formación: Raúl Marcó del Pont Lalli Corrección de estilo: Adriana Victoria Arcos Méndez Revisión y preparación de originales: Martín De Los Santos Bailón Colaboradora en la traducción al español: Judy Shirley Adaptación del texto: Mariluz Pérez Lorenzo Diseño portada: Álvaro Figueroa Foto de la portada: Claudio Contreras Edición para internet: Susana Escobar Maravillas Forma sugerida de citar el libro: Moreira, F., E. J. Huising y D. E. Bignell. 2012. Manual de biología de suelos tropicales. Muestreo y caracterización de la biodiversidad bajo suelo. Instituto Nacional de Ecología, México, 337 pp., México.
Ninguna parte de esta publicación, incluyendo el diseño de la portada, puede ser reproducida, traducida, almacenada o transmitida de forma alguna ni por ningún medio, ya sea electrónico, químico, mecánico, óptico, de grabación o de fotocopia sin permiso previo de los editores. Pequeños párrafos, tablas o figuras, pueden reproducirse dentro de lo estipulado en la Ley Federal de Derecho de Autor y el Convenio de Berna, o previa autorización por escrito de la editorial. ISBN: 978-607-7908-31-9 Impreso y hecho en México

Índice

1 2 3 4

Listado de tablas Listado de figuras Prólogo a la edición en español Prólogo Prefacio Lista de acrónimos y abreviaturas El inventario de la biodiversidad biológica del suelo: conceptos y guía general Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo Macrofauna Collembola, acari y otra mesofauna del suelo: el método Berlese

9 10 13 17 21 25 29 53 91 149

5 6 7 8 9 Nematodos del suelo Bacterias formadoras de nódulos en leguminosas Hongos micorrizógenos arbusculares (HMA) Hongos del suelo saprófitos y patógenos de plantas Muestreo. preservación e identificación de moscas de la fruta 163 177 217 243 281 287 10 Hongos y nematodos entomopatógenos 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo Colaboradores Índice analítico 297 339 343 .

labranza y deshierbe Clasificadores y atributos para el manejo de plagas y enfermedades.5 11.1 3. Especie de bacterias formadoras de nódulos en leguminosas Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes.8 11. fertilizantes y cosecha Características de la parcela y distribución del uso de suelo Características de los árboles en la finca (TROF) Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca Ejemplo de clasificadores y valores de atributos para parcelas de maíz 26 33 44 72 103 122 154 167 168 169 174 210 253 295 297 298 298 299 303 307 310 312 315 318 319 . a través de una gradiente de perturbación de la selva. unidades de referencia.1 11.6a 11.2 4.1 11.1 5.10 11. biota del suelo y principales grupos funcionales a los que pertenecen Principales grupos funcionales de la biota del suelo Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo.9 11.4 11. procesos asociados de cambio y componentes relevantes de la biodiversidad Grupos de organismos del suelo colectados utilizando diferentes métodos de captura Ejemplo de lista de especies Densidad numérica (individuos m-2) de termitas en siete localidades.6b 11.Listado de tablas 1.1 1. en la provincia de Jambi del centro de Sumatra Composición química para aclarar y montar especímenes Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina Familias y valores cp utilizados para el índice de madurez Familias y valores cp utilizados para el índice fitoparasítico Filum/Orden. amplificados del DNA total Clasificadores y atributos técnicos para el cultivo principal Tamaño del campo y características de la cobertura del cultivo Atributos de cultivos combiandos Características del suministro de agua Factor tiempo de cultivo Clasificadores y atributos relacionados con la limpieza de la parcela.2 5.3 6.2 11.1 8.3 2. Familia.3 11.1 5.1 3.1 7. Género.11 Número de especies descritas en las principales categorías taxonómicas de plantas.7 11.2 1.

utilizando permutaciones de datos al azar. utilizando un transecto de 50 m. 59 Esquema de muestreo por puntos para toda la biota. El muestreo se puede ampliar si se usa uno o dos transectos para termitas.7 4. hecha con un vaso. cuatro palitos pequeños y una cubierta de celofán. 116 Sacabocados de metal.3 2. 81 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). clasificados de acuerdo con dominios y reinos. 54 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. dispuestas a lo largo del gradiente. por estratificación. 94 Extracción de termitas de una muestra de suelo en una charola de aluminio.4 3. esto aumentará la precisión de la estimación de la pendiente. estudiados en el proyecto CSM-BGBD. d) reconociendo los límites como otra categoría.6 3. 71 Ejemplos de diferentes configuraciones de ventanas de muestreo.6 3.Listado de figuras 1. 99 Ejemplo de curva de acumulación de especies con una desviación estándar. hormigas y escarabajos. b) si se incluyen de manera deliberada valores de MOS más extremos. arañas y otros artrópodos.2 2.2 3. utilizando una pequeña cuchara o cuchillo de campo.1 3.1 2. b) tres cuadrículas que muestrean tres diferentes parches de selva. hormigas. tamaños y procesos de ecosistemas relacionados. según se requiera. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra. 70 Esquema alternativo para muestrear macrofauna. para muestrear la mesofauna en la hojarasca y en el suelo mineral. 115 Trampa pitfall improvisada. a) cuadrícula completa.3 3.5 2. dando un estimado pobre de la pendiente.1 1. 32 Principales grupos funcionales. c) incrementando la replicación. con puntos de muestreo adicionales.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas.5 3. b) ilustración de la división de una cuadrícula entre seis.2 2. 77 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. 35 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. 91 Esquema de alineación de monolitos complementarios de lombrices de tierra. b) se utilizan guantes como precaución contra enredaderas. 148 . probablemente arrojará la mayoría de los valores de MOS cercanos a la media. 93 Separación a mano de lombrices de tierra en charolas de plástico. 109 Esquema de una trampa pitfall con cebo.4 2. tres y dos ventanas. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado.

Las cajas Petri no deben contener más de una tercera parte de líquido. 189 7. hecho de aluminio.3 Embudos Berlese llenos de suelo y hojarasca.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos.1 A la izquierda. d) emergencia de juveniles infectivos en la trampa White. b) inoculación de la suspensión (alícuota de 0. 166 6. 162 5. d) almacenaje de conidios en tubos Eppendorf.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos.4 Embudo Berlese modificado. de 50cm de altura. 151 4.3 Producción de acetileno en campo o laboratorio. 282 10. c) incubación bajo condiciones controladas en una cámara DBO. con embudo superior de 40 cm de diámetro. 165 5. 187 6.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) disolución seriada de la suspensión acuosa que contiene al hongo. 163 5. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). bajo condiciones de congelación.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos 165 5. 152 5. 151 4.5 Equipo básico requerido para extracciones núcleo por núcleo Berlese-Tullgren.1 ml) en una caja Petri con medio de cultivo. creciendo en medio ADP.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. 163 5.2 a) contenedor de apoyo para embudos Berlese–Tullgren. b) muerte de nematodos en agua caliente. La rejilla que contiene a los tubos se sumerge en un recipiente con agua.3 a) Nematodos recuperados mediante el lavado de malla de 400.4. 149 4. c) larvas que muestran la patología típica de infección por nematodos. 216 10.2 Cultivos purificados de Beauveria bassiana. 180 6. juego de tamices de metal (de malla de 45 arriba y de 400 abajo).6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. resumida en seis pasos.1 Evaluación de bacterias formadoras de nódulos en leguminosas. 166 5. fijadoras de nitrógeno en diversos sistemas de uso de suelo. 282 10.7 Charola con montajes permanentes de especímenes de nematodos. b) sistema Berlese– Tullgren en operación. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. 184 6. suspensión de suelo en reposo. 284 . y a la derecha.

Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. 11.11.3 Clasificación del uso del suelo en términos de la intensidad de uso.2. 11. 322 324 325 .1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. y presencia o ausencia del componente arbóreo.

la fijación de nitrógeno. el ciclaje de nutrientes. Como lo afirmó el Dr. “¡Se sabe más de las estrellas que de los organismos del suelo!”. José Sarukhán.Prólogo a la edición en español Este prólogo es el segundo elaborado para esta misma obra y se presenta para su versión en español. colémbolos y nematodos. termitas. 13 . N2O. que pueden incorporar y asimilar estos conocimientos en beneficio de la biodiversidad del suelo. pero ahora sabemos que interviene y participa ampliamente en los servicios ambientales que brinda el suelo: por una parte. Cabe mencionar que un tipo de organismo puede participar en varios grupos funcionales. por la importancia que reviste su divulgación en un idioma que puede ser leído por un amplio grupo de países de América Latina. Por otra parte. la regulación de la dinámica de la materia orgánica del suelo. es decir. la sostenibilidad y el desarrollo de sus comunidades rurales. hormigas. las bacterias. la captura de carbono y la reducción de emisiones de gases traza (CO2. escarabajos y pequeños mamíferos. CH4) son realizados principalmente por el grupo funcional de los ingenieros químicos del ecosistema. La biodiversidad del suelo alberga más del 25 % de la que existe en todo el planeta y. la elaboración de la estructura del suelo y el mantenimiento del régimen hídrico la desarrollan los ingenieros del ecosistema. El conocimiento de esta biodiversidad se ha dejado de lado durante mucho tiempo por la dificultad para abordarla. en términos generales. fundador de la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad de México. hongos y protozoarios y los reguladores biológicos como los ácaros. es la que menos se conoce. que son las lombrices de tierra.

las condiciones de la biota del suelo continúan alterándose aceleradamente en todo el mundo debido a las actividades humanas. el equilibrio y la funcionalidad de los suelos modificados por las prácticas agrícolas. silvícolas y ganaderas en el mundo. Y si bien se ha avanzado mucho al respecto. y se dejó de lado el estudio de la biología del suelo y. que se encuentran entre los más afectados por la deforestación y el 14 Manual de biología de suelos tropicales . En este sentido. tanto del punto de vista morfométrico como molecular para lograrlo. son grandes pero se desconocen en buena medida los mecanismos y procesos que se afectan. Durante años los estudios del suelo fueron enfocados al conocimiento de la física y química del suelo. sobre el verdadero impacto que están teniendo las prácticas de manejo. así como preservar y restaurar la fertilidad natural de los suelos. el uso de fertilizantes. se reconoce la necesidad de estimular la formación de profesionales en taxonomía y sistemática de la biodiversidad del suelo. actualizada y rápida. fibra y combustible. su biodiversidad. Y aunque es difícil cuantificar el valor económico de estos servicios. particularmente en los ecosistemas tropicales. se requieren muchos años más de investigación taxonómica y funcional para comprender y manejar los procesos edáficos. permite el control de plagas y fomenta la producción de las plantas y de los animales. pues permitirán diseñar y establecer estrategias para mantener la sustentabilidad. La pérdida de la fertilidad. que se estiman en miles de millones de euros anuales.De manera global. entendidas ahora bajo el concepto de calentamiento global. con repercusiones a nivel global. pero su impacto y repercusiones sobre los procesos de funcionamiento. esta biodiversidad le da estabilidad al paisaje. reduciendo la materia orgánica contenida y alterando gravemente sus redes biológicas y funcionales. lo que visto desde el punto de vista antropogénico. son fundamentales. contribuye a nuestro alimento. Ante este panorama. combinada con las necesidades alimenticias de una población humana en continuo crecimiento. generan y provocan el avance de la frontera agrícola y la intensificación productiva. pesticidas y técnicas mecánicas de cultivo modifican fuertemente las condiciones originales del suelo. que han sido desarrolladas y probadas en siete países y tres continentes. conservación y equilibrio del ecosistema. Este manual reúne técnicas de muestreo en campo. más aun. Mientras leemos estas líneas. las técnicas de muestreo y estudio de la materia orgánica y los organismos del suelo que permitan obtener información veraz. conocer y aprender a manejar dicha biodiversidad resulta fundamental para conservar o restaurar la fertilidad del suelo. particularmente en las regiones tropicales.

BGBD. generando información útil no sólo para investigadores o especialistas sino para toda persona interesada en el estudio de la conservación y la productividad del suelo. La información de este manual se ha organizado de acuerdo con la funcionalidad de los grupos del suelo. para que su alcance e impacto sea más amplio. por sus siglas en inglés) . permitiendo llevar a cabo evaluaciones sobre la diversidad y salud del ecosistema que sirvan como base para el diseño de prácticas de manejo sustentables. portugués y español.C. Con esta versión en español. incluso en plantaciones agrícolas con manejo de bajo insumos. Esto es así porque. mientras que al final se encuentra un capítulo integrador que permite relacionar los inventarios de los organismos del suelo con una clasificación del uso de suelo para estimar el impacto del manejo del suelo sobre su biodiversidad. La información contenida en este manual es útil para investigadores. sino constituir un apoyo en el camino hacia la sustentabilidad y la relación armónica entre el hombre y la naturaleza. ahora este manual se encuentra disponible en tres idiomas. las consecuencias de un mal manejo de suelos pueden provocar consecuencias dramáticas. Estas técnicas de muestreo básicas han demostrado ser poderosas herramientas para llevar a cabo investigación básica y aplicada. financiado por el GEF. Cabe mencionar que la mayoría de los autores que colaboraron para desarrollar este manual residen justamente en países tropicales. Al inicio del manual se incluyen dos capítulos que ofrecen una guía para establecer un método de muestreo representativo que permita evaluar y comparar la biodiversidad del suelo en diferentes sitios. profesores y profesionales involucrados en el manejo productivo de los suelos y también en su conservación. De manera especial queremos P rólogo a la edición en español 15 .cambio en el uso del suelo. Las técnicas y métodos de muestreo presentados en este manual no constituyen sólo una recopilación de los procedimientos originales ya conocidos. implementado por el PNUMA y ejecutado por el TSBF a nivel internacional y por el Instituto de Ecología A. mejorados y actualizados durante el desarrollo del proyecto Conservación y manejo sostenible de la biodiversidad debajo del suelo (CMS. estudiantes. Fondo para el medio ambiente. Agradecemos a todos los especialistas que revisaron la traducción de los textos que correspondían a su especialidad y competencia. en México. pues en este caso fueron probados. Su elaboración tiene como finalidad no sólo ser una herramienta de utilidad en el trabajo técnico. inglés. lo que demuestra la mayor presencia y formación de especialistas nacionales preocupados por sus recursos naturales.

por su trabajo editorial y su paciencia ejemplar.agradecer al Instituto Nacional de Ecología. Isabelle Barois Boullard Coordinadora de la traducción y del proyecto CSM-BGBD en México 16 Manual de biología de suelos tropicales . y en particular a Raúl Marcó del Pont y su equipo.

Dicha intensificación es necesaria para asegurar el suministro global de alimentos. Una línea de investigación surgida a partir de entonces es la de cómo evaluar y manejar diversidad bajo suelo en sistemas de agricultura que faciliten la productividad agrícola y sustentabilidad de suelo a largo plazo. tiene como consecuencia 17 . surge la gran necesidad de aplicar los conocimientos referentes al papel que desempeña la biodiversidad bajo suelo para su sustentabilidad. es el cambio de uso de suelo asociado a la intensificación agrícola. los suelos en todo el mundo enfrentan una grave crisis. Sea como fuere. se enfatizó la importancia de la diversidad bajo suelo y se exhortó a abrir nuevas líneas de investigación multidisciplinaria. la mejor muestra –y la más actual– para poder evaluar la biodiversidad del suelo en ecosistemas que están siendo rápidamente alterados como consecuencia de los cambios en el uso del suelo. Esto. sin embargo. sólo en tiempos recientes se ha planteado que los suelos contienen un componente biológicamente activo. Este manual es. la regulación biológica del suelo se verá afectada e incluso sustituida por fertilizantes y cultivos mecánicos. celebrada en el año 2006. Mediante la aprobación de la Iniciativa Internacional para la Conservación y el Uso Sustentable de la Biodiversidad del suelo en la Convención sobre Biodiversidad Biológica. Un aspecto a destacar del cambio global en las regiones tropicales. sin embargo.Prólogo Durante mucho tiempo la sociedad ha reconocido su dependencia respecto del suelo. a su vez. sin lugar a dudas. Ante esta situación. en la medida que esto ocurra.

la provisión de nutrientes en las plantas y el control de patógenos en plantas como contribuciones específicas de los organismos del suelo a la fertilidad de éste.una reducción de la biodiversidad del suelo. la capacidad de retención de agua del mismo. en bioprospección y para promover mejoras sustentables en la pro18 Manual de biología de suelos tropicales . La biodiversidad tropical ha sido subestimada y es posible que las verdaderas densidades de especies sean mayores que en otras latitudes. La relación entre la diversidad de especies y la diversidad funcional de la biota del suelo sigue siendo incierta. En última instancia. la reducción de las emisiones de gas invernadero. tanto en el laboratorio como en el campo. desde luego. un número mayor de diferentes tipos de microorganismos. cubre casi la totalidad de la gama de biodiversidad biológica. las relaciones entre la biodiversidad del suelo y la ocurrencia y magnitud de los procesos ecológicos son inciertas. desde los invertebrados más grandes hasta las bacterias. El objeto explícito en este caso es práctico: proveer de una herramienta definitiva para establecer una línea de base y luego documentar la pérdida de biodiversidad de suelo. Durante mucho tiempo los ecologistas han debatido sobre la importancia de la diversidad biótica del suelo: el secuestro de carbono en suelos. además. estas herramientas pueden ser utilizadas para aprovechar los organismos del suelo en el manejo de los ecosistemas. en los trópicos. no solamente en regiones en vías de desarrollo. sino también en países de primer mundo. Del mismo modo. vitales para poder alcanzar la meta: productividad agrícola sustentable. pero constituye uno de los principales objetos de investigación en todos los niveles. asociada a la deforestación y al proceso de Intensificación agrícola en los márgenes de los bosques. manejar la biodiversidad del suelo para poder incrementar la productividad agrícola en regiones que están siendo degradadas? La respuesta a esta pregunta atañe a toda la humanidad porque la tierra está siendo degradada. quizás. Un metro cuadrado de bosque templado puede contener hasta mil especies de invertebrados y. problema cuya solución implica un gran reto: ¿es posible. el mantenimiento de la estructura física del suelo. por lo que representa el resultado publicado de más de una década de intensa discusión y un amplio trabajo de campo por parte de un gran número de expertos investigadores de muchos países. Dichos conocimientos son. únicamente. entonces. El propósito de este manual es proveer de métodos estándares internacionales para el inventario de comunidades bajo suelo y la caracterización del uso de suelo en el trópico húmedo. así como la conservación de la biodiversidad en todo el mundo y no.

sin embargo. representan a instituciones académicas y gubernamentales en las que se requiere poner en práctica nuevas políticas para el manejo del suelo que han de ser validadas. porque la verdadera biodiversidad es tan amplia que queda fuera del marco de cualquier sistema científico para que se pueda documentar totalmente. esto implica la reconciliación de los intereses y preocupaciones de los agricultores pobres. los autores han incluido la revolución en metodología molecular que ha incursionado en las ciencias biológicas durante los últimos diez años. sino también para biólogos en general. Tal selección es inevitable cuando se trata del suelo. el presente manual contiene notables diferencias respecto de los anteriores. si es que aún estamos a tiempo de parar la pérdida de la biodiversidad tropical. En la medida de lo posible esto aplica a la identificación: las claves recomendadas son los más funcionales. considerado importante o esencial en la función del suelo y. Muchas de las técnicas asociadas con una evaluación de diversidad dentro de grupos específicos microbianos han surgido a partir de P rólogo 19 . se aconseja referir los especímenes a especialistas. tanto nacionales como extranjeros.ducción agrícola. Finalmente. por lo tanto. no obstante. son de interés no sólo para expertos en taxonomía. Inevitablemente. distribuidos en siete países y tres continentes. los objetivos nacionales de desarrollo y calidad de nuestro ambiente. Otro aspecto notable de este manual es que la biota del suelo está agrupada en ocho categorías. consecuentemente. también donde es necesario. especialistas en agricultura y empleados técnicos de todos los niveles. en doce localidades como puntos de referencia. por lo que algunos taxa han sido excluidos. pero que también corresponde a un grupo funcional mayor. manuales metodológicos de muestreo para organismos del suelo. El proceso responde a una necesidad selectiva. cada una con amplia identidad taxonómica. no obstante. a muchos servicios ambientales que los suelos proveen. Durante los últimos cincuenta años se han publicado. con cierta frecuencia. En segundo lugar. dentro del alcance de la población que se encuentra relacionada con su productividad. los métodos han sido desarrollados y monitoreados en condiciones de campo. Una de las más importantes es que la mayoría de los colaboradores pertenece a los países que se encuentran más afectados por la deforestación y el cambio en el uso de suelo. especialmente en el caso de los pueblos más pobres del mundo. ofrece la ventaja de traer consigo los medios para poder hacer una evaluación aproximada de la salud del suelo. los métodos presentados en este manual contemplan también los ecosistemas terrestres en general.

Diana H. Wall Natural Resource Ecology Laboratory Colorado State University Mayo de 2008 20 Manual de biología de suelos tropicales .discusiones entre colaboradores y durante talleres específicamente pensados para la publicación del presente manual.

y. para mantener la productividad agrícola y reducir la extensión de la agricultura en paisajes naturales. al PNUD/ 21 . asimismo. al (TIGER). Uganda. El proyecto se lleva a cabo en México. Este proyecto es ejecutado por el Instituto de Biología y Fertilidad del Suelo Tropical (TSBF). constituye una actualización de los métodos y protocolos que fueron inicialmente propuestos por investigadores afiliados al Instituto de Biología y Fertilidad del Suelo Tropical del CIAT. institución que pertenece al Centro Internacional de Agricultura Tropical (CIAT). Kenia.Prefacio Este manual es uno de los resultados del proyecto PNUMA/GEF “Conservación y Manejo Sostenible de Biodiversidad Bajo Suelo” (CSM-BGBD) que surge como respuesta a la necesidad de crear métodos estándares e instrucción práctica para el inventario de la biodiversidad bajo suelo. y para su puesta en marcha. sobre todo. del Programa de Naciones para el Medio Ambiente (PNUMA/UNEP). al NERC por el Reino Unido (UK). que permitan la comparación de resultados de inventario en áreas específicas de países tropicales con validez científica y estadística. El proyecto se inició en 2002 con el objeto de generar información y conocimientos que puedan ser utilizados para un mejor manejo y conservación de la BGBD en espacios de agricultura tropical. recibe apoyo para su financiamiento del Fondo Global del Medio Ambiente (GEF por sus siglas en inglés). Costa de Marfil. India e Indonesia. El manual describe métodos de muestreo y laboratorio para evaluar la biodiversidad de una gama de grupos funcionales básicos de biota de suelo. Brasil. a la Red de Macrofauna financiada por la Unión Europea (EU).

al igual que métodos que no han sido considerados en las publicaciones mencionadas.dentro del trópico húmedo. Nairobi. en términos de grupos funcionales. Londrina. elaborado por Anderson e Ingram (1993). Bangalore. dentro del alcance de laboratorios nacionales. editado por Swift y Bignell (2001). y en varios talleres llevados a cabo desde el inicio del proyecto. en donde también se habla del principio de grupos funcionales del inventario de organismos de suelo. en el de 2004 (Embu. termitas y hormigas. en su caso. además. También cubre. Los métodos estándares propuestos contienen avances tecnológicos recientes en genética molecular. una evaluación de la diversidad de especies resulta un proceso poco práctico. hongos entomopatógenos. Hall. bacterias formadoras de nódulos en leguminosas (BFNFNL) y sus plantas hospederas. Un manual formal de técnicas para organismos de suelo y organismos que viven en agua dulce y sedimentos marinos fue publicado en 1996. 2003 (Sumberjaya. Kenia). al igual que en varios talleres temáticos de taxonomía específica (técnicas moleculares con énfasis en T-RFLP. lombrices de tierra. Ésta fue la contribución. India 2005. Dado que muchas especies aún son desconocidas o no se han descrito. Los métodos para una evaluación de biodiversidad de suelo fueron descritos en el ASB (Nota de Lectura 6B). La definición de métodos estándares aprovecha la experiencia obtenida con la implementación de los métodos utilizados en los siete países participantes en el proyecto. cuya evolución se muestra en los reportes de 2002 (Wageningen. Una 22 Manual de biología de suelos tropicales . agosto 2004. ampliamente. Manaus. editado por G. Los métodos fueron discutidos y posteriormente perfeccionados en reuniones anuales celebradas entre los años 2002 y 2005. HMA y Ectomycorrhiza. por parte de la UNESCO. Brasil mayo/2004 y Nairobi. Kenia. Brasil. saprófitos y patógenos y una amplia gama de artrópodos mayores. Colombia. Países Bajos). provee detalles adicionales en el caso de grupos funcionales específicos: como el uso de trampas Winkler para hormigas y trampas Pitfalls para escarabajos en muestras de hojarasca. S. octubre 2003). la gama completa -geográfica y biogeográfica. o la actualización de métodos para evaluar la diversidad de nematodos. Cali. en especial. diciembre 2004. como es el caso de aquéllos que se refieren a la mesofauna. al programa DIVERSITAS. febrero 2005. tales como el registro de huellas genéticas del BFNFNL. Los métodos que se describen en este manual reflejan una amplia gama de actividades del proyecto CSM-BGBD.UNDP-GEF con el apoyo financiero destinado al Proyecto Alternativas de RozaTumba-Quema (ASB). Los métodos para algunos de los grupos funcionales de organismos de suelo fueron incluidos en un manual pionero. Indonesia) y. termitas.

La mayoría de los organismos del suelo se encuentran en los primeros 20 centímetros de su perfil. por lo tanto. poco se sabe de las relaciones entre ambos factores o sobre los mecanismos por los cuales ocurren cambios en la BGBD. generalmente. de manera que causará un impacto inmediato en la BGBD que fácilmente se antepondrá al efecto combinado de todos los factores mencionados. así se podrían entender las consecuencias de una pérdida en el BGBD y. así. llega a influir sobre la abundancia y diversidad de dichos organismos. nivel de nutrientes y densidad). como consecuencia del labrado o del creciente uso directo de agroquímicos. Para responder a algunas de las preguntas mencionadas se requiere: P refacio 23 . no necesariamente se lograría restaurar la BGBD. la erosión del suelo significa la más catastrófica de las alteraciones. dejándolo como estaba antes de ser alterado. que se espera. La hipótesis actual es que una intensificación en el uso de suelo trae consigo una reducción de la biodiversidad del suelo y a su vez. provoca una pérdida de servicios del ecosistema. frecuentemente provocan una reducción de materia orgánica del suelo que forma el sustrato básico para la mayoría de los organismos que en él habitan y. Además. por lo tanto. Quedan muchas interrogantes en cuanto al manejo de BGBD. la erosión puede llegar a nulificar todos los demás procesos degenerativos. hay otros asociados con un incremento en la intensidad del uso de suelo. Aun si se pudiera regresar a sus condiciones originales. interpretar esos procesos en el contexto ecológico. estos cambios de uso de suelo. en contra de una productividad sustentable. La conversión de uso de suelo y la intensificación de su uso. La premisa es que la diversificación agrícola (en varios niveles) genera biodiversidad en el suelo y que la producción agrícola sustentable (en los márgenes de la selva tropical) se mejora significativamente.mejor opción sería investigar la pérdida de grupos funcionales básicos dentro de la BGBD que muestran un cambio en el uso de suelo o una intensidad del mismo. Es por esto que el control de la erosión y la rehabilitación de suelos fuertemente erosionados deberá considerarse parte de las estrategias para conservar y sustentar un buen manejo de la BGBD. sin embargo. Al mismo tiempo. Además de estos efectos. van acompañadas por reducciones drásticas en la diversidad de plantas. esto se traduce en una alteración del suelo como hábitat. Los efectos en BGBD son condiciones compuestas por el medio ambiente y por características físicas y químicas del suelo (por ejemplo: pH. tenga implicaciones en la BGBD. restablecer la BGBD no implica precisamente devolver los servicios del ecosistema.

Wallingford. Indonesia.fao. D. desde una parcela (agrícola. (ed) (1996) Methods for the Examination of Organismal Diversity in Soils and Sediments.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. mediante la introducción y/o manejo de biota de suelo (se experimenta con varios manejos alternativos). E. South East Asian Regional Research Programme.• Una caracterización de la biodiversidad del suelo en un amplio rango de uso de suelo de varias intensidades. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. Swift. y observar cómo esta relación se modifica y se altera por las condiciones prevalecientes en el medio ambiente (incluyendo condiciones de suelo). e Ingram. G. y Bignell. • Establecer una relación entre la biodiversidad de la superficie y bajo del suelo en los actuales y alternativos sistemas de uso de suelo. 24 Manual de biología de suelos tropicales . S. ASB Lecture Note 6B. M. CAB International. un conocimiento más amplio de prácticas existentes y un uso más efectivo de tecnologías disponibles que no requieran altos insumos. caracterizada por un cultivo continuo y un elevado uso de químicos y mecanización. Fátima M. S. Bignell ReFERENCIAS Anderson. • Identificar “puntos de entrada” para mejorar el manejo de la tierra. 2nd edition. M. J. Moreira. E. experimental o de muestreo) hasta un paisaje natural. CAB International. J. www. S. Bogor. Hall. Jeroen Huising y David. Se espera que los métodos descritos en este manual sean útiles para el diseño y la ejecución de estudios para inventario y monitoreo de la BGBD en todos los niveles. I.pdf. Wallingford. desde bosque natural hasta agricultura de monocultivo. International Centre for Research in Agroforestry. Estos “puntos de entrada” pueden incluir un mejor entendimiento del uso de prácticas indígenas. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods.

Lista de acrónimos y abreviaturas AC ADP AFLP AHM AM ANOVA ARISA B BFNFNL cPCR CSM-BGBD BGBD DGGE ea EBI ERA FID FURB GEF Análisis de correspondencia Agar dextrosa y papa Polimorfismo en el tamaño de fragmentos amplificados Agar con harina de maíz Agar extracto de malta Análisis de varianza Análisis automatizado del espaciador intergénico ribosomal Bacteriófagos Bacterias fijadoras de nitrógeno. formadoras de nódulos en leguminosas Reacción en cadena de la polimerasa competitiva Conservación y Manejo Sustentable de Biodiversidad Bajo Suelo Biodiversidad Bajo Suelo Electroforesis en gel con gradiente de desnaturalización Equivalente de ácido European Bioinformatics Institute Ensayo de reducción de acetileno Detector de ionización de flama Universidade Regional de Blumenau Global Environment Facililty 25 .

GF HMA ia ICRAF IFP IM INPA ITS KOH LCCS M MAS MOS NCBI Nd NMP P Pc PCA PCR PFGE PNUMA PP RAPD Rep-PCR RFLP RIA SR SSCP TGGE TRF T-RFLP TROF TSBF-CIAT 26 Grupo funcional Hongos micorrizógenos arbusculares Ingrediente activo World Agroforestry Centre Índice fitoparasítico Índice de madurez National Institute for Amazonian Research (Instituto Nacional de Pesquisas da Amazônia) Espaciadores de trascripción interna Hidróxido de potasio Sistema de clasificación de cobertura de suelo Micófagos Muestreo aleatorio simple Materia orgánica del suelo National Center for Biotechnology Information Nivel de dilución Número más probable Perturbación Porcentaje de colonización Análisis de componentes principales Reacción en cadena de la polímerasa Electrofóresis en campos pulsados Programa de las Naciones Unidas para el Medio Ambiente Parásitos de plantas DNA polimórfico amplificado al azar De fragmentos repetidos palindrómicos-éxtragenicos Polimorfismo de longitud de fragmentos de restricción Resistencia intrínseca a los antibióticos Sensores remotos (imagen) Polimorfismo de conformación de cadena sencilla Electroforesis en gel con gradiente de temperatura Fragmentos de restricción terminal Polimorfismo terminal de la longitud del fragmento de la restricción Árboles en finca Tropical Soil Biology and Fertility Institute of the International- Manual de biología de suelos tropicales .

UC UFAM UFC UFLA UFMG UnB VA VB Center for Tropical Agriculture Unidad de colonización Universidad Federal de Amazonas Unidades formadoras de colonias Universidad Federal de Lavras Universidad Federal de Minas Gerais Universidad de Brasilia Volumen alto Volumen bajo A crónimos y abreviaturas 27 .

.

contri29 . 1996. 2005. Bardgett. Bignell. 1990) y muchos fila. Moreira et al.1 se enlistan los principales fila de organismos eucariontes y procariontes que son o pueden ser representativos en la comunidad del suelo. Fátima M. 1979. 1998.. Jeroen Huising Organismos y servicios del ecosistema del suelo El suelo es un hábitat que alberga una amplia gama de organismos dentro de los tres dominios taxonómicos (sensu Woese et al. Moreira y E.. 2004). Brussaard et al.000 en el caso de procariontes. Wall. 1997. con más de 1.Capítulo 1 El inventario de la biodiversidad biológica del suelo: conceptos y guía general Mike J. David E.Estos procesos apoyan a los servicios del ecosistema. S. Swift.. Wall. 2004. 1998. Cavalier-Smith. Lavelle. La clasificación taxonómica de organismos vivos aún se encuentra en una situación polémica (Margulis y Schwartz. especialmente cuando se trata de los taxa a ser creados en altos niveles y los números de tales categorías altas (como reinos) a ser consideradas. la diversidad de la biota del suelo es elevada en todos los niveles de análisis (véase Swift et al. 2006). Ya que no es ni práctico ni coherente tomar en cuenta todos los organismos presentes. cuando se hace una evaluación biológica de la salud de los suelos (Lawton et al.2004).5 millones de especies de eucariontes y con una riqueza de especies estimada muy por encima de 10. 1997... cualquiera que sea el sistema de clasificación utilizado. 1998). la biota (relativa a agentes no bióticos y entre ellos mismos) será evaluada por su contribución relativa a los procesos del ecosistema (sensu Daily. Sin embargo. En la Tabla 1.

000 Filum Crustacead [>6 clases] 25.000 >10 millones Reino Animalia [37 fila] 750 Filum Tardigradad (osos de agua) d 99. 4 4 común localmente 5 - 30 Manual de biología de suelos tropicales .800 y Enchytraeidae) Clase Hirudinea (sanguijuelas) 500 45.000 cochinillas) Filum Mandibulata (Artropoda) Grupo funcionalb 1 1 1 1 1 1 1 1 1 2.000 Clase Gastropodad (incluye babosas y caracoles) 18.1 Número de especies descritas en las principales categorías taxonómicas de plantas.000 Monocotiledoneas 65.000 hepáticas) Filum Filicinophyta (helechos) 12.000 Filum Cycadophyta (gimnospermas) 185 Filum Coniferophyta (gimnospermas) 550 Filum Gnetophyta 70 Filum Anthophyta (angiospermas) 235.4 2.000 Clase Malacostracad (incluye orden Decapoda con un esqueleto externo calcificado) Orden Isopoda (ácaros de la madera y >11.000 Clase Oligochaeta(lombrices de tierra 8. biota del suelo y principales grupos funcionales a los que pertenecen.000 Filum Hepatophyta (plantas 6.000 Filum Annelidad (lombrices segmentadas) Clase Polychaeta 9.4 muy raro en el suelo 3. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Dominio Eucarionte 255.000–40.000 Filum Mollusca 35.Tabla 1.000 Dicotiledoneas 130.000 Reino Plantae [12 fila] Filum Bryophyta (musgos) 10.

6 4 2. polillas. 4. 6 4. 180. 7 31 inventario de la biodiversidad biológica del suelo . 9 2. >125. 9 4. 6 2.) Orden Trichoptera 12. peri55.000 abejas.500 Clase Symphyla 200 Clase Pauropoda 700 El Grupo funcionalb 4 4. mosquitos pequeños) Orden Hymenoptera (hormigas.000 Suborden Homoptera (cigarras. 9 2. mosquitos.826 Orden Lepidoptera (mariposas. 4.000 gegenes. 23.000 Orden Coleoptera (escarabajos) >350. 9 6 2. 9 3. abejorros) Familia Formicidae (hormigas) 11. 7 2.9 Sólo en la rivera 4. 115. 9 2. 4. 4 2. 3.1 Continúa. 9 2. 9 2.000 Orden Archaeognatha (pececillos de 350 cobre ó bristetails) Orden Thysanura 700 Orden Blattoptera (cucarachas) 4.000 Orden Collembola (colémbolos) 7. afidos. pulgones. 7 4. 9 2.800 Orden Hemiptera (chinches) >80. grillos. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Subfilum Hexapoda (Insectos) >900.000 Clase Chilopoda (ciempiés) 2. 7.500 Orden Diplura (doble cola) 659 Orden Protura 500 Subfilum Myriapoda (milpiés y 15.000 etc.162 ciempiés) Clase Diplopoda (milpiés) 10. 6.Tabla 1.800 Orden Orthoptera (saltamontes. escamas) Suborden Heteroptera 25. 6.000 Orden Isoptera (termitas) 2.000 langostas) Orden Thysanoptera (trips) 6.000 quitos.000 Orden Diptera (moscas. avispas. 6 2.000 Orden Dermaptera (tijerillas) 1.

7 1 5.1 Continúa. alfilerillos) 25.Tabla 1. 9 1 32 Manual de biología de suelos tropicales .455 Orden Palpigradi (micro-escorpiones) 80 Orden Acari (ácaros. 6.235 (Pseudoescorpiones) Orden Araneae (arañas) 40.000 Order Scorpionida (escorpiones) 2000 400 Filum Gastrotrichad (gastrotricha) d 1000 Filum Acanthocephala (lombrices con cabeza espinuda) 2000 Filum Rotiferad (animales de ruedas) 900 Filum Nemertinad (gusanos planos) Filum Nematoda (nematodos. 4. 7 Muy raros en suelo 2.000 Orden Pseudoscorpionida 3. 7. 7.000 Filum Plathyheminthesd (Helmintos. 6.100 Grupo funcionalb 6 2. garrapatas) 45.7 7 1. 9 6 6 6 7 Parásitos artrópodos 4. incluidas planarias) Número sin Reino Protoctistac [30 fila] determinar Filum Rhizopoda (amibas) Número sin determinar 4000 Filum Dinomastigotad (dinoflagelados) Filum Ciliophora (ciliados) 10.6 7 1. lombrices enterobius.000 Filum Diatomacead (diátomos) Filum Oomycota (Oomycetes) Cientos Filum Rhodophyta (alga roja) 4.000 Filum Discomitochondria (flagelados 800 y zooflagelados) 10. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos critas en el taxón (todos de organismos de suelo/nombre los hábitats) común Subfilum Cheliceratad [3 clases] >100. lom15.000 Clase Arachnida [11 órdenes] 93. 9 2.000 briz redonda.

250 >30.000 >70. Clasificación.000 1.2 (de este capítulo). orden. Hongos de acuerdo con James et al. d) Incluye organismos acuáticos y del suelo. género y especies. Categorías taxonómicasa (número total de fila existentes) ejemplos de organismos de suelo/nombre común Filum Chlorophyta (alga verde) Reino Fungi [6 fila] Filum Microsporídia Filum Chytridiomycota (Hongos quitridios) Filum Zygomycota (mohos) Filum Glomeromycota (hongos micorrízicos arbusculares) Filum Basidiomycota (incluidos hongos y algunas levaduras) Filum Ascomycota (incluidas levaduras) Dominio Archaead [4 fila] Dominio Bacteriad [52 fila]e Número de especies des.342. Dichos procesos pueden ser agrupados de acuerdo a cuatro funciones agregadas del ecosistema: El inventario de la biodiversidad biológica del suelo 33 .gov. 8 5.000 >344f >8. de acuerdo con Woese et al. 10 Nota: a) Considerando las categorías taxonómicas. 1996. 8 10 1. 2006. e) Rappé y Giovannoni (2003). f) National Center for Biotechnology Information: (www. por su influencia en la calidad y salud del suelo (Hoavelle. 1997. 8. 2008). clase. c) Considerados por algunos autores como Protistas o Protozoos y Chromistas. 8 5. 9.500 1.000 1. respectivamente. la riqueza correspondiente arrojará 3090 y 79.nlm. excluyendo organismos no clasificados. Kibblewhite et al.. de acuerdo con la Tabla 1. Reinos de Eucariotas clasificadas de acuerdo con Margulis y Schwartz.1 Continúa. buyendo al mantenimiento y a la productividad de los mismos. 5. (1990).100 204 >22. Procariotas (Dominio Archaea y Bacteria). desde el más bajo hasta el más alto nivel: dominio.. cuando éstos se incluyen. Fuente: Moreira et al.. filum.Tabla 1.Grupo funcionalb critas en el taxón (todos los hábitats) 16. consultado el 13 de mayo de 2007). (2006). familia. reino.9 5 5. b) Grupos funcionales.nih.398f 1 sólo parásitos 5..ncbi. sin cultivo y no especificados. 1998. Brussard et al.

aunque en un tipo de suelo y medioambiente determinados existe un equilibrio entre el contenido del MOS y las entradas y salidas de carbono en el sistema. los cuales trituran los residuos de plantas y animales. Así. por la biota del suelo. el paso que marca la operación del proceso se determina mediante micropredadores. sin embargo. siempre que no se incluya a los ingenieros del ecosistema (véase más abajo). Microorganismos específicos del suelo también incrementan la cantidad y eficiencia de absorción de nutrientes por la vegetación. que ocurre principalmente por actividad enzimática de bacterias y hongos. Juntos. 3. El ciclo de nutrientes. lombrices de tierra y termitas. crean y modifican microhábitats para otros organismos más pequeños y determinan propiedades del suelo como aireación. Algunos grupos de bacterias del suelo están involucrados en transformaciones elementales autotróficas. estabilidad del suelo. Animales más grandes mejoran algunos procesos porque proveen nichos para un crecimiento microbiano dentro de sus intestinos o excremento. estabilidad de agregados 34 Manual de biología de suelos tropicales . principalmente como CO2 o CH4. lo que controla el resto de la biota. estrechamente asociado con la descomposición orgánica. en gran parte realizada por animales del suelo como ácaros. estos grupos son afectados indirectamente por factores como el contenido de agua. se mantienen físicamente activos dentro del suelo formando canales. Ciclo de nutrientes. hormigas y algunos otros de la macrofauna del suelo. La descomposición de materia orgánica. Bioturbación. lombrices de tierra. colémbolos y ácaros. es esencial para todo tipo de agricultura y silvicultura. y moviendo partículas de un horizonte a otro. 2. poros. porosidad y contenido de carbono. Las raíces de plantas. tales como protoctistas. aunque el atributo “transformadores de hojarasca” es el más utilizado hoy en día para describirlos. sin embargo. el carbono orgánico es liberado en la atmósfera. nematodos. y dispersan los propágulos microbianos. termitas. mediante la formación de asociaciones simbióticas como las micorrizas y la fijación de N2 en nódulos de raíces.1. los microorganismos y los animales involucrados se llaman “descomponedores”. pero también es incorporado en diferentes reservorios en forma de materia orgánica (MOS). Como resultado de la descomposición. drenaje. agregados y montículos. Aquí también los microorganismos son mediadores de la mayor parte de las transformaciones. es decir. milpiés. Estas fracciones de MOS varían en su estabilidad y longevidad. que no dependen directamente de la materia orgánica como fuente de alimento. Estos procesos de “bioturbación” influyen y determinan la estructura física del suelo y la distribución de materia orgánica del suelo.

1 muestra la contribución de la biota del suelo a servicios ambientales. en el cambio climático. La estructura y las propiedades del suelo también están influenciadas por la producción de excretas de animales. 1997). hongos y animales invertebrados capaces de invadir plantas y animales. N2O). por lo tanto. En los agroecosistemas. las actividades de plagas potenciales y patógenas son reguladas por interacciones con otros miembros de la biota del suelo. Los organismos del suelo juegan un papel importante en la regulación de la composición atmosférica y. son relativamente raros. A este conjunto de organismos. todos los organismos enlistados. como resultado de los procesos anteriores. debido a una diversidad biológica disminuida y/o en cambios ambientales del suelo.. que incluyen microbívoros y micropredadores que se alimentan de las plagas microbianas y de animales. y también una amplia variedad de interacciones antagonistas microbianas. Para poder interrelacionar El inventario de la biodiversidad biológica del suelo 35 .y capacidad de retención de agua. NOX. capacidad de almacenaje y drenaje) y tiene una fuerte influencia sobre la susceptibilidad a la erosión. tales como los causados por un contenido de MOS más bajo. 4. pero tales epidemias sí son comunes en la agricultura. La Figura 1.. Jones et al. basándose en la función particular que desempeñan o en el proceso específico del suelo del que son mediadores. pueden ser asignados dentro de una o más de las cuatro categorías funcionales genéricas descritas. y hasta humanos.. Especialmente. La biota del suelo incluye un amplio rango de virus. como miembros de la comunidad del suelo. respectivamente. se le ha denominado “ingenieros del ecosistema del suelo” (Stork y Eggleton. La bioturbación juega un importante papel en la regulación del equilibrio del agua en el suelo (infiltración. 1992. 1997). bioturbación y ciclo de nutrientes determinará el equilibrio entre la cantidad de carbono secuestrado en el suelo (véase arriba) y entre las emisiones de gases invernadero (principalmente CO2. CH4. brotes intensivos de enfermedades en el suelo y plagas. En suelos saludables. 1994. Lavelle et al. incluyendo complejos organominerales estables durante meses o periodos más largos (Lavelle et al. En ecosistemas naturales. debe hacerse notar que la interacción entre la descomposición de materia orgánica. bacterias. este rango de interacciones puede encontrarse reducido. por tanto. Grupos funcionales de la biota del suelo En principio. Enfermedades y control de plagas. y de causar enfermedades y muerte.

Ciclaje de nutrientes Transformadores de nutrientes: Descomponedores Transformadores de elementos Fijadores de nitrógeno Micorrizas Ingenieros del ecosistema: Megafauna Macrofauna Hongos Bacteria Biocontroladores: Predadores Microherbívoros Hiperparásitos Figura 1.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. Fuente: Kibblewhite et al. 2008 Servicios agrícolas Procesos de entrega basados en el suelo Alimentos y fibras Captura y ciclaje de nutrientes Descomposición de la MO adicionada Dinámica de MOS Mantenimiento de la estructura del suelo Regulación de la población biológica Manual de biología de suelos tropicales Servicios no agrícolas Calidad y suministro de agua Control de erosión Regulación de la composición atmosférica y del clima Degradación y disminución de contaminantes Control de enfermedades y plagas no agrícolas Conservación de la biodiversidad ..36 Funciones agregadas del ecosistema 1. Transformaciones C Ensamblaje funcional Descomponedores: Hongos Bacterias Microherbívoros Detrívoros Procesos de entrega basados en el suelo Mantenimiento de la estructura del suelo Ciclaje de nutrientes Mantenimiento de la estructura del suelo Dinámica de la MOS Descomposición Ciclaje de nutrientes Regulación de población biológica Provisión de hábitat Regulación de población biológica 4. Mantenimiento de estructura del suelo 2. Regulación de la población biológica 3.

construcción de estructuras agregadas y formación de poros.. ni de cuántos de estos grupos deberán definirse dentro de un ambiente de suelo típico. por ejemplo. que incluyen minadores de hojas y de tallos. ingenieros del ecosistema. Productores primarios (plantas superiores e inferiores): organismos fotosintéticos que asimilan bióxido de carbono del aire y penetran en el suelo mediante sistemas de raíces. 3. No existe acuerdo preciso en la definición de grupos funcionales. el Tabla 1. translocando compuestos orgánicos sintetizados arriba del suelo. alguna microfauna): invertebrados que se alimentan de desechos orgánicos originados por microbios y por trituradores de este material. 1. y que son los responsables de la mayor parte del flujo de energía en la red alimenticia de los descomponedores. 4. transformadores de hojarasca. Herbívoros: animales que consumen y parcialmente digieren tejidos vivientes de plantas. rizobia): microorganismos asociados con raíces que facilitan la absorción de nutrientes. morfológica. normalmente definido por criterio trófico (Brussaard. 2. 1998) pero también calificado en función de la respuesta fisiológica. Predadores (mucha macrofauna y mesofauna): animales que regulan a los herbívoros. por lo tanto. Microsimbiontes (hongos micorrícicos. Esta actividad puede ocurrir a varias escalas espaciales. y chupadores de sabia. Transformadoras de hojarasca (mucha macrofauna y mesofauna. 7.organismos específicos del suelo (biodiversidad colectiva) con las categorías genéricas funcionales y. Ingenieros del ecosistema (macrofauna como termitas y lombrices de tierra): organismos que causan un impacto físico mayor en el suelo mediante su transporte. haciéndolo más accesible para los descomponedores o favoreciendo el crecimiento microbiano de excretas en forma de gránulos. 5. de alguna manera. muchas hormigas.2 Principales grupos funcionales de la biota del suelo. Microrreguladores (microfauna como nemátodos): animales que regulan ciclos de nutrientes mediante forrajeo y otras interacciones con los microorganismos descomponedores. Pueden incluir predadores. El inventario de la biodiversidad biológica del suelo 37 . en última instancia. 6. Descomponedores (hongos o bacterias degradadores de la celulosa): microorganismos que poseen las enzimas polímero-degradadoras. también de acuerdo con sus características taxonómicas. descomponedores y microrreguladores por depredación. con los servicios del ecosistema (Setäla et al. 8. 1998) es necesario tomar en cuenta el concepto de grupos funcionales básicos. de comportamiento bioquímico o ambiental y. incluyendo el ciclaje de nutrientes.

no obstante. plagas) especies de control biológico también pueden incluirse (ej.2 y se usan para anotar las categorías taxonómicas. 9.. probablemente se relaciona con su abundancia relativa y con la biomasa. también es importante buscar dentro de los grupos funcionales para descubrir los taxa que alcancen el criterio de ser considerados como ingenieros del ecosistema (sensu Jones et al. Grupos selectivos de biota de suelo En el diseño de trabajo de campo. al mismo tiempo. Éstos son grupos taxonómicos que fueron tomados en cuenta en el proyecto Conservation and Sustainable Management of Below-Ground Biodiversity (CSM-BGBD).: depredadores. en cuanto a la fertilidad y calidad del suelo. no relacionados. 2005). a veces.1. cuyos métodos de inventario y caracterización se describen en los siguientes capítulos. Plagas y enfermedades del suelo (hongos patógenos. Véase que algunos grupos funcionales incluyen una amplia gama de taxa relacionados y. Por esta razón y porque muchos componentes de biota de suelo son taxonómicamente difíciles de identificar. no obstante. mientras que otros son muy específicos en cuanto a su taxonomía. en donde el espectro taxonómico completo ha sido objeto de un muestreo representativo en el mismo lugar y al mismo tiempo (Bignell et al. 1994) y especies clave (sensu Davic. enlistadas en la Tabla 1. S o P (nitrificación y fijación de nitrógeno). Transformadores procariontes: Archaea y bacterias que transforman de manera específica el carbono (metanotrofa) o elementos nutricionales como N.. invertebrados. Éstas están representadas formalmente en la Tabla 1. La importancia funcional de cualquier especie o de grupos de especies. 38 Manual de biología de suelos tropicales .2 Continúa. 2003). existe un argumento válido que establece por lo menos diez categorías.2). aislado e identificado (Figura 1. concepto es heurístico y puede modificarse en función del propósito analítico necesario. parasitoides e hiperparásitos de plagas y enfermedades). uno de los principales desafíos es seleccionar un subgrupo de la biota del suelo que refleje adecuadamente el espectro taxonómico anticipado y que. 10. existen pocos estudios sobre la salud del suelo agrícola. incluya todos los grupos funcionales considerados como importantes. Los grupos taxonómicos propuestos a continuación son seleccionados de acuerdo con su significado funcional diverso. (razón por la cual se emplea el término “taxa seleccionado”) y por su facilidad relativa a ser muestreado.Tabla 1.

macropredadores ANIMALES. especialmente protoctistas Archaea y Bacteria El inventario de la biodiversidad biológica del suelo 39 .MICROFAUNA Y MESOFAUNA Nematodos Ácaros Colémbolos Otros Biomasa alta II Alta diversidad y biomasa Micropredadores. transformadores procarióticos. y microfauna <0. antagonistas.1 mm. clasificados de acuerdo con dominios y reinos. promotores de crecimiento Nota: la fauna se clasifica de acuerdo con el ancho de cuerpo: macrofauna >2.0 mm. tamaños y procesos de ecosistemas ANIMALES. transformadores de hojarasca.0 mm.2 Principales grupos funcionales. parásitos de Micropredadores. patógenos.1-2. estudiados en el proyecto CSM-BGBD.transformadores de hojarasca plantas HONGOS Y BACTERIAS MUTUALISTAS Hongos micorrizógenos Bacterias formadoras de nódulos en leguminosas Omnipresentes con especificaciones típicas de variedad de hospederos (a varios grados) III Omnipresentes Microsimbiontes mejoran la absorción por la raíz y la fijación de nitrógeno Hongos saprotróficos. nematodos y protoctistas pueden considerarse como componentes de la microbiota general. patogénos y antagonistas IV Omnipresentes con diversidad alta indeterminada Descomponedores.Figura 1. trituradores de hojarasca.MACROFAUNA Lombrices de tierra I Escarabajos Otros Hormigas Termitas Diversidad y biomasa alta Diversidad alta Ingenieros del ecosistema. un grupo que incluye muchos organismos con papeles especiales y una diversidad de descomponedores genéricos MICROBIOTA GENERAL Microfauna. trituradores de hojarasca. mesofauna 0. Por su parte.

milpiés (Diplópoda) y otros tipos de larvas de insectos que actúan como transformadores de hojarasca con una importante acción trituradora sobre el tejido de plantas muertas y sus depredadores (ciempiés. protoctistas. hormigas y escarabajos que intervienen en: a) la porosidad y la textura del suelo. mediante el transporte. 2 Macrofauna: termitas. b) el ciclo de nutrientes. omnívoros y depredadores. arañas. de la mesofauna. 3 Otra macrofauna: cochinillas (Isópoda). ácaros. micófagos. también representan factores de interés y preocupación. c) el control biológico como depredadores. Algunas especies de ácaros y formas de larvas de muchos artrópodos de suelo son lo suficientemente pequeñas como para clasificarse dentro de la microfauna. al compararse con otros grupos taxonómicos superiores (Tabla 1. que intervienen en la porosidad del suelo y en sus nutrientes. en los que viven dependientes de películas de agua. y la pérdida de especies endémicas. escarabajos. la introducción de especies exóticas e invasivas. todos ellos conforman un gran número de especies. hormigas. varios de estos grupos taxonómicos son muy importantes por sí mismos como contribuidores a la diversidad biótica en general. b) ocupan espacios que existen en pequeños poros. Los grupos incluidos en la selección son: 1 Macrofauna: lombrices de tierra. 5 Microfauna: nematodos y protoctistas que. arácnidos grandes y otros tipos de insectos).Además. la distribución geográfica. la trituración y digestión de materia orgánica. por ejemplo. Enchytraeidae. En este contexto. lombrices de tierra. microfauna y microsimbiontes. bacteriófagos. también actúan como reguladores de las poblaciones de biota del suelo. Algunas especies también resultan perjudiciales porque se convierten en plaga. c) normalmente representan una riqueza genérica y de especies muy alta d) juegan un papel importante en la regulación de abundancia y actividad microbiana. por ejemplo. bacterias y depredadores de otros animales del suelo).1). de esta manera contribuyen en procesos orgánicos de trituración a pequeña escala y ejercen un importante papel regulatorio dentro de la biota del suelo. 4 Mesofauna: colémbolos y ácaros que actúan como transformadores de hojarasca y micropredadores (forrajeros de hongos. a) influyen en la tasa de recambio por su papel como forrajeros de raíces (parásitos de plantas). al cavar sus túneles y mediante la ingestión de materia mineral y orgánica. a escala pequeña. e) 40 Manual de biología de suelos tropicales . probablemente. nematodos y. al construir galerías y al cavar túneles e ingerir suelo.

rotación de carbono orgánico en descomposición. y contribuyen al potencial control biológico de plagas y enfermedades. Estos factores.como insectos patógenos. composición funcional (la naturaleza de los grupos funcionales) y ocurrencia e intensidad de los procesos ecológicos. hongos y animales invertebrados. entre bacterias. en NH3. en ocasiones. Los métodos empleados para la extracción de diferentes grupos de organismos del suelo también son muy diferentes de un grupo a otro.2). diversidad funcional (el número de grupos funcionales). Aún sigue siendo una pregunta sin respuesta la relación existente entre diversidad de especies. Se espera que los servicios de ecosistema. de esta manera. que dependen de grupos funcionales. En la biota del suelo. que es asimilable para las plantas. En los casos de Archaea y bacteria. bacterias involucradas con el compuesto El inventario de la biodiversidad biológica del suelo 41 . saprotróficos y antagonistas: que determinan o median (en diferentes casos) la viabilidad de cultivos. otros fijadores de nitrógeno microsimbiontes que transforman el nitrógeno atmosférico N2. representan un importante control biológico. bacterias que nitrifican y denitrifican (como parte de los transformadores procariotas). 8 Hongos fitopatógenos. reducen ataques patógenos en plantas y mejoran la tolerancia al estrés del medio ambiente. En muchos Fila. lo anterior aplica para los trituradores de materia orgánica (véase transformadores de hojarasca en Tabla 1. la caracterización molecular y bioquímica reemplaza al enfoque de identificación tradicional. Métodos para inventario de la biodiversidad bajo suelo: principios generales La metodología actual no permite la identificación de todas las especies en el suelo. aunados a la inmensa escala de diversidad encontrada en el suelo. por ejemplo. sean los más vulnerables ante situaciones de estrés y perturbación que afectan a dichos grupos funcionales. 6 Hongos micorrizógenos arbusculares: se asocian con las raíces de las plantas y mejoran la disponibilidad de nutrientes. el concepto de especies también es muy variable. compuestos por relativamente pocas especies y/o especies altamente especializadas. Hasta donde se conoce. requieren de un enfoque selectivo para llevar a cabo un inventario de la biodiversidad bajo suelo. utilizando el concepto de grupos funcionales clave como los descritos anteriormente. 7 Bacterias formadoras de nódulos en leguminosas y. y enfermedades de las plantas. la mayoría de las especies aún son desconocidas.

La evaluación de la composición de la comunidad biótica depende de la identificación de los especímenes recolectados.C1 y en las transformaciones de hidrógeno (metanogénicas y metilotróficas). Por lo tanto. para su aplicación en paisajes con diferentes usos de suelo. en términos de una dis42 Manual de biología de suelos tropicales . cobre y azufre quimiolitotrofos. Si éste es el caso. lo que exige un alto nivel de conocimientos taxonómicos. cuando se adopta el concepto de los grupos funcionales principales. Esto debería servir como respuesta a un gran número de preguntas en contextos similares. preguntas como las anteriores deberían ser consideradas en la definición del propósito del objetivo de la investigación de la biodiversidad bajo suelo. aunque se dan referencias de claves para la identificación de especies de varios grupos funcionales. hierro. Este manual aborda métodos para el inventario y caracterización de la biodiversidad del suelo. y en relación con que “especies clave (si existen) en los grupos funcionales?. por ejemplo. puesto que se reflejarán en los métodos a utilizarse. Inventario de biodiversidad bajo suelo en escalas de espacio y tiempo Cambio de uso de suelo como la causa principal del cambio de diversidad biológica del suelo Un inventario puede demostrar si la biota del suelo responde a intervenciones humanas como prácticas agrícolas. el impacto que provoca la intensificación agrícola. la fragmentación de hábitat y el manejo de cultivos en la diversidad biológica del suelo. En este manual no se abordan problemas taxonómicos. especialmente. escogidos y modificados. centrándose en los grupos funcionales que permitan la evaluación de la diversidad. esto conlleva a una serie de interrogantes como ¿cuál es el número mínimo de especies dentro de los grupos funcionales que garanticen la resistencia del suelo contra el estrés del ecosistema natural y antropogénico. para el cual se han desarrollado y probado los métodos. En el prefacio se plantea una breve descripción del proyecto. que para algunos grupos y en algunos países es un desafío importante. abundancia y composición de las especies. de manera que sea posible evaluar. hongos micorrizogenos (entre los microsimbiontes) y bioturbadores (ingenieros del ecosistema). contaminación y cambio climático. Los métodos estándar son necesarios para describir los ecosistemas de manera consistente. deforestación. las consecuencias pueden ser negativas. Los métodos han sido desarrollados.

El suministro global de alimentos depende de la agricultura intensiva. especialmente. los procesos de disturbio -y recuperación. muchas veces enlazadas entre sí. retener una buena cantidad de diversidad sobre el suelo. al mismo tiempo. El principio central es que el significado funcional de la diversidad biológica cambia de acuerdo con las escalas de El inventario de la biodiversidad biológica del suelo 43 . en la medida que proceda la intensificación. escalas que determinan la predicción de servicios ecosistémicos. En los trópicos. Se presume que de esa forma se reducirá la diversidad bajo suelo y que. Dichas funciones regulatorias frecuentemente se describen como “sustitutos” por insumos. Este hecho puede considerarse tanto a nivel de campo como de paisaje.. incluso puede producirse la pérdida de la productividad primaria. además. debería reflejar un consenso de la teoría ecológica y del pensamiento actual sobre estructuras de la comunidad en diferentes escalas espaciales y temporales. por ende. varias frecuencias). 2008). produciendo efectos indeseables. la biodiversidad y complejidad arriba del suelo favorecen el restablecimiento o protección de la diversidad de organismos bajo suelo. para mejorar la complejidad estructural y diversidad funcional. pérdida del potencial para la limpieza de los residuos y contaminantes. la regulación biológica de los servicios de ecosistema basados en el suelo. lo cual implica una reducción de la biodiversidad bajo suelo y. Para qué muestrear. debido a cambios en la fertilidad del suelo y/o incrementos de enfermedades en el mismo. a pesar de que la producción se ha intensificado. si se acompaña de la extinción de especies individuales. fertilizantes químicos y pesticidas (Kibblewite et al. puede causar pérdidas de función y reducir la habilidad de los sistemas agrícolas para soportar periodos inesperados de estrés. El mantenimiento de una variedad de cultivos y otras plantas es aceptado como una práctica que protege al agricultor contra los riesgos a corto plazo. la biodiversidad arriba del suelo se verá reducida. especialmente en suelos degradados. Una solución alternativa sería intensificar y. en la medida de lo posible. de los que puedan realizar las funciones biológicas esenciales. dónde y cuándo Aunque éste es un manual de instrucción práctica. un gran número de agricultores tienen acceso limitado a insumos. la complejidad de los agroecosistemas ha sido drásticamente reducida.minución de los servicios del ecosistema. también se manifiestan en diferentes escalas espaciales y temporales (por ejemplo.que afectan la biodiversidad bajo suelo. tales como cultivo mecánico. interrupción de los ciclos elementales globales y respuesta ante los efectos de los gases invernadero y de la erosión. Sin embargo.

en un mismo paisaje. o bien. en número y diversidad de lombrices de tierra al moverse de un lugar a otro. entonces. de manera general. puede haber una influencia biótica significativa. mientras que en el caso de la zona de uso de suelo. puede que se deba al drenaje o manejo previo del lugar. que combina estos elementos dentro de un sistema de uso de suelo. a los servicios del ecosistema en diferentes tipos de comparaciones. La formación del suelo. la diferencia que puede ocurrir en la descomposición o la fijación de nitrógeno simbiótico entre dos paladas de suelo del mismo campo. por ejemplo. si uno o más grupos funcionales importantes estuvieran ausentes o permanecieran en baja presencia en una de las localidades o si el ecosistema original de bosque se hubiera reducido a una presencia mínima en uno de los lugares. del campo hacia setos que delimitan el terreno. pero en el caso de dos campos colindantes. o bien. 2002. se pensaría que el material parental y el clima fueran los factores determinantes en el proceso de formación del suelo. Esto quiere decir que. Asimismo. en otro lugar. los ciclos de vida de diferentes 44 Manual de biología de suelos tropicales . con el propósito de lograr lo anterior. como se podría esperar. a la existencia de termitas o cualquier otro ingeniero del ecosistema que haya presentado mayor actividad en un lugar que en otro. El mayor reto. constituye uno de los servicios del ecosistema que integra procesos en todas las escalas. El objetivo debería ser reducir la variabilidad intragrupo y maximizar la variabilidad entre grupos. Por ejemplo. El clima. los números o diversidad pueden mantenerse estables.. Las escalas temporales son importantes en los procesos de degradación. destruir la capacidad productiva. Entre dos paisajes o dos regiones. se puede esperar una variación grande. la erosión de finas partículas de suelo y la reducción al mínimo de materia orgánica compleja que. De la misma manera. los materiales parentales y los suelos serán los principales determinantes de todos los servicios del ecosistema a nivel paisaje.espacio y tiempo (Swift et al. en un lugar específico. a escala regional. probablemente es cuestión de saber cuáles microorganismos existen en cada una. al punto de llegar a hacerla ser irrecuperable. en última instancia podría.. el inventario de especies de lombrices de tierra. puede quedarse corto en relación con el propósito de evaluación de la diversidad de toda el área. En términos generales. Lavelle et al. la pérdida progresiva de macroporos. dónde y cuándo se mide. mientras se mantuviera en un paisaje mixto. incluso. 2004). esto quiere decir qué se mide. tomando en cuenta los aspectos de la biodiversidad que puedan afectar. espaciales y temporales. no obstante. si el objetivo del inventario es conservar la biodiversidad bajo suelo. en caso de rehabilitación. es cómo definir estos “grupos” en relación con niveles de escala.

comparado con los efectos que produce la vegetación misma. geología. de gran relevancia en ese nivel. vegetación y tipo de suelo. se enfatiza en el capítulo 2 de este manual. la distribución espacial de la biodiversidad bajo suelo estará fuertemente influenciada por los gradientes de altitud y temperatura. La biodiversidad bajo suelo. en este caso. ampliamente discutidos. derivados de la base mineral y vegetal. El inventario de biodiversidad bajo suelo. mientras que las fecundidades también varían y. El patrón de uso de suelo superpuesto en función de dichos efectos de clima. incluyendo el descubrimiento de especies invasivas exóticas es. En el nivel más alto. son usados en el proyecto CSM-BGBD (véase prefacio) y están considerados como ejemplo. para explicar las posibles variaciones en la biodiversidad bajo suelo. Los cuatro niveles de escala espacial en muestreo. A nivel paisaje es difícil evaluar el efecto de la biodiversidad bajo suelo sobre algunos servicios del ecosistema. más útil como indicador de la respuesta del suelo al manejo. también será diferente de un organismo a otro. El impacto en el diseño de muestreo. La protección y conservación de los principales agroecosistemas y hábitats representa la mejor El inventario de la biodiversidad biológica del suelo 45 . La Tabla 1. en el caso del ecosistema de suelo y sedimentos (Wall. cada proyecto necesitará determinar su propia escala en función de sus objetivos. (2006). al igual que los procesos de cambio relacionados. Las características espaciales de la distribución de uso de suelo (“parches” de uso de suelo. Los principales conceptos teóricos que corresponden a estos criterios son: apertura y conectividad. también tendrán una importante influencia en la biodiversidad. No obstante. por los gradientes o transiciones de las condiciones de humedad o por los gradientes de las propiedades del suelo. 1. el tiempo requerido para que una población creciente alcance un tamaño crítico mínimo donde es autosuficiente.3 muestra un resumen de niveles jerárquicos modificados a partir de los propuestos por Lavelle et al. por lo tanto. deberá capturar la distribución. al igual que en los protocolos de medición. como puede ser dentro de los bosques). tamaño y forma de estos gradientes y fragmentaciones. 2004).taxa de biota varían de horas a años y pueden incorporar estados obligados de inactividad. como se indica más adelante. que afectan a la biodiversidad bajo suelo (y servicios ambientales asociados) y el componente de la biodiversidad bajo suelo. será un determinante más de dicho nivel. como calidad y suministro de agua o control de erosión y no parece que éste juegue un papel importante. a escala de paisaje. Paisaje.

. una combinación específica de tipos de cobertura. tal es el caso de un área con plantaciones comerciales de té o la caracterizada por la agricultura de autoconsumo. Las áreas de uso de suelo se definen en función de su uso y régimen de manejo (Huising. 2006). éste es el caso de algunos árboles donde ciertos organismos de suelo hacen uso de sus nichos. en el caso del inventario de biodiversidad bajo suelo. Las interacciones laterales son componentes muy importantes para la biodiversidad bajo suelo. incluso. si no es demasiado grande. y para la manera en cómo funciona el sistema. tendrán un 46 Manual de biología de suelos tropicales . se asocia con la extracción de elementos vegetales como árboles. por lo tanto. sobre todo. 1993). incluyendo a las raíces de suelo. pero son asociados con el manejo. es en este nivel donde la biodiversidad bajo suelo debería estudiarse de manera minuciosa. de manera que la relación entre el patrón de distribución espacial de la biota sobre el suelo con la de bajo suelo son particularmente interesantes.. A este nivel. queda dentro de los dominios funcionales de los ingenieros del ecosistema. El terreno o parche. pertenecientes a varios niveles tróficos y grupos funcionales que gobiernan la estabilidad de redes alimenticias y la provisión de funciones de apoyo. que implican una pérdida de sus aportes e impactos. Estas áreas muestran. por ejemplo. La intensificación de uso de suelo. cercos vivos. Vanlauwe et al. la composición y actividades funcionales de la biota son de gran interés y. 3. 2. tramos de bosque y otros elementos de manejo de paisajes. A nivel de parcela. aunque sean provocados por cambios en la composición funcional y actividad de los ingenieros del ecosistema o del arado del suelo. Parcela o parche. 2007. La escala de tiempo de estos procesos (cambio de la composición de uso de suelo y configuración de paisaje) para ser observable necesitaría de varios o. son visibles en escalas de tiempo más cortas que pueden abarcar desde pocos años hasta varias décadas. rompevientos. típicamente. cuando se trata de agrosilvicultura.opción para dicha intervención. la estructura comunitaria y sus interacciones son reguladas por la arquitectura del suelo del lugar en específico (Lavelle et al. describen los gradientes de la fertilidad del suelo en función de los recursos destinados al terreno.. Los gradientes de las propiedades de suelo sí ocurren en este nivel. de cientos de años. Cambios en la arquitectura del suelo. En este nivel. los cambios relacionados con el uso y cobertura del suelo. respecto al cambio de uso de suelo. también lo es la abundancia de especies relativas. normalmente. La biodiversidad sobre el suelo se determina por la variedad de cultivos encontrados en el área y por los elementos vegetales asociados con barbechos. Área de uso de suelo. 2006 y Tittonell et al.

A nivel parcela. Tal intervención debería apoyarse en el inventario y la abundancia relativa de especies. son segregados en los dominios funcionales: rizósferas. también despiertan gran interés.3 son parcialmente derivadas del concepto “el manejo jerárquico de la biota del suelo”. Éstos existen en la escala de los horizontes de suelo. en relación con esto. El inventario de la biodiversidad biológica del suelo 47 . por lo tanto. La redundancia funcional entre los transformadores primarios (especies o familias diferentes que cumplen una misma función). Este nivel se refiere a los microhábitats que alojan a los microbios y a los componentes de la microfauna del sistema de suelo que los regulan. la competencia y la eficiencia son de particular relevancia y. la inoculación con especies microbianas. drilósferas. Las opciones para intervenciones de manejo en una escala de subparcela son actualmente limitadas. en la estructura de la red alimenticia. la introducción de depredadores para el control de una enfermedad en particular. dado que ésta es la unidad fundamental de la función del suelo. los procesos involucrados. para mayores detalles y terminología). condicionados por los organismos de suelo en la producción de servicios de apoyo tales como mantenimiento de la estructura de suelo y la descomposición de materia orgánica introducida. 4. principalmente. La lista de intervenciones y mediciones correspondiente a la biodiversidad bajo suelo. dentro de los microorganismos. por ende. Cambios estructurales en la comunidad biótica (conexiones en la cadena alimenticia. tienen escalas de tiempo relativamente cortas y mostrarán variaciones estacionales. reflejándose la dependencia de los organismos más pequeños en los ingenieros del suelo para el suministro de sus sustratos (véase Lavelle y Spain. no es necesariamente exhaustiva. subparcela o microhabitat. Cualquier tipo de inoculación causará un impacto directo sobre la diversidad bajo suelo y. del agregado individual y de la partícula individual.efecto sobre las interacciones tróficas y. pertenecientes a grupos funcionales definidos o a niveles tróficos dentro de la cadena alimenticia. el grado de diversidad genética. Las “intervenciones” enlistadas en la Tabla 1. composición funcional) pueden necesitar de varios años. termitósferas. etc. según lo describe Swift (1998). Nicho. El manejo de materia orgánica y el uso de agroquímicos causarán un mayor impacto en la estructura de la red alimenticia.. pero un entendimiento de los procesos e interacciones es vital. sino más bien ilustrativa. 2001. como en la cadena alimenticia. puede servir para corregir desequilibrios en la composición funcional o para mejorar algunas funciones en particular.

manejo ecosistemas: integrado de patrón de distrirecursos naturales bución espacial.de suelo.relacionada con diversidad arriba ingenieros de clasificación). de un país. del suelo. de detalle de la biológicas y bio. Capa de nivel de agregación Paisaje Tipo de unidad Medida/ parámetro de biodiversidad Área caracterizada Sin especificar: Cambio de uso de Diversidad biopor un mosaico de tal vez. Tabla 1. parches de selva. suelo caracteríssuelo. mancífico (depentenimiento de de especies y régimen de especialmente diente del nivel áreas de refugio manejo. dentro de degradación diversidad y tico y patrón de composición cobertura de suelo un paisaje espe. 3–20 tipos de Intensificación Diversidad Área con uso de áreas de uso de de uso de suelo. cuenca mayor.cas e invasoras. y prácticas de conservación del suelo. procesos asociados de cambio y componentes relevantes de la biodiversidad.3 Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. varias suelo: protección lógica de suelo: uso de suelo y de por bioma o por de usos de suelo y especies exótiecosistemas como región dentro elementos de pai.existiendo una superposición entre niveles de escala dentro de los parámetros a medir. saje. corredores biológicos.Proceso/ ses o unidades intervención Área de uso de suelo 48 Manual de biología de suelos tropicales . unidades de referencia. Número de cla. funcional. de relevancia específica para la biodiversidad y mantenimiento de la provisión de servicios de ecosistema. por ejemplo.

inoculación. El inventario de la biodiversidad biológica del suelo 49 . funcional.Tabla 1. na. • Proporciones relativas de GF. cepas para microsimbiontes).área de uso de jo particular. composición labranza mínima. ejemplo. selva. provee los siguientes datos e información. dentro mejoramiento de y entre grupos funcionales y sistemas de cultivo y manejo de niveles tróficos. los datos tendrán que ser acumulados en cada punto de muestreo. utilizando los métodos previstos en este manual. parche Tipo de unidad Número de cla. para lo cual se indican en los capítulos 3 y 9 los mejores métodos. Capa de nivel de agregación Parcela. drilósfera. diversidad introducción genética. 10 a 100 por Área con un uso particular y mane. materia orgánica. o a nivel más alto o más bajo (por ejemplo. Por regla general.3 Continúa. que consisten en el uso oportuno de tiempo y recursos. por suelo. erosión. etc. proveen un gran número de parámetros para la evaluación de la biodiversidad bajo suelo. Sin tomar en cuenta los objetivos específicos y el diseño experimental de cualquier estudio. inoculación con microsimbiontes. Nicho Por ejemplo. parcelas de vegetación. dependiendo del tipo de análisis realizado: En cuanto a la biodiversidad: • Riqueza taxonómica a nivel de especie. • Abundancia (total) y biomasa (en el caso de animales) de taxa. etc. el inventario bajo suelo de la biodiversidad. Biomasa y actiManejo de vidad microbiabiota clave. campo agrícola. • Abundancia y biomasa de los grupos funcionales (GF). rizósfera. de agentes de control biológico. microhábitat horizontes de suelo. especies. Datos requeridos Los métodos expuestos en este manual.Proceso/ ses o unidades intervención Medida/ parámetro de biodiversidad Intensificación de Abundancia manejo de suelo y relativa de cultivos.

.. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. E. P. Cavalier-Smith. intensidad de uso y cobertura de suelo: • • • • • • Cultivo aparente o uso de barbecho. Sanchez. P. guilds. A. L. (1998) ‘Soil fauna. M. Ambio. L. P.. vol 73. Oxford. response 11. D. Bignell. Referencias Bardgett... issue 1. Conservation Ecology. pp. D. Palm. R. D. V. Gupta. Lavelle.. P. C. (1981) ‘Effects of animals on soil’. C. (1997) ‘Biodiversity and ecosystem functioning in soil’. 123–135. Brown. Hattori. C. Pashanasi.. (1998) ‘A revised six-kingdom system of life’. D.Rusek. Dibog.. Tondoh. J. Klopatek. pp.. Geoderma. Susilo. T. Características de vegetación.. F. J. Vosti. R. Cavalier-Smith. F. Huang.. vol 7. F. Davic. (ed) (1997) Nature’s Services. Island Press. in C. Behan-Pelletier.. y Swift. A. y Virginia. T. (2005) The Biology of Soil. Washington DC. Promedio de datos climáticos y precipitación real hasta la fecha de muestra... D. Tiedje.. Applied Soil. Prácticas actuales de manejo de suelo y cultivos. 1251–1262. Moreira. S. New York. pp. Hole. Freckman. uso del suelo. Huising. Oxford University Press.. 203–266. Malloch. (2005) ‘Belowground diversity assessment: developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. G.Ecology. D. A. Brussaard. vol 9. B. En cuanto al suelo. Fragoso. J. E. B. Soderstrøm. Bignell. Daily.. Brussaard. J. A pattern recognition approach to land use inventory at the sub-regional scale 50 Manual de biología de suelos tropicales . D. Nwaga. 75–112. Historia precisa del uso de suelo desde su estado de selva no perturbada hasta otro tipo de vegetación pre-cultural. T.. V. functional groups and ecosystem processes’.. S. D. X. (2003) ‘Linking keystone species and functional groups: A new operational definition of the keystone species concept’.. Proceedings of the Royal Society of London Series B. 563–570. P. vol 5. pp.. W.. D. pp. R. Biological Reviews.• Índices cuantitativos generales de riqueza y equitatividad. Columbia University Press. vol 271. Hawksworth. V. J. Folgarait.. Propiedades físicas y químicas básicas: pendiente y aspecto del suelo. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. L. vol 26. Didden. (2004) ‘Only six kingdoms of life’..

L. Lawton. S. M. P.. y Shachak. Eggleton. M. vol 33. A. Mawdsley. (1994) ‘Organisms as ecosystem engineers’. B. El inventario de la biodiversidad biológica del suelo 51 . y Watt. in T. Bloemers. D. Brown. 159–193.. J-P. H. R.. Y.D. W. G. Roger. Hodda. Larsen. P. Lepage. Bignell. pp. Washington. The Inventory of Soil Biological Diversity 15ES_HTSB_11-6 13/6/08 18:14 Page 15 European Journal of Soil Biology. H. M. Blouin. Ineson. P. DC Lavelle.. Island Press.. Bignell. M. P. G.. D. P.. J. Thesis. (2006) ‘A molecular phylogeny of the flagellated fungi (Chytridiomycota) and a proposal for a new phylum (Blastocladiomycota)’. Behan-Pelletier. vol 98. P.pp. pp. W. G. P.. Austen. y Dillion. Spain. Berlin.. Lawton... (2006) ‘Soil invertebrates and ecosystems services’. G. (2001) Soil Ecology. P. Longcore.. y Brussaard. A. E. Stork. J. vol 33. E. Ph. Higashi (eds) Biodiversity. Kluwer Academic Publishers. Abe. Lavelle.. y Swift. Mora.. Margulis. Dordrecht Lavelle. H.. P. Decaëns. Wall (ed) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. B.using remote sensing and GIS applying an object oriented and data-driven approach’.... pp. A.. Oikos. Biology International. V. S. P. L. T. P. N. Giller... (1996) ‘Diversity of soil fauna and ecosystem function’. Lavelle. D. pp. 72–76. J. Ritz. St John. Mycologia. Garey. T.. D. Wageningen Agricultural University. Hunt. V. 373–386. W. V.. E. Aubert. M. E.. Moreira. E. Hawkins.. M. 685–701. M. Brown... Philosophical Transactions of the Royal Society Series B.. S.. F. Bignell. Letcher. pp. (1996) ‘The role of species in ecosystems: Aspects of ecological complexity and biological diversity’. Barot. Porter. Holt.. (1998) Five Kingdoms – An Illustrated Guide to the Phyla of Life on Earth. H. M.. Jones. The Netherlands. Lawton. pp. (2008) ‘Soil health in agricultural systems’. K. New York. Heal. S.Griffith. Hammond. W. M. P. G.. Volters. y Paul.. (2004) ‘Connecting soil and sediment biodiversity: The role of scale and implications for management’. 3–16. 3rd edition. James. vol 42. D. Margerie. J... H. F. Mozley-Standridge. F. vol 391. Siqueira. Wallingford. (1998) ‘Biodiversity inventories. Springer. CAB International. y Rossi. Freeman. Srivastava. C. J. S. Bureau. C. D. M. V. G. indicator taxa and effects of habitat modification in tropical forest’.vol 69. J. R. Powell. Boulton. 860–871.. an Ecological Perspective. European Journal of Soil Biology. Levin y M. S. (1997) ‘Soil function in a changing world: The role of invertebrate ecosystem engineers’. E. Nature (Lond). K.. D. R. N. Lavelle..J. vol 363. P. M.S. H... in D. E.. S. A. A.. J.. (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. M. y Schwartz. O. M. S3–S15. Kibblewhite. J. y Vilgalys. K. V. T.

Annual Review of Microbiology. 23–32 Swift. M. E. 11–24. F. P. y Van Noorwidjk. (2006) ‘Within-farm soil fertility gradients affect response of maize to fertilizer application in western Kenya’. pp. pp. (2007) ‘Heterogeneity of crop productivity and resource use efficiency within smallholder Kenyan farms: Soil fertility gradients or management intensity gradients’. J. Washington. Siqueira. y Giovannoni. N. J. (1998) ‘Towards the second paradigm: Integrated biological management of soil’. (ed) (2004) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. Carvalho (eds) Soil Fertility. M.. H. y Mukalama. vol 94. Tittonell. E. pp. y Huhta. (1979) Decomposition in Terrestrial Ecosystems. Wall. y Eggleton. Furtini Neto y J. V.. vol 76. O. J. P. pp. J. S. 376–390. Blackwell. pp. M. H. Lavras. Woese. S. K. D. y Anderson. Vanlauwe B. and Eucarya’. 171–182. N. M. R. Agricultural systems. W. (1998) ‘Functional diversity of decomposer organisms in relation to primary production’. S. Moreira. American Journal of Alternative Agriculture. Stork. 25–31... Proceedings of the National Academy of Sciences USA. O. B. V. J. Tittonell. J. Setäla. G. Applied Soil Ecology. M. 113–134.Rappé. (2003) ‘The uncultured microbial majority’. Soil Biology and Plant Nutrition interrelationships. P. 4576–4579. M. vol 9.. Oxford. Kandler. A.. (2002) ‘Biodiversity and ecosystem services in agricultural landscapes – are we asking the right questions?’ Agriculture. S. Laakso. 369–394. pp. M. vol 57. 52 Manual de biología de suelos tropicales . O. (1990) ‘Towards a natural system of organisms: Proposal for the domains Archaea. Guilherme. y Wheelis. N. Brazil. Vanlauwe. Mikola. pp. Bacteria. vol 87. A. Swift. de Ridder. J. Island Press. Faquin.. Swift. C. inJ. pp. Nutrient Cycling and Agroecosystems. vol 7. vol 104. Heal. y Giller. Ecosystems and Environment. Lopes. J. (1992) ‘Invertebrates as determinants and indicators of soil quality’. M. N. A. M. G. E.. R. L. SBCS/UFLA/DCS. Izac. L.

Souleymane Konaté. Jeroen Huising. En algún punto entre estos dos. Julio N. en otra. 2000. Existe una larga tradición de muestreo en la ecología de campo y. S. Ronald Zanetti.Capítulo 2 Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo E. En cuanto al argumento es más complicado que una mera elección al azar. Susilo. Richard Coe. 2007). Juvenil E. que aplica en todos los casos (Cochran. Moreira. Entonces ¿para qué se necesita otro capítulo que discuta las técnicas de muestreo de la biodiversidad del suelo? A pesar de los conocimientos y experiencias en rela53 . es necesario escoger el lugar dónde se tomarán las muestras de suelo para los análisis químicos. en los cuales se llevarán a cabo los protocolos de medición. mismos que se describirán en los siguientes capítulos. En una primera escala. una gran experiencia al respecto. Southwood y Henderson. Louzada. el problema gira en torno a cómo escoger el número y localización de los puntos de muestreo en el paisaje en cuestión. 1977). por tanto. en un punto predeterminado del paisaje. Francis-X. El problema de localizar los puntos de muestreo se presenta a diferentes escalas. también incluye cómo determinar la localización de estos sitios de muestreo: lo que se discutirá más abajo. La base del problema radica en el muestreo. Huang (†) INTRODUCCIÓN Gran parte de este manual contiene instrucciones de cómo tomar mediciones una vez que se tiene un sitio de muestreo. Además. se encuentra el problema de la elección de los sitios. Hay numerosos textos que describen la teoría y su aplicación (ej. se cuenta con una teoría de muestreo bien establecida. Fátima M. se necesita determinar en dónde va a estar localizado todo el estudio. Gregoire y Valentine. Meine van Noordwijk y Shiou P. Cares.

o qué es una réplica. estos podrían no estar completamente desarrollados o los objetivos múltiples podrían sugerir diferentes enfoques para el muestreo. el acceso a sitios de muestreo ideales puede ser restrictivo. Por ejemplo. Por ejemplo. En este capítulo se describen algunas opciones para muestrear la biodiversidad del suelo y las ventajas o desventajas de los diferentes enfoques. Comúnmente hay malos entendidos de algunos de los principios básicos. 2 La aplicación de una teoría de muestreo puede requerir de información con la que no se cuenta hasta que los datos han sido colectados. el tamaño de muestra requerido depende de la variación entre las muestras. pueden discrepar en lo referente al carácter práctico del estudio que está siendo diseñado. A continuación.ción con el tema. (1989) lo explican con detalle en el contexto de muestreo ecológico. se presenta un ejemplo del enfoque utilizado en el proyecto CSM-BGBD. es posible que no sea fácil tomar tantas muestras como se desearía. 4 Los objetivos del estudio determinan el diseño. están los que “Ven lo que está ahí. entonces tratan de entenderlo” y aquéllos que “empiezan con una hipótesis y tratan de probarla”. 5 Los investigadores toman diferentes posturas filosóficas relacionadas con el enfoque de muestreo. entonces esta variación es desconocida. o bien. Si datos similares no han sido colectados antes. tales como por qué el trabajo de muestreo debe ser de manera aleatoria. Ford (2000) hace referencia a una amplia discusión de los objetivos de investigación en ecología. OBJETIVOS DEL ESTUDIO Y BASES DEL MUESTREO La mayoría de los autores que escriben sobre diseños de investigación puntualizan que el diseño se determina en función de los objetivos. Son varias las razones para ello: 1 La aplicación de una teoría completa o de métodos tan extensivos como los utilizados en otros estudios. 54 Manual de biología de suelos tropicales . debido al tiempo y al costo. Muchos de los debates sobre los métodos apropiados de muestreo se deben a diferencias de opinión en cuanto a los objetivos exactos del estudio. 3 Puede haber límites en cuanto a la teoría. Kenkel et al. en cualquier proyecto habrá desacuerdos y discusiones en cuanto a las estrategias de muestreo. Sin embargo.

el caso de las orillas de un estanque. entonces. La teoría. Por supuesto. No obstante. esto es atractivo. por lo que prefieren mantener la mente abierta y partir de la observación. no importará si los nichos raros son omitidos o no. análisis de conglomerados y ordenación) y luego explicarlos (por ejemplo. existe una estimación del error de muestreo basada en el diseño). y en cada estrato tomar una muestra aleatoria). Otra alternativa al MAS consiste en usar un muestreo sistemático usando una cuadrícula. argumentando que si se empieza partiendo de un objetivo limitado. Los seguidores del primer enfoque pueden argumentar que no quieren ser prejuiciados por hipótesis previas. La media de la muestra es una estimación imparcial de la media poblacional. a través de la estratificación (es decir. Cuando el objetivo es identificar todas las especies de un grupo dado en el área de estudio entonces el MAS resulta inapropiado. y luego diseñar un estudio cuyo objetivo específico sea probar estas hipótesis. Un ejemplo de un objetivo que requiere diferentes enfoques de muestreo son los inventarios. situado en el lindero entre el bosque y la pradera. Un enfoque de muestreo consiste en colectar datos usando el método de MAS o mediante una cuadrícula. y su error estándar puede ser estimado sin hacer supuestos acerca de la variación dentro de la población (técnicamente. La mayoría de los estudios. en ecología. su imaginación y descubrimientos potenciales podrían estar restringidos. Si el objetivo es estimar la media poblacional (la biomasa media de escarabajos por m2 dentro del área de estudio. Intuitivamente. incluyendo los del proyecto CSM-BGBD. intentan entender los patrones en la biodiversidad. intentando describir patrones (por ejemplo. existirá solamente una pequeña porción del área de estudio ocupada por este tipo de nichos. lo que se discutirá en la sección de muestreo aleatorio y sistemático. indica cómo la precisión de la estimación puede ser controlada mediante la elección de la muestra. existen pocos estudios ecológicos cuyo objetivo sea estimar la media poblacional. dividir la población en sub-poblaciones o estratos. Si el objetivo del estudio es estimar la biomasa media de escarabajos en general. o el número promedio de especies de hongos en 1 cm3) el MAS adquiere propiedades relevantes. y la precisión aumenta con un tamaño de muestra fijo. entonces los nichos raros deben ser incluidos. pero si el propósito es realizar un inventario de especies.El muestreo aleatorio simple (MAS) constituye el punto de partida para la discusión sobre cómo muestrear. Piense en un nicho raro en el paisaje (por ejemplo. Otra alternativa es formular algunas hipótesis predictivas para explicar los patrones en la biodiversidad. encontrando correlaciones con variables ambientales). se han hecho imD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 55 .

portantes descubrimientos por casualidad. existen tres razones para tratar de diseñar un estudio con objetivos específicos que incluyan hipótesis comprobables: 1 Los descubrimientos inesperados usualmente tienen la naturaleza de formulación de hipótesis observacionales que sugieren explicaciones. separar los efectos de las dos variables. es imposible elegir cuáles.1). cada investigador debería estar abierto a la posibilidad de observaciones no anticipadas y explicaciones verdaderamente nuevas. sin seguir estudios planeados. relativamente. por ejemplo. son los puntos más extremos los que proporcionan más información (Figura 2. tienen valores bajos de MOS. 3 Si se parte de hipótesis específicas. sin alguna noción de los factores ambientales que puedan controlar la biodiversidad. los que proponen el enfoque “no hipotético” en realidad parten de alguna forma de hipótesis. entre un número infinito de factores. Sin embargo. Si suponemos la hipótesis de que la biodiversidad del suelo en parcelas agrícolas. • La MOS y la P pueden estar correlacionadas. Se requiere de estudios minuciosamente planeados para poder probar dichas explicaciones. Entonces es difícil y hasta imposible. 2 De hecho. es posible mejorar el diseño del estudio. deberían ser medidos en los sitios de muestreo. está determinada por el nivel de Perturbación (P) y el nivel de Materia Orgánica del Suelo (MOS) y se colectan los datos por medio del MAS o por muestreo de cuadrícula. pocos puntos con valores altos o bajos. aunque ésta sea implícita. entonces es probable que: • La mayoría de los sitios de muestreo tengan valores de P y MOS alrededor de la media con. frecuentemente. La estratificación puede usarse para incrementar el número de puntos con MOS más extremos y mejorar la estimación de la relación sin incrementar el número de muestras. frecuentemente. Por ejemplo. no obstante. el estudio podría ser diseñado para incluir específicamente algunas muestras con valores altos de P y de MOS y otras muestras con valores bajos de P y de MOS. haciéndolo más eficiente. No obstante. además. parcelas con un valor alto de P. Este último punto subraya o enfatiza gran parte de lo que sigue en este capítulo. 56 Manual de biología de suelos tropicales . Si las hipótesis implícitas se hacen explícitas el diseño de los estudios pueden ser mejorado. si se trata de entender la relación entre la biodiversidad del suelo y la MOS o la P.

generalmente. En el presente estudio. lo ideal sería llevar a cabo un estudio longitudinal. El objetivo global del proyecto CSM-BGBD fue comprobar la hipótesis de que un incremento en la intensidad del uso del suelo cambia la biodiversidad del suelo (más específicamente. en donde las parcelas sean monitoreadas a través del tiempo para observar si los cambios en la biodiversidad del suelo pueden ser correlacionados con cambios en el uso del suelo. como en muchos otros. Cuando se determina la distancia entre los sitios de muestreo y el tamaño total del área de estudio. se aplican los mismos principios de diseño. Este planteamiento es muy amplio. Aunque la validez de este enfoque puede ser cuestionable. Las discusiones en este capítulo sólo consideran esquemas alternativos de muestreo para datos colectados por el método transversal. En términos ideales. La única manera cierta para determinar el efecto de un cambio. Otro ejemplo de una hipótesis implícita en muchos de los estudios es la escala espacial en la que ocurren los patrones interesantes. los efectos de ambas variables. Se espera que las correlaciones entre la intensidad de usos de suelo y la biodiversidad del suelo reflejen alguna conexión causal. y sus efectos combinados pueden ser estimados. Si tenemos que utilizar un diseño de estudio observacional. el investigador hace una selección de las escalas importantes para su estudio.Entonces. considerando un rango de usos de suelo en un momento específico de tiempo. como el que se observa en la Figura 2. sin embargo. que indiquen lo que pasaría con la biodiversidad del suelo si los usos de suelo cambian en el futuro. tampoco es viable en un proyecto de duración fija y corta. Si éstas se seleccionan explícitamente. Lo anterior. es hacer justamente el cambio y esto precisamente constituye la base de un enfoque experimental. En la práctica. sin embargo. no siempre resulta viable.1 y las relaciones pueden ser más complejas que el caso de dos líneas rectas. puesto que se desconoce el tiempo necesario para el monitoreo. muchas veces es la única opción disponible. en lugar del experimental. dicha investigación iría acompañada de un experimento. pero aún puede resultar útil cuando se enfoca con un diseño de muestreo. señala una pérdida de biodiversidad del suelo). D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 57 . puede que sea imposible o inútil producir un solo índice de biodiversidad del suelo. entonces se abren nuevos debates con una probabilidad de mejorar el diseño del estudio. se utiliza una aproximación transversal.

Los detalles de cómo dichos factores prácticos y teóricos pueden mezclarse.Figura 2. los objetivos determinan todos los aspectos del diseño. con base científica y de las propiedades que ofrecen los diversos métodos. esto aumentará la precisión de la estimación de la pendiente. o bien. por estratificación. no obstante. b) si se incluyen de manera deliberada valores de MOS más extremos. serán diferentes para cada estudio y darán a cada investigación un aspecto único.1 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. es necesario que se combine con las restricciones prácticas impuestas por costos. el acceso limitado a localidades deseadas para muestrear. Escríbalos y compártalos con otros para 58 Manual de biología de suelos tropicales . desde un principio deberán ser expresados de manera clara y precisa. es posible que se especifiquen algunos pasos del proceso en general que se deben seguir en cualquier estudio. por lo tanto. la necesidad de transportar con rapidez las muestras desde el campo hasta el laboratorio. Sin embargo. Paso 1: Defina objetivos Como se indicó en la sección de objetivos del estudio y bases de muestreo. por ejemplo. Asimismo. tiempos y disponibilidad de expertos. podría surgir una serie de restricciones adicionales. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. ENFOQUES PRÁCTICOS El diseño de un esquema de muestreo exitoso y práctico es todo un arte. dando un estimado pobre de la pendiente. Requiere de un entendimiento profundo.

imágenes de detección remota (ej. datos meteorológicos (ej. Una herramienta que ayuda a refinar los objetivos es la presentación de resultados simulados. diseños utilizados en otros estudios y su imaginación. Escriba el diseño con tantos detalles como sea posible. Si bien puede haber aspectos sobre los cuales tenga poca idea. Después deberá comprobar con cuidado que: a) los resultados realmente logren los objetivos y b) que el diseño de muestreo simulado realmente pueda mostrar estos resultados. Estos incluyen: mapas topográficos (ej. Estos expertos pueden ser investigadores que trabajan sobre temas similares en otros lugares.. ¿Cuáles cumplen con sus objetivos y proveen evidencia para su hipótesis?. Cada estudio cuenta con aspectos únicos y siempre habrá estudios previos de los cuales puede aprender: ésto le permitirá entender qué aspectos de los métodos utilizados han tenido éxito y cuáles limitan la eficiencia y calidad de los resultados. Paso 4: Elabore un diseño Elabore un diseño tentativo utilizando una combinación de principios generales.que pueda discutir algunas sugerencias. mapas de uso de suelo (ej.... mapas de cobertura del terreno). Imagínese que ha finalizado el estudio y ha obtenido resultados ¿Qué tablas y gráficas le gustaría presentar?. otros que tienen experiencia en los métodos que va a utilizar. otros que han trabajado en el mismo sitio.1 es un ejemplo simple. o bien. Anote específicamente el tamaño de las muestras utilizadas y la variación de los resultados. anótelas y numérelas. Consiga el mayor número de comentarios y sugerencias de los expertos en la materia. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 59 . La Figura 2. Paso 3: Reúna datos relacionados Reúna información o antecedentes que serán necesarios para diseñar los detalles del muestreo. Paso 2: Consulte otros estudios Consulte los estudios relacionados con su investigación. indican la estratificación por altitud o nos permiten entender los problemas de acceso). para ayudar a decidir cuáles son las temporadas idóneas para el muestreo de campo). para identificar los principales usos del suelo que se incluirán en el estudio). su propia experiencia. siempre deberá plantear un proyecto realista.

Dentro de cada país.Paso 5: Revise su diseño Comparta su diseño con otros investigadores para que expresen su punto de vista y sus comentarios. REPLICACIÓN Y TAMAÑO DE MUESTRA La mayoría de los diseños de estudio son jerárquicos y el problema de muestreo no sólo consiste en seleccionar el sitio de muestreo dentro del área de estudio. En particular. Dentro de cada sitio de estudio alrededor de 100 puntos de muestreo fue60 Manual de biología de suelos tropicales . Una investigación piloto abre la posibilidad de evaluar el aspecto práctico del esquema de muestreo. etc. un error común es obtener información que sugiere que los objetivos son inalcanzables. Un buen estadista. procese algunos datos hasta llegar a un análisis estadístico. JERARQUÍA. Asimismo. considerará algunos aspectos que pueden pasar desapercibidos por el ecólogo. Paso 7: Revise los pasos En cualquier paso. Paso 6: Realice una prueba piloto Pruebe su enfoque. que han usado métodos similares o que han trabajado en la localidad o simplemente. procedimientos de manejo de datos. también permita estimar el tiempo del muestreo y el procesamiento de las muestras. El proyecto CSM-BGBD es un buen ejemplo. éstos pueden ser personas que han trabajado con temas similares. De ser posible.. fueron seleccionadas una o más áreas de estudio. probablemente. En cada área. esto dará una indicación de la variabilidad. puesto que involucra varios países. pero deberás seguir adelante. uno o más sitios de estudio (etiquetadas como “ventanas”) fueron seleccionados. puede ser que tenga que retroceder a un paso anterior para volver a intentar. permita probar y refinar los protocolos de medición. revise los objetivos a la luz de nueva información. De nuevo. lo que puede ser útil para ayudar a decidir el tamaño final de la muestra. Trate de incluir un estadista con experiencia en investigación en ecología. que expresan su opinión acerca de su tema.

ron seleccionados y en cada punto se tomaron muestras (el protocolo de medición determina más capas en la jerarquía. se podría estudiar la biodiversidad del suelo en fincas alrededor de los límites del bosque en el monte Kenia. relacionados con los usos de suelo. El muestreo implica que el conjunto sobre el que nosotros queremos hacer inferencias (“la población”) necesita ser delimitado antes de que un esquema de muestreo pueda ser planteado. La terminología es confusa y no tiene nada que ver con una población biológica. lo que requerirá de una muestra de fincas pertenecientes a esta localidad. Suponga que cuenta con diez muestras tomadas de un bosque y diez en las cercanías de campos cultivados y que las muestras de bosque tienen consistentemente una alta biodiversidad del suelo ¿qué podría concluir? Si las muestras fueron seleccionadas de manera apropiada. Si se desean resultados que apliquen a los límites del bosque de África del Este en general. La selección de algunos países puede estar basada en función de su política o de los intereses de algunas agencias financiadoras e investigadores que dirigen el proyecto. Sin eso. evaluada mediante un análisis estadístico) que las muestras de bosque contienen mayor diversidad que las de los campos cultivados. La segunda idea es la de replicación. dicha selección se deberá basar en los objetivos del estudio y en la aplicación de algunos principios. En cada capa jerárquica. entonces también se necesitará una muestra de otros bosques. en algún nivel. El objetivo de la investigación es encontrar algunos patrones. que trata de mantener la consistencia de patrones y relaciones. puede concluir (con un grado conocido de incertidumbre. ya que estos patrones pueden utilizarse para hacer predicciones y pueden reflejar algunas reglas o procesos. como consecuencia de la extracción de cuatro muestras tomadas para la caracterización del suelo y sub-muestras de éstas para los análisis químicos). es necesario repetir observaciones con el fin de determinar si los patrones son realmente consistentes. estrictaD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 61 . se plantean las mismas preguntas: ¿cuántas unidades deberían de ser seleccionadas?. Como ejemplo. Por lo tanto. pero. ¿cuáles son? En los niveles más altos. sólo podemos hacer afirmaciones sobre el monte Kenia con base en los datos obtenidos y no es posible extrapolarlos a otros lugares. tales como los patrones de la diversidad del suelo. La intención es saber a qué se refieren sus resultados. Lo primero es centrarse en la idea de una teoría de muestreo de una “población”. las respuestas no necesariamente estarán basadas en la ciencia. Los patrones de interés son los que mantienen una consistencia a través de un número de casos. aunque.

del diseño de muestreo. puesto que representan “pseudo-réplicas”. Dicha cuadrícula es una “ventana” con 77 puntos de muestreo (intersecciones) definidos. Si este proceso de reducir el tamaño de las ventanas mientras se incrementa su número se continúa.2.2b se pueden observar tres ventanas más pequeñas para muestrear tres diferentes parches de bosque y no uno solo. determina el nivel jerárquico donde se requiere tener réplicas. para poder examinar las diferencias en la biodiversidad del suelo. patrones consistentes entre sitios. como los sitios de estudio pueden proveer un nivel de replicación. la 62 Manual de biología de suelos tropicales . sólo podrá concluir que ese bosque en particular es más diverso y no. las unidades de nivel más alto. por lo que no pueden ser considerados representativos del uso de suelo. 1998). entonces en algún momento se perderán las ventajas posibles de muestrear por cuadrícula y se terminará con un diseño que podría parecer un muestreo aleatorio de sitios individuales. ha sido construida una cuadrícula de tal manera que incluya los dos usos de suelo. Algunas de las implicaciones de estas ideas en el muestreo de cuadrícula son ilustradas a través de un ejemplo simplificado que se muestra en la Figura 2. por lo tanto. La palabra “escala” es confusa y controversial en la ecología (Peterson y Parker. varios bosques son muestreados. muestras múltiples de un mismo bosque no sirven al mismo propósito. La replicación puede aumentarse y abarcar más área total observada. probablemente. Dentro de un estudio jerárquico. Un enfoque más certero es asegurar una replicación válida y algunos resultados genéricos. a través de un diseño que replique bosques y otros elementos de uso de suelo. utilizando más ventanas y más pequeñas (Figura 2. Nótese que no es necesario muestrear todos los usos de suelo en cada ventana. Por ejemplo.mente hablando. representan una “regla” aplicable ampliamente.2d). El que muestras repetidas dentro de un bosque sirvan para ser interpretadas de igual manera que las muestras de diferentes bosques depende de las propiedades de los datos y no.2a. Sin embargo. El objetivo es muestrear un paisaje con dos usos de suelo. los bosques en general. En la Figura 2. pero queda claro que la escala en que se anticipan o hipotetizan los patrones. Una respuesta a esto es definir una nueva categoría de “límites de bosque” y asegurar ventanas en los tres sitios de muestreo (Figura 2. En la Figura 2.2c). Una crítica a este tercer tipo de diseño es que todos los sitios de muestreo en tierras agrícolas quedan cerca de un límite de bosque. etiquetados como: “bosque” y “agricultura”. deberá buscar una consistencia en varias de ellos. Dentro de cada sitio de estudio se podrán establecer conclusiones más contundentes si por ejemplo. Si busca una conclusión válida para los bosques.

con réplicas en cada distancia. En otras áreas de la ecología. Entonces la hipótesis necesita una muestra de una unidad de 1 km². d) reconociendo los límites como otra categoría. factores del paisaje como la fragmentación del bosque. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 63 . sin embargo. Para poder evaluar la biodiversidad del suelo dentro de un 1 km². se basan en datos de diferentes niveles jerárquicos: uno. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. afectan los procesos. La réplica dentro de la unidad es importante para determinar la precisión con que la biodiversidad del suelo es medida para cada unidad. por lo tanto. la escala espacial en que se evaluó la cobertura del bosque. suponiendo que fue definida como áreas de 1 km². El mensaje es claro: “el nivel de paisaje” no está bien definido y. no queda claro el diseño de muestreo que se necesita. con varios niveles de cobertura de bosque.2 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. se necesita definir el significado de “en el paisaje”. utiliza datos en el nivel de parcela y el otro. es decir.Figura 2. Una hipótesis diferente sería “la biodiversidad del suelo en parcelas agrícolas decrece con la reducción de la cobertura del bosque en el paisaje”. Los dos ejemplos del párrafo anterior son análisis que utilizan factores del paisaje. puede ser investigado con parcelas (sitios de muestreo) en un intervalo de distancias. con la definición de algunos sitios dentro de cada unidad. En este caso. si se intenta hacer un “análisis en el nivel de paisaje”. Ahora es la réplica quien determina la necesidad de varias áreas en cada nivel de cobertura de bosque. pero no es relevante para afirmar la consistencia del patrón a través de la unidad de 1 km² necesaria para examinar las hipótesis. Lo anterior. c) incrementando la replicación. b) tres cuadrículas que muestrean tres diferentes parches de selva. los objetivos de un proyecto de biodiversidad del suelo pueden incluir “análisis del paisaje”. se requerirá de más muestras. datos en el nivel de unidades de 1 km². hipótesis puede ser “la biodiversidad del suelo en parcelas agrícolas decrece con el aumento a la distancia del límite del bosque”.

es improbable que sean prácticos para los estudios de biodiversidad del suelo porque el trabajo necesita planearse en distintas fases de campo y de laboratorio. en la práctica. se incluyen ambos 64 Manual de biología de suelos tropicales . a diferentes escalas. Cuando la investigación es dirigida a medir respuestas económicas para decisiones de manejo (por ejemplo. Una estimación aproximada de la varianza puede ser obtenida de estudios previos. Los métodos requieren conocimiento de dos cosas: de la magnitud de las diferencias (por ejemplo. los métodos estándares están disponibles para ayudar a seleccionar el tamaño de muestra. medida de diferente manera. No obstante.Una vez que se sepa lo que hay que replicar. Aunque sean teóricamente atractivos. etc. con muchas mediciones que sólo están disponibles después de un largo periodo de muestreo en campo. 1996) permite que el diseño responda a patrones que se detecten. de tal manera que los patrones. Si bien existe cierta atracción por esta idea. pero saber qué relevancia tendrá en nuevos ambientes puede ser desconocida. pero normalmente resulta difícil especificarlos. puedan ser investigados. Una variedad de diseños a multi-escala han sido utilizados en estudios ecológicos. Otra complicación surge a partir de las respuestas multivariadas de interés. 1993) permiten continuar con el muestreo hasta que algunos criterios se cumplan. la diversidad del suelo entre dos usos de suelo) que es importante detectar. sin embargo. Queda claro que la decisión sobre el tamaño de muestra depende de esto. Por lo tanto. Los métodos estándares presumen que existe una respuesta medible de la biodiversidad del suelo que se puede utilizar para obtener el tamaño de muestra. Los patrones a escala fina requieren puntos muy cercanos. números. muchas veces no es posible especificar un tamaño de muestra que resulte importante. y la variabilidad entre réplicas del mismo uso de suelo. cuando el objetivo de la investigación es detectar y entender algunos procesos. la respuesta de un cultivo a un fertilizante) entonces es viable especificar la respuesta mínima que es importante detectar. como la diversidad de diferentes grupos funcionales. al igual que el software para iniciar el análisis. es improbable su viabilidad. requieren puntos más lejanos. biomasas y proporciones de estos grupos funciones o especies. ningún estudio real ha multiplicado las respuestas de interés. el tamaño de muestra se ha basado en una combinación de información de métodos formales (lo que puede indicar los órdenes de magnitud requeridos). La idea de estos diseños es elegir posiciones de muestreo. Enfoques secuenciales (Pedigo y Buntin. Patrones a escala más grande. y estudios previos similares y pilotos. El muestreo adaptativo (Thompson y Seber. dada la necesidad de planear campañas de campo por adelantado. Por lo tanto.

Así. ENFOQUE DE OBJETIVOS: ESTRATIFICACIÓN En la introducción de este capítulo. los estratos son áreas con diferentes usos de suelo y la idea es obtener. Cuando varios grupos de especies están siendo evaluados. y los diferentes usos de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 65 . todas las mediciones se realizan a nivel de parcela. muestras de cada uno de ellos. normalmente sólo resulta posible examinar un grupo en una muestra de suelo dada y la extracción de la muestra de un grupo. dentro de cada parcela se reúnen las muestras. El objetivo de descubrir y entender los efectos del uso de suelo en la biodiversidad del suelo. En este sentido. <10 m) no se han examinado. 2003). responde a la necesidad de contar con mediciones iguales de diferentes grupos funcionales del suelo. puesto que habría demasiadas muestras para procesar si no fuera así. Stein y Ettema. se sugiere que un buen enfoque en los objetivos de un estudio mejorará la eficiencia en su diseño e incrementará la posibilidad de lograrlos. la segunda. simplemente es práctica. de tamaños adecuados. requieren establecer comparaciones en diferentes usos de suelo. No obstante. sino de una parcela. lo que quiere decir que se mezclan varias muestras de suelo. Normalmente.y los diseños eficientes tienen una estructura en forma de conglomerado (Urban et al. quizá en un área del orden de 100 m².. esto significa que la variación y los patrones en la escala dentro de la parcela (por ejemplo. Piense en un lugar seleccionado. entonces los resultados pueden estar sesgados. antes de cuantificar la biodiversidad del suelo. Algunas veces se piensa que este enfoque puede estar “sesgado” porque los tipos de uso de suelo para tomar las muestras se determinan a priori. esto quiere decir que se tiene que medir en el mismo lugar. 2002. no en función de un punto. de manera deliberada. Necesitará muestrear dentro de toda esta parcela. para cada uso de suelo. podrá alterar otros grupos. seguramente las relaciones entre ellos son importantes. Un buen enfoque para mejorar el diseño de muestreo es el uso de la “estratificación”. el número promedio de escarabajos por m2) sin tomar en cuenta un diseño. existen dos razones para ello: una. Si los datos se usan para hacer afirmaciones sobre el área de estudio en general (por ejemplo. lo que asegura que se obtengan muestras realmente representativas. se requiere tomar muestras (ver esquema de puntos de medición abajo). pero únicamente un volumen de suelo muy limitado puede ser examinado en la mayoría de las mediciones de biodiversidad del suelo y se toman varias muestras para poder representar toda la parcela. En cada sitio de muestreo seleccionado.

pero si el objetivo es investigar los efectos de uso de suelo. El primer aspecto hace que algunos investigadores se sientan incómodos ante la idea de que una predefinición de uso de suelo para la investigación excluya el descubrimiento de patrones potencialmente importantes. Con un enfoque de muestreo estratificado. ni aquellas zonas de transición que puedan ser importantes. En un enfoque estratificado. Si un diseño de muestreo no toma en cuenta el uso de suelo. ¿dónde se encuentra el límite entre “pastizales con árboles” y “bosque secundario”?. las áreas ambiguas pueden ser excluidas del muestreo. Por ejemplo. Sin embargo. tiene que considerarse en algún momento. rasgos lineales. no es deseable excluir algunos usos de suelo. ¿cuándo se debe uno de mover a lo largo de un gradiente para incrementar la cobertura de árboles? Aquí tenemos otra ganancia potencial en la eficiencia del pensamiento a través de estos requerimientos en el diseño y no sólo en la etapa de análisis. en ausencia de alguna otra información. La predefinición.suelo pueden no estar representados en las muestras. al igual que la necesidad de definir con precisión. puesto que no habrá certeza en cómo clasificarlas. entonces existen dos prerrequisitos: 1 Se necesita saber cuáles son los usos de suelo a comparar y contar con definiciones precisas de ellos. Se requiere de un mapa de uso de suelo del área bajo estudio. podemos elegir un tamaño idóneo de muestra para cada uso de suelo. de no ser así. si el objetivo es hacer un inventario del paisaje. con frecuencias proporcionales a su ocurrencia en el área de estudio. por ejemplo. tiene sentido excluir tales sitios. a partir de las cuales no se podrán establecer conclusiones. sin embargo. entonces probablemente muchos de los sitios de muestreo seleccionados terminarán siendo posiciones ambiguas en lo que se refiere a la definición de uso de suelo. el mejor diseño es tener N/2 en cada uno de los dos grupos. el diseño no es parcial para el objetivo de comparar los usos de suelo y además es eficiente. éstos deberán ser incluidos específicamente en el muestreo. 2 Las localizaciones de estos usos de suelo deben ser conocidas. es probable que la muestra incluya únicamente algunas observaciones de estas categorías. Si los objetivos incluyen investigación en límites entre áreas de diferentes usos de suelo o de nichos raros. Si se cuenta con un total de N muestras para comparar dos usos de suelo entonces. Por supuesto. Si se emplea este enfoque. Resulta más eficiente incluirlas en un número 66 Manual de biología de suelos tropicales .

sino variables ambientales. por ejemplo. El no contar con un mapa de usos de suelo. resultan muy útiles en la práctica. Cuando se usan variables como la MOS en la estratificación. Por ejemplo. y seleccionar los sitios de muestreo de manera aleatoria. si los objetivos lo requieren. abierto al debate cuando los resultados son presentados. tales como la MOS o la frecuencia de fuego. excluirlas (dándoles un equivalente de tamaño cero).suficientemente grande. ya que existe la posibilidad de la interpretación de imágenes por sensores remotos (SR). cuando una “ventana” única se coloca en un área. influenciadas por el uso de suelo. el que estos no tengan una resolución idónea. Aunque a veces es necesario. calibrarlo en un mapa de uso de suelo. o bien. Un enfoque común no aleatorio es una selección subjetiva de los sitios de muestreo. por lo tanto. Si se toma un tamaño de muestra subjetivo igual a 1. puede ser útil hacer un monitoreo rápido de la MOS. que frecuentemente sirven como base para seleccionar unidades de muestreo a niveles jerárquicos más altos. MUESTREOS ALEATORIO Y SISTEMÁTICO Las razones esenciales para utilizar el muestreo aleatorio simple (MAS) fue descrito anteriormente y son detalladas en textos tales como Cochran (1977). la limitante de este enfoque es la posible falta de “representatividad” del área de muestreo (la medida en que los resultados pueden razonablemente ser asumidos para aplicarlos a una población más grade) porque ésta depende de la percepción del ejecutor y no. Ello queda. o en imágenes de SR y utilizar esto para definir los estratos. Nótese que muchos de estos argumentos también aplican cuando los factores hipotéticos que influyen sobre la biodiversidad del suelo. no es una limitante. de tal modo que: a) cada punto tenga las mismas posibilidades de ser seleccionado. de la propiedad inherente del diseño. no son usos de suelo per se. cuando se toman muestras en lugares considerados interesantes o importantes. algunas veces por una buena razón. los estudios ecológicos no siempre usan un muestreo aleatorio. Para la implementación del MAS es necesario delimitar el área de estudio. esto es equivalente a limitar el área de estudio. y b) la selección de un punto no cambie la probabilidad de incluir cualquier otro punto. Sin embargo. entonces dicha área queda representada por esa ventana y el hecho de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 67 . El uso de un software para ayudar en la aleatorización y un GPS para localizar los puntos de muestreo en el campo. El muestreo aleatorio estratificado requiere hacer lo mismo en cada estrato. si los objetivos no lo requieren.

que esa área sea o no, representativa dependerá únicamente de la habilidad del ejecutor. El muestreo sistemático tiene muchas aplicaciones en la ecología, usando transectos de una dimensión o cuadrículas de dos dimensiones. En el caso de los transectos, las muestras son seleccionadas en puntos que se encuentran a una distancia fija entre sí, a lo largo de una línea predeterminada. Para un muestreo de cuadrícula, una cuadrícula rectangular (usualmente) es definida en el área y las muestras son tomadas en cada punto de intersección. Las ventajas potenciales de este tipo de muestreo sistemático se derivan de la teoría y de la práctica. Las ventajas de la práctica incluyen:
• La facilidad de localizar puntos de muestreo, describir su ubicación y los medios de llegar a los puntos de muestreo; por ejemplo, el protocolo puede ser algo tan simple como “desde el punto de partida, camino al norte y muestreo cada 50 m”. • La facilidad de planear el trabajo de campo; por ejemplo, de estimar el tiempo requerido para muestrear un número fijo de puntos. La razón estadística para utilizar muestreos sistemáticos es que pueden ser eficientes (Webster y Oliver, 1990). Si se considera un estudio con el propósito de calcular la media o el total de algún parámetro (por ejemplo, el carbono total en el suelo en el área de estudio o la media de escarabajos por m2). Si la cantidad medida no es constante, una muestra que utilice la cuadrícula dará una mejor estimación que una simple muestra al azar del mismo tamaño, lo que frecuentemente es el caso de variables ambientales y biológicas. La eficiencia se basa en el hecho de que puntos cercanos son similares, por tanto, no proporcionan mucha información nueva; mientras que en la cuadrícula las muestras están de manera uniforme en toda el área de estudio. Por razones similares, el enfoque de cuadrícula resultará útil para compilar el inventario de un área bajo estudio, salvo que puede excluir nichos raros (véase abajo). Sin embargo, hay aspectos negativos: • Algunos puntos de la cuadrícula tendrían que ser excluidos del estudio, tales como caminos o cuerpos de agua. • Las cuadrículas incluyen muestras de diferentes usos de suelo, con un tamaño más o menos proporcional en cada tipo de uso de suelo. En particular, tipos de uso de suelo raros pueden ser omitidos, lo que se puede compensar moviendo
68
Manual de biología de suelos tropicales

la ventana y añadiendo puntos, aunque el proceso podría llegar a ser arbitrario y subjetivo. • Algunas veces no es posible caracterizar el uso de suelo claramente en cada punto de muestreo. Estos puntos están relacionados con el problema discutido en la sección “enfoque de objetivos: estratificación”. Si el objetivo del estudio es comparar clases de uso de suelo, entonces el muestreo por cuadrícula, a veces, no los captura de forma óptima, de manera que las cuadrículas y los transectos probablemente son más apropiados para muestrear la biodiversidad del suelo, cuando a) no existe ningún objetivo explícito o hipótesis que involucre comparaciones o relaciones con variables ambientales, o b) la hipótesis se refiere a una unidad espacial de un nivel más alto que la escala en que el muestreo por cuadrícula o por transecto fue hecho. Por ejemplo, Swift y Bignell (2001) recomiendan transectos de 40 m de largo, pero éstos quedan dentro de cada clase de uso de suelo. Cuando se comparan usos de suelo, se hacen réplicas de los transectos y se asignan aleatoriamente los estratos definidos por diferentes usos de suelo. De esta forma, el muestreo sistemático por cuadrícula o transecto, normalmente, es combinado con un muestreo aleatorio. Por ejemplo, puede haber varias cuadrículas definidas como se aprecia en la Figura 2.2d, con una localización y orientación hecha al azar. De manera similar, el punto de inicio y la orientación de los transectos que se repiten pueden ser hechos aleatoriamente. Los transectos también pueden ser útiles cuando se alinean con gradientes ambientales considerados importantes; esto se conoce como “gradsectos” (Wessels et al., 1998). Con la aleatorización en algún nivel en la jerarquía, es posible hacer un análisis estadístico basado en las propiedades aleatorias del diseño; por ejemplo, si un número de cuadrículas pequeñas es colocado aleatoriamente en el área de estudio, entonces contamos con las réplicas necesarias para establecer una consistencia, a través de patrones encontrados. El análisis estadístico elegido para una muestra tomada en un diseño sistemático no puede estar basado en la aleatorización, porque los sitios no fueron seleccionados de manera independiente dentro de cada cuadrícula. Existen dos posibles enfoques para el análisis: el primero asume que los datos se comportan de forma aleatoria (por ejemplo, las propiedades estadísticas son las mismas, como si el punto hubiera sido localizado aleatoriamente); el segundo, es utilizar un modelo explícito de patrones espaciales. En la mayoría de los análisis que buscan relaciones entre variables ambientales y la biodiversidad del suelo se usa el primer análisis,
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

69

principalmente, porque las alternativas son complejas. Las consecuencias de suponer esto son raramente investigadas. Es claro que la distancia y el tamaño total de la cuadrícula determinan la escala de los patrones que pueden ser detectados. No es posible observar patrones (por ejemplo, agregación de la biodiversidad del suelo) a escalas espaciales menores que las distancias entre los puntos de la cuadrícula; de la misma manera, tampoco será posible detectar patrones más grandes que el tamaño total de la cuadrícula. Sólo se pueden reconocer los patrones cuando existen varias repeticiones dentro de la misma cuadrícula. Es este aspecto de escala de patrones, definido por los objetivos del estudio, el que debería determinar los espacios y el tamaño total de la cuadrícula. Algunas veces se sugiere que los espacios deben ser de tal manera que los puntos vecinos no estén correlacionados. Esta noción de correlación espacial es importante, pero también confusa. La correlación entre las mediciones de una determinada distancia, no es una cantidad absoluta, pero es una medida relativa a un promedio (técnicamente, el problema tiene que ver con el recambio). Para poder ver esto, piense en analizar datos de una sola ventana en Kenia, donde los puntos de una distancia de más de 200 m entre sí, pueden no indicar similitud en la biodiversidad del suelo, pero si juntamos los datos con otra base de datos global se esperaría encontrar similitud, no sólo en los puntos que pertenecen a una misma ventana, sino entre todos los puntos dentro de Kenia. HABLANDO DE VARIABILIDAD La experiencia de estudios pasados sugiere que se debería de esperar un alto nivel de variación en muchas de las mediciones principales de la biología del suelo. Aún cuando se trata de distancias cortas, se puede esperar una variación grande en número y diversidad de diferentes grupos funcionales. En paisajes agrícolas tropicales la variación dentro de una categoría de uso de suelo puede ser debida a las prácticas de manejo, la variación en las características de la vegetación, las diferencias históricas en el uso de suelo de la parcela, efectos de borde, posición topográfica y características biofísicas. Si los métodos formales para determinar los requerimientos del tamaño de muestra fueran seguidos, probablemente indicarían un tamaño de muestra mucho más grande de lo es viable o costeable, ¿Qué se debe hacer entonces? Primero, ¡no tiene sentido no hacer nada! Simplemente, si se sigue con un tamaño de muestreo preconcebido, no se alcanzarán los objetivos; si el plan original fue
70
Manual de biología de suelos tropicales

trabajar con diez muestras por cada uso de suelo dentro de un sitio de referencia, y las indicaciones son que se necesitan alrededor de 100 muestras por cada uso de suelo, no tiene sentido continuar, puesto que se terminarán obteniendo resultados vagos y no concluyentes, los cuales se traducirán en errores estándares altos y sin efectos significativos cuando se analizan los datos. Tres son las posibles opciones: 1. Incrementar el tamaño de muestra. 2. Utilizar métodos de muestreo para reducir la variabilidad. 3. Reducir la amplitud del estudio. La primera opción no resulta práctica en la mayoría de los casos, pues siempre hay limitaciones de tiempo, dinero, recursos y experiencia. Existen varios métodos para reducir la variabilidad de las muestras; los más útiles consisten en la estratificación y la congruencia. Nótese que el uso del término “estratificación” se usa para el muestreo, pero es diferente a cómo se aplica en “enfoque de objetivos: estratificación” (arriba). Si algunas fuentes de variabilidad pueden ser previstas, éstas pueden ser usadas para definir estratos y removerlas del análisis. Por ejemplo, si el sitio de estudio cubre un rango de altitudes, se puede esperar una variación en la biodiversidad del suelo dependiendo de la altitud. La estratificación, entonces, divide el sitio de estudio en zonas de altitud y los sitios de muestreo dentro de cada una de ellas. En esta fase del análisis de datos, la variación de los usos de suelo se compara dentro y entre estratos para no oscurecer los resultados. Este enfoque requiere que algunos (no todos) de los diferentes usos de suelo estén localizados dentro de zonas de altitud. Si el uso de suelo únicamente varía con la altitud, entonces los dos factores están confundidos y sus efectos en la biodiversidad del suelo no se distinguen. Dado que existe una variación ambiental, la variabilidad en la biodiversidad del suelo estará en respuesta a la variación ambiental. Consecuentemente, los estratos pueden ser útiles para definir puntos de muestro cercanos geográficamente. Las ventanas en la figura 2.2 pueden ser vistas de esta manera. Comparar conlleva la idea de la estratificación a un extremo. Imagine que si dos de los usos de suelo a comparar son bosque y campos de maíz, se puede esperar que la biodiversidad del suelo dependa de muchas variables ambientales, tales como el clima, topografía, y geología. Estas variables ambientales varían típicamente de manera irregular, con sitios cercanamente similares. De esta manera, si seleccionamos parcelas de bosque y maíz que están cercanas, las diferencias entre ellas, principalmente, se deberán al uso de suelo y no, a otros factores, lo que nos
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

71

permite eliminar las variables que “meten ruido” en el análisis. Entonces, el enfoque sería identificar y muestrear, por ejemplo, diez pares de sitios, donde cada par esté formado por parcelas de bosque y maíz cercanas, situadas a cada lado de un lindero de uso de suelo. Formalmente, cada par constituye un estrato de tamaño 2. Más de dos usos de suelo pueden incluirse en el diseño. Las ideas de diseño para experimentos de bloques incompletos son relevantes para seleccionar pares de usos de suelo similares. Controlar la variabilidad mediante la reducción del área de estudio, muchas veces es la mejor solución. El área podría ser reducida, si se reduce el tamaño del sitio de muestreo, reduciendo naturalmente la heterogeneidad, lo que puede ser insatisfactorio porque también reduce la generalidad de los resultados. Si únicamente tomamos muestras en un área pequeña, entonces no existe una base para asumir que se han encontrado patrones ampliamente aplicables. Otras maneras de reducir el ámbito del sitio de estudio son: No incluir todos los usos de suelo encontrados en el área de estudio, sino una selección que cubra un gradiente de intensidades de uso de suelo o que represente alguna transición típica en el uso de suelo. Ajustarse a la definición de una clase de uso de suelo. Por ejemplo, en lugar de tomar un “campo de maíz” como uso de suelo, se podrá limitar la atención a campos de maíz que han sido cultivados continuamente durante los últimos diez años, que no han sido fertilizados en los últimos tres años y que son trabajados con azadón. Evitar tomar muestras en sitios ambiguos, como aquellas que se encuentren cerca de linderos. Mientras esto ayudará a detectar y medir el efecto de la intensidad de uso de suelo en la biodiversidad del suelo, pueden ser inconsistentes con los objetivos del inventario de las especies. Un compromiso entre los dos objetivos puede ser necesario. Esto es común en el diseño de proyectos y, en resumidas cuentas, no se puede esperar encontrar todo en un tamaño limitado de muestra. ESQUEMA DE MEDICIÓN DE PUNTOS Una vez localizados los puntos de muestreo, tiene que ser definido un protocolo de medición, lo que implica la necesidad de un muestreo adicional. El esquema básico
72
Manual de biología de suelos tropicales

de muestreo por puntos adoptado por el CSM-BGBD se presenta en la Figura 2.3, que a la vez se complementa con la Tabla 2.1. Aunque el esquema de medición utilizado para el muestreo de grupos funcionales que son descritos por los procedimientos del proyecto alternativas de roza, tumba y quema (Swift y Bignell, 2001), es diferente de lo que fue propuesto por Swift y Bignell para adecuarse al enfoque basado en la cuadrícula. Por ejemplo, los pocos monolitos en cada punto de muestreo son compensados por el gran número de puntos de muestreo, que resulta en aproximadamente el mismo número de eventos de muestreo. No obstante, los resultados preliminares han indicado que con un pequeño monolito por punto de muestreo no todas las especies pueden ser capturadas. Si éste es el objetivo para llevar a cabo el muestreo, se prevén opciones adicionales para incluir monolitos más grandes. Macrofauna: un solo monolito, trampas de caída (pitfall) y, por lo menos un transecto de 20 m son colocados en cada sitio de muestreo. El muestreo por transectos se amplía para incluir hormigas y escarabajos, en adición a las termitas. En un esquema alternativo adicional los monolitos pueden ser excavados para mejorar el muestreo de lombrices de tierra y se puede introducir un sistema simple para tomar muestras de termitas. Nótese que en las parcelas pequeñas, los sistemas de cultivo pueden estar altamente disecados o los terrenos son difíciles, por lo tanto, no es necesario que el transecto sea lineal. Un transecto puede tener un ángulo de 90 grados, y muestrear parcelas de forma irregular o para evitar arroyos, fuertes pendientes o rocas. Los árboles caídos deben incluirse en el transecto si estos quedan sobre la línea (Swift y Bignell, 2001). Mesofauna: 12 extracciones de suelo tomadas en círculos concéntricos alrededor de un solo monolito a 3 y 6 metros de radio, y extraídas utilizando el método Berlese. Adicionalmente, las trampas pitfalls sin cebo abiertas durante un periodo de 24 horas sirven para colectar mesofauna y macrofauna que viven en la superficie. Las trampas pitfalls generalmente son apropiadas para hormigas, algunos escarabajos, algunos saltamontes, milpiés y arañas. Muestras de suelo extraídas con sacabocado por el método de Berlese contienen colémbolos, ácaros y en sitios húmedos enquitreidos. Microfauna: muestreos con sacabocado de manera similar en 12 extracciones de suelo de dos círculos concéntricos, a 3 y 6 metros de radio del monolito. La “microfauna”, principalmente se refiere a nematodos, aunque también a pequeños ácaros (y larvas de ácaros) extraídos de las muestras de suelo; por el método Berlese pueden cuantificarse.
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

73

Figura 2.3 Esquema de muestreo por puntos para toda la biota. El muestreo se puede ampliar si se usa uno o dos transectos para termitas, hormigas y escarabajos, mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.

Monolito Núcleo de suelo para mesofauna Núcleo de suelo para nemátodos y microbios Muestras para análisis físicoquimicos Transecto 1 m2 para muestra de hojarasca (Winkler) Trampa pitfall

Microsimbiontes y hongos del suelo: muestreos de manera similar mediante 12 extracciones de suelo con sacabocado, puestas en dos círculos concéntricos alrededor de un solo monolito, a 3 y 6 metros de radio. Parámetros físicos y químicos del suelo: cuatro extracciones de suelo con sacabocado puestas en un círculo de 6 metros de radio de un monolito. En el caso de estudios de co-ubicación, una extracción adicional de suelo puede tomarse de la pared exterior de la zanja del monolito (véase Capítulo 3, muestreo de macrofauna). En un esquema alternativo (Figura 2.4) los usos de suelo pueden ser muestreados por una combinación de monolitos principales y subsidiarios, transectos de 50 metros, cuadrantes de hojarasca espaciadas y trampas pitfalls. El muestreo casual alrededor de los transectos puede ser empleado y también trampas Malaise colocadas para capturar insectos voladores mayores. El protocolo difiere de la propuesta anterior, en lo concerniente a los puntos del transecto, cuadros de hojarasca, trampas pitfalls y monolitos subsidiarios colocados en líneas paralelas de 50 m, con una separación lateral de 10 m. Este protocolo debe ser tomado básicamente como una extensión del propuesto anteriormente y se considera aplicable en donde se le dé más importancia al muestreo de todas las especies que existen dentro del área y en los casos donde la frecuencia de muestreo es baja (número de parcelas muestreadas) por las razones explicadas anteriormente. Estas modificaciones
74
Manual de biología de suelos tropicales

resultan más adecuadas cuando se encuentran diferentes usos de suelo en todos los sitios. CONSIDERACIONES PRÁCTICAS EN LA ORGANIZACIÓN DEL TRABAJO DE CAMPO La colecta de muestras o la medición directa en el campo deberían, en la medida de lo posible, realizarse de forma secuencial y durante una sola salida. En el caso de parámetros físicos y químicos del suelo que permanecen estables en el tiempo, el muestreo puede hacerse en un momento diferente. Lo anterior, por supuesto, no se aplica en el caso de características dinámicas del suelo, por ejemplo, el contenido de agua en el suelo.
Figura 2.4 Esquema alternativo para muestrear macrofauna, utilizando un transecto de 50 m.
Extracción Winkler Transecto Mini-monolito

Trampa pitfall Monolito adicional
12 muestras de suelo (12 x 12 x 10 cm)
MS MS MS MS

Monolito principal 10 m

10 m 10 m 5m 50 m
MS MS MS

MS MS

Monolito adicional

MS MS MS

30 cm Hormigas de hojarasca Hormigas endogeas Termitas

2m

D iseño

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

75

Tabla 2.1 Grupos de organismos del suelo colectados utilizando diferentes métodos de captura.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Manual de biología de suelos tropicales
Suelo Mesofauna Descripción X X X X X X X X

76
Trampas pitfall con cebo* - 3 trampas por punto de muestreo. Las trampas se deben quitar después de 48 horas en campo. Transectos semi-cuantitativos 2 x 20 m uno por punto de muestreo, perpendicular a la pendiente Trampas Winkler para muestras pequeñas de hojarasca (1 x 1 m) a lo largo del transecto, 3 Winkler por punto de muestreo Núcleos de suelo con hojarasca (3.5 x 3.5 x 5 cm),12 submuestras por punto de muestreo (profundidad de 0-5 cm). Para mesofauna se hace una muestra compuesta (1er opción), o 4 muestras compuestas por 3 submuestras de cada cuadrante (segundo opción) o 3 muestras compuestas por 4 submuestras. Núcleos de suelo para microbios de 0-20 cm de profundidad sin hojarasca. En círculos a 3 y 6 m, del punto de muestro, una muestra compuesta de 12 submuestras por punto de muestreo.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

Trampa (pitfall)

X

X

X

Transecto

X

X

Trampa Winkler

X

X

X

Embudo de Berlese

X

X

X

Varios

Tabla 2.1 Continúa.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Monolito X

X

X

X

X

X

X

Mesofauna

D iseño
Suelo Descripción Monolito (25 x 25 x 30 cm), incluyendo hojarasca, una muestra por punto método TSBF. Muestra de suelo, una muestra compuesta de suelo por al menos 4 submuestras para análisis físicos y químicos, profundidad 0-10; 10-20; 20-30 cm.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

*Nota.- El cebo sugerido para las trampas pitfall es excremento de monos o de humanos, el cual es muy efectivo para extraer escarabajos coprófagos (Coleoptera) y, al mismo tiempo, no interfiere con la captura de escarabajos saprofíticos (Scarabaeidae, Aphodidae, Trogidae) y predadores (Sistiridae, Staphilinidae). El excremento de omnívoros, resulta más adecuado, en el caso de áreas de selva tropical porque los omnívoros predominan en estos ambientes

77

La colecta de muestras de los principales grupos funcionales de organismos del suelo, requiere de la colaboración de mucha gente en cada punto de muestreo, con el riesgo de lastimar el cultivo en pie, al igual que afectar el inventario, especialmente de aquellos organismos con alta motilidad o sensibles a la intromisión humana. Por ejemplo, las lombrices de tierra epígeas y algunos tipos de termitas comedoras de tierra son sensibles al disturbio, y especialmente a las pisadas, por lo que se alejarían rápidamente. Por lo tanto, es importante reducir el número de personas involucradas en la colecta de las muestras, aunque se necesita un número suficiente de manos para poder manejar y procesar las muestras. Durante el entrenamiento de técnicos y asistentes de campo, es necesario prestar atención a los riesgos que pudieran surgir en cada grupo específico de organismos de suelo. El riesgo de contaminación cuando se trata de microorganismos debe ser entendido y la importancia de utilizar procedimientos adecuados para evitar la contaminación debe ser enfatizada, especialmente en las personas inexpertas. El mismo principio rige cuando existe la posibilidad de que dichos organismos escapen de los sitios de muestreo, como consecuencia de una severa perturbación. Otra preocupación es el gran volumen de suelo que será colectado durante el muestreo y la necesidad de reducir dicho volumen para transportarlo. Desde este punto de vista, la extracción de especímenes de las muestras se hace mejor en, o cerca, del sitio de muestreo. También, en el sitio de muestreo se deben agrupar todas las muestras y extraer sub-muestras para su posterior análisis. El tiempo y la temperatura a la que se almacenan las muestras juegan un papel importante, dado que muchos organismos del suelo pueden morir a temperatura ambiente, en la superficie del suelo, o cuando son guardados en bolsas o contenedores durante unas cuantas horas. Para poder evitar dichos riesgos es importante identificar una instalación local adecuada antes de colectar las muestras o, hacer la extracción inmediata in situ de los especímenes. En algunas ocasiones, por ejemplo, el embudo de Berlese para la mesofauna y de Winkler para la extracción de hormigas y escarabajos de la hojarasca, pueden instalarse en el campo para su uso inmediato; en otros casos, cuando los organismos necesitan ser cultivados in vitro o cuando las propiedades del suelo necesitan ser determinadas, es necesario disponer de un transporte rápido para su traslado hacia el laboratorio. Bajo ninguna circunstancia las muestras deberán permanecer bajo el sol, ni aun cuando el protocolo de extracción requiera de un secado final de la materia. Otros detalles sobre las precauciones a tomar en cuenta y consejos
78
Manual de biología de suelos tropicales

sobre la logística general, se pueden encontrar en los capítulos que tratan grupos y métodos específicos.

MUESTREO EN EL PROYECTO CSM-BGBD
La jerarquía de muestreo
En el proyecto fueron seleccionadas áreas de siete países tropicales, con el propósito de evaluar la pérdida de biodiversidad del suelo con el incremento en la intensidad del uso de suelo. Los sitios se localizaron en las principales regiones biogeográficas de los trópicos, desde la selva tropical húmeda Amazónica hasta la selva montañosa del Himalaya, en la India; áreas que presentan una biodiversidad global importante. Cada sitio incluyó un intervalo de usos de suelo desde selvas prístinas relativamente no perturbadas, hasta tierras agrícolas sometidas a uso intensivo, para determinar tendencias comunes, que puedan ser observadas en el cambio de la biodiversidad del suelo en relación con la intensidad del uso del suelo. El uso de métodos estándares de muestreo en los países y sitios de estudio, permite hacer comparaciones entre los sitios. Se adoptó un enfoque para el muestreo dentro de los sitios que hace uso del muestreo por medio de ventanas. Una ventana es (usualmente un rectángulo) una parcela de tierra que incluye en el estudio varios usos de suelo locales y se consideran “representativos” de los sitios de estudio. Típicamente, las ventanas miden entre 2 y 5 km²; estas ventanas de muestreo varían en tamaño y número debido a la configuración del uso del suelo en cada sitio, y sólo se presentó un caso donde el acceso fue problemático. Por ejemplo, se utiliza una ventana más grande para incluir los usos de suelo relevantes en el área y hasta seis ventanas más pequeñas se distribuyen dentro del área para los diferentes usos de suelo requeridos. Una cuadrícula regular (con espacios variables, véase a continuación) se utiliza para identificar un conjunto de posibles puntos de muestreo dentro de cada ventana; los puntos corresponden a las intersecciones de las líneas en la cuadrícula. El muestreo de cuadrícula se usó por las razones descritas anteriormente, eficiencia estadística y para racionar el trabajo de campo. Además, el inventario es de naturaleza exploratoria, sin tomar en cuenta la hipótesis general formulada, pues quedan pendientes las siguientes preguntas: ¿cuáles de los factores que determinan las prácticas intensivas de uso de suelo influyen en la distribución y riqueza de la biota del suelo? y, ¿a qué escala los patrones de distribución espacial se manifiestan? Este
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

79

enfoque es similar al usado para el proyecto de BioAssess, financiado por la Unión Europea, cuyo objetivo, similar al de éste proyecto, fue evaluar la biodiversidad en función de la intensidad del uso del suelo en paisajes agrícolas (véase Ponge et al., 2003; Federoff et al., 2005). La biodiversidad del suelo se muestrea en el nivel de parcela (punto de muestreo o sitio). La cuadrícula define una serie de parcelas, con un objetivo de cerca de 100 a 200 parcelas por ventana. La parcela es un área de, por lo menos, 25 x 25 m determinada por el área mínima requerida para colectar todas las muestras necesarias y realizar su medición, tal y como se describió anteriormente. El principio de co-ubicación es adoptado para análisis de muestras físicas y químicas del suelo y para los inventarios de la biodiversidad del suelo. Al mismo tiempo las ventanas permiten comparar la biodiversidad del suelo entre los componentes del paisaje.

Localización y definición de las ventanas de muestreo y cuadrícula
La posición de las ventanas dentro del sitio de estudio se hace de tal modo que abarque los diferentes usos de suelo. Generalmente, una ventana no puede abarcar los diferentes usos del suelo, por lo que son necesarias otras ventanas más pequeñas. La Figura 2.5 describe las distintas configuraciones utilizadas. La Figura 2.5a ilustra el uso de una ventana de 9 x 11 puntos de muestreo (además de algunos puntos adicionales de muestreo). La figura 2.5b ilustra el uso de 6, 3 y 2 ventanas separadas. En el caso donde se usan seis ventanas separadas, una ventana medirá 1 km², dependiendo de la distancia entre los puntos de la cuadrícula. En sitios caracterizados por fuertes pendientes se esperaría que el gradiente del uso del suelo esté orientado en la misma dirección, y las ventanas estarán entonces localizadas a lo largo del gradiente (Figura 2.5b). En los linderos de la selva en los trópicos, frecuentemente se observa que el patrón de distribución de usos de suelo refleja un gradiente de intensidad de uso de suelo, con un uso más intensivo a mayor distancia de la selva. En tales casos, las ventanas de muestreo se localizan a lo largo de tal gradiente. Se necesita, por lo tanto, contar con suficientes conocimientos de la región antes de seleccionar los sitios de muestreo. Cuando algunos gradientes no son obvios, la selección de las ventanas deberá cubrir dos o tres de los usos de suelo más importantes y, por tanto, también las transiciones observadas con mayor frecuencia de un tipo a otro tipo de uso de suelo. Por ejemplo, en los márgenes del bosque puede darse la transición de bosque a pastizal, bosque a tierras de cultivo o bosque a grandes plantaciones, en donde
80
Manual de biología de suelos tropicales

tres y dos ventanas. Esto permitirá un análisis comparativo de transiciones de uso de suelo (por medidas relativas). se introduce un elemento de replicación.5 Ejemplos de diferentes configuraciones de ventanas de muestreo. Figura 2. Mapas detallados de uso de suelo y de vegetación también son adecuados para este propósito. Para la selección de las ventanas de muestreo se utilizaron fotos aéreas o imágenes de satélite de alta resolución. dentro de una ventana definida puede ser determinada utilizando software de Sistemas de Información Geográfica (SIG) estándar. a) cuadrícula completa. b) ilustración de la división de una cuadrícula entre seis. lo que facilitará la selección de las ventanas. Número de parcelas de muestreo y tamaño de la cuadrícula El número total de puntos de muestreo por área de referencia se mantiene fijo entre 100 y 120. variaciones topográficas o climáticas. Cuando únicamente están disponibles materiales análogos. dispuestas a lo largo del gradiente. De esta forma. con puntos de muestreo adicionales. mientras minimiza los cambios en la biodiversidad del suelo que surgen de los diferentes usos.una ventana cubre cada transición típica de uso de suelo. se hace una selección manual por interpretación visual. según se requiera. el área ocupada por cada uso de suelo. utilizando un papel traslúcido sobre la fotografía. Cuando se encuentran disponibles mapas digitales de uso de suelo. Lo anterior se obtiene mediante varias configuraciones de ventana(s) D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 81 . antes que un cambio de uso de suelo per se.

En este sentido Swift y Bignell (2001) argumentan.de muestreo y las dimensiones de las cuadrículas. 2003) recomienda un número similar de puntos de muestreo. 2001) tendrá un esfuerzo de muestreo comparable. un transecto de 40 x 5 m. en el caso de por lo menos algunos de los grupos funcionales (ej. La captura adicional de especies requiere de un esfuerzo de muestreo considerable.. del cual un mínimo de cinco monolitos son cavados para muestrear la macrofauna y cinco muestras conjuntas para los microsimbiontes. por lo menos. más puntos en la misma parcela). De esta manera. el número de puntos de muestreo deberá incrementarse de 5 a 8 por transecto (es decir. termitas). descritos anteriormente. 2002. el diseño 82 Manual de biología de suelos tropicales . En un muestreo basado en transectos la idea de replicación recomendada por Swift y Bignell (tres transectos por cada uso de suelo) casi nunca se logra. En este último. Eggleton et al. Se añaden puntos de muestreo donde el uso de suelo es altamente variable. en parte por consideraciones logísticas. cada uso de suelo es evaluado en. 2003). Con 100 a 200 puntos por área de referencia generalmente se llega al punto donde la curva de acumulación de las especies para grupos de macrofauna es asintótica. el proyecto BioAssess (Ponge et al. dando un total de 90 a 105 monolitos muestreados (y el mismo número de muestras agrupadas para evaluar los microsimbiontes) aproximadamente igual al número de puntos en la cuadrícula. La principal diferencia con el enfoque de muestreo de cuadrícula. Los resultados del inventario del proyecto CSM-BGBD indican que es necesario un esfuerzo mínimo de muestreo de 100 a 120 puntos para poder capturar la mayoría de las especies dentro del sitio. termitas y hormigas). y el procedimiento recomendado por el proyecto ASB (Swift y Bignell. que para incrementar la confiabilidad de los datos del esquema basado en transectos. Por ejemplo.. El número total de puntos de muestreo concuerda con otras estrategias de muestreo propuestas en ejercicios similares de evaluación de la biodiversidad. es que únicamente se toma un monolito y una muestra agrupada para los microsimbiontes por parcela. Mientras el tamaño de muestra sigue siendo más o menos igual en los transectos y cuadrículas.. otra opción es ensamblar de una manera sinóptica por combinación de transectos a lo largo de diferentes años o en proyectos no relacionados (ej. suponiendo que existan entre seis y siete usos de suelo distintos por cada área de referencia (correspondientes a seis o siete clases de usos de suelo generalmente definidos en el sistema de clasificación de usos de suelo) donde cada uso de suelo es muestreado por tres transectos. el esfuerzo de muestreo promedio probablemente varía. con un transecto extendido en el caso de algunos grupos (por ejemplo. Davies et al.

Con menos categorías de uso de suelo presentes. normalmente no todas las especies son capturadas y hará más difícil demostrar las diferencias en biodiversidad del suelo entre los tipos de usos de suelo que normalmente se caracterizan por una alta variabilidad en la riqueza de especies. Reducir el número de puntos de muestreo por categoría de uso de suelo mientras se mantiene el número de categorías de uso de uso de suelo investigado puede comprometer el objetivo de obtener resultados estadísticamente verificables. un promedio alrededor de 15 puntos por clase de cobertura de suelo resultan de muestrear la cuadrícula.de muestreo se ajusta a los objetivos del inventario del área de estudio. 1998). el número de puntos por categoría de uso de suelo aumenta. La experiencia del proyecto CSM-BGBD indica que el procesamiento de 100 a 120 muestras es viable con los recursos generalmente disponibles. es importante considerar el número mínimo de puntos requeridos para cada categoría de uso de suelo. Número de puntos de muestreo por categoría de uso de suelo Con seis o siete tipos de uso de suelo en cada área determinada. identificación y catalogación de especímenes son los pasos que requieren mayor tiempo en el proceso (Lawton et al. restringir el número de usos de suelo de manera que el esfuerzo total sea compatible con la capacidad de procesamiento. Si la capacidad para procesar y analizar esta cantidad de muestras no está disponible. en lo que concierne a la evaluación de la diversidad de especies. En números pequeños o en una distribución irregular de puntos de muestreo en los diferentes usos de suelo.. el procedimiento correcto para reducir el número total de puntos de muestreo deberá ser estimado. El número de muestras requeridas por uso de suelo deben ser representativas de la biodiversidad del suelo presente y entonces. basándose en otros datos o en un estudio piloto. historia. Se le da prioridad al tipo de agricultura de subsistencia a la hora de incrementar el número de muestras porque es precisamente en esta categoría dónde se espera que ocurra una mayor variación debido al manejo. Se aconseja hacer una prueba piloto para informar el diseño de muestreo. etc. pero aun así se requiere de una campaña organizada en el campo y de instalaciones establecidas para poder procesar y analizar las muestras. La colecta de muestras rara vez es el paso que limita la evaluación de la biodiversidad porque la extracción. si esta prueba confirma alta variabilidad en la biodiversidad del suelo dentro de las D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 83 . Dado el alto nivel de variación en las medidas de los componentes de la biodiversidad del suelo.

El enfoque de la cuadrícula asume un acceso libre al terreno o parcela donde se localizan los puntos de muestreo. seleccionar las clases de uso de suelo que cubren un claro gradiente en intensidad de usos de suelo. Posteriormente. deberán hacerse algunos intentos para aleatorizar la selección de los puntos originales para ser divididos en dos. se aplica un procedimiento no-sesgado para restar un número de puntos que permitan contrarrestar el incremento en el número total de puntos de muestreo que resulta de ampliar la cuadrícula. De la misma manera. Una estrategia es usar una “cuadrícula estratificada” según lo ilustrado en la Figura 2. donde la distancia mínima entre puntos necesita ser respetada. Para este propósito. se define una cuadrícula mayor (resaltando el número de intersecciones).categorías de uso de suelo. La definición de un sistema de clasificación de uso de suelo se detalla en el Capítulo 11. Esto implica adoptar un nivel más alto de detalle en el sistema de clasificación de uso de suelo y. La segunda opción es seleccionar puntos adicionales dentro de las ventanas entre los puntos existentes de la cuadrícula para aquellas categorías de uso de suelo que están siendo muestreadas. Adaptación del enfoque de muestreo a condiciones de campo Hay dos estrategias disponibles para asegurar una representación de los usos de suelo y clases de cobertura en el muestreo. se necesita una 84 Manual de biología de suelos tropicales .6. se puede partir de una cuadrícula vacía (que únicamente contenga posibles puntos de muestreo).5a. Esta opción se puede observar en la Figura 2. Cuando éste no es el caso. entonces se hace un ajuste de la definición de clases de uso de suelo. Este procedimiento permitirá eliminar los puntos que caigan en tipos de uso de suelo no especificados. Aunque la inserción de puntos adicionales es conveniente. con el propósito de seleccionar aleatoriamente puntos de muestreo para cada categoría de uso de suelo. Esta estrategia implica incluir ventanas de muestreo irregulares. mientras se cumplen los requerimientos para el número mínimo de puntos de muestreo para cada categoría de uso de suelo. Para poder seleccionar o eliminar sitios de muestreo (parcelas) es necesario conocer los usos de suelo en cada punto de la cuadrícula y se requiere de un inventario de uso de suelo previo al muestreo de la biodiversidad del suelo. de forma separada hasta que se cumpla con el requerimiento del número mínimo de puntos de muestreo. de acuerdo con los principios detallados en “Hablando de variabilidad” (arriba). de tal manera que se cumpla el criterio para un mínimo número de puntos de muestreo en cada uno de los tipos de uso de suelo. posteriormente.

Distancia entre los puntos de muestreo La distribución de los organismos del suelo puede reflejar gradientes. debido al aislamiento de las comunidades. estrategia de muestreo alterna. colocando una cuadrícula fija dentro de dichas ventanas. por ejemplo. con D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 85 .6 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. Los patrones de distribución de los organismos del suelo puede correlacionarse con la topografía. En este caso las tierras seleccionadas fueron aquéllas que pertenecían a agricultores que sí permitieron el acceso y se adoptó un patrón específico para muestrear dentro de estas tierras. Por ejemplo: en un área determinada en México. En el área determinada en La Amazonia en Brasil. el acceso a las tierras de los agricultores estuvo restringida. aquéllos de carbono orgánico y prácticas de cultivo. en lugar de utilizar una cuadrícula regular que cubriera un área mayor. de una a tres ventanas fueron colocadas en cada comunidad disponible.Figura 2.

o bien. atravesar de un punto a otro. No obstante. con parcelas muy pequeñas (menos de 0. se debe considerar aumentar la distancia entre los puntos. Existen varias teorías para explicar la riqueza extremadamente alta de las comunidades del suelo y el bajo grado de especialización en recursos. Por otro lado. al mismo tiempo permite. En el caso del proyecto de la biodiversidad del suelo. en el caso de paisajes altamente fragmentados. el muestreo en cuadrícula permite examinar patrones espaciales a escalas entre la distancia inter-muestra y el tamaño de la cuadrícula. si las parcelas individuales miden más de dos a cuatro hectáreas. que las termitas siguen patrones espaciales en un intervalo de hasta 330 m y que la distribución de especies de nematodos muestra tamaños de parches entre 6 a 80 m. los espacios en la cuadrícula fueron reducidos en el área determinada en Brasil. la investigación de la distribución de patrones específicos no representa un objetivo deseado. Una distancia de 200 m parece aceptable porque permite un área relativamente mayor de muestreo a través de la cuadrícula y es probable que refleje los usos de suelos más dominantes en la muestra. razón por la que no fueron considerados esquemas de muestreo adecuados para llevar a cabo un análisis de la distribución espacial. vegetación secundaria muy densa dentro de parcelas barbechadas). Por estas razones. con la ubicación de árboles individuales. anidadas en estructuras más grandes.los parches de vegetación. Al mismo tiempo reduce la dependencia espacial de las observaciones para la mayoría de los principales grupos de organismos del suelo. Sin embargo. 2001). En la literatura se pueden encontrar varios ejemplos de la estructura espacial de la biota de suelo sobre distancias de menos de un centímetro hasta de cientos de metros en el campo. se pueden reducir los espacios en la cuadrícula. tales como las lombrices de tierra. También se registra una distribución parchada en una escala miniatura de centímetros a metros. Ettema y Wardle (2002) mencionan que la biomasa microbiana y los colémbolos son espacialmente dependientes en intervalos de más de 200 m. reproducción y competencia (Lavelle y Spain.5 ha) y donde no es posible atravesar (ej. a 100 m. 86 Manual de biología de suelos tropicales . con gradientes de recursos del suelo. en la Amazonia. en la mayoría de los casos. dependiendo de los organismos implicados. con muchos grupos diferentes de organismos del suelo estudiados. la distribución y agrupación de organismos de suelo también son gobernadas por fuerzas intrínsecas de procesos poblacionales tales como dispersión.

lo indicado será incluir una descripción detallada de uso y cobertura del suelo. duración de secas y la precipitación acumulada hasta la fecha de muestreo. las condiciones bióticas y abióticas. la información sobre la precipitación anual. asumir que una categoría de uso del suelo está en una escala correcta para acomodar su variación puede ser incorrecto. uso de químicos. cationes D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 87 . pF (tensión de humedad del suelo). Existn un número de factores interrelacionados: bióticos y abióticos (ej. pendiente y aspecto.Inventario de uso del suelo y caracterización del sitio La hipótesis central plantea que la mayor variación en la biodiversidad del suelo está asociada con la diferencia en la intensidad de usos de suelo. como parte del proceso del inventario. la diversidad del suelo es inventariada independientemente a lo largo de un gradiente de intensidades de usos de suelo para cada área seleccionada. con referencia especial al uso del suelo también es importante de conocer (aunque no siempre se cuenta con este dato). La definición de clases de uso de suelo resulta importante y se discute en el Capítulo 11 de este manual. textura (la proporción arcilla/arena/limo). Al mismo tiempo. junto con la altitud. La historia del sitio. materia orgánica del suelo) y características de manejo (tipo de labranza. así como las características de uso y manejo del suelo pueden variar considerablemente entre regiones. diversidad de plantas. etc. El conjunto básico de las propiedades físicas y químicas del suelo debería incluir densidad aparente. a fin de permitir un análisis completo de los datos para identificar los parámetros que explican la variabilidad en la biodiversidad del suelo. pH.) que afectan la distribución de organismos del suelo y se asume que las principales categorías de uso de suelo proporcionan una diferencia significativa. Sin embargo. descrita a nivel de las principales categorías de uso de suelo. días de lluvia. y de las características del suelo. especialmente en sistemas tan diversos como los representados en los trópicos. temperatura y humedad media. y debido a que las características completas del sitio no pueden ser obtenidas solamente por la apariencia del uso del suelo. en términos de los factores que determinan la biodiversidad del suelo. Por lo tanto. C y N total. Es posible que la variabilidad en abundancia y diversidad de organismos del suelo dentro de una categoría de usos de suelo pueda ser mayor que la variabilidad entre categorías de uso de suelo. Debido a que se sabe muy poco sobre la importancia relativa de los factores antes mencionados. deberían registrarse para la ventana e incluso para el área seleccionada.

Una descripción de los sitios puede ser completada por el tipo de vegetación. lo que puede ser diferente. También. debido a la senescencia de las raíces. cuando el método depende del conteo e identificación de esporas. Épocas de muestreo Los organismos del suelo responden a cambios estacionales. 2005). en la práctica. en áreas de bosque. ayudan a elegir sitios a lo largo de un gradiente de diversidad botánica que tiene alguna relación con sus posiciones actuales en las cronosecuencias e intensidades de perturbaciones. acumulación y abundancia de hojarasca. Al3+ y H+. los inventarios deberían elaborarse durante la época de lluvias y también en la época de seca. En los casos de hongos fitopatogénos y hongos ectomicorrízicos. en el caso de cultivos anuales las esporas son más abundantes durante la época seca. no siempre suele ser factible. Respecto de hongos micorrizógenos arbusculares. pero inmediatamente adyacentes a la zanja de cada monolito (la zanja exterior probablemente sea el mejor lugar). la época seca será la más apropiada para muestrear. ver Anderson e Ingram (1993). La diversidad y abundancia de especies de leguminosas son de particular importancia en relación con la presencia de las bacterias formadoras de nódulos en leguminosas. por esta razón se hace el muestreo al final de la época de lluvias 88 Manual de biología de suelos tropicales . dependiendo de los métodos utilizados. especies de plantas y la riqueza de géneros. y los resultados del inventario de la riqueza de especies y abundancia (relativa) mostrarán marcadas diferencias entre las épocas. CIC. área basal. La producción de esporas responde a la fenología de las plantas y. Además. P.intercambiables. características como la altura media del dosel. la actividad de las lombrices de tierra es mayor al final de la época de lluvias (Tondoh y Lavelle. Para el muestreo de otras variables relacionadas con la caracterización del sitio. Muestras de suelo son tomados de suelos no perturbados. Sin embargo. Idealmente. la evolución de las estructuras y ciclos reproductivos (como la formación de esporocarpos) se sincronizan con los cambios estacionales que ocurren dentro del hospedero y son mejor observados durante y hacia finales de la época de lluvias. por ejemplo. por ejemplo. El Capítulo 11 proporciona más detalles sobre los requerimientos respecto de usos de suelo específicos. puesto que de esta manera surge la posibilidad de correlacionar las propiedades del suelo con la presencia o ausencia de un taxa en particular y grupos funcionales (véase Anderson e Ingram. el porcentaje de cubierta vegetal. cobertura dominante/abundancia de flora en el nivel del suelo. 1993).

.. y Wardle. Lo último puede realizarse con el objetivo específico de investigar cambios temporales en la biodiversidad del suelo. L. Columbia University Press. Ford. D.. A.. Lavelle. Agriculture. T. pp.con la opción de tomar muestras adicionales durante la época de secas. G. (2000) Scientific Method for Ecological Research. T. S. Pedigo. Larsen. Bignell. T. M. Gregoire. 2nd edition. Holt. Nature (Lond). y Spain. Ecosystems and Environment. E. e Ingram. y Madong. P. Peterson. indicator taxa and effects of habitat modification in tropical forest’. Wiley. Journal of Biogeography. H. D. D. Gathorne-Hardy. G. vol 391.. L. F. A.. Dordrecht Lawton. A. E. y Hernandez. C. M. F. vol 83. y Lavelle. N. E.. J. Dibog. Federoff. Dubs. Juhfisz-Nagy. Cambridge University Press. N. G.... y Podani. Ponge. Cambridge. S. Wallingford. I. Eggleton. Norgrove.. (2002) ‘Spatial soil ecology’. P.. A. T. Trends in Ecology and Evolution. vol 90.. CAB International. 195–207. Bignell. D . Stork. V. 283–290. J. Cochran W. Kluwer Academic Publishers. T. R.. S. H. Jones. Davies. y Buntin.. (2001) Soil Ecology. D.. R.. Boulton. G. 847–877. P. 72–76. y Watt. Chapman and Hall/CRC Press. (eds) (1993) Handbook of Sampling Methods for Arthropods in Agriculture.. L. London. (1977) Sampling Techniques. New York.. D. Ettema. 3rd edition. Bloemers. Agriculture. Srivastava. Eggleton. P. pp. J. P. (2002) ‘Termite diversity across an anthropogenic disturbance gradient in the humid forest zone of West Africa’.E. Vegetatio. pp. C. vol 105. B.. J-F. D.. B. P. y Parker.. M. Kenkel. (2005) “Small-scale response of plant species to land-use intensification”. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 89 . N. Mawdsley. (2003) ‘Evolution of termite functional diversity: Analysis and synthesis of local ecological and regional influences on local species richness’. y Valentine. L. F. Fernández-González. B. D. Hammond. vol 17. E. Ecosystems and Environment. pp. Eggleton. New York. Hauser. D. P. F. P. Hodda. D. REFERENCIAS Anderson. L. vol 30. CRC. J. G. (eds) (1998) Ecological Scale: Theory and Applications. (1989) ‘On sampling procedures in population and community ecology’. (2007) Sampling Strategies for Natural Resources and the Environment. (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. 89–202. New York. pp. pp177-183. (1998) ‘Biodiversity inventories.

vol 9. Oxford University Press. International Centre for Research in Agroforestry. S. y Ettema. R. pp. 813–826. New York. Ecoscience. Sousa. Bogor. J. Biodiversity Conservation. D. (2000) Ecological Methods. Oxford. 200–202. 1093–1121.Ponge. P. T. South East Asian Regional Research Programme. y Seber. Indonesia. E. Soil Biology & Biochemistry. F. P. vol 35. K. (eds) (2001) Standard Methods for the Assessment of Soil Biodiversity and Land-use Practice. G. L. F. 3rd edition. Ecosystems and Environment. Federoff. S. P. J.. Oxford. pp... M. Swift. (1990) Statistical Methods in Soil and Land Resource Survey. pp. J. M... A. Gillet. R. Thompson. J. 31–47. Jaarsveld. A. A. ASB-Lecture Note 6B . M. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. Pierce. A. P. A. 493–500. y Lookingbill. D. y Bignell. S. y Lavelle. J. F. pp. E. Eudrilidae) in Ivory Coast’. (2002) ‘Extending community ecology to landscapes’. Blackwell Science. pp. E.... Southwood. Stein. J. C. (1998) ‘An evaluation of the gradsect biological survey method’. y Lavelle. Haese. vol 94. y van der Linde. E. Webster. Tondoh. D. 90 Manual de biología de suelos tropicales . S. (2003) ‘Collembolan communities as bioindicators of land use intensity’. Journal of Tropical Ecology. vol 7. (2003) ‘An overview of spatial sampling procedures and experimental design of spatial studies for ecosystem comparison’. vol 21. K. Dubs. Agriculture. y Henderson. van. Wessels. Wiley.worldagroforestrycentre. T. www. Grimbeek. K. Urban. Goslee. (1996) Adaptive Sampling. y Oliver.org/SEA/Publications.

hormigas y escarabajos. indicativos de la biodiversidad de suelo y de los efectos del cambio de uso y prácticas de manejo del mismo. Agus Karyanto. en ambientes tropicales. por tanto. que habitan especialmente en ambientes tropicales. Susilo. Bignell. o que tienen una anchura o diámetro de más de 2 mm. Una diversidad de organismos de suelo se incluye en esta categoría (capítulo 1). se consideran un componente determinante de la biota del suelo. aunque éste se concentra en los grupos más significativos: lombrices de tierra. Francis-X. Las lombrices de tierra son. como ingenieros del suelo. 91 . los grupos de macrofauna frecuentemente son utilizados o propuestos como indicadores de la calidad biológica del suelo. Reginaldo Constantino. Además. sin embargo. los invertebrados más importantes en el suelo de regiones templadas. el grupo macrofauna incluye aquellos animales del suelo que miden más de un centímetro de largo. Otros son trituradores que deshacen la materia orgánica y un buen número de estos grupos son macropredadores. sobre todo. termitas.Capítulo 3 Macrofauna David E. Mucha macrofauna desempeña un importante papel en los ecosistemas del suelo. Souleymane Konaté. predominan las termitas y las hormigas. Debido a su importante papel en los procesos del ecosistema y a su sensibilidad ante condiciones ambientales. Julio Louzada. Csaba Csuzdi. probablemente. Jérôme Ebagnerin Tondoh y Ronald Zanetti INTRODUCCIÓN Este capítulo describe los métodos para realizar el inventario de la macrofauna del suelo. e influyen de manera notable en las propiedades físicas y químicas de los suelos. debido a su biomasa. en la creación de macroporos y en la transformación y redistribución de materia orgánica.

Éstos están basados en monolitos de suelo y. cuyo énfasis se concentra en un grupo específico de organismos asociados y. Como en el caso de otros grupos de biota de suelo. se explica que no existe un sólo método para llevar a cabo un inventario de un grupo específico de macrofauna. y no simplemente tres páginas que fueron impresas en los métodos originales “TSBF”. el hecho de que se pueda dedicar un capítulo entero al muestreo de macrofauna. por lo tanto. en la generalidad de la macrofauna. en cada una de las siguientes secciones que describe un método en particular. mientras que las trampas pitfall con cebo son apropiadas para la captura de escarabajos. forman un importante componente de la red alimenticia en el suelo. este capítulo se estructura de acuerdo con el método utilizado y no tanto en función del grupo funcional. Nuevos esquemas son propuestos en el diseño de monolitos para mejorar el muestreo de lombrices de tierra. Para poder contar con datos de diversidad y abundancia de lombrices de tierra. y la extracción Winkler es el método más idóneo para la captura y extracción de hormigas de muestras de hojarasca. con la extracción de los insectos de los marcos de hojarasca por el método Winkler (Bestelmeyer et al. que sirvan como indicadores para monitorear el cambio de efecto de uso de suelo. 92 Manual de biología de suelos tropicales . abundancia y biomasa. algunos grupos representativos de macrofauna específica son capturados. utilizando cualquiera de los métodos enlistados en el capítulo 2. demuestra cómo ha crecido durante los últimos años nuestra percepción de la importancia de estos organismos. por ende. Un avance mayor consiste en utilizar el principio de transecto para hormigas y escarabajos. En este capítulo se describen métodos propuestos para realizar un inventario de macrofauna. Generalmente. Se entiende que los métodos propuestos son aplicados en ambientes tropicales. 2000). cada uno de los métodos descritos es idóneo para un grupo en particular: los monolitos son especialmente escogidos para el inventario de lombrices de tierra. 1993) consolidados y mejorados por Swift y Bignell (2001). En el capítulo 2.generalmente alta. el método de transecto es más adecuado para un inventario de termitas. podrán ser utilizados más ampliamente. el punto de partida de desarrollo de los protocolos han sido los procedimientos de Anderson e Ingram (1989. se requiere de métodos estándares en el muestreo para diversidad. en un transecto corto (20-40 X 2m) al que ahora han sido añadidas trampas pitfall (principalmente para escarabajos) y otras guías para muestreo casual. sin embargo. al mismo tiempo. No obstante. tal y como fueron aplicados en el proyecto CSM-BGBD. en el caso de termitas. los que generalmente se refieren como métodos “TSBF”.

una charola de plástico grande de cocina. es decir. serán milpiés y lombrices de tierra con bajas densidades de población. de 0-10 cm. véase el capítulo 2. en su mayor parte. Si no hay mucho tiempo o si la luz es insuficiente (colectar en selva cerrada es difícil porque la luz disminuye muy temprano).. En una variante del método. Su abundancia y biomasa podrán ser calculadas con base en las muestras de 0.50 m². Este transecto también puede ser utilizado para hormigas y escarabajos. son dictados por Anderson e Ingram (1993). aunque es mejor si se muestrea la hojarasca delimitada por marcos dispuestos en una línea paralela. éstos. 2000). Para revisar el suelo es conveniente utilizar la superficie de una mesa grande de campo para llevar a cabo la extracción.1a y 3. HOJARASCA Y LOMBRICES DE TIERRA EN PARTICULAR. En el caso de la hojarasca. con la adición de trampas pitfall (Swift y Bignell. aislando el monolito como un pilar no perturbado (Figuras 3. Se divide el bloque del monolito en tres capas.INVENTARIO DE MACROARTRÓPODOS DE SUELO. de manera que puedan trabajar varios asistentes en la misma muestra de suelo o en muestras diferentes. esto se puede hacer de manera sencilla.1b). Se utiliza un transecto adicional de 20 x 2 m para muestrear las termitas. UTILIZANDO MONOLITOS DE SUELO Macroartrópodos de hojarasca y de suelo. junto con monolitos extraídos del suelo. excavados de la zanja y la hojarasca pueden ser colectados. Primero se coloca un marco de 25 x 25 cm para marcar la posición del monolito y cualquier hojarasca o madera dentro de él es removida e introducida en una charola (Figura 3. pero que representan una biomasa importante. preferentemente en el lugar y bajo sombra. hay que meter la muestra en un bote de 19 L y llevarla al laboratorio. con un reborde. Se aísla el monolito utilizando una pala a unos pocos centímetros fuera del marco y luego se cava una zanja a su alrededor de 25 cm de ancho y 30 cm de profundidad.1c y 3. Para la discusión del número y posicionamiento de monolitos. con dimensiones de 50 x 50 x 20 cm de profundidad para lombrices de tierra. la anchura aproximada del monolito más dos anchuras de zanja. utilizando un machete o parang tomado de forma horizontal y agarrado por ambos lados. La muestra de suelo en botes se debe guardar alejada del sol directo y deberá ser revisada antes de 24 horas. sirve como un buen recipiente para la M acrofauna 93 . todos los invertebrados mayores de 10cm de largo.1d). 10-20 cm y 20-30 cm. Monolito TSBF Los procedimientos generales. 2001) y las extracciones con trampas Winkler (Bestelmeyer et al. Se revisa manualmente la hojarasca y cada capa de monolito por separado.

• El microhábitat en cuestión (madera nueva. como en el caso de un transecto. el periodo destinado deberá incluir el tiempo para el llenado de la etiqueta. las pequeñas ramas deberán romperse y ser golpeadas en la charola para que se desprenda cualquier insecto que contengan. etc. en una charola. deberán preservarse en alcohol al 80%. no usar bolígrafo o pluma): • Fecha y clave de identificación del lugar. El tamiz retiene las hormigas que pueden ser aspiradas. Se añadirá una etiqueta dentro del alcohol o formaldehído. al igual que obreras. hojarasca. montículo. suelo. Las hormigas pueden ser extraídas tomando un puñado de suelo.). • En el caso de transectos o monolitos alineados. termitas y escarabajos colectados. generalmente. se incluirán soldados. La información es importante para establecer la naturaleza de los organismos encontrados (especialmente la diversidad de grupos funcionales) y para construir una curva de acumulación de especies. Se diseccionarán los pedacitos de madera en diferentes piezas para ver si hay termitas. madera podrida. Se deberá utilizar un tubo o frasco por cada especimen o población encontrada (o colonia aparente). madera seca. pasándolo a través de un tamiz de malla grande. en el caso de las termitas. las etiquetas se pueden hacer cuando se ha completado la extracción en cada sección del transecto. de 5 mm. en la que se anotan los datos siguientes (con lápiz o tinta indeleble. 94 Manual de biología de suelos tropicales . Las lombrices de tierra y moluscos. el número de la sección en el transecto en donde se encontró el espécimen (1. Las hormigas. cuando se hace la extracción durante un tiempo determinado. Para evitar confusión en lugares ricos. sin embargo. hormigas o escarabajos. las etiquetas deberán escribirse en el momento en que los especímenes sean introducidos en los tubos o frascos. Protocolo de muestreo alternativo para evaluar la abundancia y diversidad de lombrices de tierra en ecosistemas tropicales Introducción Este protocolo alternativo combina el llamado monolito de suelo TSBF (25 x 25 x 30 cm) y tres grandes monolitos (50 x 50 x 20 cm) para evaluar la abundancia y diversidad de lombrices de tierra a nivel local y de paisaje en ecosistemas tropicales. se conservan en formol (formaldeído) al 4% para evitar la supuración de la mucosa.3 ó 4). En otros casos. suelo de raíz de árbol.2.revisión.

(2004). Haymes et al. por lo menos. la mayoría de los estudios sobre lombrices de tierra han sido elaborados utilizando el método TSBF (Anderson e Ingram.Figura 3. 2004). véase Gilot et al. En todos los casos.1 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). Dlamini y Haynes (2004) para el muestreo de lombrices de tierra en África. los monolitos se distribuyen a lo largo de un transecto corto (40 m) con. un monolito cuadrado de suelo de 25x25 cm y de 30 cm de profundidad. (1994. véase Bhadauria et al. Por más de una década. A B C D Nota: las ilustraciones A y B muestran la colocación de un marco de madera para delimitar el monolito y la limpieza de hojarasca suelta. (2002) y Mathieu et al. La ilustración C muestra un monolito grande (50 x 50 x 30 cm) y la D un monolito pequeño (25 x 25 x 30 cm) y la excavación de la zanja. M acrofauna 95 . (2000) para Asia y Decaëns et al. (2003). satisface el requerimiento de rapidez y la necesidad de tomar en cuenta la heterogeneidad del suelo a nivel parcela. 1993) para macroinvertebrados. para ejemplos de América del Sur. (1995). siendo la unidad de muestreo. antes de muestrear el monolito. Barrios et al. cinco monolitos por parcela bajo estudio.

1969. bajo diferentes prácticas de manejo de suelo (Fragoso et al. que combina pequeños y grandes monolitos. Se pueden usar argumentos similares para justificar un muestreo más extensivo de lombrices de tierra. utilizando grandes monolitos de suelo de 1 m² x 40 cm de profundidad. Recientemente. 2002). 1999. (2000). en cada tipo de uso de suelo. Decaëns y Jiménez.. (1999) y Agosti et al.. Eggleton et al. 1998) porque las lombrices de tierra son reconocidas por presentar sensibilidad ante la perturbación antropogénica (Fragoso et al. Protocolo de muestreo De manera ideal. la carencia relativa de centros de colonias y su distribución altamente parchada. 2005). 1978). permite tomar en cuenta la variación a 96 Manual de biología de suelos tropicales . se estudió la demografía de lombrices de tierra.A pesar del éxito relativo del método TSBF para estimar la abundancia y diversidad de los macroinvertebrados del suelo. Este esquema de muestreo estratificado. 2005). Fragoso et al. 10-20 cm y 20-30 cm. ha sido reportada para monitorear la dinámica de población de la lombriz peregrina Hyperiodrilus africanus (Tondoh y Lavelle. Originalmente. debido a su especificidad de grupo funcional. pero consumen mucho tiempo y resultan tediosos. aunque pequeños monolitos han sido utilizados con éxito para identificar cambios importantes en la diversidad de lombrices de tierra a nivel parcela. Decaëns y Jiménez. 2002). 2001. Vincent. el reto será desarrollar un protocolo de muestreo rápido para muestrear a nivel paisaje. una combinación más eficiente de 100 x 100 x 40 cm para grandes y de 25 x 25 x 30 cm para monolitos pequeños de suelo. por ejemplo. Burel et al. Lavelle. cubriendo grandes áreas. Los monolitos de tamaño medio (50 x 50 x 40 cm) fueron utilizados por Ortiz-Ceballos y Fragoso (2004) para evaluar el impacto de una cobertera en poblaciones de lombrices de tierra. el muestreo debería realizarse al final de la temporada de lluvias. 1997. aunque pocas investigaciones se han enfocado a la evaluación de la abundancia y diversidad de lombrices de tierra en paisajes agrícolas. Tal avance será crucial para desarrollar indicadores de degradación de suelo (Moreno y Halffter. Como las prácticas agrícolas contemporáneas muestran un mosaico de tipos de uso de suelo. cuando se sabe que las lombrices de tierra son más activas (Tondoh y Lavelle. respectivamente. Se seleccionan cinco puntos de muestreo al azar. en cada punto de muestreo se extrae un pequeño monolito de 25 x 25 x 30 cm que se rebana en tres capas: 0-10 cm. han propuesto protocolos de muestreo más exhaustivos para muestrear termitas y hormigas. 1997.. Las lombrices de tierra son colectadas a mano.

cuando se considere apropiado (TSBF modificado. M acrofauna 97 .3) y son almacenadas en una solución de formol al 4% para su posterior identificación. contados y pesados. mientras la variación a nivel paisaje se hace con un muestreo en los usos de suelo más representativos. de acuerdo con el procedimiento de TSBF (Anderson e Ingram. a lo largo de un transecto.2 Esquema de alineación de monolitos complementarios de lombrices de tierra. Los individuos después son identificados. con un punto de partida elegido al azar. En cada punto seleccionado. porque la mayoría de los especímenes (57-99%) son localizados en los primeros 20cm durante la temporada de lluvias (Tondoh y Lavelle. perpendicular a la pendiente. 2005). Monolitos grandes (50x50x20 cm) Monolito pequeño (25x25x30 cm) nivel parcela de las poblaciones. El transecto aparece representado esquemáticamente en la Figura 3. se extraen tres grandes monolitos de 50 x 50 cm y de 20cm de profundidad. 1993). De manera adicional. Las lombrices de tierra se colectan a mano (Figura 3. las lombrices de tierra son muestreadas. 1993).Figura 3. Monolitos adicionales son extraídos para poder tomar en cuenta la heterogeneidad a nivel de la parcela. como en los pequeños monolitos. Anderson e Ingram. en intervalos de 5 m.2. Cada monolito mayor se separa en dos capas (0-10 y 10-20cm) y no en tres.

Para la identificación de lombrices de tierra de la India y del Sureste de Asia. 1995. Fragoso y Rojas-Fernández. Desgraciadamente.3 Separación a mano de lombrices de tierra en charolas de plástico. 1987) y Csuzdi (1996) y. cuando sea necesario. las monografías de Gates (1972). previamente agrupados como morfoespecies. Las especies de lombrices de tierra peregrinas comunes. 2005) son los principales puntos de referencia. Identificación de lombrices de tierra y estimaciones de su abundancia Especímenes de lombrices de tierra. no existen a la fecha monografías disponibles para la identificación de lombrices de tierra de América Central y América del Sur. La abundancia de lombrices de tierra se estima 98 Manual de biología de suelos tropicales . la revisión de Eisen (1900) y estudios seleccionados de varios autores (Righi. sin embargo. que se encuentran distribuidas en toda la región tropical. 1994. 2001. 1971. Sims e Easton (1972). utilizando las claves desarrolladas por Blakemore (2005). las especies nativas requieren de la pericia específica del país. se debe consultar la descripción original de especies. por lo tanto. Easton (1979) y Julka (1988) son las apropiadas. pueden ser identificados a nivel de familia. Para las especies africanas de Eudrilidae y Acanthodrilidae (Benhamiinae) se pueden utilizar las revisiones de Sims (1980.Figura 3. Zicsi. debido a la carencia de guías comprensivas para su identificación. son identificables a nivel especie utilizando las guías y descripciones dadas por Blakemore (2002).

dos grupos de lombrices de tierra pueden ser distinguidos de acuerdo con su origen: especies nativas o exóticas.. 1997). 1977. M acrofauna 99 . 1987). La diversidad de lombrices de tierra se estudia en dos niveles complementarios: diversidad taxonómica y funcional (Bouché. La relación nativas vs exóticas puede utilizarse como un índice para calcular la extinción de especies nativas o como un claro indicador de la invasión de especies exóticas o peregrinas.. Lombrices epígeas: de tamaño pequeño. 1997). 1981): 1. Los servicios que proveen las lombrices de tierra al ecosistema se relacionan con el impacto de su actividad en el sistema de suelo (Lavelle et al. introducidas por interferencia humana. Desde el punto de vista ecológico. 2) la diversidad promedio expresada en términos de la media de número de especies por cada tipo de uso de suelo y 3) el índice ShannonWiener de diversidad (Pielou. se lleva a cabo mediante la identificación en cada tipo de uso de suelo de especies nativas y exóticas o peregrinas. 1997 y Lavelle et al. las comunidades de lombrices de tierra pueden dividirse en tres grupos (Bouché. El análisis de comunidades de lombrices de tierra. Blanchart et al. con este enfoque. Fragoso et al. Lavelle 1983. Lavelle.. 1977. Lombrices endógeas: de tamaño medio. La estructura de las comunidades de lombrices de tierra puede ser caracterizada por la densidad y biomasa de lombrices nativas y exóticas La importancia de la diversidad funcional en las lombrices de tierra ha sido ampliamente documentada (Lavelle. 1996). regional y continental. 1997. éstas han sido llamadas peregrinas para indicar su amplia distribución a niveles regionales y continentales (Lee. El aspecto funcional de la diversidad resulta de gran interés para evaluar la relación entre diversidad y servicios del ecosistema. El primer nivel de diversidad taxonómica trata del número y de la identidad de especies de lombrices de tierra. Especies nativas son las caracterizadas por una distribución restringida a nivel local.. mientras que las especies exóticas son. en cada tipo de uso de suelo. no pigmentadas y que viven dentro del suelo. 1983. 1977). a nivel de la superficie del suelo. en casi todos los casos. Como resultado de su actividad. Fragoso et al.como el número de individuos por m² y la biomasa como g de individuos por m². El segundo nivel de diversidad taxonómica trata de la biogeografía de lombrices de tierra (Fragoso et al. 2. Dentro de un ecosistema dado. producen excretas dentro del perfil del suelo y sobre la superficie. Se pueden utilizar tres categorías de expresión de la riqueza de especies: 1) el número de especies registrado en todos los monolitos. 1997)... con pigmentación y que viven en la hojarasca.

aunque se considera que. Swift y Bignell (2001).. pero comen en la superficie. tumba y quema. Este método se considera de bajo impacto y resulta idóneo para ser usado por aquellos que no son especialistas en termitas y puede ser completado en cada punto de muestreo por dos personas en un día (dos días para un transecto de 100 m). Equipo requerido Brújula. El método. aunque se ha acortado a 20 m en el protocolo estándar. tal y como se describe y desarrolla más adelante. HORMIGAS. sin pigmentación y viven en el suelo. una 100 Manual de biología de suelos tropicales . para el proyecto CSM-BGBD y a 50 m en el esquema alternativo de muestreo (véase Capítulo 2). Los datos obtenidos son cualitativos (identificación y número de especies) y/o semi-cuantitativos (abundancia relativa de especies y/o grupos funcionales específicos). modificando así las propiedades hídricas y químicas del mismo. cinta métrica de 30 m o preferiblemente cuerda de nylon o mecate. utilizando cinta naranja o amarilla fluorescente o a prueba de agua y un palo de 2 m. 1997) porque son activas mezclando y cavando el suelo. ESCARABAJOS Y LOMBRICES de tierra Introducción Este método utiliza un transecto de 100. Sus actividades forman una red densa de túneles dentro del suelo. por lo que los transectos se tratan separados de los monolitos y de las trampas pitfall. marcada en secciones de 5 m. fue desarrollado para bosques o localizaciones recientemente derivadas como en la agricultura de roza.3. A las lombrices de tierra se les puede asignar una categoría ecológica o grupo funcional y posteriormente comparar dichos grupos con base en su densidad y biomasa. Cada persona lleva un machete o parang afilado. presentan una alta resolución. MÉTODOS DE TRANSECTO PARA TERMITAS. y sigue las descripciones formales de Jones e Eggleton (2000). relativamente. La mayoría de las lombrices de tierra que pertenecen a los tipos endógeos y anecicos son destacados ingenieros del ecosistema (Lavelle et al. Lombrices anecicas: de tamaño grande. 50 o 20 x 2m. se basa en un transecto de 100 m.

por lo menos. sin embargo. Procedimiento Se traza una línea de transecto de 20. de manera simultánea. a 15m de distancia. para poder replicar un monolito) los transectos deberán posicionarse para evitar interferencia mutua y separarse. El muestreo se estratifica por M acrofauna 101 . en diferentes secciones.cuchara de albañil. Las líneas de transecto no necesariamente tienen que ser rectas. tales como pendientes. En una parcela pequeña. un transecto puede curvarse sucesivamente por dos ángulos de 90° para que corra hacia atrás hasta su punto de partida. una charola de plástico o metal con reborde alto. cuando se trata de decidir sobre la línea ideal. estrechas zanjas con arroyos o cortes en el dosel. ese tiempo podrá reducirse si se trabaja con varios equipos de dos personas. acantilados o caminos en uso que no sean hábitats adecuados para termitas. Alternativamente. siempre que por lo menos una parte del sistema de raíces quede dentro de la cinta de muestra de dos metros de ancho. puede ser útil para picar madera o suelo. Se debe asegurar que las líneas de pitfall se mantengan sin perturbación en todo momento. evitando grandes arroyos. pero los dos “brazos” principales de la línea del transecto deberán encontrarse. de modo subjetivo. el transecto se puede desviar hacia un lado. El tiempo requerido para realizar transectos de 20 m es de 30 minutos de muestreo por dos personas. pueden inclinarse para alcanzar ángulos de hasta 90°. dos pares de pinzas. Es necesario anotar el punto de partida. con alcohol al 80% (se necesitarán más para hábitats ricos en termitas). en cada sección de 5m. de área basal muy grande. para evitar obstáculos naturales. alrededor de 40 frasquitos de aproximadamente 1 x 5 cm. a una distancia suficiente para evitar cualquier perturbación durante el muestreo. No obstante. Se coloca el transecto de manera que visualmente atraviese los alrededores de manera homogénea. para evitar pisadas excesivas en un solo lugar. de alrededor de 8-10 cm. Si se emplean otros transectos en la misma parcela (por ejemplo. especialmente en los casos de pequeñas parcelas. Si la línea atraviesa un árbol. dirección del transecto con la brújula y cualquier cambio de dirección. 50 o 100 m junto al monolito. siempre que no se crucen con ellas mismas. se pueden colocar dos transectos de 50m (o de 10 m) para que queden en paralelo. Frecuentemente se necesita evaluar. un cuchillo de campo de hoja fija. Un equipo de dos personas será capaz de muestrear entre 8 y 12 secciones por día (2 a 3 transectos). el transecto puede incorporar otros fenómenos naturales del ambiente biótico que contribuyen a su heterogeneidad física.

debería muestrearse la primera vez bajo la supervisión de un colector experimentado. El suelo. Normalmente se requiere de un corto periodo de entrenamiento u orientación para que colectores sin experiencia puedan muestrear con la misma eficiencia que un experto. Los colectores deberán trabajar de manera constante (no frenética) en cada uno de los periodos de muestra de 30 minutos y tratar de mantener el mismo nivel de eficiencia de muestreo en cada sección del transecto. por esta razón y para poder minimizar la necesidad de tener que trabajar con escasa luz. de 50 ó 100 m. es aconsejable comprobar la periferia y la base de la estructura. Otras especies pueden habitar montículos y nidos o podrán coexistir con los que están construyéndolos. nidos subterráneos epígeos y arbóreos y montículos de una altura de hasta 2 m sobre la superficie del suelo (incluyendo nidos de bolsitas suspendidos en la vegetación). otros invertebrados. Los pedazos más grandes de madera deberán cortarse tomando en cuenta que pueden estar infectados en alguna parte. la hojarasca y los restos de madera pueden diseccionarse rápidamente en charolas. un transecto de entrenamiento. por ello se permite interrumpir la labor 102 Manual de biología de suelos tropicales . El tronco de un árbol vivo puede ser investigado para ver si contiene túneles de termitas a una altura accesible. frecuentemente contiene termitas. lombrices de tierra y. sin olvidarse de las ramificaciones o de los helechos que pueden acumular suelo que contenga termitas.4). madera en todas sus etapas de descomposición. Los siguientes micronichos son investigados con detalle: hojarasca y la superficie del suelo hasta una profundidad de alrededor de 5 cm. Es imposible muestrear con lluvia fuerte. escarabajos y lombrices de tierra en nichos crípticos o cuando escasea la luz. incorporada en el suelo de superficie. junto con sus cámaras centrales. También resulta de ayuda descansar unos minutos entre secciones. posiblemente. se recomienda completar no más de 12 secciones en un día. nidos de termitas o pistas de tierra en troncos de árboles y otra vegetación. por lo tanto. Idealmente. La madera podrida. sin necesidad de usar una escalera o tener que trepar (alrededor de 2 m). o cubierta de pedazos de suelo.nichos. esto ayuda mucho a ver las termitas (Figura 3. En la mayoría de las localizaciones no es necesario colectar cada termita y las especies más comunes podrán ser ignoradas después de muestrearse inicialmente para poder buscar las formas más raras o crípticas o para buscar soldados en especies que tengan una relación relativamente baja de soldado/obrero (tomando en cuenta que algunas especies no tienen soldados). acumulaciones profundas de hojarasca y suelo entre grandes raíces que funcionan como retenedores. Los palitos deberán romperse en pedazos y golpearse moderadamente en las charolas para desplazar cualquier termita u hormiga que contengan.

5 x 2 m. en lados opuestos de la línea. en el M acrofauna 103 . Se debe destinar un tubo de especímenes para cada población (o colonia aparente). se puede usar un pincel de artista humedecido con alcohol para depositar el espécimen en el frasco colector. El trabajo puede dividirse entre los colectores. sin interrumpir el trabajo. Nota: las pinzas finas son idóneas para atrapar insectos con cuidado. una docena de lugares separados en cada sección del transecto. de manera que mientras uno muestrea la madera. por ejemplo. a pesar de que se trate de una pequeña cosecha. sin dañarlos. previo acuerdo. sección a sección. hasta que mejoren las condiciones climatológicas. por lo menos. el otro examina el suelo y las raíces de los árboles. Alternativamente. Esto dependerá de la naturaleza del lugar y de la topografía. En los transectos donde se encuentran pocas termitas. contener soldados y obreros. es importante observar el protocolo de muestreo con precisión.Figura 3. para dividir cada sección en dos subsecciones de 2. Se recomienda que el suelo se extraiga en. cada persona trabaja en una cinta de un metro de ancho.4 Extracción de termitas de una muestra de suelo en una charola de aluminio. Procesamiento de especímenes Los especímenes representativos de las termitas encontradas deberán ser preservadas en alcohol al 80% y. en lo posible.

Lo anterior hace que el procesamiento sea más eficiente. • Número de sección en el transecto donde se encontró el espécimen (1. donde se anotan. Todas las notas de campo se guardan en la libreta y. hojarasca. Las termitas deberán separarse en unidades taxonómicas reconocidas. con pluma o bolígrafo. • El micro hábitat en cuestión (madera fresca. con lápiz o tinta indeleble y no. sin embargo. razón por la cual deben limpiarse lo antes posible (se separan las termitas del suelo o de la hojarasca. reduciendo así las posibilidades de cometer errores en la numeración. suelo. En otros lados. en orden secuencial. se podrán imprimir etiquetas numeradas. el mismo día en que son colectados o tan pronto como sea posible. Se generan diez secuencias al azar de las secciones por 104 Manual de biología de suelos tropicales . utilizando una impresora láser. madera seca. Alternativamente. por morfoespecies o especies nombradas. suelo a raíz de árbol). madera podrida. los siguientes datos: • Fecha y clave del transecto. lo que facilitará el trabajo. Los especímenes pueden resultar dañados o afectados en su color por el suelo o basura contenido en el frasquito. como una muestra independiente. montículo. se podrá construir una curva de acumulación por especies basada en especímenes o simplemente por especies. se deberán escribir las etiquetas (o las notas de campo) tan pronto como se hayan colocado las termitas en los tubos de especímenes. que se cortarán y pegarán en una libreta de campo. en el campo únicamente se añaden las etiquetas a los frasquitos y se toma nota en la libreta de campo de los números por sección y del transecto. etc. en lugares ricos en termitas. se añade alcohol fresco y se escriben las etiquetas nuevas). todas las etiquetas seguirán el mismo patrón. al completar cada sección del transecto. los treinta minutos para el trabajo deberían incluir el etiquetado. se podrán escribir etiquetas o notas. 2.). los números de las etiquetas estarán relacionados. razón para destinar un mínimo de dos días a cada transecto de 100 m (proporcional para transectos más cortos). por lo que se podrán leer con mayor facilidad. 3. por lo tanto. La información referente al micronicho en donde se encuentra cada espécimen es importante para poder establecer la naturaleza de la comunidad de termitas (especialmente la diversidad funcional del grupo) y para construir una curva de acumulación de especies. Para evitar la confusión. para los taxónomos expertos. Al tratar cada sección de 5 m.cual se introducirá una etiqueta.

dependiendo del lugar y de la región biogeográfica. se calcula la media acumulativa de especies de los diez juegos de 20 secciones para cada sección y se construye una curva de acumulación de especies. tales como Jackknife de primer orden y Jackknife de segundo orden. en el lugar 2. a nivel especie. Las muestras y los especímenes necesitan ser etiquetados y organizados cuidadosamente. en el lugar 1. finalmente. 2000. Las especies y morfoespecies encontradas por transecto pueden ser desde sólo unas cuantas hasta más de 50. se separaran en morfoespecies. se identificaría a nivel género y. lo que resulta muy laborioso en términos de tiempo. el resto.medio de un trazo (en cada secuencia) de 20 secciones al azar. sean las mismas que “A”. El número de especies encontradas en cada sección se usa para calcular el número acumulativo de especies. También es importante que las morfoespecies “A”. La colección entera deberá ser preservada durante un tiempo después de la identificación para su posterior confirmación y se debe de depositar. parcialmente compuesta por especies identificadas y. M acrofauna 105 . 2004) que son implementados por el software libre EstimateS (Colwell. normalmente requiere una pericia taxonómica alta. indicando que se encontrarían pocas o nuevas especies con transectos adicionales en el área. género y especie. en un museo. Lo ideal sería que todos los especímenes fueran identificados hasta especie. Una curva ideal debería ser asintótica. Chao y ACE. La identificación de organismos de suelo. un subjuego en una colección de una institución nacional. es importante utilizar el mismo esfuerzo de identificación y métodos. pero esto muchas veces no es posible para algunos grupos de organismos de suelo. Una taxonomía pobre podría resultar en una baja o sobreestimación de diversidad y similitud de especies y hacernos llegar a establecer conclusiones erróneas. Cuando se comparan datos de diferentes hábitats o localidades. entre otros (Magurran. La riqueza específica del lugar puede ser estimada utilizando métodos de extrapolación. para cada selección de las diez secuencias. sin reemplazo. 2004). o bien. será identificar cuáles son las que están presentes en la muestra. debería subir y posteriormente inclinarse. es decir. de manera permanente. trabajando desde niveles altos como órdenes hasta familia. Una manera más realista sería obtener la lista final. Identificación El primer paso para compilar una lista de especies y organizar los datos del ensamble de las especies encontradas. la identificación consiste en la determinación de la posición de un espécimen en la clasificación existente.

En el caso de animales. (abreviación del latín confer. de manera particular. Los paréntesis. ocasionalmente. aunque frecuentemente se recomienda. B fueron identificadas únicamente a nivel género y morfoespecie. tienen un significado y su uso se determina de acuerdo con las reglas de nomenclatura. similis. será el Código Internacional de Nomenclatura Zoológica (Comisión Internacional de Nomenclatura Zoológica. el Código Internacional de Nomenclatura de Bacterias (Sneath.1 presenta un ejemplo de una lista de especies. El paréntesis que abarca el nombre de los autores indica que la especie fue originalmente descrita en otro género y después se transfirió al género actual. para grupos de organismos diversos o poco conocidos. por ejemplo. excluyendo animales. La Tabla 3. se utilizan con la misma connotación o de manera similar. Tal abreviación se usa para indicar que la identificación es incierta. c) comparaciones con colecciones de referencia y d) envío de especímenes a un experto taxónomo. Se utilizan. que deberán ser respetadas: los géneros y especies se imprimen en cursiva. técnicas moleculares para la identificación de microorganismos. nunca se deben utilizar nombres manuscritos no publicados. Lista de guías y catálogo de identificación Se puede consultar una lista integrada de claves de identificación para termitas. Termes sp. 2000). Consulta un catálogo taxonómico que te permita comprobar la validez y cómo se deletrean los nombres. La abreviación “cf” en el caso de Coatitermes y Armitermes. pero no es obligatorio. compare). a modo de rutina. para plantas. lo cual generalmente resulta más práctico que un “orden taxonómico” subjetivo. el Código Internacional de Nomenclatura Botánica (Greuter et al.Los métodos comunes de identificación de la fauna del suelo incluyen: a) uso de claves de identificación publicadas. b) comparaciones con descripciones. N. 1999). 1992). Se muestran tres niveles de identificación. Otras abreviaciones. El dato de autor y año de publicación no forma parte de un nombre de especies y su uso es opcional. los Códigos de Nomenclatura contemplan reglas muy estrictas de formato para nombrar autores. Se trata de una lista organizada en orden alfabético. El formato de los nombres deberá seguir el código respectivo de nomenclatura. fueron identificadas plenamente a nivel especie. hormigas y escarabajos en el apéndice 1 y listas más especializadas en las publicaciones 106 Manual de biología de suelos tropicales . corniger y N. No obstante. si existen. por lo tanto. y para bacterias. Nota que las abreviaciones “sp” y “cf” no aparecen en cursivas. A y Termes sp.

9 Angularitermes sp. 14 Angularitermes sp. 6 Angularitermes sp. 17 Angularitermes sp. 3 Angularitermes sp. 15 Angularitermes sp. 13 Angularitermes sp. 16 Angularitermes sp. 18 Angularitermes sp. 19 Araujotermes nanus Armitermes holmgreni Armitermes minutus Armitermes teevani Atlantitermes osborni 1 1 1 13 9 13 46 2 2 1 15 7 1 1 1 1 1 2 2 6 1 7 3 4 1 3 1 2 1 1 5 1 1 1 1 1 4 14 1 6 1 6 25 8 1 1 2 19 20 3 1 9 4 10 71 47 3 10 1 2 16 7 1 3 Armitermes cf. 5 Angularitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Kalotermitidae Angularitermes nasutissimus Angularitermes sp. 8 Angularitermes sp. 7 Angularitermes sp. 4 Angularitermes sp. 2 Angularitermes sp. 1 Angularitermes sp.1 Ejemplo de lista de especies. 11 Angularitermes sp.Tabla 3. peruanus Caetetermes taquarussu Constrictotermes cavifrons M acrofauna 107 . 12 Angularitermes sp. 10 Angularitermes sp. No. Angularitermes sp.

Especie Selva Barbecho Cultivo Agroforestal Pastizales 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 Coptotermes testaceus Cornicapritermes mucronatus Cornitermes pugnax Cornitermes sp. No.1 Continúa. Curvitermes odontognathus Cylindrotermes flangiatus Cylindrotermes parvignathus Embiratermes parvirostris Heterotermes tenuis Labiotermes psilus Microcerotermes strunckii Nasutitermes callimorphus Nasutitermes corniger Nasutitermes gaigei Nasutitermes guayanae Nasutitermes octopilis Nasutitermes sp. J Nasutitermes surinamensis Nasutitermes unduliceps 1 Nasutitermes wheeleri Neocapritermes pumilis Neocapritermes sp. Neocapritermes talpa 1 2 6 1 1 1 108 Manual de biología de suelos tropicales .Tabla 3. A Nasutitermes sp. I 5 1 10 9 10 1 22 4 1 1 1 3 85 1 6 29 1 35 6 1 89 4 2 8 3 2 7 4 1 10 7 1 18 2 2 3 15 1 12 17 21 1 56 29 6 2 11 1 9 1 5 29 1 1 2 16 1 1 1 37 19 1 Nasutitermes sp.

3 Subulitermes baileyi Subulitermes microsoma Syntermes molestus Syntermes spinosus Syntermes territus Termes hispaniolae Termes medioculatus Triangularitermes sp.1 25.3 17. Planicapritermes planiceps Rhinotermes hispidus Rhinotermes marginalis Rotunditermes bragantinus Rugitermes sp.04 .Tabla 3.90 26. 3 Triangularitermes triangulariceps Velocitermes sp.4 M acrofauna 109 .41 0.4 1 5 2 2 1 3 8 7 471 50 39 2.90 25. Ruptitermes sp.6 81.8 72. 1 Ruptitermes sp. 1 6 8 1 1 1 2 1 1 1 2 3 9 3 6 5 1 1 5 1 1 1 9 9 259 52 20 3.80 .3 25.4 3 2 1 229 35 18 2.3 52.2 18. No. Especie Selva Barbecho Cultivo Agroforestal Pastizales 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Neocapritermes taracua Neocapritermes villosus Obtusitermes sp.6 4 Muestras Especies Transectos Índice Shannon(H) Índice Simpson Rarefacción (100 muestras) Estimación de Chao 86.96 34.81 14.01 .1 3 119 15 10 2.91 . 2 Ruptitermes sp.8 203 18 13 2.7 Estimación de Jackknife 1 74.3 50.1 Continúa.80 14.

esto se obtiene como resultado de la anotación del número de especies y morfoespecies. Una de las principales propiedades de un ensamble es “la diversidad de especies”. de un hábitat o área geográfica específica. en los apéndices 2 y 3. cuentan con sus propios manuales. La caracterización de un ensamble de especies involucra varios pasos. la capa de hojarasca orgánica y/o montículos epigeos se alimentan del suelo mineral. con un grado de selección de limos y fracciones de ar110 Manual de biología de suelos tropicales . Los ensambles de diferentes hábitats o localidades pueden compararse con varias estimaciones o índices y agruparse de acuerdo con sus similitudes. El mejor enfoque para identificación. pero este término no es correcto. varían entre el taxa y entre regiones. Las termitas pueden colocarse dentro de las siguientes categorías tróficas: • Las que se alimentan del suelo. Si los detalles bibliográficos no están incluidos en la tabla. por lo tanto. antes de tomar las muestras. Invariablemente. formar un grupo funcional (GF) uniforme y su composición también puede verse afectada por los métodos de muestreo utilizados. al final del presente capítulo. que se centran en una sola región. Las termitas distribuidas en el perfil de suelo. en relaciones ecológicas actuales. la disponibilidad de claves adecuadas publicadas. conferencias y documentos producidos por proyectos de desarrollo internacional sin una distribución global. Algunas veces se refieren a “comunidades de especies”. será el entrenamiento o bien que el procesamiento de especímenes esté a cargo de un taxónomo con experiencia. Interpretación de resultados Los ensambles de especies son grupos de especies relacionadas taxonómicamente. junto con su calidad. desde muestreo en campo hasta identificación y análisis de datos. Lo más importante es la diversidad funcional del grupo. aparentemente. otra información puede ser obtenida del transecto.taxonómicas para termitas. pueden consultarse en la lista de literatura. por ende. Aunque la información básica generada es la de riqueza especifica. Existe también una “literatura gris” extensiva de reportes de talleres. Casi siempre la muestra no contiene todas las especies presentes en el hábitat. por lo que muchos museos o instituciones científicas dedicadas a la taxonomía y conservación de la biodiversidad. la cual se puede definir y estimar por varios métodos. Los ensambles pueden o no. es necesario extrapolar de la muestra y utilizar estimaciones comparables de la diversidad local. los cuales no están disponibles para el público en general. pues dichos ensambles son delimitados por una clasificación taxonómica basada en historia y filogenia y no.

la cual se ha vuelto fácilmente desmenuzable y que se asemejan al mismo suelo o que predominan dentro del suelo. junto con por lo menos una termita inferior del sur de África Hodotermes mossambicus con un hábito similar. todos menos los que se encuentran en una fase de descomposición terminal. hojarasca y superficie del suelo y porque hace agujeros que se abren en la superficie. subterráneos o epígeos. Las termitas que se alimentan de madera y que cavan túneles en piezas más grandes de madera. provenientes de pasajes subterráneos o la formación de columnas descubiertas de individuos. quedan proporciones más altas de materia orgánica del suelo y sílica. pero no en la misma categoría de “alimentadores de madera podrida”. o mezclada con hojas podridas en complejos de limo . pero que se alimentan en otro lado y muchas Macrotermitinae que cultivan jardines de hongos. Hospitalitermes hospitalis en el sureste de Asia. Este grupo incluye termitas con nidos arbóreos. Este tipo de termita forrajera usualmente es más conspicua que otros tipos alimenticios. al igual que otros que se han caído y se conservan aún frescos. pastos vivos o secos y pequeños pedazos de madera. algas. 1996). debajo de troncos o en suelo adherido a la superficie de troncos en estado de putrefacción. reconocida por Collins (1989). Las termitas que buscan hojas muertas. que pueden volverse centros de colonias. y menos tejidos de plantas reconocibles que en otros grupos (Sleaford et al. Las termitas de alimentación especializada o incidental. todavía unidas del árbol viviente y árboles muertos en pie.• • • • cilla. Las termitas que se alimentan de madera muy podrida.raíces. El término “madera” incluye ramas muertas. Este grupo es sinónimo de “alimentadores medios” sensu DeSouza y Brown (1994).. Las que forrajean la hojarasca (Termitas forrajeras). Esta categoría sigue la lista de alimentación de termitas de acuerdo con Wood (1978). o bien. briofitas y líquenes en la corteza de los árboles (por ejemplo. Las que se alimentan del suelo y de madera. Las que se alimentan de madera. Aunque el material digerido es altamente heterogéneo. normalmente cortan el material antes de consumirlo o lo llevan a sus nidos. normalmente compuestas por obreros y soldados forrajeros. incluye especies que se alimentan de hongos. Ruptitermes y otras especies de Constrictotermes en América del sur que se M acrofauna 111 . por razones de las numerosas galerías o placas de suelo que construye encima de la madera. Este grupo incluye algunos Macrotermitinae subterráneos y constructoras de montículos y otras Nasutiterminitinae y algunas otras que se alimentan en la superficie del suelo.

La identificación del grupo funcional puede hacerse de acuerdo con el color abdominal en especímenes vivos (las alimentadas de suelo y suelomadera son más oscuras). pero la perturbación o un periodo de secas. encontrada en las cámaras interiores como inquilinas obligadas (Por ejemplo: Ahamitermis y Incolitermis. etc. suelo. las que se alimentan de excrementos o las carroñeras de cuerpos de vertebrados (probablemente consumidos oportunamente. • Las que anidan de manera hipogea. otros aspectos biológicos como el lugar donde anidan (las que anidan en árboles normalmente no se alimentan de suelo).). Ophiotermes y Tuberculitermes. Termitas cuyos centros de colonia quedan bajo el suelo. según las siguientes categorías: • Las que anidan en madera. la mayoría de la Apicotermitinae se alimentan de suelo o de suelo y madera). 1997. Si se dificulta la selección de un grupo funcional. Los centros son pocos definidos y amorfos (especialmente en 112 Manual de biología de suelos tropicales . Eggleton y Bignell. Las termitas cuyos centros de colonia normalmente se concentran en troncos muertos o árboles en pie. La forma de distribución de dichas categorías indica la estructura de la comunidad de termitas. Algunas veces la madera muerta es gradualmente reemplazada por material acartonado o por panales de hongos. es posible comparar ensambles de termitas en base a tipos de nidos. que habitan dentro de los nidos de Constrictotermes). y “las que no se alimentan de suelo” (todas las demás). las comunidades de selva son frecuentemente dominadas por las que se alimentan de suelo. en Australia. de manera similar. incrementa las proporciones de otros grupos funcionales. una aproximación útil se obtiene dividiendo las especies en “alimentadas de suelo” o geófagas (alimentadas de suelo. generalmente. Inquilinitermes.alimentan de líquenes). aunque ninguna especie es realmente fitófaga. en África oeste y central.Gay y Calaby. la ausencia de soldados (generalmente indica las que se alimentan del suelo) y la afiliación taxonómica (por ejemplo. Las categorías no son mutuamente excluyentes y muchas especies toman sus alimentos de por lo menos dos fuentes diferentes. especialmente bajo condiciones desfavorables. Algunas termitas también se alimentan de tejido de planta viva. aunque el excremento se puede considerar como forma de basura descompuesta) y también ciertas habitantes secundarias de montículos de termitas que se alimentan de los forros hechos de rica materia orgánica. 1970. las Macrotermitinae no se alimentan del suelo. y suelo y madera) como las definidas arriba. el lugar de su descubrimiento (en madera.

5 Ejemplo de curva de acumulación de especies con una desviación estándar. aunque algunas forman nidos subterráneos complejos (por ejemplo Marcotermitinae). M acrofauna 113 . normalmente están bien definidos y constituyen estructuras altamente complejas. Estos montículos. usualmente construidos con material de apariencia acartonada (cartón).los Apicoterminotenae que no tienen soldados). Figura 3. hechas de acuerdo con especificaciones típicas de la especie. • Montículos arbóreos. adiciones y ocupación por parte de habitantes secundarios. pero excluyen montículos arbóreos. con estructura interna poco obvia. que se forman por sí solos o que se asocian con los contrafuertes de los árboles. • Montículos epigeos. utilizando permutaciones de datos al azar. pero con una tendencia a volverse más irregulares con el paso del tiempo por razones de erosión. Nidos que se sujetan a árboles y que se localizan en diferentes alturas. Termitas cuyos centros de colonia se sitúan arriba del suelo. En la mayoría de los casos. estos nidos están conectados con el suelo mediante pistas cubiertas que pueden ayudar a distinguir algunos nidos de termitas arbóreas de los de hormigas. Este grupo incluye especies que son habitantes secundarias facultativas de montículos epigeos.

la curva es asintótica y tiende a inclinarse. tiempo (o persona por tiempo). El esfuerzo de muestreo puede ser medido por espécimen. tales como el de componentes principales (PCA).5) u otros métodos que normalmente requieren de programas computacionales especializados. número de especies y.Curvas de acumulación de especies Las curvas de acumulación de especies son gráficas que representan la relación entre el esfuerzo de muestreo y el descubrimiento de las especies en un hábitat o región. Las curvas de acumulación de especies pueden ser obtenidas reiterativamente mediante remuestreo al azar de los monolitos de suelo o por secciones de transectos. producción de excretas por cada tipo de uso de suelo. o área. La relación entre abundancia de lombrices de tierra y el índice de uso de suelo se comprueba utilizando regresiones. La prueba Kruskal-Wallis ANOVA puede utilizarse para probar si existe un efecto significativo de los tipos de uso de suelo en relación con la abundancia de lombrices de tierra. OTRA MACROFAUNA Y MESOFAUNA EN HOJARASCA. mediante la prueba Fisher. en el caso de lombrices de tierra. tienen diferentes sig114 Manual de biología de suelos tropicales . en relación con el número de unidades de muestreo. Para más análisis estadísticos. con desviaciones estándar. hasta 500 veces. 1997). muestra. en todos los paisajes agrícolas (Thioulouse et al.. se establece la comparación de la media del índice Shannon-Wiener. el de correspondencia (AC) y el de co-inercia pueden ser útiles para determinar factores que afectan la densidad y la diversidad de lombrices de tierra. con un 5% de nivel de probabilidad. 2000). Aunque algunos autores consideran estos nombres como sinónimos. en la secuencia en que fueron anotadas en el campo. Las curvas más sofisticadas. La forma más simple de estas curvas es conocida como la curva del colector. se pueden obtener utilizando permutaciones (reiteraciones) de los datos al azar (Figura 3. es únicamente una gráfica del número de especies acumuladas. HORMIGAS.0b1 (Colwell. UTILIZANDO EL MÉTODO WINKLER Introducción Las hormigas pueden clasificarse en grupos funcionales o gremios. En el caso de un esfuerzo de colecta grande. trampa. utilizando el software de EstimateS versión 6. Los análisis de multivariados. Otro método será normalizar la densidad y la biomasa de las lombrices de tierra antes de llevar a cabo el análisis paramétrico de varianza (ANOVA).

• Especies dominantes: especies muy abundantes y agresivas que influyen sobre la distribución y el comportamiento de otras especies de hormigas. son cosmopolitas. Meranoplus spp. las pertenecientes al género Camponotus. no especialistas y altamente competitivas. M acrofauna 115 . Bothroponera y Odontomachus).). debido al tamaño relativamente grande de su cuerpo y a su comportamiento sumiso. mientras que los grupos funcionales se refieren a especies que utilizan estrategias similares para explotar el recurso y pueden estar formados por más de un gremio. morfológicas y de comportamiento que reducen su interacción con la dominante Iridomyrmex spp. que pueden coexistir con la dominante Iridomyrmex spp.).) muestran adaptaciones fisiológicas. Eurhopalothrix spp.. y Notoncus spp. en su mayoría.. • Especies especialistas en clima y suelo: estas especies (Melophorus spp. pues es la más usada en diferentes paises. hormigas no especialistas que frecuentemente viven en ambientes perturbados (Rhytidoponera spp. • Especies generalistas myrmicines: especies que pertenecen al género Monomorium. Aphaenogaster spp. • Especies forrajeras solitarias de tamaño relativamente grande: predadoras solitarias que manifiestan muy poca interacción con otras especies de hormigas (especies dentro de los géneros Myrmecia... Los siguientes son ejemplos de gremios en la selva brasileña de la Costa Atlántica (Delabie et al. • Especies crípticas: especies de hormigas forrajeras que normalmente anidan bajo el suelo (en la capa de suelo y hojarasca). Paratrechina spp. se recomienda utilizar el de Andersen (1997). Crematogaster y Pheidole. Ejemplo: Iridomyrmex spp. originalmente diseñado para hormigas australianas. Aunque han sido varias las propuestas de esquemas de clasificación de grupos funcionales. 2000).. • Especies subordinadas asociadas: incluyen.. • Especies oportunistas: escasamente competitivas. de modo que minimizan el contacto con otras hormigas que no ocupan este hábitat (Brachyponera spp. 1986).nificados: los gremios son un grupo de especies que utiliza el mismo tipo de recurso para su supervivencia (Terborgh y Robinson.

• Especies de hormigas subterráneas: dependen de gotitas de aguamiel y comen secreciones de azúcar de otros insectos. ejemplo: Amblyopone (predadoras de termitas) y Thaumatomyrmex (predadoras de miriápodos) y Strumigenys (predadoras de colémbolos). ejemplo: Acropyga. ejemplos: Gnamptogenys (hormigas y otros insectos depredadores). Anochetus e Hypoponera. donde son forrajeras. ejemplo: Odontomachus y Ectatomma. carroña y restos de plantas para cultivar sus hongos. incluyendo los restos de animales muertos. También existen otras clasificaciones funcionales. Campanotus. Paratrechina. Apterostigma. Mycocepurus. normalmente miembros de Attini. es conveniente escoger las clasificaciones más cortas. ejemplo: Azteca y Crematogaster. ejemplos: Acromyrmex. 1995). son altamente agresivas y presentan una influencia competitiva sobre otras especies. ejemplo: Megalomyrmex. • Especies predadoras especialistas: especies que se alimentan de un solo tipo de presa. se subdividen en dos grupos: a) predadoras generalistas grandes. forrajean toda la vegetación arriba de la superficie y en la hojarasca. Solenopsis (especies grandes) y Wasmannia. Pachycondyla y Centromyrmex (inquilinas de nidos de termitas). predadoras especialistas que comen otras hormigas. Cyphormyrmex. probablemente comedoras de larvas de termitas del género Syntermes (Delabie. Sericomyrmes y Trachymyrmex.• Especies omnívoras: especies que se alimentan de varias fuentes. Utilizan hojas frescas. • Especies de hormigas arbóreas dominantes: especies omnívoras que anidan en árboles. la empleada en el taller CSM-BGBD (2005): 116 Manual de biología de suelos tropicales . por ejemplo. Atta. • Especies de hormigas legionarias: también conocidas como “formigas da correição”. • Especies de hormigas dominantes en suelo u hojarasca: hormigas forrajeras de hojarasca y suelo o de la superficie. Myrmicocrypta. • Especies cultivadoras de hongos: especies que utilizan hongos simbióticos. por ejemplo. b) verdaderas omnívoras: Brachymyrmex. • Especies predadoras generalistas: especies que se alimentan de diferentes tipos de presas. Labidus (predadoras generalistas) y Neivamyrmex y Normamyrmex. para trabajo de campo práctico. • Especies predadoras de suelo: especies que se establecen en el suelo y en la hojarasca. son generalistas o especialistas dentro de las especies predadoras. ejemplos: Eciton. Pheidole y Solenopsis.

sobre una sábana blanca. ventilado y bajo condiciones ambientales. en alcohol al 70%. La fracción fina queda en el fondo de la bolsa del tamiz. con el centro de su colonia en las capas superficiales de hojarasca. con guantes de cuero. posteriormente. de manera que no escape ningún insecto. 1999). hacia arriba. como complemento o alternativa. con el centro de colonia epigeo o arbóreo. los cuales son colgados en un lugar cubierto. • Herbívoras. preferentemente colocados a lo largo de la línea de transecto. lentamente las hormigas y otros insectos migran hacia afuera y se caen en el alcohol. trabajando desde el borde hacia el centro. junto a la coordenada GPS y al monolito (Ilustración 1. se mantiene la trampa durante por lo menos 72 horas. Una vez en el laboratorio. Procedimiento de muestreo El procedimiento completo se lleva a cabo en tres fases: a) tamizar en campo para separa la hojarasca fina (con hormigas) de la materia más gruesa. tres cuadrantes de 1 m2.• Carnívoras (especialistas o generalistas). c) extraer las hormigas dentro de la trampa Winkler. Se recoge primero la hojarasca. Se coloca un frasco con alcohol al 70% en la base de la trampa Winkler. con un centro de colonia en las capas superficiales de hojarasca. cerrado pero ventilado. conforme se seque la hojarasca. • Herbívoras. con un centro de colonia subterránea. se puede pasar la hojarasca burda por una malla de 2 mm. • Carnívoras (especialistas o generalistas). Este procedimiento permite separar la macrofauna pequeña y alguna de la mesofauna M acrofauna 117 . • Herbívoras. realizando movimientos laterales. cuando los Winklers no se encuentren disponibles. con el fin de maximizar la recuperación de los especímenes (Delabie. Esto debe hacerse con suficiente habilidad. por lo menos. b) transportar al laboratorio dentro de una bolsa segura. • Carnívoras (especialistas o generalistas). junto con las hormigas y se transfiere a bolsas en campo. Se almacenan los especímenes en tubos cerrados y etiquetados. Se tamiza cada muestra de hojarasca para remover pedazos grandes. el contenido de las bolsas de campo se transfiere a redes. que se encuentra en. con un centro de colonia epigeo o arbóreo. Se utiliza un marco para delimitar un área de un 1 m2 y se remueve la hojarasca a mano. de manera que se puedan separar los fragmentos más gruesos. estas redes se fijan dentro de la trampa Winkler. con un centro de colonia subterráneo. véase también el Capítulo 2).

plástico o aluminio para delimitar el área de muestreo. en este caso. de alrededor de 5 mm. las cuales serán llenadas holgadamente con la hojarasca trasportada en las bolsas del campo y se colocaran en el centro de la trampa Winkler para dar paso a los invertebrados. Se achica el fondo de la bolsa para que se pueda colocar un frasco de aproximadamente 200 ml de capacidad. • Bolsas de nylon.del material orgánico y. Como variación de este método.5 m de largo. de aproximadamente 34 cm de ancho x 55 cm de largo. después de limpiar la hojarasca suelta en el punto donde se va a colocar la trampa.. tazas. se pueden recolectar los especímenes de la sábana. el cual contiene alcohol al 70%. las cuales se usarán en campo para transportar el material tamizado. de 25 cm de ancho y 37 cm de largo. la parte superior del envase puede situarse a 1 cm más arriba de 118 Manual de biología de suelos tropicales . se marca un límite de búsqueda de 30 minutos por cada metro cuadrado de hojarasca muestreada. latas. vasos. botellas de plástico. una por cada trampa. de aproximadamente 1. hasta el lugar donde se encuentren las trampas Winkler. dichas trampas están hechas de envases profundos relativamente pequeños. • La trampa Winkler consiste en una bolsa porosa de algodón o nylon. tarros. contenida en la trampa Winkler. ESCARABAJOS. • Redes. OTRA MACROFAUNA Y MESOFAUNA QUE SE ENCUENTRAN EN LA HOJARASCA: TRAMPAS PITFALL CON Y SIN CEBO Introducción Las trampas pitfall o de caída constituyen un método efectivo de recolección de muestras de los invertebrados meso y macro que viven en la hojarasca. a prueba de insectos y mide 1. 25 cm de ancho y 20 cm de profundidad central. deberá ser pesada al final de la extracción. 2000) es la siguiente: • Marco con una medida de 1 x 1 m de madera. de esta manera. La hojarasca seca.50 m de largo. • Tamiz de malla grande. que se entierran de manera que la parte superior del envase quede exactamente al ras del suelo. utilizando un aspirador manual (pooter). por ejemplo. La lista completa de los materiales para la extracción con trampas Winkler (Bestelmeyer et al. que entre dentro de una bolsa resistente de nylon o tergal.

éstas ofrecen ventajas adicionales: se puede muestrear. pero la trampa debe ser lo suficientemente amplia como para poder colectar un número razonable de especímenes y suficientemente profunda Figura 3. El diámetro más pequeño ofrece la ventaja de sufrir menos perturbación al momento de insertar la trampa. No obstante. Las pitfall son baratas.6 Esquema de una trampa pitfall con cebo. miriápodos. Una típica trampa pitfall puede observarse en la Figura 3. se encuentran dispuestas de manera lineal (para facilitar la instalación y el retiro) sufren la misma desventaja que los transectos. ortópteros juveniles. Las trampas se colocan bajo cubierta para evitar que entre la lluvia y funcionan como colectores de artrópodos que viven en el suelo y que caen en el envase. presentan algunas desventajas: sobre todo que no muestrean todos los grupos taxonómicos con la misma eficiencia (escarabajos. puesto que en ambas existe un alto grado de autocorrelación entre muestras adjuntas. Las trampas normalmente se limpian y se recolocan una vez al día. colémbolos). normalmente. Nota: frascos con diámetro de 10 a 20 cm generalmente son efectivos. de manera simultánea. Además. las pitfall son proclives a sufrir daños ocasionados por mamíferos y aves. M acrofauna 119 . se pueden utilizar específicamente para atrapar animales nocturnos. arañas y otros arácnidos grandes tienden a dominar. ahogándose en agua contenida en el fondo de la trampa. de fácil instalación.la superficie y se construye una rampa de suelo suelto a su alrededor. al igual que a actos de vandalismo. por lo que se utilizan frecuentemente en los trabajos de inventario de la biodiversidad. mientras que los insectos alados se escapan). la macrofauna y parte de la mesofauna (especialmente. las dimensiones no son fundamentales. hormigas.6. Las trampas pitfall no son cuantitativas y dado que.

una caja Petri de vidrio invertida. cuatro palitos pequeños y una cubierta de celofán. es lo ideal. sin embargo. ésta descansará sobre palitos o clavos. Los clavos galvanizados o de madera son la mejor opción para elevar el techo hasta dos Figura 3. Un aditamento usual a las trampas es un techo inclinado para protegerlas de la lluvia. éstos pueden ser improvisados en el campo.7 Trampa pitfall improvisada. Entre 1 o 2 cm de agua en el fondo y un poquito de detergente serán suficientes para ahogar o inmovilizar a la mayoría de los animales y el detergente contrarrestará las propiedades hidrofóbicas de muchas cutículas de artrópodos. hecha con un vaso. 120 Manual de biología de suelos tropicales .para impedir la fuga.

con la excepción de agua y roca. de manera alternativa. ajenos a la fauna del suelo. al mismo tiempo que ayuda a mantener el contenido fresco. pero deberán evitarse siempre que se pueda. madera podrida y turba. una solución de hidrato de cloruro al 5% o una mezcla de ácido láctico/ácido acético (10% de cada uno de ellos. muestran que un nivel de captura aproximada puede obtenerse mediante la replicación de trampas pitfall. En otras palabras. éste deberá ser gris claro. Pueden emplearse para muestrear artrópodos en madrigueras. Se puede argumentar que cuando se trata de sol directo. madera u otro material lo suficientemente pesado como para que no lo eleve el viento o que pueda ser afectado por la lluvia o el sol y que además no sea comestible para las termitas. Estudios que se enfocan a la abundancia. En estudios referidos a riqueza de especies. hojarasca. de manera que permitan el acceso a las trampas. El número de réplicas puede basarse en curvas de acumulación de especies y ha de ser seleccionado para lograr un 85% o más de las especies buscadas. las pitfall normalmente se colocan en paralelo y M acrofauna 121 . retardando así la descomposición. En algunas variaciones de este procedimiento se añade sal como conservador. ¿cuál sería el número apropiado de trampas pitfall requeridas para colectar el 85% o más de las especies capturables en una unidad vegetal dada? En el muestreo basado en transectos (Swift y Bignell. con una respuesta negativa a la luz. también crea un microhábitat como si fuera una cueva. dentro de un rango de unidades vegetales. plástico. El vidrio pesa más que el plástico.7). El techo puede hacerse también de loseta de cerámica. pueden ser útiles para la estimación de la diversidad alfa. Las trampas pitfall pueden usarse en cualquier sustrato a nivel del suelo. aunque su aplicación más común es en un sustrato de suelo para la fauna de artrópodos activa en la superficie del suelo (Figura 3. el techo debería ser opaco para evitar un efecto invernadero dentro de la trampa.o tres centímetros. por lo que el techo se mantendrá más estable. 2001). Colocación de trampas Mientras las pitfall son estrictamente no cuantitativas. El uso de envases de color fuerte o con dibujos puede mejorar la captura de parasitoides u otros insectos voladores que serán atraídos por los colores. de manera que no atraiga insectos voladores. combinados con un poco de glicerina) para mejorar su conservación. pero se puede utilizar. el número de especies obtenidas por medio de las trampas pitfall se incrementa cuando éstas son colocadas en un máximo de unidades vegetales. lo que resulta atractivo para los artrópodos diurnos activos en la superficie.

con el fin de hacer un hoyo del tamaño del vaso a introducir. Instalaciones de las trampas pitfall Las trampas pitfall deben ser introducidas en el suelo con el borde superior del envase al ras del mismo o de la superficie de la hojarasca. es decir. podrá hacerse en cualquier momento. fuera del área principal de actividad. 3 El suelo fino. No se especifica el número. una precaución sensata sería. especialmente a pisadas. 122 Manual de biología de suelos tropicales . 2 Se coloca la trampa pitfall en el hoyo y el borde externo se llena de tierra procedente de la excavación. según el orden de vulnerabilidad decreciente: primero las pitfall (de un día para otro) seguidas por los transectos. De esta manera. se aplana con cuidado para mantener el mismo nivel que el borde de la trampa. pero esto no trata de ser prescriptivo. donde se puede colocar una colección de pitfall de manera cercana (véase "cercas movibles”). Se debe tener especial cuidado para evitar remover suelo y raíces. que cae en la trampa durante su colocación. colocados en la superficie del suelo. ordenar el lugar entero. el monolito. a una distancia de alrededor de 5 m.a cada lado. extracciones de núcleos de mesofauna y de microsimbiontes y. se canalizan los animales móviles hacia la base de la “V” o embudo. se sugiere que las pitfall sean colocadas a lo largo de la línea de transecto y a un lado de los cuadrantes de 1 m² del muestreo para hojarasca. 1 Se utiliza una cuchara de albañil para cortar y sacar las raíces y suelo. Se muestrea. puede soplarse hacia afuera. El número recomendado es de 3 a 5 trampas por cada punto de muestreo. sugerido por Southwood (1978) hace uso de tablas de madera o de algunos obstáculos similares de hasta 30 cm de alto. deberán ser extraídas a mano. las pitfall pueden ser distribuidas de la misma manera que en el muestreo casual para hormigas y termitas. En el sistema de muestreo recomendado para el proyecto CSM-BGBD. cualquier microhábitat de interés podrá ser investigado. ello depende del largo del transecto. las partículas más grandes. de manera que los animales caminen sin obstáculos hacia el borde de la trampa. Se usa el relleno para construir una rampa. de manera que se minimice al máximo la perturbación del microhábitat adjunto. Un esquema variable de muestreo con pitfall. capítulo 2. La colecta de las pitfall es sensible a la perturbación. en forma de “V” o de embudo. Cuando una parcela es botánicamente compleja y varias unidades vegetales pueden ser reconocidas. Un muestreo ocasional. por lo tanto. finalmente.

que hayan caído en la trampa. utilizando un flujo suave de agua. utilizando un frasco para enjuague o pipeta de agua. a no ser que la frecuencia de mantenimiento sea de 24 horas o menos. palitos. situado en su parte superior. enjuagando el contenido de cada bolsa en la red. siempre se necesitará sal u otro tipo de conservador en climas tropicales. animales más grandes. Se extraen los elementos grandes. etc. dejando así 2. 5 Se llenan las trampas hasta alrededor de ¼ de su capacidad con agua y suficiente sal como para lograr una solución saturada (en caso de escoger una solución salina). Se retira cualquier basura grande restante y se trata de retirar al máximo la tierra u otra basura orgánica.5 cm de cada soporte visible.4 Se insertan tres soportes de techo en el suelo alrededor de la trampa. lo que dificulta que sean manipulables y visibles bajo M acrofauna 123 . lo que servirá para separar los últimos ejemplares. Los especímenes deberán procesarse el mismo día en laboratorio o la base de campo. la sal y el detergente. con el fin de remover la suciedad. durante varios minutos. El lavado de ejemplares en agua fresca es esencial porque el detergente y la suciedad forman una película sobre los insectos. Para poder retener los colémbolos. colocado verticalmente con un pedazo de cinta o banderín amarillo o naranja. se agita suavemente el contenido restante del vaso para levantar los especímenes del fondo y se filtra con una red de acuario. esta película es difícil o hasta imposible retirar una vez que los ejemplares quedan conservados. resulta útil para identificar la localización de la trampa y para prevenir pisadas accidentales. se utiliza por separado un colador de 53 µm. 6 Se coloca el techo sobre los soportes. Se transfieren los especímenes en bolsas de plástico o frascos desde la red. 7 Se coloca un indicador con el número de lugar y trampa (en tinta indeleble o lápiz) cerca de la trampa. trampa y fecha de recolección. Cada trampa se debe procesar de manera separada y se coloca en la bolsa o frasco una etiqueta con la identificación del lugar. un palito. Se añade un poquito de detergente como agente tensoactivo. ver abajo). arriba del substrato. El detergente facilitará la inmovilización por ahogamiento de animales activos. tales como hojas. si se les introduce directamente en alcohol. El mantenimiento y el procesamiento de especímenes El mantenimiento de las trampas se lleva a cabo de la siguiente forma: se quita el techo y se levanta el vaso interior que contiene el cebo (en el caso de que lo contenga.

Las muestras almacenadas deberán quedarse en una bolsa doble o frasco. Para mejorar la capacidad de captura con trampas pitfall Es posible mejorar la capacidad de captura con las trampas pitfall haciendo varios cambios en el diseño de la trampa o usando cebo atractivo para artrópodos.microscopio. se invierte el contenido de la red en una bolsa de especímenes y con un atomizador o piseta. El excremento humano fresco también es apetecible para una gran variedad de escarabajos y. carroña. Una variante de este proceso es usar dos filtros para colémbolos (malla 53 µm y 38 µm) se utilizan para separar estos animales de la otra fauna (ver Capítulo 4). porque la capacidad de captura de las pitfall está en función del tamaño de su circunferencia. frutos caídos u hongos en descomposición que resultan indistintamente atractivos para los detritívoros y algunos otros tipos de artrópodos. cebos de color (amarillo. en espera de futuros procedimientos. Se cubre con alcohol la muestra hasta la altura de los ejemplares que se encuentran dentro de la muestra. El uso de cebos resulta controversial porque el muestreo se sesga hacia los animales con un marcado olfato. el porcentaje de todas las trampas estará ocupado por una sola especie) porque no se puede determinar 124 Manual de biología de suelos tropicales . La principal modificación en el diseño consiste en agrandar su diámetro. se refrigeran o se congelan las muestras. o sustancias sintéticas atractivas (por ejemplo. El cebo deberá separarse del líquido conservador. y se introducen las etiquetas (escritas con tinta indeleble o con lápiz). Se pueden preparar trampas pitfall adicionales (opcional) con un contenido de 120 ml de etanol al 95% + glicerina (9:1) que se dejan en campo durante 72 horas. feromonas). Para el procesamiento de ejemplares de colémbolos véase Capítulo 4 (Mesofauna). por supuesto. si es posible. El cebo puede ser estiércol. Después de este lavado. rojo o azul) para atraer moscas o parasitoides. se encuentra fácilmente disponible. esto se lleva a cabo con la suspensión del cebo en un pequeño bote colocado en la boca del envase principal. Las trampas con cebo no podrán utilizarse en una evaluación semi-cuantitativa como medio de captura (por ejemplo. El hecho de usar cebos atractivos implica un mejoramiento general para la captura de una gran variedad de artrópodos. Se recomiendan dos trampas de este tipo más tres de diseño convencional por cada punto de muestreo. lleno de alcohol. se usa alcohol al 95% en el caso de colémbolos y al 70% para otros especímenes. se lava suavemente el contenido de la red y los lados de la bolsa o frasco con el fin de que los ejemplares caigan hasta el fondo. Después de siete días se debe cambiar el alcohol y.

• Soportes del techo: clavos de madera o galvanizados de 152 mm (seis pulgadas). sin embargo. M acrofauna 125 . sino también de la movilidad relativa. pesados después de un secado con papel absorbente. REGUISTRO E INTERPRETACIÓN DE DATOS Parámetros Registre el número y peso fresco de todos los organismos e identifique. siempre que sea posible agruparlas en familias o subfamilias. se combinan los resultados de los monolitos. • Techo de 200 x 200 mm (uno por trampa). • Indicadores de plástico o de madera. no. • Lápiz de grafito (ej. La presencia y el peso de hongos cultivados por las termitas (si los hay) también deberán anotarse. • Agua: agua de la llave o de una fuente natural. transectos. trampas pitfall junto con un muestreo casual. se puede estimar el peso fresco para ejemplares conservados. Lista de materiales requeridos • Trampas pitfall: vasos de plástico de 1000 ml (con dimensiones de 180 mm de diámetro superior x 120 mm de profundidad). • Sal. esto es aplicable para las lista de especies de la localidad. • Detergente puro: detergente líquido no perfumado para platos. hasta el nivel de determinación taxonómica y funcional más alta posible. utilizando el nombre genérico y por orden alfabético. Para completar la lista. • Alcohol al 70 al 90%. Si no se cuenta con una balanza disponible en el campo. • Cubeta o envase para agua. por lo menos. • Red de acuario o similar (de malla fina). 2 o 6B) • Etiquetas tipo tarjeta.el área en donde se llevó a cabo el muestreo y la captura no sólo depende de la abundancia de animales. • Bolsas de plástico para muestreo con sello (tipo ziplock son las más convenientes para el almacenamiento de especímenes de campo) o frascos. trampas Winkler. se hace una lista de especies. loseta de color gris claro.

Cassava 26 Media aritmética Nivel del estrato (Promedio de todas individuos m-2 (n=5) las localidades) 46 0–10 cm 106 10–20 cm 55 20–30 cm 49 Media geométrica individuos m-2 (n=5)* 971 65 47 11 25 2 10 Media geométrica individuos m-2 (n=5)* 15 80 44 4 95% de confianza 347-12. A. La abundancia se estima como número o individuos por m2. con la excepción de las lombrices de tierra y milpiés. deberán enlistarse sin letras: Ejemplo Colobobsis sp. Selva primaria 2..Las especies plenamente identificadas deberán enlistarse con su nomenclatura binomial (género y especie) y la autoridad que las describió completas: Ejemplo Dorylus laevigatus Smith. Árboles talados 163 BS6.892 BS3. Hule 128 BS10. a través de un gradiente de perturbación de la selva.445 2-1. se multiplica el número crudo de cada monolito x 16.772 0-20 2-534 95% de confianza 3-64 43-148 24-78 1-50 * Datos retrotransformados. Incorpore la lista de especies en una tabla que muestre las localidades donde fue encontrada cada una. Selva de hule 211 BS12. la especie A es la misma especie en toda el área de muestreo. Las morfoespecies deberán enlistarse por letra: Ejemplo Crematogaster sp. Sitio Media aritmética individuos m-2 (n=5) BS1. 2003. Paraserianthes 512 BS8. Por ejemplo.827 22-977 5-16. Tabla 3. Fuente: datos de especies de Jones et al.046 2-9. y Crematogaster sp. Alang-alang 3 BS14. en la provincia Jambi del centro de Sumatra. Es importante que la designación de letra sea consistente entre las localidades. Las especies identificadas únicamente a nivel género. los cuales se muestrean en el mo126 Manual de biología de suelos tropicales .2 Densidad numérica (individuos m2) de termitas en siete localidades. B. de cada monolito y de cada estrato.

Los datos transformados pueden usarse para histogramas y comparaciones de lugar a lugar (Eggleton et al.nolito y la zanja (véase monolitos arriba). el número de veces que se descubren colonias separadas en el caso de hormigas o termitas. Se evita el uso del peso seco debido a las diferentes temperaturas de los hornos que usan algunos investigadores y por el contenido variable de agua de los diferentes tipos de organismos. En casos difíciles. o para otros grupos individuos separados a lo largo del transecto completo. (1997). También partiendo de que un transecto completo representa una muestra única y grande. existe un método alternativo que consiste en calibrar la biomasa viva con el ancho de cabeza. Jones e Eggleton (2000). datos transformados y los límites de confianza para log10(x+1). también es posible que el número total de encuentros. junto con las medias geométricas. Se estima la biomasa en g. tal y como se muestra en la tabla 3. se utiliza peso fresco o la masa de un espécimen parcialmente seco. Algunos indicadores de la abundancia relativa se pueden obtener a partir de la frecuencia de encuentro de diferentes especies (número de secciones de un transecto en donde se localizó la especie con respecto al número total muestreado. si es posible. y prepare una tabla resumida. véanse las discusiones en Eggleton y Bignell (1995). los datos primarios deberán transformarse en log10(x+1). Se citan las medias para datos no transformados. Cuando no hay demasiados ceros (muestras sin organismos) este procedimiento debería normalizar los datos y producir varianzas homogéneas de grupo a grupo. puedan ser parámetros útiles de población. El peso de los desconocidos puede entonces estimarse desde la curva. finalmente. se determina la abundancia para cada taxón. o sea.. Para poder estimar el 95% de límite de confianza. En el caso de transformaciones a log de los datos. derivar en índices de diversidad de especies y de equitatividad. Eggleton et al. número de pitfall respecto al total.2). resulta más conveniente M acrofauna 127 . por lo tanto. Woodcock (2005) y Jones et al. también para cada grupo taxonómico superior y se combinan los datos de todas las especies.m-2 de manera similar a como se calcula la abundancia. es posible asignar dominancia y. Donde se dispone de especímenes de insectos de varios tamaños. en especímenes representativos que cubren todo el rango de tamaños. Este concepto no se puede aplicar de la misma manera para las pitfall. incluyendo el 95% de los límites de confianza y con los datos transformados se obtiene una media geométrica. etc.). se puede probar una transformación loglog. 1996). Para la información completa obtenida de transectos. se calculan las medias aritméticas. (2005). Se aplican estadísticas descriptivas al juego de datos transformados.

muchas tasas de procesos en el ecosistema son proporcionales a la biomasa y no a la abundancia. es decir. el efecto de estos invertebrados es fraccionar y despedazar la hojarasca. Este grupo incluye. cochinillas y grillos). caracoles y pequeñas lombrices de tierra completamente pigmentadas. la clasificación de lombrices de tierra (ya mencionada) puede aplicarse a todos los invertebrados del suelo. escarabajos. en su mayoría. cucarachas. por tanto. menos informativa. de manera que monitorear datos sin estimaciones de biomasa proporciona información incompleta y. puesto que no implica pesar especímenes individuales o hacer otras medidas para estimar la biomasa. Cantidades considerables de suelo. Ensambles pueden ser comparados por la proporción relativa de especies o unidades taxonómicas (morfoespecies). Especies anécicas son las que retiran hojarasca de la superficie del suelo a través de su actividad alimenticia. Se debe mostrar riqueza de especies/morfoespecies. pero no redistribuyen activamente materiales de las plantas (aunque el material despedazado sea más fácilmente transportado por el viento o el agua que el material de donde deriva). Las lombrices de tierra y las termitas que no se alimentan de suelo constituyen los principales grupos dentro de esta categoría. ciempiés.trabajar en (mg+1) y luego se transforman y se expresa en gramos. elementos minerales y materia orgánica se redistribuyen con esta actividad y también se acompañan de efectos físicos sobre la estructura del suelo y las propiedades hídricas. Se prepara una tabla resumida. Análisis Los análisis se deben llevar a cabo por grupo funcional. La macrofauna activa en la superficie incluirá a los organismos muestreados en las trampas pitfall. sin embargo. las cuales pueden ser incluidas en una o más 128 Manual de biología de suelos tropicales . una variedad de artrópodos (hormigas. Nota: determinar solamente la abundancia resulta fácil. abundancia y biomasa en forma gráfica. definido por su hábito alimenticio y su distribución en el perfil del suelo. Especies epigeas que viven y se alimentan en la superficie del suelo. milpiés. pero también algunos arácnidos. y liberar nutrientes. Para poder establecer una comparación. ingiriendo grandes cantidades de materia mineral. Especies endógeas que viven en el suelo y se alimentan de materia orgánica y de raíces muertas. Los dos grupos principales son las lombrices de tierra y las termitas que se alimentan del suelo. como arriba.

según se explica a continuación. por categoría de uso de suelo y por ventana de muestreo. CONJUNTO mínimo DE DATOS El conjunto mínimo de datos puede ser expresado por cada punto de muestreo. Los índices de diversidad y de similaridad útiles incluyen: ShannonWiener. La riqueza de especies actual puede ser estimada por medio de Sob. Transformadores de hojarasca (normalmente artrópodos no sociales o semisociales. lombrices epigeas y ácaros grandes) ingieren una mezcla de materia orgánica y biomasa microbiana y forman heces holorgánicas de corta vida. ACE. M acrofauna 129 . pero ocasionalmente más pequeños) ingieren una mezcla de materia orgánica y minerales. normalmente procedentes de varios grupos de artrópodos).2 cm.categorías funcionales. Conjunto mínimo de datos por punto muestreado De todo el muestreo Lista de especies/morfoespecies para hormigas. como sinónimos.2 a 1cm). Nota: los términos “ingeniero de ecosistema y especies claves” con frecuencia son utilizados. que son complejos organominerales. Se recomienda probar la clasificación de un grupo funcional (GF) adicional para la macrofauna. utilizando las siguientes categorías: Los ingenieros del ecosistema (normalmente hormigas. y forman heces longevas y estables. Las especies clave (termitas y posiblemente algunos transformadores de hojarasca) proveen oportunidades físicas de nichos para organismos de nivel más bajo y determinan la estructura de la comunidad de estos organismos. Jacquard y Sorensen (véase Southwood. Jackknife. Los grandes invertebrados (> 1cm. Macropredadores (especies predadoras >0. termitas y lombrices anécicas y endógeas). de forma incorrecta. Este grupo incluye invertebrados grandes (> 1cm) y medianos (0. termitas y escarabajos capturados con cebo. Lista por familia de los otros escarabajos. 1978 y Krebs. 1998). ICE y EstimateS. pero algunos animales más pequeños (varios ácaros) pueden tener funciones análogas. Simpson.

Se hace un cálculo para cada GF.) también pueden estimarse. etc. De las trampas Winkler Frecuencia de especies por muestra. GF 2. Nótese que un encuentro es un evento en una sección de 5 m del transecto. números totales por cada grupo funcional (GF1. por lo tanto. GF 2. Todas las lombrices de tierra (además por GF 1.Lista de los otros invertebrados en la resolución taxonómica la más alta posible. Todas las termitas (y por GF 1. La abundancia relativa para cada GF está dada por el número de encuentros de divididos entre el número total de encuentros de todos los GFs. Desde el transecto o los transectos Abundancia relativa de termitas. Se pueden juntar los datos obtenidos de diferentes transectos en puntos de muestreo separados. en su defecto las que se alimentan de madera o de suelo). varía de 0 a 4 para transectos de 20 m y de 0 a 20 para transectos de 100 m. GF2.). GF2. con la excepción de lombrices de tierra). etc. etc.. 130 Manual de biología de suelos tropicales . En el caso de las hormigas. Datos de abundancia para hormigas y escarabajos (número de individuos m²). Todos los escarabajos Otros invertebrados Todos los invertebrados. etc. utilizando todas las secciones de transectos disponibles para el muestreo. Abundancia total en número m2 de forma separada para: Todas las hormigas (y por grupo funcional GF1.). Para cada taxón se indica el método de muestreo empleado: C = casual T = transecto W = Winkler P = pitfalls M= monolito (Para el monolito no observar estratificaciones de 3 x 10 cm. el número de encuentros.

como % ± SD.). etc. Conjunto mínimo de datos por uso de suelo Las categorías de uso de suelo son anotadas y cuando esto no es posible se clasifican de acuerdo con la intensidad de uso de suelo. donde n = número de puntos por uso de suelo.. Lista de familias para los demás escarabajos Lista de invertebrados en la resolución taxonómica la más alta posible Para cada taxón se indica el método de muestreo empleado. etc. utilizando las mismas claves que las especificadas anteriormente: C= Casual. GF 2. todas las termitas (y para los grupos GF 1. GF 2. todas las lombrices de tierra (y por grupos GF 1. otros invertebrados y todos los invertebrados (igual a lo indicado para datos mínimos por punto de muestreo).).De las trampas pitfall Se desglosa los taxa no muestreados por otros medios (únicamente). De todo el muestreo Listas de especies/morfoespecies para hormigas. etc. lombrices de tierra y escarabajos capturados con cebos. separado para hormigas (y para grupos funcionales GF1. todos los escarabajos. termitas. etc. o en su defecto las que se alimentan de madera o de suelo). M acrofauna 131 . T = Transecto. W= Winkler. GF 2. De los transectos Abundancia relativa media de termitas GF 1. P= Pitfalls y M= Monolito De los monolitos Es necesario proveer la abundancia media como: a) Número de individuos m² ±SD b) Media geométrica ± 95% de intervalo de confianza c) Media aritmética ± 95% de intervalo de confianza donde n = número de puntos por uso de suelo. GF 2.

Abundancia media de escarabajos como individuos m² ± SD. muestreo anidado y estratificado ejemplo Eggleton et al. cuando su abundancia o biomasa lo justifique. 1994). El uso de datos crudos de abundancia y de biomasa en la interpretación de la función del ecosistema resulta controversial. ejemplo Diversidad β. De manera similar. Desafortunadamente.. se dice que la abundancia de individuos no se debe usar en el caso de hormigas porque son insectos sociales que se organizan en colonias formadas por miles de individuos que se alimentan en grupos. 1995. GF 2. 1996) y que la biomasa es tan importante para la determinación del impacto ecológico que no se puede prescindir de ella o sustituirla. donde n = número de puntos por uso de suelo. Lawton et al. será sobreestimada (Colwell y Coddington. en base de lugar a lugar. la escala del esfuerzo requerida para poder evaluar la biomasa es enorme (véase Eggleton y Bignell. Conjunto mínimo de datos por ventana de muestreo De todos los métodos de muestreo Recambio de especies a lo largo del gradiente como la β de Whittaker. Para todas las abundancias medias totales y las abundancias medias relativas de los GF Correlación con parámetros individuales del gradiente.) como individuos m² ± SD. el cálculo retrospectivo hasta llegar a la densidad numérica. se argumenta que los organismos se deben asignar únicamente como ingenieros del ecosistema. 132 Manual de biología de suelos tropicales . La frecuencia de especies por muestreo presenta un parámetro alternativo. Por ejemplo. si el muestreo se hace en una colonia.. etc. si el régimen de muestreo es suficientemente robusto (incluyendo réplicas adecuadas. existen contra argumentos de que los insectos sociales pueden evaluarse correctamente en cuanto a su abundancia y biomasa. no obstante.De las trampas Winkler Abundancia media de hormigas (y como GF 1. incluyendo los resultados de intensificación de uso de suelo.

D. COE Soil Ecology Research Group. T. 29.. (1977) ‘Stratégies lombriciennes’...T. 143–147. 32. (eds) (2000) Measuring and Monitoring Biological Diversity. K. 35. pp. y Saha. Ecological Bulletins. J.ac. M. pp. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. K. Bestelmeyer. Standard Methods for Ground-living Ants.. 122–132. www. J. J. Environmental & Ecology. Kippax. Braudeau. pp. Soil Biology and Biochemistry.. M acrofauna 133 .eis. (2002) Cosmopolitan Earthworms – An Eco-Taxonomic Guide to the Peregrine Species of the World. Kaneko and M. Persson (eds) Soil Organisms as Components of Ecosystems. J. T. E.. Constantino. Yokohama National University. REFERENCIAS Agosti. P. Agosti. e Ingram. C.. H. Pashanasi. R. 25. in U. Halder. Soil Biology and Biochemistry. R. y Lavelle. D. Washington.htm. Bhadauria T. J. Alonso. B. vol. P.. Australia. (2002) ‘Effects of land-use system on the soil macrofauna in western Brazilian Amazonia’. Y. Delabie.bio-eco. Wallingford. Brown. T. Blakemore. A. R. Bouché. (1997) ‘Regulation of soil structure by geophagous earthworm activities in humid savanna of Côte d’Ivoire’. E. pp. S. Lohm and T. (eds) (1989) Tropical Soil Biology and Fertility: A Handbook of Methods. 433–460. e Ingram. Andersen. 1st edition. y Schultz T. M. vol.. Lebissonnais. DC. VermEcology. in N. B. Japan. W. E.. Ito (eds) A Series of Searchable Texts on Earthworm Biodiversity. N. E. N. S. F. C. I. Wallingford.. R. y Valentin. G. (2000) ‘Soil microarthropods of a rubber plantation and a natural forest’. Biology and Fertility of Soils. M. 24. Barrios. Majer. pp. Blanchart. y Srivastava. India’. (1997) ‘Functional groups and patterns of organization in North American ant communities: A comparison with Australia’. Journal of Biogeography.. Lavelle. 2nd edition.. D. Blakemore. Ecology and Systematics from Various Regions of the World. Brandão. J. pp. M. 431–439.1998). Smithsonian Institution. vol. (2000) ‘Diversity and distribution of endemic and exotic earthworms in natural and regenerating ecosystems in the central Himalayas. S.. CAB International. vol. T.jp/eng/index. J. 3. Anderson. I. J. L. Ramakrishnan. C.ynu. CAB International.338–347. lo que compromete la caracterización de la heterogeneidad del paisaje porque restringe el número de puntos de muestreo que pueden ser utilizados. R. 2045–2054. vol. (2005) ‘Introductory key to revised earthworm families of the world’. Anderson.. Leeanne. Alonso L. Bhattacharya.. vol. P.

. C. Le Coeur. (1999) ‘Comunidades de formigas (Hymenoptera: Formicidae): Métodos de estudo e estudos de casos na Mata Atlântica’. H.ucon. A.. pp133-143. Termitidae. J. 39. C. vol. (2005) ‘EstimateS.eeb. 605–609. Jiménez. http://viceroy. 157–168. Fragoso. Thenail. Mitteilungen aus dem Zoologischen Museum in Berlin. P. Software and User’s Guide’. Morvan. Schultz 134 Manual de biología de suelos tropicales . Brunel. y Lavelle. Petit. Collins. CSM-BGBD (2005) Global workshop on ant and termite sampling and identification. http://viceroy. N.. Acta Oecologia. Plant and Soil. J.. y Lefeuvre. uconn.edu/estimates.. pp. C. J. (1995) ‘Inquilismo simultâneo de duas eespécies de Centromyrmex (Hymenoptera. Agosti. vol. and Rippstein.Burel. 103. Werger (eds) Tropical Rain Forest Ecosystems. G. in D.. D.. Agosti. L. 347–367. S. (2000) ‘Statistical Estimate of Species Richness and Shared Species from Samples. Colwell. J. Leith and M. 12... vol. Elsevier Science Publishers. R. Version 7. Dubs. P. Tropical Soil Biology and Fertility Institute of CIAT. y Nascimento. J. I. T. Alonso and T. Decaëns. N. (1994) ‘Estimating terrestrial biodiversity through extrapolation’.. F. T. Majer. pp. (1996) ‘Revision der Unterfamilie Benhamiinae MICHAELSEN. y Jiménez. Baudry. 301–312 Decaëns. (1998) ‘Comparative biodiversity along a gradient of agricultural landscapes’.. 72. Y. Encontro De Zoologia Do Nordeste. Jiménez. Amsterdam.. G. K.. Chauvel. 345. Feira De Santana.. Colwell. C. E. E. (1989) ‘Termites’. (Isoptera. vol. Delabie. K. M. Decaëns. Philosophical Transactions of the Royal Society (Series B).. T. 58–68. pp. Kenya. A. 47–60. J. vol. G.5: Statistical Estimation of Species Richness and Shared Species from Samples. C. Delettre.. J. Lavelle. E. D. Formicidae.. pp.0b1’. T. vol. J.. Nasutermitinae)’. R. Csuzdi. (2002) ‘Earthworm communities under an agricultural intensification gradient in Colombia’. 101–118. P. Escobar. in H. Ponerinae) em cupinzeiros de Syntermes sp. J. Blanchart. Revista Brasileira De Entomologia. H. pp. H. São Paulo. R. S. 30. J. 19. Nairobi. C.eeb. vol. C. Barros. Clergeau. (1994) ‘Impact of land management on soil macrofauna in the Oriental Llanos of Colombia’. F. K. Delabie. vol. Version 6. A. pp. Paillat. Butet. (2004)‚‘Soil macrofauna communities in permanent pastures derived from tropical forest or savannas’. J. Agriculture. J.edu/EstimateS. J. Sociedade Nordestina De Zoologia. pp. A. Delabie. European Journal of Soil Biology. J. (2000) ‘Litter ant communities of the Brazilian Atlantic rain forest region’. 1897 (Oligochaeta: Acanthodrilidae)’.. D. Resumos Feira De Santana.-C. Colwell. y Coddington.. Ecosystems and Environment. 240.

T.. Eggleton. 35.. R. y Brown.. pp.. vol.. K. vol. Haynes. D. MacDonald. forest disturbance and greenhouse gas fluxes in Sabah. J.. Eggleton. y Rojas-Fernandez. (1994) ‘Earthworms from Southeastern Mexico. (1995) ‘Monitoring the response of tropical insects to changes in the environment: troubles with termites’. (1996) ‘The diversity. A. 27. 87–276. P. N. O. vol. Sands. Homathevi. C. R. G. G. P. Smithsonian Institution. Journal of Tropical Ecology.(eds) Measuring and Monitoring Biological Diversity: Standard Methods For Groundliving Ants.. A.. W. 1–12. Wood. D. C. D. D. C. Philosophical Transactions of the Royal Society of London. Metapheretima.. Eggleton. Applied Soil Ecology. y Maryati. H. Eisen. 351. Davies. E. vol. Homathevi. Bignell. pp. R. y Maryati. 489–498. P. Easton. Washington. DC. E. Davies. Bulletin of the British Museum (Natural History) Zoology. pp. Southern Cameroon’. vol. J. M. 10.. E. T. 119–128. South Africa’. (1999) ‘Termite assemblages. (1979) ‘A revision of the ‘acaecate’ earthworms of the Pheretima group (Megascolecidae: Oligochaeta): Archipheretima. D.. 1791–1802. Harrington and N.. Eggleton. V. T. 2. D. M acrofauna 135 . vol. E. Jones. Series B. M. Journal of African Zoology. vol. P. vol. E.. 111. 354. Eggleton. vol. Jones. pp. (1900) ‘Researches in American Oligochaeta with especial reference to those of the Pacific Coast and adjacent islands’. East Malaysia’. E. Philosophical Transactions of the Royal Society of London. D. pp. pp. Pleinogaster and Polypheretima’. Megadrilogica. in R. 51–68. F. P. (1994) ‘Effects of habitat fragmentation on Amazonian termite communities’. F. G. (2004) ‘Influence of agricultural land use on the size and composition of earthworm communities in northern KwaZulu-Natal. Dlamini. 1–128. Bignell. A. 197–206. Academic Press. Series B. (1997) ‘The species richness and composition of termites (Isoptera) in primary and regenerating lowland dipterocarp forest in Sabah.. Jeeva. y Bignell. 3. D. New Acanthodriline genera and species (Megascolecidae. J. pp. and its biological significance’. Southern Cameroon. Oligochaeta)’. Lawton. R. Ecotropica. abundance and biomass of termites under differing levels of disturbance in the Mbalmayo Forest Reserve. y Bignell. Planapheretima. 6. London. (1997) ‘The incidence of secondary occupation of epigeal termite (Isoptera) mounds by other termites in the Mbalmayo Forest Reserve. pp.. R.. G. 77–88. G. Fragoso. DeSouza. Stork (eds) Insects in a Changing Environment. Mawdsley. P. East Malaysia’. pp. Jeeva. y Bignell. N. Proceedings of the Californian Academy of Sciences.

. Keli. Lavelle. P. Martinez. (1988) The Fauna of India and the Adjacent Countries. Susilo. B. J. Gilot. M. structure and influence of management pratices’. H. R. an introduction to the systematics and biology of Megadrile oligochaetes with special reference to South-East Asia’. D. 453–464 International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature. 186–189. C. Calcutta. P. y Hawksworth.. Jones. J. in K... F. V. H.. E. D.. D. J. Krishna and F. P.. Gillison.. Haynes. E. G. Gates. J. pp. Suryo.. Konigstein. pp. Filgueiras. A. (1972) ‘Burmese earthworms. P. 17–35. (2003) ‘Termite assemblage collapses along a land-use intensification gradient in lowland central Sumatra. Fragoso. pp. (2003) ‘Effect of agricultural land use on soil organic matter status and the composition of earthworm communities in KwaZuluNatal. Zoological Survey of India. vol.. Lavelle. T. T. Weesner (eds) Biology of Termites. F. 40. McNeill. E. (1995) ‘Biological activity of soil under rubber plantation in Côte d’Ivoire’. C.. P. y Eggleton. Blackwell. Oxford. F. Ecosystems and Environment. 380–391. Decaëns. R. Indonesia’.. C. D. Turland N. 37. J. Applied Soil Ecology.. Agriculture. Patron. y Eggleton. J. E.. T. E. G. in S. W. B. (1997) ‘Agricultural intensification. P. J. 6. Barrie. H. y Kumar.. vol. L. Lavelle. Megadrile Oligochaeta (Earthworms) Family Octochaetidae. D. New York. S. (2000) ‘Sampling termite assemblages in tropical forests: Testing a rapid biodiversity assessment protocol’.. 4th edition.. L. Transactions of the American Philosophical Society. 1–326. Bignell. Nicolson. soil biodiversity and agroecosystem function in the tropics: The role of earthworms’. Julka.. Blanchart. P. Demoulin.Fragoso. International Trust for Zoological Nomenclature. 136 Manual de biología de suelos tropicales . Brussard and P. (1999) ‘Earthworm communities of tropical agroecosystems: Origin. Jiménez. T. Gay. Senapati. Senapati. B. J. Journal of Applied Ecology. Blanchart. Skog.. vol. y Graham. vol. pp. P. y Tondoh. Trehane. Jones..-X. J. C. Kouassi. vol.. S. J. E. E. H. vol. Hendrix (eds) Earthworm Management in Tropical Agroecosystems. C. P. D. y Eggleton.-M.. Acta Zoologica Fenica. M.. Burdet. G. J. London.. T. Leather (ed) Insect Sampling in Forest Ecosystems. Jones.. 196. Verkerk. Wallingford. (1970) ‘Termites of the Australian region’. M. 62. M.. K.. Koeltz Scientific Books.. 95.. Lavelle.. y Guillaume. C. 191–203. in P. J. (2005) ‘Methods for sampling termites’. Journal of Applied Ecology. pp.. South Africa’.. CAB International. A. y Calaby. Academic Press. Blanchart. H. W. J. T. Silva. Greuter. Pashanasi. R. F.. (2000) International Code of Botanical Nomenclature (St Louis Code). Dominy. pp. G. Brown.

pp. Pearson Education. J. J. Boulton. Amsterdam. (1995) ‘Colombian earthworms’. Nature (Lond). M. Blackwell Science. 20. y Watt. 2nd edition. E. pp. indicator taxa and effects of habitat modification in tropical forest’. Bignell. G. 300–305.. Bonvicini and P. 39. C.. 485–607. European Journal of Soil Biology. (1997) ‘Soil function in a changing world: The role of the invertebrate ecosystem engineers’.. Lepage. vol.. Studies on Tropical Andean Ecosystems. I. 1–95. and Fragoso. in F. Wolters. (1998) ‘Biodiversity inventories. (1987) ‘Peregrine species of earthworms’. Lawton. Hammond. Righi. P. 40. Biodiversity and Conservation. A. S.. P. 438–445. B. pp. 72–76. E. D. P. M. M acrofauna 137 . (1996) ‘The measurement of diversity in different types of biological collections’.. Rossi. R. Bloemers. pp. C. vol. Moreno. II The earthworms’. y Halffter. D. G. Pielou. A. G. G. P. M.. pp. Mucchi... (1981) ‘Strategies de reproduction chez les vers de terre’. D. Mathieu. P. (1983) ‘The soil fauna of tropical savannas. D.... A. Righi. 149–158. P. Mora. M.. K. C. Laboratoire de Zoologie.. Srivastava. Journal of Applied Ecology. Acta Oecologia – Oecologia Generalis. 2. A. Elsevier Publishing Company. Biology and Fertility of Soils. vol. Oxford. Lavelle. Grimaldi. N. E. 10. Stork. pp. pp. pp. vol. (1971) ‘Sobre a familia Glossoscolecidae (Oligochaeta) no Brasil’. J. P. Biology and Fertility of Soils. G. C. V. (2004) ‘Earthworm populations under tropical maize cultivation: The effect of mulching with velvet bean’.-P. Modena.. 391. Bourlière (ed) Tropical Savannas. 4. Lavelle. (2001) ‘Spatial and temporal analysis of. Omodeo (eds) On Earthworms: Selected Symposia and Monographs. H. Thèse de Doctorat. S. D. vol. O. Lavelle. 33. pp. 213–226.Krebs.. vol. y Rouland-Lefèvre. N. C. vol. E. J. Heal. Université Paris VI. Lavelle. (2000) ‘Assessing the completeness of bat biodiversity inventories using species accumulation curves’. 13. B. Journal of Theoretical Biology. Roger. Arquivos de Zoologia. Larsen. Moreno. E. (1978) ‘Les vers de terres de la savane de Lamto (Côte d’Ivoire): Peuplements. vol. vol. Unione Zoologica Italiana 2. Magurran. Eggleton. 117–133. Mawdsley. in A. P. vol. P. M. 37. Lavelle. E. Lee. Hodda.. E. France. London. y Dhillion. F. C. y Halffter. (1998) Ecological Methodology. pp367–382 Ortiz-Ceballos.... (2004) ‘A multi-scale study of soil macrofauna biodiversity in Amazonia pastures’. populations et fonction dans l’écosystème’. (2004) Measuring Biological Diversity. T. Holt. 159–193. Bignell. and diversities of bats in a fragmented landscape’. Ecole Normale Supérieure 12.

Chessel. (1992) International Code of Nomenclature of Bacteria: Bacteriological Code. E. (1978) Ecological Methods with Particular Reference to the Study of Insect Populations. (1987) ‘A review of the Central African earthworm family Eudrilidae (Oligochaeta)’. Bulletin of the British Museum (Natural History) Zoology. 169–268. VA. Pagliani and P. Bogor. G. 1990 Revision. A. pp. P. Herndon. R. vol. Pattern and Process. T. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition’. suborder Lumbricina (Haplotaxida: Oligochaeta)’. P.. P. pp. Oxford. y Lavelle. y Bignell.. Vincent. (2005) ‘Pitfall sampling in ecological studies’. W. Thioulouse. 4. South East Asian Regional Research Programme. Woodcock. Eudrilidae) in Ivory Coast’.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. R. Biological Journal of the Linnean Society. London. S. 113–131. R. D. F. W. H.Sims. Opuscula Zoologica Budapest. M. pp. Anderson (eds) Community Ecology. (1996) ‘A pilot analysis of gut contents in termites from the Mbalmayo Forest Reserve. Unione Zoologica Italiana 2. Kikkawa and D. Brian (ed) Production Ecology of Ants and Termites. 39. Bignell. 21. ASB Lecture Note 6B. (1997) ‘ADE: A multivariate analysis and graphical display software’. A. Sims. Blackwell Science. (1980) ‘A classification and the distribution of earthworms. (1986) ‘Guilds and their utility in ecology’. y Easton. in A. R. E. pp. Blackwell. vol. G. Thèse de 3e cycle. D. 75–83. 7. 493–500. vol. Zicsi. Tondoh.. Southwood. Statistics and Computing. y Eggleton. Omodeo (eds) ‘On earthworms. 1995) (Oligochaeta: Glossoscolecidae). vol. y Olivier. Modena. in S. International Centre for Research in Agroforestry. Sims. Sneath. 138 Manual de biología de suelos tropicales . T. S. Ecological Entomology. 103–124. Oxford.pdf. France. (1972) ‘A numerical revision of the earthworm genus Pheretima auct. J. Terborgh. D. (1969) ‘Recherche sur le peuplement en Oligochète de la savane de Lamto (Côte d’Ivoire)’. B. selected symposia and monographs’. J. E. 2nd edition. pp. Cambridge University Press. Swift. E. Mucchi. Indonesia. P.. Dolédec. pp.fao. A. Journal of Tropical Ecology. R. y Robinson. Regenwürmer aus Südamerika’. Chapman and Hall. Wood. 21. in M. J. (1978) ‘Food and feeding habits of termites’. Leather (ed) Insect Sampling in Forest Ecosystems. Université Paris VI. W. Cambridge. vol. V. M. M. (2001) ‘Revision der Untergattung Martiodrilus (Maipure Righi. vol. E. www. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. 279–288. ASM Press. Sleaford. J. 33. in J. Cameroon’.

A. 92. pp. Berichte des Naturwissenschaftlicher-Medizinischer Vereins in Innsbruck. vol. M acrofauna 139 .Zicsi. Regenwürmer aus Südamerika 39. (2005) ‘Über den heutigen Stand der Regenwurmfauna (Oligochaeta) Ekuadors mit einem Bestimmungsschlüssel der Glossoscoleciden-Arten’. 95–130.

dentro del clado Termes. 2003. Forest Research Institute of Malaysia. útil para Sumatra. XXVI. 12-26 octubre. P. Bien ilustrada con sinopsis genérica. 140 Manual de biología de suelos tropicales . incluyendo Indonesia). Publicación clave para géneros de la región Neotropical. Notas Clave de géneros de hormigas de Borneo (útil en el S. M. Incluye una revisión de la biología ecología. Bogota. pero no cubre toda la diversidad de animales que se alimentan del suelo. Disponible y económica. 1-398. de fácil manejo. vol. 65-87.Apéndice 1.R.E. 36. de Asia. 30.G. Hormigas Neotropicales Fernández. y Homathevi. Kepong. with descriptions of one new genus and new species and including a key to genera’ Journal of Natural History. pp. Trabajo estándar. Clave moderna y de fácil interpretación. pp 95162. Colombia.E. pp1-244. S. pp. de Asia Thapa. Sarawak Museum Journal. Título y referencias ‘Manual for Bornean Ant (Formicidae) Identification’. ‘Termites of Sabah’ Forest Record 12. (2003) Termitas del S. F. E. (1992) ‘Termites of peninsular Malaysia’ en L. pp. de Asia Hashimoto. 1-374. (2 003). Universidad Malasis Sabah. ‘Introducción a las hormigas de la región Neotropical’ Instituto de Investigaciones de Recursos Biológicos. Región y autor Hormigas del S. Y. ‘A review of the South-east Asian Nasutitermitinae (Isoptera Temitidae). Clave un poco obsoleta de géneros de termitas del Norte de Borneo. F. taxonomía y la importancia económica de las hormigas. R. Tho. 35 pp. Kirton (ed) Malaysian Forest Records. escarabajos y hormigas. (1984) Collins. Bien ilustrada clave de fácil identificación para los soldados. Alexander von Humboldt. 1485-1506. protocolos de muestreo por región. vol. Preparado por “Tools for Monitoring Soil Biodiversity in the ASEAN Region”. Y. Gathorne-Hardy. Claves de identificación de termitas. Borneo Java y Sulawesi. N. (2001). (1984). ‘The termites (Isoptera) of Gunung Mulu National Park with a key to the genera know from Sarawak’. vol. Fácil de usar.

1-374. con muchas referencias que incorporan descripciones taxonómicas recientes. pp. 12–26 Octubre 2003. R. S. 2006. tanto para imagos como soldados. Trabajo estándar. Coleoptera. A. fácil de usar. Termitidae) from the Ethiopian region’. Booth. Webb. 2003. A. R. 18-22 Septiembre. London pp. 36 p. 1–384. Adaptación de Chung. Hormathevi. The Natural History Museum. ‘Manual for Bornean beetle (Coleoptera) family identification’. curation and data management.Cox. L. pp. Clave de géneros de imagos y soldados. 12–26. A. (1961). corta y bien ilustrada de familias con una sinopsis diagnóstica de más de 100 familias y casi 50 subfamilias. Y. G. International Institute of Entomology (and Institute of escarabajos. Continúa. Bulletin of the British Museum (Natural History). Un poco anticuado. C.Apéndice 1. Región y autor Homathevi. (2003) Título y referencias ‘Manual for Bornean Termites (Isoptera)’ preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Notas Clave inédita de géneros de termitas en el S. Training course on Arthropod preservation. Supplement 4. y Madge R. 1-28. M. incluyendo Indonesia. (1959). de Asia. 3. C. B. Claves hasta especies. de fácil manejo. Bien ilustrada. Universiti Malaysia Sabah. Termitas africanas Sands. (2003). Universiti Malasia Sabah. Universiti Malaysia Sabah.E. 1–172. Coleoptera. vol 8. “Termites of Sabah”. Clave bien ilustrada a nivel género de soldados. (1990). Escarabajos de Asia Chung. 2–38. Explicación detallada de la IIE Guides to insects of importance morfología y agrupaciones de to Man. Sands W. Nigeria. R. Escarabajos en general. preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. La autoridad estándar del momento para este genero. M acrofauna 141 . G. ‘A review of the termites of the genus' Antitermes the Ethiopian region. CAB International). Thapa. (1981). pp. (1965). W. (2006).. Sabah Forest Record 12 pp. Bulletin of the British Museum (Natural History). Octubre 2003. Lo que opera actualmente sobre esta subfamilia en África. Ibadan University Press. R. Clave moderna. pp. 129-156 Keys to the Genera of the African Termites. ‘A revision of the termite subfamily Nasutitermitinae (Isoptera.

Their Recognition and Control. obreros y soldados. Ruelle. únicamente para géneros principalmente en el contexto africano. (2000). R. vol 67. G. Incluye una sinopsis de familias y subfamilias en forma de clave con notas e identifica caracteres diagnósticos. Kluwer Academic Publishers. Región y autor Bouillon. E. (1980). pp. pp. London. Título y referencias Quel est ce termite Africain? Zooleo. más 32 referencias. Symbioses Ecology. Longman. A. pp. 500 pp. Clave hasta género para soldados y muchos géneros ilustrados de manera detallada a nivel de especies (en francés). Natural Science 6. (1971). 365–444. (1998). y Mathot. pero útil para confirmaciones. J. utilizando imagos. Termites. soldados mayores y soldados menores. vol. “The Identification of Worker Castes of Termite Genera from Soils of Africa and the Middle East”. Series B. incluye detalles del enrollamiento del intestino y de cómo está conformada la válvula entérica para identificar algunas Apicotermitinae. Mitchell B. D. en: T. pero recomendada para formarse. Sands. y Eggleton P. de difícil manejo. pp 1–23. 1.Apéndice 1. Termitas neotropicales Constantino. ‘Report on a survey of the termites of Zimbabwe’. 187–323. Continúa. Clave corta. Wallingford. ‘Taxonomy and phylogeny of termites’. Clave completa muy ilustrada y detallada. no muy útil como clave. Sociality. W. Bignell and M. 1–115. V. ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. Estudio prestigiado. (1970) A revision of the termites of the genus Macrotermes from the Ethiopean (Isoptera: Termitidae) Bulletin of the British Museum (Natural History) Entomology vol. 1–40. A. muy útil para termitas subterráneas crípticas. pp.. Abe. (2002). Kambhampati. (1966). Harris W. Higashi (eds) Termites: Evolution. Clave de especies para imagos. 142 Manual de biología de suelos tropicales . S. especialmente Apicotermitinae y todas las que se alimentan del suelo. Occasional Papers of the National Museums of Rhodesia. Zootaxa. 24. anticuada. Lo que opera actualmente este género. Estudio comprensivo que incluye claves hasta géneros de soldados. L. Notas Clave a nivel familia de imagos y soldados. CAB International. E.

subfamilias. vol.Uganda. Calcutta. 672 pp. (1983). Harvard University. Bibliografía completa. C. (Family Termitidae) Zoological survey of do Sri Lanka. Kenia. (2003). R. Los volúmenes I y II cubren todo el The Fauna of India and Adjacent subcontinente de la India. Clave detallada y de fácil manejo A Key to the Genera of the Termitinae by the Soldier Caste. (2001). Listas de material requerido para un muestreo de hormigas con precios en $US del 2001. Continúa. M acrofauna 143 . P. imagos y soldados. C. E. Ward. Darlington. II. M. Tanzania y Zanzibar. (sin fecha). Excelente para entrenaPest Research. géneros y especies para imagos y soldados. M. miento avanzado. Calcutta. reporte detallado con definiciones de características morfológicas. (sin fecha). 801 pp. Harvard University. ‘Equipment specifications’ Department of Entomology. C. Los volúmenes I y II contienen claves hasta familias. Williams R. O. I. No publicado. Fisher. pero sí un listado Checklist of the Species of Termites que identifica la distribución entre (Isoptera) Recorded from East Africa. (2001). eje de muchas claves privadas de museos nacionales. 'Ant subfamilies’. con una amplia bibliografía. Documento de base. Documentos variados Roowal. A. K. (J. Fisher. Centre for Overseas para géneros de África del Oeste y Central. B. y Williams. utilizadas en taxonomía. The Fauna of India and Adjacent Countries: Isoptera (Termites). Guías para caracterización del sitio y anotaciones relacionadas con el muestreo de hormigas. UC Davis. B. Región y autor Claves inéditas de termitas y listas de comprobación Wanyoni. B. Sinopsis ilustrada de subfamilias y su distribución. P. ed) International Centre of Insect Physiology and Ecology. (1989). L. Chhotani. Department of Entomology. O. y Chhotani. vol. Entomology department. 'Guidelines for data collection for ants’. incluyenCountries: Isoptera (Termites). (1997). B. Sands W. No publicado. S. India. Título y referencias Notas No es una clave. Centre for Overseas Pest Research. M.Apéndice 1. Zoological Survey of India. incluye claves hasta familias y subfamilias. ‘Taxonomy of Termites’.

No publicado. Notas Revisión moderna y completa de la naturaleza de la biodiversidad del suelo y métodos de evaluación rápidos para hormigas. Bibliografía amplia y actual. Harvard University Entomology. T. Department of Entomology. 2003. 1–39. pero sin ilustraciones. “Glossary of morphological characters used in ant taxonomy”. Continúa. (Anónimos.Apéndice 1. 12–26 October. pp. escarabajos del suelo. sin fecha). lectura obligatoria. Región y autor Jones. Isópteros y arañas (Araneae). Universiti Malaysia Sabah. D. Completo. prepared for ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. termitas. Título y referencias ‘Tools for the Rapid Assessment of Soil Invertebrate Biodiversity in the ASEAN Region’. lombrices de tierra diplópodos. (ed) 2003. Harvard University 144 Manual de biología de suelos tropicales .

Claves de soldados de especies de Las Antillas (anticuado). Constantino (2001). Clave de soldados. Claves de soldados de especies de Las Antillas (anticuado). Referencia Contenido RHINOTERMITIDAE Heterotermes TERMITIDAE Amitermes Anoplotermes Atlantitermes Cornitermes Cyranotermes Cyrilliotermes Labiotermes Light (1932). Género KALOTERMITIDAE Cryptotermes Eucryptotermes Procryptotermes Bacchus (1987) Scheffrahn y Krecek (1999). Constantino y DeSouza (1997). Clave de soldados de Paracomitermes (anticuado). Revisión de Labiotermes sensu stricto. Neocapritermes Parvitermes Krishna y Araujo (1968). Emerson y Banks (1965). Emerson (1952). Fontes (1985). Revisión y claves. Revisión mundial con revisión de claves de las especies antillanas con claves hasta la diagnosis de los soldados. Scheffrahn y Krecek (2001). Scheffrahn y Krecek. Constantino (1990). (2006).Apéndice 2. Las claves hasta género son dadas en Krishna (1961. Revisión y claves. con claves. Revisión y claves. Nasutitermes Parvitermes Procornitermes Holmgren (1910). Revisión y claves (anticuado). únicamente Kalotermitidae). Clave de soldados. Clave de soldados. Araujo (1954). Emerson (1952). Revisión y claves (anticuado y en alemán). Revisión y claves. Cancello (1986). Revisión y claves de soldados (en portugués). Snyder (1926). Trabajos taxonómicos con claves de especies de algunos géneros neotropicales. Constantino (1997). Clave de soldados de América del Sur. 2002). Constantino et al. Clave de alados (anticuado). Revisión de mapas de distribución de especies del Nuevo Mundo con clave de soldados y alados. Mill (1983) y Constantino (1999. M acrofauna 145 . Scheffrahn and Krecek (1993).

Continúa. Contenido Revisión y claves. Revisión y claves. Claves de soldados (anticuado). Claves de soldados. Revisión y claves de soldados (en portugués). 146 Manual de biología de suelos tropicales . Género Procornitermes Referencia Emerson (1952). Emerson (1945) . Cancello (1986). Constantino (1995). Fontes y Bandeira (1979). Revisión y claves (anticuado). Rhynchotermes Rotunditermes Syntermes Fontes (1985).Apéndice 2.

Acioli. 1. y DeSouza. y Banks. R. (1997) ‘Key to the soldiers of Atlantitermes Fontes 1979. Bulletin of the American Museum of Natural History. Papéis Avulsos de Zoologia (São Paulo). 10. Constantino. pp.. (2002) ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. 463–472. vol. pp.. F. E. Constantino. (1986) ‘Revisão de Procornitermes Emerson (Isoptera. 83. M acrofauna 147 . A. S. F. vol. Emerson. 36. C. pp. R. 125–131. E. 181–189. Zootaxa. Insect Systematics and Evolution. 1–40. Emerson. S. vol. y Vasconcellos. pp. 427–472. 1–33. Termitidae. Termitidae)’. vol. 1–11. vol. Constantino. Sociobiology. vol. (1987) ‘A taxonomic and biometric study of the genus Cryptotermes (Isoptera: Kalotermitidae)’. (1995) ‘Revision of the Neotropical termite genus Syntermes Holmgren (Isoptera: Termitidae)’. paper 67. Zootaxa. R. K. 55. (1965) ‘The Neotropical genus Labiotermes (Holmgren): Its phylogeny. with a new species from Brazil (Isoptera: Termitidae: Nasutitermitinae)’. Constantino. (1952) ‘The Neotropical genera Procornitermes and Cornitermes (Isoptera. Nasutitermitinae)’. 1–44. (1945) ‘The Neotropical genus Syntermes (Isoptera: Termitidae)’. University of Kansas Science Bulletin. Cancello. vol. Constantino. vol. R. 475– 540. Constantino. (1997) ‘Notes on Eucryptotermes with a new species from central Amazonia (Isoptera: Kalotermitidae)’. vol. A. R. pp. 99. Bacchus. pp. Schmidt. Goeldiana Zoologi. 205–213. pp. (2006) ‘A taxonomic revision of the Neotropical termite genera Labiotermes Holmgren and Paracornitermes Emerson (Isoptera: Termitidae: Nasutitermitinae)’. R. (2001) ‘Key to the soldiers of South American Heterotermes with a new species from Brazil (Isoptera: Rhinotermitidae)’. pp. paper 1340. A. Tropical Pest Bulletin. R. Carvalho. Nasutitermitinae)’. A.. Revista Brasileira de Entomologi. A. pp. Literatura especializada en termitas neotropicales Araujo. no 2208. (1990) ‘Notes on Cyranotermes Araujo with description of a new species (Isoptera. M. American Museum Novitates. 30. vol. (1954) ‘Notes on the genus Paracornitermes Emerson 1949 with description of two new species (Isoptera.. A. 2. Bulletin of the American Museum of Natural History. 7. Constantino. Termitidae. A. Termitidae. Termitidae. N. distribution and ecology (Isoptera. 189–236. Cuezzo. E. pp. R. 1–91. pp. F. E. O. 455–518. pp. pp. Nasutitermitinae)’. Emerson. Tropical Zoology. 31. Nasutitermitinae)’.Apéndice 3. H. L.

N. R. Krishna. 122. A. J. 111–171. Nasutitermitinae)’. pp. Bulletin of the American Museum of Natural History. Nasutitermitinae)’. R. pp. 138. J. Krishna. y Bandeira. 603–607. (1983) ‘Generic keys to the soldier caste of New World Termitidae (Isoptera: Insecta)’. y Krecek. pp. Light. vol. 171–325. 303–408. H. pp. vol. pp. pp. vol. L. y Araujo. (1926) ‘Termites collected on the Mulford Biological Exploration to the Amazon Basin 1921–1922’. Termitidae. Snyder. 13. L. R. 148 Manual de biología de suelos tropicales . 84–138. L. K. (1932) ‘Contribution toward a revision of the American species of Amitermes Silvestri’. Scheffrahn. Fontes. Termitidae)’. pp. pp. a new subterranean termite (Isoptera: Termitidae) from Cuba and the Dominican Republic’. vol. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten. vol. vol. 68. Scheffrahn. (1999) ‘Termites of the genus Cryptotermes Banks (Isoptera: Kalotermitidae) from the West Indies’. 7–25. Mill. 107–110. (1961) ‘A generic revision and phylogenetic study of the family Kalotermitidae (Isoptera)’. 9. 1–76. vol. T. Florida Entomologist. (1968) ‘A revision of the Neotropical genus Neocapritermes (Isoptera. S. R. E. H. Revista Brasileira de Zoologia. pp. 27. A.Fontes. 530–539. 5. vol. 335–414. y Krecek. H. G. (2001) ‘New world revision of the termite genus Procryptotermes (Isoptera : Kalotermitidae)’. Bulletin of the American Museum of Natural History. Systematic Entomology. (1979) ‘Redescription and comments on the Neotropical genus Rotunditermes (Isoptera. E. Termitidae. Revista Brasileira de Entomologia. F. vol. Holmgren. K. 179–190. vol. 94. Scheffrahn. Annals of the Entomological Society of America. 3. (1910) ‘Versuch einer Monographie der amerikanische Eutermes – Arten’. R. pp. R. 23. (1993) ‘Parvitermes subtilis. Insecta Mundi. vol. pp. 76. University of California Publications in Entomology. y Krecek. Proceedings of the US National Museum. J. (1985) ‘New genera and new species of Nasutitermitinae from the Neotropical region (Isoptera.

descrito en el Capítulo 2. Los núcleos de suelo. a 3 m y 6 m de radio del monolito. sin embargo. Pauropoda y otros Nematodos son típicos representantes de la mesofauna. y se complementan con pitfall. El muestreo de la mesofauna (y otra biota del suelo) se encuentra integrado como parte de la estrategia global del inventario de la biodiversidad bajo del suelo. sirven para colectar mesofauna que habita en el suelo mineral. bien por el método Berlese-Tullgren o por el de Berlese modificado.0 mm. 149 . localizadas a por lo menos 14 m del centro del monolito. Protura. los núcleos de suelo se localizan en dos círculos concéntricos. En cada punto de muestreo. Elizabeth Franklin. Cahyo Rahmadi. b) del contenido líquido de las trampas pitfall. Acari (ácaros). La mesofauna se colecta utilizando dos métodos de muestreo: a) una muestra compuesta que contiene varios núcleos de suelo y hojarasca extraída de la superficie. en principio. mientras las trampas pitfall se utilizan para colectar los que habitan en la superficie del suelo. acari y otra mesofauna del suelo: el método Berlese Agus Karyanto. Collembola (colémbolos). y cuya abundancia no puede ser evaluada con exactitud por medio de la selección manual del suelo. Francis-X. Susilo y Jose Wellington de Morais INTRODUCCIÓN La mesofauna está conformada por animales cuyo tamaño de cuerpo oscila entre 0.Capítulo 4 Collembola. por debajo de la hojarasca de la superficie y en la hojarasca en sí. respectivamente.2 y 2. Enchytraeidae. formas de larvas de especies de macrofauna también caen dentro del rango de tamaño de mesofauna.

2004). su abundancia.El método Berlese es un sistema de extracción por embudo para separar los pequeños artrópodos del suelo. composición de especies y diversidad en un hábitat específico son buenos indicadores de un suelo “sano” (Minor. El principio es colectar pequeños núcleos o bloques y combinarlos para hacer una sola muestra compues150 Manual de biología de suelos tropicales .) es suficientemente eficaz como para poder capturar colémbolos que viven en la superficie del suelo (edáficos). Estos ácaros se alimentan de materia de plantas vivas o muertas y de carroña. fue desarrollado por Antonio Berlese. se pueden encontrar entre 50 y 100 especies (Norton. asimismo. en contraste con los grupos más oportunistas como los colémbolos. a su vez. no resulta útil para colectar ácaros oribátidos (Acari: Oribatida) porque estos animales. normalmente. sin embargo. se convierten en un importante desecho nitrogenado. en suelos no perturbados. se alimentan de nematodos vivos (Siepel. y algunos son predadores. Sus heces fecales proporcionan una amplia superficie para la descomposición primaria por hongos y bacterias y. 1990). forrajean en hongos y algas. reemplazando la envoltura de agua por un foco de luz eléctrica. constituyen un componente integral de la estructura del suelo. su densidad puede alcanzar cientos de miles de individuos por m². al igual que en la formación de la estructura de suelo. a finales del siglo XIX. después de muertos. Los ácaros oribátidos (también conocidos como Cryptstigmata a los que se refieren como ácaros escarabajos o ácaros de caja) son artrópodos numéricamente dominantes en los horizontes orgánicos de la mayoría de los suelos. MÉTODOS DE MUESTREO Los protocolos aquí descritos abordan principalmente los de los ácaros y colémbolos presentes en los horizontes minerales y en la hojarasca. En 1918. de manera que la muestra se seca lentamente. por ejemplo. Tullgren modificó el método Berlese. con una diversidad de especies también muy alta y. El método pitfall (Capítulo 3. En este sistema circula agua caliente entre las paredes dobles de latón del embudo (o embudos). son sedentarios (con la excepción de algunas familias como Galumnidae y Scheloribatidae). Lo anterior es aplicable para los grupos mayores de microartrópodos del suelo o a partir de las proporciones de abundancia y diversidad entre los grupos de mesofauna del suelo. Se sugiere que para un muestreo normal ambas extracciones de embudo y pitfall deben emplearse de manera conjunta. 1990). Debido a su papel regulador en la descomposición y el reciclaje de nutrientes.

Una vez en el laboratorio. De manera alternativa.1a y b). se colectan en el campo. con una capa de papel para mantener un ambiente de humedad estable dentro de la caja. utilizando una pequeña cuchara que tome un volumen constante de aproximadamente 100 ml. se utilizan tres o cuatro muestras compuestas y no sólo una. Al llegar al campo de base o laboratorio. No se debe usar un costal de plástico porque la temperatura del suelo puede aumentar sustancialmente. lo que provocaría la muerte de la mesofauna antes de su extracción. De manera alternativa. C ollembola .5 x 3. Ahora las muestras estarán listas para su traslado al laboratorio. tanto la luz solar como el calor del motor. Enseguida se empacan las muestras en una caja de cartón. y toma muestras a una profundidad de hasta 5cm que posteriormente se transfieren a un recipiente de plástico de 300 ml de volumen (Figuras 4. La muestra compuesta de suelo se divide en 10 bolsas de nylon. De la misma manera. Si se transporta la muestra sin aire acondicionado. utilizando un sacabocados. se colocan todos los costales de tela bajo techo. Este aparato mide 3. con un promedio de un kilo por bolsa. Así. evitando que la temperatura se eleve. Las muestras de suelo.5 cm de ancho y 10 cm de alto. donde serán identificadas. las muestras del suelo pueden ser colectadas en muestras de 3.5 x 5 cm de profundidad.ta. Dichas muestras deben permanecer alejadas del calor del motor del vehículo y de su sistema de escape. el suelo deberá someterse de inmediato a su extracción.5 x 3. de acuerdo con su localidad de muestreo. con o sin hojarasca. el suelo de 12 sub-muestras se coloca entonces en una bolsa de 5 kg como una muestra compuesta. porque la tela permite que circule el aire. son dañinos para los animales que se encuentran en la muestra. se debe evitar que la muestra se exponga a sol directo durante el encostalado en el campo. Se ha observado que los costales de tela son muy eficientes para almacenar temporalmente y transportar las muestras durante largas distancias y tiempos. El siguiente paso es almacenar las muestras en cajas grandes para transportarlas hasta el laboratorio. la fauna también puede morir. la cual es entonces sub-muestreada por extracción por el método de BerleseTullgren. acari y otra mesofauna del suelo 151 . se etiquetan y se transfieren a un costal de tela de 30 x 35 cm de tamaño. porque si éstas se mojan o humedecen demasiado. ésta deberá situarse en el asiento del pasajero. también se deben proteger de la lluvia durante el traslado. para evitar que la mesofauna muera. para ello es recomendable utilizar un vehículo con aire acondicionado.

La manera ideal es utilizar un contenedor de madera de alrededor de 160 x 50 cm. se mantiene el aparato en el laboratorio del campo de base. El tamaño de malla del tamiz. Morais y E.W.Figura 4. hormigas.2) es utilizado para extraer la mesofauna activa que habita en las muestras de suelo y en la hojarasca. Se coloca un tamiz (de 8 cm de diámetro y 5 cm de altura) con muestras de suelo y hojarascas encima del embudo. b) se utilizan guantes como precaución contra enredaderas. dividido en compartimentos superiores e inferiores. se debe incrementar el calentamiento de manera gradual cada día. utilizando una pequeña cuchara o cuchillo de campo. cerca del área de referencia. Cortesía de: J. dejando los focos encendidos cada vez 152 Manual de biología de suelos tropicales . aunque también se podrían usar los de 40 W. éstos se suspenderán a 14 cm por encima del tamiz. Se calientan ligeramente los embudos. Franklin.1 Sacabocados de metal para muestrear la mesofauna en la hojarasca y en el suelo mineral. cada compartimento contará con un marco para sostener los embudos de plástico (Figura 4. A B EXTRACCIÓN Método Berlese-Tullgren El aparato Berlese-Tullgren (Figura 4. deberá contener cuatro agujeros de 4 mm de diámetro para permitir que animales mayores escapen hacia abajo. para evitar que otros insectos voladores pasen a formar parte de la muestra.2 a) al igual que puertas. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. utilizando para ello focos eléctricos (los de 25 W son ideales). de 1.5 mm. arañas y otros artrópodos.

por lo tanto. de modo que los animales que caen por la malla lo hagan de manera rápida hasta llegar a la botella que los recibe.W. por un periodo de hasta 8 días. Franklin. Morais y E. la temperatura de la muestra se aumenta gradualmente de 27°C hasta aproximadamente 40-45°C. evitando así que las especies que se mueven con mayor lentitud queden atrapadas en las capas secas y duras del suelo. acari y otra mesofauna del suelo 153 . esto inmovilizará a la mesofauna antes de que se escape. es decir. b) sistema Berlese–Tullgren en operación. para una mayor efectividad. para evitar que el material de la muestra se seque demasiado rápido. Nota: nótese que las patas están sumergidas en agua para evitar la invasión de hormigas y de otros insectos. Se ajusta la posición de la lámpara para asegurar que la temperatura del suelo suba gradualmente. en una botella que los recibe hasta la base del embudo. El principio básico del aparato Berlese-Tullgren es que los organismos de suelo responden al incremento de temperatura o sequedad en el suelo migrando hacia abajo hasta que finalmente caen a través de la malla. si se dejan durante más tiempo nacen los C ollembola . Típicamente. Figura 4. el embudo deberá presentar una superficie lisa y una fuerte pendiente. hasta que mantengan un peso seco constante que generalmente tarda unos 8 días.durante mayor tiempo. Cortesía de: J.2 a) contenedor de apoyo para embudos Berlese–Tullgren. la cual contiene un conservador. Las muestras se quedan en el aparato hasta que estén completamente secas.

3.. es uno de los más usuales para la extracción en la evaluación de la diversidad y densidad de microartrópodos del suelo (André et al. lo único que se requiere es un embudo más grande y un tiempo de secado más largo. éste se cerrará con una tapa para prevenir la entrada de otros insectos. El envase receptor se llena con etanol al 96% para su conservación y durante intervalos de 4 a 5 días se cambia el envase receptor. en donde se coloca un tamiz con una malla de 2 x 2 mm (malla 13). por lo que las muestras serán menos representativas. Un sistema Berlese que opera sin luz muchas veces permite una mejor extracción. es el adecuado para el secado sin electricidad. el agujero de ventilación de la tapa deberá cerrarse durante la noche. al tiempo que utilizan el mismo principio para extraer un solo núcleo o una muestra conglomerada mayor. en este caso. con la colocación de una bombilla de 10 a 40W. El método Berlese modificado Cuando no se cuenta con electricidad. el tiempo de espera será de 7 a 14 días. 2006). El uso de un foco puede atraer insectos nocturnos. Como líquido conservador. el sistema Berlese-Tullgren y. en cierta manera. arriba de las muestras de suelo. generalmente. aun en regiones remotas (Frankin y Morais. 2002). El aparato Berlese sensu stricto puede transformarse en un modelo Berlese-Tullgren. pueden moverse con facilidad desde el lugar del muestreo y ser ajustados para acomodar un gran número de muestras. aunque tomará más tiempo. el de Berlese. especialmente si el embudo Berlese no está perfectamente cerrado. el equipo completo requerido es barato y puede ser fácilmente improvisado (Figura 4. Una ventaja de dichos sistemas es que se pueden operar a diferentes escalas. Asimismo. un embudo de aluminio modificado de Berlese. dependiendo de las condiciones de humedad inicial del suelo.5). 154 Manual de biología de suelos tropicales . el tiempo de incubación (tiempo necesario para extraer la fauna del suelo) es aproximadamente de 4 a 5 días. Son baratos y sencillos. cuando se compara con otros métodos de muestreo.huevos y las formas inmaduras se vuelven adultos. se utiliza formol al 4% o etanol. el embudo se coloca sin luz y el proceso de calentamiento-secado se lleva a cabo simplemente a temperatura ambiente. que se muestra en la figura 4. Para evitar lo anterior. al 96%. En la presencia de luz. A pesar de una eficiencia menor.

R. hecho de aluminio. Suhardjono LIPI Bogor. los especímenes de mesofauna son montados sobre laminillas. PROCESOS DE ACLARADO Y MONTAJE DE ESPECÍMENES Para su identificación. acari y otra mesofauna del suelo 155 . de 50cm de altura. con embudo superior de 40 cm de diámetro.4 Embudo Berlese modificado.3 Embudos Berlese llenos de suelo y hojarasca. Fuente: cortesía del Dr.Figura 4. después de su aclarado. Figura 4. Y. El proceso de montaje debe realizarse bajo un microsC ollembola .

Coelho. en donde se sumergen y calientan durante los diferentes periodos de tiempo. copio de disección. 2008). Los especímenes pueden ser aclarados con un 15% de KOH. dependiendo del pigmento y de la grasa del cuerpo del animal. Cortesía de: M. mediante el lavado y removido de las grasas y pigmentos del cuerpo. Proceso de aclarado El aclarado consiste en volver más transparente el tejido de los especímenes. Un método más simple de aclarado es utilizando ácido láctico. como algu156 Manual de biología de suelos tropicales . con o sin calentamiento. requiere de un microscopio compuesto. la observación de la morfología. se transfieren los especímenes a una solución de cloral fenol. durante dos a cinco minutos. aunque Greenslade et al.R. fácil y seguro.. normalmente se usa una solución de Nesbitt (su composición se describe a continuación). (2008) propusieron una solución de KOH 10% durante 1 a 5 minutos. durante unos minutos. Los taxa con cutículas delicadas. aunque el hidróxido de potasio (KOH) y el ácido láctico son alternativas efectivas.Figura 4. normalmente. y da buenos resultados (Greenslade et al.. hasta neutralizar la reacción. Para ello. dependiendo del tamaño. Después de la inmersión en KOH. este método es más barato.5 Equipo básico requerido para llevar a cabo extracciones Berlese-Tullgren núcleo por núcleo.

por lo menos. en el C ollembola . sin calentamiento. Otras soluciones. Normalmente. abdomen grande (látero-lateral). Algunos grupos necesitan ser disecados o disectados antes del montaje. En cada caso se debe regular y controlar el tiempo. mientras que para los Entromobrymorpha. Symphypleona y Neelipleona. muchos ácaros oribátidos se guardan en viales etiquetados. mientras que las partes del cuerpo de los Symphypleona grandes se montarán de la siguiente manera: cabeza (dorsoventral). el medio líquido Hoyer. los especímenes deben transferirse a otro medio. estos especímenes deberán sumergirse en una mezcla de 50% de ácido láctico/etanol durante unas horas. también pueden usarse para el proceso de montaje (Tabla 4. Protura y Pauropoda no deben meterse en una solución concentrada de ácido. abdomen pequeño y fúrcula (dorsoventral). cristales de fenol y agua destilada. con alcohol 70%. los especímenes pueden destruirse o desarticularse. En el caso de especímenes mutilados.nos Diplura. es aconsejable montar todas las partes del cuerpo en una sola preparación. Los ácaros también pueden aclararse y conservarse trasladándolos del alcohol a un medio de Hoyer. tubo ventral y en los segmentos V y VI abdominales. siete días. Las especímenes son montados en laminillas y secadas en el horno a 70°C durante. La posición de los especímenes sobre el portaobjetos difiere entre los órdenes: por ejemplo. por ejemplo. al que se añade un 5% de glicerina. acari y otra mesofauna del suelo 157 . Los ácaros esclerotizados pueden ser aclarados con lactofenol (compuesto por ácido láctico. Para dicho montaje se requiere de una solución Berlese.. Las partes diseccionadas del cuerpo de los Entromobrymorpha deberán colocarse de forma dorso-ventral sobre el portaobjetos. De nuevo. utilizando el ejemplo de los colémbolos. tales como cabeza. patas. la posición indicada es látero-lateral. fúrcula. Después de su identificación. La disección se realiza en varias partes del cuerpo.1). Para un almacenaje permanente. si no se hace. Montaje No existen métodos totalmente satisfactorios para el montaje (Greenslade et al. 2008). se recomienda la disección en el caso de Symphypleona y de las Paronellidae y Entomobrydae mayores (6 a 8mm). porque el ácido láctico continúa aclarándolos y ablandándolos. como característica clave. en proporciones 50:25:25) o simplemente con ácido láctico (frío o caliente). para que puedan ser bien identificados. con el propósito de identificarlos viendo la quetotaxia de cada parte. los colémbolos Poduromorpha se deben colocar en posición dorso-ventral.

El medio líquido de Hoyer es un agente temporal y no se endurece con calentamiento.5 ml de ácido hidroclórico 20 ml de agua destilada. una identificación más allá de este nivel. 10 g de glucosa y 5 ml de ácido acético glacial. Montaje de especimenes: medio líquido de Hoyer Nota: montaje Berlese: calentar a 70°C durante 7 días. sin embargo. se hace un montaje temporal. en el caso de la mayoría de los grupos de artrópodos de suelo.massey. Se coloca de manera parcial un cubreobjetos sobre la depresión y se empuja el espécimen por debajo del recubrimiento. 5 ml de glicerina. aunque también se puede usar para otros grupos de mesofauna. Para aclarar especimenes solución Nesbitt’s 10% KOH ó NaOH Montaje de especimenes : medio líquido de Berlese 25 ml de agua destilada.1 Composición química para aclarar y montar especímenes. www. Krantz (1978) y Norton (1990). Tabla 4.cals.caso de ácaros de suelo. la pericia taxonómica quizás sea el factor determinante en la selección de una taxa para su estudio posterior.ac. 50 ml de agua destilada. El espécimen se traslada a unas gotas de ácido láctico o glicerina en un portaobjetos excavado. resulta difícil. A nivel de especies. pero las preparaciones pueden hacerse semipermanentes sellando el recubrimiento con barniz de uñas transparente. 40 g de hidrato de cloro y 2. ofrecen una buena discusión de fondo acerca de cómo aclarar y montar ácaros. El espécimen puede rodarse suavemente hasta conseguir la orientación deseada.nz/key. tales como los de Bachelier (1978) y Dindal (1990).edu/course/ent591k/kwikey1. Se encuentran disponibles varias páginas en la web. 158 Manual de biología de suelos tropicales . 200 g de hidrato de cloro y 20ml de glicerina. donde se indican las características distintivas de varios grupos de invertebrados. 15 g de goma arábiga. de donde se pueden obtener guías de ayuda para la identificación. Trave (1965). 30 g de goma arábiga. hacia el borde de la depresión. IDENTIFICACIÓN DE ESPECÍMENES Y ANÁLISIS DE DATOS Identificación La mayoría de los invertebrados del suelo pueden identificarse hasta orden o familia con la ayuda de trabajos estándares de referencia. Por ejemplo.htm o http://soilbugs. esta última dirección también concentra la literatura principal. 50 g de hidrato de cloro.php.ncsu.

al igual que una lista de comprobación y bibliografía de especies descritas en esta área. ya que contiene guías de identificación ilustradas.permitiendo así. es utilizado para estimar su abundancia. Un estudio completo de la biología. Pseudoscorpionida. Enchytraeidae. familias. por lo que es recomendable tanto para principiantes como para profesionales. Pauropoda. quienes ofrecen guías y figuras a nivel genérico para ácaros que pertenecen a la suborden Oribatida. se encuentra disponible en Greenslade et al. Balogh y Mahunka (1983) y Balogh y Balogh (1992).. Chilopoda. órdenes. C ollembola . por lo menos. taxonomía y ecología de grupos de la biota del suelo. algunos géneros y listas de especies terrestres conocidas. acari y otra mesofauna del suelo 159 . Asimismo. la identificación a nivel género y/o especies. Symphyla. una vez conocida su morfología y características básicas (Crossley y Coleman. Isopoda. Collembola. por ejemplo. Análisis de datos El número de individuos en cada orden y en cada lugar. Los subórdenes de ácaros y muchas familias de colémbolos son de fácil identificación. Coleoptera. a nivel familia. algunas veces. al igual que referencias de la taxonomía actual de estos grupos. Bachelier (1978) ofrece buena información de fondo dentro de las amplias unidades taxonómicas de artrópodos del suelo e incluye guías ilustradas para varios grupos. en las familias Entomobryidae y Paronellidae. 1982a. Balogh (1972). Publicaciones de Yoshii (1981a. Araneae. hasta nivel de familia y. 2008. Adis (2002) ofrece guías ilustradas para principiantes y cualquier persona interesada en Arachnida y Myriapoda Neurotropicales. están disponibles en Kranz (1978) y Dindal (1990). Protura. Scorpiones. a nivel genérico. Opiliones. Mites. Diplura. utilizando pequeños núcleos o bloques. son combinadas para crear una muestra compuesta que se somete a extracción. Las muestras colectadas. es mostrado en Dindal (1999). El libro contiene claves de identificación para todas las clases. 1999). son escasas las guías específicas para este grupo en los trópicos. Isóptera. Desafortunadamente. de especies para algunos grupos como Nematoda. Balogh y Balogh (1990) ofrecen una breve caracterización y claves de identificación para ácaros oribátidos que habitan en la región neotropical. la identificación de colémbolos. Los recursos para la identificación de ácaros. El libro se escribió para un fácil manejo. La base de identificación y clasificación se encuentra resumida en las referencias que se citan a continuación.1982b y 1983) pueden utilizarse para identificar colémbolos a nivel especies. 1981b. Diptera y Hymenoptera.

vol. Este procedimiento mejora la eficiencia de la extracción porque maximiza las posibilidades de captura de grupos o especies representativos. André. 96. Sofia-Moscow. por lo tanto. no 38. y Lebrun. 1988). Este estimador. 3–24. 2006). 2005.. puede usarse para calcular los índices de riqueza de especies. Se ha demostrado que datos a nivel género y familia. pp. ejemplo: ácaros oribátidos. Los datos obtenidos deben. o bien. J. predadores. basada en la correspondencia estadística entre combinaciones de singletons y de otras especies raras (estimador de abundancia Chao-SØrensen) fue desarrollada por Chao et al. los taxa escasamente conocidos también se pueden clasificar a niveles taxonómicos más altos (orden o familia). 2003). REFERENCIAS Adis. etc. M. 2006). un nuevo estimador estadístico que toma en cuenta especies compartidas no detectadas.). 160 Manual de biología de suelos tropicales . 2006. El número de individuos normalmente se transforma de forma logarítmica log: x’=log10 (x+1) para evitar dar mayor peso a las especies dominantes en el análisis de datos (Ludwig y Reynolds. fitofagos.utilizando el método Berlese-Tullgren. ácaros oribátidos y hormigas. también pueden detectar los efectos de la perturbación con poca pérdida de información y llegar a ser una herramienta preliminar para describir patrones y sucesiones en ecosistemas del suelo perturbado por humanos (Caruso y Migliorini. incluir la riqueza de especies en el caso de los taxa seleccionada para la identificación a nivel especies. (2002) Amazonian Arachnida and Myriapoda. También puede llevarse a cabo un análisis adicional como rarefacción y estadística multivariada. Bachelier. Ducarme. ORSTOM. pueden ser calculados utilizando el programa EstimateS (Colwell. junto con otros índices de diversidad. Este índice resulta especialmente útil para eliminar invertebrados hiper-diversos.. El programa DIVERS. tales como colémbolos. de acuerdo con su función ecológica mayor (detritivoros. Ph. del paquete de metodología ecológica para Windows. G. (1978) “La faune des sols. Paris. Pensoft.. con numerosas especies raras. X. Dado que los grupos de lugares similares ofrecen una fauna similar y que la mayoría de animales del suelo pueden distribuirse en los grupos funcionales básicos (Ruf et al. H. son écologie et son action“. Initiations et Documents Techniques. reality or conning?” Oikos. La comparación de la composición de taxa entre usos de suelo debería llevarse a cabo utilizando un análisis jerárquico de agrupación y la unión promedio de agrupaciones de los datos transformados. (2002) “Soil biodiversity: Myth.

Colwell. Balogh. Fauna Malesiana.eeb. J. Sumner (ed) Handbook of Soil Science. K. Version 8 User’s Guide and Application’. A. E. Colwell. R. J. Boca Raton. T-J. (2006) ‘EstimateS: Statistical estimation of species richness and shared species from sample. Amsterdam. Acta Oecologica. Franklin. Balogh. W. no. New York. pp. y Shen. (2006) ‘Abundance-based similarity indices and their estimation when there are unseen species in samples’. K. http://viceroy. E. P. pp. no. in D. Elsevier. 142–162. A. Krantz. Biometrics. L. T. y Mahunka. Deharveng. Ecology Letters. John Wiley and Sons. Chazdon. Y. Dindal (ed) Soil Biology Guide. vol. Hungarian Natural History Museum Press. Leiden (in press). 148–159. O. Mahunka (eds) The Soil Mites of the World. (1988) Statistical Ecology: A Primer on Methods and Computing. y Balogh.edu/estimates. (1990) Soil Biology Guide.. G.. Siqueira and L. www. no 1. in M. Caruso. Minor. (1990) ‘Acarina: Oribatida’. D. J. J.. 361–371. Chao.ac. L. y Suhardjono. (1999) ‘Microarthropods’. C ollembola . 2. D. 59–65. y Morais. 30. (2005) ‘A new statistical approach for assessing compositional similarity based on incidence and abundance data’. accessed 10 January 2008. Brill. (1978) A Manual of Acarology. Balogh. L. 779–803. in F. A. Amsterdam. 62. uconn. Bedos. W. (2006) ‘Micro-arthropod communities under human disturbance: Is taxonomic aggregation a valuable tool for detecting multivariate change? Evidence from Mediterranean soil oribatid coenoses’. Brussaard (eds) Soil Biodiversity in Amazonian and Other Brazilian Ecosystems. J. pp. John Wiley & Sons. Budapest. Oregon. in J.. vol.massey. Elsevier. R. D. Oregon State University Book Store Inc. R. pp. (1992) The Oribatid Mite Genera of the World. Chao.. John Wiley and Sons.nz/~maminor/mites. M. J. R. pp. CABI Publishing...Balogh. J. S Moreira. (2008) Handbook to Collembola of Indonesia. 8. A. Akadémiai Kiadó. S. F. y Coleman. 2. M. Colwell. New York. Norton. y Balogh. Chazdon. Ludwig. acari y otra mesofauna del suelo 161 . y Reynolds. A. K. M. Wallingford. y Shen. New York. (1990) ‘Oribatid Mites of the Neotropical Region II’. Balogh and S. R. L. Budapest. T-J. Greenslade. (1983) Primitive Oribatids of the Palaearctic Region. (1972) The Oribatid Genera of the World. y Migliorini. Dindal. P. CRC Press. html. (2006) ‘Soil Mesofauna in Central Amazon’. 46–53. P. L. Crossley. pp. J. R. (2004) ‘Soil mites and other animals’. vol. R. vols 1 and 2.

139–144. Entomological Report from the Sabah Forest Research Centre No. pp1–38. Japan International Cooperation Agency.Ruf. vol. pp. y Spelda. (1965) “Quelques techniques de récolte. 263–271.. P. 98. (1981a) ‘Paronellid Collembola of Sabah’. pp. R. d’observation et de conservation des Oribates (Acariens) et autres microathropodes”.. Travè. Entomological Report from the Sabah Forest Research Centre No. 1–70. EX-1 JR. 1–38. R. 7. Nothridae) and Platynothrus peltifer (Koch) (Acari. de triage. no. 2. Nothrus silvestris Nicolet (Acari. J. pp. J. A. no. Japan International Cooperation Agency.. L. Entomological Report from the Sabah Forest Research Centre No. (1981b) ‘Neanurid Collembola of Sabah’. Hund-Rinke. pp. 1–70. R. Japan International Cooperation Agency. J. (1983) ‘Studies on Paronellid Collembola of East Asia’. Beck. vol. (1990) ‘Niche relationships between two panphytophagous soil mites. Japan International Cooperation Agency. vol. R. K. Oribatida. pp. Soils. EX-1 JR. Agriculture. 3. Yoshii. Biol. 162 Manual de biología de suelos tropicales . Japan International Cooperation Agency. Revue d’Écologie et de Biologie du Sol. pp. 23–47. (1982b) ‘Studies on the Collembolan Genera Callyntrura and Dicranocentroides’. Yoshii. Yoshii. 2. R. Camisiidae)’. Oribatida. Entomological Report from the Sabah Forest Research Centre No. Yoshii. Dreher. 1–28. Fert. (1982a) ‘Lepidocyrtid Collembola of Sabah’.. Römbke. 4. H. Siepel. 81-12. 6. (2003) “A biological classification concept for the assessment of soil quality: “Biological soil classification scheme” (BBSK)’. Yoshii. Ecosystems and Environment. 5. pp. 1–3. 8112. Entomological Report from the Sabah Forest Research Centre No. 9.

los nematodos se adaptaron a la exploración de una amplia variedad de fuentes de alimento.Capítulo 5 Nematodos del suelo Juvenil E. 1980. sin embargo. los nematodos parásitos tienen la capacidad de colonizar y alimentarse de tejidos de plantas y animales. Los nematodos en una primera aproximación. son conocidos como una amenaza para la salud humana. mientras que las formas de vida libre se alimentan de microorganismos (bacterias y hongos). Aunque la biomasa de nematodos en el suelo es pequeña (10¹ a 104 mg peso seco m-2). los nematodos están presentes en cualquier lugar donde exista carbono orgánico. algas. en todas las latitudes del planeta y desde fondo del mar hasta la cima de las montañas. además de estos bene163 . 1982). Derivado de su evolución. otros nematodos y microinvertebrados. Debido a su gran capacidad de adaptación. Petersen. ya que poseen un cuerpo alargado y cilíndrico. La palabra nematodo deriva del griego “nema” que significa “forma de un hilo”. 1990). los cuales se consideran uno de los grupos de animales más abundantes y más diversos en el planeta. protozoarios. ellos son responsables del 10 a 15% de la respiración de los animales del suelo (Sohlenius. ellos juegan un papel importante como agentes de ciclado de nutrientes y como reguladores de la fertilidad del suelo mediante el flujo de energía y la movilización y utilización de nutrimentos (Procter. De esta manera. Cares y Shiou P. animal y de plantas. Huang (†) INTRODUCCIÓN Los nematodos del suelo son pequeños invertebrados dependientes del agua.

el aparato bucal incluye un estilete tipo aguja (lustración 2a). Los nematodos bacteriófagos. Se distinguen también entre ellos mismos por su 164 Manual de biología de suelos tropicales . Su omnipresencia y abundancia en todo tipo de suelos y hábitats acuáticos. Los nematodos del suelo viven en grupos o gremios. Por tal motivo. mismos que carecen de estilete (Ilustración 2c). Algunos nematodos viven en un amplio rango de ambientes. los nematodos bacteriófagos pueden incrementar su población ante cualquier perturbación del suelo o bien. 2006). o en algunos casos. así como su ciclo de vida corto y sensibilidad ante alteraciones ambientales. 2001). influir en la nodulación por parte de bacterias tipo Rhizobium. una condición que puede interpretarse como indicador de la fertilidad del suelo (Ferris et al. se alimentan de las hifas de hongos saprofíticos. En el caso de nematodos parásitos de plantas. bajo condiciones de enriquecimiento de nutrimentos. con la capacidad de alimentarse de cualquier fuente. bacteriófagos. son polífagos. depredadores y omnívoros (Ilustración 2). los nematodos están bien representados a lo largo de la red trófica del suelo. benéficos y micorrízicos. equipados en su mayoría con un estilete pequeño y delicado (Ilustración 2b). bacteriófagos. micófagos. poseen un estilete que les permite alimentarse de otros nematodos. Los nematodos depredadores tienen la cavidad bucal equipada con una o más estructuras en forma de dientes (Ilustración 2d). Como típicos estrategas r. mientras otros ocupan áreas más restringidas. pueden regular el nitrógeno y el fósforo disponible para las plantas. Los micófagos. en la mayoría de los casos la identificación de los diferentes grupos funcionales puede lograrse en base a la morfología de su aparato bucal. Aunque la identificación de estos organismos requiere de intenso entrenamiento. tal es el caso de los nematodos entomofílicos Deladenus siricidicola o los entomopatógenos Steinernema carpocapsae y Heterorhabditis bacteriophora. microinvertebrados y protozoarios. patogénicos. algunos nematodos micófagos son pueden comportarse como parásitos facultativos de plantas. los califican como poderosos bioindicadores de condiciones ecológicas (Huang y Cares. herbívoros y también como depredadores al alimentarse de otros nematodos.ficios para el ecosistema. Los omnívoros tienen la cavidad bucal armada con un estilete hueco (Ilustración 2e). pueden alimentarse de bacterias y esporas de hongos. en algunos casos. por lo que pueden fungir como micófagos. así como alimentarse y diseminar bacterias benéficas y fitopatógenas. también participan en importantes servicios del agroecosistema al fungir como agentes de control biológico de plagas de insectos. mediante el cual puede causar pérdidas significativas en varios cultivos. compuestos por lo general de cinco grupos funcionales principales: parásitos de plantas.

y los nematodos se colectan directamente en un tamiz de 400 mallas (tamaño de malla de 37 µm) (Figura 5. poseen una baja movilidad. los nematodos colonizadores (similares a los estrategas r) típicamente poseen un tiempo de generación corto. MUESTREO DE SUELO En cada punto de muestreo dentro de un sistema de cuadrícula (véase Capítulo 2). Para colectar el suelo se utiliza un nucleador de acero y las muestras se toman en cuatro puntos equidistantes en el círculo pequeño. se trazan dos círculos concéntricos. producen muchos huevecillos pequeños. Esta suspensión se pasa a través de tamices de 40 a 60 mallas (tamaño de malla de 250 a 350 µm. y ocho puntos en el círculo grande. respectivamente). EXTRACCIÓN DE NEMATODOS La muestra de suelo se mezcla completamente y se toma una submuestra de 300 ml. A esta última suspensión de nematodos se le pueden eliminar aún más partículas de N ematodos del suelo 165 . los nematodos persistentes (similares a estrategas k) se caracterizan por necesitar un largo tiempo de generación. producen pocos huevillos. Los doce núcleos de suelo se depositan en una bolsa de plástico que deberá sellarse para evitar su desecación y además protegerla de la luz solar.sensibilidad a la perturbación del suelo y a los contaminantes químicos. un análisis apropiado de la comunidad de nematodos. abundancia y estructura de comunidad. una ausencia de dauerlarva y sensibilidad ante contaminantes y otros factores de perturbación. además son los más resistentes a la perturbación del suelo y a contaminantes químicos. pero más grandes. con un radio de 3 m y 6 m.1). se agita durante 30 segundos y se deja reposar otros 2 minutos para que las partículas del suelo se sedimenten. puede presentar un índice de sistemas de uso de suelo y cambios de uso de suelo y medir los niveles de perturbación provocados por contaminantes y otros factores. tomando en cuenta su diversidad. por tal motivo. todos los núcleos de suelo se deben tomar a una profundidad de 20 cm. Por otra parte. muestran la presencia de dauerlarva e incrementan sus poblaciones cuando existen condiciones ricas en alimentación. Según lo propuesto por Bongers (1990) y Bongers y Borgers (1998). lo cual deberá hacerse con la mayor rapidez posible. la cual se vacía a una cubeta con 2 litros de agua. Las muestras son transportadas al laboratorio en una caja aislada y almacenadas a 4° C hasta su extracción. respectivamente.

1 A la izquierda.2a) y se centrifuga de nuevo a 1. 166 Manual de biología de suelos tropicales . 1970).3a).500 rpm durante 5 minutos y el sobrenadante se descarta. Posteriormente. posteriormente se fijan con solución Golden 2X (Hooper.3b) y. FIJACIÓN Y CONTEO DE NEMATODOS Los nematodos extraídos se matan con agua caliente a 50-60°C durante un máximo de un minuto (Figura 5. se añade un volumen igual de solución Golden Figura 5. dejando así una suspensión de nematodos de 10 a 20 ml. 1964). los nematodos se colectan a partir del sobrenadante utilizando un cernidor con tamaño de malla de 37 µm (Figura 5.2b). suspensión de suelo en reposo. éstos se dejan reposar durante 30 minutos y se remueve el exceso de sobrenadante utilizando una pipeta o por medio de succión al vacío (preferentemente).000 rpm durante uno a dos minutos. Una vez calentados los tubos. Los especímenes que se hallan sobre la malla se lavan y arrastran con agua. para luego colectarse en un vaso de precipitados (Figura 5. contenida en el vaso. el sedimento o botón dentro del tubo de centrífuga se resuspenden en solución de sacarosa (456g L-1) (Figura 5. Posteriormente.suelo mediante un método modificado de centrifugación con flotación de azúcar (Jenkins. juego de tamices de metal (de tamaño de malla 45 arriba y 400 abajo). y a la derecha. La suspensión. En este procedimiento. se distribuye en tubos de ensayo para su fijación. la suspensión acuosa se centrifuga primero a 3.

La rejilla que contiene a los tubos se sumerge en un recipiente con agua. 2X. a b Figura 5. el número total se obtiene de multiplicar la media de tres conteos de manera que el número total representará el número medio de 3 conteos de submuestras x 15.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos.2%. La suspensión resultante se ajusta a un volumen de 15 ml y se cuenta el total de nematodos en la población mediante la toma al azar. N ematodos del suelo 167 . de alícuotas de 1 ml.3 a) Nematodos recuperados mediante el lavado de malla de 400.Figura 5. b) muerte de nematodos en agua caliente. con lo que se obtiene una concentración final de formol 3. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa.

1994.5. Al segundo día. La identificación de nematodos por caracteres morfológicos se basa en la literatura taxonómica especializada (Goodey. Nickle y Hooper.000 x). 2000. 1991. 1961.1) y el volumen resultante se vacía por completo en una caja Petri de 5 cm de diámetro. Goseco et al.. 1991. 1991. Anderson y Potter. los nematodos de la caja se montan en laminillas.1974. May et al. 1991. se coloca una tira de cinta adhesiva para evitar que el cubreobjetos aplaste a las especímenes. El procedimiento se ilustra en la Figura 5. 1984) (Figura 5.5.1. 1991.6). Después de este proceso. 2001). aunque en la última ocasión no es necesario añadir solución Seinhorst II pero sí incubar a la misma temperatura durante otras 48 horas para evaporar todo el alcohol.. 1991. 1983. Smart Jr y Nguyen. la caja se coloca en un desecador a 43°C durante la noche (Figura 5. Thorne. al final. se tapa la caja y se deja nuevamente en el desecador durante la noche. 168 Manual de biología de suelos tropicales . Decraemer. la preparación se sella utilizando bálsamo de Canadá (Huang et al. Andrássy. Tabla 5. la caja se retira del desecador y se deja evaporar a la misma temperatura durante un mínimo de cuatro horas. 1988. 1993. Bongers. 1991. 1991. Baldwin y Mundo-Ocampo.7). Loof. La modificación consiste en reducir a 3 ml el volumen de la suspensión (Figura 5. Smart Jr y Nguyen. Antes de colocar el cubreobjetos de vidrio sobre la gota. Hunt. Jairajpuri y Ahmad. El volumen de la caja se reestablece con solución Seinhorst II. 1991. 1988. Maggenti. Se hace una selección al azar de aproximadamente 100 nematodos montados para su identificación a nivel de género.INFILTRACIÓN CON GLICERINA Y OBSERVACIÓN DE NEMATODOS El método de Seinhorst (Seinhorst. en esas condiciones se retira la tapa de la caja para que se reduzca por lo menos a la mitad de su volumen. luego se añaden 7 ml de la solución Seinhorst I (Figura 5. utilizando un microscopio compuesto (se requiere un aumento de 400 a 1. Raski. 1992. mientras que la composición de las soluciones se puede observar en la Tabla 5. 1959) suele modificarse para evitar la laboriosa tarea de pescar individualmente cada nematodo y elaborar numerosas preparaciones permanentes. Estos pasos se repiten tres veces. 1991. Cares y Huang. 1951. utilizando una gota de glicerina deshidratada como medio de montaje. 1996. Fortuner. Geraert.4).

Nematodos en: Golden (3 ml) + Seinhorst I (7 ml) Evaporación a 43°C durante 4h para reducir el volumen a la mitad Completar volumen con Seinhorst II Desecador a 43°C durante la noche Desecador a 43°C durante la noche Desecador a 43°C durante la noche Evaporación a 43°C durante 48 horas.Figura 5. Evaporación a 43°C durante 4 hrs para reducir a la mitad del volumen Completar volumen con Seinhorst II Evaporación a 43°C durante 4h para reducir el volumen a la mitad Desecador a 43°C durante la noche N ematodos del suelo 169 .5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos. Las cajas Petri no deben contener más de una tercera parte de líquido.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos Figura 5.

6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. Foto Francisco Franco. Teixeira. Foto: Marcella A. Figura 5. 170 Manual de biología de suelos tropicales . Nota: el fondo del contenedor se mantiene a 43°C.7 Charola con montajes permanentes de especímenes de nematodos.Figura 5.

depredadores y omnívoros. todos ellos basados en los criterios de Yeates et al. Si un nematodo posee dos tipos de hábito alimenticio. cuando un nematodo tiene dos tipos de hábitos alimenticios. Los datos de frecuencia y abundancia de los diferentes grupos tróficos se usan para calcular el Índice de Diversidad Trófica y varios cocientes que consideran la abundancia relativa de los grupos tróficos. pueden utilizarse para calcular índices de diversidad y equitatividad. Índice de Riqueza de Género [d = (S – 1)/log N. (1993). donde S = número de géneros y N = número total de nematodos]. Golden X Formol (+ 40% formaldehído) Glicerina Agua destilada Alcohol 96% Glicerina Agua destilada 8 partes 2 partes 90 partes Seinhorst I 20 partes 2 partes 78 partes Golden 2X 16 partes 4 partes 80 partes Seinhorst II 95 partes 5 partes ÍNDICES Y PARÁMETROS PARA LA CARACTERIZACIÓN DE POBLACIONES DE NEMATODOS Los nematodos identificados a nivel de género pueden dividirse en cinco grupos tróficos: parásitos de plantas.1 Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina.Σpi log2 pi]. donde pi = porcentaje de género ‘i’ en la abundancia total]. su número poblacional se divide entre dos para cada hábito. bacteriófagos. Los datos sobre frecuencia absoluta. N ematodos del suelo 171 . micófagos. abundancia total y abundancia relativa de cada uno de los géneros. Índice de Diversidad de Shannon [H’ = .Tabla 5. Índice de Diversidad de Simpson [Ds = 1 – Σ(pi)². Equitatividad del Índice de Diversidad de Simpson [Es = Ds/Ds max’ donde Dsmax = 1 – 1/S Equitatividad del Índice de Diversidad de Shannon (J’= H’/H’max’ donde H’max = Log2 S]. empleando las fórmulas que se mencionan líneas adelante.

el Índice de Madurez (IM) (que incluye únicamente nematodos de vida libre) (Tabla 5. 1988. producen muchos huevecillos pequeños. baja movilidad. donde pi = abundancia relativa de un grupo trófico . 1998). 1978. los persistentes cp5 se distinguen por tiempos generacionales largos. Yeates (1994) amplió el Índice de Madurez para incluir a todos los nematodos del suelo (mIM). Porcentajes de criconematidos y de dorylaimidos en la población.2) y el Índice Fitoparasítico (IFP) (que incluye únicamente parásitos de plantas) (Tabla 5. y fi = frecuencia relativa del género ‘i’).2 Familias y valores cp utilizados para el índice de madurez* Familia Neotylenchidae Anguinidae Aphelenchidae Aphelenchoididae Rhabditidae 172 valor cp 2 2 2 2 1 Familia Achromadoridae Ethmolaimidae Cyatholaimidae Desmodoridae Microlaimidae valor cp 3 3 3 3 3 Manual de biología de suelos tropicales . Por el contrario. 1990). se han utilizado varios índices para la evaluación del suelo. respectivamente). y el cociente IFP /IM como un indicador de fertilidad del suelo. La relación micófagos/bacteriófagos (M/B) y (micófagos+bacteriófagos)/parásitos de plantas [(M+B)/PP]. Para medir el nivel de perturbación del suelo (Bongers. 1994]. Índice de Diversidad Trófica [T = 1/ Σ(pi)². Σ(vi x fi) (donde vi = valor c-p de 1 a 5 para el género ‘i’. siempre están activos. asignándoles un “valor cp” en una escala de 1 a 5. En base a estos conceptos. Tabla 5. pero excluyendo a los nematodos cp1) para evaluar factores de estrés inducidos por contaminación. véase Norton. la producción de pocos huevecillos pero muy grandes. presentan dauerlarvae o estadios de sobrevivencia y crecen bajo condiciones de riqueza de alimento. Los colonizadores cp1 se caracterizan por tener tiempos generacionales cortos. Bongers (1990) dividió a los nematodos del suelo en una serie desde los colonizadores (c) hasta los persistentes (p) (similar a los estrategas r y k.3). ausencia de dauerlavae y elevada sensibilidad ante la presencia de contaminantes y otros factores de perturbación (Bongers y Bongers. Bongers y Bongers (1998) propusieron IM2–5 (igual que IM. Magurran. Krebs.

2 Familias y valores cp utilizados para el índice de madurez* Familia Alloionematidae Diploscapteridae Bunonematidae Cephalobidae Ostellidae Panagrolaimidae Myolaimidae Teratocephalidae Diplogasteridae Neodiplogasteridae Diplogasteroididae Tylopharyngidae Odontopharyngidae Monhysteridae Xyalidae Linhomoeidae Plectidae Leptolaimidae Halaphanolaimidae Diplopeltidae Rhabdolaimidae Chromadoridae Hypodontolaimidae Choanolaimidae valor cp 1 1 1 2 2 1 2 2 1 1 1 1 1 1 2 3 2 3 3 3 3 3 3 4 Familia Odontolaimidae Aulolaimidae Bastianiidae Prismatolaimidae Ironidae Tobrilidae Onchulidae Tripylidae Alaimidae Bathyodontidae Mononchidae Anatonchidae Nygolaimidae Dorylaimidae Chrysonematidae Thornenematidae Nordiidae Qudsianematidae Aporcelaimidae Belondiridae Actinolaimidae Discolaimidae Leptonchidae Diphtherophoridae valor cp 3 3 3 3 4 3 3 3 4 4 4 4 5 4 5 5 4 4 5 5 5 5 4 3 Nota: *Bongers (1990).Tabla 5. .3 Familias y valores cp utilizados para el índice fitoparasítico cp2 Tylenchidae Psilenchidae Tylodoridae cp3 Dolichodoridae Hoplolaimidae Pratylenchidae cp4 Trichodoridae cp5 Longidoridae N ematodos del suelo 173 Nota:*modificado de Bongers (1990). Tabla 5.

V. 8. no. T. P. Bongers. 185–223. J. E. E. 10. Cares. (1988) De Nematoden van Nederland. T. (1991) ‘Stunt nematodes: Tylenchorhynchus. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian amazon and savanna vegetation’. (1991) ‘Heteroderinae cyst. S. 2nd edition. New York. Revisão Anual de Patologia de Plantas. (2000) “Taxonomia atual de fitonematóides. London. REFERENCIAS Anderson. Applied Soil Ecology. J. Bibliotheekuitgave no 46. y Mundo-Ocampo. vol. Bongers. The Netherlands. M. G. 174 Manual de biología de suelos tropicales . vol. Budapest. T. J. The Netherlands. Nickle (ed) Manual of Agricultural Nematology. S. (eds) (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. pp. Revisão Anual de Patologia de Plantas. 163–183. Eötvös Lorand University. R. Cares. CABI Publishing. L. Bongers. Koninklijke Nederlandse Natuurhistorische Vereniging. (1983) A taxonomic review of the suborder Rhabditina (Nematoda Secernentia). (1994) De Nematoden van Nederland. pp. 275–362. Andrássy. y Bongers. 239–251. Siqueiera and Brussaard. pp. Bongers. Pirola. Merlinius. Bibliotheekuitgave no. 46. P. y Potter.and non-cyst-forming nematodes’. Moreira. 83. 3. in W. Marcel Dekker. J. vol. y Huang. pp. M. vol. pp. Schoorl. (2001) “Taxonomia de fitonematóides. (1998) ‘Functional diversity of nematodes’. W. Baldwin. J. (1990) ‘The maturity index: An ecological measure of environmental disturbance based on nematode species composition’. 14–19. R. Schoorl. Chave sistemática simplificada para gêneros Parte I”. I. Nickle (ed) Manual of Agricultural Nematology. S. in F.3 Continúa cp2 Ecphyadophoridae Paratylenchidae Anguinidae cp3 Heteroderidae Hemicycliophoridae cp4 cp5 Nota: * modificado de Bongers (1990). Oecologia. T. 9. Marcell Dekker. 529–586. Pirola. pp. y Huang. O. New York. Chave sistemática simplificada para gêneros Parte II”. P. 177–235. in W. R. pp. E. M. Cares. Koninklijke Nederlandse Natuurhistorische Vereniging.Tabla 5. J. and related genera’. y Huang.

Purdue University. W. E. vol. Ferris. E. 16. pp. 18. O. Nickle (ed) Manual of Agricultural Nematology. (1992) Dorylaimida: Free-living. R. CAB International. (1991) ‘Stubby root and virus vector nematodes: Trichodorus. Leiden. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian Amazon and savanna vegetation’. Siqueira and L. H. pp. F. Hooper. Huang. S. M. R. S. R. Wallingford. 13–29. Bongers. (1993) Aphelenchida. Marcel Dekker. y Goede. Ministry of Agriculture. Nickle (ed) Manual of Agricultural Nematology. J. Plant Disease Reporter. (1994) Ecology: The Experimental Analysis of Distribution and Abundance. 669–720. in J. Hunt. M. and Monotrichodorus’. fixing. and Ahmad. Southey (ed) Laboratory Methods for Work with Plant and Soil Nematodes. Technical Bulletin No 2. 4th edition. 1949’. P. Allotrichodorus. M. Marcel Dekker. Paratrichodorus. C. New York. E. Ferris. New York. pp. New York. T. pp. 34–39. R. no 1. 587–626. J. C. in W. Fisheries and Food. y Ferris. y Cares. C. (2001) ‘A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept’. R. J. (1951) Soil and freshwater nematodes. West Lafayette. (1964) ‘A rapid centrifugal flotation technique for separating nematodes from soil’. Goseco. Bittencourt. J. Ltd. in W. E. A.. New York. Purdue Nematode Collection Department of Entomology. (1991) ‘The family Pratylenchidae Thorne. y Silva. pp. Maggenti. (1991) ‘Nemata: Higher classification’.. Harper Collins College Publishers. pp. pp. London. Nickle (ed) Manual of Agricultural Nematology. Jairajpuri. in W. Marcel Dekker. Brussaard (eds) Soil biodiversity in Amazonian and other Brazilian ecosystems.. (1991) ‘The Hoplolaimidae’. R. 1st edition. N ematodos del suelo 175 . S. Nickle (ed) Manual of Agricultural Nematology. pp. 795–826. 48. Applied Soil Ecology. 662–665. Longidoridae. R. Brill. Wallingford. Journal of Nematology. G. New York. R. Huang. Krebs. V. C. New York. (1991) ‘Tylenchidae in agricultural soils’. pp. in W. R. in F. Indiana.Decraemer. in W. Fortuner. pp. staining and mounting nematodes’. P. D. J. M. 163–183. Geraert. vol. and Trichodoridae: Their systematics and bionomics. Marcel Dekker. Loof. Jenkins. Methuen and Co. 341–342. W. (1974) Revision in Leptonchoidea (Nematoda: Dorylaimida). F. M. Predaceous and Plant Parasitic Nematodes. vol. F. no 9. CAB International. 147–190. W. (1970) ‘Handling. S. (1984) ‘Preparing nematode permanent mounts with adhesive tapes’. no 3. J. Marcell Dekker. Moreira. Nickle (ed) Manual of Agricultural Nematology. Goodey. A. D. R. 363–422. T. G.

no. 176 Manual de biología de suelos tropicales . S. W. vol. D. pp. Oikos. pp. Nickle (ed) Manual of Agricultural Nematology.. (1996) Pictorial Key to Genera of Plant Parasitic Nematodes. K. Raski. 1. Journal of Nematology.. vol. G. Cambridge. J. Journal of Nematology. New York. Marcel Dekker. pp. y Hooper. L. vol. pp. y Georgieva. 67–69. F. (1978) Ecology of Plant Parasitic Nematodes. Mullin. pp. (1988) Ecological Diversity and its Measurement. W. Thorne. Seinhorst. May. A. in W. 34. Procter. 22. D. 97–101. 761–794.. G. Yeates. 2. vol. G. Pedobiologia. Bongers. R. W. (1991) ‘Tylenchulidae in agricultural soils’. H. D. biomass and contribution to energy flow by soil nematodes in terrestrial ecosystems’. 1–7. 25. Nickle (ed) Manual of Agricultural Nematology.. B. y Nguyen. pp. no. 39. R. Nematologica. 3. Cornell University Press. P. and insect nematodes’. (1993) ‘Feeding habits in soil nematode families and genera . Norton. S. leaf. and Dolichodorus spp. pp. T. R. H. W.Magurran. M. (1959) ‘A rapid method for the transfer of nematodes from fixative to anhydrous glycerin’. (1980) ‘Abundance. Nickle. in W. (1991) ‘The Aphelenchina: Bud.. and Nguyen. New York. Freckman. Smart Jr. R. B. Yeates. New York. 306–329. vol. K. (1994) ‘Modification and quantification of the nematode maturity index’. W. McGraw Hill Co.. Lyon. (1982) ‘Structure and size of soil animal populations’. G. y Loeffer. Gainesville. 38. Cambridge University Press. New York. (1991) ‘Sting and awl nematodes: Belonolaimus spp. John Wiley and Sons. Smart Jr. W.’. R. (1988) Illustrated Key for Identification of Common Nematodes in Florida. K.an outline for soil ecologists’. G. New York. 5th edition. pp. de Goede. C. University of Florida. G. in W. Marcel Dekker. New York Petersen. Sohlenius. J. Nickle (ed) Manual of Agricultural Nematology. (1990) ‘Global overview of the functional roles of soil-living nematodes in terrestrial communities and ecosystem’. C. D. 315–331. 186–194. E. Oikos. C. J. no. G. vol. pp. (1961) Principles of Nematology. 4. D. Marcell Dekker. 627–668. B. H. C. 465–508.

c) Introducción de la hojarasca en un tamiz para separar los fragmentos más gruesos. i . desde el borde hacia el centro. Sistema de extracción de hormigas y escarabajos con trampas Winkler a) Delimitación de un metro cuadrado de hojarasca. f y g) Se fijan las redes al interior de la trampa Winkler previamente colgadas en un espacio bien aireado con un frasco colocado en el fondo. que contiene alcohol al 70%. d) Transferencia del material tamizado a bolsas de nylon en campo. e) Cada muestra de hojarasca tamizada se transfiere a una red.Ilustración 1. b) Colecta de la hojarasca utilizando guantes de cuero. por un marco.

B) micófago. Fotos: Juvenil Cares. E) omnívoro.Ilustración 2. A y B: Estoma con estilete C: Estoma sin estilete D: Diente dorsal E: Odonto estilete ii Manual de biología de suelos tropicales . D) depredador. Fotomicrografías de la región anterior en las que se muestra el aparato bucal (flechas) de nematodos de suelo pertenecientes a diferentes grupos funcionales: A) parásito de plantas. C) bacteriófago.

Fotos: F. Moreira excepto e) de Lima et al. en gel de poliacrilamida.Ilustración 3. b) Plantas de Prosopis juliflora en agar inclinado con solución de nutrientes. PAB vol 319. 2009. I lustraciones a color iii .. Pasos de la metodología para caracterizar a las bacterias fijadoras de nitrógeno y formadoras de nódulos en leguminosas (BFNFNL) aplicada en el proyecto CSMBGBD. tropici (CR crecimiento rápido) creciendo en YMA f) Perfiles de Rep-PCR de e) Perfiles de proteínas totales obtenidos por electroforesis diferentes cepas. cr CL CL d) Características de dos aislamientos de Bradyrhizobium (CL de crecimiento lento) y de R. a) Siratro en bolsa de plástico con solución de nutrientes Pheseolus vulgaris c) Pruebas en plantas de Pheseolus vulgaris para ver la eficiencia de aislamientos en Jarras de Leonard.

Esporas y estructuras producidas por especies de HMA de la familia Acaulosporaceae: e) espora de Entrophospora colombiana mostrando la pared de la espora. f) espora de Entrophospora colombiana mostrando las dos cicatrices (flecha). c) detalle de la ornamentación de la pared de la espora (verrugas) de Scutellospora coralloidea. g) espora de Acaulospora scrobiculata mostrando la cicatriz (flecha) que queda en la espora después de que se suelta el sáculo esporífero. b) espora de Scutellospora scutata con la célula suspensora bulbosa (flecha). d) células auxiliares nudosas diferencias por miembros del género Scutellospora. obsérvese el escudo redondo de germinación de color café que contrasta con el color hialino de la espora. h) esporas de Acaulospora sp. Esporas y estructuras producidas por especies de hongos micorrizógenos arbusculares de la familia Gigasporaceae: a) espora de Gigaspora albida mostrando la célula suspensora bulbosa (flecha). típica de la familia. iv Manual de biología de suelos tropicales . pared germinal 1 (gw1) y pared germinal 2 (gw2) con su capa más interna en reacción con el reactivo Melzer.Ilustración 4. mostrando algunos sáculos esporíferos todavía fijados a la espora (flecha). Fotos: Sidney Stümer.

I lustraciones a color v . Fotos: Sidney Stümer. L2 y L3) (obsérvese que la capa L2 está ornamentada con pequeñas crestas). d) Esporocarpo de Glomus sp. Esporas y estructuras producidas por especies de HMA de la familia Archaeosporaceae (e y f) y Paraglomeraceae (g y h): e) espora de Archaeospora Leptoticha con sáculo esporífero.edu. f) Detalle de Archaeospora Leptoticha mostrando salientes y depresiones en las capas 2 y 3 de la pared de la espora (flecha).wvu. brasilianum que fueron tomadas de http:// invam. excepto de Paraglomus occultum y P. h) Espora de Paraglomus brasilianum mostrando la estructura de la pared de la espora formada por tres capas (L1. mostrando la pared de la hifa de sostén de manera continua con la pared de la espora. obsérvese que la capa más profunda de la pared de la espora se separa y se asemeja a la pared germinal.caf.Ilustración 5. L2 y L3). b) Espora de Glomus sp. c) Esporocarpo de Glomus clavispora. Esporas y estructuras producidas por especies de HMA de la familia Glomeraceae: a) Espora de Glomus clarum mostrando la hifa de sostén. g) Espora de Paraglomus occultum mostrando la estructura de la pared de la espora formada por tres capas (L1.

f) Pythium liberando zooesporas. vi Manual de biología de suelos tropicales . c) cultivo puro en cebo.Ilustración 6. Aislamientos de hongos zoospóricos de muestras del ambiente (Oomycota y Chytridiomycota): a) muestra de suelo con cebo. b) muestra de agua con cebo. d) esporangio de Phytophthora. e) Oogonio y anteridio de Pythium.

Ilustración 7. f) medio de cultivo en placas. c) suelo pre-lavado. b) tamices con diferentes mallas. e) partículas de suelo lavado. Abreu. I lustraciones a color vii . Técnica de lavado del suelo para el aislamiento de microhongos del suelo: a) Pre-lavado. h) colonias de hongos en medio de cultivo para retardar el crecimiento. Fotos: Lucas M. d) continuando con el procedimiento de lavado. g) placa con partículas de suelo para su incubación.

D) Extracción del aculeo.Ilustración 8. E) Adulto de mosca de la fruta y detalle del aculeo. B) Trampa MacPhail con cebo. C) Patrones alares típicos con bandas. A C Banda costal Banda “s” Banda “s” D B E Cabeza Punta del oviducto Mesonoto Aculeo Mediotergio Abdomen Terminalia viii Manual de biología de suelos tropicales . A) Larvas y pupas de la mosca de la fruta en el suelo.

considerando un área de 21 millones de hectáreas. En Brasil. se utiliza en algunos países con un pequeño y selecto grupo de leguminosas con el propósito de reemplazar el uso de fertilizantes químicos de nitrógeno. donde se cosecharon cerca de 57 millones de toneladas de soya. por lo tanto. en el caso de la soya. 177 . la inoculación con cepas de Bradyrhizobium reemplaza completamente la aplicación de fertilizantes sintéticos. pues proporciona alrededor del 70% de todo el nitrógeno requerido en los ecosistemas naturales y agroecosistemas (Burns y Hardy. Moreira LA IMPORTANCIA ECONÓMICA Y ECOLÓGICA DE LA SIMBIOSIS DE BACTERIAS FORMADORAS DE NÓDULOS EN LEGUMINOSAS (BFNFNL) La fijación biológica de nitrógeno es uno de los procesos más importantes para mantener la vida en el planeta. S. un conocimiento de la diversidad de BFNFNL en el suelo deberá ser el primer paso para el manejo y la conservación de este recurso genético de tanto valor. usadas para la inoculación. la biodiversidad del suelo puede afectar el comportamiento de la formación de nódulos de manera positiva o negativa.3 billones de gastos en fertilizantes mediante la aplicación de esta biotecnología. Las cepas. manteniendo así la armonía con el medio ambiente. La inoculación con cepas de BFNFNL altamente eficientes y adaptadas a las condiciones ambientales dominantes. debido a las múltiples interacciones que se dan entre organismos del suelo y plantas. provienen de una diversidad que se encuentra en el suelo. En el año 2006. se ahorraron alrededor de US$ 3. al mismo tiempo. 1975).Capítulo 6 Bacterias formadoras de nódulos en leguminosas Fátima M.

2002.. giardinii R. 1997 Chen et al. por esta razón.Familia/Género/Especie α-Proteobacteria-Orden Rhizobiales Referencia Rhizobiaceae Rhizobium R. el nombre ”rhizobia” ya no resulta idóneo para describir bacterias formadoras de nódulos. 1997 van Berkun et al. trifolii.1). una taxa a nivel familia de bacterias creada expresamente para acomodar organismos que pueden formar nódulos en leguminosas. Una extensión reciente de conocimientos acerca de las bacterias formadoras de nódulos en leguminosas fue el descubrimiento que estableció que las bacterias pertenecientes al β-proteobacteria (género Burkholderia y Ralstonia/Cupriavidus) y a otras familias de la α. mongolense R. Género. 1998 Wang et al. forman nódulos en las raíces (y algunas veces en los tallos) de algunas especies de leguminosas y en las raíces de Parasponia spp. Chen et al. 1989 Martinez-Romero et al. Methylobacterium Methylobacteriaceae y Dovosia Hyphomicrobiaceae) también pueden formar nódulos en leguminosas (Moulin et al.TAXONOMÍA ACTUAL DE BFNFNL Las bacterias fijadoras de nitrógeno. Sy et al. Tabla 6. aunque se continúa usando en alguna literatura. 1998 Wang et al. 1984 Lindström. Las citas referidas describen a las especies y/o comprueban su capacidad de nodulación. 1938). etli R. Familia. 2001. 1993 Amarger et al. 2003) (Tabla 6. 1999a . 1997 Amarger et al. El término rhizobia se deriva de Rhizobiaceae (Conn. etli biovar mimosae 178 Manual de biología de suelos tropicales Frank. leguminosarum biovars phaseoli. Jordan.. hainanense R.1 Filum/Orden. 2001. Especie de bacterias formadoras de nódulos en leguminosas. 2004 Rivas et al. gallicum R. galegae R. giardinii biovars phaseoli. 1889... 2001. 1879. tropici R. (Ulmaceae). Jourand et al..proteobacteria (por ejemplo. huautlense R. Filum/Orden. conocidas anteriormente como rizobios. 1991 Segovia et al. viceae R.

teranga E. 2009 Hou et al.Tabla 6. 2003 B acterias formadoras de nódulos en leguminosas 179 . 2008 Peng et al. 1994 Rome et al. indigoferae R. 2009 Li et al. 1999 Nick et al. daejeonense R. xinjiangense E. arboris E. 1988. fredii E. 2001 Squartini et al. tubonense Ensifer (Sinorhizobium) E. 2003 Scholla & Elkan. Young. americanum Referencia Tan et al. 2003 Quan et al. medicae E. 2009 Tian et al. Filum/Orden. 1984. 2008 Berge et al. 2002 Wei et al. loessense R. 1994 de Lajudie et al. pisi R. 2007 Gu et al. 1988. fabae R. alamii R. morelense E. 2011 Zhang et al. 2006 Hunter et al. 1999 Wei et al. sullae R. Jordan et al. 2008 Ramirez-Bahena et al. Chen et al. kummerowiae E. kostiense E. meliloti E. multihospitium R. Chen et al. 2002 Wei et al. selenireducens R. de Lajudie et al. 1994 Chen et al. lusitanum R.1 Continúa. tibeticum R. 1996 Nick et al. 2005 Valverde et al.Familia/ Género/Especie R. miluonense R. 2011 Dangeard. yanglingense R. oryzae R. saheli E. 1984. 1994. mesosinicum R. 2008 Han et al. de Lajudie et al. 2009 Lin et al. 2002 Toledo et al. 1926. 2002 Wang et al. alkalisoli R. vignae R. 1988 de Lajudie et al. 2008 Ren et al.

yuanmingense B. 2005a Ramírez-Bahena et al. loti M. huakuii 180 Referencia Casida. (Rhizobium) undicola Agrobacterium* A (Rhizobium). 2009 Merabet et al. doebereinerae Phyllobacteriaceae Mesorhizobium M.adiobacter/ tumefasciens Shinella S. (2010) de Lajudie et al. 1991. 2007 Rincon-Rosales et al. 2006 Jordan et al. numidicus Allorhizobium* A. Jarvis et al. Willems et al. 2006** Dreyfus et al. liaoningense B.canariense B. 2003 Lloret et al. Filum/Orden.Familia/Género/ Especie E. Young.1 Continúa. Jarvis et al. 1995 Yao et al. 2002. 1997 Chen et al. 2001 Cummings et al. Young et al.Tabla 6. 1982. 1984. 2008 van Berkun & Eardly. garamanticus E. pachyrhizi B. elkanii B. iriomotense Bradyrhizobium (Blastobacter) B. 1988 Moreira et al. 1998a. adhaerens E. 1997 Manual de biología de suelos tropicales . jicamae B. 2009 Ramírez-Bahena et al. chiapanecum E. denitrificans** Xanthobacteraceae Azorhizobium A. 1982. 2009 Islam et al. 2002 Vinuesa et al. 2008 Jordan. mexicanus E. 1992 Xu et al. 2009 Lin et al. (2010) Merabet et al. van Berkun et al. kummerowieae Bradyrhizobiaceae Bradyrhizobium B. 1984 Kuykendall et al. 2003. Jarvis et al. caulinodans A. japonicum B.

2005 Zurdo-Pineiro et al. 2007 Imran et al. trifolii P. gobiense M. amorphae M. lupini O. Jarvis et al. ciceri Hyphomicrobiaceae Devosia D. metallidurans M. 2008 Han et al. 2004 Wang et al. 2005 Mantelin et al. albiziae M. 2009 Chen et al. 2004 Gao et al. 2010 Valverde et al.alhagi Phyllobacterium P. 1994. tarimense M.1 Continúa. opportunistum M. shangrilense M. neptuniea Referencia Nour et al. leguminum*** Methylobacteriaceae Methylobacterium M. 1995. 1999b Velásquez et al. 2001. 1997 De Lajudie et al. cytisi O. Filum/Orden. 2009 Vidal et al. 2001 Gao et al. 2008 Li et al. temperatum M. ifriqiyense*** P. 2006 Mantelin et al. 1997 Nour et al. 2004 Trujillo et al. tianshanense M. 2007 Gu et al. 2008 Han et al. caraganae M. 2003 B acterias formadoras de nódulos en leguminosas 181 . Jarvis et al.Familia/Género/ Especie M. 1998b Wang et al. ciceri M. 2006 Sy et al. australicum M. Jarvis et al. 2009 Nandasena et al. mediterraneum M. 2010 Rivas et al. 2009 Nandasena et al. Jourand et al. 1995.Tabla 6. nodulans Brucellaceae Ochrobactrum O. 2002. 1997 Chen et al. plurifarium M. chacoense M. septentrionale M.

2004) fueron propuestos para acomodar dichas especies de Ralstonia.cepacia genomovar VI) B.. vitis y (Young et al.Familia/Género/ Especie D. pero su capacidad de nodular no fue comprobada. Hasta 1989. 2007 Chen et al. 2008 Chen et al. dolosa (B. *** Fueron aislados de nódulos. 2004) y más tarde del género Cupriavidus (Vandamme y Conye. mimosarum B. pero descubrieron que pueden formar nódulos en leguminosas y la propusieron para que se incluyera en el género Bradyrhizobium.. Vandamme et al. caribensis B. **** Estos autores no describieron el género. 2002 Vandamme et al. tuberum B. 2010 Moulin et al. Arubi y A.. Vermis et al. 2002 Vandamme et al. A.. phymatum B. nodosa B. 2002 Achouak et al. plantas leñosas. Mimosoideae (3270 spp. 2001) y A. 2004 Chen et al. en su mayoría plantas tropicales leñosas). A.1 Continúa. El alcance de la simbiosis con BFNFNL entre leguminosas queda todavía sujeta a investigación. ** Estos autores no describieron estas especies. subtrópico y zona templada) y Papilionoidae (13. larrimoorei (Young 2004) en Rhizobium. 2002.800 spp. Filum/Orden. sabie Cupriavidus (Ralstonia) C. pero descubrieron que pueden formar nódulos en leguminosas ***** El género Wautersia (Vaneechoutte et al. únicamente el 57% del género y el 20% de las espe182 Manual de biología de suelos tropicales . Las leguminosas contienen alrededor de 20 mil especies. tumetaciens (syn. yakushimensis β-Proteobacteria Orden Burkholderiales Burkolderiaceae Burkholderia **** B. 2006 Chen et al. distribuidas en las subfamilias Caesalpinoideae (2250 spp. del trópico. 2001. 1999. en su mayoría herbáceas) (Lewis et al.Tabla 6. 2001 Vandamme et al. rhizogenes. adiobacter).. 2005). (Ralstonia) taiwanensis ***** Referencia Bautista et al. Vandamme & Conye 2004 Notas: * Se propuso incluir a las especies Agrobacterium como A.

los nódulos pueden muestrearse en plantas cultivadas en el campo (colecciones in situ). 2006) EVALUACIÓN DE DIVERSIDAD DE BFNFNL EN EL SUELO Los estudios sobre poblaciones y diversidad de BFNFNL dependen de un aislamiento exitoso de nódulos de raíces y ocasionalmente de tallos.. Sin embargo. Bradyrhizobium betae (Rivas et al. y que han sido desarrolladas nuevas técnicas de genética molecular. 90 y 97% entre Caesalpinoideae.. aunque este método puede resultar difícil en el caso de hospederas perennes o leñosas (Moreira et al. 1995). 2004) y Mesorhizobium thiogangeticum (Ghosh et al.. 1992).. Para poder aislar o enumerar BFNFNL en una población microbiana diversa. de leguminosas hospederas. tradicionalmente. respectivamente (Faria et al. Aunque algunas plantas hospederas se consideran muy promiscuas. la taxonomía del BFNFNL estaba basada en cepas aisladas de cultivos de zonas templadas.1). Moreira et al. en 1984 (véase Tabla 6. en selvas tropicales). Faria et al.. es posible que nuevas simbiosis se identifiquen en el futuro. De esta manera. en ecosistemas naturales (por ejemplo. se requiere de un método que separe claramente BFNFNL de otras especies bacterianas y que permita un muestreo fácil y sistemático de los nódulos. Odee et al. únicamente el 25% de las especies existentes han sido examinadas. El proceso de infección de la planta es el resultado de la formación de nódulos en sí. Tres especies de los géneros descritos de BFNFNL no fueron incluidas en la tabla porque no fueron aisladas de nódulos ni la capacidad de nodulación se comprobó hasta el momento: Rhizobium cellulosilyticum (García-Fraile et al. 2007). ha ocurrido una revolución en la taxonomía con 90 especies y 10 géneros adicionadas a las 4 especies y a los 2 géneros originales enlistados por Jordan. 1982. Aunque se han llevado a cabo búsquedas extensivas para nuevos géneros y especies formadoras de nódulos. muestran una B acterias formadoras de nódulos en leguminosas 183 . como la que surge en el suelo. especialmente en Brasil (Magalhães et al.. ahora que se encuentran disponibles las que han sido aisladas de otras especies y regiones... Mimosoideae y Papilionoidae. por ejemplo.. 1989. 1989). El cultivo posterior y caracterización de BFNFNL y de los nódulos. se estima que hoy en día. puede proveer información sobre la composición taxonómica de poblaciones de BFNFNL y determinar el grado de especificidad entre cepas específicas y candidatos hospederos. para poder estimar la población de BFNFNL en el suelo. 1992. y se esperan más revisiones en un futuro.cies habían sido examinadas por la formación de nódulos y los porcentajes de las especies que sí podían formar nódulos se encontraron en porcentajes de 23.

. de crecimiento lento. De manera similar. acetileno a etileno (Dilworth. de hecho. Antes de escoger las plantas hospederas para realizar un bioensayo. en la mayoría de los casos. 2002. Moreira. 184 Manual de biología de suelos tropicales . Para poder evaluar la diversidad de BFNFNL en el suelo. Resultados obtenidos en Brasil (Alto río Solimões) muestran que caupí (Vigna unguiculata) captura más especies que M.. cultivados en muestras de suelo tomadas del campo o inoculadas con suspensiones del suelo (Moreira et al. La nitrogenasa es la enzima responsable de la reducción del gas nitrógeno a amoniaco. tiene una especificidad muy baja y puede ser nodulada por Rhizobium spp. Pereira. de manera natural. Lima et al. normalmente considerada como hospedero de Badyrhizobium. 2006 y 2008.. indican que M. atropurpureum fue nodulado.. de rápido crecimiento. 1988a). se recomienda llevar a cabo experimentos preliminares para cada tipo de suelo. ningún hospedero promiscuo puede ser nodulado por todas las especies o cepas existentes de BFNFNL y. También reduce.. aisladas de nódulos formados de manera natural. 2007) y Burkholderia. Odee et al. 1966. donde sea posible. por Bradyrhizobium spp. Resultados preliminares de Taita. 2009).. punto de referencia CSM-BGBD. en Kenia. Aunque algunas de las asociaciones mencionadas pueden ser relativamente específicas.. debería incluirse una especie leguminosa nativa como trampa hospedera. 1970). Lima. más variedad resultará de cepas de BFNFNL. 2000). aisladas e identificadas. 2009). El bioensayo para BFNFNL puede hacer uso de hospederos promiscuos. atropurpureum y que el frijol Phaseolus vulgaris. de manera contraria. Las especies encontradas posteriormente deberían compararse con las especies que forman nódulos en el lugar. Por lo anterior. también cabe la posibilidad de que sea nodulado por especies de rápido crecimiento como Rhizobium (Pereira. entre otros sustratos. y. únicamente. Lewin et al. 1987 demostraron que Vigna unguiculata. con los que se muestrea con el bioensayo. 1997.. 1993. 2000. no existe ninguna cepa de BFNFNL que sea lo suficientemente promiscua como para nodular a todas las especies leguminosas. la comparación de BFNFNL. entre otras (Moreira et al. se reporta que suele estar nodulado por la especie Bradyrhizobium (Woomer et al. siratro (Macroptilium atropurpureum) atrapa BFNFNL en los 98 puntos de muestreo del proyecto CSM-BGBD (Lima et al. por ejemplo: Macroptilium atropurpureum es uno de los hospederos ampliamente conocido (Vicent.. representa una comprobación útil de la exactitud del procedimiento en el laboratorio. pero. en la mayoría de los casos.baja especificidad. es deseable hacer uso de una variedad de especies de plantas hospederas candidatas y cuantas más sean empleadas.

la gran ventaja de un ensayo de reducción de acetileno (ERA). tal y como se describe a continuación. ya que posee pequeñas semillas y resulta fácil de manipular bajo condiciones controladas en bolsas de plástico y jarras de Leonard. Esta reacción se utiliza como técnica para medir la actividad de la nitrogenasa. 1992). 1987). Paso 2A: para el proyecto se utiliza el método convencional de uso de especies promiscuas.. resulta idóneo Macroptilium atropurpureum (siratro). como trampas para aislar las BFNFNL de las muestras del suelo. aplicados en el proyecto CSM-BGBD. Giller. es barato y fácil de realizar aun en condiciones de campo. 1987. Es por ello que se emplea una única especie promiscua como trampa. con esto se B acterias formadoras de nódulos en leguminosas 185 . y estará limitado por el tiempo disponible y las facilidades que ofrezca el laboratorio. sin embargo. El ensayo también puede usarse para confirmar una nueva simbiosis de BFNFNL o en el caso de nódulos no usuales (Moreira et al.1. Bajo estas circunstancias. puesto que deben quedarse intactos para su aislamiento posterior o secarse cuando requieran ser almacenados durante un largo periodo. METODOLOGÍA APLICADA EN EL PROYECTO CSM-BGBD: UNA REVISIÓN GENERAL Los pasos utilizados en la metodología para la caracterización de BFNFNL. es que destaca por su gran sensibilidad y velocidad. el personal que no posee la suficiente experiencia podrá confundirlos con estructuras no inducidas por BFNFNL. Los nódulos sin actividad de la nitrogenasa pueden estar senescentes o ser inefectivos. cuyos seis pasos a seguir se muestran en la ilustración 3a hasta la 3f. dentro de cámaras de crecimiento o invernadero. Una descripción previa fue hecha por Moreira en 2004. Paso 1A: recoger muestras de suelo del campo. dado lo afanoso del procedimiento.Schollhorn Burris. con una solución nutritiva. deben utilizarse semillas de la misma procedencia. Aunque el uso de ERA para obtener estimaciones cuantitativas de fijación de nitrógeno a la nutrición de la planta ha sido ampliamente discutido (Boddey. el uso de especies múltiples no es viable con un gran número de puntos de referencia (por ejemplo 100). dado que la anatomía de los nódulos varía ampliamente en forma y en tamaño. Por ejemplo. 1966). se encuentran resumidos en la Figura 6. resulta muy útil para la detección simple de fijadores de nitrógeno. Cuando se llevan a cabo varios experimentos. La actividad de la nitrogenasa constituye una información invaluable porque en muchos casos es imposible verificar que los nódulos aún son efectivos y viables (color interior rojo).

fijadoras de nitrógeno en diversos sistemas de uso de suelo. Caracterización de aislados verificados. 2A. Bioensayos con aislados: verificación (postulados de Koch) y propiedades simbióticas (número de nódulos y peso seco de materia). Jarra de Leonard. c) 2 B. Almacenaje en frascos con gel de sílice o CaCl2 4.1 Evaluación de bacterias formadoras de nódulos en leguminosas. Especies nativas (opcional) Bolsas de plástico (Ilustración 3. Frijol (opcional) 4. otros genes.Figura 6. tales como dnaK. especialmente para Bradyrhizobium). Doce muestras en cada punto de muestreo (véase esquema global CSM-BDBG. ** Algunos nódulos pueden guardarse en gel de sílice para su aislamiento. Aislamiento de NLB de nódulos ** en YMA/79 con azul de bromotimol (Ilustración 3. con la muestra de suelo. índices de diversidad. secuencia del gen (16S rRNA para todos los géneros. Siratro* 2. b). eficiente. Captura de BFN. Eficiencia de poblaciones nativas: número de nódulos. * Puede usarse para conteo NMP (opcional). Claves de identificación de plantas. (Ilustración 3. 1A. resumida en seis pasos. más un control de una cepa conocida. La eficiencia de poblaciones nativas es evaluada con la floración. Nódulos de especies de plantas locales 5. peso de materia seca y peso seco de planta (contenido N). 2A.55% 1. Caupí (opcional) 3. 12 muestras compuestas de suelo por punto. d) caracterización de cultivo 3 A. contenido de N por planta (opcional). f (ii). a). Capítulo 2). cuando se aprecian diferencias significativas entre tratamientos 4. 3A. tamizar según características de cultivo y REP-PCR o perfiles de proteína (Ilustración 3. dos controles sin inoculación (con o sin mineral N). capturadas con suspensiones de suelo 1:1. 6. utilizando la técnica de infección de planta. Caracterización de cultivos (son necesarios los experimentos preliminares con suelo de selvas y cultivos de leguminosas para determinar el número de aislamientos requeridos para caracterizar las comunidades de simbiontes en su conjunto. 2e) 1C. representativos de grupos previos. colectadas bajo condiciones asépticas Área de referencia /Uso del suelo/ Puntos de muestreo 1B. basados en una 186 Manual de biología de suelos tropicales . capturando BFN: técnica de infección de planta: inoculación de especies promiscuas. Nota: 1A. solución de nutriente de suelo o NaCl a 0. agar inclinado (Ilustración 3. Ensayo de reducción con acetileno (opcional) 3 B. Origen del hospedero. en caso necesario. Dos controles sin inoculación (con o sin mineral N) más un control con un tipo eficiente (Ilustración 3. peso seco de materia aérea de planta.

Paso 3 A: aunque la eficiencia bajo condiciones controladas no refleja lo que está pasando in situ. en el tamizado de la colección entera de aislamientos (para conseguir racimos) y elementos repetitivos extragénicos palindrómicos/secuencias de DNA (REP-PCR) (u otros métodos como perfiles de proteínas por electroforesis con SDS-PAFE/poliacrilamida gel puede ser complementario). éste no es obligatorio. basados en características de cultivo (si este es el caso) y/u otro método deben ser secuenciados para 16SrRNA y otros genes como dnaK (por ejemplo. aunque sería imposible estandarizar esta selección. aunque también se puede aplicar a otros géneros). esto puede servir como un punto de referencia. caupí y frijol) se pueden seleccionar otras. Los suelos con un alto contenido de N deberán evitarse. deberán corregirse para los ensayos. Las especies-trampas pueden usarse para capturar y contar BFNFNL o simplemente para capturarlas. debido a diferentes relaciones simbióticas (diferentes especies de plantas) y condiciones ambientales. incluyendo algunas especies nativas que. aún dispersos. acidez y un alto contenido de Al. para trampas promiscuas adicionales se recomienda usar Vigna unguiculata (como segunda especie) y Phaseolus vulgaris (frijol) como tercera especie. Para poder capturar BFNFNL. las cuales se describen a continuación. Las muestras de suelo en macetas pueden usarse únicamente cuando haya disponibilidad en los laboratorios y se deben seguir todas las técnicas asépticas normales de la microbiología. Bradyrhizobium. Dada la complejidad del primer ejercicio. pueden ser diferentes en cada país. Las semillas que se encuentren disponibles en la localidad proveerán información útil para agricultores del lugar. incluso puede indi- curva de extinción de especies). Se selecciona Phaseolus vulgaris con base en que en varios países existen datos.evita cualquier variación de NFNLB debida a las plantas. jarras de Leonard o en macetas que contengan las muestras de suelo. Cuando un equipo puede manejar más de una trampa de especies. por supuesto. otros factores limitantes como deficiencias de macro y micronutrientes. sobre poblaciones de BFNFNL donde se utiliza el frijol común como especie-trampa. Después de las tres especies mencionadas (siratro. Las dos especies fueron escogidas por ser bastante promiscuas y porque se cultivan en muchos países. B acterias formadoras de nódulos en leguminosas 187 . El criterio para la selección debe basarse en que la especie-trampa sea ecológica y económicamente relevante para el país. pueden cultivarse especiestrampas en bolsas de plástico. ni forma parte de la metodología estándar. es fácil de medir y proporciona información útil sobre la variabilidad y eficiencia de las poblaciones nativas. Representantes de racimos. Incluye características de cultivos obtenidos en el paso número 4.

. para una especie hospedera en particular.. y quizá más de 100 por uso del suelo (Jesús et al. junto con los de nódulos recogidos de plantas nativas que naturalmente forman nódulos. formados en el campo. hará posible la mejor evaluación de diversidad y de eficiencia de la especie-trampa. Considerando que estas curvas se obtienen con base en el número de diferentes cultivos que todavía pueden mostrar características genéticas variables. Se necesitará aplicar las curvas de muestreo a todos los aislados. con una inoculación de suspensiones de suelo. y los de plantas. Cuando se usa la técnica de infección por planta. Este número se encuentra en el punto (asíntota) donde la curva alcanza su mayor nivel. Se sabe que la diversidad genética en poblaciones naturales de las NFNLB del mismo lugar puede presentar diferencias entre los aislados de nódulos. se necesitan entre 30 y 50 nódulos. en caso de no alcanzarlo. las BFNFNL deben ser aisladas. de esta forma estarán disponibles para futuros aislamientos. proporcionarán los datos de la diversidad. Paso 1C: las especies de leguminosas en un área específica. pertenecientes a los diferentes sistemas de uso de suelo en cuestión. cultivadas en una serie de diluciones de suelo. Paso 1B/2B. 3B: se recomienda también que las BFNFNL sean aisladas de especies leguminosas (nativas e introducidas) que nodulan naturalmente. por lo menos. por ejemplo. de ocho metros de radio alrededor de cada punto de muestreo. 2001). En la literatura se ha discutido que. los nódulos deberán muestrearse a partir de plantas que nodulen y representen niveles secuenciales de diluciones (Moreira y Pereira. 2001) porque los tipos de BFNFNL capturadas pueden variar también con la dilución (Bala et al. Paso 4: después de la aparición y crecimiento de nódulos. los aislados de estos nódulos. se necesitarán más aislamientos para obtener una buena resolución. esto indica que no se han detectado todas las especies y que muestras adicionales (aisladas de nódulos) deberán ser analizadas. 188 Manual de biología de suelos tropicales . tal y como se explicó anteriormente. a los del bioensayo y a los nódulos colectados en campo. deben ser inventariadas para que las relaciones con poblaciones naturales de BFNFNL puedan determinarse. en los diferentes sistemas de uso de suelo.. en condiciones de laboratorio (Bala et al. es decir. Las curvas de muestreo (acumulación o escasez) pueden revelar el número de aislados requeridos para evaluar correctamente la diversidad. 2001). 2005).2). Los nódulos se almacenan en sílica gel (Figura 6. lo que permite la construcción de curvas de muestreo para evaluar si la diversidad en un lugar ya ha sido completamente caracterizada.car la existencia de cepas eficientes en las poblaciones del suelo. Una comparación de BFNFNL aisladas de nódulos del campo y de nódulos introducidos en una especie-trampa.

El aislamiento de BFNFNL de nódulos deberá hacerse en el medio 79 con azul de bromotimol (Fred y Waksman, 1928). El medio 79 se conoce también como YMA (Vincent, 1970) (anexo 6.1); esto permite la caracterización completa del cultivo (tasa de crecimiento, cambio de pH, producción de exo-polisacáridos, morfología de colonia, color, tamaño, etc.). Para obtener grupos a partir de estas características de cultivo. La diversidad genética de poblaciones de BFNFNL puede evaluarse al agrupar los perfiles que resultan de rep-PCR, utilizando un software como Gelcompar (Brujin et al., 1997) o mediante el uso de otra técnica: perfiles de proteínas por electroforesis con gel de SDS-Poliacrilamida; que dan una buena resolución a nivel cepa (Paso 6); sin embargo, esto puede ser opcional, de acuerdo con los recursos disponibles en cada país y debe llevarse a cabo después del paso 5 para evitar perder el tiempo con contaminantes. Finalmente, los representantes de cultivos de los clados generados mediante el agrupamiento por Rep-PCR u obtenidos mediante otros métodos se secuenciarán para obtener el gen 16SrRNA (Paso 6). Cuando existen recursos suficientes, dnaK u otros genes involucrados en el mantenimiento de la bacteria, tales como atpD, rpoB, recA, glnII (Parker, 2004; Vinuesa et al., 2005b; Gaunt et al., 2001), pueden ser probados para algunas cepas de género que no hayan sido bien discriminadas por 16 SrRNA, como en el caso de Bradyrhizobium.
Figura 6.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. Fuente: Moreira y Pereira, 2001.
1 ml de C2H2 Muestra de gas Tapón de goma (a) Vial (10 ml) 30 minutos a 1 hora Tapón de goma Tubo al vacío

Nódulo Nódulo efectivo Nase C2H2+2H++2e 2C2H4 Tubo de ensayo 8.5 ml (b)

Tapón de rosca Tapón de rosca, nódulo, algodón y sílica gel o CaCl2

B acterias

formadoras de nódulos en leguminosas

189

REQUERIMIENTO DE MATERIALES PARA TRABAJO DE CAMPO Y LABORATORIO Trabajo de campo: para muestrear suelo: alcohol al 95%, agua para eliminar el suelo del equipo de muestreo antes de la esterilización con alcohol, caja refrigeradora, bolsas de plástico esterilizadas (300 ml), espátula, bolsas grandes de plástico (5 l) y un pequeño sacabocados. Para muestrear nódulos: tijera pequeña, cuchara, azada y azadón, pinzas, pala, tubos de tapón de rosca, sílica gel o CaCl2 anhidro. Para resguardo de plantas: alcohol, prensa y periódico. Trabajo de laboratorio para aislar y enumerar BFNFNL: pipetas de 1 ml y 5 ml, solución para dilución, matraces Erlenmeyer de 1 L y 125 ml, agitador orbital, bolsas esterilizadas de plástico (125 ml) para crecimiento, tubos de ensayo (150 x 20 ml ó 200 x 30 mm), o botellas de cerveza recicladas, rejillas para bolsas de crecimiento o tubos, solución de nutrientes, semillas de plantas leguminosas hospederas promiscuas o nativas, temperatura ambiente controlada de luz y humedad. Trabajo de laboratorio para aislamiento de BFNFNL y caracterización de cultivos: cajas Petri, alcohol al 95%, HgCl2 al 0.1% (acidificado con HCl concentrado a 5ml/L) (Hipoclorito de Na o Ca; puede usarse H2O2 para sustituir al HgCl2), agua esterilizada, pinzas, medio de cultivo que contiene levaduras, manitol y sales minerales (hipoclorito de sodio o calcio, o H2O2 (pueden sustituir al HgCl2), agua esterilizada, pinzas, medio de agar con sales, levadura-manitol-mineral, pH6.8. Para la actividad de nitrogenasa mediante reducción de acetileno: matraces Kitasato Erlenmeyer, globo de hule, jeringas de 1 ml a prueba de gas, tubos de vacío de 5 ml, frascos de 10 ml o de mayor capacidad con tapones de goma, carburo de calcio CaC2, cromatógrafo de gases equipado con un detector de ionización de flama (FID) y columna RN Poropak para determinaciones de acetileno/etileno. Nota: los ensayos de nitrogenasa pueden llevarse a cabo en campo. MÉTODOS DETALLADOS Muestreo del suelo. Se saca una muestra de suelo a una profundidad de 20 cm, en 12 puntos, distribuidos alrededor de cada parcela de muestreo (véase Capítulo 2, Figura 2.3). Se utiliza el mismo esquema de extracción del núcleo para el muestreo en todos los grupos microbianos, incluyendo el BFNFNL. Se junta cada juego de 12 muestras, para formar una muestra compuesta de alrededor de 300 g que, posteriormente, se introduce en una bolsa plástica esterilizada. De manera alter190
Manual de biología de suelos tropicales

nativa, cuando lo permitan los recursos, se pueden obtener tres o más muestras compuestas en cada punto. Todas las herramientas: sacabocados, espátulas, azadón, etc. deberán lavarse muy bien con agua para remover partículas de suelo y ser esterilizadas mediante alcohol y flama antes y después de cada muestreo, con el fin de evitar la introducción de BFNFNL exóticas. Se deben minimizar las pisadas cerca de los puntos de extracción y la hojarasca deberá ser removida justo antes de que se lleve a cabo el muestreo. Las muestras de suelo se trasladan al laboratorio lo antes posible, utilizando un envase con aislamiento (preferiblemente debe permanecer a 4° C). Una segunda muestra compuesta de alrededor de 200 g será recogida en una bolsa de plástico no estéril para su análisis físico-químico. Muestreo de nódulos. Se deberán identificar plantas leguminosas dentro de un radio de 8 m (lo mismo que para un inventario de vegetación) en el punto de muestreo y se recogerá el material vegetal resultante. Será de gran ayuda contar con información previa acerca de cuáles son las especies que pueden nodular, de manera que se confine el muestreo a estas especies en concreto; sin embargo, hay que aclarar que existe un enorme potencial para el descubrimiento de nuevas especies de leguminosas de este tipo. En el caso de plantas herbáceas, se puede extraer todo el sistema de raíces del suelo, utilizando una azada, un azadón o una pala, cuidando no romper nódulos de manera accidental. Los nódulos de plantas leñosas deberán descubrirse extrayendo las raíces y poniendo gran atención para no dañar las ramificaciones delgadas en donde éstos normalmente se encuentran. Se debe verificar, con extremo cuidado, que las raíces delgadas pertenezcan a la planta leguminosa identificada; por este motivo, se recomienda empezar la excavación junto al tallo; se extirpan los nódulos (dejando un pedazo de raíz para facilitar la manipulación) y se guardan en tubos de tapón de rosca con un desecador (Figura 6.2b). Antes del almacenaje, las partículas de suelo deberán removerse, bien por sacudido o bien mediante lavado, retirando el exceso de agua con una servilleta. Por lo menos se recogerán 50 nódulos por cada punto de muestreo y la muestra será representativa de todas las especies nodulantes existentes en la parcela de muestreo. En ocasiones, algunos nódulos pueden ser demasiado grandes para los tubos normales de rosca: deberán ser almacenados en un recipiente de mayor capacidad. Actividad nitrogenasa. La actividad de nitrogenasa puede medirse en el campo o a partir de cada nódulo, justo después del muestreo o en el laboratorio (Figura 6.2). Se introduce el nódulo en un frasco de tapa de goma de 10 ml o de mayor capacidad, en caso necesario. Se produce acetileno en un matraz Kitasato Erlenmeyer
B acterias
formadoras de nódulos en leguminosas

191

por la reacción de CaC2 con agua (Figura 6.3). Si se lleva a cabo el trabajo en laboratorio, se obtiene acetileno de cilindros de gas comerciales. Se inyecta 1 ml de este gas en el frasco que contiene el nódulo. Después de una hora aproximadamente, se remueve 1 ml de gas de la superficie y se transfiere a un tubo al vacío para su posterior análisis de etileno por cromatografía de gases (Figura 6.2a). Especímenes de resguardos de plantas. Los especímenes de resguardos de plantas nodulantes, deberán recogerse en el área que se encuentra alrededor del punto de muestreo (radio de 8 m). Se debe poner especial atención en el etiquetado (véase a continuación) y si es posible, incluya flores y frutas. Enseguida, los especímenes se mandan al herbario para su identificación junto con una tarjeta de identificación de las mismas: Proyecto: CSM-BGBD Colector: Fátima Moreira Fecha: 2 de abril de 2005 Localidad: Benjamin Constant Altitud: 500 m Nombre vulgar de la especie: faveira Nombre científico de la especie: ¿? Número de vale: 05 Características del nódulo: crecimiento medio, tamaño 0.5 a 1.5 cm Descripción del lugar: pastizales abiertos con ganado y troncos de madera Tipo de suelo: limo arenoso
Figura 6.3 Producción de acetileno en campo o laboratorio.
Agua Globo de hule CaH2

Tubo de goma

CaC2

CaC2 + H2O ⇒ C2H2 + Ca (OH)2 Sólido Gas Sólido

192

Manual de biología de suelos tropicales

Características de la planta: herbácea con frutos maduros Otros comentarios: se recogieron semillas; flores amarillas. El conteo de BFNFNL. Se someten muestras de suelo a una serie de diluciones antes de la inoculación de las plantas hospederas candidatas (Figura 6.4). La correlación de diluciones varía entre 2.0 (1:2) y 14.5 (1:14.5), según la concentración de células esperada en la muestra. Esto significa una mayor dilución para suelos con más BFNFNL; sin embargo, aún es necesario inocular plantas hospederas en todas sus diluciones (véase a continuación). Asimismo, en cada dilución se debe emplear una réplica del bioensayo (2 a 5 veces). Las plantas se cultivan en condiciones controladas (Vicent, 1970) y después de 15 días, se les examina para ver si han formado nódulos. Las poblaciones de BFNFNL se estiman por el método del Número más Probable (Cochran 1950; Woomer et al., 1988b, 1999). En el caso de inocular las plantas únicamente para capturar las BFNFNL, las muestras de suelo deberán resuspenderse en agua esterilizada o en una solución de nutrientes (la misma que se utiliza para un medio de cultivo o crecimiento de plantas) (véase anexo 6.1 y 6.2) en una correspondencia 1:1. Las plantas pueden cultivarse en bolsas de plástico, jarras de Leonard u otro tipo de frasco. Se deben utilizar tres tipos de controles sin inoculante de suelo: el primero comprueba la presencia de contaminación durante los procedimientos experimentales. Si no se mantienen de manera correcta las condiciones axénicas, este control resultará en nódulos y el experimento se invalidará (aún cuando nódulos ocurren en una sola réplica). Se recomienda que el número de réplicas dentro de este control sea mayor que las réplicas de tratamientos de inoculación y el control debe localizarse dentro de diferentes posiciones en el protocolo. Los otros dos controles permitirán comprobar la eficiencia de las comunidades de BFN. Las comunidades que nodulan la planta hospedera indican si las condiciones del experimento (temperatura, concentraciones de nutrientes) son adecuadas para que se lleven a cabo la nodulación y la fijación de nitrógeno en las plantas y su crecimiento. El primero de los controles se complementa con nitrógeno mineral (para jarras de Leonard, 70 mg N-NH4NO3) cada semana desde la tercera hasta la penúltima, pero no se inocula. Para bolsas de plástico o recipientes de pequeños volúmenes, se utiliza una sola aplicación de 70 mg N-NH4NO3). De esta manera el caupí, que alcanza su nivel de floración en dos meses, con el uso de jarras de Leonard recibirán un total de 350 mg N-NH4NO3, mientras que los frijoles con un periodo de crecimiento de mes y medio, en jarras de Leonard, recibirán 280 mg de N-NH4NO3. El otro control se inoculará con un inoculante recomendado para esta
B acterias
formadoras de nódulos en leguminosas

193

especie de planta; por ejemplo, CIAT 899 para Phaseolus vulgaris en Brasil, pero no se añade nitrógeno. Aislamiento y caracterización de BFNFNL. Las BFNFNL son aisladas de los nódulos recogidos en campo y por bioensayo en el laboratorio. En el último caso, los nódulos obtenidos en cada dilución sucesiva pueden indicar cuáles son las cepas menos frecuentes en la muestra de suelo y cuáles, las más comunes. El primer paso será esterilizar la superficie de los nódulos con una breve inmersión en 95% de alcohol, seguida de una inmersión más larga de tres a cuatro minutos en HgCl2 (hipoclorito de Na o Ca, o H2O2 pueden usarse como sustitutos) y lavado mediante varios enjuagues con agua estéril (Vicent, 1970). A continuación se aplasta el nódulo dentro de unas gotas de agua estéril, utilizando pinzas y esto se vierte sobre un medio de agar. En el caso de los nódulos disecados, éstos deben remojarse en una solución de agua esterilizada para mejorar la absorción de la solución desinfectante. Los tiempos de inmersión en HgCl2 u otros desinfectantes, deberían ajustarse al tamaño del nódulo (más corto para nódulos pequeños). En la composición del medio de agar: levadura-manitol-sales minerales (Fred y Waksman, 1928) (Anexo 6.1), especialmente el pH y la fuente de carbohidrato pueden variarse, tomando en cuenta las condiciones específicas del suelo (Date y Halliday, 1979; Souza et al., 1984; Elkan y Bunn, 1991). Puede incluirse azul de bromotimol como indicador porque los cambios en el pH, causados por la formación de BFNFNL, pueden resultar útiles en la identificación de género. Otros caracteres incluyen: la tasa de crecimiento (tiempo TAIC de aparición de colonias aisladas), la cantidad de polisacáridos celulares, forma y tamaño de colonia, diámetro y color según lo descrito por Moreira et al. (1993) y Jesús et al. (2005). Los principales descriptores de cada género son: Allorhizobium, Rhizobium y Sinorhizobium: colonias circulares, de 2 a 4 mm de diámetro, normalmente unidas debido a la copiosa producción de polisacáridos extracelulares, convexas, semitraslúcidas, elevadas y mucilaginosas, la mayoría con el centro de color amarillo (debido al indicador de pH), de crecimiento rápido (TAIC: de 2 a 3 días). Mesorhizobium: igual que Rhizobium, pero normalmente de crecimiento más lento (TAIC: de 4 a 5 días). Bradyhizobium: colonias circulares que no exceden de un milímetro de diámetro, producción extracelular de polisacáridos de abundante a escasa (esto último, generalmente en el caso de los tipos que toman más de diez días para su crecimiento), opacas, raramente traslúcidas, blancas y convexas, granulares en textura y que producen un cambio de pH a alcalino, de crecimiento lento o muy lento (TAIC: de 6 a más días).
194
Manual de biología de suelos tropicales

Figura 6.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.

Paso de dilución

Nivel de dilución

El porcentaje base de la dilución (Nd) puede variar de 1:2 hasta 1:14.5 y el numero de replicas por dilución (N) de 2 a 5. Fuente: adaptado de Woomer, 1993 y Vincent, 1970 por Moreira y Pereira, 2001.
B acterias
formadoras de nódulos en leguminosas

195

. composición de bases de DNA (%C + G). lo que puede ser muy útil para numerosos estudios.. Burkholderia: con características de crecimiento muy similares a las de crecimiento rápido. será necesario definir el nivel apropiado de diversidad que permita caracterizar géneros y especies específicos. 1986). generalmente. Graham et al. Cupriavidus: similar a Azorhizobium... dentro de la especie puede ser genéticamente y fenotípicamente alta. contienen gránulos refráctiles de poly-β-hidroxibutirato en microscopio de contraste de fases. mediante una demostración en la que formen nuevos nódulos en una planta hospedera de prueba. 1983). perfiles de plásmidos (Giller et al. sino también la capacidad de discriminación dentro de diferentes taxas: cada una tiene un nivel específico de resolución para la clasificación bacteriana. 1988). en sus características simbióticas. En la Tabla 6. a veces. con un poco más de producción extracelular de polisacáridos. donde incluyeron serología (Dudman y Belbin. con la excepción de modificación de pH porque pueden producir una reacción ácida o alcalina (dependiendo de la edad). Las BFNFNL son bastoncillos Gram negativos que no forman esporas y que. lo que mejora no sólo la clasificación bacteriana. 1993).. patrones totales de proteína por SDS-PAGE (Dreyfus et al. se han descrito nuevas técnicas para la caracterización de los procariotes. resistencia intrínseca a los antibióticos (RIA) (Kingsley y Bohlool. morfológicas y fisiológicas. por ejemplo Rhizobium. de crecimiento rápido a medio (TAIC: de 3 a 4 días). Moreira et al. de color cremoso. muy poca producción extracelular de polisacáridos (mucho menos que en el caso de Bradyhizobium). también conocidas como huellas 196 Manual de biología de suelos tropicales . de acuerdo con los postulados de Koch. La diversidad de cepas. 1996). hibridación DNA:DNA. 1989). al mismo tiempo. (1991) aportaron estándares mínimos para la descripción de nuevos géneros y especies.5 mm de diámetro. lipopolisacáridos celulares (De Maagd et al. crecimiento en diferentes fuentes de carbono (Dreyfus et al. 1988. Las cepas aisladas deben reconfirmarse como BFNFNL. 1988). hibridación rRNA-DNA y polimorfismos en los tamaños de fragmentos de restricción del DNA. 1988).Azorhizobium: colonias circulares. Estas técnicas. por lo tanto. producen un cambio de pH a alcalino. secuencia de la subunidad pequeña del RNA ribosomal (Young y Haukka. bajo condiciones bacteriológicas controladas... por ejemplo. Recientemente.1 se pueden observar referencias que ofrecen amplios detalles de las características de especies de NFNLB. de 0. electroforesis de enzimas metabólicas (Selander et al.

la purificación y secuenciación de un fragmento de genes (una muestra) ya amplificada por PCR. si existe disponibilidad de recursos.) (Rademaker y Bruijn.genómicas. por otro lado. en la actualidad. 1997). Se pueden utilizar el kit “Ultraclean” para el aislamiento de DNA de suelo de los laboratorios MOBIO o cualquier otro kit recomendado por el productor. 23S rARN u otras secuencias de genes. en algunos casos. Los métodos basados en la reacción de Polimerasa en Cadena (PCR). homología DNA:DNA) requiere de mucho tiempo y de equipo especializado y. Los análisis numéricos con un número adecuado de cepas y la comparación con las cepas de BFNFNL permiten la caracterización de grandes poblaciones.. para cada tipo se suspende una azada con bacterias de una colonia aislada en 1 ml de agua B acterias formadoras de nódulos en leguminosas 197 . dependiendo de la tasa de crecimiento específica para cada cepa (de 2 a 10 días). REP-PCR (Huellas Genómicas de Elementos Genómicos Repetidos de DNA. Se cuantifica el DNA a A260 nm con un espectrofotómetro o se estima por comparación con diferentes estándares de concentraciones de DNA en geles de agarosa. tRNA-PCR o ITS (Amplificación y Análisis del tRNA y de Regiones Intergénicas del 16S-23S rRNA). El número total de placas de 96 muestras cuesta alrededor de US $350 para la secuenciación. La caracterización genética de DNA (secuencia del 16S. RAPD (DNA polimórfico amplificado al azar): AP-PCR (PCR Con Arimers Arbitrarios). Los costos y beneficios de una caracterización previa y secuenciación de representantes versus una secuenciación directa de un número mayor de aislados. puede costar alrededor de US $6. normalmente. se restringe únicamente a representantes de grupos. Por ejemplo. Bruijn et al. la secuenciación de genes específicos puede aplicarse directamente a un número de cepas determinado por las curvas de rarefacción o acumulación. AFLP (Polimorfismo de Tamaño de Fragmentos Amplificados) para el análisis de todo el genoma. Empresas privadas dan buenos servicios para productos PCR y su purificación y secuenciación. la secuenciación directa de 16S rARN u otros genes puede ofrecer ventajas económicas. Extracción de DNA: el DNA genómico es aislado de cultivos de fases log en 79/YMA durante diferentes periodos de incubación. Los costos de la secuenciación de DNA se han reducido notablemente durante los últimos años y. Alternativamente. 1997. incluyen: la digestión de DNA genómico con endonucleasas que cortan sitios (de restricción) poco frecuentes seguido por PFGE (Electroforesis en Gel en Campos Pulsados) y otros métodos de RFLP. tales como ARDRA (Análisis de Restricción del rDNA Amplificado). deben tomarse en cuenta. si se piden las placas completas de 96 muestras.

La extensión final se lleva a cabo a 72°C.ac.5 mm MgCl2. usando los aislamientos representativos de diferentes grupos (obtenidos bien por caracterización de cultivo. durante 7 minutos. Estos pares de oligonucléotidos corresponden a posiciones 8-27 y 1507-1492.nih. MANTENIMIENTO Y COLECCIÓN DE CULTIVOS PUROS Normalmente. durante 40 segundos. Secuenciación 16S rDNA. respectivamente. se utiliza un volumen de esta suspensión como templado para el PCR.cme.2 μm de cada oligonucleótido y dos unidades de la enzima Taq polimerasa (DNA extraído o cultivos líquidos): 6 μl. La purificación de los productos PCR se hace con filtros Microcon™ (Millipore) o mediante otros métodos de purificación.esterilizada.ebi.jsp). Un paso de secuenciación del PCR amplificado se obtiene con el primer 27F. tales como la del National Center for Biotechnology Information (NCBI) (www. Sin embargo. los cultivos puros se mantienen en agar inclinado dentro de tubos de tapa rosca en el mismo medio de cultivo.gov/).2 mm de cada dNTP. seguido por 30 ciclos de desnaturalización a 94°C durante 40 segundos. El programa para PCR incluye un paso inicial: desnaturalizar a 94°C durante 5 minutos. por otras técnicas). Otros oligonucleótidos pueden utilizarse si permiten la síntesis de un gen 16S rARN casi completo. similares a los presentados en la Figura 6. apareamiento a la temperatura de 55°C. pero también con el primer reverso 1492R.edu/index.2.nlm.ncbi. 0. Se comparan las secuencias con otras conocidas contenidas en las bases de datos. Análisis filogenético. perfiles REP-PCR. Las concentraciones finales en las mezclas de reacción (100 ml) son: 1 x PCR Buffer. 1990).. Cuando se requiere la secuencia de todo el gen se deben elegir otros primers internos y usarse para amplificar y secuenciar el fragmento del gen que falte después de utilizar 27F y 1492R. con extensión a 72°C durante 90 segundos. o bien. el European Bioinformatics Institute (EBI) secuenciación de base de datos (www. 2.uk) y el Ribossomal Database Project (RDP) (http://rdp. Los genes casi completos del 16S rDNA se amplifican con un par de oligonucleótidos 27F (pA: 5`AGAGTTTGATCCTGGCTCAG) y 1492R (5´GGTTACCTTGTTACGACTT). del gen 16S del RNA ribosomal de Escherichia coli (Wilson et al. la viabilidad de dichos cultivos no es larga: los métodos como liofilización y almacenaje en un congelador (–80°C) garantizan una larga conservación de las células viables. 198 Manual de biología de suelos tropicales . lo que produce una suspensión ligeramente turbia que posteriormente se hierve durante cinco minutos para lisar las células.msu. 0.

nov.. nov. W.G. J. W. (1999) ‘Burkholderia caribensis sp. Y. vol 32.. G. P.. nov.787-749. y Heulint. T. De Faria... P. y Vandamme. J. F... pp209–266. Casida Jr. E. pp996–1006. from Phaseolus vulgaris nodules’. Critical Reviews in Plant Sciences.. nov. W. y Achouak. E.... E.. pp2174-2179.. an exopolysaccharide-producing bacterium isolated from vertisol microaggregates in Martinique‘. S. nov. C.H. Lodhi. Bontemps.H. Elliot.. A.AGRADECIMIENTOS Agradecimientos especiales por sus comentarios y revisiones a los Drs. G. Marlet. C. T. (1982) ‘Ensifer adhaerens gen. Monsalud. M. R. Chen. Murphy. Christen. (2007)´ Burkholderia nodosa sp. O. J. REFERENCIAS Achouak. vol 16. isoled from root nodules of Pueraria lobata (Willd. Burns. V. James. Brandelet. Bautista. pp. G.. Christien.. N. pp841–843. nov. and Rhizobium giardinii sp. Cnockaert. (2001) ‘Genetic diversity of rhizobia varies from natural populations with the soil dilution sampled’. y Hardy. R. B acterias formadoras de nódulos en leguminosas 199 .. vol 33. pp339–345.. (1987) ‘Methods for quantification of nitrogen fixation associated with Graminae’. Roncato. Boddey. J. S.. A. James. an exopolysaccharide-producing species isolated from legume and non-legume rhizospheres´ International Journal of Systematic and Evolutionary Microbiology vol 59. P. Springer-Verlag.. Amarger. M. W. . Sprent. C. N. I. R. Chou. (2008) ´Burkholderia sabiae sp.. nov. M. M. Esperanza Martínez.. K. J. K. W. Elliot. Bala.. V.. Young. G. nov. International Journal of Systematic Bacteriology.. Giller.P. y Laguerre.. R. Sheu.) Ohwi´ International Journal of Systematic and Evolutionary Microbiology vol 60. Heulin. S. Macheret. E... Chen.. (1975) Nitrogen Fixation in Bacteria and Higher Plants. nov. International Journal of Systematic and Evolutionary Microbiology vol 49. (2009) ´Rhizobium alamii sp. Chou. Soil Biology and Biochemistry. J. Lin.W y Vandamme. (2010) ´Devosia yakushimensis sp. (1997) ‘Rhizobium gallicum sp. David Odee y Nancy Karanja. New York... L.: A bacterial predator of bacteria in soil’. vol 47. pp627-632.. M.V. R. y Yakta. Y.pp367-372. K.. I. International Journal of Systematic Bacteriology. De Faria. Sprent. M.. Berge. M. K. N. M. M. isolated from root nodules of Mimosa caesalpiniifolia´ International Journal of Systematic and Evolutionary Microbiology vol 58. A... Barakat. R. Santealla. sp..

vol 11. Coenye. Zhu. W. nov. from Taiwan and South America’... E. Lee.. International Journal of Systematic and Evolutionary Microbiology. W. pp870–873. nov. vol 16..I. E. P. Elliot..G. Dangeard. G. M. vol 56. International Journal of Systematic and Evolutionary Microbiology vol 60 pp958962.S. vol 41.M. Cochran.. Botaniste (Paris). J. pp275–280. Chen. Andrews.. International Journal of Systematic Bacteriology. Y. (1926) ‘Recherches sur les tubercles radicaux des légumineuses’. Wang. Chen.W. (2010) ´Mesorhizobium alhagi sp. vol 57. Viniesa. L. Bontemps. C... A. T. X. W. P. X. T. P. nov.P. (1950) Estimation of bacterial densities by names of the “most probable number”. y Wang. J. (1991) ‘Rhizobiumhuakuii sp. W. Humphry. Y. W.. vol 47.. J. Odee. Li. J.. Faria. S. W. G.. M. Li. L.F. pp10551059. y Vandamme. Y. Barrios. Biometrics. (2009) ´Nodulation of Sebania species by Rhizobium (Agrobacterium) strain IRBG74 and other rhizobia´Environmental Microbiology. K.. Y. L. W. Yuan. pp105-116. Sprent. y Li. W. M. People’s Republic of China’. vol 45. Wang. Chen.. E. International Journal of Systematic Bacteriology.. 200 Manual de biología de suelos tropicales . pp1–275.K. y Li. (2006) ‘Burkholderia mimosarum sp. Chou. Shen. vol. E. L.. isolated from the root nodules of Astragalus sinicus’.. 6. International Journal of Systematic Bacteriology. X.M. T. nov. Chen.T. pp1847–1851. James... Y. J. W. S. N. y Li. Young. pp153–159. P.. y Vandamme. vol 38. G. pp1729–1735. J. Tan. Mergeay. isolated from nodules of Mimosa species and sputum of a cystic fibrosis patient’. J. International Journal of Systematic Bacteriology. Yan. Gyaneshwar. F. M. (1988) ‘Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned to Sinorhizobium gen.. T... y James.isolated from root nodules of the woody Brazilian legumes Mimosa bimucronata and Mimosa scabrella´ International Journal of Systematic Bacteriology.. a moderately and slowly growing root nodule bacterium isolated from an arid saline environment in Xinjiang. Li. pp392–397... Farruggia. Vos.. (2001) ‘Ralstonia taiwanensis sp. Qi. (1995) ‘Characteristics of Rhizobium tianshanense sp. M. nov. E. S. S. Z..W y Wei. H.P. (1997) ‘Rhizobium hainanense sp.’. Coenye. Young. D.. I. E. X. Chen. S. isolated from nodules of Mimosa spp. M. F. D. pp2510-2525. Cummings. H. P. Wang. International Journal of Systematic and Evolutionary Microbiology vol 51. J. Moreira. nov. T. G...P. Chen. nov. M.. Gao. S.... L. X. Laevens. Chen. isolated from tropical legumes’. P.. Chen. isolated from wild Alhagi sparsifolia in north-western China´.. Sprent..

Coopman. Struffi. pp1825–1830.. (1988) ‘Numerical taxonomic analysis of some strains of Rhizobium spp. J. C. and Sinorhizobium teranga sp. pp1277–1290. Willems.. nov.. H. Dreyfus.. F. infertile soils of the tropics’. in A. L. Collins. F. Journal of Bacteriology. K. (1988) ‘Recognition of individual strains of fast-growing rhizobia by using profiles of membrane proteins and lipopolysaccharides’. A. (1998b) ‘Characterization of tropical tree rhizobia and description of Mesorhizobium plurifarium sp.. E.. y Lugtenberg. (1987) ‘Collection. Molouba. K.. Balows.. International Journal of Systematic Bacteriology.. R. (1994) ‘Polyphasic taxonomy of rhizobia: Emendation of the genus Sinorhizobium and description of Sinorhizobium meliloti com. Pot. B. McSpadden-Gardener. vol 127. isolation. vol 44. A. Davey.. pp715–733.. G. L.. (1991) ‘The Rhizobia’. y Gillis. pp89–98. R. C. Elmerich. Willems. International Journal of Systematic Bacteriology. Ragatz. a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata’. Dreyfus.. Kersters. F. D.. Kluwer Academic Publishers. Applied and Environmental Microbiology. P. Schlegel and H. nov. nov. J. De Lajudie. M. nov.. Maestrojuan. in G. G. De Lajudie.. A. cultivation and maintenance of rhizobia’ . J. in C. D. y Stoltzfus. Dreyfus. Collins. E. Millcamps. (1979) ‘Selecting Rhizobium for acid....’. M. M. H. y Gilles.. Truper (eds). G. vol 277. Rademaker. K. J. A. that uses a qualitative coding of immunodiffusion reactions’. Dilworth. sp. U. Dudman. Elkan (ed) Symbiotic Nitrogen Fixation Technology. P. G. B.. pp369–382. M. Neyra. van Rossum.. y Gillis. (1997) ‘Molecular approaches in microbial ecology to assess genomic diversity and stress-induced gene expression in plantassociated diazotrophs’.. Neyra.. Elkan. Dreyfus... Hoste.. De Maagd.. De Lajudie. Torck. nov. D. The Prokaryotes. E.. Berlin. Dewettinck. Collins. J. nov. J. Laurent-Fulele. y Belbin. J. y Halliday.’.. (1988) ‘Characterization of Azorhizobium caulinodans gen.. Date. International Journal of Systematic Bacteriology. B. W. M. A.. R. Nature. pp285–294. Marcel Dekker Inc. y Bunn. De Bruijn. Dordrecht. B acterias formadoras de nódulos en leguminosas 201 . New York. F. A. B.. A. A. D. D. J. vol 48. L. B. Sinorhizobium saheli sp.. L. R. M. M. nov. International Journal of Systematic Bacteriology.. Springer-Verlag.. (1998a) ‘Allorhizobium undicola gen. vol 38. (1966) ‘Acetylene reduction by nitrogen fixing preparations of Clostridium pasteurianum’. nitrogenfixing bacteria that efficiently nodulate Neptunia natans in Senegal’. Moreira. M. vol 54. Nick. vol 48. Torck. y Gillis. Garcia. vol 170. Dworkin. P. pp3782–3785. R. 2nd Edition. Biochemica et Bioophysica Acta. Lindstrom. W. Schultz. M. U. nov. B. y Halliday.. H. M. P.Date. B.. pp62–64. Willems. M. Newton (eds) Biological Nitrogen Fixation for the 21st Century. M. Kondorosi and W. sp.. Kersters. M.

Z.F. (1989) ‘Occurrence of nodulation in the Leguminosae’. vol 21. F. Jarvis. Y. Tian.. a novel sulfur-oxidizing chemolithoautotroph from rhizosphere soil of an Indian tropical leguminous plant´. isolated from sawdust of Populus alba’. L. L. Strijdom.. McGraw-Hill Book Company. B. P. Frank. y Chen. Keyser. L. Inc.. A. E.. Botanik Zeitung. y Hirsch.T. W.. pp376–387.. Kan. E. A. Lloyd-Macgilp. Terefework. W. Lindstrom. (1889) ‘Ueber die Pilzsymbiose der Leguminosen’. W. Sadowsky.. M. C. Turner. K. S. Z. E. B. vol5. International Journal of Systematic Bacteriology. Barnet. pp 841–848.. J.H.. de Ley.. isolated from Astragalus adsurgens growing in the northernregions of China’. (1928) Laboratory Manual of General Microbiology. Sprent.. Tan. B. E. (1987) ‘Use and abuse of the acetylene reduction assay for measurement of “associative” nitrogen fixation’. y Waksman. Wang.. New York and London. nov. J. vol 37. E.F. (1879) ‘Ueber die Parasiten in den Wurzelan-schwillungen der Papilionaceen’. G. W. M. B. y Chen. pp332–346. P. (1989) ‘Absence of nitrogen fixation in clover grown on soil subject to long-term contamination with heavy metals is due to survival of only ineffective Rhizobium’. X. Soil Biology and Biochemistry. McGrath. Rivas.. (2008) Rhizobium miluonense sp. Martínez-Molina. nov. Turner.. Y.. y Young. Giller. a symbiotic bacterium isolated from Lespedeza root 202 Manual de biología de suelos tropicales . Graham. R. Sui. E.. H. W. Fred. y Sutherly. International Journal of Systematic and Evolutionary Microbiology. Willems. Gu. International Journal of Systematicand Evolutionary Microbiology.T. New Phytologist. E. vol 7. Young. K. Frank. W. Wang. P.. Rigottier-Gois.. M.Faria.. Gaunt.. vol 57. M. S. E. K. M. H. pp783–784.. R. International Journal of Systematic and Evolutionary Microbiology. Martens. P. pp 844-848.. y Velázquez. H. pp 607–619. Y... vol 111. S. Roslycky. Gao. J. nov. Peix. S. García-Fraile. vol 56. pp2037–2048.. D.. (2006) ´Mesorhizobium thiogangeticum sp. A. and Mesorhizobium temperatum sp.. S. W. 394–399. pp91-97. P.nov. J. Giller. pp2003–2012.. J. Han. W. P.P. J. Lewis.X. (2004) ‘Mesorhizobium septentrionale sp. X. H. L. W. (2007) Rhizobium cellulosilyticum sp.. S. Cooper. P. W. vol 19. B. I.X.. Mateos.M. (1991) ‘Proposed minimum styards for the description of new genera and species of root.. Bradley. vol 51. J. B.. Chen. P... E. y Roy.and stem-nodulating bacteria’.F. T. L. R. pp 582–587. Soil Biology and Biochemistry. T. nov. (2001) ‘Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia’. S. y Young.. Ghosh. vol 41. International Journal of Systematic and Evolutionary Microbiology. J. C.. Berichte der Deutschen Botanischem Gesellschaft.. Qiu. A. J.. R.

F.. W. a novel rhizobial species nodulated with Caragana spp. Han. vol 32. L.T.F. C.X.. Rodrigues. Dong. W. vol 58. pp1364-1368. nov.. Y. D. J. M. Gu. Kawasaki. Islam. A. P. International Journal of Systematic Bacteriology. (1982) ‘Rhizobium loti. in China ‘. y Stackebrandt. T. vol 47.. y Patel.L. F.vol 59.K. e Seky. pp378–380.F. Wang. pp1416-1429. S.J. vol58. Li. Biotechnol. nov. International Journal of Systematic Bacteriology. Schumann.G. C. Malik.International Journal of Systematic and Evolutionary Microbiology. M. X. isolated from nodules of Cicer arietinum´. nov. International Journal of Systematic and Evolutionary Microbiology. W. Wang. Imran.. Wang. M. W. Hafeez. Chen. Isolated from a Tumor-Like Root of the Legume Entada koshunensis from Iriomote Island in Japan‘.X. (1997) ‘Transfer of Rhizobium loti. L. X. C... nov. K.. P.. L. T.. Lu. B. Cleyet-Marel... pp2610-2618. Wu. Gao. I.X.. Chen. H. A. Jarvis. Chen. Florentino. Tian C. Rhizobium mediterraneum and Rhizobium tianshanense to Mesorhizobium gen. China‘. pp455-460. Nakagaka. L. (2010)´Ochrobactrum ciceri sp... J. y Chen. Yan. International Journal of Systematic and Evolutionary Microbiology.J.. (2008) Mesorhizobium gobiense sp. (2008) ‘Bradyrhizobium iriomotense sp. (2005) ‘Leguminosae nodulating bacteria diversity from three different land use B acterias formadoras de nódulos en leguminosas 203 . E. nov. (2009) ´Rhizobium tibeticum sp. M.J. R. W. Jesus. A. E. y Gillis. W.I. vol 58.. Y. W. Gu. T.. Mesorhizobium caraganae sp.G. vol 60: 1548 .. and Mesorhizobium tarimense sp. a new species of legume root nodule bacteria’. S. Y. B. W. R. W.. vol58. E. A. y Chen. E.’.nodules‘.T. J. a symbiotic bacterium isolated from Trigonella archiducis-nicolai (irj.H. China‘.... International Journal of Systematic and Evolutionary Microbiology. M... (2007) ´ Rhizobium selenireducens so. Sui.B. y Manter D. Biosci. E. Oliveira. W..) Vassilcz´. y Chen. (2008).. Y.(2008) ‘Rhizobium multihospitium sp.: a selenite-reducing (alpha)-Protobacteria isolated from a bioreactor´Current Microbiology. Han.X.s. L. Wu. nov. Nour. vol 55. Zhang..F.1553. X. nov.T. Jia..F. Guan. Rhizobium ciceri. M. Rhizobuim huakuii. isolated from wild legumes growing in desert soils of Xinjiang. van Berkum... Han. International Journal of Systematic and Evolutionary Microbiology.T. Gu. International Journal of Systematic and Evolutionary Microbiology. Hou... Kuykendall..pp3051-3057. J.C. D.... Biochem vol 72.. Fernyez..Z. Hunter.. W. Chen..R. B. X. E. 895–898. y Moreira.T. nov. Chen.. M.. W.X.X. Y. nov. C. J. D. pp1693-1699.J.H. P. Pankhurst. E. Wang.... pp2646-2653. y Chen. Jarvis.F. isolated from multiple legume species native of Xinjiang. Muramatsu. Frühling.X. Y. S.

H..F. pp501–505. y Udell. Wang. W. pp1409-1413. Kingsley. NGR234 selected using the widely compatible legume Vigna unguiculata’.nov. vol 59: 1919 . D.T..1923. He. D. isolated from Caragana intermedia growing in saline-alkaline soils in the north of China´. pp518–526. Han. Hu. F. B. R. a symbiotic bacterium isolated from root nodules of the herbal legume Kummerowia stipulacea ‘. nov. Giraud. Williams and Wilkins. International Journal of Systematic and Evolutionary Microbiology. Saxena. Wang. A. N. A. H.L. nov. Dowling. Bena.Q. isolated from root nodules of three different legume´.. D.T. W. Sui.Y. E... Gillis. Stanley. E. S.. W. 204 Manual de biología de suelos tropicales .X. Sy. pp30123018.F. (1992) ‘Genetic diversity in Bradyrhizobium japonicum and a proposal for Bradyrhizobium elkanii sp. F.) by immunofluorescence.. Plant Molecular Biology. Wang E.. pp769–776. vol 38. (2004) ‘Methylobacterium nodulans sp. isolated from root nodules of Caragana species ‘.. (Cicer arietinum L.Y.. for a group of aerobic facultatively methylotrophic. Meyer. Lewis. E.. London. M. nov. G. Jourand. (2008) ´ Shinella kummerowiae sp. Canadian Journal of Microbiology. Y... D. nov. vol 59. pp447–459. Holt (eds) Bergey’s Manual of Systematic Bacteriology.. P. Lin.X. vol 29. (2009) ´ Mesorhizobium shangrilense sp.X. D. vol 8. y Chen. W. B.. J. vol 59.. Sui. W. J. L. Royal Botanic Gardens. y Chen. Tang. B. C. (2009)´Rhizobium mesosinicum sp. Kew.. Mackinder.. Guan. A. Wang E.L. (2009)´Rhizobium alkalisoli sp. immunodiffusion and intrinsic antibiotic resistance’. L..H.. (1983) ‘Characterization of Rhizobium sp. D. M. X. Dreyfus... L. Dénarie... Wong.X. C. Willems. y de Lajudie.T. Chen.R. legume root-nodule-forming and nitrogen fixing bacteria’. W.H. Lin. T. Nelson..Q. Li. Lewin.. B.. S. X. y Chen. D. J. y Broughton.... vol 40. Jordan. in N. International Journal of Systematic and Evolutionary Microbiology. (2005) Legumes of the world.. Schrire.. Devine.. International Journal of Systematic and Evolutionary Microbiology.. Chen. Rosenberg. Canadian Journal of Microbiology. M. y Chen. F. y Bohlool. W. T.... B. P. T. International Journal of Systematic and Evolutionary Microbiology. J.X.X. W. Manen. Krieg and J. Li.. B. C. D.. pp3006-3011.. nov.systems in Brazilian Western Amazon’. L.. Kuykendall. Hu. Han. pp2269–2273. H.T. Wang E. (1984) ‘Rhizobiaceae Conn 1938’. vol 54.F. Pesquisa agropecuária Brasileira. Wang.’. vol 58. Chen. (1987) ‘Multiple host-specificity loci of the broad host-range Rhizobium sp. G. H.X. International Journal of Systematic and Evolutionary Microbiology. y Lock.

Bekki. nov. B. J..F. Mercante. A. y Cleyet-Marel. Universidade Federal de Lavras. Segovia..R. Lima.. Brasil. F.. J. Mantelin. beans and Leucaena trees’. Argyrolobium uniflorum and Medicago sativa (Tunisia) and description of Ensifer numidicus sp. R.. Lindström.. Lotus creticus. L.. Le Roux. and Phyllobacterium brassicacearum sp.´. Martínez-Romero. Oliveira. J. A. Béna. B acterias formadoras de nódulos en leguminosas 205 . eficiência e diversidade de bactérias fixadoras de N2 que nodulam o siratro (Macroptilium atropurpureum) de solos sob diferentes usos na Amazônia Ocidental’. G. nov. Zakhia. vol 12. (2006) ´Emended description of the genus Phyllobacterium and description of four novel species associated with plant roots: Phyllobacterium bourgognense sp.. S. Bonneau. Conservation and Sustainable Management of Below-ground Biodiversity CSM-BGBD. A... y Döbereiner. E. Phyllobacterium leguminum sp... L. Merabet.. A. Fischer-Le Saux. P. International Journal of Systematic Bacteriology. Ormeno-Orrillo. M.A. Acta Amazônica.M. Llorente. S. M. F. A. PhD Thesis. y de Lajudie. P. International Journal of Systematic and Evolutionary Microbiology.S. (2009) ´Nitrogen-fixing bacteria communities occurring in soils under different uses in the Western Amazon Region as indicated by nodulation of siratro (Macroptilium atropurpureum)´ Plant and Soil. S. Rincon. a new specie nodulating Acacia angustissima (Mill. (2004) ‘Methodology for the inventory of nitrogen-fixing Leguminosae nodulating bacteria’. F. vol 60: 664 .. C. L. y Martínez-Romero. Mars. (2010) Multilocus sequence analysis of root nodule isolates from Lotus arabicus (Senegal). (1989) ‘Rhizobium galegae. vol 41. vol 30.A. Martens. Franco.. Magalhães. D. F. pp509-514. pp365–367. pp827-839.. International Journal of Systematic and Evolutionary Microbiology. Nairobi. Ferreira. P. Magalhães.M.127-145. (2007)´Ensifer mexicanus sp.M. A. PP. vol 39. Willems.674. Rogel-Hernández.S.C. vol 319. Nóbrega.S.Lima. Moreira. (2007) ‘Densidade. (1982) ´Ocurrência de nodulacão en leguminosas florestais notivas de terra firme da região de ManausAM´. Jeder.. M. Graham. K. nov. M... y Pardo.. nov.. O. F. M. E. M. Annual meeting report 4. M. vol 56. y Moreira. (1991) ‘Rhizobium tropici. S. Domergue. pp280-290. nov... Zakhia. nov´. Kenya.M. E. Phyllobacterium ifriqiyense sp. Coopman. K.) Kuntze in Mexico. R. L. pp417– 426.. Barberi. A. A. Martínez-Romero.S. C. F. a new species of legume root nodule bacteria’.. and Ensifer garamanticus sp... de Lajudie. Systematic and Applied Microbiology.. International Journal of Systematic Bacteriology. A. nov.... Minas Gerais.A. Silva. H. Sy. Mahdhi. a new species nodulating Phaseolus vulgaris L.

Marsh. (1999) ‘Sinorhizobium arboris sp.. Bogor. (2006) ‘Azorhizobium doebereinerae sp. pp1359–1368. Pitard. J.. nov. pp197–206. G. M. y Fernandez. Moreira. vol 16. L. A. (2008) ‘Bactérias fixadoras de nitrogênio que nodulam Leguminosae’. Editora.) Pers. Nick. microsymbiont of Sesbania virgata (Caz. S. F. S. Brussaard (eds) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. S.. UFLA. B. vol 40. S. and Mesorhizobium opportunistum sp. de Lajudie. Dreyfus.. in F.nov.. D. Tiwari. Silva. Canadian Journal of Microbiology. S. CAB International. vol 411. (1992) ‘Occurrence of nodulation in legume species in the Amazon region of Brazil’.org/AG/agl/agll/soilbiod/docs/manual-soil%2). Munive. (2001) ‘Nodulation of legumes by members of the b sub-class of Proteobacteri’. K. E. Lavras. M. y Pereira.. Siqueira and L.. nov. E. R. (2006) ‘Nitrogen-fixing Leguminosae nodulating bacteria’. M. nov.. T. D. New Phytologist. Systematic and Applied Microbiology.. A. B. X.. F. C. Cruz. 768pp. Gillis. M..G..G.. y Lidstrom. K.. F. pp2140-2147. (1993) ‘Characterization of rhizobia isolated from different divergence groups of tropical Leguminosae by comparative polyacrylamide gel electrophoresis of their total proteins. (1994) ‘Genotypic y phenotypic diversity of Rhizobium isolated from chickpea (Cicer arietnum L. (2002) ‘Burkholderia spp. A. J. M. vol 59. Pot. (2001) ‘Microsymbionts: rhizobia’. vol 29. S. O. 206 Manual de biología de suelos tropicales .. International Journal of Systematic and Evolutionary Microbiology. 280pp. J. M. Gillis. J. nov.)’. F.. y Bolvin-Masson. Siqueira and L. Nandasena. in F. M.. J. Faria. S. M... Moreira.W. Paulin. Nour. J. Brussaard (eds) Biodiversidade do solo em ecossistemas brasileiros. y Faria. F. isolated from leguminous trees in Sudan and Kenya’. L. Moreira. Pedrosa. Effosse.’. P. pp345–354. P. M. and Sinorhizobium kostiense sp.. F. L. A. vol 49. K. Nature. International Journal of Systematic Microbiology. Willems. vol 121. in M. O. M. isolated from Biserrula pelecinus L. M. y Franco. S. (2009) Mesorhizobium australicum sp. Moulin. G. M. M. Wallingford.Moreira. B. Beck. S. P. Martínez-Romero.. Moreira. International Centre for Research in Agroforestry.. Systematic and Applied Microbiology. T. S. Swift and D. S. Indonesia (available at http://fao. y Young. Kersters. Moreira. Moreira. O’Hara. Bignell (eds) Standard Methods for Assessment of Soil Biodiversity and Land Use Practice. in Australia´. S. O.. Memorias da XXI Reunión Latinoamericana de rhizobiologia. M. are among fast growing symbiotic diazotrophs isolated from diverse land use systems in Amazônia and from Brazilian Leguminosae forest species’. Moreira. pp135–146. Cleyet-Marel.. M. y Howieson. R. M. F. México. Moreira.. M. A... G. W. Tiedje.P. Cocoyoacan. Zhang. y Marsh.. S. pp948–950. F. Eardly. pp563–570. C. F. Suomalainen. L.

.. Applications. Plant and Soil. E. isolated from effective nodules B acterias formadoras de nódulos en leguminosas 207 . Plant and Soil. International Journal of Systematic and Evolutionary Microbiology. nodule bacteria from four Papilionoid legume trees in Costa Rica’. M. vol 45. McInroy. S. (2000) ‘Diversity of rhizobia isolated from different land use systems in Amazon region’. Yuan. (1995) ‘Genomic heterogeneity of strains nodulating chickpea (Cicer arietnum L. W. P. M. pp640–648. J.. International Journal of Systematic and Evolutionary Microbiology. leguminosarum. D. M.Nour. P. Rodríguez-Navarro. A.. (1997) ‘Characterization and classification of microbes by rep-PCR genomic fingerprinting and computer-assisted pattern analysis’.. I. J. Rhizobium phaseoli Dangeard 1926AL and Rhizobium trifolii Dangeard 1926AL. y Lee.M. S. S. M. Chen. P. trifolii is a later synonym of R. Peix. y Sprent. Gresshoff (eds) DNA Markers: Protocols. J. Pereira.. Baek. Reclassification of the strain R. I. W.. leguminosarum DSM 30132 (=NCIMB 11478) as Rhizobium pisi sp. (2008)´Revision of the taxonomic status of the species Rhizobium leguminosarum (Frank 1879) Frank 1889AL.. Z.H. W. G. Bae. W. pp334–342. y Sprent. P. L. vol 58. Systematic and Applied Microbiology..F. Valverde. Makatiani. W.N. C. J. D. and Bradyrhizobium jicamae sp. Normy. (2005) ‘Rhizobium daejeonense sp. nov. vol 173. Li... G. Zhang. pp2158-2163. A. Odee. A... y Velázquez. W. A. y de Bruijn.. Ramírez-Bahena. vol 27. Willems. T.) and description of Rhizobium mediterraneum sp. Caetano-Anollés. Quan. International Journal of Systematic and Evolutionary Microbiology. Universidade Federal de Lavras. Z. y Tan. vol 58. R.. Q. H. nov... (2008) ´Rhizobium oryzae sp.nov. pp2543–2549. M. Sutherland. Peng.. F. Igual. E. nov. Lavras.. Sutherland. nov.. E. H. pp2484-2490. y Fernandez. (2009)´ Bradyrhizobium pachyrhizi sp. (2004) ‘rRNA and dnaK relationships of Bradyrhizobium sp. J.. PhD Thesis. (1995) ‘Natural rhizobial populations and nodulation status of woody legumes growing in diverse Kenyan conditions’. Mateos.. J.. Martínez-Molina. R. E. John Wiley and Sons Inc.F.. New York. isolated from a cyanide treatment bioreactor’.’. International Journal of Systematic Bacteriology. G.H. pp211–224. nov.. Martínez-Molina. Odee. isolated from the wild rice Oryza alta´. D. Rivas.. A. García-Fraile. Kimiti.. M. J.. Peix. and Overviews. R. Cleyet-Marel. vol 188. P. (1997) ‘Phenotypic characteristics and composition of rhizobia associated with woody legumes growing in diverse Kenyan conditions’. Brazil. Ramírez-Bahena. M. Parker. y Velázquez. Rademaker. vol 55. pp65–75.. Camacho. M. and P. Rivas. M. E.. M.. J. J. D. Im. E. Mateos. in G.

. García-Benavides. International Journal of Systematic Bacteriology. Willems. which has common symbiotic genes with Sinorhizobium mexicanum´. Scholla. pp255. International Journal of Systematic Bacteriology.. E. R. (1993) ‘Reclassification of American Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp.’. Rivas.. vol 43. Mateos. A.. (1966) ‘Study of intermediates in nitrogen fixation’.nov. A... y Martínez-Romero. P. y Martínez-Romero. E. F. X. isolated from annual Medicago spp. Velázquez. Subba-Rao. Chen. Martínez-Molina. y Cleyet-Marel. P.. L. y Velázquez. W.of Pachyrhizus erosus’. K. B. S. Llorente.F. R. vol 59. S. (2002) ‘A new species of Devosia that forms a unique nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (L. E. J.. M. R. (1996) ‘Sinorhizobium medicae sp. Rivas. Gillis. Caugant. (2009)´ Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico. Dazzo. R.H. Applied and Environmental Microbiology. A.. W. L. pp873–884. Selyer... a fast-growing species that effectively nodulates soybeans’. (2004) Bradyrhizobium betae sp. y Chen. N.F.L.. D. M. E. M. y Vizcaíno. y Martinez-Molina.. J. D.. International Journal of Systematic and Evolutionary Microbiology. R.W. Fernadez. FEMS Microbiology Ecology Vol 68. F. Schollhorn. E. N. P.. N. H. F.. 208 Manual de biología de suelos tropicales . pp47–53. pp5217-5222. vol 68. (1986) ‘Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics’. N. Willems. pp1271-1275. Dazzo. C. pp374–377.f. y Elkan. N.. M. Ren.. D. vol 51. pp484–486. H. Gilmour. R. Applied and Environmental Microbiology. P. J. (2003) ‘Description of Devosia neptuniae sp. R. nov. nov. P.’.. including Sinorhizobium chiapanecum sp. J. International Journal of Systematic Bacteriology. vol 34. Gillis. E. vol 26. H. (1984) ‘Rhizobium fredii sp. a symbiotic bacterium isolated from multiple legume species´.. nov... H. G.. vol 46. E. E. Palomo. W. vol 54. Ochman. Rome. nov. pp580-586. E. D. Systematic and Applied Microbiology. isolated from roots of Beta vulgaris affected by tumour-like deformations´ International Journal of Systematic and Evolutionary Microbiology. y Whittam.T. Sui.. Proceedings of the Federation of American Societies for Experimental Biology.X. Willems. pp5217–5222.. Young. that nodulates and fix nitrogen in symbiosis with Neptunia natans. Martinez-Molina. Subba-Rao. M.. Wang. y Burris. International Journal of Systematic and Evolutionary Microbiology. M. A.. nov.. Rivas. T. P. an aquatic legume from India’.) Druce’. vol 24. Mateos.. Kroppenstedt... vol 61. p710 Segovia. Musser. Vizcaíno. R. Normy. Mateos.... Rincón-Rosales.. F. P. (2011)´Rhizobium vignae sp. pp972–980. Gillis.. Brunel. M. nov. Ponce. M.

. Struffi. P. Applied and Environmental Microbiology. International Journal of Systematic and Evolutionary Microbiology. (1998) ‘Rhizobium mongolense sp. E. E.. F. nodulating Trifolium and Lupinus in Spanish soils’. M. (2005) ‘Phylobacterium trifolii sp. (1984) ‘Avaliaçao do crescimento de rhizobium de leguminosas florestais tropicais em diferentes meios do culura’. nov. Wu. L. (2002) ‘Rhizobium sullae sp. (2003) ‘Sinorhizobium americanum sp. D. nov.’. Garcia. is one of three rhizobial genotypes identified which nodulate and form B acterias formadoras de nódulos en leguminosas 209 .. (2006) ‘Rhizobium lusitanum sp. L. A. Igual..X.. N. pp1985– 1989. E. Vizcaíno. a bacterium that nodules Phaseolus vulgaris´. B.. in Mexico’. A.. S.. Planchuelo. Bao. N. I. G. Z. nov. (2005) ‘Nodulation of Lupinus albus by strains of Ochrobactrum lupine sp. 58: pp 2871-2875. International Journal of Systematic and Evolutionary Microbiology. E. M. P. Prin.. Ludeña. W. 2631-2637. y Chen. J.J. y Velazquez. Pesquisa Agropecuária Brasileira – Ediçao Especial 19. E. a bacterium that nodulates Vicia faba.. G.Souza. Tola. W. pp1132–1136. B.. (2008) ‘Rhizobium favae sp. A. Squartini.T. pp1267–1276.G.. F.. H. P. Matínez-Molina.. vol 52. A. E.. de Lajudie. Velázquez. nov. A. F. Toledo. D. B. B. Velázquez. M. vol 55. J.F. M. Y. Boivin-Masson.. P. M. (2001) ‘Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes’. P. L. Giacomini... Joury. Wang. Campbell. A. E. W. Sy. P. R. vol 51.M. pp214–220. Abril. pp1318–1327. Döring. Willens. Reinhold-Hurek. F.... Lloret. D.T. International Journal of Systematic Bacteriology. Beyene.. L. y Nuti.. y Eardly. nov. Han. Gillis. Neyra. Valverde..F. Casella. isolated from arid and semi-arid regions in China’. Magalhaes... Systematic and Applied Microbiology. (2002) ‘The aquatic budding bacterium Blastobacter denitrificans is a nitrogen-fixing symbiont of Aeschinomene indica’. y Chen. Trujíllo. T. A.. s/n. A. Applied and Environmental Microbiology.... y Oliveira. vol 56. Willems. E. R. Mateos.. International Journal of Systematic Bacteriology. Journal of Bacteriology.G. Wang.. Van Berkum. A. International Journal of Systematic and Evolutionary Microbiology‘. X. pp.. y Martínez-Molina. vol 26.. Tian.. A. the root-nodule microsymbiont of Hedysarum coronarium L.nov. Rivas. E. C. S.nov. E. A... y Eardly. Gu. (2001) ‘Rhizobium yanglingense sp. pp54–64.. Kan. A. vol 68. a new Sinorhizobium species nodulating Acacia spp.. nov. Y. Fernández-Santos.. M. E. P. Gu. Dazzo. A. C.. P. Valverde. Cervantes. Giraud. F. y Dreyfus. vol 71.X. B..’. vol 183. pp901–914. Rivas. E. E. Van Berkum. Mateos.. X. C. y Mateos.. P... G. F. T. (formely ‘Rhizobium hedysari’). Tan.. Chen. y Martínez-Romero.. Peix. Selnska-Pobell. Vendramin.

P.. Kamfer. 1985) to the genus Bradyrhizobium as Bradyrhizobium denitrificans (comb.. International Journal of Systematic Bacteriology. pp850-855. C. nov. Systematic and Applied Microbiology. y Conye. nov. vol 54. E. H. P. Nelis. a metal-resistant symbiont of Anthyllis vulneraria growing on metallicolous soil in Languedoc. International Journal of Systematic and Evolutionary Microbiology. C. International Journal of Systematic Bacteriology vol 54.J. E. Vincent.)’. J. D. Vandamme. (1970) A Manual for the Practical Study of Root-Nodule Bacteria. Mateos. y CleyetMarel. A. LiPuma. T. Igual. R.. France´. Werner.. (2004) ‘Wautersia gen. Goris. M.. pp207–215. de Baere. Willems.. P... (2009)´Mesorhizobium metallidurans sp... pp689691. Leibold. (2004) ‘Taxonomy of the genus Cupriavidus: A tale of lost and found’. M. (Aeschynomene indica) with Blastobacter denitricans and to transfer Blastobacter denitrificans (Hirsh and Muller.. Brunel. E. Fernyez. y Verschraegen.. nov. T...) Ledebour]’. nov. de Vos. Chen. Mahenthiralingam. A.-M. nov. Chantreuil. International Journal of Systematic and Evolutionary Microbiology.. vol 51. a new genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species. J. L. Mauré.. P. Gillis. C.. (2002) ‘Burkholderia tuberum sp. nov. A. Toro. A. Willems. vol 25. nov.C... M. Systematic and Applied Microbiology. Van Berkum. J. Coenye. P. Velazquez..nitrogen fixing symbioses with Medicago ruthenica [(L. y Vandamme. y Eardly.. P. International Journal of Systematic and Evolutionary Microbiology.. K. vol 54. E.’. pp317–327. vol 59. E. D.. M. nodulate the roots of tropical legumes’. pp507–512. y Willems. y Martínez-Romero. nov. vol 29.J. pp13–22. B. Béna.. pp1011–1021... P. Berge. Vaneechoutte. a novel species that nodulates Prosopis alba in the Chaco Arido region (Argentina)’.. Vermis. Blackwell Scientific Publications.. E. M.. B. Vidal. (2005a) ‘Bradyrhizobium canariense sp.. Léon-Barrios.. W. (2004) Proposal to accommodate Burkholderia cepacia genomovar VI as Burkholderia dolosa sp. Oxford. 1990) comb. Cervantes. A... International Journal of Systematic and Evolutionary Microbiology. P. N.. an acid tolerant endosymbiont that nodulates endemic genistoid legumes 210 Manual de biología de suelos tropicales . nov. Munoz. Vinuesa. J. (2001) ‘Mesorhizobium chacoense sp. y Martinez-Molina. Escarré. pp2285–2289.. and Burkholderia phymatum sp. J. Pérez-Galdona. Normy. O. G. M. T. (2006) ‘Proposal for combining Bradyrhizobium spp. M. P. sp. Abril. G. P. M. Vandamme. F. J.. Silva. J... Falsen. vol 48. Jarabo-Lorenzo. nov. and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al.

nov. H. International Journal of Systematic Microbiology. Wang. Y. y Martínez-Romero. van Berkum.. Cevallos. Willems. Tan. Chen. G. X. S. Wang. International Journal of Systematic Bacteriology. vol 53. (2007)´Mesorhizobium albiziae sp. pp51–65. X.. M. Martínez-Romero... T.. vol 49. a Leucena leucocephala-associated bacterium that is highly resistant to multiple antibiotics’. Wang. (1998) ‘Rhizobium huautlense sp. Wang. y Chen. Wei. International Journal of Systematic Bacteriology.. genistearum. International Journal of Systematic and Evolutionary Microbiology. T.. W. T. pp1479–1491. (1999a) ‘Rhizobium etli bv. E. D. P. International Journal of Systematic and Evolutionary Microbiology. Q. P. G. pp1192-1199. Beyene.. E.. E. Chen. and Sinorhizobium kummerowieae sp. A. (2003) ‘Characterization of rhizobia isolated from legume species within the genera Astragalus and Lespedeza grown in Loess Plateau region of China and description of Rhizobium loessense sp. X. G. M. pp569–575. vol 57. M. International Journal of Systematic and Evolutionary Microbiology. y Chen.. Z. vol 52. A. vol 52. M. Wang. (2002) ‘Sinorhizobium morelense sp.. Wang. X.. W.. Rinhold-Hurek.. y Martínez-Romero. Fernández-López. T. along with Bradyrhizobium japonicum bv. and Kummerowia stipulacea’. Z. nov.. D. respectively isolated from Indigofera spp. A. W. T.. Werner.. Dorado. pp29–54. F.. W. H. Zhu.’. E. W.. X. Han. International Journal of Systematic and Evolutionary Microbiology. Santos. Chen.. Wang. H. nov. T. nov’. E. (2005b) ‘Population genetics and phylogentic inference in bacterial molecular systematics: The roles of migration and recombination in Bradyrhizobium species cohesion and delineation’. C. van Berkum. E. a novel bacterium that nodulates Albizia kalkora in a subtropical region of China´.. (2002) ‘Rhizobium indigoferae sp.Q. E. E. Silva. pp687–699. P. W.. Rogel-Hernández. E. Liu.. E.. y Martínez-Romero. T. A. H. O. Wei. Chen. pp2231–2239. a novel biovar isolated from Mimosa affinis’..F.. nov. a symbiont of Sesbania herbacea that has a close phylogenetic relationship with Rhizobium galegae’. Molecular Phylogenetics and Evolution.. D... X. Beyene. Sui. y MartínezRomero..T.. nov.. Tan. X. y Chen. Zhu.H. E.. (1999b) ‘Diversity of rhizobia associated with Amorpha fruticosa isolated from Chinese soils and description of Mesorhizobium amorphae sp.. Wang. B. Wang. nov. mimosae. E. Sui. J. Bradyrhizobium genospecies a and Bradyrhizobium genospecies b’..X. vol 48. E. vol 49. vol 55. J. pp1687–1693. Vinuesa. International Journal of Systematic Bacteriology.(Papilionoideae:Genisteae) from Canary Islands. E. pp1575–1583 B acterias formadoras de nódulos en leguminosas 211 . M. Sui. vol 34.. y MartínezRomero. E. E.

.... isolated from the root nodules of soybeans’. nov. vol 53. Young. X. pp1942–1946. (1988b) ‘Reliability of the most-probable technique for enumerating rhizobia in tropical soils’. Applied and Environmental Microbiology. M. nov. Y. P... Woomer. W. y Green.. (2003) ‘The genus name Ensifer Casida 1982 takes priority over Sinorhizobium Chen et al 1988 and Sinorhizobium morelense Wang et al 2002 is a junior synonym of Ensifer adhaerens Casida 1982..’. vol 54. MartínezRomero. Wallingford. Z. N. (2002) ‘Characterization of rhizobia that nodulate legume species within the genus Lespedeza and description of Bradyrhizobium yuanmigense sp. nov. E. (1988a) ‘Ecological indicators of native rhizobia in tropical soils’. M. S. L. J.. T. Ge. P. y Chen.. B. Singleton. vol 45. Z. CAB International. Singleton. vol 54. I.. pp706–711. E.. vol 52. C. Wilson. (2003) ‘Description of new Ensifer strains from nodules and proposal transfer Ensifer adhaerens Cassida 1982 to Sinorhizobium as Sinorhizobium adhaerens comb. pp1494–1497. Kan. Young. H. Cui. Fernández-Lopez. vol 82. Yerson and J. Woomer. (1990) ‘Agroclimatology and modeling – overcoming the inflexibility of most-probable-number procedures’. J. Muñoz-Adelantado. L. R. pp2219–2230. Blitchngton.. Request for an opinion’. (1993) ‘Most Probable Number Counts of Rhizobia in Soils’. (1990) ‘Amplification of bacterial 16S ribossomal DNA with polymerase chain reaction’. P. y Bohlool. pp172–178. C. International Journal of Systematic Bacteriology. vol 54 pp149. Is the combination “Sinorhizobium adhaerens” (Casida 1982) Willems et al 2002 legitimate? Request for an opinion’. in J. nov. E. Wang. P.. R. Xu. International Journal of Systematic and Evolutionary Microbiology. A. B. B. Yao. pp1112– 1116. Applied and Environmental Microbiology. M. Agronomy Journal. y Yost. M. W. J. Toro. y Bohlool. Vos. 212 Manual de biología de suelos tropicales . H. y Gillis. M. F. P. R. pp2107–2110. W. K. International Journal of Systematic and Evolutionary Microbiology. Ingram (eds) Tropical Soil Biology and Fertility: A Handbook of Methods.. pp349–353. P. B. Bennet.Willems. y Fan. (1995) ‘Bradyrhizobium liaoningense sp. International Journal of Systematic Bacteriology. pp1207–1217. vol 28..´ International Journal of Systematic Evolutionary Microbiology. P. M. vol 53. Li. Woomer. J. B. Woomer. Goris. J. Journal of Clinical Microbiology. (2004) Renaming of Agrobacterium larrymoorei Bouzar and Jones 2001 as Rhizobium larrymoorei (Bouzar and Jones 2001) comb.

A. R.J. y Velázquez.. pp87–94. undicola and R. J.. Kuykendall. Martínez-Romero. rhizogenes. vol 51. New Phytologist.... Kerr. Hou. (2007)´Ochrobactrum cytisi sp.. rubi. W. Palomares. M. P. Zhang. M. Zurdo-Piñeiro. nov. and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. B acterias formadoras de nódulos en leguminosas 213 . R. 1998 as new combinations: Rhizobium radiobacter. J. D. Martínez-Molina.. R. H.. vol 57. vol 61.. E. vitis’. Wang.. Young J. B. E. isolated from root nodules of Oxytropis glabra´International Journal of Systematic Evolutionary Microbiology. y Sawada.T. pp89–103. K. Li. A.. (2001) ‘A revision of Rhizobium Frank 1889. . y Chen.X.. Trujillo. Chamber.. R.X. W. L.L. International Journal of Systematic Evolutionary Microbiology. M..E. E. J.Young.vol 133. E. Zhang. pp512-517. with an emended description of the genus. E.F.. Y. Mateos. y Haukka. nov. Vizcaíno.. Rivas. R.C. (2011)´Rhizobium tubonense sp. P. Carrasco. isolated from nodules of Cytisus scoparius in Spain´ International Journal of Systematic Evolutionary Microbiology. pp784-788. A. X. (1996) ‘Diversity and phylogeny of rhizobia’. N..

K2HPO4 (10%) (o 0. 214 Manual de biología de suelos tropicales . 1928) (similar a medio YMA – Vincent.75g Agar Autoclave a 120°C durante 15 minutos. Medio sólido: 15g Agar Medio semisólido: 1. KH2PO4 (10%) (o 0. 0.8–7. 1970): 10g manitol o sacarosa 1ml sol. Cuando pH <5.0.0 se reemplaza azul por Azul de Bromotimol por Verde de Bromocresol y se aumenta agar hasta 20 gl–1.5% azul de bromotimol en 0. para hacer 1000 ml con agua destilada pH 6.1 Composición de medio 79 para el crecimiento de Bfn Medio 79 (Fred y Waksman.4 gl–1) 2ml sol.1 gl–1) 100ml extracto de levadura (o polvo 0.1 gl–1) 4ml sol.2 N KOH. NaCl (10%) (o 0. 7H2O (10%) (o 0.2 gl–1) 1ml sol. MgSO4.4 gl–1) 5ml sol.APÉNDICE 6.

..7.... 2... También después se usa la solución con sirato en bolsas de plástico. 0. Diluir solución a 1:4..... es decir. las concentraciones más altas (>0. Vicent (1970) recomienda la mezcla para una solución de nutrientes.... por lo tanto..... entonces la concentración puede aumentar o hacer una suplementación dividida. los controles nitrogenados no presentan nódulos......7% KNO3) pueden ser tóxicas. Si al final del experimento esto resulta insuficiente para el crecimiento sostenido y el color verde de las plantas control.03 g ZnSO4.2 Solución de nutrientes Jensen’s para el crecimiento de espe- cies de leguminosas en bolsas de plástico y jarras de Leonard Componentes K2HPO4 (2%) MgSO4.....7H2O .... Normalmente. ajustar con KOH. * Solución de micronutrientes (para 1 l de agua). diluida de la misma manera.05% KN03 o NH4 NO3)...86 g MnSO4.APÉNDICE 6.... pues las dosis elevadas inhiben la nodulacíon.......... o entre 7 a 10 días después de plantar.. Esto puede añadirse a la solución de nutrientes al principio del experimento........000 ml pH = 6.....22 g CuSO4.. Control Se proveen los controles con nitrógeno a una concentración final de aproximadamente 70 ppm N (0. Sin embargo. 0....6H2O 1...7H2O (2%) NaCl (2%) CaHPO4(10%) FeCl3..09 g El mismo protocolo que para agar con semillitas. sin inoculación del suelo B acterias formadoras de nódulos en leguminosas 215 . 2.. H3BO3 ..7 % o FeCl3 1% Solución de micronutrientes* Agua destilada (completar a) Volumen 10 ml 10 ml 10 ml 10 ml 10 ml 1 ml 1.......08 g Na2MoO4.. 0...5H2O ...H2O .4H2O ....... los controles absolutos.

Si existe la disponibilidad de las cepas recomendadas. es el uso de una cepa eficiente como un control positivo para la nodulación y la fijación de nitrógeno. éstas deberán utilizarse. 216 Manual de biología de suelos tropicales . Otro control importante.son necesarios para comprobar las condiciones asépticas del experimento. no mencionado por Vincent.

patógenos de la raíz. La conversión de estos dos ecosistemas en agro-ecosistemas ya sea para agricultura de subsistencia. 1990. salinas y sistemas manejados como praderas. altas temperaturas. 1991). 1981. Los HMA han sido registrados en ecosistemas naturales como desiertos. la agricultura se practica en áreas previamente ocupadas por dos principales ecosistemas naturales ricos en especies vegetales: bosques tropicales y sabanas. se encuentra bien documentado que los hongos micorrizógenos arbusculares (HMA) mejoran la salud y el crecimiento de las plantas de importancia agrícola.. cobre y zinc. 1995). sequía. En la mayoría de los suelos tropicales. Bagyaraj. pH desfavorable del suelo y al choque por trasplante que sufren las plantas no micorrizadas (Mosse et al. provee una mayor superficie de absorción que los pelos radiculares y. Bagyaraj y Sidney L. por lo tanto. se ha demostrado que las plantas micorrizadas tienen mayor tolerancia a metales tóxicos. dunas de arena. Bagyaraj and Varma. salinidad. aumenta significativamente la captación de iones relativamente inmóviles. La red de hifas producidas por los HMA en el suelo durante su asociación con la planta huésped. En los trópicos. el fósforo disponible es muy bajo. tales como fosfato.Capítulo 7 Hongos micorrizógenos arbusculares (HMA) Joseph D. Además. huertos y cultivos agrícolas (Brundrett. Stürmer INTRODUCCIÓN Actualmente. selvas tropicales. hortícola y forestal. producción de cultivos redituables o plantaciones forestales industriales provoca cambios en las características quí217 . esto limita el desarrollo de las plantas.

También notaron un cambio en la composición de especies. por lo general. pastizales (Bever et al. físicas y biológicas del ambiente edáfico. 218 Manual de biología de suelos tropicales . especialmente de los géneros Glomus y Gigaspora. sin embargo. No obstante. 1985). Picone (2000) demostró que la densidad de esporas y la comunidad fúngica disponible para la formación de micorrizas eran relativamente similares entre praderas y bosque tropical lluvioso. 1989) son también adecuadas. Mason et al. 1996). se eliminan muchas especies vegetales de todas las edades y. La infectividad micorrízica se determina fácilmente por el método del número más probable (NMP) y puede servir para propósitos comparativos (Porter. Las macetas trampa preparadas con suelo de campo han sido usadas exitosamente para detectar y recobrar especies crípticas durante estudios de diversidad en huertos de manzano en regiones templadas (Miller et al. De igual forma.micas. La medición del porcentaje de colonización (PC) (Moorman y Reeves. como los hongos dominantes.. La conversión de los ecosistemas naturales para distintos usos de suelo influye en la abundancia de esporas y composición de especies de HMA. En estos sitios. se siembran con una sola especie de la misma edad. en donde se detectaron 28 morfotipos de HMA con Glomus aggregatum y dos especies de Glomus no descritas. 1979) y la determinación de las unidades de colonización (UC) (Franson y Benthlenfalvay. usualmente. Aunque comúnmente no es reportado. (1987) observaron un descenso en el número de esporas y un cambio en la composición de especies después del disturbio en algunos lugares de Australia. Asimismo. a través de una cuenta directa y de la identificación de esporas recuperadas del campo. Jasper et al. La medición de la diversidad taxonómica de HMA se ha hecho. Johnson y Wedin (1997). generalmente. estas determinaciones no detectan a las especies crípticas de HMA que no están esporulando en el momento del muestreo (pero que están asociadas con las plantas hospederas) e impiden la adecuada identificación de algunas especies. las medidas de diversidad taxonómica deberían estar acompañadas de algunas evaluaciones de la actividad de la comunidad micorrízica.. (1992) encontraron que el número de esporas de HMA en una plantación de Terminalia ivoriensis en Camerún disminuyó notablemente después de tres meses de una desforestación. 1979). encontraron una riqueza similar de especies en la selva tropical seca y en praderas con dominio de una especie. 1996) y también en desiertos (Stutz and Morton.

TAXONOMÍA Y CLASIFICACIÓN DE HMA Debe establecerse un esquema taxonómico antes de cualquier estudio de diversidad. Por lo tanto. Morton y Benny (1990) transfirieron todas las especies de HMA al orden Glomerales (División Zygomycota) con tres familias y seis géneros. 2000) y para erigir dos nuevos géneros en dos familias distintas (Morton and Redecker. Gerdemann y Trappe (1974) incluyeron todas las especies de HMA dentro del orden Endogonales en la familia Endogonaceae (División Zygomycota). (2001) transfirieron todas las especies de HMA a una nueva división monofilética: Glomeromycota. con aquellos de Morton y Redecker (2001) y Schüßler et al. Se basa en una serie de diluciones decimales H ongos micorrizógenos arbusculares 219 .. La formación de esporas en este género es similar a la de Glomus pero éste diferencia paredes germinales internas. También incluyeron en el Nuevo esquema de clasificación tres nuevos órdenes y varias familias. Aunque se han aplicado técnicas moleculares para aclarar la clasificación filogenética entre las especies de HMA. MÉTODOS PARA EVALUAR PROPÁGULOS INFECTIVOS DE HMA Y COLONIZACIÓN MICORRÍZICA Número más probable (NMP) El protocolo propuesto para estimar la diversidad de HMA (descrito en el Capítulo 2) es el mismo que se sigue para todos los microorganismos y no será discutido aquí. (2001) (Tabla 7. (2001). La taxonomía y clasificación de los hongos micorrizógenos han cambiado radicalmente en los últimos años.. colocando a este grupo de hongos en el mismo nivel que Basidiomycota y Ascomycota. Redecker et al. 1990. Este género es incluido en el orden Diversisporales en la filogenia molecular propuesta por Schüßler et al. especialmente.1). Datos moleculares y morfológicos fueron usados para transferir a los miembros del género Sclerocystis a Glomus (Almeida y Schenck. El método del Número Más Probable se ha utilizado para estimar el número de propágulos infectivos de HMA en varios suelos. Schüßler et al. un género nuevo llamado Pacispora fue propuesto por Oehl y Sieverding (2004). la identificación de especies está basada principalmente en las características morfológicas de las esporas. se propone un esquema de clasificación para estudios de diversidad que surge de los esquemas de Morton y Benny (1990). 2001). cuando se requieren comparaciones entre los sistemas de uso de suelo.. Recientemente.

La micorriza se tiñe muy obscuro. Germinación a través de una estructura de germinación esférica. conectada a una hifa ramificada. Los arbúsculos e hifas intrarradicales se tiñen débilmente. Hifas intrarradicales rectas o enrolladas cerca de los puntos de entrada. División Glomeromycota Schüßler. plana. La pared de la espora esta formada por tres o cuatro capas y no se forma una verdadera bicapa germina. Berch (31 especies) Esporas formadas a los lados del cuello de un sáculo esporífero el cual deja una cicatriz en la superficie de la espora. Arbúsculos con troncos aplanados o cilindricos adelgazándose sucesivamente en las ramificaciones. Familia Archaeosporaceae Morton y Redecker Archaeospora Morton y Redecker (una especie) Esporas formadas terminalmente de una hifa de sostén o como una ramificación de una estructura que semeja un sáculo esporífero. solitarias. Esporas con la pared esporal formada por dos capas. Se presentan especies dimórficas formando esporas acaulosporoides y glomoides. Vesículas de pared delgada y elipsoides. en agregados laxos o en esporocarpos. 220 Manual de biología de suelos tropicales . Esporas con la pared esporal formada por un número variable de capas todas originadas a partir de la hifa de sostén. La pared germinal más interna tiene una superficie con excrecencias. Otras estructuras subcelulares de la espora y germinación idéntica a la de Acaulospora. y Trappe emend. Las vesículas y células auxiliares no están diferenciadas. Entrophospora Ames y Schneider (cinco especies) Esporas formadas dentro de un cuello de un sáculo esporífero el cual deja dos cicatrices sobre la superficie de la espora. Familia Acaulosporaceae Morton y Benny Acaulospora Gerd. Scharzott y Walker Orden Glomerales Morton y Benny Suborden Glomineae Morton y Benny Familia Glomeraceae Pirozysnki y Dalpé Glomus Tulasne y Tulasne (85 especies) Esporas formadas blásticamente sobre una hifa de sostén. No se observan paredes germinales diferenciadas. Germinación a través del lumen de la hifa de sostén o a través de la pared de la espora. flexible. arbúsculos. hifas intrarradicales y micorriza se tiñen como en Acaulospora.1 Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales. Hifas intrarradicales raramente enrolladas. La micorriza se tiñe débilmente. Las vesículas varían en forma con protuberancias y concavidades. Vesículas.Tabla 7.

La segunda capa de la pared germinal generalmente reacciona con el reactivo de Melzer. Scutellospora Walker y Sanders (30 especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. Las vesículas y células auxiliares no están diferenciadas. Esporas con la pared esporal formada por dos capas permanentes. cerca de los puntos de entrada. Esporos glomoides de forma aislada en el suelo o agregados en racimos. Familia Paraglomeraceae Morton and Redecker Paraglomus Morton y Redecker (dos especies) Esporas formadas terminalmente de una hifa de sostén como en Glomus. Arbúsculos con troncos hinchados angostándose abruptamente en las ramificaciones. Germinación de la espora directamente de la pared germinal a través de la pared de la espora. a menudo nodosas o con proyecciones. Pared de la espora generalmente formada por tres capas distintas y la pared germinal compuesta también por tres capas. Familia Pacisporaceae Walker. Esporos acaulosporoide formado un apéndice hifal emergiendo lateralmente del cuello de un sáculo esporífero. y germinan atreves de hifa suspensora. Vestberg & Schüßler Ambispora Walter. células auxiliares finamente papiladas o equinuladas. Schüßler y Schwarzott Pacispora Sieverding y Oehl (siete species) Esporas formadas terminalmente de una hifa de sostén (como en Glomus). no se diferencian paredes germinales. No se forman vesículas. especialmente. Las paredes de la hifa de sostén son continuas con la primera y segunda capa de la pared esporal. Suborden Gigasporineae Morton y Benny Familia Gigasporaceae Morton y Benny Gigaspora Gerd. Blaszkowski.1 Continúa Familia Ambisporaceae Walter. Al germinar. Vesículas y arbúsculos las raíces teñidas en azul franco con azul tripano. Los arbúsculos y las hifas intrarradicales se tiñen débilmente. se diferencia una capa delgada con verrugas esparcidas y crece un tubo germinativo a través de la pared esporal. No se forman vesículas. y Trappe (cinco especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. Arbúsculos e hifas intrarradicales similares en morfología a las de H ongos micorrizógenos arbusculares 221 . Las estructuras subcelulares de la espora y la germinación como en Glomus. Hifas intrarradicales frecuentemente enrolladas. células auxiliaries que van de casi lisas a nodosas.Tabla 7. Vestberg & Schüßler (ocho especies) Especies generalmente dimórficas con asociaciones micorrizicas produciendo morfotipos acaulosporoide y glomoides.

que se diferencia sobre la superficie de la última pared germinal. pero el número calculado tiene hasta un 95 por ciento del nivel de confianza (Adelman y Morton. Sin embargo. Fuente: compilado de Morton y Benny. La ventaja es que. Si no contamos con semillas de cebolla. el método es apropiado para comparaciones entre sistemas con diferente uso del suelo si los ensayos del NMP se establecen de forma simultánea. como el sorgo y el Paspalum.edu. 222 Manual de biología de suelos tropicales . basándose en una tabla estadística. cada una con dos capas. Una de las desventajas de esta prueba es que se requiere mucho tiempo para la preparación del bioensayo. si tiene cierta dependencia micorrízica. La planta hospedera recomendada para el ensayo del NMP es la cebolla. Oehl y Sieverding. Spain et al. de suelo en donde la presencia o ausencia de colonización micorrízica se registra y da como resultado el número más probable de propágulos infectivos. 1986).5 cm) y gradillas bolsas de plástico (30 X 20 cm) diluyente esterilizado (arena: mezcla de suelo 1:1) semillas de cebolla. ya que es dependiente de la micorriza y las raíces son fáciles de teñir.Tabla 7. El tubo de germinación crece a partir de un escudo flexible plano.1 Continúa Gigaspora. y puede llevarse a cabo por cualquiera que esté familiarizado con la morfología de la micorriza.wvu. el análisis de las raíces de las plantas trampa para comprobar la colonización es fácil y rápido. Esporas con una pared formada por dos capas permanentes y de una a tres paredes germinales internas. Materiales necesarios • • • • tubetes para plantas (150 X 2. 2004. 1990. Como el resultado es un solo número. 2006 y http://invam..caf. se pueden utilizar gramíneas C4. se puede utilizar cualquier otro hospedero.

lavar el suelo de las raíces y teñirlas con azul de tripán (véase más abajo). Supongamos que. Esto significa que las cinco réplicas fueron positivas para la colonización micorrízica en las diluciones 10-1 y 10-2. Después de emerger. si es necesario). Para el cálculo del NMP. Agitar bien para obtener una dilución decimal. Al cosechar. determinar la presencia o ausencia de colonización micorrízica en cada réplica. 10-3 y 10-4). considerando las cinco réplicas (tubetes) para cada una de los cuatro diluciones (10-1. En este ejemplo. tres réplicas fueron positivas en la dilución 10-3 y dos réplicas fueron positivas en la dilución 10-4. dejar una sola planta por tubete y dejarlas crecer en un invernadero o en una cámara de crecimiento durante seis semanas. 2. Los otros dos números (N2 y N3) son los correspondientes a las próximas dos diluciones. 5. El procedimiento para el cálculo del NMP. se obtiene la siguiente secuencia de números de tubetes positivos: 5. 5. hacer cinco replicas por cada dilución. Bajo un microscopio de disección. N2 = 3 y N3 = 2. 3. se ilustra con el siguiente ejemplo. la combinación sería: N1 = 5. Sembrar las semillas de cebolla en cada tubete. si no se dispone de las semillas de cebolla puede utilizar cualquier otro hospedero (ver arriba).Procedimiento 1. El número de tubetes positivos (los que contienen colonización) en diluciones diferentes se utilizan para calcular los valores de NMP. 4. 7. 3. si el número de tubetes positivos es el mismo en diluciones posteriores). 2. Utilice las tablas de Cochran (1950). hacer más diluciones decimales hasta la dilución 10-4 (o más. Distribuir el suelo de cada dilución en los tubetes para plantas. de Fisher y Yates (1963) o Alexander (1965). 6. El primer número (N1) corresponde al número de tubetes positivos para la colonización micorrízica en la dilución que muestra el mayor número de tubetes positivos (se toma la serie menos concentrada. 10-2. Retirar 30 g de la dilución anterior y colocarlo en otra bolsa que contiene 270 g del diluyente estéril. Agitar bien para obtener una dilución 10-1. sólo tres números de una secuencia dada son necesarios. Pesar 30 g de suelo de campo en una bolsa de plástico y añadirle 270 g del diluyente esterilizado. H ongos micorrizógenos arbusculares 223 .

para detectar y medir la colonización micorrízica. las raíces son sometidas a un procedimiento de clareo y tinción. Materiales necesarios • solución de KOH al 10% (hidróxido de potasio) • solución de HCl al 1% (ácido clorhídrico) • solución acidificada de glicerol.4 X 10-3 propágulos infectivos g–1. 450 ml de H2O. el suelo tiene 1. Procedimiento 1. (en este caso 10-3). Tinción de raíces para observar la colonización micorrízica La colonización de las células corticales de la raíz por HMA.5 g/l) • H2O2 alcalinizada (3 ml NH4OH al 20%. Por lo tanto.Usando la tabla del NMP el valor dado para esta combinación de tubetes positivos es 1. Kormanik y McGraw (1982) eliminan el fenol en las soluciones para tinción y decoloración.05 % en solución de glicerol (0. Teniendo en cuenta el costo de los productos químicos y el ahorro al reducir el número de productos químicos sin interferir con la calidad de la tinción. Para obtener el NMP de propágulos infectivos de HMA en la muestra.4. no altera la morfología de la raíz. se propone para la tinción de raíces el método de Philips y Hayman (1970) modificado por Koske y Gemma (1989). 50 ml de de HCl al 1%) • azul de tripano 0. 30 ml de H2O2 al 3%. Lavar las raíces para eliminar residuos de suelo y enjuagar con varios cambios de agua. El método más ampliamente utilizado es el descrito por Philips y Hayman (1970). (500 ml de glicerol. Sumergir las raíces en KOH a 90°C por una hora o a 120°C por 15 minutos en autoclave. Por lo tanto. mientras que Koske y Gemma (1989) modificaron el procedimiento mediante la eliminación de ácido láctico de estas soluciones sin interferir con la intensidad de la tinción. 2. 567ml de agua). en contraste con las asociaciones ectomicorrízicas. 224 Manual de biología de suelos tropicales . este valor debe de ser multiplicado por la dilución media.

Tiña las raíces en una solución de glicerol ácido con azul de tripano a 90°C por una hora o a 120 °C por cinco minutos. 1980) que se presenta a continuación. Material necesario • Cajas de Petri cuadriculadas en la base con cuadrados de 1. Para los pasos 2 y 7. H ongos micorrizógenos arbusculares 225 . Descargue la solución colorante y mantenga las raíces en glicerol acidificado (sin azul de tripano) o agua a temperatura ambiente o 4°C. la solución de agua oxigenada alcalinizada debe de prepararse justo antes de su uso. Medición de la colonización micorrízica La determinación de la colonización micorrízica de la raíz. Sumerga las raíces en HCL al 1% por cinco minutos. crecidas bajo condiciones del invernadero. Eliminar el KOH y enjuagar las raíces con agua (dos o tres veces) para quitar el exceso de KOH.1 cm. Comentarios: si lo desea. Enjuagar nuevamente las raíces con agua. 8. las raíces pueden guardarse en agua adicionada con unas gotas de azida de sodio al 0.01%. El paso 4 puede ser omitido si las raíces no están muy pigmentadas.3. El método de intersección de cuadrante (Giovannetti y Mosse. Para almacenar por un tiempo largo. Si las raíces están demasiado pigmentadas se deben sumergir en agua oxigenada alcalinizada durante 10-30 minutos. 6. Esta medida estima el crecimiento de un aislamiento de un hongo o de una comunidad fúngica dentro de la corteza de la raíz. es usado comúnmente para medir la longitud de la raíz y el porcentaje de la colonización micorrízica. • Agujas de disección. 7. un baño de agua a 90°C es apropiado para mantener las muestras. Elimine el HCl. 40ml de glicerol y 40 ml de agua destilada). la solución de glicerol acidificada puede ser reemplazada por una solución de lactoglicerol (20 ml de ácido láctico. No enjuague las raíces en esta paso ya que éstas deben estar acidificadas para una tinción adecuada. 5.1 x 1. 4. se realiza con frecuencia en raíces colectadas de campo (sacadas directamente del suelo o de plantas individuales) o en plantas experimentales.

1963). 2. La morfología del micelio interno y externo durante la asociación micorrízica es prácticamente indistinguible entre las especies del mismo género y entre géneros. Calcule el porcentaje de colonización micorrízica (% CM) utilizando la siguiente fórmula: % CM = (Número total de intersecciones con raíces micorrizadas/ Número total de intersecciones entre la raíz y las líneas de la cuadrícula) X 100. usando la relación entre el peso seco de la planta y la submuestra. con las líneas de la cuadricula separadas en 1. Registre: a) el número total de intersecciones de las raíces y las líneas de la cuadricula y b) el número de intersecciones con raíces micorrizadas. 1995). 3. se teñirá y se medirá en el microscopio con este método. Es posible calcular la longitud total de la raíz y la longitud de la raíz micorrízada de la planta completa. Bajo el microscopio de disección explore las líneas horizontales y verticales de la cuadrícula.1 cm. el número total de raíces que interceptan las líneas de la cuadricula.htm.Procedimiento 1. seguido por centrifugación en un gradiente de sacarosa. Las esporas se extraen del suelo mediante un tamizado húmedo (Gerdemann y Nicolson. 4.. Métodos para evaluar la diversidad de HMA Extracción de esporas del campo La Identificación de las especies de HMA está basada en el análisis de estructuras subcelulares de las esporas asexuales. En una caja de Petri extienda al azar las raíces teñidas.edu/ methods/mycorrhizae/rootlengths. En contraste. las estructuras subcelulares de las esporas están altamente conservadas y son fenotípicamente estables independientemente del ambiente y la planta huésped (Morton et al. el total de la longitud de la raíz micorrizada será el número de intersecciones. con estructuras micorrízicas. De esta manera. Por lo tanto. 226 Manual de biología de suelos tropicales . Si toda la raíz se extiende en la caja de Petri.caf. Comentarios: los datos obtenidos en el paso 3. Si se toma una muestra pequeña de toda la raíz. las esporas son la única parte del organismo del hongo que puede utilizarse para delimitar las especies. representan la longitud total de la raíz en cm. también se pueden utilizar para determinar las longitudes tanto de la raíz completa como de la raíz micorrizada. Para más detalles ver http://invam.wvu.

vidrio de reloj. • El porcentaje de colonización micorrízica= (12/43) x 100=27. el numero de intersecciones entre una raíz y las líneas horizontales y verticales tendríamos: • 25 intersecciones (Línea horizontal) • 18 intersecciones (Línea vertical) y • 12 intersecciones (Puntos negros) presentando colonización micorrizica. cajas de Petri. En el diagrama las infecciones de micorrizas son representadas con puntos negros. • Tubos para centrífuga y centrífuga. el largo de la raíz = 43 cm (25 + 18) y el largo de la raíz micorrizada=12 cm (Seis intersecciones positivas sobre líneas horizontales y seis intersecciones positivas sobre líneas verticales).9%.1 provee una ilustración del método de intersección de línea.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea.Figura 7. Figura 7. • Vasos de precipitados. después de expander las raíces. • Soluciones de sacarosa (20 % y 60%). • Por lo tanto. Materiales necesarios • Un juego de tamices anidados que tengan al menos 710 µm y 45 µm de abertura de malla. • Cubeta de plástico o un vaso de precipitados grande. Ejemplo. H ongos micorrizógenos arbusculares 227 . Nota.

Centrifugue a 2. Para preparar el gradiente de la sacarosa. Transferir las esporas y el material retenido en el tamiz 45 µm a una caja de Petri y bajo el microscopio colecte las esporas en un vidrio de reloj limpio. al menos. 228 Manual de biología de suelos tropicales . después transfiera este material a un tubo de centrífuga que contenga un gradiente de sacarosa de 20–60%. En este momento. Vacíe el sobrenadante en el tamiz de 45 µm y lave con agua corriente para quitar el exceso de sacarosa. las esporas se pueden separar por morfotipos de acuerdo con su color y tamaño y si las esporas están en buen estado se pueden identificar hasta género y especie. agregue otros 15 ml de la solución al 60% . 6. se pueden anidar otros tamices entre los dos recomendados. 8. ya que el tamaño de las esporas de HMA para la mayoría de las especies está en un intervalo de 40 a 600 μm. 3. Los tamices recomendados (con mallas de 710 µm y 45 µm) son adecuados para recuperar la mayoría de especies. es preferible vaciar la suspensión de suelo a través de un tamiz de 1 mm antes de pasar por el tamiz de 710 μm. 5. en el fondo. Coloque el material retenido en el tamiz de 45 µm en una vaso de precipitados con una pequeña cantidad de agua. 4. se puede agregar una pequeña cantidad de pirofosfato de sodio a 0. si hay demasiados pedazos de raíz y otros desechos. Sin embargo. 7. Comentarios: en el paso 3. 1979) para dispersar las partículas de arcilla y liberar las aberturas del tamiz. 2.Procedimiento 1. Las esporas pueden separarse de los residuos orgánicos y recogerse de la caja de Petri usando unas pinzas finas o una pipeta Pasteur adelgazada en la punta. agregue 15 ml de la solución de sacarosa al 20% en un tubo de centrífuga de 50 ml y después. comprada en el supermercado. Agitar hasta que las esporas queden suspendidas y dejar reposar 30 segundos . Esto separa a las esporas por tamaños pero incrementa la cantidad de trabajo ya que el material retenido en cada tamiz debe centrifugarse por separado. 500 ml de agua. Los suelos con alto contenido de arcilla pueden obstruir los tamices. Coloque el material retenido en el tamiz de 710 µm en una caja de Petri grande y observe bajo el microscopio de disección para observar esporas grandes (esporas de Gigaspora y Scutellospora) y esporocarpos. Pasar la suspensión repetidamente a través de dos tamices anidados con abertura de malla de 710 µm y 45 µm. La solución de sacarosa se hace con azúcar comercial. Colocar 100 g de la muestra de suelo en la cubeta /vaso de precipitados y suspender en.000 rpm durante 60 segundos.1M (Fogel y Hunt.

b. café. de 160 especies de HMA descritas en total. 2. El manual de Schenck y Pérez es una copia de las descripciones originales de las especies y por lo tanto. en estos sitios web se describen 79 y 55 especies respectivamente.ar. West Virginia University. a la vez que Bentivenga y Morton (1995) proponen una clave para identificar las cinco especies de Gigaspora. la INVAM y el sitio de Blaszkowski poseen excelentes fotografías con detalles de la estructura subcelular de las esporas. 1982) se publicaron antes de algunas revisiones de taxonomía recientes e importantes. La identificación de especies de HMA se puede hacer por comparación con la descripción original de la especie.V. f. Joseph Morton en la INVAM (Colección Internacional de hongos micorrizógenos arbusculares. falta de buenas fotografías para las comparaciones y las descripciones están hechas con esporas extraídas del suelo de campo por lo cual pueden no incluir características taxonómicas importantes). este manual incorpora en un solo volumen toda la descripción de las especies hasta 1990.wvu. y por consiguiente..edu) y por Dr. 3 y 4 se proporcionan los nombres de las especies y los autores.agro. Algunas claves de identificación para HMA (por ejemplo Hall y Fish. La fotografia a) muestran una espora de Gigaspora albida con la hifa de sostén bulbosa típica de esta familia.szczecin. USA) sitio web (http://invam.caf. g. c) un detalle de la ornamentación de H ongos micorrizógenos arbusculares 229 . Sin embargo. W. Koske y Walker (1985) proponen una clave para algunas especies de Scutellospora con esporas con paredes ornamentadas.Identificación de especies y montaje de preparaciones En la mayoría de los casos. Janusz Blaszkowski (Department of Plant Pathology of the Agricultural University of Szczecin. c y d) y Acaulosporaceae (e. usando como referencia al Manual para la identificación de HMA (Schenck y Pérez. La ilustración 4 muestra las esporas y las estructuras producidas por las especies de la familia Gigasporaceae (fotografías a. b) espora de Scutellospora scutata con la hifa de sostén bulbosa (note el escudo de germinación redondo. Fotografías de esporas de especies representativas de diferentes géneros se muestran en las ilustraciones 4 y 5. En los anexos 1. 1990) y comparando con las descripciones e ilustraciones de las especies proporcionadas por el Dr. Trappe. el tamaño de las esporas y una descripción estandarizada de las especies de HMA.pl/~jblaszkowski. 1979. Por otro lado. contrastando con el color hialino de las esporas). Poland) en http://www. y h). las esporas extraídas del campo no son identificables bajo el microscopio de disección. deben ser montadas en portaobjetos y observadas en un microscopio compuesto. alberga todos los problemas inherentes a esas descripciones (falta de estandarización de las estructuras subcelulares de las esporas.

L2 y L3) de Paraglomus occultum y en la foto h) se muestra una espora de Paraglomus brasilianum. En la foto e) se muestra una espora de Entrophospora colombiana (familia Acaulosporaceae) con la pared de la espora. forma. presencia de hifa de sostén.la pared de las esporas (verrugas) de Scutellospora coralloidea. finalmente. Las esporas necesitan montarse en líquidos de montar permanentes como son el PVLG (alcohol polivínilico lactoglicerol) y PVLG mezclado con reactivo de Melzer. mostrando algunos sáculos esporíferos adheridos a las esporas. la pared germinal 1 (gw1) y la pared germinal 2 (gw2) con su capa más interna reaccionando al reactivo de Melzer. c. L2 y L3) (la capa L2 está ornamentada con pequeñas crestas). La foto e) muestra un espora de Archaeospora leptoticha con el sáculo esporífero. reacción al Melzer. la foto f) muestra un detalle de Archaeospora leptoticha en donde se observan protuberancias y depresiones de las capas 2 y 3 de la pared esporal (indicada con flechas). en la foto h). Una espora de Entrophospora colombiana mostrando las dos cicatrices características se ve en la foto f). La foto b) muestra la pared de la hifa de sostén continua con la pared de la espora de un Glomus sp. Materiales necesarios • Portaobjetos. en la foto d). también con la pared formada por tres capas (L1. Las características taxonómicas importantes que pueden observarse bajo el microscopio de disección son tamaño de las esporas. color. número de paredes germinales y grosor de la pared de la espora. esporas de Acaulospora sp. La ilustración 6 muestra a las esporas y estructuras producidas por especies de la familia Glomeraceae (a. En el microscopio compuesto pueden observarse algunas características taxonómicas importantes como son la presencia y tipo de ornamentación sobre la pared de la espora. y d) células auxiliares nodosas que diferencian a los miembros de Scutellospora. Archaeosporaceae (e y f) y Paraglomeraceae (g y h). de células suspensoras y del sáculo esporífero (raramente observado en esporas recolectadas directamente del campo). se observan. cubreobjetos y etiquetas • Agujas de disección 230 Manual de biología de suelos tropicales . d). La fotografía g) representa una espora de Acaulospora scrobiculata que muestra la cicatriz que queda en la espora después de que el sáculo esporifero se desprende. Un esporocarpo de Glomus clavispora se observa en la foto c) y un esporocarpo de Glomus sp. b. Foto a): espora de Glomus clarum indicando la hifa de sostén (note que la capa más interna de la pared de la espora se desprende y se ve parecida a la pared germinal. la foto g) ejemplifica la estructura de la pared formada por tres capas (L1.

10 ml de glicerol. las esporas se deslizan hasta los bordes cuando se coloca el cubreobjetos en la parte superior de cada gota. Etiquetar las preparaciones incluyendo número de muestra. 16. 3. 7. mezcle las esporas en la solución de PVLG y de PVLG + Solución de Melzer y deje secar la superficie de la gota por lo menos cinco minutos. 100 ml de ácido láctico. si se agrega demasiada agua. y fecha. Comentarios: el paso 2 es crucial para el montaje de las esporas sobre el portaobjetos. Establecimiento de cultivos trampa Los cultivos trampa se utilizan con más frecuencia en estudios de diversidad de HMA porque revelan las especies que no están esporulando en el campo. Procedimiento 1. 5. ofrecen esporas nuevas y saludables que pueden ser utilizadas para establecer cultivos puros de HMA. 4. Con una aguja de disección. 5 g de yoduro de potasio. El método propuesto se basa en los protocolos de Stutz y Morton (1996).6 g de alcohol polivínilico (PVA) • Reactivo de Melzer (100 g de hidrato de cloral. Guardar las preparaciones a temperatura ambiente durante cinco días y luego incubar a 40-60ºC. tenga cuidado de no agregar demasiada agua). 1. Este paso es importante para exponer las paredes germinales y sus capas. 6. H ongos micorrizógenos arbusculares 231 . colocar una gota de PVLG y una gota de la solución de PVLG + Melzer.5 g Iodo. Colocar las esporas al centro de cada gota usando un pinza fina o una micropipeta (en este caso. durante dos días para endurecer el medio de montaje. Además.• Solución de PVLG (100 ml de agua destilada. Usando una aguja de disección. género y especie (si se conoce). en el momento del muestreo. Coloque suavemente un cubre objeto sobre la gota de PVLG y otro cubreobjetos sobre la gota de PVLG + Solución de Melzer. En un porta objetos. rompa cada espora individualmente bajo el microscopio de disección. 2. Mezclar el reactivo de Melzer con el PVLG (1:1) para preparar la solución de PVLG + Melzer. 100 ml de agua destilada.

vol. B. (1965) ‘Most-Probable-Number Method for Microbial Populations’. 2 Colocar esta mezcla en macetas de plástico de 1. M. Se recomienda cualquier gramínea C4 y/o leguminosa como hospederas. R. y Schenck. y Morton. Part 2: Chemical and Microbiological Methods. Almeida. donde las plantas intactas colectadas del campo se trasplantan a una maceta con un sustrato libre de HMA y se evalúa la esporulación después de tres a cuatro meses. in A. (1996) utilizan un procedimiento diferente para establecer cultivos trampa. Klute (ed) Methods of Soil Analysis. homogeneizar el suelo de campo con arena estéril (50% de suelo de campo y 50% de arena). se incluyan las raíces de las plantas ya que también sirven como propágulos para iniciar los cultivos trampa. Wisconsin. En el paso 2. según lo explicado arriba. 18. pp. pp . 1467–1472. 7–13. Soil ScienceSociety of America. (1990) ‘A Revision of the Genus Sclerocystis (Glomaceae. extraer las esporas e identificarlas. T. Alexander. durante el muestreo de suelo de campo.Soil Biology and Biochemistry. (1986) ‘Infectivity of vesicular-arbuscular mycorrhizal fungi: Influence of host-soil diluent combinations on MPN estimates and percentage colonization’.Materiales necesarios • • • • Arena estéril Macetas de plástico de 1. N. Bever et al. M. REFERENCIAS Adelman. Comentarios: es importante que.5 kg Bandejas o bolsas de plástico Semillas de Sorghum sudanense (Sorgo) y Vigna unguiculata (Frijol) Procedimiento 1 En una bandeja de plástico (o en una bolsa de plástico). Después de tres a cuatro meses. Mycologia. Madison. llamado “cultivos trampa de trasplante”. colecte uno o dos núcleos de suelo de 50 ml de cada maceta. otras plantas hospederas pueden utilizarse. Glomales)’. bajo condiciones del invernadero.5 kg y sembrar abundantemente con una mezcla de semillas de sorgo y frijol (40-50 semillas por maceta). J. vol. Cubrir las semillas con la mezcla de suelo y arena. 82. pp. 232 Manual de biología de suelos tropicales . T. 703–714. 3. si el sorgo y frijol no están disponibles. J.

Mycologia Memoir. (1979) ‘A key to the Endogonaceae’. (1974) ‘Endogonaceae in the Pacific Northwest’. Canadian Journal of Forest Research. 14. Fogel. W. pp. Bentivenga. vol. y Varma. pp. K.. vol. (1963) ‘Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting’. (1995) ‘Interaction between arbuscular mycorrhizal fungi and plants: Their importance in sustainable agriculture and in arid and semiarid tropics’. J. 171–213. incorporating developmental patterns of morphological characters’. Hall. B. vol. K. 75–78. H ongos micorrizógenos arbusculares 233 . pp. W. Franson. y Nicolson. 84. S. vol. y Mosse. vol. 754–756. Arora. 5. G. R. y Fish. T. y Hunt. 119–142. D. R. (1991) ‘Mycorrhizas in natural ecosystems’. Transactions of the British Mycological Society. (1989) ‘Infection unit method of vesicular-arbuscular mycorrhizal propagule determination’. pp. W. D. Marcel Dekker Inc. pp . Bever. 235–244. y Abbott. in D. New Phytologist. (1979) ‘Fungal and arboreal biomass in a Western Oregon Douglas-fir ecosystem: Distribution pattern and turnover’. B.. 21. R. 720–732. M. 245–256.Bagyaraj. B. y Schultz. vol. Australian Journal of Botany. (1990) ‘Ecology of vesicular-arbuscular mycorrhizae’. vol. J. R. (1987) ‘The effect of surface mining on the infectivity of vesicular-arbuscular mycorrhizal fungi’. (1996) ‘Host-dependent sporulation and species diversity of arbuscular mycorrhizal fungi in a mown grassland’. K. L. Oliver and Boyd. Mukerjii and G. D. Jasper. (1980) ‘An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots’. (1995) ‘A monograph of the genus Gigaspora. Rai. J. A. vol. pp. B. J. 84. (eds) (1963) Statistical Tables for Biological. G. pp. 489– 500. C. pp. D. A. 46. Antonovics. P. Brundrett. Knudsen (eds) Handbook of Applied Mycology: Soil and Plants. vol. 53. (1950) ‘Present status of biometry’. J. y Yates. M. I. Advances in Microbial Ecology. 6. G. R. Journal of Ecology. D. 641–652. 73. J. y Bethlenfalvay. pp. vol. Mycol ogi a. Giovannetti. 71–82. vol. J. 261–270. y Trappe. vol. pp. pp. P. Gerdemann.. H. 87. New York. Robson. pp. Advances in Ecological Research. Bagyaraj. Agricultural and Medical Research. F. J. Transactions of the British mycological Society.. Fisher. G. L. Soil Science Society of America Journal. 1–76. Cochran. 9. Edinburgh. y Morton. Gerdemann. A. 35. A. M. Morton J. A. J. J. Biometrics.

Bentivenga. 158–161. Ecological Applications. y Reeves. 92. 78. vol. O. St. 5. Morton. C. 234 Manual de biología de suelos tropicales .. C. (2004) ‘Pacispora. F. J. 66. Koske. in D. E. Stribley. D. B. 100. and two new families. (1997) ‘Soil carbon. y Sieverding E. pp. A.. D. B. Mosse. S. C. H. S25–S32. y Wedin. (1981) ‘Ecology of mycorrhizae and mycorrhizal fungi’. Miller. 702–720. (1985) ‘Species of Gigaspora (Endogonaceae) with roughened outer walls’. J. pp. 14–18. P. y Hayman. A. P. J. Canadian Journal of Botany. Transactions of the British mycological Society. B. D. pp. Journal of Applied Botany. F. Domoto. y Last. J. N. 181–195 Morton. P. Mycologia. Mycologia. y Le Tacon. 486–505. D. Mycotaxon. pp. vol. T. based on concordant molecular and morphological characters’. 471–491. pp. 72–82. R. D. J. Paul. M. CAB International Wallingford. Morton. E. 77. vol. A. 73 (suppl. y Gemma. two new suborders. E.. Archaeosporaceae and Paraglomaceae. Read. B. Oehl. Glomales. y McGraw. G. measurement. M. pp. J. vol. pp. Philips. vol. 171–182. vol. with an emendation of Glomaceae’.. (1982) ‘Quantification of vesicular-arbuscular mycorrhizae in plant roots’. Musoko. vol. (1979) ‘The role of endomycorrhizae in revegetation practices in the semi-arid West. (1995) ‘Discovery. American Journal of Botany. II: A bioassay to determine the effect of land disturbance on endomycorrhizal populations’. (1989) ‘A modified procedure for staining roots to detect VA mycorrhizas’. Schenck (ed) Methods and Principles of Mycorrhizal Research. Acaulosporaceae and Gigasporaceae. pp. Moorman. H. D. A. y Walker. pp. a new vesicular-arbuscular mycorrhizal fungal genus in the Glomeromycetes’. with two new genera Archaeospora and Paraglomus. P. N. J. and interpretation of diversity in arbuscular endomycorrhizal fungi (Glomales. Glomineae and Gigasporineae. 1). 37. y Benny. Fitter and I. Mason. pp. in N. A. y Bever. y Redecker. (1970) ‘Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection’. P. J. Koske. American Phytopathological Society. Kormanik. 7. S. (1990) ‘Revised classification of arbuscular mycorrhizal fungi (Zygomycetes): A new order. 379–391. P. D. (1992) ‘Short-term changes in vesicular-arbuscular mycorrhizal spore populations in Terminalia plantations in Cameroon’.Johnson. C. L. Advances in Microbial Ecology. y Walker. New Phytologist. Alexander (eds) Mycorrhizas in Ecosystems. R. (1985) ‘Mycorrhizal fungi at eighteen apple rootstocks plantings in the United States’. F. vol. D. Lewis. 137–210. 55. Mycological Research. T. vol. 93. vol. B. pp. pp. Zygomycetes)’. C. (2001) ‘Two new families of Glomales. nutrients and mycorrhizae during conversion of dry tropical forest to grassland’. vol. 261–267.

J. 282–285. Sieverding. y Oehl. Synergistic Publications. H ongos micorrizógenos arbusculares 235 . vol. Mycologia. Mycotaxon vol 97. D.. y Walker. Biotropica. Spain. pp. vol. (1982) ‘Synoptic key to the genera and species of Zygomycetous mycorrhizal fungi’.Picone. Morton. Stutz. J. J. F. (2001) ‘A new fungal phylum. 1883–1889. Schwarzott. T. y Pérez. M. Australian Journal of Soil Research. vol. C. pp.. (2000) ‘Diversity and abundance of arbuscular-mycorrhizal fungus spores in tropical forest and pasture’. N. (2000) ‘Molecular phylogeny of the arbuscular mycorrhizal fungi Glomus sinuosum and Sclerocystis coremioides’. Redecker. 734–750. 74. with a discussion of the genus Archaeospora. 3rd Edition. 105. Porter. J. C. vol. pp. D. USA. 17. 72. pp. Trappe. Schübler. the Glomeromycota: Phylogeny and evolution’. 163-182. W.. vol. Phytopathology. vol. 32. (1979) ‘Most Probable Number method for enumerating infective propagules of vesicular arbuscular mycorrhizal fungi in soil’. 92. Canadian Journal of Botany. M. pp515–519. J. pp. A. 2006. pp. (1990) Manual for Identification of VA Mycorrhizal Fungi. 1413–1421. B. B. Y. D.L. y Morton. y Bruns. E. Schenck. Gainesville. (1996) ‘Successive pot cultures reveal high species richness of arbuscular endomycorrhizal fungi in arid ecosystems’. Appendicispora: a new genius in the arbuscular micorrhiza-forming Glomeromycetes. Mycological Research. 1102–1108. C. C.

monosporum Gerdemann y Trappe G.. y Trappe G. multicaule Gerd. multisubstensum Mukerji. y Bakshi G. citricola Tang y Zang G. laccatum Blaszkowski G. y Trappe G. boreale (Thaxter) Trappe y Gerd. Tadych y Madej G. Bhattacharjee y Tewari G. melanosporum Gerd. pansihalos Berch y Koske G. maculosum Miller y Walker G. y Schenck G. lacteum Rose y Trappe G. cerebriforme McGee G. minutum Blaszk. G. canadense (Thaxter) Trappe y Gerd. aggregatum Schenck y Smith G. macrocarpum Tulasne y Tulasne G. Sieverding y Schenck G. G.Apéndice 7. y Ellis) Trappe y Gerdemann 236 Manual de biología de suelos tropicales . coremioides (Berk. proliferum Dalpe y Declerck G. australe (Berkeley) Berch G. y Gerd. manihotis Howeler. aurantium Blaszkowski. przelewicensis Blaszkowski G. botryoides Rothwell y Victor G. Bhattacharjee y Tewari G. antarticum Cabello G. clavisporum (Trappe) Almeida y Schenck G. magnicaule Hall G.1. G. mosseae (Nicol. albidum Walker y Rhodes G. caledonium (Nicol. y Trappe G. microaggregatum Koske. Renker y Buscot G. Especies de HMA de la familia Glomeraceae. mortonii Bentivenga y Hetrick G. arborense McGee G. delhiense Mukerji. invermaium Hall G. ambisporum Smith y Schenck G.) Trappe y Gerd.) Gerd. género Glomus Género/Especies Glomus G. y Gerd. pubescens (Sacc. microcarpum Tulasne y Tulasne G. constrictum Trappe G. Gemma y Olexia G. clarum Nicol. Blanke. liquidambaris (Wu y Chen) Almeida y Schenck G. callosum Sieverding G. pallidum Hall G. claroideum Schenck y Smith G. coronatum Giovannetti G. nanolumen Koske y Gemma G. corymbiforme Blaszkowski G. convolutum Gerd. y Broome) Redecker y Morton G.

trimurales Koske y Halvorson G. G. viscosum Nicol. tenerum Tandy emend.Apéndice 7. tubiforme Tandy G. fragilistratum Skou y Jakobsen G. taiwananse (Wu y Chen) Almeida y Schenck G. sterilum Mehrotra y Baijal G. versiforme (Karsten) Berch G. Friese. y Broome) Trappe y Gerd. y Trappe G.caf. deserticola Trappe. xanthium Blaszk. flavisporum (Lange y Lund) Trappe y Gerd. Walker y Koske G. heterosporum Smith y Schenck G. G.1. Blanke.) Walker G. y Broome) Trappe y Gerd. diaphanum Morton y Walker G. fragile (Berk. Walker y Dalpe G. tortuosum Schenck y Smith G. rubiforme (Gerd. glomerulatum Sieverding G. fasciculatum (Thaxter) Gerd. fuegianum (Spegazzini) Trappe y Gerdemann G. pulvinatum (Henn. tenebrosum (Thaxter) Berch G. y Bakshi) Almeida y Schenck G.wvu. segmentatum Trappe. dominikii Blaszkowski G. globiferum Koske y Walker G. hoi Berch y Trappe G. y Trappe emend. halonatum Rose y Trappe G. Spooner y Ivory G. y Trappe) Almeida y Schenck G. tenue (Greenhall) Hall G.) Trappe y Gerdemann G. Renker y Buscot G. fulvum (Berk. etunicatum Becker y Gerdemann G. G.. sinuosum (Gerd. Continúa Género/Especies G. reticulatum Bhattacharjee y Mukerji G. G. radiatum (Thaxter) Trappe y Gerd. dimorphicum Boyetchko y Tewari G. McGee G. formosanum Wu y Chen G. Bloss y Menge G. y Gerd. insculptum Blaszkowski G. G. vesiculiferum (Thaxter) Gerd. pustulatum Koske. geosporum (Nicol. intraradices Schenck y Smith Fuente: tomado de http://invam.edu. warcupii McGee H ongos micorrizógenos arbusculares 237 . G.

dilatata Morton A.Apéndice 7. delicata Walker. schenckii Sieverding y Toro 238 Manual de biología de suelos tropicales . lacunosa Morton A. tuberculata Janos y Trappe A. spinosa Walker y Trappe A. walkeri Kramadibrata y Hedger Entrophospora E. gedanensis Blaszkowski A. scrobiculata Trappe A. infrequens (Hall) Ames y Schneider4 E. bireticulata Rothwell y Trappe A. sporocarpia Berch A. myriocarpa Spain. excavata Ingleby y Walker A. nicolsonii Walker. A.2. Chaverri y Rojas A. longula Spain y Schenck A. Especies de HMA de la familia Acaulosporaceae.edu. foveata Trappe y Janos A. mellea Spain y Schenck A. thomii Blaszkowski A. baltica Blaszkowski E. morrowiae Spain y Schenck A. capsicula Blaszkowski A. cavernata Blaszkowski A. undulata Sieverding A. paulineae Blaszkowski Fuente: tomado de http://invam. koskei Blaszkowski A. rugosa Morton A. Pfeiffer y Bloss A. rehmii Sieverding y Toro A. géneros Acaulospora y Entrophospora Género /Especies Acaulospora A. splendida Sieverding. elegans Trappe y Gerdemann A.caf. laevis Gerdemann y Trappe A. taiwania Hu A.wvu. kentinensis Wu y Liu E. denticulata Sieverding y Toro A. Sieverding y Schenck A. Reed y Sanders A. polonica Blaszkowski A. colombiana Spain y Schenck E.

scintillans Rose y Trappe emend. Especies de HMA de las familias Archaeosporaceae(Género Archaeospora). H ongos micorrizógenos arbusculares 239 . y Oehl Fuente: tomado de Oehl y Sieverding. chimonobambusae Blaszk. Daniels y Trappe) Morton y Redecker Ar. y Oehl P. leptoticha (Schenck y Smith) Morton y Redecker Paraglomus P. Sieverd.caf. franciscana Sieverd. dominikii Sieverd. occultum (Walker) Morton y Redecker Pacispora P. y Oehl P.edu. Paraglomeraceae (Género Paraglomus) y Pacisporaceae (Género Pacispora) Género /Especies Archaeospora Ar. y Oehl P. boliviana Sieverd. y Oehl P. trappei (Ames y Linderman) Morton y Redecker Ar. y Oehl P.wvu. Sieverd. robigina Sieverd.Apéndice 7. emend. gerdemannii (Rose. coralloidea Sieverd. brasilianum (Spain y Miranda) Morton y Redecker P. y Oehl P. 2004 y http://invam.3.

albida Schenck y Smith Gi.Apéndice 7.) Walker y Sanders 240 Manual de biología de suelos tropicales . y Herr. y Herr.) Walker y Sanders S. cerradensis Spain y Miranda S. reticulata (Koske. calospora (Nicol.) Gerd. y Trappe Gi. gregaria (Schenck y Nicol. y Herr.) Walker y Sanders S.4. y Gerd. arenicola Koske y Halvorson S. dipapillosa (Walker y Koske) Walker y Sanders S. y Gerd. rosea Nicol. coralloidea (Trappe. géneros Gigaspora y Scutellospora Género /Especies Gigaspora Gi. nodosa Blaszkowski S. alborosea (Ferr. Gerd.) Walker y Sanders S. margarita Becker y Hall Gi.) Walker y Sanders S. hawaiiensis Koske y Gemma S. y Schenck Scutellospora S. fulgida Koske y Walker S. Sieverding y Toro S. y Gerdemann) Walker y Sanders S. y Ho) Walker y Sanders S. biornata Spain.) Walker y Sanders S. erythropa (Koske y Walker) Walker y Sanders S. gilmorei (Trappe y Herd. savannicola (Ferr. decipiens Hall y Abbott Gi. pellucida (Nicol. heterogama (Nicol. Miller y Walker) Walker y Sanders S. minuta (Ferr. aurigloba (Hall) Walker y Sanders S. persica (Koske y Walker) Walker y Sanders S. dipurpurascens Morton y Koske S. nigra (Redhead) Walker y Sanders S. gigantea (Nicol. castanea Walker S. armeniaca Blaszkowski S. Especies de HMA de la familia Gigasporaceae. y Schenck) Walker y Sanders S.

verrucosa (Koske y Walker) Walker y Sanders S.) Walker y Sanders S. scutata Walker y Diederichs S. H ongos micorrizógenos arbusculares 241 .edu. y Ferr.4. Continúa Género /Especies S. spinosissima Walker.caf. Cuenca y Sanchez S. tricalypta (Herr.wvu. weresubiae Koske y Walker Fuente: tomado de http://invam.Apéndice 7.

.

podrían ser una alternativa (Hyde. existen dos condiciones básicas. La evaluación de la diversidad de hongos en suelos tropicales bajo diferentes usos de suelo es. los patógenos de plantas actúan en el suelo y en la rizósfera. por lo 243 . Los hongos son una parte importante de la cadena alimenticia en el suelo. Cuando un estudio de largo plazo involucra varios especialistas no resulta viable. los hongos interactúan con una compleja comunidad microbiana que incluye: bacterias. En el suelo. 2000). grupos específicos o un conjunto de predictores. principalmente para la mesofauna que habita en el suelo (Bonkowski et al. Para poder obtener una evaluación confiable de la diversidad de los hongos del suelo. 1993). Las actividades agrícolas pueden afectar la diversidad de organismos presentes en el suelo.. junto con una metodología precisa.Capítulo 8 Hongos del suelo saprófitos y patógenos de plantas Ludwig H. 1988. actinomicetos (actinobacterias) y pequeños invertebrados. (Wainwright. debido al tiempo y la limitación de los recursos. Lodge. 1997a y b). En los ecosistemas agrícolas. los cuales juegan un importante papel en el reciclaje de nutrientes o son mediadores del equilibrio entre los patógenos y sus antagonistas. El uso de organismos indicadores. Las investigaciones deben ser diseñadas en forma de estudios a largo plazo donde intervengan especialistas en taxonomía y micología. causando una notable reducción en las cosechas y afectando su calidad. Pfenning y Lucas Magalhães de Abreu INTRODUCCIÓN Los hongos del suelo juegan un papel clave en los procesos de descomposición que mineralizan y reciclan nutrientes de plantas.

un grupo monofilético de organismos de hongos obligados asociados a las raíces de las plantas (véase Capítulo 7). 1993. 1997). 2000.. por lo tanto. Incluso el análisis de abundancia relativa de especies cultivables recuperadas del suelo. afirmaciones genéricas de que únicamente el 1% de los “microorganismos” del suelo son cultivables aumentan la dificultad y no tienen en cuenta la inmensa diversidad biológica que realmente representan dichos microorganismos (Rondon et al. Muyzer et al. No obstante. Gams.. tales como suelos que muestran limitaciones inherentes debido a la naturaleza de las especies y la inhabilidad de los medios de cultivo para copiar con exactitud los hábitats del suelo (Tsao et al.... Singleton et al.. Las metodologías para aislar y cultivar hongos de ecosistemas complejos. que cubran las diferentes idiosincrasias de la diversidad taxonómica y grupos fisiológicos de hongos presentes en los ecosistemas del suelo. un objetivo del proyecto CSM-BGBD. Los métodos estándares aceptados para inventariar la diversidad de hongos o para evaluar su impacto en varias prácticas agrícolas u otras actividades humanas. Una visión global de los métodos para estudiar hongos patógenos de plantas en el suelo fue descrita por Singleton et al. puede no ser representativo de la dinámica de las comunidades del suelo. Gray.. deben ser capaces de crecer en cultivos axénicos. Se ha progresado considerablemente utilizando técnicas de lavado. la mayoría de los hongos que habitan en el suelo pueden ser considerados saprotróficos. 2000). 2001). Los procedimientos clásicos microbiológicos para estudiar los hongos del suelo se basan en cultivos que implican el aislamiento de propágulos microbianos o hifas activas que crecen en el suelo. 1990. (1992). junto con muchos grupos homogéneos como el filum Glomeromycota. 244 Manual de biología de suelos tropicales . 1996. Cannon. Los métodos utilizados para el aislamiento del suelo. han sido revisados por varios autores (Frankland et al. Una medida confiable de las comunidades de hongos en el suelo sin prejuicios requiere del seguimiento de un laborioso programa de aislamientos sistemáticos. 2004).tanto. con diferentes medios de cultivos y estrategias de aislamiento. 1992. tales como fila de Eubacterias. 1983. Dentro de este grupo se encuentran grupos filogenéticamente diversos. 1990. 1992. rizósfera y hongos rizoplanos. Sin embargo. Bills et al. medios de cultivo parcialmente selectivos y adictivos que reducen el crecimiento de ciertos grupos de hongos. Davet y Rouxel. y su crecimiento en un medio de cultivo axénico para su posterior identificación y cuantificación. debido a que los medios de cultivo imponen nuevas condiciones selectivas y pueden introducir un sesgo en los análisis (Liu et al.. Bridge y Spooner. aún no están disponibles.

sino un ecosistema compuesto por una mezcla de sustratos más diversos que incluyen partes de las plantas vivas y muertas. porque el suelo representa una mezcla compleja de fracciones orgánicas e inorgánicas con agua y organismos vivos. generalmente aceptados. Malosso et al. En general. junto con minerales y agua.. por lo tanto. Aunque este enfoque no es exhaustivo. se requieren los procesos de aislamiento e identificación tradicionales (Brodie et al. el suelo alberga una parte considerable de la biodiversidad total de hongos. Brodie et al. 1973. microorganismos. y no existe ninguna estimaHongos del suelo saprófitos y patógenos de plantas 245 . se han aplicado métodos que dependen del análisis de la biomasa microbiana del suelo. raíces vivas. intenta ofrecer una visión global de los procedimientos disponibles. 2006). y no un sustrato. animales y otros microorganismos. se deberá tomar en cuenta que el suelo no es un sustrato. 2003). para un mejor entendimiento de la estructura y función de las comunidades de hongos del suelo. exudados. cada método presenta ciertas preferencias a ciertos grupos específicos de hongos. por sí solos. Con estos fines. respiración del suelo. No obstante. Por ello. esta característica complica las definiciones y la metodología. Por esta razón. principalmente.. También son tomados en cuenta los principios y aplicaciones de herramientas moleculares en los estudios de comunidades de hongos del suelo. estos métodos proporcionan. 1998. reciclaje de nitrógeno y contenido de ácidos grasos del hongo o de observaciones directas del crecimiento del micelio en partículas de suelo (Widden y Parkinson. además.Otras metodologías que han sido desarrolladas se enfocan en el análisis de la actividad de los hongos y su papel en los procesos biogeoquímicos que ocurren en el suelo. En este capítulo se hace referencia a algunos de los métodos más comunes y también a algunas técnicas menos conocidas para la evaluación y monitoreo de comunidades de hongos del suelo. es necesario adoptar métodos similares dentro de los proyectos cooperativos o multidisciplinarios para garantizar la comparación de los datos en un futuro. Las fracciones orgánicas se componen de material de plantas en diferentes fases de descomposición. LA IMPORTANCIA ECOLÓGICA DE LOS HONGOS DEL SUELO El suelo es un hábitat o ecosistema. pequeños invertebrados y contenidos intestinales. Los resultados obtenidos de un estudio de hongos del suelo dependen.. El objetivo principal es contribuir al establecimiento de una serie de métodos estándares. Houston et al.. 2003. de los métodos utilizados. poca información acerca de las especies de hongos involucrados en dichos procesos.

2004). 1991. 2001). una mejor estructura física del suelo y el control de antagonistas de los patógenos de las plantas en el suelo. 1997).. mientras los ascomycetes descomponen principalmente celulosa y hemicelulosa (Domsch et al. causando que las plántulas se marchiten y. 2001. Zak y Visser. La supresión de patógenos de plantas puede resultar intrínseca en los suelos. los patógenos de plantas y sus antagonistas son particularmente importantes. pero también es posible que se mantenga o incremente con algunas prácticas agrícolas específicas. Los saprófitos tienen una especificidad limitada por sustratos. los zygomycetes usan carbohidratos simples. Los hongos también constituyen una parte importante de la cadena alimenticia dentro del suelo.. Se ha demostrado experimentalmente que la introducción de antagonistas específicos como Trichoderma spp. 1993. aunque la mayoría ataca una amplia gama de plantas hospederas. 1980.ción fidedigna del número de especies de hongos del suelo (Hawksworth. Lodge. 2000). Existen evidencias de que las prácticas agrícolas causan más alteraciones cuantitativas que cualitativas en la comunidad de microhongos del suelo (Pfenning. 1996. o Coniothyrium minitans pueden reducir la incidencia de una variedad de enfermedades en el suelo (Whipps et al. 1997. Hawksworth y Rossman. cabe mencionar que los hongos son responsables de la degradación de xenobióticos y contaminantes orgánicos introducidos en el suelo (Bordjiba et al. 1997). Silva et al.. En sistemas agrícolas. provocan grandes pérdidas. El mantenimiento de la diversidad de hongos del suelo debería... 1997). 1984.. mineralizando y reciclando los nutrientes de las plantas (Wainwright. Schneider. 1993). 1988. 2003. tales como la incorporación de materia orgánica. Algunos elementos biológicos han sido identificados como los principales factores de la supresión de enfermedades (Chet y Baker. Mazzola. Lodge. plantas utilizadas como cubierta vegetal y la diversificación de cultivos. Con relación al papel de los organismos descomponedores. en la rizósfera o infectan tallos. 2002. por ejemplo. especialmente en el caso de la mesofauna (Bonkowski et al. 2007. Los patógenos de plantas actúan en el suelo. por tanto. Barratt et al. Beare et al. Los hongos del suelo juegan un papel clave en los procesos de descomposición. 246 Manual de biología de suelos tropicales . mediante el suministro de nutrientes. 2003). Rodrigues-Guzman. por ende. Éstos pueden ser específicos. beneficiar directamente la agricultura sustentable..

. 2001. aunque también pueden encontrarse en el suelo. Hongos del suelo saprófitos y patógenos de plantas 247 . su hábitat e importancia ecológica son variables. Trabajar con este grupo de simbiontes biotróficos obligados requiere del uso de diferentes técnicas específicas. aunque algunos de ellos son importantes patógenos de las plantas del suelo. La detección de estos organismos requiere de bioensayos o cebos. Dentro de este reino se reconocen cinco fila: los géneros que pertenecen al filum Glomeromycota forman micorrizas arbusculares y no crecen en ausencia de su planta hospedera (Schußler et al. 2001.. 2001). las cuales se presentan en la sesión “Procedimientos basados en cultivos”. Moreira y Siqueira. Glomeromycota Los hongos clasificados en el reino Fungi se caracterizan por tener quitina como el mayor componente en su pared celular. Los hongos del reino Protozoa no son numerosos.ASPECTOS DE SISTEMÁTICA MODERNA Protozoa Los organismos conocidos como hongos actualmente se agrupan en tres reinos. 2002). Dentro del grupo de los Oomycetes del suelo es posible encontrar saprófitos. como se discutió en el Capítulo 7. A pesar de que estos hongos representan un grupo delimitado de acuerdo con sus características y filogenia. Estas especies se clasifican en la clase Plasmodiophoromycetes. Mientras que algunos son verdaderos hongos acuáticos asociados con restos de plantas en agua o con patógenos de otros organismos acuáticos. Por sus características biológicas requieren de técnicas específicas para su aislamiento y caracterización. Los hongos llamados mohos mucosos -un grupo de organismos heterogéneos y polifilético. Plasmodiophora brassicae o Polymyxa graminis. tales como Spongospora subterranea. así como otros géneros patógenos de plantas. otros habitan en el suelo.habitan en restos de plantas. con un sistema de clasificación filogenético (Kirk et al. Chromista Los hongos que son derivados de algas y que contienen celulosa como el mayor componente en su pared celular pertenecen al reino Chromista Filum Oomycota (Dick. 2001). Kirk et al..

Cunninghamella.Chytridiomycota El único grupo dentro del reino de los hongos que forma esporas flageladas es el filum Chytridiomycota. Ascomycota El filum Ascomycota representa el grupo más abundante de hongos. un meiosporangio en el que generalmente se forman cuatro esporas sexuales (Bauer et al. una estructura formada durante la fase sexual de su ciclo de vida. Mucor. Gongronella. insectos. Basidiomycota El filum Basidiomycota se caracteriza por el basidium.. La fase asexual de los ascomycetes se llama anamórfica y es la fase más comúnmente encontrada.. 2006) y en la mayoría de los casos por la formación de un cuerpo fructífero. en el suelo y en restos de plantas. tales 248 Manual de biología de suelos tropicales . Zygomycota Representan el filum Zygomycota y se consideran como hongos de azúcar por su preferencia por carbohidratos simples y por su crecimiento vigoroso en un cultivo axénico. Muchos de ellos forman ectomicorrizas en asociación con el sistema de raíces de árboles forestales. algunos de estos hongos habitan en el suelo. distinguir los grupos más importantes. Para fines prácticos.. Varias de estas especies se conocen como trasmisores de virus patógenos de plantas (Krik et al. El micelio vegetativo se desarrolla. Mortierella o Rhizopus son muy comunes en el suelo y se encuentran en casi todos los estudios de hongos de suelo. plantas u otros hongos. pero normalmente son acuáticos y viven como saprófitos o parásitos de otros organismos como nematodos. 2008). La filogenia de este grupo aún es objeto de discusión y de revisión. La evaluación de la diversidad de estos hongos y el monitoreo de su impacto en la comunidad requieren de técnicas específicas (Rossman et al. 1998) que no son consideradas en este manual. Se caracterizan por la formación de las ascas. Los patógenos de plantas importantes en el suelo son especies de Rhizoctonia y Sclerotium. Especies de los géneros Absidia. por lo general.

con el fin de evitar la contaminación entre puntos de muestreo. utilizando plantas altamente susceptibles. Cada juego de 12 muestras se homogenizan para formar una muestra compuesta de alrededor de 500 g que se coloca en una bolsa de plástico. 2008). a pesar del uso de antibióticos en los medios de cultivo. Probablemente. a una profundidad de 20 cm en 12 puntos distribuidos en cada parcela de muestreo de acuerdo con el esquema mostrado en el Capítulo 2. ascomycetes que forman un asca en un cuerpo fructífero cleistotecal. Debido a su pequeño tamaño y estructura poco diferenciada. pyrenomycetes y loculoascomycetes puede ser útil.como plectomycetes. preferentemente a 4°C y congelarse lo más pronto posible para su futuro procesamiento.. De manera alternativa. La rizósfera también contiene una alta concentración de bacterias que. si los recursos lo permiten. espátula. Para la extracción del DNA. Todos los materiales de muestreo (nucleador. debido a que la micobiota de la rizósfera es altamente influenciada por las especies de plantas.) deberán lavarse antes y después de tomar las muestras. la detección y el monitoreo de los hongos de organismos protistas como Spongospora y Plasmodiophora puede llevarse a cabo mediante bioensayos. el grupo más grande de hongos encontrados en el suelo son los pyrenomycetes anamorfos (Krik et al. tres o más muestras compuestas podrán colectarse en cada punto de muestreo. las muestras del suelo deberán trasladarse al laboratorio utilizando un recipiente con aislamiento. EVALUACIÓN DE LOS HONGOS DEL SUELO: PROCEDIMIENTOS BASADOS EN CULTIVOS Todos los métodos propuestos dependen de muestras del suelo y no contemplan el uso de raíces para aislar hongos del suelo. MUESTREO DE SUELO Utilizando un nucleador se extraen pequeñas cantidades de suelo. etc. azadón. La hojarasca deberá ser removida justo antes de extraer la muestra. Hongos del suelo saprófitos y patógenos de plantas 249 . en caso de que se haya previsto realizar otros análisis físicos y químicos del suelo. pertenecen a los plectomycetes. También se recogerá una segunda muestra compuesta de alrededor de 200 g. Algunos de los ascomycetes como Aspergillus y Penicillium que habitan en el suelo. pueden resultar contraproducentes para la recuperación de especies de hongos. discomycetes.

Edena et al. tomate o papa. 250 Manual de biología de suelos tropicales . en la última ilustración F). después se comprueba la presencia de micelio en el cebo. Otra técnica con sustrato susceptible utiliza muestras de suelo húmedo de 0. Las hojas de zacate como cebo pueden ser sustituidas por pedazos de frutas o verduras como pepino.. Especies de Pythium y Phytophthora pueden causar serios daños a plantas cultivadas. Pueden llevarse a cabo ensayos cuantitativos utilizando la frecuencia de la colonización relativa de los tejidos del cebo entre las réplicas de cada muestra de suelo. la C) muestra un cultivo puro en el cebo y en la D) se observa el esporangio de Phytophthora. las porciones de agar que contengan micelio serán transferidas a placas con agua estéril destilada y con dos mitades de semillas de sorgo. Las muestras son incubadas durante tres a cinco días a 25°C en la oscuridad. finalmente. 1983. La ilustración A) representa una muestra de suelo con cebo. 1970. la B) una muestra de agua con cebo.Oomycota: uso de cebos para el aislamiento de Pythium y Phytophthora Para poder recuperar del suelo los oomicetes es aconsejable el uso de plantas susceptibles o tejidos vegetales. Tsao et al. 2000).5 g colocadas en tubos de ensayo de vidrio esterilizado con 3 ml de agua estéril.. se observa la liberación de zoosporas de Pythium. agar dextrosa y papa (ADP) o agar de papa y zanahoria (en el caso de Pythiaceae) (véase Apéndice 8. Los tejidos infectados deben transferirse en agua estéril con el antibiótico cloranfenicol durante unas horas. El micelio en crecimiento se verifica directamente mediante montajes con agua en un microscopio o se transfiere del cebo al medio de aislamiento (AHM) que contiene cloranfenicol (50 mg L-¹) y benomil (10 mg L-¹) (Marks y Mitchell. mientras que el oogonio y anteridio de Pythium se ilustran en E)”. Después de incubar durante tres a cinco días. El micelio del hongo formado en el sustrato deberá traspasarse a charolas con el medio MP5 (en el caso de Saprolegniaceae) y agar con harina de maíz (AHM).1 para la composición del medio). Este procedimiento deberá continuarse durante varias semanas. Chytridiomycetes) de muestras ambientales aparece en la ilustración 6. Se esterilizan en autoclave fragmentos de hojas de zacate y se añaden a los tubos como tejidos para recuperar el Pythium spp. Alícuotas de 2 g de suelo se traspasan a cajas Petri que contienen agua estéril destilada. 1998. Se añaden granos de sorgo como cebo y se incuban por cinco días.. Al final de dicho procedimiento se deberá observar que se obtiene únicamente un aislamiento para cada placa. en la sección de color de este manual. El aislamiento de hongos zoospóricos (Oomycetes. Gams et al.

Después de un periodo de incubación de 48 horas a 25°C.Uso de cebos para el aislamiento de Chytridiomycota Para evaluar los Chytridiomycota se usan las mismas técnicas empleadas para los oomicetos. se evalúa la frecuencia de la colonización en las partículas del suelo y el micelio se transfiere a ADP para su eventual caracterización (Sneh et al. la caracterización e identificación se hace directamente en el cebo. compilados por Sneh et al. a 25°C.5 mm. y pedazos de frutas y verduras (Gams et al. se lavan con agua destilada durante Hongos del suelo saprófitos y patógenos de plantas 251 . se verifica el crecimiento típico de Rhizoctonia.. Técnica de cebo Se mezcla 1 g de semillas de betabel con 100 g de suelo húmedo en cajas Petri. en suelos de jardines de eucaliptus clonados fue descrito recientemente por Sanfuentes et al. (1991). Como el aislamiento de colonias individuales en un medio de cultivo axénico es difícil. se presentan dos métodos de aislamiento útiles. (2002). Después de un periodo de incubación de 24 a 48 horas. Los cebos más apropiados incluyen cáscara de camarón. se recuperan las semillas con un tamiz de 1.5 mm. se describen varios métodos. 1998). Un método para evaluar la densidad de inóculo de Rhizoctonia spp. 1991). posteriormente. Método de partículas de suelo Una suspensión de 10 g de muestra de suelo y agua de la llave es agitada. los cebos pueden transferirse a viales. alas de insectos. A continuación.. después decantada usando un tamiz de 0. Basidiomycota – Rhizoctonia: técnica de cebo y aislamiento directo de partículas de suelo Para evaluar este género de basidiomicetes anamórficos del suelo. Para su preservación. piel de serpiente. Las partículas de suelo retenidas se secan con papel absorbente estéril y se transfieren a una caja Petri de 15 cm de diámetro que contenga un medio de agar con agua acidificada (al 2%) con 250 mg L-¹ de cloranfenicol. El suelo retenido se resuspende y se pasa varias veces por el tamiz.

. La frecuencia de colonización de partículas de suelo para cada especie de hongos es utilizada en ensayos cuantitativos.. A pesar del uso común de varios métodos para el aislamiento de Rhizoctonia de muestras de suelo agrícola. por el grupo de investigadores involucrados en el proyecto. el sobrenadante se desecha y se repite el procedimiento dos veces. 0. Cuando se emplea ciclosporina se logra una supresión casi completa 252 Manual de biología de suelos tropicales . El crecimiento de Rhizoctonia se verifica y se transfiere micelio a ADP para su aislamiento y caracterización (Papavizas et al. el empleo de técnicas de cultivo independiente. que contenga 100 mg L-¹ de cloranfenicol. como la amplificación de DNA ribosomal de Rhizoctonia con iniciadores (en inglés. utilizando un juego de tamices de 1. Todas estas especies exhiben una fase saprotrófica en el suelo y pueden ser aisladas utilizando una metodología con placas de suelo. La técnica de lavado de suelo es un método adecuado para el aislamiento de estas especies. Los coloidales de suelo y granos de arena son removidos del último tamiz. ha mostrado severas limitaciones debido a la continua presencia de Trichoderma spp. Las partículas de suelo prelavadas son filtradas. fitopatógenas y sus antagonistas. se secan con papel absorbente estéril para ser transferidas a un medio de agar con agua al 2%.5 mm y 0. Ascomycota: técnica de lavado del suelo y filtración de partículas Éste es el mayor grupo de hongos del suelo que incluye especies saprófitas. 2002). 1975). secados con papel absorbente esterilizado y transferidos (7 partículas por placa) a 5 cajas Petri (90 mm) que contienen el medio de aislamiento AHM (30 g L-¹). Después de la sedimentación de las partículas del suelo durante 2 minutos. 0.21 mm usando agua destilada (alrededor de 2 litros) por 2 minutos.20 minutos.7 mm.0 mm. entomopatógenas. en estos suelos. su aplicación en el estudio de suelos bajo vegetación natural. De esta manera. primers) específicos y su análisis cualitativo e incluso cuantitativo puede resultar idóneo bajo circunstancias específicas (Lees et al. para la inhibición de hongos de rápido crecimiento. más estreptomicina plus (50 mg L-¹) para la inhibición de bacterias y ciclosporina (10 mg L-¹) o rosa de Bengala (70 mg L-¹). Técnica de lavado Una muestra de 10 g de suelo mineral se agita con 200 ml de agua destilada en una centrífuga a 180 rpm durante 10 minutos.

2003). Ascomycota: medios selectivos y técnica con cebo Para un aislamiento selectivo de grupos blanco o especies de hongos del suelo. 1985. Gams et al. La técnica es muy simple y se han descrito varias modificaciones. 1988. 1986. Por lo tanto. modificado con antibióticos como cloranfenicol. una cantidad conocida de suelo es suspendida en agua estéril. Un gran número de medios selectivos ha sido desarrollado para el aislaHongos del suelo saprófitos y patógenos de plantas 253 . 1983). cuando se trata de estudiar este último grupo de hongos. 1985). El método de dilución del suelo en placa Este es el método de uso más común para el aislamiento y estimación cuantitativa de bacterias y hongos. se toma 10% de la suspensión. el resultado es una estimación del número de propágulos de hongos por gramo de suelo (Bills et al. 1994. Lang y Jagnow. rutinariamente se utilizan medios selectivos..de zygomycetes saprotróficos. Gams. Las alícuotas de la dilución final son distribuidas en cajas Petri que contienen un medio de agar generalmente. hasta lograr la dilución final. 2004). Básicamente. Existe una preocupación generalizada porque el método de dilución en placas muestra un sesgo hacia los hongos que son capaces de producir grandes cantidades de esporas y que crecen muy rápido en un medio de cultivo rico. Se pueden lograr medidas cuantitativas multiplicando el promedio de las unidades formadoras de colonias (UFC) en las placas. Kacprzak y Stanczyk-Mazanek. la cual se mantiene en agitación durante unos momentos. 1998. De esta suspensión se prepara una serie de 10 diluciones. por el factor de dilución empleado. éstos pueden contener fuentes de carbono preferiblemente metabolizados por algunos grupos fisiológicos de hongos o pueden modificarse con químicos que inhiben el crecimiento de organismos no deseados. Bååth. 1992. y que tienen poca habilidad de competir con especies de rápido crecimiento en medios axénicos son subestimados por esta técnica (Bååth. Tsao et al. la diversidad de hongos que normalmente existen en forma de micelio que crece activamente en el suelo. Este método se puede observar en la ilustración 7. Por lo tanto.. 1988. estreptomicina o penicilina para inhibir el crecimiento de bacterias. se debe evitar el uso de ciclosporina (Dhingra y Sinclair.. Un factor final de dilución de 10-4 ó 10-5 se considera adecuado para el aislamiento de hongos (Dhingra y Sinclair. Bills y Polishook.

Dhingra y Sinclair. 2001). basidiomycetes y oomycetes del suelo.miento de varios géneros de ascomycetes. Tsao et al. Ejemplos de cebos utilizados para el aislamiento selectivo de hongos del suelo son tejidos de plantas para el caso de patógenos de plantas... Gonçalves et al. Papavizas et al. 1991... 1975. cuyo protocolo se describe a continuación.. El aislamiento selectivo de los hongos del suelo también puede llevarse a cabo con cebos que son colonizados por grupos fisiológicos específicos de hongos. después se transfiere a un medio selectivo de agar para su posterior aislamiento de los hongos deseados.. Edel et al... Dackman et al.. 2002b). el medio usado es Komada (Masago et al. Thorn et al. 1977. cabello para las especies queratinofílicas. 1998. En el laboratorio se utilizan hojas de ricino (Ricinus communis) como cebo para el aislamiento de hongos del complejo Cylindrocladium de manera rutinaria. 2003. Procedimiento para el aislamiento para el aislamiento de Cylindrocladium y géneros afines del suelo. mientras que para Fusarium spp. especies de Cylindrocladium y de las especies relacionadas Cylindrocladiella y Gliocladiospsis raramente son reportadas en muestras de suelo que emplean el método de dilución del suelo por placas. utilizando como cebo hojas de Ricinus communis Cylindrocladium es un género conformado por especies saprotrófitas y patógenas de plantas comúnmente encontradas en el suelo..1987.. Sneh et al. 2001.. Hojas jóvenes y frescas se recogen y se lavan bajo agua de la llave para posteriormente ser sometidas a una desinfección con etanol al 70% durante un minuto. La colonización del cebo por un hongo clave también puede llevarse a cabo mediante la observación directa al microscopio (Gams et al. 1985. 254 Manual de biología de suelos tropicales . Como el Cylindrocladium y probablemente otros géneros son sensibles a la ciclosporina. Wellington et al. 1991. en particular. 1970. quitina para los productores de quitinasa. En la mayoría de los casos. aquéllos que contienen especies patógenas de plantas. Sneh et al. 2002. larvas de insectos para los entomopatogénos y nematodos para los hongos nematófagos (Marks y Mitchell.. para el aislamiento de Rhizoctonia solani se utiliza agua-agar acidificada. 2000.. 1998). Pettitt et al. Edena et al. Gams et al. varios materiales de plantas adecuados para su aislamiento fueron descritos en una monografía reciente (Crous. 1983.. el tejido cebo es incubado con una muestra de suelo durante unos días. por ejemplo. 1996. deberán aislarse selectivamente usando cebos. A pesar de ello. Barratt et al. 2003).

(2007) aún sigue siendo una fuente importante para todos los involucrados en el estudio de hongos del suelo. Las dificultades de identificar a nivel de especie se ilustran con el género Fusarium. Después de más de 20 años. es recomendable para su aislamiento el uso de plántulas de tomate como cebo. donde diariamente se verifica la esporulación típica de Cylindrocladium. Crous. bajo un microscopio estereoscópico (Gams et al. que es un grupo heterogéneo que incluye saprófitos. Cylindrocladiella. después de tres días de incubación se lavan las hojas cuidadosamente con agua destilada y se transfieren a una cámara húmeda. durante 30 segundos). síntomas de podredumbre. Técnica de cebo para el aislamiento de patógenos fúngicos de plántulas Una amplia gama de hongos patógenos de plantas en el suelo puede causar la muerte prematura de las plántulas. Los tejidos de plántulas infectadas se esterilizan con hipoclorito de sodio (al 2%. Las hojas enteras se colocan un una caja Petri de 15 cm y se cubren con una capa de suelo húmedo. 2001. Gonçalves et al. 2002b). tal como ADP y AM (agar extracto de malta) que contiene cloranfenicol (250 mg L-¹). El trabajo de Barnett y Hunter (1998) es usado para unos pocos de los muchos saprófitos. Las hojas utilizadas sin desinfección previa tienden a ser degradadas con mayor rapidez y a ser colonizadas por bacterias.. Hongos del suelo saprófitos y patógenos de plantas 255 . Gliocladiospsis y otros géneros relacionados. este compendio contiene claves para especies de varios géneros importantes y una recopilación de la literatura. durante dos minutos. por lo tanto. endófitos y patógenos de plantas. enseguida se lavan con agua destilada y se secan en papel absorbente esterilizado para ser transferidas a un medio de aislamiento. IDENTIFICACIÓN DE HONGOS DE SUELO La identificación de hongos que habitan el suelo puede causar problemas para aquéllos que no tengan suficientes conocimientos de micología. el amplio trabajo de Domsch et al. 1998.seguida de hipoclorito de sodio al 3%. Además de las claves y monografías de alrededor de 250 géneros. Las semillas de tomate se germinan en 100 g de suelo y se verifica si las plántulas manifiestan o no. El aislamiento del hongo se logra con la transferencia de esporas a un medio de cultivo. utilizando agujas finas de cristal. incluyendo hongos del suelo..

algunos tipos de hongos como Basidiomycota son difíciles de aislar y pueden no esporular en un medio axénico (Thorn et al. 1968. sin embargo. Trichoderma (Bissett. b) pueden ser un buen punto de partida. Las herramientas moleculares basadas en el análisis del DNA han sido aplicadas con éxito en el estudio de complejos bacterianos y. 1976) y coelomycetes anamórficos (Sutton.. 1983. (1998). 2004). éstos incluyen técnicas específicas de DNA. las monografías y claves de Hanlin (1990. 1998a. sí. EVALUACIÓN DE HONGOS DEL SUELO: TÉCNICAS ESPECÍFICAS DE DNA Una medida confiable de las comunidades de hongos del suelo. 1993. 2001. 1970. Tsao et al. 2001).Monografías y páginas web se encuentran disponibles para identificar las especies de Aspergillus. 1967. (2000) o el manual de Gams et al. La monografía de Sheh et al. se puede consultar el Dictionary of the Fungi (Kirk et al.. (Klich y Pitt 1988). hifas anamórficas pigmentadas (Ellis. 2006). recientemente. 2002b). 1980. 1996).. 2000). 1996).. Samson et al. Cylindrocladium (Crous.. en ensambles de hongos a partir de muestras ambientales. Fusarium (Leslie et al. van der Plaats-Niterink. Para más instrucciones acerca de cómo identificar hongos o grupos específicos de hongos. Existen monografías disponibles para chyrids (Karling 1977) y también para el género Pythium (Waterhouse. Erwin y Ribeiro. Bills et al.. No obstante.... Samuels et al. (1991) resulta útil para trabajar con Rhizoctonia. c. 1993). 1991a. (página web).. Penicillium (Pitt. 1983. 1981) y para Phytophthora (Waterhouse. 1971. Muyzer et al. Nag Raj. requiere de un laborioso programa de aislamientos sistemáticos con diferentes medios de cultivos y estrategias de aislamiento que reflejen la inmensa diversidad taxonómica y fisiológica de grupos de hongos que habitan en el suelo (Tsao et al. Se pueden utilizar otras metodologías para complementar los enfoques tradicionales usados para un mejor entendimiento de la diversidad y dinámica de los hongos del suelo. 1984. No son específicas para el caso de hongos del suelo. b. de mucha utilidad para este tema otras recopilaciones y monografías como la de Ellis y Ellis (1985). Bridge y Spooner. Si se trata de identificar ascomycetes. Una lista de referencias de guías y manuales para la identificación de grupos de hongos de suelo puede consultarse al final de este capítulo. Las secuencias de DNA son amplificadas directamente desde el suelo por medio de la reacción en cadena de 256 Manual de biología de suelos tropicales .

incluso como micelio o esporas. principalmente. Las muestras muy pequeñas (menores a un gramo) deben usarse con precaución porque tienen mayor probabilidad de error. facilitando la amplificación de pequeñas muestras de DNA. Los protocolos de extracción se basan. 2001). es la extracción del DNA directamente del suelo. 2001). Varias copias del DNA ribosomal (rDNA) se encuentran en el genoma eurocariota. Las células de los hongos presentes en la muestra del suelo. Los kits para la extracción de DNA del suelo están comercialmente disponibles.. este paso se logra mediante separaciones a través de columnas de separación o con el uso de kits comerciales de purificación de DNA (Liu et al. La heterogeneidad encontrada a nivel de micro-escala en el suelo debe ser considerada cuando se selecciona el tamaño de la muestra de suelo sometida a la extracción total de DNA.. Viaud et al. 2001). El rDNA también contiene espaciadores entre las regiones codificantes conocidos como espaciadores internos de transcripción (ITS) que presentan secuencias de bases menos conservadas y que pueden utilizarse para la diferenciación entre especies relacionadas o para evaluar Hongos del suelo saprófitos y patógenos de plantas 257 . 5. Uso de Primers específicos para “hongos” El grupo de genes para las moléculas de RNA Ribosomales 18S. El total de DNA obtenido debe estar completamente purificado para eliminar sustancias húmicas y fenólicas que interfieren con el PCR..la polimerasa (PCR) y posteriormente caracterizadas utilizando varios enfoques (Bridge y Spooner. Bridge y Spooner.8S y 28S se considera que son altamente conservados entre los organismos eucarióticos y normalmente se emplean como marcadores moleculares. debido a una variabilidad más alta dentro de la muestra (Ranjard et al. La identificación de secuencias de DNA desconocidas también puede realizarse comparándolas con bases de datos de secuencias de nucleótidos de taxones conocidos. Extracción de DNA Un paso crucial antes del PCR. tienen que estar correctamente lisadas. 1997. en los procesos físicos de macerado asociado con calor y lisis química. 2000. Reacción en cadena de la polimerasa. El polimorfismo en la longitud del DNA y la variación en la secuencia de las bases pueden utilizarse para agrupar organismos de acuerdo con su origen y relación evolutiva.

Los Primers permiten la amplificación de una amplia gama de especies de hongos sin perder la especificidad de este grupo clave. Algunos hongos que están presentes en muy bajas densidades en suelos naturales.. 2002. 2001).. Baayen et al. tales como especies de Phytophthora. Por 258 Manual de biología de suelos tropicales . 2000.. los Primers que son específicos para amplificar PCR del DNA de hongos de muestras complejas de suelo. Lees et al. Basándose en las secuencias de genes de RNA ribosomal disponibles en bancos de datos especializados para varias especies de hongos. 2003). El DNA clonado es secuenciado y comparado con las bases de datos que contienen secuencias oligonucleotídicas del rDNA fúngico mediante análisis de software.. Filion et al. los amplicones de tamaño correcto pueden separarse en geles de agarosa. Down. Para este tipo de investigación se han desarrollado varios iniciadores especie-específicos para una detección directa y el monitoreo de patógenos de estas plantas a partir de muestras del suelo (Cullen et al. utilizando Primers específicos para Géneros y/o especies de interés (Nechwatal et al. En el caso de estos hongos.. no son adecuados para la evaluación de muestras ambientales complejas. el obtener Primers o iniciadores de rDNA de hongos específicos constituye un paso fundamental en la amplificación del PCR. han sido desarrollados y compilados por Anderson y Cairney (2004). Como el suelo contiene un gran número de organismos. 2002. ya que el PCR tiende a amplificar moléculas del DNA que son dominantes en el extracto del DNA total. extraídos de matrices de gel. además.. 2000. purificados.. Secuenciación del DNA Para poder conocer las identidades del DNA de los hongos amplificados por PCR. 2003).. la detección molecular de muestras de suelo puede ser mejorada mediante el uso de técnicas de cebo en conjunto con PCR. La detección y/o cuantificación de pocas especies específicas de hongos es requerida generalmente en el campo de la fitopatología. conectados a vectores plásmidos y clonados en células bacterianas. son difíciles de detectar por métodos moleculares. Borneman y Hartin. Estos procedimientos son caros. Anderson et al. 2000. consumen tiempo y. 1999. algunos de estos Primers específicos han mostrado que amplifican DNA no fúngico o muestran preferencia hacia la amplificación de grupos taxonómicos específicos dentro del reino de los hongos (Smit et al.divergencias genéticas intraespecíficas (Viaud et al. Sin embargo. 2002).

. Basidiomycota. pero difieren en su contenido de Guanina-Citosina (GC). Por lo tanto. Método de huella molecular TGGE y DGGE La electroforesis en gel con gradiente de desnaturalización fue introducida en estudios sobre ecología microbiana por Muyzer y Smalla (1998). Los amplicones tienen exactamente el mismo número de nucleótidos. presentan diferentes comportamientos de desnaturalización y migran hacia diferentes puntos en el gel (Muyzer et al. Los patrones de bandeo generados son utilizados para analizar complejas comunidades de hongos del suelo. Hongos del suelo saprófitos y patógenos de plantas 259 . Milling et al. Los iniciadores usados en el PCR.ello. generalmente. Las restricciones y limitaciones están representadas en la selección de Primers utilizados en el primer paso de amplificación después de la extracción total del DNA de las muestras.. al igual que para monitorear modificaciones o impactos debidos a prácticas agrícolas o actividades industriales (Smit et al. 2002. moléculas de DNA con diferentes secuencias en sus pares de bases. En varios estudios se ha usado esta técnica para evaluar la estructura de la comunidad de hongos y otros microorganismos. El gradiente de desnaturalización en DGGE puede variar con el uso de diferentes cantidades de urea y de formamida en la matriz del gel. En esta técnica. pero con diferentes secuencias de pares de bases. parcialmente desnaturalizadas debido a las diferencias de la desnaturalización de los dominios menos estables en las moléculas. Gomes et al. Viaud et al. el DNA se extiende a la misma longitud (como resultado del PCR). 1999. Vandenkoornhuyse et al. Varias combinaciones de Primers han sido propuestas para amplificar DNA de distintos grupos de hongos como Ascomycota.. 2000. 2003. Bajo estas condiciones de desnaturalización.. 1993).. contienen un DNA con bases repetitivas de GC que resultan menos propensas a la desnaturalización debido a su alta estabilidad química. y se llaman dominios de fusión.. 2000. 2003). lo que determina el modo de desnaturalización y la movilidad electroforética al migrar en el gel desnaturalizante. Anderson et al. se han desarrollado técnicas moleculares de huella o rastreo molecular (en inglés fingerprint) para estudiar la diversidad a nivel de comunidad (Borneman y Hartin. 2004). Elsas et al... 2000. las moléculas 18S DNA amplificadas por PCR son sometidas a una electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) o con un gradiente desnaturalizante (DGGE).

después de la amplificación del DNA por PCR directamente extraídos del suelo utilizando Primers género-específicos (Nechwatal et al. 2001). Las especies de hongos relacionadas pueden identificarse de acuerdo con sus patrones típicos de RFLP... El uso de un PCR anidado puede arrojar aún mejores resultados e incrementar la resolución en la separación de los productos del PCR (Oros-Sichler et al. la restricción enzimática del DNA antes de la electroforesis puede utilizarse en una técnica conocida como polimorfismo de longitud de fragmentos de restricción (RFLP) del DNA amplificado por PCR (Viaud et al. (1997) desarrollaron una versión complementaria del PCR-RFLP. Se puede construir una base de datos de TRFs a partir de especies de hongos conocidos y utilizarla en corre260 Manual de biología de suelos tropicales . 2006). T-RFLP Liu et al... tales como TGGE y DGGE. los análisis bioquímicos y las técnicas de aislamiento. el DNA es amplificado por PCR con uno de los dos Primers marcados con fluorescencia. Los fragmentos de restricción terminal (TRFs) se marcan con fluorescencia y pueden ser detectados y cuantificados en un secuenciador automático. 2004). el DNA es tratado con enzimas de restricción y los fragmentos de restricción separados en un gel de acuerdo con su tamaño. los enfoques polifásicos que incluyen la construcción de bibliotecas de fragmentos clonados. Para incrementar el polimorfismo de la banda y mejorar la resolución. 2006. llamada polimorfismo de longitud de fragmentos de restricción terminal para el análisis (T-RFLP) de comunidades bacterianas de muestras ambientales. la comigración de diferentes moléculas de DNA hacia un mismo punto en el gel. Otra limitante es que el DNA obtenido de organismos filogenéticamente distantes puede producir productos de PCR con una movilidad electroforética idéntica (Gomes et al. Singh et a. el método de huella molecular. 2006).. son la mejor opción (Malosso et al.Chytridiomycota. Técnica PCR-RFLP La escasa variabilidad de rDNA de hongos puede resultar desventajoso en la técnica de huella molecular. la técnica puede proporcionar un estándar altamente reproducible de un gran número de muestras ambientales durante un periodo de tiempo relativamente corto. En el T-RFLP.l. Recientemente. Después de la amplificación. Zygomycota y Oomycota (Nikolcheva y Bärlocher. 2003). No obstante. por ejemplo. 2000).

En estos esHongos del suelo saprófitos y patógenos de plantas 261 . Como consecuencia. están enfocados en una o en pocas especies de hongos presentes en el suelo. En el polimorfismo de conformación de cadena sencilla (SSCP). Kennedy et al. 1996. SSCP Otro estudio de huella molecular utiliza la migración diferencial de moléculas de una hebra de DNA en un gel para poder estudiar a las comunidades microbianas más complejas.laciones taxonómicas con los haplotipos detectados en el análisis T-RFLP (Brodie et al. Edel-Hermann et al. El ARISA de hongos es una técnica altamente sensible. el polimorfismo intra-específico del ITS puede presentar problemas en la separación de distintas especies filogenéticas (O’Donnell y Cigelnik. En el análisis automatizado del espaciador intergénico ribosomal (ARISA). 2000. La Tabla 8. pero disímiles en su secuencia de pares de bases pueden ser fácilmente separados en SSCP por su diferencial de migración en el gel cuando existe la conformación de una sola hebra (Lee et al. ARISA El polimorfismo natural de la región ITS del rDNA entre especies de hongos puede utilizarse para la evaluación de comunidades de hongos de suelo. Las moléculas de una sola hebra de DNA adquieren estructuras con dobleces únicos dictados por sus secuencias nucleotídicas y migran hacia puntos específicos en el gel. el DNA amplificado es completamente desnaturalizado antes de ser sometido a una corrida de electroforesis.. sin embargo. los fragmentos de DNA del mismo largo.. 1997. 2003. Lowell y Klein 2001. PCR cuantitativo Algunos estudios. Singh et al. 2005. el DNA fúngico es extraído del suelo y amplificado por PCR utilizando Primers específicos para la región ITS con uno de los Primers marcados con fluorescencia. 2005).. 2001). 2004. Kennedy et al.. 2005). 2006). He et al... los diferentes fragmentos de ITS son separados en un gel y posteriormente detectados y cuantificados en un secuenciador automático (Ranjard et al. Viaud et al. especialmente con hongos patógenos de plantas.1 muestra algunos ejemplos de técnicas moleculares empleadas para el estudio de comunidades de hongos del suelo publicadas en años recientes.. Después de la amplificación...

. por lo tanto. el incremento de moléculas de DNA durante la amplificación conlleva un incremento en la intensidad de la emisión fluorescente. Después de esta amplificación. Las sondas fluorescentes son capaces de emitir fluorescencia en la presencia de DNA de dos hebras. la cuantificación del DNA de hongos en el suelo es requerida frecuentemente para estudios epidemiológicos y ecológicos. No obstante. 1992... 2002). lo cual puede calibrarse y medirse con precisión. La cantidad de DNA en la muestra puede calcularse con la adición de diferentes cantidades de DNA competitivos. Además de la detección molecular. En el caso de ensayos cuantitativos. 2003). Esta técnica es más rápida y más sencilla que cPCR porque no existe la necesidad de construir un competidor de DNA y no se requiere de ningún análisis post-PCR (Cullen et al.. Li y Hartman. los distintos productos de PCR son cuantificados por separado de acuerdo con sus intensidades de bandeo relativas en geles de agarosa. Filion et al. 2003). 2002.. 2000.. fragmentos de DNA que contienen los mismos sitios iniciadores que la muestra de DNA son añadidos en cantidades conocidas a las reacciones del PCR y coamplificados con el DNA específico. Sondas fluorogénicas o colorantes adicionados al PCRs permiten el monitoreo correcto de los productos obtenidos durante la amplificación. Mauchline et al. En el cPCR. Lees et al. Mauchline et al. 2002. 2002. a una cantidad estándar de una muestra de DNA en una serie de PCRs y con el monitoreo de productos PCRs competitivos producidos en cada reacción (Siebert y Larrick. 1998. Una curva estándar puede construirse con cantidades conocidas de DNA e intensidades de fluorescentes.. se deben diseñar Primers de PCR específicos para obtener la amplificación correcta del DNA de la especie clave y otros marcadores moleculares pueden ser empleados como secuencia del gen β-tubulina o el factor de elongación de traducción del gen EF 1-α (Baayen et al. 262 Manual de biología de suelos tropicales . han sido desarrolladas modificaciones del PCR convencional como PCR competitivo (cPCR) y PCR en tiempo real. el PCR convencional es inapropiado para enfoques cuantitativos porque cualquier pequeña variación durante la fase exponencial en la reacción de amplificación puede alterar drásticamente las cantidades de los productos del PCR. Filion et al. Otro método empleado en aproximaciones cuantitativas es el de PCR en tiempo real.tudios. Después de un número definido de ciclos de PCR éstos se usan para cuantificar el DNA directamente de muestras de suelo. Baek y Kenerley. 2003.

2005 DGGE SSCP y TGGE ARISA y T-RFLP DGGE con iniciadores específicos para Fusarium DGGE y T-RFLP Singh et al. Rizósfera de dos cultivos de maíz durante el periodo de ciclo de vida de la planta. Técnica* TGGE PCR-RFLP SSCP ARISA DGGE Evaluación de comunidades de hongos en Rizósfera y suelo compuesto con trigo. Tres diferentes suelos cultivados con Lolium perenne.. 2005 Kennedy et al. Pastizales bajo diferentes tipos de vegetación. Gradiente de suelo desde llanuras hasta bosques de pino escocés.. Suelos de bosque natural y plantaciones de pino hoop..... Gradiente de pastizales semi-naturales a suelos agrícolas mejorados. 2004 Milling et al.. Análisis de la dinámica de comunidades de hongos del suelo vía PCR hongoespecíficos del DNA del suelo. 2004 He et al. Suelos con diferentes propiedades fisicoquímicas.1 Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes. 2000 Lowel y Klein..Tabla 8.. amplificados del DNA total. Referencias Smit et al. 2004 Edel-Hermann et al. Una muestra de suelo por métodos de cultivo y molecular. 2006 Hongos del suelo saprófitos y patógenos de plantas 263 . 2003 Brodie et al. Diferentes horizontes de un suelo de selva. 2003 Agnelli et al... 2001 Ranjard et al. análisis de detección y diversidad de especies de Fusarium. Campos de espárragos. 2003 Gomes et al. seguido por DGGE. 2000 DGGE DGGE y TRFLP DGGE y restricción de DNA amplificado DGGE T-RFLP Anderson et al. Suelos bajo cultivos de papa transgénica y no transgénica.. 2005 Yergeau et al. los efectos de cambiar el suelo al añadir composta o excremento.. Suelos con diferentes propiedades fisicoquímicas. 1999 Viaud et al.. Suelo estepario con pasto corto con o sin presencia de nitrógeno. 2001 Elsas et al.

1 Continúa. generalmente. amplificación y secuenciación de contaminantes de hongos e incluso. los enfoques taxonómicos de hongos basados únicamente en datos moleculares. lo que origina errores en identificaciones morfológicas. requieren de una secuenciación y comparación utilizando bancos de datos de DNA al alcance del público. exagerado. invariablemente. Técnica* DGGE y ARDRA Evaluación de comunidades de hongos en Diversidad de hongos en suelos antárticos que combinan cultivo de aislamiento. pero una mejor caracterización y análisis filogénico de taxas dominantes. como hongos micorrízicos arbusculares. 1992. Hawksworth.Tabla 8. Otra limitación del enfoque molecular basada en la amplificación del DNA es la falta de conocimientos acerca de la actividad de crecimiento o grupos funcionales 264 Manual de biología de suelos tropicales .. por lo tanto. Sin embargo. Incluso la mayoría de los hongos patógenos de plantas no son parásitos obligados. no se aplica en el caso de hongos saprófitos. de estudios sobre la diversidad bacteriana y. sin duda. contienen las mismas limitaciones que las técnicas de cultivos para hongos (Selenska y Klingmüller. 2006 Nota: * la clonación del DNA y la secuenciación fueron usadas por todos los autores para la identificación de haplotipos dominantes amplificados del DNA total. Tsai y Olson. huella molecular y técnicas de clonación. pueden presentar algunos problemas debido a que los bancos de datos pueden estar incompletos y puede que las secuencias de DNA se encuentren mal identificadas. 1992. en el caso de los hongos el número de especies no cultivables es. O’Donnell et al. principalmente. 2003. Las técnicas de huella molecular en comunidades puede monitorear composiciones complejas de hongos de suelo. 2002a. No obstante.. en la secuenciación de quimeras (Crous. Muchos obstáculos para la identificación basada en cultivos han sido superados con la llegada de técnicas de aislamiento más sofisticadas como. CONCLUSIONES Las herramientas moleculares para ensayos de comunidades de hongos del suelo fueron extraídas. Bridge et al. por ejemplo.. Referencias Malosso et al. los métodos de lavado del suelo y la filtración de partículas. 1994). tal y como ha sido discutido. este método no se describe para cada ejemplo. 2004b). Lo que puede ser verdad para organismos estrictamente simbióticos.

el análisis de Kruskall-Wallis (Rodrigues. fechas de colecta o diferentes tratamientos de suelo. Se verifica el número de cepas de cada muestra y este dato puede ser usado para comparar entre sitios.de hongos del DNA total extraído del suelo. Otra opción consiste en llevar a cabo un análisis de varianza no paramétrico. 2006. resulta ser un análisis robusto y confiable (Sokal y Rolf. Por el momento. donde el número total de cepas de cada muestra se usa en comparaciones pareadas. 2006). como parámetros físicos y químicos del suelo bajo análisis. Singh et al. pueden añadirse al ANOVA para evaluar sus efectos y sus interacciones con otros datos cuantitativos (Setälä y McLean. los protocolos de extracción del DNA son capaces de lisar y extraer ácidos nucleicos ya sea de micelio en crecimiento activo o de esporas latentes. 2004). por lo tanto.. además del número de cepas. tales como logaritmo o raíz cuadrada pueden aplicarse antes del análisis (Houston et al. las transformaciones de datos. constituye el primer conjunto de datos. Adicionalmente. dado que algunos de los datos no tienen una distribución normal. por ejemplo. otros factores. La forma de las curvas indica si el número Hongos del suelo saprófitos y patógenos de plantas 265 . y también dan información sobre el esfuerzo de muestreo empleado en la investigación. por ejemplo. de acuerdo con la acumulación de las cepas muestreadas. Por medio del ANOVA es posible derivar variaciones entre diferentes muestras y dentro de las muestras (error). Sokal y Rohlf. 1995).. Como se ha discutido. El conjunto de datos preliminares usualmente no es adecuado para hacer los análisis de ANOVA. La prueba de independencia de Chi cuadrada puede usarse para este análisis. las curvas que se forman con más facilidad. Cuando están disponibles datos sobre variaciones cuantitativas entre las repeticiones dentro de las muestras. 1998). Para solucionar ese problema. 1994. 1995). La pendiente de las curvas muestra cuáles son las muestras con mayor riqueza de especies. Las curvas de acumulación de especies o curvas de rarefacción pueden proporcionar comparaciones gráficas de la riqueza de especies entre muestras. ANÁLISIS DE DATOS Una lista de especies o agregados de especies aisladas y su abundancia relativa en cada muestra. un entendimiento más completo sobre las comunidades de hongos del suelo deberá centrarse en enfoques polifásicos con ensayos basados en cultivos y taxonomía molecular en asociación con el estudio de los procesos biogeoquímicos que ocurren en el suelo (Malosso et al. un enfoque más confiable es realizar un análisis de varianza (ANOVA). haciendo difícil la diferencia del crecimiento activo o grupos funcionales basados únicamente en el producto del análisis del PCR. generalmente..

. El porcentaje de la varianza total explicada por el primer eje del AC y la contribución de las especies y muestras a la varianza (inercia) de cada eje apoya la designación de especies que ocurren en la comunidad como clave y “casual” (Howard y Robinson.. explican la mayoría de la variabilidad de datos. 1995). por ejemplo. se elige un límite (por ejem266 Manual de biología de suelos tropicales . 1988. común o rara y a la complejidad de los modelos matemáticos que se basan en la distribución de las especies. y existen casos en donde dos comunidades distintas pueden tener el mismo índice de diversidad. por ejemplo. Los resultados se muestran gráficamente y permiten el análisis de tendencias generales de la estructura de la comunidad (Gauch. Muchos índices se han obtenido para evaluar y comparar la diversidad de especies. 1994). La diversidad de especies de cualquier sistema está compuesta por dos componentes: la riqueza de especies (el número de especies) y la equitatividad o equidad de la frecuencia de especies (Kennedy y Smith. 1995). si las curvas tienden a llegar a una asíntota. En el caso de AC. el análisis multivariado no se lleva a cabo en el total de comunidad debido a la naturaleza “ruidosa” de la frecuencia y a la distribución de especies raras. 1994. 1998. idealmente. 1982. El índice Shannon-Wiener se basa en la riqueza y equitatividad de la diversidad de las especies y se encuentra frecuentemente en la literatura (Dighton. El análisis de correspondencia (AC) y su versión modificada. Bettucci et al. Curvas que no tienden a una asíntota indican que el número de especies podría aumentar si se aumenta el esfuerzo de muestreo (Bills y Polishook. 2003). al igual que en otras técnicas de ordenación.. tales como los métodos de ordenación. La información sobre la estructura de la comunidad es mejor si se usa un análisis multivariado. Grishkan et al. análisis de correspondencia sin tendencia. Persiani et al. las relaciones multidimensionales entre muestras y especies se reducen a un número reducido de ejes que. 1993. Los índices de diversidad son puramente numéricos y no proporcionan información sobre la estructura de la comunidad. De esta manera.). Los índices de similitud (disimilitud) de diversidad para realizar comparaciones pareadas entre diferentes muestras también son usados con frecuencia (Magurran. datos generados de conteos.de especies es estable después de la acumulación de todas las cepas. Howard y Robinson. matrices de datos de gran tamaño (llenas de ceros) y datos de distribución no paramétricos. basándose en su riqueza o equitatividad o tomando ambas variables y éstos cambian en función de la importancia relativa que se da a la especie dominante. De manera general. 1995). son métodos de ordenación adecuados para la clase de datos generados de hongos y de otras comunidades.

en donde las matrices son construidas con datos de presencia o ausencia de bandas distintivas (de manera ideal para especies diferentes) en los geles y la estructura de la comunidad es analizada posteriormente (Fromin et al. Oros-Sichler et al. Los métodos de ordenación de análisis de componentes principales y análisis de correspondencia. Ryan y Smith. Bettucci y Alonso.. Las colecciones de recursos genéticos hoy en día son solicitadas en todo el mundo. 2002. Agradecimientos Al profesor Richard Mibey y a la Dr. con el objetivo de la preservar las especies ex situ y de suministrar a instituciones de investigación e industrias de este material.plo. PRESERVACIÓN Y COLECCIÓN DE RECURSOS GENÉTICOS Los inventarios de biodiversidad proporcionan argumentos y algunas bases científicas para la preservación de hábitats y el uso sustentable de suelos. por lo tanto. 1995. 2002). 0. En el futuro.. 2003). para la preservación a largo plazo de especímenes de resguardo será fundamental validar las entradas de secuencia y bases de datos genómicas. El estatus actual de las colecciones de recursos genéticos de hongos y los retos para apoyar la necesidad de la genómica de hongos. Bettucci et al. Las colecciones de referencia deberían ser apoyadas por países con una política fuerte en ciencia y tecnología dado que contienen información acerca de la distribución geográfica y de los hospederos. 1992. Sheila Okoth por sus comentarios y discusiones durante la preparación del capítulo. así como el análisis de conglomerados (cluster). 1% ó 5% del número total de aislamientos) y únicamente aquellas especies con una frecuencia de aislamientos igual o superior a este límite son incluidas en el análisis (Gauch. 1993. por lo que proveen material de trabajo básico para quienes estudian las características y la variación. 2004a. Hawksworth. Hongos del suelo saprófitos y patógenos de plantas 267 . 2004). la biología molecular y la conservación de hongos han sido revisados recientemente (Hawksworth. Kirsop.5%. 2006). como en el caso de la publicación de nuevos nombres (Agerer et al. 1996). son normalmente empleados para derivar resultados procedentes de los métodos de huella molecular.. 1996.. es necesario que sean recopilados. al igual que las aplicaciones prácticas y económicas de las especies (Smith y Waller. 1982.

. R. (2003) ‘Always deposit vouchers’ Mycological Research. R. R. (1997) ‘Agricultural intensification. G. Applied Soil Ecology.. R.. vol. C.. pp. 36. J. vol. S. pp. Halling. J. D. 642-644. 891–900.. G. Bettucci. (2003) ‘Potential bias of fungal 18S rDNA and internal transcribed spacer polymerase chain reaction primers for estimating fungal biodiversity in soil’. Mueller. E. P.P. L.. vol. G. 36–47. vol. 104. P. D. Ascher. 6. vol. Rambold. S. (2004) ‘Diversity and ecology of soil fungal communities: Increased understanding through the application of molecular techniques’.. I. Environmental Microbiology.. Robson. S. D.. Weiss.. y Oberwinkler. Ceccherini. y Alonso. Soil Biology and Biochemistry. y Kenerley. y Prosser. vol. Cigelnik.. J. F. L. 268 Manual de biología de suelos tropicales . 41–66. Ammirati. 769–779. Bauer.. Anderson. pp. vol. vol. Anderson. Triebel. Journal of Applied Microbiology. G. 66. 25. J. Barratt.. pp. Vikram Reddy. W.. P. C. C. M.... Gams. the role of decomposer organisms’. vol.. Hawksworth. M. G. 87–108. K. R. E. y Watling. R. L. (2000) ‘Gene genealogies and AFLP analyses in the Fusarium oxysporum complex identify monophyletic and nonmonophyletic formae speciales causing wilt and rot disease’.. W. (1995) ‘The effect of wildfire on the opportunistic decomposer fungal community of Uruguayan Eucalyptus spp. Dejardin. C. 470–480. 859–868. Kroon. Roebroeck. Tian. R.. Courtecuisse. 39. J. I. Ennos. (1988) “A critical examination of the soil washing technique with special reference to the effect of the size of the soil particles’. pp. J. J. pp. Nannipieri.. Mycological Progress. D. Beare.. y Pietramellar.REFERENCIAS Agerer. O’Donnell. P. N. E. A. Baek. 78–85. pp. soil biodiversity and agroecosystem function in the tropics. J.. R. Agnelli. A. G. T. (2006) ‘The simpleseptate basidiomycetes: A synopsis’. M. Korf. M. Oberwinkler. y Handley. Hallenberg. vol. pp.. (2004) ‘Distribution of microbial communities in a forest soil profile investigated by microbial biomass..E. M. Phytopathology. Begerow. M.. (1998) ‘Detection and enumeration of a genetically modified fungus in soil environments by quantitative competitive polymerase chain reaction’. pp. P.. A.. 90. 419–428. R. D. 95. D. I. Canadian Journal of Botany. P. 6. (2003) ‘Fungi are the predominant micro-organisms responsible for degradation of soil-buried polyester polyurethane over a range of soil water holding capacities’. y Cairney.. Baayen. pp. G. soil respiration’. Environmental Microbiology.. 5. Horak. Cortia. 5. F. Bonants. 1566–1569. y Waalwijk. Blanz.. E.. M. Sampaio. y Srivastava. C. H. N. vol. Greenhalgh. Campbell. Bååth. P. pp. FEMS Microbiology Ecology. R. C. forest’. M. Pedobiologia. R. C.. Summerbell.

. y Spooner. y Panchal. Pedobiologia. P. Dackman. Griffith. F. F. Plant Pathology. Phytopathology. K. y Polishook. M. S. P. P. pp. St Paul. 106.. y Roquebert. Pedobiologia. 187–198. y Baker. C. 4356–4360. pp. J. G. CAB International. vol. y Guiraud. W. Semadi. y Ritz. D. Bills. Spooner. B. F. (2000) ‘Food preference of earthworms for soil fungi’. Bridge. in G. pp1378–1379. FEMS Microbiology Ecology. G. G. vol. pp. pp. R. 105–114.. Bridge. S. J.. Elsevier. Crous. M. A. (1994) ‘Abundance and diversity of microfungi in leaf litter of a lowland rain forest in Costa Rica’. P. pp. 232. y Clipson. Mycologia. R. vol. (1980) ‘Induction of suppressiveness to Rhizoctonia solani in soil’. Malvarez. vol. Borneman. C. vol. pp994–998. y Thorn. M. Rodriguez. J.. vol. J. 70. Mueller. 44. S. Cannon. O.. (2001) ‘Soil fungi.. 281–292. I. (1996) ‘Filamentous fungi’. vol. Brodie. 89–93.. pp. H. (2003) ‘On the unreliability of published DNA sequences’. (2001) ‘Removal of herbicides from liquid media by fungi isolated from a contaminated soil’. M. I. Kadri. E. in G. B. 666–676. N. Edwards. Chet. Bills. L. D. Toth. L. Hongos del suelo saprófitos y patógenos de plantas 269 . Plant and Soil. W. (1993) ‘Fungal communities of two grazing-land soils in Uruguay’. 127–145. y Hartin. Dupont. Christensen. 160. Powell. Pedobiologia. P. 72–82. (2000) ‘PCR primers that amplify fungal rRNA genes from environmental samples’. y Nordbring-Hertz. K. (1987) ‘Quantification of predatory and endoparasitic nematophagous fungi in soil’. E. APS Press. Applied and Environmental Microbiology. (2002a) ‘Adhering to good cultural practice’. F. Bordjiba. vol. D. G. J. B. vol. Foster (eds) Biodiversity of Fungi: Inventory and Monitoring Methods. y Duncan. vol. Jansson. vol.. R. 37. M. 606–623. 13.. I. M. vol. Journal of Environmental Quality. Roberts... pp. 43–48. F.. Hall (ed) Methods for the Examination of Organismal Diversity in Soils and Sediments. K. Amsterdam. B. 46.W. Lees. 66. Microbial Ecology. Cullen. M. K. P. 30. Mycological Research. Bills y M. pp. S. (2003) ‘Soil fungal community structure in a temperate upland grassland soil’. (2002) ‘Detection of Colletotrichum coccodes from soil and potato tubers by conventional and quantitative real-time PCR’.Bettucci.. M.. ppv147–154. Bettucci. (2002b) Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. (2004) ‘Saprobic soil fungi’. pp. vol. MN. pp. A. 51. New Phytologist. 271–302.. Bonkowski. Bury. pp. pp. (2002) “Paraná river delta wetlands soil microfungi’. F. 45. J. Olsson. G. y Indarte. D. 418–426. P. Lundgren.. diversity and detection’. Steiman. M. B. 86. Crous. Wallingford..

61–71.. (2000) ‘Analysis of the dynamics of fungal communities in soil via fungal-specific PCR of soil DNA followed by denaturing gradient gel electrophoresis’. 133–151. Recorbet. vol. C. Aragno. 16. pp.. S. Gautheron. Jourdain-Miserez. The Netherlands. Forestier. pp67–76. R.Davet. pp. Enfield. (2002) ‘Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns’. Edena. Mycologist. M. D. M. G. Elsas. A. (2000) ‘An efficient baiting assay for quantification of Phytophthora cinnamomi in soil’. W. Pérez-Piqueres. Journal of Microbiological Methods. (2004) ‘Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils’. Duarte. vol. 51–58. pp.. O. G. Dhingra. (2002) ‘Fungal family trees: Finding relationships from molecular data’. Academic Press. F. pp.. pp. (1994) ‘Analysis of micromycete communities in soil: A critique of methods’. 53. 49. L. E. (2003) ‘Direct quantification of fungal DNA from soil substrate using real-time PCR’. vol.. D. V. 98. pp. (2007) Compendium of Soil Fungi. pp. FEMS Microbiology Ecology. London. H. Dordrecht. Environmental Microbiology. y Rouxel. (2001) Straminipilous Fungi. D. Keijzer-Wolters. Domsch.Cuvelle. Dighton. A. 11. S. 36.. Fromin. pp. S. A. y Jabaji-Hare. IHW Verlag. Frankland. vol. Hamelin. (1990) ‘Methods for studying fungi in soil and forest litter’. K. F.. y Rossi. Down. vol. G. C. FEMS Microbiology Ecology. vol. J. 43. 22. M. G. Edel.. Gams. J. Journal Microbiological Methods. 2nd edition. N. Grigorova y J. J. Dreumont.. 343–404. G.. y Smit. Kluwer Academic Publishers. Dighton. H. 397– 404. Filion. A. y Anderson. J. W. vol. P. Norris (eds) Methods in Microbiology. 634–643. K. y Alabouvette... Edel-Hermann. Eching. (1985) Basic Plant Pathology Methods. Roesti. Gillet. 270 Manual de biología de suelos tropicales . Hillb.. M. 796–798. C. vol.. Steinberg. M. CRC Press Inc.. (2001) ‘Genetic diversity of Fusarium oxysporum populations isolated from different soils in France’.. (2000) Detection and Isolation of Soil Fungi. in R.. T. B. J. St-Arnaud. M. Science Publishers. J. R. y Galpoththage. V.. y Boddy. F. Tarnawski. N. Teyssier. Plant Pathology. y Sinclair. N. y Steinberg. Boca Raton. 47.. Mycological Research. 515–522. vol. M. Dick.

A. G. Grishkan. W. Kluwer Academic Publishers. S. 888–891. Dordrecht. Grigorova y J. O. Mendonça-Hagler. Baarn. J. pp13–15. D. Proceedings of the International Congress for Culture Collections.. 41. Cambridge. (1990) ‘Methods for studying the microbial ecology of soil’. Hongos del suelo saprófitos y patógenos de plantas 271 . y Aptroot. A. C. pp. New York. D.. (2004a) ‘Fungal diversity and its implications for genetic resource collections’. pp. J. Baarn. Maffia. (2004b) ‘“Misidentifications” in fungal DNA sequence databanks’. CBS. (2005) ‘Analyses of soil fungal communities in adjacent natural forest and hoop pine plantation ecosystems of subtropical Australia using molecular approaches based on 18S rRNA genes’. Cambridge University Press. pp. Studies in Mycology. E. y Smalla. Norris (eds) Methods in Microbiology. London. census. van der Mei y A. in W. in R. G. vol. Cambridge University Press.. G. vol. magnitude. L. K. D. Xu. 87. in R. L. J. vol. C. D. 50. I. Biological Journal of the Linnean Society. C. Hoekstra. Frankland. A. Applied and Environmental Microbiology. Costa. 95. pp. R. (1998) CBS Course of Mycology. L. R. New Phytologist. R. Winterhoff (ed) Fungi in Vegetation Science. Gomes. 641–655. pp. Rumjanek. vol. Y. R. 26–35. y Rossman. D. J. vol. y Crous. C. L. R. Whalley (eds) Aspects of Tropical Mycology. in S. Israel’. (1997) ‘Where are all the undescribed fungi?’. Hawksworth. Buchner. S. Hawksworth. Lower Nahal Keziv.. western Upper Galilee. P. A. pp. Samson. Watling y A. (1996) ‘Microbial collections as a tool in biodiversity and biosystematic research’. D. y Beharav. Gams. vol. and prognosis’. pp. (1993) ‘The tropical fungal biota. pp. 183–223. (2001) ‘Evaluation of bioassays to quantify Cylindrocladium inocula soil’. P. pp. The Netherlands. Stalpers. CBS. Fagbola. Isaac. S. E. J. A. Gray. G. A. M. 247. Hawksworth. 527–539. vol. vol. 4th edition. Academic Press. (2003) ‘Adaptive spatiotemporal distribution of soil microfungi in ‘Evolution Canyon’ II. vol. 91–100. N. Nevo. A. Alfenas. 69. L. 22. Z. T. FEMS Microbiology Letters.. 161. 9–18. L. H. L. L. N. Gauch.. 261–264. (2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. pertinence. Hawksworth. W. y Hughes. Gonçalves.. H. pp. prophylaxis. Stouthamer (eds) Culture Collections to Improve Quality of Life... W. D. Mycological Research. significance and conservation’. He. Hawksworth. Hawksworth.. (1992) ‘The analysis of communities of saprophytic microfungi with special reference to soil fungi’. (1991) ‘The fungal dimension of biodiversity. 3758–3766. Jr (1982) Multivariate Analysis in Community Ecology. 78.Gams. Wasser. Mycoscience. Phytopathology... 310–342. A.

. (ed) (1996) Access to Ex-situ microbial genetic resources within the framework to the convention on Biological Diversity. y Clipson. y Jagnow. H. K. 76. Plant Pathology. vol. Lodge. y Kim. E. A. Lang. (1995) ‘Soil microbial diversity and the sustainability of agricultural soils’. vol. vol. L. F. (2001) Dictionary of the Fungi. vol. Kacprzak. pp. (1996) ‘Nonradioactive method to study genetic profiles of natural bacterial communities by PCR single-strand-conformation polymorphism’. pp. R. Lees. Applied and Environmental Microbiology. C. in S. 50. 38. G. M. Pedobiologia.. Sullivan.... Hong Kong University Press. R. L. WFCC. Visser. A.. B. y Stanczyk-Mazanek. N. pp. y Robinson. P. C. A. (1986) ‘Fungi of a forest soil nitrifying at low pH values’. C. K. pp. Cheng. Whalley (eds) Aspects of Tropical Mycology. K. 38. (1997b) ‘Can we rapidly measure fungal diversity?’. M. 39. vol. D. Hong Kong. y Stalpers. J. J. 74–83.. S. vol. vol. y Smith. J. Cannon. pp. L. vol. (1995) ‘The use of correspondence analysis in studies of successions of soil organisms’. Plant Pathology. (2003) ‘Changes in the structure of fungal communities of soil treated with sewage sludge’. vol. Zo. (1997) ‘Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16s rRNA’. D. 463–473. pp. P. pp. Mycologist. M. y Hartman.. A. pp. E. Liu. 37–58. Marsh. sp. Biology and Fertility of Soils. Microbial Ecology. J. 9th edition. W. J. 630–640. Applied and Environmental Microbiology. 4516–4522. Kirk. P. 518–527.Houston. Kennedy. (1993) ‘Nutrient cycling by fungi in wet tropical forests’. S. CAB International. Isaac. S. 257–265. Cullen. Kirsop. K. L. N. (ed) (1997a) Biodiversity of Tropical Microfungi. 272 Manual de biología de suelos tropicales . H. y Lautenschlager. 51. 89–95. Hyde. Cambridge University Press. J. D. Wallingford. y Nicholson. glycines in soybean roots and soil’. pp293–302. Kennedy.. G. 170. C. FEMS Microbiology Ecology. vol. pp. 52. P. 176–178. 75–86. vol. S. J. Li. Lee. 11. pp. (2003) ‘Molecular detection of Fusarium solani f. World Federation of Culture Collections. A. C. Canadian Journal of Botany. W. 63. D. (2002) ‘Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil’. Howard. Hyde. 62. y Forney. Plant and Soil. Frankland. Cambridge. L. 3112 –3120. S. Edwards. (1998) ‘Microbial processes and fungal community structure in soils from clear-cut and unharvested areas of two mixed wood forests’. (2005) ‘Soil bacterial and fungal community structure across a range of unimproved and semi-improved upland grasslands’. A. Y. T. D. Watling y A. David. pp.

vol. Moreira. de Waal. 36. W.. A. vol. M. J. from soils and plants’. (2002) ‘Mechanisms of natural soil suppressiveness to soilborne diseases’. isolation and pathogenicity of Phytophthora megasperma from soils and estimation of inoculum levels’. E. Masago. Mazzola. K. Princeton University Press. Muyzer. D. Polar Biology. B.. Brazil. Phytopathology. R. pp. Lavras. O.. 681–688 Lowell.. G. A. vol. (1988) Ecological Diversity and its Measurement. J (1997) ‘Factors related to diversity of decomposer fungi in tropical forests’. T. 1687–1690. R. Malosso. pp. Hopkins. A. (1998) ‘Application of denaturing gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology’. 35–59. J. Annual Review of Plant Pathology. 23–39. A. K. 6. J. Muyzer. Fukada. pp. Mauchline. F. pp. molecular fingerprinting and cloning techniques’. (2001) ‘Comparative single-strand conformation polymorphism (SSCP) and microscopy-based analysis of nitrogen cultivation interactive effects on the fungal community of a semiarid steppe soil’. y Hirsch.Lodge. Princeton. pp. vol. (1993) ‘Profiling of complex microbial populations by denaturing gradient electrophoresis analysis of polymerase chain reacHongos del suelo saprófitos y patógenos de plantas 273 . y Siqueira. H. G. vol. y Nakanishi. (2002) Microbiologia e bioquímica do solo. D. y Mitchell. L. E. Phytopathology. 1846–1853. H. (1970) ‘Detection. vol. y Klein. P. 266. M. FEMS Microbiology Ecology.. (2006) “Fungal diversity in maritime Antarctic soils determined using a combination of culture isolation. C. E.. C. Magurran. (2004) ‘Assessment and management of soil microbial community structure for disease suppression’. N. G. 29. 425–428. Editora UFLA. 42. X. y O´Donnell. Mazzola. G. F. (1977) ‘Selective inhibition of Pythium spp. pp. 67. 85–92. vol. (2004) ‘Effects of transgenic potatoes with an altered starch composition on the diversity of soil and rhizosphere bacteria and fungi’. Antonie van Leeuwenhoek. vol. Waite. 68. S. 552–561. Maidl. E. Milling. I. Applied and Environmental Microbiology. Plant and Soil.. pp. 60. S. M. Smalla. L. J. (2002) ‘Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating’. English. y Smalla. Schloter. 127–141. Yoshikawa. C. D. A. pp. Antonie van Leeuwenhoek. 73 pp. y Munch. y Uitterlinden. pp.. M. G. Biodiversity and Conservation. on a medium for direct isolation of Phytophtora spp. vol. vol. M. M.. Kerry.. 557–564. Marks. 81.

59. Hong Kong University Press. P.. Thioulouse. L. Plant Pathology. O´Donnell. 6. pp. y Nazaret. vol. pp. M. 7. Mouguel. 345. y Pineda. 65. Gomes.. F. T. Schlenzig. L. A. vol... vol. J. L. Ayers. Cooke. Jung. N. A. Journal of Microbiological Methods. L. Nechwatal.. 90.. G. B. y Kantzer. (2004) “Taxon-specific fungal primers reveal unexpectedly high diversity during leaf decomposition in a stream’. vol. vol. culture.. F. A. Pfenning. pp. vol.. C. A. y Hawksworth. F. K. y Osswald. J.. pp. 274 Manual de biología de suelos tropicales . A. (1994) ‘Theoretical and practical aspects of the quantification of biodiversity among microorganisms’. pp. C. Papavizas. (2001) ‘Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints. (1994) ‘The foliar fungal endophytes of the Amazonian palm Euterpe oleraceae’. D. Forest Pathology.. Wainwright. E. Phytopathology.. Wakeham. Pettitt. 65–73. Lews. Applied and Environmental Microbiology. pp. Dow. y Cigelnik. J. Biological Sciences. Mycological Progress. Mycologia. B. E. Hong Kong. F. (1975) ‘Ecology and epidemiology of Rhizoctonia solani in field soil’. G. Applied and Environmental Microbiology. Lata. L. H. M. (1997) ‘Soil and rhizosphere microfungi from Brazilian tropical forest ecosystems’. 31. M. 86. Poly. R. Ranjard. (2001) ‘A combination of baiting and PCR techniques for the detection of Phytophthora quercina and P. pp. citricola in soil samples from oak stands’. M. pp. and bait methods for detection of Pythium and Phytophthora zoospores in water’. biological and methodological variability’. Casado. y White. J. 41–49. D.. vol. 3. pp... A. vol. 63–75.. and Bärlocher. G. G. (1997) ‘Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous’... J. Oros-Sichler. Molecular Phylogenetics and Evolution. Adams. 51. (2006) ‘A new seminested PCR protocol to amplify large 18S rRNA gene fragments for PCR-DGGE analysis of soil fungal communities’. D.tion-amplified genes coding for 16S rRNA’. Nikolcheva. 67.. 376–385. W. 720–727. R. Maggi. J. pp. G. K. S. Lomsden. C. O. vol. A. vol. Hyde (ed) Biodiversity of Tropical Microfungi. C. F.. y Smalla. O’Donnell. L. M. D. T. K. Philosophical Transactions Royal Society London. Mycologia. Persiani. D. (2002) ‘Comparison of serological. F. 206–214. 4479–4487. M. R. Goodfellow. 695–700. pp. 85–97.. W. 341–365. M. Neuber. in K. pp. J. 103–116. 871–877. (1998) ‘Diversity and variability in soil fungi from a disturbed tropical rain forest’. Duncan. Rodrigues. G. vol. J.

pp. M. y Esposito. P. 31. Paul. M. V. Acta Zoológica Mexicana.. Parkway Publishers. H. R. Siebert. P. (2001) “Biodiversidad de los hongos fitopatógenos del suelo de Mexico’. Tulloss. European Journal of Soil Science. J. y Silveira. E. Ord. (1984) Suppressive Soils and Plant Disease. y Larrick. E.. H. Munro. vol. L. vol. MN.. Maffia. Canhos. J. G. (1999) ‘Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes enconding 18S rRNA and temperature gradient gel electrophoresis’. vol. 3rd edition. A. Glandorf. Burpee. E (2003) ‘Filamentous fungi isolated from estuarine sediments contaminated with industrial discharges’. y van Elsas. vol. pp. E. L. Ryan.. pp. St. vol. Singleton. pp. Smit. M. New York. 17. A. 105. y Smith. y Ogoshi. Soil and Sediment contamination. Y. A. APS Press. Applied and Environmental Microbiology.. vol. Fitopatologia Brasileira. Sokal. 2614–2621. A. (1991) Identification of Rhizoctonia Species. L. J. K. 345-356. Boone. B. 41–46. the Glomeromycota: Phylogeny and evolution’. D. special issue no 1. B. pp. St. A. Singh. T. APS Press. (1992) “Direct recovery and molecular analysis of DNA and RNA from soil’. D. 359. Potts. 53–78. y Rush. Smith.. Rossman. R... biochemical and molecular fingerprinting methods’. D. Mycological Research. Sanfuentes.. y Walker C. M. pp. 98–107. L. R.. Silva. Oecologia. (1995) Biometry: The Principles and Practice of Statistics in Biological Research. Schuessler. M. MN. 139.Rodrigues-Guzman. Leeflang. H. 5–12. W. E. 557–558. NC. pp. Freeman.. D. 72–82. (1992) ‘Culture collections of microorganisms... (2001) ‘A new fungal phylum. P. pp.. C. F. L. R. 1. y Waller. D. in Eucalyptus clonal garden soils’. J. y Millard. B.. vol. Paul. 57. Australasian Plant Pathology. C. pp. Schneider. Setälä. 66. MN. E. J. W. (2004) ‘Decomposition rate of organic substrates in relation to the species diversity of soil saprophytic fungi’. Umbuzeiro. (1992) ‘Competitive PCR’. S. F. Mycological Research. W. APS Press. 1351–1362. y McLean. 108. Alfenas. vol. G.. J. E. pp. y Rohlf. 12. Microbial Releases. A. Paterson. Hongos del suelo saprófitos y patógenos de plantas 275 . P. M. Reid. Nature. vol. Pfenning. S. y Thorn. P. pp. (2006) ‘Investigating microbial community structure in soils by physiological. Schwarzott. O´Dell. (2002) ‘Comparison of baits to quantify inoculum density of Rhizoctonia spp. D. J. y Klingmüller. 177–183. Mihail. (2004) ‘Fungal genetic resource centres and the genomic challenge’. W.. Sneh B. R. their importance in tropical plant pathology’. (1992) Methods for Research on Soilborne Phytopathogenic Fungi. A. M. S. 1413–1421 Selenska. (1998) Protocols for an All Taxa Biodiversity Inventory of Fungi in a Costa Rican Conservation Area. St Paul. vol.

C. 276 Manual de biología de suelos tropicales . D. A. (1988) ‘Metabolic diversity of fungi in relation to growth and mineral cycling in soil: A review’. C. 143– 154. L. Journal of Microbiological Methods. Whipps. Vujanovic. J. y Parkinson. M. y Young.. W. 6. E. Science. Yergeau. 90. M. J. J. vol. Wellington. E.’. 58. McQuilken. MN. pp. 62. Ecology and Pathology. B. (2000) ‘Diversity of soil fungi studied by PCR-RFLP of ITS’. y Hunter.. Y. D. Transactions of the British Mycological Society. Pesticide Science. pp. (1992) ‘Rapid method for direct extraction of DNA from soil and sediments’. nov. S. Tsao. Harris. B. y Brygoo. 4288–4292. St. 295–301. J. 62. y Olson. pp. (2003) ‘Resolving functional diversity in relation to microbial community structure in soil. pp. vol. P. pp. L. y Paul. C. vol.. 37. S. S. Canadian Journal of Botany. Section Longibrachiatum sect. 1070–1074. M. P. pp. Paul. 4th edition. M.. J. A. H. 309– 317. A. pp. G. 2275–2290. H. y Budge. Filion. y Bartnicki-Garcia. E. 1027–1032. C. M. St Paul. 5. pp. P. Leyval. H.Thorn. M. P. R. S. (2002) ‘Extensive fungal diversity in plant roots’. pp. E. 69... V. vol. Viaud. y St-Arnaud. y Visser. vol. P. Tsai. vol. (1991a) ‘A revision of the genus Trichoderma. P. MN. APS Press.. H. Widden. Reddy. pp. APS Press. Y. Zak. (1984) ‘A revision of the genus Trichoderma. 295. (1983) Phytophthora.. Infrageneric classification’. Vandenkoornhuyse. (1973) ‘Fungi from Canadian coniferous forest soils’. (2005) ‘A PCR-denaturing gradient gel electrophoresis approach to assess Fusarium diversity in asparagus’.. Manuales para identificación Barnett. 169–183. Applied Environmental Microbiology. D. vol. Berry. 159–170. 51. exploiting genomics and stable isotope probing’. y Krsek.. J. Bissett. Applied Environmental Microbiology. Baldauf.. Erwin. vol. Mycological Research. Taxonomy. Pasquier. 2357–2372. vol. Canadian Journal of Botany. p. A. 60. vol. vol. 104. M. (1993) ‘Use of fungal antagonists for biocontrol of damping-off and Sclerotinia disease’. 924–931. pp. 2051. its Biology. Straczek. vol. II. Current Opinion in Microbiology. (1998) Illustrated genera of imperfect fungi. (1996) ‘An appraisal of soil fungal diversity: The crossroads between taxonomic and functional biodiversity’. Wainwright. Bissett. M. Biodiversity and Conservation. I. (1996) ‘Isolation of saprophytic basidiomycetes from soil’. Canadian Journal of Botany.

MacNeil. Gams. y Stalpers. M.. C. R. J. APS Press. David. T. S.. M. M. S. J. London. MN. August. D. Vaduz. London. (2001) Dictionary of the Fungi. MN. M. J. y Ellis. H. Hanlin. P. J. W.. vol. B. ‘A revision of the genus Trichoderma. 2nd edition. Ellis. Klich. Gams. J. II. Ellis. Karling. y Bullock. St Paul MN. Cannon. T. Cramer. M. Australia. I. R. P... Betterman. A. 69. (1985) Microfungi on Land Plants: An Identification Handbook. Bissett. P.. Section Pachybasium’. MN. R. North Ryde. vol. 69. IHW Verlag. The Netherlands. D. (1991b) ‘A revision of the genus Trichoderma. T. Wallingford. J. Nag Raj. (2000) A Laboratory Guide to Common Penicillium Species. St Paul. A. vols I and II. F. y Pitt. F. (1988) A Laboratory Guide to Common Aspergillus Species and Their Teleomorphs. St Paul. E. T. M. St Paul. Baarn. 4th edition.T. R. A. y Anderson. Co. T. III. P.. A. American Phytopathological Society.. Handelsman. O. (1998a) Illustrated Genera of Ascomycetes. S. London. CBS. M. H. 2418–2420. (1991c). 1997). Brady... American Phytopathological Society.. Pitt. vol.. C. A. Crous. MN.. Osburne. Summerell. (1998) CBS Course of Mycology. Waterloo. pp.. Liechtenstein Kirk. CMI. Gilman. Kew. M. K. Liles. A. (1977) Chytridiomycetarum Iconographia. 1990. (1996) Phytophthora diseases worldwide. Illustrated genera of Ascomycetes. B. Erwin. R. L. Leslie. y Goodman. Kew. Blackwell Publishers. Minor. W. Rondon. (1993) Coelomycetous Anamorphs with Appendage-bearing Conidia. (1971) Dematiaceous Hyphomycetes. R. CSIRO. B. APS Press. (2007) Compendium of Soil Fungi. CMI. P. A. J. M. (1976) More Dematiaceous Hyphomycetes. Additional notes on section Longibrachiatum’. Canadian Journal of Botany. St Paul. Loiacono. M.. S. J.. (2006) The Fusarium Laboratory Manual. North Ryde. I. 9th edition. W. pp. J. American Phytopathological Society. Malden. Hoekstra. Eching. expanded reprint (Richmond Publ. S. Australia. R.. Domsch.. I. (1998b) Combined Keys to Illustrated Genera of Ascomycetes.Bissett. 2373–2417. CAB International. Clardy. L. y Aptroot. Hanlin. Croom Helm. MA. A. (2000) ‘Cloning the soil meHongos del suelo saprófitos y patógenos de plantas 277 . Grossman. J. Hanlin. IV.. (2002b) Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. Tiong. Canadian Journal of Botany. K. B. Mycologue Publications.. Lynch. K. Ellis. y Ribeiro. 3rd edition. CSIRO. C. vol. F. J. R. J. I. B. C.

L.tagenome: A strategy for accessing the genetic and functional diversity of uncultured microorganisms’. taxonomy. (1968) ‘The genus Pythium Pringsheim: Diagnoses or descriptions and figures from the original papers’. G. C. E. The Netherlands. Sitios web Johnson. Applied Environmental Microbiology. G. ecology and pathology. 110. Hoekstra. APS Press. 109. CMI. Mycological Papers. London. vol. F.. 278 Manual de biología de suelos tropicales . y Ogoshi. Chaverri. D. D. www. Mycological Papers.edu/people/padgett/book. M. A.gov/ taxadesciptions/keys/Trichodermalndex.. Farr. Tsao. Jr. T. Kew. APS Press. 2541–2547. E. (undated) ‘Trichoderma Online’.cfm. y Filtenborg. S. Samson. Baarn. St Paul. P... J. Waterhouse. Systematic Botany & Mycology Laboratory. C. 1–59. C. vol. (1970) ‘The genus Phytophthora de Bary: Diagnoses or descriptions and figures from the original papers’. S. R. CBS. vol. (1967) ‘A key to Pythium Pringsheim’. Mycological Papers. 6th edition.. St Paul. Frisvad. pp. 1–50.. (1983) Phytophthora: Its biology. J. A. vol. http://nt. MN. M. 66. pp1–15. Sutton. D. (2000) Introduction to Food and Air-borne Fungi. y Bartnicki-Garcia. O. Samuels. Waterhouse.ars-gring. ARS. W. (2002) ‘Biology and systematics of Saprolegniaceae’. B. Burpee. Sneh. M. MN. L. pp. R. USDA. G. accessed November 2002. (1980) The Coelomycetes.. Erwin. P. 122. y McCray. E. B.uncw. y Padgett. (1991) Identification of Rhizoctonia species. B. Waterhouse. H. pp. G. Seymour.

0g peptona 1.0g MgSO4 x 7H2O 0.2g pimaricina 0.02g estreptomicina 0.1g agar 18g MP5. (1998) y Erwin y Ribeiro (1996).agar maltosa peptona maltosa 4.s zanahoria.0g agar 18g agua destilada 900 ml PARP harina de maíz 17g pimaricina 10mg ampicilina 250mg rifampicilina 10mg pentacloronitrobenceno 100mg himexazol 50mg AHM + p.0g penicilina 0.1 Medios de cultivo y aditivos: cebos Las recetas son para un litro. molida 100g agar 18g penicilina 0.0g KNO3 1. –agar con harina de maíz harina de maíz 8.5g KCL 0.1g V8 agar V8 100 Ml CaCO3 2.1g Hongos del suelo saprófitos y patógenos de plantas 279 .0g agar 18g Antibióticos.5g glucosa 0.Apéndice 8. basados en Gams et al.2g sacarosa 0.2g pimaricina 0.02g estreptomicina 0. molida 100g agar 18g CA + p. si es necesario penicilina 0. cubitos 200g dextrosa 20g agar 18g PCA. MA2% .s.agar papa zanahoria papa 20g zanahoria 20g agar 18g CA – agar zanahoria zanahoria.02g estreptomicina 0.p.p.agar extracto de malta extracto de malta 20g agar 18g SNA – agar sintético pobre en nutrientes KH2PO4 1.2g agar 18g OA – agar harina de avena Copos de avena 30g Agar 15g ADP – agar dextrosa y papa papa.2g pimaricina 0.

Los cebos de vegetales pueden ser lavados. papa. papel celofán. 280 Manual de biología de suelos tropicales . alas de insectos. hojas secas de maíz. Sustratos celulósicos: semillas de Sorghum. exoesqueleto de camarones. Sustratos quitinosos: piel de serpiente. Dependiendo del tipo de hongo pueden ser utilizados cebos específicos.Cebos El uso de cebos es imprescindible para la recuperación de zoosporas formadas por hongos de sustratos complejos como el suelo. granos de polen de Pinus. trozos de manzana. Sustratos queratinosos: cabellos de niños rubios. los de origen animal son esterilizados usando luz UV por una hora. zanahoria o pepino. epidermis de cebolla.

las moscas de la fruta son consideradas una de las más preocupantes. preservación e identificación de moscas de la fruta Neliton Marques da Silva INTRODUCCIÓN Entre las plagas de la fruta de América tropical. 2000). Las moscas de la fruta muestran un comportamiento y una taxonomía complejos (Bateman. Steck y Wharton. Su clasificación se basa exclusivamente en los caracteres morfológicos del adulto. volviéndola 281 . en su mayor parte. el periodo durante el cual la larva destruye la pulpa de la fruta. y a la familia Tephritidae. Se trata de insectos multivoltinos con un potencial biótico relativamente alto y una gran capacidad para infestar diferentes especies de frutos nativos y exóticos. Los daños que producen las moscas de la fruta se dan durante la fase inmadura. Se distinguen cinco géneros importantes de esta plaga: Anastrepha. 1972. Las características taxonómicas que permitan distinguir sexos entre pupas y larvas aún no se han determinado (Salles. al final del abdomen.. Ceratitis. 1992). 1996). ya que representan plagas primarias para la mayoría de los cultivos frutales. con una punta larga y delgada. excepto en la Antártida (White y ElsonHarris. Bactrocera. y su sexo es fácilmente distinguible debido a que las hembras tienen un prominente ovopositor. éstas pertenecen al orden Díptera. Zucchi et al. que se extienden globalmente.Capítulo 9 Muestreo.. Algunos estudios han acentuado aspectos ecológicos y etológicos de las moscas de la fruta. enfocados a las fases de pupa y larva (Silva et al. Rhagoletis y Dacus. debido al gran impacto económico que causan. 1996. 1988).

ramas o semillas en donde las larvas de la mosca residían previamente. durante una parte de su ciclo de vida. 200 ml de proteína hidrolizada de maíz (5% en agua preservada con tetraborato de sodio con un pH entre 8. en su mayor parte depredadores y entomopatógenos como bacterias. por lo tanto. hongos y nematodos.5 y 9). Antes de llegar al estado adulto. y constituye una de las fases más vulnerables al estrés abiótico y a muchos enemigos naturales. las larvas se mueven sobre la superficie del suelo buscando condiciones adecuadas para su desarrollo y penetran hasta una profundidad aproximada de 10 cm para entrar en la fase de pupa. sobre todo. Esta profundidad varía dependiendo de las condiciones físicas del suelo. Debido a que el ciclo de vida involucra las partes aéreas de la planta hospedera. la mosca de la fruta es un habitante temporal del suelo. pues sólo permanece ahí durante una etapa de su vida. por ello. los procedimientos para muestrear varían de acuerdo con la fase y el propósito. las larvas migran de la fruta para pupar en el suelo (Ilustración 8a). azúcar al 10% o jarabe de caña de azúcar al 10%. Los cebos deberán reemplazarse cada semana y los especímenes capturados. De manera alternativa. Aun cuando las larvas son parasitadas dentro de los frutos. se puede utilizar jugo de fruta al 10%. esta técnica representa una relación ambigua entre la mosca y su hospedero. de ahí que. MUESTREO DE LA MOSCA DE LA FRUTA El muestreo de adultos de moscas de la fruta se lleva a cabo utilizando trampas McPhail (Ilustración 8b) con atrayente alimenticio. el parasitoide adulto puede emerger en el suelo. La fase pupal dura de 8 a 10 días. En el caso de la mosca adulta. el uso de trampas con cebos alimenticios es lo más recomendable. Estos antagonistas juegan un papel importante en el control biológico de las moscas de la fruta. El desarrollo de la pupa ocurre en el suelo. removidos. sin embargo.inservible para cosecha o consumo. Después de que la fruta infestada cae. la mosca de la fruta se puede considerar un organismo del suelo. resulta de suma importancia que en el diseño de la estrategia del manejo integrado de plagas se tome en cuenta la biodiversidad del suelo como un factor fundamental que influye en la mortalidad de larvas y pupas. en función de la temperatura. que también forman parte de la biota del suelo (véase Capítulo 10). puesto que ésta sólo se puede establecer usando frutos infectados. 282 Manual de biología de suelos tropicales . junto con el suelo. dependiendo de la temperatura y de la humedad. normalmente. la humedad y la textura. que es diurna y responde a estímulos visuales y olfativos.

o bien. COLECCIONANDO LOS ADULTOS CAPTURADOS Debido a la probabilidad de que distintos grupos taxonómicos de insectos sean capturados. Cuando los cebos son reemplazados. Por ejemplo: Manaus-AM Brasil 04° 05`S. una trampa cada cuatro hectáreas resulta suficiente. Muestreo. Trampa No 5 • • • • • También deberá ser registrada la identidad de individuos de otros grupos taxonómicos capturados en las trampas. N.5 mm para remover las moscas y separarlas de otros grupos taxonómicos utilizando unas pinzas curvas. colocarse sobre un árbol adyacente. En el caso de plantas herbáceas. primero será necesario separar las moscas de la fruta de otros especimenes. esto se puede llevar a cabo en el campo o en el laboratorio. la densidad deberá ser de tres a cinco trampas por hectárea o estar de acuerdo con el tipo de uso de suelo existente en el predio. cada tipo de uso de suelo existente debe ser monitoreado con la misma densidad de trampas. Se anota el sexo y se colocan en frascos de vidrio (de alrededor de 50 ml) etiquetados. mientras que. Hasta cinco trampas por hectárea pueden ser instaladas en áreas con arbustos o árboles (jardines caseros). dispuestos en forma de trípode. Cuando el objetivo es el manejo integrado. 60° 04´W 23/Marzo/2006 Silva. M. El número de trampas por unidad de superficie puede variar de acuerdo con los objetivos del proyecto.Las trampas se instalan en el centro del dosel de los árboles y su localización será tomada con GPS. preservación e identificación de moscas de la fruta 283 . la trampa puede utilizar como soporte tres palitos. Las trampas deberán ser colocadas de manera equidistante. si lo hay. el contenido de la trampa deberá pasarse por una malla de nylon de 1. con alcohol al 70% para su identificación posterior. Si el objetivo es monitorear plagas. es decir. La etiqueta deberá incluir la información básica de muestreo y el número de la trampa. hasta tres por hectárea son las recomendadas para plantaciones herbáceas.

Posteriormente. se recogen frutos al azar en diferentes agroecosistemas y en diferente estado de de maduración. los especimenes recuperados son fijados en una solución de alcohol al 70%.MUESTREO DE LA FRUTA Para poder establecer la relación entre las especies Anastrepha con sus plantas hospederas. Los adultos emergidos serán retenidos. Estas jaulas deberán ser examinadas diariamente. durante 48 horas para permitir el endurecimiento cuticular y la pigmentación completa de los patrones alares (Ilustración 8c): características de gran importancia para la identificación taxonómica. se depositan en charolas de plástico con una capa de vermiculita o arena fina como substrato de pupación.5 mm. OBTENCIÓN DE LAS PUPAS La vermiculita o arena fina deberá pasarse por una malla galvanizada. Finalmente. se pesan. de 1. para separar las pupas que posteriormente serán colocadas en jaulas. Los frutos deberán ser colectados directamente de los árboles o inmediatamente después de caer al suelo. La determinación de la relación de sexos hembra-macho (SR) para moscas adultas y parasitoides se hace de acuerdo con Silveira-Neto (1976) en función de la siguiente ecuación: Número de hembras SR= Número de hembras + Número de machos IDENTIFICACIÓN DE ESPECIES La identificación taxonómica de especies de Tephritidae se basa en un examen ventral de la región apical. el número y el sexo deberán quedar registrados con relación a las moscas o parasitoides. se cuentan y se separan para cada sitio de muestreo. las charolas se cubren con una tela de gasa y se aseguran con ligas de plástico para prevenir que se escapen las moscas adultas al emerger. el aculeo de la hembra bajo un microscopio estereoscó284 Manual de biología de suelos tropicales . Después de emergidas. las moscas adultas son alimentadas con una solución de miel disuelta en agua al 10% que será cambiada cada día. Los frutos muestreados se separan por especie. Finalmente. para permitir la salida de las moscas adultas y/o parasitoides. con sus respectivas etiquetas de identificación. se protegen con bolsas de tela y se transportan en cajas térmicas hasta el laboratorio. Las fechas de emergencia.

Es recomendable que se depositen ejemplares de referencia en colecciones de museo. Muestreo. abdomen y. M. Ribeirão Preto. L. pp. 493–518. Annual Review Entomology. University of São Paulo. PhD Thesis. Zucchi (eds) Moscas-das-frutas de importância econômica no Brasil: Conhecimento básico e aplicado. Salles. L. pp. tergito medio. REFERENCIAS Bateman.)’. A. A. comparando el patrón alar. utilizando un microscopio de transmisión (100X). Vanzolini (ed) A Catalogue of the Diptera of the Americas South of the United States. Lima. (2000) ‘Biologia e ciclo de vida de Anastrepha fraterculus (Wied. Norrbom. Escola Superior de Agricultura “Luiz de Queiroz”. PhD thesis. 17. Foote (1967). (2002) “Ocorrência e flutuação populacional de espécies de moscasdas-frutas eparasitóides com ênfase para o Gênero Anastrepha (Diptera: Tephritidae) na Amazônia Brasileira’. Zucchi (1978 y 2000) y Norrbom (1985). PhD Thesis. A. Ronchi-Teles. São Paulo.pico (40X) o mediante el montaje sobre laminillas para examinar estas estructuras. C. (1967) ‘Family Tephritidae’. Manaus. R. Steyskal (1977). H. no. 1868 (Diptera: Trypetidae)’. (1934) “Moscas-de-frutas do gênero Anastrepha Schiner. Pennsylvania. 28. São Paulo. La identificación de especies del género Anastrepha se logra para las hembras adultas. The Pennsylvania State University. robusta and schausi species groups of Anastrepha Schiner (Diptera: Tephritidae)’. 4. Holos. (1972) ’The ecology of fruit flies’. in M. Silva. (1993) “Levantamento e análise faunística de moscas-das-frutas (Diptera: Tephritidae) em quatro locais do Estado do Amazonas’. Secretaria da Agricultura. o que éstas sean incorporadas a la colección institucional del laboratorio. Federal University of the Amazon (UFAM) and National Institute for Agricultural Research (INPA). Departamento de Zoologia. 487–575. Memórias do Instituto Oswaldo Cruz (Rio de Janeiro). Malavasi and R. Silva (1993). Foote. vol. En primer lugar. A. daciformis. como lo describe Zucchi (1988). es necesario extraer completamente el aculeo de la funda del ovipositor con ayuda de agujas o pinzas (Ilustración 8d). (1985) ‘Phylogenetic analysis and taxonomy of the cryptostrepha. A. mesonoto. como las de Lima (1934). B. Ronchi-Teles (2002). preservación e identificación de moscas de la fruta 285 . Brazil. las características morfológicas del aculeo (Ilustración 8e) con especímenes de museo o usando claves taxonómicas. in A. Brazil. Stone (1942). N. vol. M. coloración de cuerpo. especialmente.

A. L. M. CRC Press.. G. Nakano. M. (1992) Fruit Flies of Economic Significance: Their Identifications and Bionomics. S. R. pp. (eds) (1976) Manual de Ecologia dos Insetos. R. and A. A. S. Boca Raton. (2000) ‘Taxonomia’. R. Zucchi. Ceres. Malavasi and R. and Silveira Neto. A. M. Steck and B. in G. (1977) Pictorial Key to Species of the Genus Anastrepha (Diptera: Tephritidae). PhD Thesis. A. M. distribuição geográfica e hospedeiros”. vol. pp.. Holos Zucchi. 286 Manual de biología de suelos tropicales . MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. V. Stone. hosts and lectotype designations’. CAB International. Zucchi. A. Steck. A. S.. Escola Superior de Agricultura ‘Luiz de Queiroz’. (1988) ‘Description of immature stages of Anastrepha interrupta. A. Steyskal. Silva. y Elson-Harris. in H. Fundação Cargill. (1978) “Taxonomia das espécies de Anastrepha Schiner 1868 (Diptera: Tephritidae) assinaladas no Brasil’. Ribeirão Preto. (1996) ‘The natural hosts plants of Anastrepha (Diptera: Tephritidae) in the State of Amazonas. Silveira Neto. Tephritidae) no Brasil: taxonomia. Zucchi. A. C. 994–1003. Barbin. A. y Silveira Neto.. United States Department of Agriculture Miscellaneous Publications. (1988) “Moscas-das-frutas (Dip. R. grandis (Diptera: Tephritidae)’. de Souza (ed) Moscas-das-frutas no Brasil. Zucchi. O. M. University of São Paulo. Brazil’. in G. 1–112. Washington DC. Campinas. 81. 439. N. Annals of the Entomological Society of America. Wallingford. CRC Press. vol. M. (1996) ‘Anastrepha species (Diptera: Tephritidae) from the Brazilian Amazon: Distribution. N. Zucchi (eds) Moscas-dasfrutas de importância econômica no Brasil: Conhecimento básico e aplicado. R. São Paulo. no. in A. R. J. limae. São Paulo. White. Steck and B. y Nova. J. A. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. J. D. y Wharton. (1942) ‘The fruit flies of the genus Anastrepha’. Entomological Society of Washington. I.Silva. 6. A.. A. Boca Raton. N.

aunque la cifra verdadera de diversidad puede ser mucho mayor (Groombridge. Si se asume que cada especie de insectos es susceptible a por lo menos un microorganismo patogénico. con el fin de utilizarlas como mecanismos de control de especies que son plaga. pero sí manteniéndolas en niveles por debajo del umbral de daño económico. el 10% pueden considerarse plagas agrícolas forestales o urbanas. Jr y Ricardo Sousa Cavalcanti INTRODUCCIÓN Existe alrededor de medio millón de especies de insectos descritas en la tierra. Esto es similar a la dinámica natural que sucede en el campo entre el patógeno y su hospedante. De éstas. prevenir su ocurrencia en insectos benéficos.Capítulo 10 Hongos y nematodos entomopatógenos Alcides Moino. La patología de insectos es la ciencia que estudia las enfermedades de insectos. o bien. frecuentemente hospedante-específico. 1992). El control microbiano es una forma de control biológico cuyo principio es el uso racional de entomopatógenos sin que necesariamente se eliminen las poblaciones de plagas. Las enfermedades son procesos dinámicos en donde el patógeno (microorganismo) y el hospedante (insecto) están adaptados morfológica y fisiológicamente. Los principales microorganismos utilizados. ello da la idea de la potencial importancia del estudio de estos patógenos de insectos en el contexto de control de plagas y de biodiversidad. aproximadamente. para resistir la enfermedad. sin intervención humana. y que han demostrado su 287 . el primero para llevar a cabo el proceso de infección y el segundo.

la Sterneinematidae y la Heterorhabditidae que son parásitos obligados de insectos y que son la base de varios plaguicidas biológicos diseñados específicamente para su uso en contra de plagas del suelo como los gorgojos y las larvas de mosca. La mayoría de los patógenos poseen una estrategia de transmisión de “sentar y esperar” (sensu Ewald. A pesar del éxito limitado de hongos y nematodos entomopatógenos como productos biocidas. a pesar de ello.5 mm de largo. Un pequeño número de especies generalistas con capacidad para ser cultivadas y producidas de manera masiva. Los hongos producen esporas que germinan al contacto con el hospedante. aparece una nueva generación de estadios infectivos (Kaya y Gaugler. debido a su alto costo. y convirtiéndose posteriormente en adultos. los basados en toxinas). los nematodos y los protozoarios. 1995): los organismos producen fases infectivas que son liberadas al ambiente cuando muere el hospedante 288 Manual de biología de suelos tropicales . 1994.potencial en el control microbiano de insectos son: los hongos. 1993). 1997. causar la muerte rápida del hospedante y provocar grandes niveles de mortandad en las poblaciones de éste) y causar epizoóticas periódicas (Chandler et al. Los estadios juveniles parasitan a sus hospedantes. baja persistencia e inactividad a bajas temperaturas (en el caso de los nematodos). Existen dos familias. 1995). pobre persistencia (especialmente bajo condiciones tropicales) y su baja eficacia cuando se compara con los insecticidas químicos (por ejemplo. se han utilizado como biopesticidas para su uso contra poblaciones de plagas. en donde pueden ser excepcionalmente virulentos (o decir. se producen miles de nuevas esporas que se dispersan y continúan su ciclo de vida en nuevos hospedantes. ambos presentan desventajas debido a su alto costo. como es el caso de Lecanicillium logisporum. las bacterias. penetrando directamente la cutícula o a través de las aperturas naturales como los espiráculos. Se conocen cientos de especies de hongos entomopatógenos que atacan una amplia gama de insectos y ácaros. Después de una a dos semanas posteriores a la invasión del hospedante. éstos aparentemente son componentes diversos y universales de las biotas del suelo. permitiendo que los nematodos crezcan y maduren sobre el tejido en descomposición. Una vez muertos los insectos. Roy et al. Leger. los virus. Myers y Rothaman.. con varios grados de especificidad con su hospedante (Hajek y St. invadiendo su cuerpo y matándolo de cuatro a diez días posteriores a la infección.. 2006). las bacterias que se introducen junto con el parásito se multiplican rápidamente y matan al hospedante. aunque esta tecnología no se ha adoptado por completo en la práctica. Los nematodos entomopatógenos miden alrededor de 0.

Estas estructuras vegetativas son llamadas hifas. sin duda. que constan de células alargadas provistas de una pared que contiene celulosa y quitina.y tienen la capacidad de entrar en un estado de letargo o diapausa y permanecer latentes hasta que haya nuevos hospedantes disponibles. sugiriendo de nuevo que los patógenos se distribuyen ampliamente en el suelo. Aschersonia aleyrodis. son susceptibles a hongos y nematodos. Después de la infección exitosa de un hospedante. Entomophaga. Esta capacidad es una adaptación a sus hospedantes artrópodos que son más grandes y con patrones de distribución en parches. el suelo es. lo que les permite mayor distribución geográfica de la población y alta movilidad. además de otros carbohidratos y proteínas. Lecanicillium lecanii. Neozygites). Nomuraea rileyi. 2001). Con frecuencia no hay correlación entre la densidad del hospedante y la ocurrencia de la enfermedad. Entomophthora. Las fases de diapausa y latencia reducen la dependencia en la movilidad de su hospedante y pueden complementarse con la capacidad para vivir saprotróficamente en suelo. el reservorio de las fases infectivas. Cordyceps spp. flavoviride.. Los hongos de mayor interés por su potencial como patógenos de insectos son: Beauveria bassiana. Los hongos poseen una gran variabilidad genética y un amplio rango de hospedantes. aunque su eficiencia competitiva en comparación con otros saprótrofos de vida libre puede ser baja. ello a pesar de la ausencia de fases sexuales manifiestas y que el significativo flujo de genes ocurre localmente (Bidochka et al. En el caso de los hongos entomopatógenos esto se apoya en evidencia molecular que muestra que poblaciones en suelo no son totalmente clonales. Paecilomyces spp.. y hongos del orden Entomophthorales (Zoophthora. Metarhizium anisopliae. como los que habitan debajo de éste. debido a que ofrece un microambiente estable con una estructura de poros favorable para nematodos y recursos orgánicos para hongos. se producen asexualmente estructuras reproductivas conocidas como esporas o conidias que ayudan a la diseminación del patógeno. Aunque los artrópodos que viven por encima del suelo. BIOLOGÍA DE HONGOS Y NEMATODOS ENTOMOPATÓGENOS Hongos Los hongos son microorganismos unicelulares (levaduras) o multicelulares (especies filamentosas).. H ongos y nematodos entomopatógenos 289 . Hirsutella thompsonii. M.

en el caso de los hongos. en el caso de los nematodos. 290 Manual de biología de suelos tropicales . Sin embargo.. La identificación correcta de un agente entomopatógeno. espiráculos y ano. los nematodos entomopatógenos presentan una estrecha asociación (simbiosis) con bacterias específicas. 1993. la identificación se fundamenta en medidas hechas a partir de estructuras presentes en los estadios juveniles infectivos. bacterias y otros microorganismos saprotróficos que no tienen potencial como agentes específicos para el control de plagas. Por lo general. aislar poblaciones. 1998A) Las muestras de suelo se colectan a una profundidad de 0 a 20 cm y se colocan en bolsas de plástico debidamente etiquetadas.. Estas bacterias se multiplican dentro del insecto y lo matan al causarle septicemia (infección generalizada). 1986. se basa en caracteres morfológicos del organismo en cultivo y en la estructura de los conidióforos y conidias.. Liud et al. Los nematodos transportan internamente bacterias específicas que son liberadas en el interior del cuerpo del insecto después de que el nematodo penetra a través de aberturas naturales como boca. A continuación se describen dos técnicas básicas para el aislamiento de hongos y nematodos entomopatógenos a partir de muestras del suelo. y dentro de éste a las familias Steinernematidae y Heterorhabditidae. En cada sitio de muestreo. De igual manera.Nematodos Los nematodos entomopatógenos son organismos pseudocelomados vermiformes muy similares a los que parasitan plantas y que pueden asociarse con los insectos de tres formas: forecia (adherencia pasiva y transporte). las cuales son los agentes primarios que inician la infección en el hospedante. para lograr una buena identificación es necesario aislar el microorganismo en cultivos puros o al menos. METODOLOGÍA PARA EL AISLAMIENTO DE HONGOS ENTOMOPATÓGENOS (Chase et al. también pueden obtenerse resultados semejantes y se requerirá de medidas adicionales para identificar patógenos con potencial. La población microbiana en cualquier ambiente natural es muy grande y por lo tanto. es muy común encontrar también hongos. cuando un insecto muerto es recogido para el cultivo de inóculo infectivo. cuando el objetivo del muestreo es evaluar la biodiversidad (por ejemplo. en el suelo). Los principales grupos de nematodos de interés pertenecen al orden Rhabditida. parasitismo obligado y parasitismo facultativo. Alves et al.

Las cajas se incuban a 27°C (Figura 10. se añade agua destilada hasta alcanzar el volumen original de 1 litro y posteriormente se añaden 20 g de agar. 1998b. A partir de estas alícuotas se preparan diluciones 10-1 sucesivamente.se toma una muestra compuesta a partir de seis submuestras tomadas en puntos localizados alrededor de un monolito central (véase Capítulo 2).1). Samson et al. 550 mg de dodina (N-dodecilguanidina acetato). conidias y fiálides (Alves et al. utilizando agua destilada esterilizada hasta alcanzar una dilución 10-4. se esteriliza durante 20 minutos a 120°C y se filtra. Después de la incubación. El crecimiento de los hongos y su esporulación se evalúan de 7 a 15 días posteriores a la inoculación. El medio selectivo de dodina se prepara de la siguiente manera: 20 g de harina de avena + 1 litro de agua destilada.1 ml de la última dilución y se colocan sobre la superficie del medio de cultivo contenido en una caja Petri.) puede llevarse a cabo usando un microscopio compuesto y claves de identificación basadas en caracteres morfológicos de las estructuras reproductivas.1ml y se colocan en medio de cultivo selectivo (el cual contiene el fungicida dodina) y en medio ADP (Agar-Dextrosa-Papa). tales como conidióforos.. Beauveria bassiana y Paecilomyces spp. con la subsecuente purificación de los cultivos (Figura 10. el volumen añadido se reparte sobre la superficie utilizando una asa de Drigalski (ya sea de acero inoxidable o vidrio).0 mg de tetraciclina y 10 mg de cristal violeta. 200 g infusión de papa (preparada a partir de papas rebanadas y hervidas para extraer el almidón).2) y almacenaje de conidios en condiciones de congelación utilizando tubos Eppendorf para tal fin. aunque puede prescindirse de él. 1998).. y agua destilada hasta completar el volumen total de un litro. H ongos y nematodos entomopatógenos 291 . la identificación de los cultivos de interés (principalmente Metarhizium anisopliae. Estas muestras pueden tomarse mediante el método de extracción de núcleos (véase Capítulo 4: Mesofauna). El medio ADP se prepara de la siguiente manera: 15 g de agar. Después de este paso se toman 0. De las diluciones 10-3 y 10-4 se toman 0. 5. En el laboratorio se debe mezclar muy bien la muestra compuesta y tomarse alícuotas de 1g de suelo. Esto suele ser efectivo especialmente con Metarhizium anisopliae. 20 g de dextrosa. El fungicida dodina se añade en pequeñas concentraciones (cerca de 10 mg ml-¹) al medio selectivo con el fin de aislar hongos entomopatógenos a partir del suelo y preservar los aislamientos menos susceptibles al fungicida.

Nota: la separación de contaminantes se logra recogiendo una pequeña porción de cualquiera de las colonias del hongo de interés con una aguja. y transfiriéndola a una caja Petri nueva con medio de cultivo ADP (tres puntos de inoculación por caja). b) inoculación de la suspensión (alícuota de 0.Figura 10.2 Cultivos purificados de Beauveria bassiana.1 ml) en una caja petri con medio de cultivo. Figura 10. bajo condiciones de congelación. c) incubación bajo condiciones controladas en una cámara DBO.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) dilución seriada de la suspensión acuosa que contiene al hongo. creciendo en medio ADP. d) almacenaje de conidios en tubos Eppendorf. 292 Manual de biología de suelos tropicales .

éstos deben colectarse y colocarse en agua destilada dentro de un frasco Becker. si se encuentran estados infectivos en el líquido.000 estados infectivos ml-¹. Adams y Nguyen. MgSO4 0. CuSO4 0 1μM. La detección de nematodos se lleva a cabo mediante bioensayos.. Una trampa de White se puede construir utilizando dos cajas Petri: una caja de 5 cm de diámetro se coloca invertida dentro de una caja de 9 cm que contiene agua esterilizada o medio “S” esterilizado y cubierta con un círculo de papel filtro de 9 cm. La suspensión se deja reposar para permitir que los nematodos queden en el fondo. El medio “S” consiste en un litro de solución madre (0. Los ejemplares de nuevas especies pueden someterse a un análisis molecular para así comparar los patrones de DNA. Na EDTA 0. ZnSO4. Figura 10. Las larvas de este lepidóptero son conocidas como mealworms (o gusanos de la harina).7H2O 0. La mortandad de las larvas se evalúa después de cinco a siete días.0. FeSO4.3M. la suspensión se lava adicionando una solución de formaldehído (1%) o solución de Ringer para obtener una concentración final de 10. Después de dos días. CaCl2 0. que contienen las muestras de suelo y se mantienen cerradas a 23°C en oscuridad. Posteriormente. Las larvas de insectos infectadas se colocan en el centro del papel filtro. utilizando la técnica de trampas de insectos con cinco larvas de Galleria mellonela (L.3) para colectar los estadios juveniles infectivos a partir de los cuerpos muertos. Los nematodos se almacenan en envases cerrados de 50 ml a 11°C o cercano a esa temperatura.1M NaCl. y pueden adquirirse comercialmente.4M. pH 6.1mM.) (Lepidoptera: Pyralidae). 2002).METODOLOGÍA PARA EL AISLAMIENTO DE NEMATODOS ENTOMOPATÓGENOS (Bedding y Arkhurst. H ongos y nematodos entomopatógenos 293 .7H2O 0. 1998b.3mM. La identificación se lleva a cabo con base en las claves específicas de identificación para cada familia de nematodos (Steinernematidae y Heterorhabditidae) (Alves et al. 1974) Se recogen las muestras de la misma forma que fue descrita anteriormente. 1μM colesterol) a la que se le añaden 26 ml de una solución nutritiva fresca que contiene citrato de K 0. Las larvas muertas se colocan en una trampa White (Chen et al. Las larvas se colocan en cajas de plástico de 500 ml. 2004.6mM. el cual cae hasta tocar el líquido en el borde de la caja inferior. 0.05M KH2PO4..4M.

Fotos: R. (1998a) “Técnicas de laboratório”. A. B. Piracicaba Brazil.. F. Alves (ed) Controle Microbiano de Insetos. y De Croos. K. J. A. M. Bedding. N. y Alves. M. B. 21. Moino Junior.. REFERENCIAS Adams.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). A. A.. B. Gaugler (ed) Entomopathogenic Nematology. in S. C.Figura 10. A. y Akhurst. vol.. L. Almeida. S. Bidochka. B. T. Nematologica. (1974) ‘A simple technique for the detection of insect parasitic nematodes in soil’. FEALQ. B. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. 2nd edition. J. A. Alves. Ferraz. C. Lavender. J. Deckoning. Gaugler. E. c) larvas que muestran la patología típica de infección por nematodos. d) emergencia de juveniles infectivos en la trampa White. J. B. J. Kamp. J. L. (2001) ‘Habitat association in two genetic groups of the insect-pathogenic fungus Metarhi294 Manual de biología de suelos tropicales . (1998b) “Chaves para identificação de patógenos de insetos”. (2002) ‘Taxonomy and Systematics’. Alves (ed) Controle Microbiano de Insetos. Wallingford. B. FEALQ. S. CAB International. y Nguyen.. R. 2nd edition. pp. M. 109–110.. Alves. y Castello Branco Jr. R. in R. in S. M. Piracicaba Brazil.

CAB International. A. P. S. y Read. D. C. P. y Lutton. Florida Entomologist. Samson. V. Evans. H. R. Chen. J. Annual Review of Entomology. pp. y St. (1995) ‘The evolution of virulence: A unifying link between parasitology and ecology’. A. from soil’. Wallingford. Roy. E. 38. Chen. Kaya. Meyers. 331–357. 1335–1342. 248–251. vol. Hajek. (1994) ‘Interactions between fungal pathogens and insect hosts’. X. 194–198. Advances and Perspectives.P. H ongos y nematodos entomopatógenos 295 . A.. Applied Soil Ecology. (1986) ‘Selective isolation of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium’. Milner. World Conservation Monitoring Centre.. London. (1988) Atlas for Entomopathogenic Fungi. Journal of Invertebrate Pathology.. Applied and Environmental Microbiology. D. J. y Ferguson. vol. C. J. E. Annual Review of Entomology.. Eilenberg. pp. (2006) ‘Bizarre interactions and endgames: Entomopathogenic fungi and their arthropod hosts’. C. y Rothaman. E.. D. R. Y. y Pell.. A. Hay. K. (1995) ‘Virulence and transmission of infectious diseases in humans and insects: Evolutionary and demographic patterns’. Y. H. (ed) (1992) Global Biodiversity: Status of the Earth’s Living Resources. y Latgé. 5. Trends in Ecology and Evolution. New York. 69. H. 133-141. vol. pp. D. pp. vol. K. 67. 293–322. A. (2004) Nematology. (1993) ‘The use of Dodine in selective media for the isolation of Metarhizium spp. R. Hajek. Journal of Parasitology. (1993) ‘Entomopathogenic nematodes’. S. M. Chapman and Hall. B. vol. y Gaugler. McRae. 285–292. G. Chase. G. (1997) ‘Sampling and occurrence of enomopathogenic fungi and nematodes in UK soils’. Leger. pp.zium anisopilae: Uncovering cryptic species’. L. Annual Review of Entomology. vol. 10. Ewald. Steinkraus. W. pp. 81. 659–669... Z. F. Z. W. H. E. 181–206. vol. vol. pp. Liu. y Dickson. 51. pp. R. J. Groombridge.. L. J. pp. R. Springer-Verlag. 62. 39. J. Osborne. Chandler. vol.

.

entrevistas o preguntas. Esto se lleva a cabo mediante la observación directa. En la mayoría de los casos. se necesitarán mediciones reales. Cuántas clases de uso de suelo pueden ser definidas con respecto a la intensidad de usos de suelo se ilustra a continuación. 297 . Solamente en algunos casos. La clasificación de uso de suelo se facilita por una estructura jerárquica donde se ordenan los atributos. dependiendo de los datos disponibles. los dominios de los valores de los atributos se especifican. lo cual requiere solamente el valor adecuado por evaluar en el campo. en los puntos de muestreo. Jeroen Huising RESUMEN DE LA METODOLOGÍA PARA LA DESCRIPCIÓN DE USO DE SUELO Este capítulo muestra una lista estructurada de atributos de uso de suelo que sirve como guía para la observación de características de uso de suelo en el campo. en función del propósito y del contexto de la clasificación misma. cuando se precise un alto nivel de detalle. Este método ofrece varios niveles de detalle que describen las características.Capítulo 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo E. pero las clases finales de uso de suelo dependerán de la selección de dichos atributos a considerar para la clasificación.

proporciona una estructura para la clasificación de usos de suelo. el enfoque que se describe a continuación se aleja de la idea de que las clases de uso de suelo sean definidas de acuerdo con la identificación de las características relevantes de uso de suelo (atributos) que permiten una 298 Manual de biología de suelos tropicales . 2005). y es por lo tanto. Para comprobar esta hipótesis. de manera que se puedan definir las clases de uso de suelo. pero dependen de los clasificadores o atributos seleccionados para la asignación de la clase de usos de suelo a cualquier observación particular. basadas en un común denominador en todas las áreas bajo estudio. en cuanto al uso de varios recursos como fotos aéreas o imágenes satelitales para el propósito de la clasificación. Este capítulo presenta una estructura que provee el registro sistemático de las características de uso de suelo. y en particular la intensidad de su uso. 1975). Lo último. especialmente en las regiones tropicales. Los procesos dominantes que determinan la presencia e incidencia de la biota del suelo y la escala espacial donde éstos se manifiestan no se conocen completamente. La idea general es que el contenido de un estudio depende de la naturaleza de la región (Vink. dada la variación en los cultivos y sus posibles combinaciones.ANTECEDENTES Y PRINCIPIOS DE DISEÑO Propósito de la clasificación del uso de suelo y de su cobertura vegetal El uso de suelo. En lugar de utilizar clases predefinidas de uso de suelo. se requiere de un sistema que permita el registro de las características de uso de suelo en las parcelas de muestreo y su clasificación posterior. razón por la cual fue adoptado un sistema regular en cuadrícula para muestrear la biodiversidad del suelo con un inventario detallado de su uso y cobertura en los lugares de muestreo. y al mismo tiempo. la hipótesis central del proyecto CSM-BGBD (Giller et al.. Las clases de uso de suelo predefinidas no son necesariamente aplicables o relevantes para todas las áreas involucradas porque será muy difícil definir un grupo estándar de clases de usos de suelo. se considera uno de los factores determinantes de la abundancia y riqueza de poblaciones de organismos del suelo. de modo que se puedan reflejar las diferencias en la intensidad de uso de suelo. implica que las clases de uso de suelo no están definidas a priori. Dicha estructura necesita ser flexible. la historia de uso de suelo y las prácticas de manejo de los mismos. a través de puntos de referencia de los países tropicales involucrados. lo que facilita el análisis de los factores determinantes actuales y una clasificación a posteriori.

como clima. áreas cultivadas y manejadas) mientras que el marco del LCCS incluye sistemas terrestres vegetales (semi) naturales. El sistema de clasificación de uso y cobertura del suelo ayuda a la armonización de los procedimientos para la recolección de datos y al manejo de los mismos. ej. sistemas acuáticos y principalmente áreas sin vegetación. los métodos descritos en este capítulo se aplican únicamente en paisajes agrícolas terrestres (p. El objetivo del inventario para proveer datos que permitan evaluar cambios en la biodiversidad del suelo en relación con el uso del suelo. aunque atributos relacionados con la historia del uso de suelo o condiciones ambientales podrían ser adicionados o modificados del sistema de clasificación. Un segundo objetivo para los inventarios de uso de suelo es proveer información básica para definir los usos de suelo alternativos y las prácticas de manejo que mejoran la sustentabilidad de la producción agrícola y conservan la biodiversidad del suelo. Para la clasificación y descripción de las áreas de vegetación (semi) natural se puede seguir el LCCS. El método que se presenta pretende ser de utilidad para la descripción de uso de suelo a nivel parcela. es diferente al monitoreo usado con frecuencia que incluye en la descripción de uso de suelo y el estudio de las condiciones naturales y socioeconómicas del suelo como un primer objetivo (Vink. especialmente en su intensidad. 1975). aunque contiene elementos añadidos relacionados con el manejo de suelo y cultivos. que desarrollaron el Sistema de Clasificación de Cobertura de Suelo (LCCS) por Di Gregorio y Jansen (2000). Los objetivos mencionados arriba fueron también citados en el programa Africover. generalmente se traduce en el registro de la ocurrencia de cultivos. El enfoque del inventario de uso de suelo aquí descrito se apoya principalmente en ese sistema de clasificación. los fenómenos relacionados con la forma en que se está utilizando el suelo (p. Lo anterior. para el propósito actual. Asimismo..discriminación entre clases de usos de suelo. La estructura de las descripciones del uso de suelo actual no ha sido hecha para registrar el uso de suelo histórico. No obstante. sin incluir elementos relacionados con el manejo de ganaD escripción y clasificación de uso de suelo en puntos de muestreo 299 . etc. forma del paisaje. Las clases de usos de suelo obtenidas de esta manera pueden ser utilizadas para la extrapolación de los resultados más allá de los lugares de estudio. ej. el manejo de los cultivos y del suelo) son de particular importancia porque impactarán notablemente sobre la distribución de los organismos del suelo. La descripción detallada de uso y la cobertura de suelo deberán formar parte del inventario. El método no incluye una estructura para la descripción de los atributos ambientales.

Obsérvese. Cuantos más clasificadores se añaden. aunque se reconoce que para los estudios a una escala mayor o para considerar opciones alternativas de uso de suelo. donde cada jerarquía se relaciona con diferentes niveles de detalle temático y espacial. basada en la interpretación de fotografías aéreas con el propósito de elaborar mapas de uso y cobertura del suelo. Nivel 3: Características relacionadas con aspectos culturales como irrigación y cultivo de temporada. por lo tanto. porque esto no está particularmente relacionado a nivel de parcela. no son exhaustivos (es decir. más detallado queda el nivel de clasificación. El método que se describe a continuación. son rígidos y de capacidad limitada para incorporar nuevas clases. Nivel 4: Características relacionadas con el manejo de prácticas del suelo. Muchos sistemas de clasificación utilizan a priori definiciones descriptivas de uso de suelo y clases de cobertura del suelo. descrita por Lillesand y Kiefer (1987). por ejemplo. a no ser la cobertura del suelo per se. son limitados cuando se les compara con otros sistemas. Dicho sistema a menudo carece de una definición clara de los límites de clases. dispuestos en un sistema jerárquico. no resulta apropiado para la descripción y mapeo de áreas más grandes. representan un subconjunto de un rango de posibles usos y coberturas de suelo) y debido a que no existe un sistema de clasificación de referencia. utilizados para definir una clase. el sistema de clasificación de uso de suelo y de su cobertura del US Geological Survey. ni incluye elementos relacionados con el sistema de cultivo. Concepto y principios de diseño Los conceptos y principios de diseño del LCCS adoptados utilizan criterios diagnósticos ordenados de manera jerárquica para permitir un sistema de clasificación consistente con límites claros para las clases. Estos “sistemas” de clasificación básicamente representan leyendas. resultarían de gran utilidad. por lo tanto. Existen cinco niveles en la jerarquía de clasificación: Nivel 1: Características relacionadas principalmente con el cultivo y el campo Nivel 2: Características relacionadas con la combinación de cultivos. Nivel 5: Características de uso de suelo del área directamente circundante a Manual de biología de suelos tropicales 300 .do. El principio básico se apoya en el uso de clasificadores que refieren a criterios de diagnósticos o atributos independientes. La jerarquía de clases es construida sobre un conjunto de clasificadores.

pero con algunos antecedentes de uso de suelo y de los sistemas de cultivo habituales. Las características de rotación de cultivos se consideran en otros estudios. tales como la preparación del suelo. Otros aspectos que se deben considerar son la distribución. son características que no se evalúan en los primeros niveles de clasificación. cercas vivas. especialmente en relación con elementos leñosos de la vegetación que no se reconocen como cultivo y en relación con cultivos en campos adyacentes. Dichos clasificadores. en secuencia. El quinto nivel en los sistemas de clasificación se relaciona con elementos de vegetación leñosa (semi) permanentes dentro de la parcela y en los campos aledaños. Esta información puede ayudar a determinar si la parcela bajo consideración representa una característica (o patrones) del uso de suelo o tipo de cobertura. Las características no siempre son fácilmente observables. “cultivo de árboles” para un sistema basado en árboles). Por ejemplo. se han añadido clasificadores que relacionan el manejo del suelo y cultivos que permiten la determinación del nivel de intensidad de uso. normalmente. Asimismo. incluyendo arreglos espaciales de los campos agrícolas. 1993). junto con el tamaño de las áreas de los campos. el deshierbe y la fertilización del mismo. como setos. lo que sirve para D escripción y clasificación de uso de suelo en puntos de muestreo 301 . patrones de campo) y los cultivos asociados. pero que se consideran importantes en relación a la intensidad del uso y pueden tener un impacto directo sobre la biodiversidad del suelo. En el siguiente nivel de la clasificación jerárquica se consideran las prácticas culturales relacionadas con el suministro de agua y factores de cultivos de temporada. la clase mayor es definida por el tipo de cultivo principal (p. ej. o basados en los datos proporcionados por el agricultor. éstos pueden ser evaluados. el manejo de los campos agrícolas (es decir. se refieren a las operaciones realizadas en una parcela en particular. Estos tres primeros niveles forman la base para la clasificación de uso de suelo y la colecta de datos en relación con dichas características se sugiere representan los datos mínimos requeridos.la parcela de muestreo. barreras de viento y otras estructuras semipermanentes. Este último determina si el campo forma parte de un sistema de cultivo migratorio. Las subclases pueden definirse basándose en otros cultivos que forman parte del sistema del cultivo general. Estos elementos de vegetación se relacionan con características permanentes en el paisaje. que muchas veces es referencia de la clase social y del tipo de manejo (Huising. Esto puede ser señal de cultivos simultáneos o. un sistema de barbecho o un sistema de cultivo permanente. El tamaño del campo generalmente es indicador del tamaño de la finca.

identificar posibles asociaciones de usos de suelo que. a su vez. Los valores de datos posibles (dominios de valor) para la mayoría de los atributos son dados para proporcionar una descripción estándar de las características de uso de suelo. Además de este eje existe uno más en la clasificación jerárquica que hace referencia al nivel de precisión con que se describen las características de uso o añade información específica (detalles técnicos) de las características de uso de suelo descritas. Por otro lado. por ejemplo. Además. Los atributos. Si se conoce el valor de clase a un nivel más específico. La transformación de las listas de atributos a formatos para registrar los datos en el campo resulta fácil. Los principios de las clasificaciones jerárquicas son explicados por Molenaar (1991. el valor de clase a un nivel más detallado de generalización puede ser inferido. los dominios de valor no son específicos para permitir la definición de 302 Manual de biología de suelos tropicales . la descripción cuantitativa de la intensidad del uso del suelo. son consideradas observaciones a nivel de parcela. Estos atributos técnicos específicos. sirven para trazar la cartografía del uso de suelo (mediante la interpolación de puntos de observación que complementan un mapa). que pueden incluir. por lo tanto. información más específica se remite a variedades y esto representaría un mayor nivel de detalle (especificidad). el cultivo principal puede describirse a un nivel más general (de género) como Zea o a un nivel de familia como Gramineae (pastos). Los atributos técnicos específicos permiten una definición más precisa de clases de uso de suelo asociados. por lo tanto. como los refiere el LCCS. por ejemplo. Registro de datos en campo y observaciones adicionales En las siguientes secciones se presenta la lista de atributos para la descripción de usos de suelo. Éstas sirven para guiar las observaciones en el campo en los puntos de muestreo y sus áreas circundantes. pueden añadirse sin mayores consecuencias para el sistema de clasificación. En el caso de algunos de estos atributos. el patrón del campo ofrece información sobre la fragmentación del suelo y constituye otro aspecto de la intensidad de uso de suelo que puede impactar directamente sobre la biodiversidad del suelo. 1998) y Huising (1993). no son independientes y pueden involucrar algún tipo de medición con un nivel más alto de detalle. Estos nuevos atributos ofrecen información más específica sobre el objeto de observación. el cultivo principal se puede describir como maíz (Zea mays). Los niveles de clasificación definen un eje de la clasificación jerárquica en donde atributos adicionales (conjuntos de ellos) en cada nivel subsecuente definen las subclases (que representan un mayor nivel de detalle).

no se obtiene a través de observaciones directas en el campo. la información puede generalizarse para la clase de “fertilizante aplicado” (implicando el uso de fertilizante inorgánico).6b). como documentos). utilizando otros recursos. El sistema para describir el uso de suelo muestra varios niveles de detalle. Sin embargo. se debería poder inferir información sobre el manejo de la parcela en particular. con los conocimientos de un sistema habitual de cultivo y las prácticas de manejo en el área. Por ejemplo. basada en observaciones secundarias. una tasa particular de aplicación (baja. junto con la información relacionada con el tercer nivel (es decir. El nivel de detalle al cual la información es reunida depende del propósito del inventario de uso de suelo y de la posibilidad de obtener D escripción y clasificación de uso de suelo en puntos de muestreo 303 . Las observaciones para los tres primeros niveles del sistema de clasificación se pueden hacer directamente en el campo. pero éstos deberán añadirse a los niveles más bajos de la clasificación jerárquica para evitar que interfieran con la estructura de la misma. a partir de la observación directa en el campo. esto no es prescriptivo en el sentido de que los datos necesitan ser colectados en todos los niveles de detalle. Sin embargo. a personas externas. Las clases de datos deben indicar una discriminación relevante (significativa) de objetos y el subconjunto de clases debe ser extensivo (no exclusivo). La situación contraria sería con el conocimiento de la práctica común en el área. es aceptable clasificar la tasa de aplicación como baja. características culturales) obtenida de un informante o derivada de la información general de las prácticas culturales en el área. sino que requiere del acceso a fuentes adicionales de información (a través de entrevistas a los agricultores. basados en la definición de la clase adoptada (ver Tabla 11. los datos relacionados con niveles muy detallados de observación son muy difíciles de obtener. o bien. relacionada con el manejo. simplemente. A priori. A menudo. La información de estas fuentes de datos puede resultar incorrecta. La información en el cuarto nivel. clases de tamaño estándar definidas en campo con límites fijos no podrán ser significativas por esa razón. pero ello se compensa con la aplicación de la jerarquía en la precisión de los datos (referidos anteriormente como el segundo eje en el sistema de clasificación). media o alta) puede ser asumida. sus fuentes no son totalmente confiables.valores de datos en los rangos de observación y distribución de los valores de datos. media o alta. o bien. Los atributos pueden agregarse para facilitar la descripción de características específicas de un área en particular. si la información sobre la tasa de aplicación de un fertilizante inorgánico en particular no se considera confiable o correcta. Si éste no es el caso.

no se incluyen en las listas de atributos que se detallan a continuación. como el elemento de vegetación más dominante. ya que puede tener un efecto en la distribución de la biodiversidad del suelo. Se deberá registrar la localización específica del punto de muestreo dentro del campo (por ejemplo. Estas observaciones secundarias sirven. dependiendo de la experiencia del encargado del proyecto. El sistema para la descripción de uso de suelo requiere de una estructura que pueda implementarse a detalle y que se considere viable bajo las condiciones reales. pueden ser incorporadas fácilmente a las libretas de campo en caso necesario. para la selección entre un cultivo de árboles y un cultivo anual en el mismo campo. Observaciones secundarias pueden relacionarse con el estatus del cultivo o con la presencia de maleza. la información sobre el tipo de lindero se debe registrar. el centro o los linderos). Se recomienda revisar el trabajo de Stocking y Murnaghan (2001) para los indicadores relevantes de observaciones en el campo. la cobertura del dosel deberá clasificarse como “abierta” o “cerrada”. será siempre una ventaja. Para este propósito. sí pueden aportar información para el análisis de datos. como un mecanismo para la validación de los datos en atributos y clasificadores e incluso para los resultados de clasificación finales. el segundo. nombre del encargado del proyecto y nombre de la persona que toma los datos. Si bien estas observaciones no se incluyen en la clasificación del uso de suelo. sin embargo. la explicación de posibles datos atípicos). fecha.la información requerida. al mismo tiempo. Estas observaciones no se consideran como clasificadores y. donde el cultivo de árboles se considera como el principal. por lo tanto. El hecho de que el encargado del proyecto se encuentre familiarizado con el uso de suelo y con las prácticas de manejo en el área. Este tipo de información deberá registrarse en la libreta de campo. siempre y cuando la cobertura del suelo no se clasifique como escasa. además de los datos administrativos como hora. OBSERVACIONES DE USO DE SUELO: CLASIFICADORES Y ATRIBUTOS Observaciones respecto del cultivo principal y tamaño del campo El primer nivel del sistema de clasificación se reserva para las observaciones del cultivo principal. (por ejemplo. Si la selección se realiza entre dos 304 Manual de biología de suelos tropicales . El uso de una cuadrícula regular para el muestreo permite que se tomen puntos de muestreo en cualquier lugar dentro de la parcela y posibles efectos de borde deben tomarse en cuenta.

es mejor definir una lista de Tabla 11. hierba. dependiendo. La clasificación se basa en la forma de vida del cultivo. En la Tabla 11. En el caso de cultivos herbáceos. pero en lugar de dejarlo abierto.1 los valores posibles (clasificadores o atributos) se enlistan entre corchetes.1. por lo tanto. se puede añadir un cuarto nivel que ofrezca información sobre la variedad específica del cultivo. el propósito) y duración del cultivo. de la edad de la plantación. nueces y otros. una especificación con más detalle indica si el cultivo pertenece a la categoría de “raíces o tubérculos”. deciduo] Tipo de hoja [aguda. árboles de sombra] Duración del cultivo [Estación (parte del año). arbusto.o más cultivos de la misma forma de vida. Se prevé para una descripción de un segundo y tercer cultivo. “forrajes o fibras”. La categoría de cultivo herbáceo representa un nivel adicional en la clasificación jerárquica (nivel de especificación) y. para madera o leña). proporcionando una mayor especificación de la forma de vida a nivel de detalle. porque su apariencia (características de vegetación) puede ser muy distinta. cosecha de frutas. entre 3 – 10 años.1 Clasificadores y atributos técnicos para el cultivo principal Nivel 1a – Clasificador Forma de vida [árbol. Generalmente. por ejemplo. “leguminosas o vegetales”. o gramíneas] Atributo técnico 1 Atributo técnico 2 Cultivo de árboles o arbusto Tipo de cultivo (especies y Fenología de la hoja [siem. ancha] Propósito [vivero. no se enlista bajo el título “Atributos técnicos 1” en la Tabla 11. Cuando se considera relevante. Los atributos técnicos son específicos para cada una de las diferentes formas de vida. El valor de dominio no se especifica aquí. cosecha de toda la planta (p. 1 año. La información más concreta sería entonces el tipo específico de cultivo. el cultivo con el mayor porcentaje de cobertura califica como el cultivo principal. En el caso de un cultivo de árboles o arbustos se puede añadir información sobre el aspecto (es decir. más de 10 años] 305 D escripción y clasificación de uso de suelo en puntos de muestreo . entre 1 y 3 años. ej. es conocido el tipo de cultivo.variedades) pre verde.

La definición de clases de tamaño de campo “pequeña”. a manera de ejemplo.Tabla 11. aunque esto se relaciona más con las características del cultivo que. forrajes. especificar el tipo de cultivo) Atributo técnico 2 Tipo de cultivo (especies o variedades) Tipo de cultivo Tipo de cultivo nombres permitidos para los tipos de cultivo. mediano y grande. II. ésta queda fuera del marco de este capítulo. El siguiente nivel en la clasificación jerárquica se determina por las características espaciales de la parcela en observación (Tabla 11. 1993) con la opción de utilizar diferentes definiciones para cada una de las distintas regiones en donde se esté llevando a cabo el estudio.1 Continúa Nivel 1a – Clasificador Atributo técnico 1 Gramíneas Tipo [bambú.2). 2000). sirve como indicador del grado de organización y mecanización de las prácticas de manejo. La cobertura del cultivo se anexa aquí. no obstante. arroz. legumbres y vegetales. pastos] Si no son gramíneas Categoría del cultivo [I. IV. con las características de campo. “mediana” o “grande” no aparece. III-cultivos de cobertura. caña. pero manteniendo la distinción conceptual entre pequeño. es mejor definir clases significativas basadas en un estudio piloto del rango de tamaño de campo presentes en el área de estudio (Huising. véase la lista LCCS (Di Gregorio y Janssen. fibras] (si se conoce.lúpulo y otras enredaderas perennes] Herbáceas Categoría de cultivos [raíces y tubérculos. puesto que ello dependerá del contexto de estudio. con el propósito de evitar cualquier confusión. aunque está más relacionada con las características del cultivo que con las características del campo.herbáceas. Aquí se incluye la “cobertura de los cultivos”.plátanos y otras plantas herbáceas arbóreas. cereales. La forma del campo se añade principalmente como una preocupación respecto a posibles efectos de borde y. además. La cobertura del cultivo se usa generalmente como un parámetro para la interpretación de 306 Manual de biología de suelos tropicales .

Nivel 1b -Clasificador Atributo técnico 1 Tamaño de campo o parce. rectangula [chica. grande] lar. Una cubierta “abierta” significa que la distancia entre los perímetros de las copas puede ser hasta dos veces mayor que el diámetro medio del dosel. generalmente. los límites de clases son ligeramente diferentes (ver Di Gregorio y Janssen. Se pueden hacer distinciones de acuerdo con el número de cultivos y con su secuencia. su densidad puede medirse directamente en términos del número de plantas por unidad de medida (m² o ha) o en términos de espacio entre plantas (el espacio entre surcos y la distancia entre las plantas). mediana.imágenes de percepción remota. Esto puede servir para entender la importancia relativa del cultivo en sistemas de cultivos múltiples. proporciona información acerca de la densidad del cultivo y es un indicador útil de la intensidad del uso de suelo. circular. la distribución espacial en el campo puede especificarse. esto se refiere a que en una misma parcela y durante una sola temporada se realizan uno o varios cultivos. Las clases de densidad podrían especificarse. y especialmente en el caso de los cultivos anuales. Para coberturas no permanentes. En el caso de formas de vida permanentes. En el caso de cultivos anuales. 2000). la cobertura del cultivo puede resultar difícil de interpretar debido a la variación en la arquitectura de las plantas. a las diferencias en las etapas de crecimiento y otros factores. baja (30 -15%)] Cobertura permanente: [cerrada (> 70-60%). el tipo de cobertura “cerrada”. en tira o irregular] Tamaño del campo (metros cuadrados) Atributo técnico 2 Cobertura del cultivo Cobertura no permanente: [alta (> 60%).Forma [cuadrada. Por lo tanto. Tabla 11. El segundo y tercer cultivo pueden describirse por los mismos D escripción y clasificación de uso de suelo en puntos de muestreo 307 .2 Tamaño del campo y características de la cobertura del cultivo. mediana (60 – 30%). Además. abierta (70-60 – 20-10%). se refiere a que se produce un empalme entre las copas. en los casos donde un clasificador de segundo nivel “combinación de cultivos” indica que existe un segundo o tercer cultivo creciendo en el campo. pero dependería mucho del tipo de cultivo. multiangular. escasa (20-10%)] Observaciones relacionadas a combinación de cultivos y prácticas culturales Las combinaciones de cultivos se consideran el segundo nivel. En el caso de un segundo o tercer cultivos.

igual que para el cultivo principal. aspersión o goteo] Atributo técnico 2 Demanda de agua por irrigación [mm de agua suministrada por temporada de crecimiento o cultivo] 308 Manual de biología de suelos tropicales .atributos. serían suficientes. en cuyo caso. con un sotobosque herbáceo cerrado. múltiple (intercalado)] Atributo técnico 1 Cultivos múltiples No. el porcentaje de cobertura del cultivo adicional o añadido) puede alcanzar fácilmente el 100%.4 Características del suministro de agua Nivel 3a – Clasificador Suministro de agua [lluvia. La descripción para las características del suministro de agua es muy sencilla (ver Tabla 11. Es necesario registrar cuando se practica una rotación de cultivo en particular. franjas alternas. junto con la fenología y tipo de hoja. El nivel tres en el sistema de clasificación se refiere a las prácticas culturales. La vegetación del sotobosque también puede referirse a vegetación (semi) natural. los cultivos de árboles (hule) en un campo grande (plantación). en donde la especificación de la forma de vida. postinundaciones.3 Atributos de cultivos combiandos. relacionadas con el “factor de tiempo del cultivo” para especificar esta información. traslapar. la totalidad de su cobertura (es decir. también en estos casos. Un segundo tipo de cultivo puede referirse a un cultivo de sotobosque como el cardamomo. plantaciones. irrigación] Atributo técnico 1 Irrigación Tipo de irrigación [superficial. El segundo tipo de cultivo se añade como un segundo atributo técnico. Se realizan previsiones al tercer nivel de clasificación. por ejemplo. definidas como características de suministro de agua y características relacionadas con el barbecho. Nivel 2 – Clasificador Combinación de cultivos [simple (monocultivo). 2 o más] Secuencia [simultáneo. de cultivos adicionales [1. fragmentadas o dispersas] Tabla 11. en los varios niveles de especificación. El segundo (o tercer) cultivo o elemento de la vegetación puede incorporarse en la descripción de clase del sistema de uso de suelo como elemento descriptivo o como atributo.4). como por ejemplo. Tabla 11. no habría un arreglo especial. secuencial] Atributo técnico 2 (Segundo tipo de cultivo) Simultáneo o traslapado Arreglo espacial [una o dos filas intercaladas.

mediano. Nivel 3b . Se hace una distinción entre cultivos migratorios. largo] Permanente Permanente [continuo o intermitente] Atributo técnico 2 Índice de cultivo (valor del índice de cultivo Ruthenberg) Si es mejorado: Tipo de cobertura (ej. Los atributos técnicos se especifican en la Tabla 11. barbecho. Los cultivos migratorios típicamente se refieren a situaciones donde los agricultores abren nuevas parcelas para el cultivo. la lluvia infiltrada en el suelo se usa intencionalmente como reserva para los cultivos”.El cultivo post inundación se define. mediano.. El factor de tiempo del cultivo indica la fracción de tiempo durante la cual el suelo es usado para el cultivo. mejorado] Duración del barbecho[corto. se debe hacer la distinción entre si esto se hace con el objetivo de restaurar la fertilidad del suelo o debido a que las condiciones no permiten cultivar (bajas temperaturas o disponibilidad de agua limitada). natural. de cultivos en dos años D escripción y clasificación de uso de suelo en puntos de muestreo 309 . en principio. aunque no lo mismo. mientras que en el sistema de barbecho Tabla 11. Leguminosas. El barbecho se refiere al periodo (estación de crecimiento) durante el cual se deja descansar el suelo. o largo plazo] Barbecho Tipo de barbecho[suelo desnudo. El cultivo migratorio se define como suelo cultivado durante menos del 33% del tiempo (Ruthemberg et al. el suelo está cultivado por más de 66% del tiempo. 1980). esta distinción no se mantiene.Clasificador Factor tiempo de cultivo [cultivo migratorio.5 Factor tiempo de cultivo. y debido a que no trae consecuencias en la intensidad del uso de suelo. barbechos y cultivos permanentes. de la siguiente forma: “después de que un campo ha sido inundado con agua de lluvia. en términos prácticos. de acuerdo con el LCCS. sin embargo.5. al empleo de técnicas de cosecha de agua (tratado por separado en la sección relacionada con el manejo de suelos y cultivos). Esto es similar. u otro tipo) Índice de cultivo (valor del índice de cultivo Ruthenberg) Intermitente No. Los sistemas de barbecho se definen como suelo cultivado entre el 33% y el 66% del tiempo y en los cultivos permanentes. permanente] Atributo técnico 1 Cultivo migratorio Período de barbecho [corto.

por lo tanto. con un periodo de > 1–2 años.cultivan la misma parcela o área de suelo. forrajes. El barbecho medio refleja la situación donde el suelo descansa durante seis a siete meses. Bajo la presión de una población en aumento. pero eso no resulta lo suficientemente largo para clasificarlo como cultivo migratorio. El periodo largo de barbecho es la situación típica en donde el suelo se deja en barbecho durante un año o más. Periodo largo: > 8–9 meses El barbecho de periodo corto se refiere a situaciones donde normalmente existen dos temporadas de cultivo en un año y el suelo se deja descansar durante el resto del periodo. No se hace ninguna distinción referida al tipo de cultivo o propósito. se sobreponen los límites de clases y se especifican para cubrir la variación específica de un periodo de barbecho para cualquier área que probablemente sea dependiente de las condiciones socioeconómicas y biofísicas habituales. durante el segundo año. pero < 8–9 meses. por ello. con un periodo de > 8–10 años. pero necesita confirmarse y puede ajustarse con base en los datos reales sobre la duración de los periodos de barbecho en el área en cuestión. el periodo de barbecho típicamente tiende a reducirse. pero < 8–10 años. con un periodo de < 1–2 años. por ejemplo. Los barbechos se consideran como “mejorados” en el momento en que se planta o se siembra para cambiar la composición de la vegetación de barbecho o para mejorar su calidad. En el caso de cultivos migratorios. Periodo medio: 4–5 meses. Barbecho medio. Barbecho largo. se hace una distinción entre la duración del periodo de barbecho: Barbecho corto. Si se requiere de datos más precisos. la clasificación del periodo de barbecho es la siguiente: Periodo corto: < 4–5 meses. resulta relevante anotar la duración de dicho periodo. Estas son evaluaciones parcialmente cualitativas y. lo cual es muy común en algunos lugares donde uno o dos cultivos “cortos” ocurren durante un año o donde el agricultor deja un periodo de barbecho más largo. dejándola descansar durante diferentes periodos de tiempo para restaurar la fertilidad del suelo. La definición de estos límites de clases se basa en la experiencia en el campo. éstos se pue310 Manual de biología de suelos tropicales . Para sistemas de barbecho.

Si se practica una rotación de cultivos. En cuanto a la preparación del suelo y la cosecha. 1980): CIr = Tc/(Tc + Tf) En donde: Tc = duración del cultivo (tiempo). plagas y enfermedades. el principal aspecto que se debe considerar sería si esto se realiza por medios mecánicos o no. fertilización y cosecha. Hasta este momento no se han considerado las rotaciones de cultivo. por lo tanto. se podría prever. Tf = duración del barbecho o duración del tiempo en el que no se cultiva el suelo. Esto es. tal y como se observa en la Tabla 11. donde potencialmente existe un alto impacto en la biodiversidad del suelo. como un clasificador podría ser excluida de la clasificación porque la preparación del suelo es generalmente la D escripción y clasificación de uso de suelo en puntos de muestreo 311 . Se añade la “preparación del suelo” por su relevancia en los márgenes de la selva en los trópicos. tal y como se muestra en la siguiente fórmula (Ruthenberg et al. el manejo de las malas hierbas.den calcular utilizando el índice de cultivos de Ruthenberg.5. una opción para combinar ambos clasificadores dentro de uno que describa el grado de mecanización.. el manejo del suelo y de los cultivos se consideran representativos de un nivel separado en el sistema de clasificación (Tabla 11. la cosecha. Los mayores componentes de las prácticas de manejo discutidas se refieren a técnicas para la preparación del suelo o su cultivo. el mejor momento para incluir una descripción de las secuencias de los cultivos sería en el segundo nivel de la clasificación jerárquica donde “la combinación de cultivos” puede describirse como “secuencial”. puesto que el barbecho a menudo forma parte de un sistema de rotación de un cultivo en particular. Los datos deberán especificar el número de años del ciclo de rotación de cultivos y la secuencia de los cultivos en el ciclo. el “factor tiempo de cultivo”. es un factor que deberá tomarse en cuenta en relación con la biodiversidad del suelo. De manera alternativa. Alternativamente. por lo que no han sido incluidas en el sistema de clasificación. Características de manejo del suelo y de cultivos Las prácticas culturales mencionadas incluyen: “manejo de agua” como una operación de manejo.6a). sin embargo.

la profundidad del arado. El tipo de animal o el tipo de maquinaria empleada es indicado en el siguiente nivel de detalle. donde la labranza del suelo se restringe a hacer agujeros para sembrar. La eficiencia se refiere más a lo económico que a lo ambiental. se podría considerar combinar ambos (mecánica y química) dentro de un clasificador que describa el uso de agroquímicos (excluyendo fertilizantes orgánicos). Por lo tanto. Se presume que animales “pesados” o maquinaria pesada causan un mayor impacto en el suelo.primera operación para ser mecanizada y tiene un profundo efecto en la biodiversidad del suelo. se basa en el tipo de tracción utilizada: animal o mecánica. arado de disco. La labranza mínima se refiere a aquellos sistemas donde el arado y la siembra son típicamente una combinación de una sola operación. o arado de cincel. tomando en cuenta el impacto directo del peso del animal o la maquinaria y el impacto generado por los diferentes tipos de equipo operados por maquinaria o animales de diferentes capacidades. sin embargo. por ejemplo. plagas y enfermedades es el uso de agroquímicos. las opciones son: arado de vertedera. Una distinción más detallada de acuerdo con los requerimientos reales de poder o capacidad en términos de caballos de fuerza no se considera relevante. ya que no resultará un indicador directo del grado de perturbación del suelo. tales como tipo de suelo. sería más sencillo 312 Manual de biología de suelos tropicales . Se debe mencionar aquí si se practica la labranza mínima. La principal preocupación relacionada con el control de las malezas. comparado con animales “ligeros” o maquinaria de igual consideración. estos arados se presentan desde el menos eficiente en remover el suelo y dejará más estructura intacta en el suelo. De acuerdo con el orden mencionado. El uso de combustibles puede fácilmente estimarse si se conoce su eficiencia. en caso afirmativo. La “eficiencia” en términos de horas por hectárea requerida para la operación se añade como un atributo opcional. refiriendo su capacidad. tales como la unidad de sembrado directo (ripper-planter) utilizada en la agricultura de conservación (de Freitas. en el sentido de que una mayor o menor eficiencia no causará mayor o menor impacto en el suelo y los organismos que se encuentran en él. Se hace una distinción basada en si el suelo ha sido labrado o no. el uso de combustibles debería añadirse como atributo en el siguiente nivel más alto de especificación. el suelo (y otras condiciones ambientales) afectarán la eficiencia de la operación. Opcionalmente. tipo de equipo y tipo de tracción. en lugar de labrar el campo entero o donde el grado de perturbación se minimiza con el uso de equipos especializados. pero al contrario. Se añade un atributo técnico que describe el tipo de arado usado. porque esto dependerá de las condiciones locales. 2000). aquí se incluye su compatibilidad con los métodos que incorporan el uso de combustibles fósiles en los cálculos de la intensidad del uso de suelo.

. labranza mínima/unidad de sembrado les usados [búfalo. por ello.6a Clasificadores y atributos relacionados con la limpieza de la parcela. mecánico. manual (azadón). manual. químico] Tipo de deshierbe [con azadón. a Deshierbe a mano Eficiencia (horas/ha) mano. biológico o cultural. estas han sido registradas de las prácticas de uso de suelo en los niveles previos del sistema de clasificación y. labranza y deshierbe. “No quitar malezas” puede atender a situaciones donde no existe la extracción real de las malezas. química] Atributo técnico 1 Manual Modo [desmontar y quemar. desmontar y cubrir con abono verde] Mecánica Grado [limpieza moderada. el barbecho. la rotación de cultivos. Respecto al deshierbe manual se hace una distinción Tabla 11. no se incluyen en el valor de dominio.y práctico manejarlas por separado. etc. En el caso de medidas de control culturales (y biológicas). cincel. mecánico. directo (ripper-planter)] vaca.disco. Tracción animal Tipo (y número) de anima. mecánica. con la mano] D escripción y clasificación de uso de suelo en puntos de muestreo 313 . intermedia e intensa] Manual Atributo técnico 2 Labranza [Sin labranza. labranza mínima/unidad de das (pesada)] sembrado directo (ripperplanter)] Eficiencia (horas/ha) Deshierbe [Sin deshierbe. Nivel 4 – Clasificador Limpieza [Sin limpiar.disco. reducida o mínima] Eficiencia (horas/ha) Tipo de arado [vertedera. mula/burro] Eficiencia (horas/ha) Mecánico Tipo de arado Clase de maquinaria [dos ruedas (ligera). buey. cuatro rue. cincel.[vertedera. caballo. El clasificador para el control de malezas especifica el modo de mecanismos de control. por ejemplo. mecánica] Alcance de la labranza [labranza completa. tracción animal. sea por el método de herbicidas.

Nivel 4 – Clasificador Atributo técnico 1 Mecánico Tipo de deshierbe [labranza frecuente. Las especificaciones de manejo de malezas no cubren todas las medidas de control de malezas. se basa en el volumen de la aplicación que resulta no viable. mientras que una aplicación (ea) de más de 2500 gha-1.edu/pnw/weeds).6a Continúa. dado que el Roundup es. se recomienda implementar un sistema de clasificación para la aplicación de volumen de herbicidas que sea relevante para el área en cuestión. el herbicida más usado en los trópicos (www. la distinción se hace acorde con su aplicación: el uso de aspersor de mochila es el más común. 2005). weeds. ingrediente activo y tasa de aplicación entre si esto se lleva a la práctica con el uso del azadón o mediante la extracción totalmente manual. VA (> 2500 g ia/ha)] Herbicida.edu/mgmt/2004) por la cantidad de aplicaciones especificada en gramos equivalentes de ácido (ea) por hectárea de glifosato.Tabla 11. Si se considera de vital importancia. si se considera el gran número de herbicidas que se encuentran disponibles en el mercado. junto con la cantidad en gramos del ingrediente activo por hectárea.ippc. Una tasa de aplicación de (ea) menos de 850 gha-1 se considera un volumen bajo (VB) de aplicación. VI mochila. se debería especificar el ingrediente activo (ia). otros mecanismos] (entre 850 y 2500 g ia/ ha). que es la sustancia activa del Roundup. se considera un volumen alto (VA). Sin embargo. azadón rotatorio) Eficiencia (horas/ha) Químico Volumen de aplicación Tipo de equipo [aspersor de [VB (< 850 g ia/ha). En cuanto al uso de químicos en el control de malezas. Una diferencia más. o cualquier otro tipo de herbicida. azadón de presión. cultivo para el control de malezas] Atributo técnico 2 Eficiencia (horas/ha) Tipo de equipo (ej. los diferentes tipos de ingredientes activos y las fórmulas que existen (Oregon State University. Las especificaciones son asignadas de manera arbitraria. basadas en recomendaciones generales para su aplicación en diferentes cultivos. si se requiere información más detallada acerca del Roundup. los cuales se convierten de libras por acre a gramos por hectárea (weeds. por lo 314 Manual de biología de suelos tropicales . orst. por mucho.iastate.

1985). los rangos de tasas de aplicación se especifican para los límites superiores e inferiores de las clases. La frecuencia de la aplicación puede variar y en la tabla que se observa a continuación. las cifras se convierten en tasas de aplicación por año.que la libreta de campo es un buen complemento para la observación relacionada con cualquier medida específica de control de malezas. Tasas de aplicación bajas de menos de una tonelada por hectárea por año se consideran insuficientes para mantener los niveles de humus y de materia orgánica en el suelo. en caso de considerarse relevante. Los fertilizantes de bajo grado tienen menos del 25% de nutrientes para las plantas. Los volúmenes especificados se refieren a la forma líquida en la cual el pesticida o el fungicida se obtienen. (2002) y son usadas en caso de aspersión aérea. se podrían especificar cantidades reales de aplicación. estos se basan en asumir un contenido de materia orgánica del 30%. Los elementos nutritivos pueden referirse a un solo elemento (por ejemplo N) en los fertilizantes simples o la combinación de elementos en mezclas incompletas o mezclas completas (el porcentaje de peso se relaciona al N para el nitrógeno. Cuando se utilicen fertilizantes de bajo grado. mientras que los fertilizantes de alto grado contienen hasta el 50% de elementos nutritivos. Dos toneladas por hectárea por año se consideran suficientes para todo tipo de cultivo. se deberán tomar en cuenta los valores más altos. control biológico o mecanismos de control químico (Tabla 11. se hace una distinción basada en si éstos son ampliamente aplicados en todo el campo o si la aplicación se restringe a puntos específicos y también al tipo de equipo utilizado. En este punto. sin tomar en cuenta su modo de empleo. Generalmente. Con relación a las medidas de control de plagas y enfermedades. se definen clases similares: control natural o medidas culturales. Las clases de volúmenes para aplicar pesticidas se obtienen de Craig et al. fungicidas u otros químicos. se prevén especificaciones para la tasa de aplicación. Para abonos.6b). Eso se hace para poder acomodar los diferentes grados de fertilizantes. Se presume que el modo de aplicación no traerá muchas consecuencias para la tasa de aplicación. Con respecto a la aplicación de fertilizantes inorgánicos. P2O5 para el fósforo y K2O para el potasio) El índice toma D escripción y clasificación de uso de suelo en puntos de muestreo 315 . en lugar de usar un valor en particular. En cuanto a los fertilizantes orgánicos e inorgánicos. dentro del rango especificado. estas cantidades se suministran una vez cada cuatro a seis años (ILACO. sin considerar las disoluciones hechas antes de la aplicación. se presume que se requieren entre 5 y 10 toneladas por hectárea para poder mantener los niveles de humus en el suelo. Respecto al uso de pesticidas. y las mismas clases de volumen se consideran relevantes.

para alrededor de tres toneladas de trigo en suelos relativamente fértiles y 25 toneladas de mandioca en suelos moderadamente fértiles. lo que ha ocurrido en algunos márgenes de selvas en donde opera el proyecto CSMBGBD. Sin embargo. La “limpieza intensa” significa que la tierra se limpia completamente con el uso de tractores oruga y otra maquinaria pesada. estos valores se toman como el límite superior de la clase de “tasa de aplicación de fertilizante medio”. Esto sería particularmente relevante donde se practican cultivos migratorios o donde las selvas han sido convertidas recientemente en suelo agrícola. La limpieza también es importante en sistemas de barbecho. “La limpieza moderada” está indicada cuando se utilizan medios manuales y mecánicos. de un fertilizante de alto grado y de 700 kg ha-1 o más de un fertilizante de bajo grado. Una aplicación de 75 kg ha-1 de N requerirá 150 kg ha-1 de un fertilizante con N de alto grado y alrededor de 350 kg ha-1 de un fertilizante de bajo grado. Esto sería la aplicación recomendada para un suelo moderadamente fértil que produce alrededor de cuatro toneladas de maíz (grano). o si las tasas de aplicación altas son de particular interés. en donde los árboles se cortan a mano o con sierra de cadena y los troncos se remueven utilizando tractores u otra maquinaria más ligera. Actualmente.75 kg ha-1 de N como punto de referencia para la aplicación de N. ya sea en o alrededor del hoyo de plantación. La conversión puede incluir operaciones para nivelar el suelo. por lo tanto. Las otras clases se derivan de estas cifras. en donde una tasa muy baja de aplicación representa alrededor de 10 a 15% de esta cantidad de referencia. Si las tasas de aplicación son generalmente altas. se incluye como clasificador separado. En todos los sistemas es importante registrar si la quema se lleva a cabo para eliminar la vegetación muerta o si esta vegetación se queda como abono orgánico. se podría considerar añadir una clase para las tasas muy altas que serían aplicaciones de 300 kg ha-1 o más. lo cual coincide más o menos con la duración máxima de barbecho bajo sistemas de cultivos migratorios. cuando incluyen quemas. especialmente. La aplicación del fertilizante. por lo tanto. La manera en que se prepara la parcela puede tener un profundo impacto en la biodiversidad del suelo. cualquier incidencia de fue316 Manual de biología de suelos tropicales . “Sin limpieza” (ver Tabla 11. Otra distinción se hace basada en el tipo de equipo usado. será relevante en el caso de tasas bajas o muy bajas de aplicación. 6a) se enlista cuando el campo ha sido convertido a partir de bosque o vegetación secundaria desde hace más de 20 años. se hace una distinción entre sistemas de “desmontar y quema” y “desmontar y cubrir con abonos verdes”.

vehículos. abono verde.go como parte de las prácticas de manejo deberá registrarse en esta sección como fenómeno importante. mezclas incompletas. media (entre 1–2 t/ha/año). aspersión en toda la parcela] Atributo técnico 2 Volumen de aplicación [UVB (<10L/ha). media (entre 75– 175 y 150–350 kg/ha). estiércol de corral] Aplicación [hoyos. VB (entre 10-100L/ha). fertilizantes químicos. franjas. o de manera homogénea en la parcela] Cosecha [manual.6b Clasificadores y atributos para el manejo de plagas y enfermedades. fertilizantes y cosecha. aviones] Fertilizantes orgánicos Tipo de fertilizantes [residuos de cultivos. composta. Tabla 11. mezclas completas] Tasa de aplicación [muy baja (<20 – 60 kg/ha). (VA >200L/ha)] Tipo de químico y tasa de aplicación Tasa de aplicación [baja (<1t/ha/año). mecánica] Eficiencia (Horas/ha) D escripción y clasificación de uso de suelo en puntos de muestreo 317 . baja (entre 25–60 y 75–175 kg/ha). o de manera homogénea en la parcela] Inorgánico Clases de fertilizantes [simple. franjas. control químico y biológico] Atributo técnico 1 Control químico Aspersión [aspersión focalizada. aspersor de motor. VI (entre 100 y 200L/ha). alta (>150–350 kg/ha) Aplicación [hoyos. Nivel 4 – Clasificador Manejo de plagas y enfermedades [medidas preventivas y control natural. abonos. alta (>2 t/ha/año)] Fertilizantes [sin fertilizante. combinación de fertilizantes químicos y orgánicos] Equipo usado [aspersor de mochila.

muros de contención. cultivos en curvas de nivel. que se practica en el Níger). Probablemente. La información sobre el rendimiento de la cosecha es igual de útil. Las observaciones del estatus de los cultivos podrían ser útiles para corroborar los resultados anteriores (o resultados de clasificación). La World Overview of Conservation Approaches and Technologies (WOCAT). especialmente. si se conoce la técnica con un nombre en particular (por ejemplo “Zai”. provee una visión general en su página web de muchas técnicas existentes (www. cuando se compara con un cultivo de 318 Manual de biología de suelos tropicales . en donde se observa que la altura del cultivo es menor. número de macollos por planta de cereal. etc. 2001). esta información deberá adjuntarse. Estos datos proporcionan información adicional sobre el cultivo principal tal y como se especifica en el primer nivel del sistema de clasificación. por lo que es difícil obtener cifras confiables y del todo correctas. las características del crecimiento del cultivo pueden utilizarse como una medida representativa del rendimiento. el crecimiento puede clasificarse como: crecimiento retardado. lo que aumenta la capacidad de retención y reduce la pérdida de suelo.net). De manera general. sean incluidas. construcciones y empalizadas. De manera alternativa. entre otras. corta vientos y otros) o medidas estructurales que incluyen terrazas. pero no como base de clasificación. incluyendo las relacionadas con técnicas de recolección de agua.). cuando se relacionan con su manejo. El rendimiento del cultivo como indicador integra muchos factores. se incluyen como medidas estructurales. wocat. bancos. altura y diámetro relativos del cultivo en crecimiento (ver Stocking y Murnaghan. Las técnicas de recolección de agua como cavar zanjas. La información de las medidas de conservación no se captura directamente en el registro de los atributos enlistados arriba. se recomienda que las observaciones de las prácticas de conservación de suelo y agua. al igual que las del estatus del cultivo.Otras observaciones sobre el manejo de suelo y cultivos Aparte de registrar las características del manejo de suelo y de cultivos como se describió en las tablas anteriores. Las medidas de conservación de suelo y agua afectarán las poblaciones de organismos del suelo indirectamente por el almacenamiento de agua mejorada. hondonadas y otras. Las evaluaciones del rendimiento basadas en campo deberán incluir lo siguiente: población de plantas por metro cuadrado. acolchonado. el uso de elementos de vegetación (referido a tiras de pastizales. barreras de setos. la mejor manera de categorizarlas es determinar si incluyen medidas agronómicas (como cultivos mixtos. El registro debe contener la descripción de las medidas de conservación del suelo y el agua.

La fragmentación del uso de suelo que puede ser evaluada a partir de estas observaciones resulta ser. por sí misma. Queda fuera del marco de este capítulo proporcionar información más detallada sobre plagas. el factor Ruthenberg se establece. se esperaría encontrar barbecho como parte del patrón de uso de suelo. Las observaciones del estatus del cultivo deberán acompañarse de observaciones acerca de la incidencia de plagas y enfermedades e incluir el porcentaje del cultivo afectado. están disD escripción y clasificación de uso de suelo en puntos de muestreo 319 . dentro del contexto del uso de suelo en las áreas de los alrededores (esto ayuda a establecer si el uso de suelo en la parcela en observación es representativo o no). y finalmente. frijol y col. dentro de una proporción espacial entre barbecho y el suelo cultivado en el uso de suelo actual. Existen guías disponibles para registrar deficiencias específicas de nutrientes en cultivos (ver Stocking y Murnaghan. Este es el caso cuando la cobertura de árboles es escasa (menos de 10 a 20%). lo que resulta importante para un mapeo del uso de suelo. cercas vivas y otros elementos de vegetación importantes. en principio. permite una evaluación del uso del suelo en un punto de muestreo particular. enfermedades y sus clasificaciones. y la severidad de la infección en términos del grado en el cual la planta es afectada. permite la validación y la verificación de las observaciones en el lugar del muestreo. y cultivo de crecimiento vigoroso.crecimiento vigoroso. un importante aspecto de la intensidad del uso del suelo. en el caso de cultivos migratorios o sistemas de barbecho. la primera distinción se hace en función de si éstos son continuos. todos a nivel parcela o paisaje. deberá enlistarse su nombre. Además. Respecto a la distribución de los campos (evaluación del patrón de distribución). El uso de suelo en el área circundante del punto de muestreo tendrá una notable influencia sobre la biodiversidad del suelo de la parcela en observación. por ejemplo. Esto permite la inclusión de elementos de vegetación leñosa en la descripción que no están capturados en el sistema de descripción de uso de suelo. plantas de menor vigor. Si se conoce la plaga o enfermedad específica. lo cual puede ocurrir cuando los árboles están dispersos dentro de la parcela. Patrones de distribución en el campo y árboles en la finca Las observaciones relacionadas con el tipo de campo y con los elementos de vegetación leñosa dentro de la parcela bajo observación y sus alrededores están incluidas. con un diámetro del cultivo menor y una decoloración generalizada en sus hojas. 2001) por signos de déficit de nutrientes en maíz.

7). áreas terrestres seminaturales. lo que parece relevante especialmente en el caso de áreas cultivadas terrestres.) 320 Manual de biología de suelos tropicales . irregular] Patrón de la parcela [regular. grande] Cultivo principal (lista de los cultivos de cuatro parcelas vecinas ) Cultivo principal (lista de cultivos de cuatro parcelas vecinas) Cobertura del suelo (cobertura dominante de áreas no cultivadas) Tipo de cultivo o actividad Tipo de área acuática Tipo de área urbanizada (ej.tribuidos en forma de racimos o dispersos (ver Tabla 11. mediana. áreas acuáticas cultivadas o de inundación regular. vegetación acuática (semi) natural. industrial. Tabla 11. La segunda distinción se refiere al tamaño.7 Características de la parcela y distribución del uso de suelo. son las características del suministro de agua y la permanencia del cultivo. superficies artificiales. forma y patrón de los campos y finalmente. Los distintos componentes de uso del suelo pueden describirse con mayor detalle. Residencial. queda una opción para especificar los porcentajes del área usando varias categorías: tierras cultivadas y áreas manejadas. etc. agrupada. irregular] No continuo Parte de las tierras cultivadas [% de cultivo y área de manejo] Parte de la cobertura vegetal [% de área (semi) natual] Parte del área acuática cultivada [% de área acuática cultivada] Parte acuática no cultivada [% de área acuática no cultivada] Área urbanizada [% de superficie artificial] Atributo técnico 2 Uniforme clases de tamaño (mayoría del campo) [pequeña. Clasificador espacial Distribución espacial de la parcela [continua. utilizando las clases mayores de cobertura de suelo del LCCS. áreas vacías o cuerpos de agua artificiales y cuerpos de agua naturales (hielo y nieve). El patrón del campo se relaciona a la forma del lugar y al arreglo espacial del mismo. en donde se especifican los cultivos principales. dispersa] Atributo técnico 1 Continuo Distribución del tamaño de la parcela [uniforme.

para cosechar frutas. como estanques. Más información trata de la cobertura o densidad del componente árbol. Se entiende que los tramos de bosque y otra vegetación leñosa fueron ya cubiertos por el método de clasificación para uso de suelo. a partir de los claD escripción y clasificación de uso de suelo en puntos de muestreo 321 . Como se ha mencionado.8 especifica los atributos utilizados para describir los TROF. si es posible)] El último elemento que debe ser registrado es la presencia de elementos permanentes de vegetación leñosa en el paisaje. La Tabla 11. especificado en términos del número de árboles por hectárea o longitud de los elementos lineales de la vegetación leñosa. es importante registrar la localización del punto de muestreo respecto al lindero del campo. Es importante derivar las clases de manera sistemática. para madera. Clasificador espacial Atributo técnico 1 Atributo técnico 2 Suelo desnudo [% de áreas desnudas] Cuerpos de agua [% de Tipo de cuerpos de agua [arcuerpos de agua] tificial. DESCRIPCIÓN Y CLASIFICACIÓN DE USO DE SUELO Definición y descripción de clases de uso de suelo No es el propósito de este capítulo describir cómo las clases de uso de suelo se definen. para leña o material de construcción). Los atributos técnicos permiten una descripción del tipo de árbol (ya sea por especie u otro nivel taxonómico) y el propósito de tener árboles (por ejemplo. este podría no ser el caso. pantanos. nueces. natural (especificar tipo. La información sobre los árboles pertenecientes a la familia leguminosa es útil en relación con la ocurrencia de las bacterias formadoras de nódulos. aunque estos elementos pueden ser característicos del uso y cobertura del suelo y tener mayor influencia sobre la presencia de la biota específica del suelo. Se hace referencia a éstos como árboles en una finca (TROF).Tabla 11. presas. En el caso de porcentajes bajos de cobertura de árboles y árboles dispersos dentro del campo o alineados en forma de cerca viva. El primer atributo describe la distribución espacial de los árboles. Las “zonas verdes” se refieren a árboles espaciados en filas dispuestas como empalizadas.7 Continúa.

“cultivo de temporada” y “cultivo permanente”. de manera que un conjunto de clases definido para un área en particular puede ser fácilmente mapeado en el conjunto de clases utilizados para otra área y viceversa.8 Características de los árboles en la finca (TROF). Si se contemplan atributos adicionales del cultivo principal (por ejemplo.Tabla 11. Esto se traduce en “plantación de árboles”. el diseño de la clasificación jerárquica y el atributo de los valores de clase. son explicados a continuación. cercas vivas. por ejemplo. zonas verdes] Atributo técnico 1 Cercas vivas: especies de árboles Árboles dispersos dentro de la parcela Propósito [principalmente frutas y nueces. es posible distinguir entre una plantación de teca y otra de hule. distintos grados de cobertura de árboles pueden observarse dentro de la clase “plantación de árboles” (o aun dentro de las plantaciones de teca). otros] Barreras contra el viento u otros arreglos lineales: especies de árboles Empalizadas: tipo o especie dominante Atributo técnico 2 Cobertura (% de linderos que constituyen cercas vivas) Densidad (número de árboles por ha) Longitud total por ha (m/ha) sificadores y atributos presentados aquí. Los principios de la definición de usos de clase de suelo. “cultivo único”. lo que determina el nivel de detalle con que se definen las clases. principalmente madera. no necesariamente tienen que implicar una definición de un conjunto adicional de clases en el siguiente nivel de la clasificación jerárquica. barreras contra el viento u otros elementos leñosos. árboles dispersos dentro de la parcela. tipo de cultivo). Nivel 5 Clasificador Tipo de TROF [sin TROF. No todos los atributos o clasificadores tendrán que tomarse en cuenta. Por otra parte. cuando se toman en cuenta atributos técnicos adicionales. utilizando reglas de decisión. Si únicamente se consideran los primeros tres niveles en la clasificación jerárquica. relacionados con observaciones de campo. pero esto pue322 Manual de biología de suelos tropicales . “parcela de tamaño grande”. una clase de uso de suelo podría ser definida en función de los siguientes valores de atributos: “cultivo de árboles”. Las clases se definen por la combinación particular de clasificadores y atributos (determinados por el valor de los mismos). principalmente árboles de sombra.

Y. Esto se refiere a los niveles de la clasificación jerárquica. Debido a la estructura anidada. y “un cultivo permanente”.9 proporciona una lista generalizada de los clasificadores y atributos de clases de acuerdo con el nivel la clasificación jerárquica. plantación de árboles). un “campo grande”. en áreas donde los cultivos migratorios o permanentes se practican uno al lado del otro. en donde el factor “tiempo de cultivo” sería el parámetro en la jerarquía agregada y no. Debido a que el sistema que se presenta trata de áreas cultivadas y manejadas. en la jerarquía de clasificación para observaciones en parcela. La Tabla 11. y no a los niveles de generalización (el segundo eje en el sistema de clasificación). lo que D escripción y clasificación de uso de suelo en puntos de muestreo 323 .9 contiene una vista global de la estructura de la clasificación principal. decidiendo la presencia de un clasificador sobre otro. Las reglas de decisión generalmente toman la forma de un conjunto de condiciones SI – ENTONCES que aplica los atributos. tal y como se observa en la Tabla 11. combinados a través de operadores Booleanos (es decir. No obstante.10. y por ello podría usarse para realizar ejercicios de mapeo a pequeña escala. Para ilustrar la definición y descripción de la clase. como han sido presentados arriba.1 a la 11. La Tabla 11. Para una explicación de clasificación y jerarquías agregadas. Para información precisa habrá que referirse a las Tablas 11. el factor “tiempo de cultivo” puede tener prioridad sobre el cultivo principal como la característica dominante. Una clasificación jerárquica se establece de manera similar. no todos los atributos pueden ser fácilmente organizados en una tabla. sin embargo. ver Huising (1993). “sin irrigación”. Los clasificadores especifican un “cultivo de árboles”. esta característica es general en áreas grandes y no en parcelas. XO y NO). hay que tomar en cuenta los valores especificados para los diferentes clasificadores y atributos técnicos. Las clases se asignan de acuerdo con las reglas de decisión y al mismo tiempo las clases se definen. Más bien. la jerarquía considera el cultivo principal como la puerta de entrada.8. O.de no ser relevante para definir clases separadas de plantaciones de árboles. se retiene la información sobre el porcentaje de cobertura como un valor de atributo en particular para cada observación individual (instancia u ocurrencia) del objeto clase (es decir. Por ejemplo: SI (<forma de vida> igual a ‘árbol’ y <tamaño de parcela> igual a ‘grande’ y <combinación de cultivos> igual a ‘único’ y <factor tiempo de cultivo> igual a ‘permanente’) ENTONCES <clase> = ‘plantación de árboles’.

a un sistema agroforestal en donde los árboles de hule (Hervea brasiliensis) crecen dentro de la selva (Joshi et al. que la parcela es cultivada de manera permanente con un pequeño periodo de barbecho cada dos años. se clasificará como “extensivo”.. En cuanto a los clasificadores del nivel 5. Posteriormente. De manera alternativa. de cacao y otras. Esto. por ejemplo.200 mm de lluvia por año. 2002) o en lugares donde se cultivan únicamente árboles de hule. Si se utiliza la información sobre la especie de árbol. El primer nivel especifica que se trata de una pequeña parcela cuyo cultivo principal es el maíz. el tercer nivel. El manejo de estas plantaciones. La Tabla 11. si la plantación de árboles bajo estudio es un pequeño bosque aislado dentro de un ambiente dominado por cultivos anuales. frecuentemente no son relevantes para cultivos de plantación. el manejo de plagas. Algunos de los clasificadores de suelo y atributos de suelo y cultivos. podría basarse en la clase de atributo nivel 1 “densidad de árboles” o en el atributo nivel 2 “combinación de cultivo de árboles”. La principal categoría de uso de suelo a la que esta parcela en particular pertenecerá puede definirse como “cultivos permanentes a pequeña escala con maíz como cultivo principal”. si la información es correcta y se considera importante en el contexto de la clasifica324 Manual de biología de suelos tropicales . por ejemplo.11 muestra los datos para una parcela imaginaria de maíz.significa una plantación grande de árboles. por lo tanto. se podría definir una subclase añadiendo la descripción “intercalada con un cultivo de leguminosas” para distinguirla del maíz como único cultivo. con relación a la variedad de plantaciones. enfermedades y la fertilización del suelo no tienen lugar. lo cual únicamente tendrá sentido si existe una gran variación de dichas características dentro del área y si éstas reflejan diferentes regímenes de manejo. se pueden distinguir plantaciones de frutales. permitirá una distinción entre hule de “jungla”. porque la preparación del campo. con 100 árboles por hectárea y que recibe 1. Se pueden tomar en cuenta medidas para el control de malezas mediante corte o también el uso de químicos. Tomando en cuenta la información del cultivo principal (clasificadores del nivel 1) se describirá la parcela como grande (con 10. se pueden distinguir plantaciones de árboles destinadas a la producción de madera para tablas o para otros fines y si se utiliza la información sobre el propósito.000 m² por tamaño de la parcela). Las diferencias entre la intensidad de uso de suelo. es importante informar sobre el uso del suelo circundante. el segundo nivel indica que entre el maíz se encuentran otros cultivos y. una plantación de más de 10 años de teca (que forma un dosel cerrado). o si forma parte de un paisaje dominado por plantaciones de cultivos de árboles.

9 Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo.Tabla 11. Nivel 2 cultivo combinado Cultivos simples o múltiples Suministro de agua Factor tiempo de cultivo Nivel 3 prácticas culturales Cobertura del cultivo Nivel 1 características del cultivo y el campo Clasificador Forma de vida del cultivo principal Tamaño del campo Segundo Densidad o espacio entre tipo de cultivo plantas Tercer tipo de cultivo Cantidad de agua suministrada Número de Clase de cobertura del cultivos cultivo Tiempo de secuencia Arreglo espacial Tipo de irrigación Duración del período de barbecho Índice Ruthenberg Clase de tamaño del campo D escripción Modo de preparación del campo Tipo de tracción Frecuencia Tipo de operación Alcance de la operación Frecuencia Modo de deshierbe Manejo de plagas y enfermedades Prácticas de fertilización Tipo de fertilizante Volumen aplicado Atributos Nivel de especie 1 Tipo de cultivo (categoría) Forma del campo Tipo de barbecho Tipo especifico de barbecho Atributos Nivel de especie 2 Cultivo especifico (categoría o especies) Atributos Nivel de especie 3 Cultivo variedad (especie o variedad.) Nivel 4 manejo Modo de cosecha y clasificación de uso de suelo en puntos de muestreo Clasificador Medios de limpieza Atributos Nivel de especie 1 Grado de limpieza Modo de limpieza 325 .

Nivel 2 cultivo combinado Tipo de equipo Ubicación. 3 Atributos Nivel de especie 4 Nivel 5 Configuración espacial del campo y árboles en la finca Clasificador Configuración espacial de los árboles en la finca Atributos nivel 1 Propósito de los árboles en la finca Atributos nivel 2 Tipo de especies de árboles dominantes .Tabla 11. Modo de equipamiento Aplicación Nivel 3 prácticas culturales Tipo de arado Alcance de la operación Eficiencia Clasificación de la aplicación Tipo de fertilizante Tipo de químicos Tipo de herbicida Volumen Volumen aplicado Volumen aplicado aplicado Patrones de distribución del campo Cobertura de árboles (copa) Densidad de árboles o longitud de barreras Patrones de distribución del tamaño del campo Partes del área terrestre cultivadas y manejadas Partes terrestres no cultivadas Arreglo espacial del campo Forma de vida del cultivo principal Otros tipos de uso o cobertura Clasificación de la aplicación Clasificafión de la aplicación Tipo de equipo 326 Eficiencia Nivel 1 características del cultivo y el campo Atributos Nivel de especie 2 Manual de biología de suelos tropicales Atributos Nivel de especie.9 Continúa.

Tabla 11. Tamaño o clases de tamaño del campo Tipo de cultivo principal % cobertura Nivel 5 Configuración espacial del campo y árboles en la finca Atributos nivel 3 Especies de árboles D escripción y clasificación de uso de suelo en puntos de muestreo 327 .9 Continúa.

de hoja ancha leñoso >10 años Manual de biología de suelos tropicales Atributo téc.Tabla 11.Teca nico nivel 2 Atributo téc. .Tectona grandis nico nivel 3 * En este caso. aunque no se discuten en este capítulo. para lo cual se utilizan otros parametros. si es relevante.10 Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca. ** En el caso de sistemas de temporada de ser posible debe especificarse la cantidad de lluvia.000 m2 100 árboles/ ha n/a n/a 1. aunque esto por lo general se describe en las características del sitio. Nivel 2 Combinación de cultivos Único 328 Nivel 3 Prácticas culturales De temporada n/a n/a n/a n/a Permanente n/a Grande Regular Cerrado Vegetación natural* 10. se puede describir las plantas debajo de los árboles y estas plantas pertenecerán a la categoría de vegetación (semi) natural.200 mm** n/a n/a Nivel 1 Características del cultivo y el campo Clasificador Árboles Atributos técnicos Nivel 1 Perenes.

16 1 cultivo adicional Simultaneo 2 filas alternadas NA Intermitente De temporada Permanente Mejorado Nivel 1 Características del cultivo y el campo Nivel 3 Prácticas culturales Clasificador Gramíneas Pequeño Atributos nivel de especie 1 Cereales Cuadrada D escripción Mecánica y química Labranza frecuente (2x) y fumigación una vez (1x) Aspersor de mochila VB (Roundup) Continuo n/a n/a Pequeño Uniforme 90% Regular Hierbas y gramíneas Chícharos. maíz 10% n/a n/a n/a n/a Ninguno Fertilizante químico Directamente hoyos Manual VMB (muy bajo) 50 kg CAN/ha n/a Atributos nivel de especie 2 Maíz Mucuna (abono verde) Atributos nivel de especie 3 Nivel de manejo 4 n/a Tracción animal n/a 2 bueyes n/a Arado de vertedera n/a Nivel 5 Configuración espacial del campo y árboles en la finca No TROF y clasificación de uso de suelo en puntos de muestreo n/a n/a Caminos .Tabla 11. Nivel 2 Combinación de cultivos Múltiple 2.11 Ejemplo de clasificadores y valores de atributos para parcelas de maíz.infraestructura 329 n/a .000 m2 Mediano a grande 75 x 25 cm Frijoles NA 0. habas.

que las parcelas son generalmente pequeñas. principalmente. Esta sección pretende demostrar cómo un conjunto de clases podrá definirse y organizarse en una estructura jerárquica y que el sistema es bastante flexible en cuanto a la selección de clasificadores y atributos considerados para su clasificación. el manejo tiene por objetivo modificar o establecer condiciones que propicien la producción de un cultivo. dependiendo de las reglas de clasificación. La información específica se refiere a la densidad de la planta. al arreglo específico de la combinación del cultivo y a qué especie es utilizada para mejorar el barbecho. Los clasificadores de nivel 5 y los atributos describen que el suelo es cultivado de manera continua. sin que esto quede reflejado en la definición de las clases. más intenso será su uso). Parece que existe un consenso sobre los factores que determinan la intensidad del uso de suelo. Giller et al.ción. Ordenamiento de las clases de uso de suelo respecto a la intensidad de su uso En sistemas agrícolas. Manejo y nivel de insumos: la información en el manejo del cultivo y el suelo habla de que el nivel de perturbación del suelo se considera intermedio (habiendo sido arado dos veces con el uso de tracción animal) y que el insumo de químicos ha sido bajo. La norma general es que los sistemas culturales y manejados son más intensivos que los naturales (cuanto más insumos de manejo se requieran para mantener los sistemas.. uso de nutrientes. en “un manejo caracterizado por el uso de tracción animal y bajo insumos agroquímicos”. manejo de plagas. con un bajo volumen de herbicidas. Un esquema de clasificación estándar no funcionará porque la definición de un conjunto de clases depende del contexto y del propósito específico de la clasificación. con cultivos anuales. sin el uso de fungicidas o pesticidas y únicamente con muy baja cantidad de fertilizantes. con escasa o sin presencia de árboles. pero una definición de un índice o medida de la intensidad de uso de suelo no es fácil. el criterio para mejorar el barbecho podría considerarse en la definición de las subclases. El grado de interferencia con (perturbación o alteración) el ecosistema natural sería una buena medida de la intensidad del uso de suelo. (1997) definieron un índice de intensidad de uso de suelo que considera la frecuencia de la ocupación de suelo (según lo expresado en el índice Ruthenberg). Esto podría traducirse. insumos de ener330 Manual de biología de suelos tropicales . que indica patrones de uso de suelo fragmentados y un uso intensivo del suelo.

El primer gradiente representa la presencia (proporción en el espacio o tiempo) de vegetación seminatural.gía y manejo de agua. Además. la proporción del tiempo durante el cual la vegetación del suelo se restablece de manera semipermanente. Existen dos principales ejes a lo largo de los cuales se mide la intensidad del uso: el primero. puesto que cada índice es una expresión particular de la intensidad del uso de suelo. reflejando el grado en el que estos factores tienen un efecto en los ecosistemas (el grado en el que se altera o perturba el ecosistema natural) y debido a que algunas veces los datos requeridos para una evaluación cuantitativa de la intensidad del uso de suelo no son accesibles. En ambos casos. Lo anterior permite un arreglo de los componentes de la vegetación (objetos) a lo largo de dos gradientes. indicando que el sistema con una proporción mayor de vegetación permanente (ya sea como elementos de vegetación natural o cultivada) representa una intensidad menor de uso o un grado menor de perturbación. en el caso de cultivos migratorios. que en el entorno de márgenes de selva se traduce en elementos de vegetación leñosa. el componente de la cobertura de la vegetación (semi) permanente es un indicador útil. Han existido varios intentos por definir una medida de intensidad de uso de suelo. pero éstos no han sido del todo exitosos. se requieren categorías de clases de uso de suelo en términos de la intensidad de uso de suelo (o alternativamente una definición de clases de uso de suelo que reflejen diferentes niveles de la intensidad de uso de suelo). La presencia de vegetación permanente en el sistema de cultivo limitará las posibilidades para cultivar el suelo o la proporción del suelo que puede ser cultivado. puesto que es difícil asignar un peso adecuado a las variables explicativas. El segundo gradiente D escripción y clasificación de uso de suelo en puntos de muestreo 331 . con la relevancia de que un índice en particular dependiente del contexto o propósito para el cual se está desarrollando. Para los propósitos de investigar tendencias en la pérdida de la diversidad del suelo en relación con un incremento en la intensidad de su uso. como factores relevantes. los esfuerzos para crear un índice universal o una medida de la intensidad de uso de suelo serán inútiles. Esto se hace considerando aquellos atributos (y clasificadores) que expresen un aspecto en particular de la intensidad de uso de suelo. se refiere a la permanencia (o frecuencia) de operaciones y el segundo. a la intensidad (o amplitud) de las operaciones. También. aunque no directamente relacionado con la influencia de la operación del manejo. se traduce directamente en la frecuencia del cultivo. Es decir. de la misma manera como lo ilustran Kuechler y Zoonneveld (1988). la presencia de vegetación permanente disminuirá la influencia de la variación climática en el ecosistema del suelo.

Cultivos anuales-campo Componente de le vegetación leñosa y semileñosa (natural) Componente de la vegetación leñosa cultivada Componente de la vegetación leñosa no cultivada Componente árbol Selva Tiempo de cultivo-permanencia Plantación 332 Manual de biología de suelos tropicales . La localización a lo largo de los dos ejes. de acuerdo con el incremento en la intensidad: “sin cultivar”. pero sobre todo.“cultivos migratorios”. como en el sistema de “hule de la selva” mencionado arriba. y presencia o ausencia del componente arbóreo. Los objetos se refieren a árboles que existen en la naturaleza (en el caso de vegetación natural). se determina basándose en los clasificadores y atributos del sistema de clasificación. de acuerdo con el componente Figura 11. dentro del sistema de cultivo. para el sistema de cultivo permanente. dentro de cada una de las clases definidas.5).1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. En segundo lugar. selva). este eje también expresa una partición en el espacio entre los elementos de vegetación natural y cultivada. Además de servir como una partición en el tiempo. Se puede hacer una subdivisión adicional basándose en la duración del periodo de barbecho. en el siguiente nivel de especificación. los objetos de uso de suelo son ordenados a lo largo del segundo gradiente de intensidad de uso de suelo. sólo de árboles plantados (plantación) o sólo de cultivos anuales o pastizales. como se ha especificado en el atributo técnico 1. a árboles plantados o cultivados (árboles cultivados) o elementos de vegetación no leñosos (por ejemplo. El continuo puede representarse gráficamente con un triángulo en donde los tres ángulos representan los valores extremos de la cobertura del suelo que solo pueden estar constituidos por árboles naturales (es decir. cultivos anuales y pastizales) en el caso de elementos de vegetación cultivados. lo que resulta relevante en el caso de sistemas particulares de uso de suelo.representa la cobertura de vegetación leñosa. la permanencia se expresa con el factor “tiempo de cultivo” y el sistema de clasificación permite un arreglo de clases de uso de suelo.“sistemas de barbecho”-“cultivos permanentes” (véase Tabla 11. En primer lugar.

las cuatro clases de intensidad se definen de acuerdo con el grado de mecanización (es decir. tracción animal o medios mecánicos). En el tercer paso. tiene que considerarse la información relacionada con los árboles en la finca (Tabla 11.1). sin cultivo. como se ve reflejado en la información sobre la categoría del cultivo (ver atributo técnico 1. Respecto al tipo de cultivo de gramíneas. Por ejemplo. Una vez más. También se podrían considerar operaciones de deshierbe con “deshierbe mecánico”. las plantaciones de árboles se consideran menos intensivas que cuando se trata de arbustos pequeños como el del café o té. Si únicamente se toma en cuenta la forma de vida del cultivo principal.2) y combinaciones de cultivo (Tabla 11. Las clases se ordenan de acuerdo con este gradiente utilizando las características del cultivo principal (Tabla 11. Una asignación de la intensidad de clases se basa en el valor del clasificador en las operaciones de cultivo (es decir. porcentaje de la cobertura del cultivo. manual. se deberá considerar la intensidad de las operaciones. los cultivos de árboles se consideran menos intensivos cuando se comparan con cultivos de arbustos.1) junto con las características de la cobertura del cultivo (es decir. Respecto a los cultivos sin gramíneas. Tabla 11. Una diferenciación adicional para cultivos que no son árboles se basa en la permanencia o duración del cultivo. operación de cultivo) y con el grado de uso de agroquímicos (para el control de malezas y manejo de plagas y enfermedades) tal y como se indica en la Figura 11. “plátano y otras plantas herbáceas similares”.5). la clase “bambú” aparece antes que las clases de “pastos”.2.3).1). A un nivel más general. el rango se lleva a cabo basado en las características de manejo (el cuarto nivel en el sistema de clasificación). D escripción y clasificación de uso de suelo en puntos de muestreo 333 . Existen dos aspectos que deben ser considerados en relación al manejo: uno se relaciona con el grado de perturbación física debida a las operaciones de manejo y el otro se relaciona con el grado de interferencia química con el sistema (uso de agroquímicos). dentro de las clases resultado de los dos pasos explicados arriba. de gramíneas y con formas de vida herbáceas. Los clasificadores y atributos del nivel 4 (especialmente relacionados con las operaciones de cultivo. Tabla 11. el orden de intensidad de uso sería el siguiente: “cultivo herbáceo”. Si la cobertura de los árboles es escasa. En el caso de cultivos de árboles (sistema basado en árboles) se puede considerar el número de estratos de la vegetación y el porcentaje de cobertura del suelo para una categoría posterior.árbol o arbusto en el sistema de cultivo (referido a las proporciones en el espacio o en el tiempo). “lúpulo y otras enredaderas perenes herbáceas” y “cultivo de cobertura”. como un nivel más de intensidad. “cereales” y “arroz” (ver Tabla 11. deshierbe y de manejo de plagas y enfermedades) son utilizados para definir las clases de intensidad.

2. seguido por el arado de disco. Como se ilustra en la figura 11. En cuanto al orden de categoría respecto del uso de agroquímicos. La superposición será considerable entre las clases de sistemas de barbecho y sistemas de cultivos permanentes.Figura 11. en el primer paso de la clasificación. El arado de vertedera tiene un efecto más profundo en el suelo (remoción completa). podría basarse en el volumen de aplicación (aplicación selectiva o localizada. que representa el nivel más bajo de perturbación. BAJO NIVEL DE INSUMOS QUIMICOS INTENSIDAD MEDIA: ALTO GRADO DE MECANIZACIÓN. el arado de cincel y. considerando una plantación de árboles (cultivo permanente bajo manejo extensivo) representará un sistema menos intensivo que un cultivo manejado intensivamente bajo un sistema de barbecho corto. Para poder llegar a una clasificación final de clases de uso de suelo en términos de intensidad de uso. tipo de equipo o maquinaria usada en el caso de plagas y enfermedades y el volumen de aplicación. pero una diferencia más. A nivel más general. únicamente se considera el “uso” o el “no uso” de agroquímicos. INTENSIDAD MEDIA: BAJO GRADO DE MECANIZACIÓN.3. y no reconoce que puede haber una superposición considerable en términos de intensidad de uso de suelo entre las clases. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. los clasificadores para el control de malezas y manejo de plagas y enfermedades. son considerados de manera conjunta.6b). ALTO NIVEL DE INSUMOS QUIMICOS Uso de agroquimicos INTENSIDAD ALTA: ALTO GRADO DE MECANIZACIÓN.3. ver Tabla 11. el arado escarificado. estas clases tienen que relacionarse entre sí. la clase de uso de suelo más intensiva pertenece a “cultivos migra334 Manual de biología de suelos tropicales . una evaluación por pares de clases de uso de suelo individuales en la región de superposición dará la clasificación final en términos de la intensidad de uso de suelo. Al final. El procedimiento jerárquico descrito arriba producirá ramificaciones claramente separadas en la clasificación del árbol. BAJO NIVEL DE INSUMOS QUIMICOS Otra diferencia podría establecerse en función del tipo de animales o maquinaria usada (de acuerdo con los caballos de fuerza) y el tipo de arado empleado. Esto se puede observar en la figura 11. ALTO NIVEL DE INSUMOS QUIMICOS Grado de disturbio físico INTENSIDAD BAJA: BAJO GRADO DE MECANIZACIÓN. por último.

en esta fase. sistema de barbecho (4-5 meses < barbecho < 8-9 meses) Fsci: cultivo intensivo. sistema de barbecho (barbecho 4-5 meses) Pte: cultivo de árboles extensivo.3 Clasificación del uso del suelo en términos de la intensidad de uso. en primera instancia. cultivo migratorio (barbecho < 1–2 años) Flce: cultivo extensivo. en las regiones superpuestas entre la categoría mayor de uso de suelo. sin distinguir. considerando que la cobertura de árboles en plantaciones puede ser entre el 60% al 70% de la intensidad de uso. se aplican los mismos criterios que en el segundo y tercer pasos de la clasificación. si proviene de orígenes culturales o (semi) naturales (por ejemplo. si el suelo está en barbecho el 60% del tiempo y la vegetación de ese suelo es pasto. cultivo permanente Pcmi: cultivo de intensidad media. cultivo permanente Pti: cultivo de árboles intensivo. este pasto se considera el tipo de vegeD escripción y clasificación de uso de suelo en puntos de muestreo 335 . donde se determina el orden a lo largo del gradiente de intensidad de uso de suelo descrito anteriormente. bajo cultivo migratorio (periodo de barbecho > 8-10 años) Smce: cultivo extensivo. cultivo permanente Pchi: cultivo intensivo. bajo cultivo migratorio (1-2 años < barbecho < 8-10 años) Ssce: cultivo extensivo. cultivo permanente Pgi: pastizales intensivos.Figura 11. lo que se toma como el límite superior para la clase “cultivos migratorios”. que corresponde al 66% del tiempo que la tierra no es cultivada. Donde: Fn: selva natural Fl: selva explorada Slce: cultivo extensivo. cultivo permanente torios” y es seguida por el de menos intensidad de uso “cultivo permanente”. cultivo permanente Pge: pastizales extensivos. sistema de barbecho (barbecho > 8-9 meses) Fmcm: cultivo de intensidad media. Esto quiere decir. Para establecer una comparación de clases de uso de suelo individual. que se considera la forma de vida de la vegetación dominante o cultivo.

F. los pastizales permanentes. B. Susilo.. FAO. Craig. S. in C. J. M. J. Strategies and Methods of Introduction. Rome.. si se compara con un área de cultivo permanente bajo manejo intermedio o bajo (Pcmi). 336 Manual de biología de suelos tropicales . S. Igualmente. A. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. A. (2002) Soil Management and Conservation for Small Farms. in D. Respecto a la selva.. F. es decir.. D. si se compara con un cultivo anual con un sistema de barbecho corto (Fsc). 2005). Columbia University Press. G. N.. J. De Freitas.. A. GCP/RA/287/ITA Africover – East Africa Project and Soil Resources. FAO Soils Bulletin 77. V. (2005) ‘Belowground diversity assessment: Developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. Tondoh. de acuerdo con los sistemas de uso de suelo en el trópico húmedo a diferencia del proyecto ASB (Bignell et al. aun en el caso de que sean manejados intensivamente (Pgi) tendrán una clasificación más baja en términos de intensidad de uso de suelo. A. se hace una distinción entre selva natural. FAO. “sistemas de barbecho” refiriéndose al componente de cultivo. H. Huang. J. Marcel Dekker Inc. Vosti. Di Gregorio. REFERENCIAS Bignell. Palm. (2000) Land Cover Classification System (LCCS): Classification Concepts and User Manual. Agradecimientos Al profesor Ken Giller por sus comentarios y al Dr. P. (2002) ‘Aerial application’. más que al barbecho en sí) para permitir a la clase bajo consideración subir una o dos posiciones en el orden de clasificación. y Swift. Pashanasi. Pimentel (ed) Encyclopaedia of Pest Management. I. L. P. M.-X. con la introducción de una noción de que la extracción de productos de la selva sirve como un indicador para la intensidad de uso. un cultivo con un manejo intensivo bajo un sistema de barbecho corto (Fsci) puede subir una posición. Management and Conservation Service. Techniques and Equipment. y Jansen. E. En el segundo ejemplo se considera la intensidad de manejo (en relación con el cultivo más demandante del sistema. De esta manera. Sanchez and P.tación dominante).. D. Rome.New York. New York. Moreira. Woods. Nwaga.. y Dorr. selva manejada y selva explotada. L. P. Dibog.. Peter Okoth por las discusiones en la preparación de este capítulo.

Dordrecht. K. Barrios. Handbook of Vegetation Science. L.edu/pnw/weeds.D. G. ICRAF-Southeast Asia Regional Research Programme. Kluwer Academic. Baere. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica.weeds. www. H. John Wiley & Sons. J. K. 3rd edition. Stocking. R. y Swift. Fritsch and C. (2005) ‘Soil biodiversity in rapidly changing tropical landscapes: Scaling down and scaling up’. in M. S. E.iastate. P. Zandstra. 10. Huising. Heipke (eds) Digital Photogrammetric Systems. M. P. (2002) Jungle Rubber: A Traditional Agroforestry System Under Pressure. Moreira. Oxford. J.. y Huising. H. Amsterdam.. E. F. R. T. y Williams. Molenaar.. Vink. D. E. G. A.org/swcmeas. Bardgett and D.Giller. M. The Netherlands. M. W. J. G.. van Noordwijk. A. Thesis. Indonesia. A. van Noordwijk. y Zonneveld.. www. M. D escripción y clasificación de uso de suelo en puntos de muestreo 337 . Giller... Joshi.. Cambridge University Press. Clarendon Press. and Murnaghan. Manurung. Lillesand. ippc. in H. W. Iowa State University (2004) ‘Weed Science’. y Kiefer.. N.edu/mgmt/2004/ world.. N. (1997) ‘Agricultural intensification. Springer Verlag. Hopkins (eds) Biological Diversity and Function in Soils. New York. D. W. (eds) (1988) Vegetation Mapping.V. M. D. E.. soil biodiversity and ecosystem function’. Lavelle. Elsevier Science Publishers B. Kuechler... M. Cambridge. The Netherlands. A. 6. Barois. Oregon State University (2005) Pacific Northwest Weed Management Handbook.-M. ILACO (1985) Compendium for Agricultural Development in the Tropics and Sub-Tropics. www. Swift. Bignell. (1987) Remote Sensing and Image Interpretation.. Izac. Molenaar. Karlsruhe. Usher. (1998) An introduction to the Theory of Spatial Object Modelling for GIS. M. The Netherlands. J. Boutin. Wichman Verlag. Bogor. Berlin WOCAT. M. pp. World Overview of Conservation Approaches and Techniques. y Collinsons. Wageningen Agricultural University. MacArthur.. London. (1975) Land Use in Advancing Agriculture. Wibawa.. Akiefnawati. P.. P.shtml. M.. Earthscan Publications Ltd. D. vol. E. object dynamics and consistency rules’. Vincent. Applied Soil Ecology. vol. Karanja. R. H. J.. S. Ph. A pattern recognition approach to land use inventory at the sub-regional scale using remote sensing and GIS applying an object oriented and data-driven approach’. (1991) ‘Formal data structures.asp. N. Ruthenberg. Taylor & Francis Ltd.. B.orst. (2001) Handbook for the Field Assessment of Land Degradation. D. Ebner.. I.wocat. London. (1980) Farming Systems in the Tropics. M. I. 3–16. Lavelle.

.

Brazil. Belo Horizonte MG.com. cares@unb. Constantino. Brazil. Csuzdi. Kenya. Huang. C. DF. Departament of Agricultural Microbiology. Departamento de Fitopatología. Instituto de Química. Malaysia. Universidade Federal de Minas Gerais. 88999 Kota Kinabalu.br. Abreu. Nairobi.org. Campus Universitario Darcy Ribeiro.bignell@qmul. Bangalore. CEP 70. Franklin. (finado). M. Departamento de Zoología. Brazil.com. E. Sabah. Cx Postal 478. R. J. S.904-979. Manaus. Cx Postal 4457. D. Hungary. Instituto de Ciências Biológicas. Gigiri. R. Universidade de Brasilia (UNB). Coordenação de pesquisas em Entomologia. H-1088 Budapest. Instituto Nacional de Pesquisas da Amazõnia (National Institute for Amazonian Research-INPA).hu. Universidade de Brasilia. Instituto de Ciencias Biológicas. Brasilia. E. Coe. Brazil. Institute for Tropical Biology and Conservation. PO Box 30677-00100. United Nation Avenue.gov. AM. Universidade de Brasilia (UNB).br. DF. Brazil.Colaboradores L. Systematic Zoology Research Group of Hungarian Academy of Sciences and Hungarian Natural History Museum. P. CEP 69011-970. Universiti Malaysia Sabah. Bagyaraj. D.coe@ criar. J.ac. CEP 70910-900 Brasilia. Brasilia. DF. beth@inpa. csuzdi-alef@nhmus. 339 . constant@unb. Cx Postal 4457.904-970. 13. dbagyaraj@vsnl. Barross str. World Agroforestry Centre (ICRAF).uk. E. University of Agricultural Sciences. India. Bignell. d. Departamento de Fitopatología. GKVK Campus. CEP 70. Cares. r.br. lmabreu@gmail.

Abidjan 02.br. j. J. 02 BP 801. W. J. Indonesia. F. morais@inpa. Centre de Recherche en Ecologie. Abidjan.edu. fmoreira@ufla. Faculdade de Ciências Agrárias. asgknila@yahoo.id. Faculty of Agriculture. Jr. L. M.fr. Tropical Soil Biology and Fertillity (FSBF) Institute of CIAT. Cx Postal 3037. Instituto Nacional de Pesquisas da Amazônia (Nationale Institute for Amazonian Research-INPA). MG. CEP 37200-000. Kenya. C. m.net.org.van-noordwijk@cgiar. CEP 89010-971. Jalan Suantri Brojonegoro nº1. Moreira. Universidade Regional de Blumenau. Universidade Federal de Lavras. S. Departamento de Fitopatologia. alcmoino@ufla.br. Cx Postal 3037. B. Zoology Division. Indonesia. LIPI JI. Côte d’Ivoire. CEP 37200-000. C. MG. RC Biology. 69011-970. University of Lampung.. Universidade Federal de Lavras. Cx Postal 1507. E. Universidade Federal doAmazonas. Departamento de Biología (Biology Department). Pfenning. Université d’Abobo-Adjamé. Universitas Lampung. Susilo. Lavras. Rahmadi. AM Brazil. A.br. Kenya. Brazil. X. Bandar Lampung 35145. World Agroforestry Centre SE Asia. Indonesia. UFR des Sciences et de la Nature. J.P. Silva. Bogor. Jalan Sumantri Brojonegoro nº 1. Department of Plant Protection. F. van Noordwijk. H.com. Skonate2@yahoo. Morais. Departamento de Ciência do Solo (Soil Science Department). Cx Postal 3037. N. Raya Jakarta-Bogor Km. Lavras .com. Manaus. M. Departamento de Entomología. Gigiri. Tondoh. Gigiri. Universidade Federal de Lavras. United Nations Avenue.E. J. CEP 37200-000.go.br.com. Swift. Louzada. AM. L.br. S.gov. Universidade Federal de Lavras. Brazil. Cx Postal 3037. PO Box 161. Stürmer.br. Côte d’Ivoire. c/o ICRAF.com. Brazil. sturmer@furb. 16001 Indonesia. Brazil. CEP 69070-000 Manaus. A. ludwig@ufla. Moino. tondohj@ yahoo. M. United Nations Avenue. cahyo. Karyanto. Lavras. Tropical Soil Biology and Fertility Institute of CIAT. c/o ICRAF. 46. Faculty of Agriculture. CEP. N. S. jlouzada@gmail. Brazil. 340 Manual de biología de suelos tropicales . Nairobi.huising@cgiar. Blumenau. Departamento de Ciências Naturais. Cx Postal 478. J. Université d’Abobo-Adjamé. M. nmarques@ufam. fxsusilo@tlkom. Huising.rahmadi@lipi. PO Box 30677-00100. Cibinong. Brazil.com. CEP 37200-000 Lavras MG. Konaté. SC. 801. PO Box 30677-00100 Nairobi. swiftmj2003@ yahoo. Bandar Lampung 35145. Coordenação de Pesquisas en Entomnologia.

MG.br. Cx Postal 37.R. Zanetti. C olaboradores 341 . Lavras. CEP 37200-000. Universidade Federal de Lavras. zanetti@ufla. Brazil. Departamento de Entomologia (Enthomology Department).

.

252-153 Asia 140–141 atributos 297. 247–248 arado 311. 334 aislamiento 190. 251-252 bienes y servicios. 334 Ascomycota 248. 263 análisis de conglomerados (cluster) 267 análisis de correspondencia (AC) 266 análisis de varianza (ANOVA) 265 análisis filogenéticos198. Véase análisis de correspondencia ácaros oribátidos 150 ácaros 149-159 acceso a puntos de muestreo 84. 291 análisis automatizado del espaciador intergénico ribosomal (ARISA) 261. 177-214.Índice analítico A abundancia macrofauna 98. 191. 246 agroquímicos 313.314.85 ácido láctico 156 aditivos 279. de uso de suelo 302 B bacteria 39. 99. 280 África 141–142 agroecosistemas 43. 132 mesofauna 159. 217. 290 bacterias fijadoras de nitrógeno (BFNFNL) 177-213 Basidiomycota 248. 93. Véase servicios ecosistémicos biomasa 127. 40. 194-197. 151.164. 243. 132 343 . Véase atributos atributos técnicos específicos.160 nematodos 171-172 AC. 302-329 atributos de tamaño de unidades de muestreo campo o parcela 304-307 cuadrícula 81-82 atributos técnico. 126. 288. 290-294 alimentación especializada o incidental 111 almacenamiento de las muestras 78.127.

Véase Proyecto. 331-332 Chromista 247 Chytridiomycota 248. 265-267. 303 DGGE. 188. 246 descriptores genéricos 194 desmonte de la tierra 311. Véase colonizadores cálculo. 94. 298. 125-132. 301. 226-232 hongos 244. 302. 101. Véase taxonómica clasificación. 310. 164 descomposición 29-35. 307 características del cultivo 301. 194 HMA 219-222. 158-160. 58 . 316 cultivos puros 198 cultivos secundarios 307 cultivos trampa 231-232 curvas de acumulación de especies 113. 304-324. 304307. 102 clasificación. 300. 58. jerarquía 323 clasificadores 297. 96. 325-329 colecciones de recursos genéticos 267 Collembola 123. 319-320. 190 caracterización de sitios 87-88 caracterización genética 197 cartografía. cultivo 305. 197.biopesticidas 288 bioturbación 34 C C. 317 cPCR. cultivo 305-307 depredadores 37. Véase disturbio datos requeridos y análisis 49-50. 129. 251 ciclo de nutrientes 34 clasificación de uso de suelo 332. 37-38. 149-162 colonización 219-224 colonizadores (c) 172-174 combinación de cultivos 308-311. 313-315 determinación a priori 65. 124. 325-329 caracterización cultural 189. 97. 334335 clasificación de procesos 93. 171-172 cercas vivas y otros elementos de vegetación 319-321. 110 nematodos 171-172 uso de suelo 42-43. 245. Véase electroforesis en gel con gradiente de desnaturalización diapausa 289 disección 157 diseños multiescala 64 diversidad BFNFNL 178-182. 243. uso de suelo 81 categorías tróficas 110-112. 265-267 macrofauna 98-100. Véase PCR competitivo CSM-BGBD. 254-255 D D. 265 curvas de rarefacción 265 Cylindrocladium spp. 302-304 densidad. conservación y manejo sostenible de la biodiversidad del suelo 344 Manual de biología de suelos tropicales cuadrícula estratificada 84-85 cultivo post inundación 308 cultivos de sotobosque 308 cultivos migratorios 309. Véase enumeración cobertura. 302. 325-329 conjunto mínimo de datos 129-132 contaminación 78 control microbiano 287 cosecha 311.

257 esporas de HMA 226-228 método de Berlese 152-154 método de extracción Winkler 92. 128 especies clave 129 especies endógenas 99. 322-323. 36. 319 enfoque sesgado 65 enfoques transversales 57 ensamble de especies 110 ensayo de reducción de acetileno (ERA) 185. 190. 226-228.99-100. 110-111. 193 equidad 266 ERA. 94-100 esquemas de puntos de muestreo 72-75 estacionalidad 88. 315.6567. 104. 192 . 112125. 152-155 enfermedad 35. 330-333 familia Acaulosporaceae 238 familia Archaeosporaceae 239 familia Gigasporaceae 240 familia Glomeraceae 236 familia Pacisporaceae 239 familia Paraglomeraceae 239 fase de pupa 284 fauna de la hojarasca 37. 229-231. 287. 163-165 grupos funcionales de la biota del suelo 38-41 H herbívoros 37 hidróxido de potasio (KOH) 156 hipótesis de CSM-BGBD 57 Í ndice analítico 345 . 128 especies epigeas 78. 312. muestreo 80-81 gremios 114-115 grupos funcionales 29-41. 128 fertilizantes 314-316. 113. 71 etiqueta 97. 70. 116-125. 288 esquemas de muestreo alternativos 5789. 189. 132 nematodos 165-166 extracciones núcleo por núcleo 154 F factor tiempo de cultivo 309. 115-117. 98 estándares para BFNFNL descripción de especies 194-196 estatus de los cultivos 318 estratificación en el muestreo 55-57. 85-86 escarabajos 100-113. Véase ensayo de reducción de acetileno escala 62 escalas espaciales de muestreo 42-50. 114-118. 191 enumeración 168. 283 extracción DNA 197. 218. 140 especies anécicas 100. 128 especies trampa 185-186 esporas 88. 162. 317. 130. 317 fertilizantes inorgánicos 315 fijación de nematodos 165-169 G glomerales 220 Glomeromycota 247 gradientes. 263 embudo de extracción 149.E eficiencia en la labranza 312-314 electroforesis en gel con gradiente de desnaturalización (DGGE) 259-260. 99.

243-280 hongos fitopatógenos 41 hongos micorrizógenos 217-241 hongos micorrizógenos arbusculares (HMA) 41. 193 jerarquía clasificación 323 clasificación de uso de suelo 300-302.173 índice de riqueza de género 171 índice de Shannon–Wiener 266 infiltración de glicerina 168 ingenieros del ecosistema 34. 259-260. 140-144 mesofauna 156-159 moscas de la fruta 284-285 nematodos 163-165. 293. 263-264 índice fitoparasítico (IFP) 172-174 índice de madurez (IM) 172.HMA. Véase índice de madurez imágenes satelitales 67. 187. 297-336 investigaciones piloto 60 irrigación308. 334 labranza mínima 312 LCCS. Véase hongos micorrizógenos arbusculares hongos entomopatógenos 287-294 esquema de medición por puntos 74 grupos funcionales 39. 37. 91-92. 317 J jarras de Leonard 186. 91. 243-280 hongos antagonistas 41 hongos del suelo. 100-113. 306 índice de diversidad de Shannon 171 346 Manual de biología de suelos tropicales L labranza 312. 41 HMA 217–241 patógenos de plantas y saprofitos 41. 305-306.93–100. 140 hospederos promiscuos 178-185. 301. 304. 330-336 inventarios 41-50. Véase también taxonomía IM. 229-230 hongos 255-256 lombrices de tierra 98-100 macrofauna 105-110. 100–113 . 166-168 organismos entomopatógenos 290. patógenos de plantas 41. 243-280 hongos saprofitos 41. 313. Véase Sistema de clasificación de cobertura de suelo límites. 91. 302-304 manejo de la biota del suelo 47-49 muestreo 79-80 replicación y tamaño de muestra 60–65 I identificación grupos funcionales en macrofauna 112-113 HMA 226-228. 193 insectos 287-294 intensidad de uso de suelo agrícola 42. 44. 53. 46 datos requeridos 48-50 descripción y clasificación 299. 185–187 huella molecular 196-198. 217. 217-241 hormigas 40. 310 limpieza de malezas 313-315 listas de especies 107-109 lombrices de tierra 40. 64. 114-118. 87-88. 129 inoculación 47. muestreo de 63.

54. 97 muestreo no aleatorio 67 muestreo secuencial 64 muestreo simple aleatorio (MSA) 55. 249. 73. 261. 82–83. 260. 118. 287–295 nematodos bacteriófagos 164 nematodos omnívoros 164 Í ndice analítico 347 . 126. 98-100.M macrofauna 39.84–85 paisajes 61-63 aleatorio y sistemático 67-68 muestreo en transectos monolitos para lombrices de tierra 97 macrofauna 75.114–118. 56. 334 media poblacional 25 medidas de conservación 318 “medio 79” 214 medio “S” 293 medio selectivo. 130 métodos de extrapolación 105 métodos de montaje 157–158. 197.149-160 método de Berlese 149-160 método de Berlese modificado 154-155 método de centrifugación en azúcar 166 método de de extracción 190. 73. 214 muestreo dentro de una parcela 65 muestreo animales 39 BFNFNL185–189. para hongos 252-255 mesofauna 39.118125. 193–195 clasificación de usos de suelo 297-336 diseño y estrategias 53-90 hongos 249 inventarios de biodiversidad 42-47 macrofauna 91-148 mesofauna 149-162 moscas de la fruta 282-285 muestreo adaptativo 64. 229–230 métodos TSBF 93–94 microfauna 37-38. 114-118. 39. 40. 290 método de filtración de partículas 252– 254. 48-49 monolitos 94–100. 263 método de Seinhorst 168 método de Seinhorst modificado 169 método Winkler 92.84–85 nematodos 165 punto de muestreo 62-63 muestreo aleatorio 55–56 muestreo en cuadrícula clasificación de uso de suelo 304 CSM-BGBD 79–80. 321-330 materia orgánica 29-35 materia orgánica del suelo (MSO) 34. 75-77. 263-264 método de la cuadrícula de intersección 227-228 método de partículas de suelo251–253 método de reacción en cadena de la polimerasa (PCR) 196. 73 microhabitat 47. 193 muestras control 193. 91-148 manejo 311-319. 67-68 muestreo sistemático 67-68 N nematodos 163–176. 40. 58 mecanismos de control 313-315 mecanización 311. 131 número de muestras 81–83 esquema de puntos de muestreo 72–75 muestreo estratificado 67. 131 monolitos complementarios para lombrices de tierra 97 moscas de la fruta 281-286 muestras compuestas 61–65.256–259. 40.

126. muestreo 81. 328.nematodos parásitos de plantas 164 nematos micofagos 164 nicho. subparcela o microhabitat 47. 145. 330 PCR competitivo (cPCR) 262 PCR cuantitativo 261-262 PCR. 219224 O observación directa 302 observaciones secundarias 303 Oomycota 250 organismos entomopatógenos 287–295 organismos mutualistas 39 P p. 126 número más probable (NMP) 218. Véase persistencia paisajes 44–47. separación de 85-86 puntos. 249–255 proceso de aclarado 156-157 procesos de degradación 44 procesos de rehabilitación 44 productores primarios 37 programa Africover 299 propágulos infectivos 219-224 protozoa 247 proyecto. 314 Phytophthora spp. 49 nivel neotropical 142. 174 pesticidas 286. 64-65. 49 nitrogenasa 184. 329 preparación de la tierra 311-312 primers específicos para “hongos” 257258 principales grupos funcionales 35-38. Conservación y manejo sostenible de la biodiversidad del suelo (CSMBGBD) 45–47. 165. 307–311. 38. muestreo 60-62 polimorfismo de conformación de cadena única (SSCP) 261. Véase Método de reacción en cadena de la polimerasa permanencia de la vegetación 330–332 persistencia (p) 172. 41 procedimientos basados en cultura 333–245. 78. 219 población. 102 nivel de parche 46–47. 49. 250 . 250 plagas 35. 7980. 325.61-62 parcelas de muestreo y clasificación de uso de suelo 46–47. 132 Pythium spp. 319 plantaciones 322–324 348 Manual de biología de suelos tropicales plantaciones de teca 328 plantas hospederas 178–182. 298 prueba de hipótesis 55–57. 263 prácticas culturales 301. 48-49.140–144 nomenclatura 106. 191 nivel de nicho 47. 63 prueba piloto 60 pseudo-replicas 62 puntos de medición 53 puntos de muestreo 74 puntos de muestreo. 57. 315. 85–86. 81. 263 polimorfismo de longitud de fragmentos de restricción (RFLP) 260 polimorfismo de longitud de fragmentos de restricción terminal (T-RFLP) 260. 317. 48. 244. 300–336 patógenos fúngicos de plántulas 255 perturbación (P) 56.185–198.147–148 nivel regional 44.79–89. 83–84. 184–186.218.

251 Ricinius communis 254–255 riqueza de especies 265–267. 140. 130-132.187 trampas McPhail 282 BFNFNL 190 pitfall 118-125. 304–319. 147 termitas que se alimentan de madera 111 termitas que se alimentan del suelo 110 TGGE. 334. 100–113. 188189 técnicas de cebo 119. 36-41 técnica de infección de plantas 178.279–280 técnicas de lavado para partículas del suelo 252.R reactivo de Melzer 230-231 reglas de decisión para la clasificación de usos del suelo 323 rendimiento.124. 123. 93-95. 82. Véase electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) 259–260. 155158 técnicas específicas de DNA 197. 145. 227 tipos de anidación 112-113 trampa de especies múltiples 185. 79 solución de nutrientes Jensen’s 215 solución Nesbitt 158 SSCP. 253-255. 297–299 rizosfera 249 rotación. 300–302. 124. 325. 317 taxonomía BFNFNL 177–182 HMA 219-222. cultivos 310-311 roundup 314 T tasas de aplicación 303. 41. 329 sitios de muestreo 60-63. 126. 285 respuestas multivariadas de interés 63-64 RFLP ver polimorfismo de longitud de fragmentos de restricción rhizobia 177-183 Rhizoctonia spp. 91.267 técnicas de procesamiento de muestras 78. 30–33. 103.249–252. Véase Polimorfismo de conformación de cadena única sustancias químicas 156-158 349 . 130-132. 149 trampa White 293 Í ndice analítico S secuencia de cultivos 107 secuenciación 16S rDNA 196 selección subjetiva 67 servicios ecosistémicos 29–36. 103105. medición del estatus de los cultivos 318-319 resguardo de especímenes 192-193. 284 neotropical 145 Véase también identificación visión general 29. 314–316. 328. 263 tinción de raíces 224–226. 263 técnicas de preservación 267 técnicas de preservación 93-94. 256–265 termitas 40. 335–336 sistemas de cultivo 42. 229-230 macrofauna 105 mesofauna 158-159 moscas de la fruta 281. 149 trampa 118-125. 163 sistema de clasificación de cobertura de suelo (LCCS) 299 sistemas de barbecho 309–310.

7981. 331–333 ventanas para muestreo 60. 303 BFNFNL 186 cartografía 81 definición de clases 321–324 descripción y clasificación 297–336 diversidad 42. Véase polimorfismo de longitud de fragmentos de restricción terminal trituradores 260 V valores cp 171-174 variabilidad 70-72 variabilidad de datos 44. 64. 83.trampas sin cebo 118 transecto de entrenamiento 102 transformación de datos 126. 132 U uso de suelo a priori definición de clases descriptivas 65. 300. 58 hongos 243 inventarios 87-88 muestreo 65-67. 87 variabilidad intragrupo 51 vegetación leñosa 319. 48 W WOCAT World Overview of Conservation Approaches and Technologies 318 Z Zygomycota 248 350 Manual de biología de suelos tropicales . 70–72. 61–62. 320–322 vegetación semi-permanente 331 vegetación. 298. 159-160 transformadores procariotas 38 T-RFLP. 83-84 Véase también intensidad de uso de suelo área de uso de suelo 46. efectos de mitigación 301.

S. Muestreo y caracterización de la biodiversidad bajo suelo .com. Col. Badillo. E. 20 de Noviembre No 649. Moreira.proagraf.Manual de biología de suelos tropicales. editado por Fátima M. Xalapa. de C. P. Tel/FAX (228) 890 6204/815 1876 www. Jeroen Huising y David E. Bignell se terminó de imprimir durante el mes de mayo de 2012 en los talleres gráficos PROAGRAF. C. Av. Veracruz.A.V. México. S.000 ejemplares . 91190.mx Se tiraron 1.

Sign up to vote on this title
UsefulNot useful