Manual de biología
de suelos tropicales

Esta publicación presenta parte de los resultados del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity”, implementado en siete países tropicales: México, Brasil, Costa de Marfil, Kenia, Uganda, India e Indonesia. El proyecto es coordinado por el Tropical Soil Biology and Fertility Institute del CIAT (TSBF-CIAT) con co-financiamiento del Global Environment Facility (GEF), y con apoyo para su implementación del Programa de Naciones Unidas para el Medio Ambiente (PNUMA-UNEP). Las opiniones expresadas en esta publicación pertenecen a los autores del libro y no necesariamente concuerdan con las de PNUMA-UNEP o GEF. La traducción y publicación de este libro en español fue posible gracias al apoyo financiero del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity” y al Instituto Nacional de Ecología (INE). También queremos agradecer todas las facilidades proporcionadas por Tiberious Brian Etyang del Tropical Soil Biology and Fertility Research Area of CIAT (TSBFCIAT) Nairobi, Kenia, a Teotonio Soares de Carvalho de la Universidade Federal de Lavras, Brazil, al Dr. José Antonio García Pérez por sus valiosos consejos y sugerencias, y a Caridad González Lerma por cuidar los últimos detalles.

Manual de biología de suelos tropicales
Muestreo y caracterización de la biodiversidad bajo suelo
Fátima M. S. Moreira, E. Jeroen Huising y David E. Bignell (editores )

Secretaría de Medio Ambiente y Recursos Naturales (S emarnat) Instituto Nacional de Ecología (INE)

Título original de la obra: A Handbook of Tropical Soil Biology Sampling and Characterization of Below-Ground Biodiversity © Earthscan en el Reino Unido y Estados Unidos en 2008 Hardcover ISBN: 978-1-84407-621-5 Paperback ISBN: 978-1-84407-593-5

Revisión de capítulos por especialistas en el tema: Dra. Isabelle Barois Boullard, Instituto de Ecología, A.C. Dra. Simoneta Negrete Yankelevich, Instituto de Ecología, A.C. Dra. Rocío Vega Frutis , Instituto de Ecología, A.C. M.C. José Antonio Gómez Anaya , Instituto de Ecología, A.C. M.C. Francisco Franco Navarro, Colegio de Posgraduados Dra. Esperanza Martínez-Romero, Centro de Ciencias Genómicas, UNAM Dra. Lucia Varela Fregoso, Hongos y Derivados, S.A. de C.V. Dr. Juan Rull Gabayet, Instituto de Ecología A.C. Dra. Dora Trejo Aguilar, Universidad Veracruzana

Primera edición: 2012
D.R. © Instituto Nacional de Ecología

Periférico Sur 5000. Col. Insurgentes Cuicuilco, Deleg. Coyoacán, 04530, México, D.F. www.ine.gob.mx

Coordinación General de la Publicación en Español: Isabelle Barois Boullard Coordinación editorial y formación: Raúl Marcó del Pont Lalli Corrección de estilo: Adriana Victoria Arcos Méndez Revisión y preparación de originales: Martín De Los Santos Bailón Colaboradora en la traducción al español: Judy Shirley Adaptación del texto: Mariluz Pérez Lorenzo Diseño portada: Álvaro Figueroa Foto de la portada: Claudio Contreras Edición para internet: Susana Escobar Maravillas Forma sugerida de citar el libro: Moreira, F., E. J. Huising y D. E. Bignell. 2012. Manual de biología de suelos tropicales. Muestreo y caracterización de la biodiversidad bajo suelo. Instituto Nacional de Ecología, México, 337 pp., México.
Ninguna parte de esta publicación, incluyendo el diseño de la portada, puede ser reproducida, traducida, almacenada o transmitida de forma alguna ni por ningún medio, ya sea electrónico, químico, mecánico, óptico, de grabación o de fotocopia sin permiso previo de los editores. Pequeños párrafos, tablas o figuras, pueden reproducirse dentro de lo estipulado en la Ley Federal de Derecho de Autor y el Convenio de Berna, o previa autorización por escrito de la editorial. ISBN: 978-607-7908-31-9 Impreso y hecho en México

Índice

1 2 3 4

Listado de tablas Listado de figuras Prólogo a la edición en español Prólogo Prefacio Lista de acrónimos y abreviaturas El inventario de la biodiversidad biológica del suelo: conceptos y guía general Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo Macrofauna Collembola, acari y otra mesofauna del suelo: el método Berlese

9 10 13 17 21 25 29 53 91 149

5 6 7 8 9 Nematodos del suelo Bacterias formadoras de nódulos en leguminosas Hongos micorrizógenos arbusculares (HMA) Hongos del suelo saprófitos y patógenos de plantas Muestreo. preservación e identificación de moscas de la fruta 163 177 217 243 281 287 10 Hongos y nematodos entomopatógenos 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo Colaboradores Índice analítico 297 339 343 .

1 11.6a 11.1 1. Género. Familia.3 11.1 3.2 11.11 Número de especies descritas en las principales categorías taxonómicas de plantas.6b 11.3 6. unidades de referencia. a través de una gradiente de perturbación de la selva.9 11.7 11. en la provincia de Jambi del centro de Sumatra Composición química para aclarar y montar especímenes Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina Familias y valores cp utilizados para el índice de madurez Familias y valores cp utilizados para el índice fitoparasítico Filum/Orden.Listado de tablas 1.1 7. labranza y deshierbe Clasificadores y atributos para el manejo de plagas y enfermedades. amplificados del DNA total Clasificadores y atributos técnicos para el cultivo principal Tamaño del campo y características de la cobertura del cultivo Atributos de cultivos combiandos Características del suministro de agua Factor tiempo de cultivo Clasificadores y atributos relacionados con la limpieza de la parcela.1 5. fertilizantes y cosecha Características de la parcela y distribución del uso de suelo Características de los árboles en la finca (TROF) Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca Ejemplo de clasificadores y valores de atributos para parcelas de maíz 26 33 44 72 103 122 154 167 168 169 174 210 253 295 297 298 298 299 303 307 310 312 315 318 319 .5 11.1 5.1 8. procesos asociados de cambio y componentes relevantes de la biodiversidad Grupos de organismos del suelo colectados utilizando diferentes métodos de captura Ejemplo de lista de especies Densidad numérica (individuos m-2) de termitas en siete localidades.2 1.1 3.8 11.2 5. biota del suelo y principales grupos funcionales a los que pertenecen Principales grupos funcionales de la biota del suelo Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo.1 11.3 2.10 11. Especie de bacterias formadoras de nódulos en leguminosas Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes.4 11.2 4.

35 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. clasificados de acuerdo con dominios y reinos. 93 Separación a mano de lombrices de tierra en charolas de plástico. según se requiera. mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra. c) incrementando la replicación. 71 Ejemplos de diferentes configuraciones de ventanas de muestreo. con puntos de muestreo adicionales. utilizando una pequeña cuchara o cuchillo de campo. 91 Esquema de alineación de monolitos complementarios de lombrices de tierra. utilizando permutaciones de datos al azar. 77 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. b) tres cuadrículas que muestrean tres diferentes parches de selva. 99 Ejemplo de curva de acumulación de especies con una desviación estándar. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. 148 .6 3. cuatro palitos pequeños y una cubierta de celofán. por estratificación. utilizando un transecto de 50 m.2 3. dispuestas a lo largo del gradiente. estudiados en el proyecto CSM-BGBD. 115 Trampa pitfall improvisada.2 2. arañas y otros artrópodos. 116 Sacabocados de metal. esto aumentará la precisión de la estimación de la pendiente. para muestrear la mesofauna en la hojarasca y en el suelo mineral. tres y dos ventanas.4 2. 109 Esquema de una trampa pitfall con cebo.5 2. b) se utilizan guantes como precaución contra enredaderas. dando un estimado pobre de la pendiente.Listado de figuras 1. 70 Esquema alternativo para muestrear macrofauna.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. tamaños y procesos de ecosistemas relacionados.1 3.3 2.3 3. a) cuadrícula completa.2 2. 54 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. El muestreo se puede ampliar si se usa uno o dos transectos para termitas.1 2.7 4. b) ilustración de la división de una cuadrícula entre seis.4 3.6 3. hecha con un vaso. hormigas. 94 Extracción de termitas de una muestra de suelo en una charola de aluminio. hormigas y escarabajos.5 3. 32 Principales grupos funcionales. 81 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). 59 Esquema de muestreo por puntos para toda la biota. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. d) reconociendo los límites como otra categoría. b) si se incluyen de manera deliberada valores de MOS más extremos.1 1.

c) incubación bajo condiciones controladas en una cámara DBO. suspensión de suelo en reposo. 162 5. 216 10. c) larvas que muestran la patología típica de infección por nematodos. b) inoculación de la suspensión (alícuota de 0. y a la derecha.3 a) Nematodos recuperados mediante el lavado de malla de 400.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). hecho de aluminio.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo.4 Embudo Berlese modificado. b) muerte de nematodos en agua caliente.2 Cultivos purificados de Beauveria bassiana.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. 166 5.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. bajo condiciones de congelación. 166 6. d) emergencia de juveniles infectivos en la trampa White. 163 5.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) disolución seriada de la suspensión acuosa que contiene al hongo. d) almacenaje de conidios en tubos Eppendorf. fijadoras de nitrógeno en diversos sistemas de uso de suelo.5 Equipo básico requerido para extracciones núcleo por núcleo Berlese-Tullgren.2 a) contenedor de apoyo para embudos Berlese–Tullgren.3 Producción de acetileno en campo o laboratorio. 189 7. 282 10. creciendo en medio ADP. 149 4. resumida en seis pasos.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. 184 6. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa. 180 6. 284 . 282 10.1 A la izquierda.4.1 ml) en una caja Petri con medio de cultivo.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos. 151 4. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. juego de tamices de metal (de malla de 45 arriba y de 400 abajo). Las cajas Petri no deben contener más de una tercera parte de líquido. b) sistema Berlese– Tullgren en operación. 187 6.3 Embudos Berlese llenos de suelo y hojarasca. 152 5.7 Charola con montajes permanentes de especímenes de nematodos. de 50cm de altura.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos 165 5. 163 5. 151 4.1 Evaluación de bacterias formadoras de nódulos en leguminosas. 165 5. con embudo superior de 40 cm de diámetro.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos.

Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. 322 324 325 .2.11. 11.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural.3 Clasificación del uso del suelo en términos de la intensidad de uso. 11. y presencia o ausencia del componente arbóreo.

pero ahora sabemos que interviene y participa ampliamente en los servicios ambientales que brinda el suelo: por una parte. colémbolos y nematodos. Cabe mencionar que un tipo de organismo puede participar en varios grupos funcionales. Por otra parte. que pueden incorporar y asimilar estos conocimientos en beneficio de la biodiversidad del suelo. las bacterias. hongos y protozoarios y los reguladores biológicos como los ácaros. es decir. escarabajos y pequeños mamíferos. es la que menos se conoce. 13 . la captura de carbono y la reducción de emisiones de gases traza (CO2. termitas. hormigas. José Sarukhán. La biodiversidad del suelo alberga más del 25 % de la que existe en todo el planeta y. la regulación de la dinámica de la materia orgánica del suelo. la sostenibilidad y el desarrollo de sus comunidades rurales. fundador de la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad de México. Como lo afirmó el Dr. la fijación de nitrógeno. CH4) son realizados principalmente por el grupo funcional de los ingenieros químicos del ecosistema. N2O. “¡Se sabe más de las estrellas que de los organismos del suelo!”. la elaboración de la estructura del suelo y el mantenimiento del régimen hídrico la desarrollan los ingenieros del ecosistema. en términos generales. El conocimiento de esta biodiversidad se ha dejado de lado durante mucho tiempo por la dificultad para abordarla. que son las lombrices de tierra. por la importancia que reviste su divulgación en un idioma que puede ser leído por un amplio grupo de países de América Latina.Prólogo a la edición en español Este prólogo es el segundo elaborado para esta misma obra y se presenta para su versión en español. el ciclaje de nutrientes.

su biodiversidad. que se encuentran entre los más afectados por la deforestación y el 14 Manual de biología de suelos tropicales . las técnicas de muestreo y estudio de la materia orgánica y los organismos del suelo que permitan obtener información veraz.De manera global. Durante años los estudios del suelo fueron enfocados al conocimiento de la física y química del suelo. más aun. particularmente en las regiones tropicales. tanto del punto de vista morfométrico como molecular para lograrlo. pesticidas y técnicas mecánicas de cultivo modifican fuertemente las condiciones originales del suelo. que se estiman en miles de millones de euros anuales. el equilibrio y la funcionalidad de los suelos modificados por las prácticas agrícolas. actualizada y rápida. se requieren muchos años más de investigación taxonómica y funcional para comprender y manejar los procesos edáficos. contribuye a nuestro alimento. reduciendo la materia orgánica contenida y alterando gravemente sus redes biológicas y funcionales. se reconoce la necesidad de estimular la formación de profesionales en taxonomía y sistemática de la biodiversidad del suelo. conocer y aprender a manejar dicha biodiversidad resulta fundamental para conservar o restaurar la fertilidad del suelo. Mientras leemos estas líneas. con repercusiones a nivel global. fibra y combustible. silvícolas y ganaderas en el mundo. y se dejó de lado el estudio de la biología del suelo y. generan y provocan el avance de la frontera agrícola y la intensificación productiva. En este sentido. Y aunque es difícil cuantificar el valor económico de estos servicios. pero su impacto y repercusiones sobre los procesos de funcionamiento. así como preservar y restaurar la fertilidad natural de los suelos. esta biodiversidad le da estabilidad al paisaje. son grandes pero se desconocen en buena medida los mecanismos y procesos que se afectan. La pérdida de la fertilidad. el uso de fertilizantes. lo que visto desde el punto de vista antropogénico. pues permitirán diseñar y establecer estrategias para mantener la sustentabilidad. particularmente en los ecosistemas tropicales. permite el control de plagas y fomenta la producción de las plantas y de los animales. combinada con las necesidades alimenticias de una población humana en continuo crecimiento. son fundamentales. Ante este panorama. sobre el verdadero impacto que están teniendo las prácticas de manejo. Este manual reúne técnicas de muestreo en campo. que han sido desarrolladas y probadas en siete países y tres continentes. conservación y equilibrio del ecosistema. las condiciones de la biota del suelo continúan alterándose aceleradamente en todo el mundo debido a las actividades humanas. Y si bien se ha avanzado mucho al respecto. entendidas ahora bajo el concepto de calentamiento global.

La información de este manual se ha organizado de acuerdo con la funcionalidad de los grupos del suelo. generando información útil no sólo para investigadores o especialistas sino para toda persona interesada en el estudio de la conservación y la productividad del suelo. Cabe mencionar que la mayoría de los autores que colaboraron para desarrollar este manual residen justamente en países tropicales. ahora este manual se encuentra disponible en tres idiomas. mientras que al final se encuentra un capítulo integrador que permite relacionar los inventarios de los organismos del suelo con una clasificación del uso de suelo para estimar el impacto del manejo del suelo sobre su biodiversidad. implementado por el PNUMA y ejecutado por el TSBF a nivel internacional y por el Instituto de Ecología A. incluso en plantaciones agrícolas con manejo de bajo insumos. Fondo para el medio ambiente.BGBD. profesores y profesionales involucrados en el manejo productivo de los suelos y también en su conservación. portugués y español. las consecuencias de un mal manejo de suelos pueden provocar consecuencias dramáticas. Su elaboración tiene como finalidad no sólo ser una herramienta de utilidad en el trabajo técnico. Esto es así porque. Al inicio del manual se incluyen dos capítulos que ofrecen una guía para establecer un método de muestreo representativo que permita evaluar y comparar la biodiversidad del suelo en diferentes sitios. Con esta versión en español.C. Las técnicas y métodos de muestreo presentados en este manual no constituyen sólo una recopilación de los procedimientos originales ya conocidos. inglés. De manera especial queremos P rólogo a la edición en español 15 . La información contenida en este manual es útil para investigadores. Estas técnicas de muestreo básicas han demostrado ser poderosas herramientas para llevar a cabo investigación básica y aplicada. Agradecemos a todos los especialistas que revisaron la traducción de los textos que correspondían a su especialidad y competencia. permitiendo llevar a cabo evaluaciones sobre la diversidad y salud del ecosistema que sirvan como base para el diseño de prácticas de manejo sustentables. pues en este caso fueron probados. financiado por el GEF. en México. sino constituir un apoyo en el camino hacia la sustentabilidad y la relación armónica entre el hombre y la naturaleza. por sus siglas en inglés) .cambio en el uso del suelo. para que su alcance e impacto sea más amplio. mejorados y actualizados durante el desarrollo del proyecto Conservación y manejo sostenible de la biodiversidad debajo del suelo (CMS. lo que demuestra la mayor presencia y formación de especialistas nacionales preocupados por sus recursos naturales. estudiantes.

Isabelle Barois Boullard Coordinadora de la traducción y del proyecto CSM-BGBD en México 16 Manual de biología de suelos tropicales .agradecer al Instituto Nacional de Ecología. por su trabajo editorial y su paciencia ejemplar. y en particular a Raúl Marcó del Pont y su equipo.

la mejor muestra –y la más actual– para poder evaluar la biodiversidad del suelo en ecosistemas que están siendo rápidamente alterados como consecuencia de los cambios en el uso del suelo. sin embargo.Prólogo Durante mucho tiempo la sociedad ha reconocido su dependencia respecto del suelo. en la medida que esto ocurra. es el cambio de uso de suelo asociado a la intensificación agrícola. la regulación biológica del suelo se verá afectada e incluso sustituida por fertilizantes y cultivos mecánicos. Esto. Dicha intensificación es necesaria para asegurar el suministro global de alimentos. se enfatizó la importancia de la diversidad bajo suelo y se exhortó a abrir nuevas líneas de investigación multidisciplinaria. Mediante la aprobación de la Iniciativa Internacional para la Conservación y el Uso Sustentable de la Biodiversidad del suelo en la Convención sobre Biodiversidad Biológica. tiene como consecuencia 17 . sin embargo. Un aspecto a destacar del cambio global en las regiones tropicales. Ante esta situación. Una línea de investigación surgida a partir de entonces es la de cómo evaluar y manejar diversidad bajo suelo en sistemas de agricultura que faciliten la productividad agrícola y sustentabilidad de suelo a largo plazo. surge la gran necesidad de aplicar los conocimientos referentes al papel que desempeña la biodiversidad bajo suelo para su sustentabilidad. Sea como fuere. celebrada en el año 2006. sólo en tiempos recientes se ha planteado que los suelos contienen un componente biológicamente activo. a su vez. Este manual es. los suelos en todo el mundo enfrentan una grave crisis. sin lugar a dudas.

la reducción de las emisiones de gas invernadero. no solamente en regiones en vías de desarrollo. la capacidad de retención de agua del mismo. en bioprospección y para promover mejoras sustentables en la pro18 Manual de biología de suelos tropicales . En última instancia. Durante mucho tiempo los ecologistas han debatido sobre la importancia de la diversidad biótica del suelo: el secuestro de carbono en suelos. quizás. problema cuya solución implica un gran reto: ¿es posible. asociada a la deforestación y al proceso de Intensificación agrícola en los márgenes de los bosques. un número mayor de diferentes tipos de microorganismos. sino también en países de primer mundo. manejar la biodiversidad del suelo para poder incrementar la productividad agrícola en regiones que están siendo degradadas? La respuesta a esta pregunta atañe a toda la humanidad porque la tierra está siendo degradada. La biodiversidad tropical ha sido subestimada y es posible que las verdaderas densidades de especies sean mayores que en otras latitudes. pero constituye uno de los principales objetos de investigación en todos los niveles. vitales para poder alcanzar la meta: productividad agrícola sustentable. desde luego. estas herramientas pueden ser utilizadas para aprovechar los organismos del suelo en el manejo de los ecosistemas. entonces. El objeto explícito en este caso es práctico: proveer de una herramienta definitiva para establecer una línea de base y luego documentar la pérdida de biodiversidad de suelo. La relación entre la diversidad de especies y la diversidad funcional de la biota del suelo sigue siendo incierta. así como la conservación de la biodiversidad en todo el mundo y no. además. tanto en el laboratorio como en el campo. cubre casi la totalidad de la gama de biodiversidad biológica. las relaciones entre la biodiversidad del suelo y la ocurrencia y magnitud de los procesos ecológicos son inciertas. Dichos conocimientos son. El propósito de este manual es proveer de métodos estándares internacionales para el inventario de comunidades bajo suelo y la caracterización del uso de suelo en el trópico húmedo. la provisión de nutrientes en las plantas y el control de patógenos en plantas como contribuciones específicas de los organismos del suelo a la fertilidad de éste.una reducción de la biodiversidad del suelo. Del mismo modo. el mantenimiento de la estructura física del suelo. únicamente. por lo que representa el resultado publicado de más de una década de intensa discusión y un amplio trabajo de campo por parte de un gran número de expertos investigadores de muchos países. en los trópicos. desde los invertebrados más grandes hasta las bacterias. Un metro cuadrado de bosque templado puede contener hasta mil especies de invertebrados y.

porque la verdadera biodiversidad es tan amplia que queda fuera del marco de cualquier sistema científico para que se pueda documentar totalmente. sino también para biólogos en general. Otro aspecto notable de este manual es que la biota del suelo está agrupada en ocho categorías.ducción agrícola. especialmente en el caso de los pueblos más pobres del mundo. los métodos han sido desarrollados y monitoreados en condiciones de campo. no obstante. a muchos servicios ambientales que los suelos proveen. consecuentemente. si es que aún estamos a tiempo de parar la pérdida de la biodiversidad tropical. Tal selección es inevitable cuando se trata del suelo. en doce localidades como puntos de referencia. ofrece la ventaja de traer consigo los medios para poder hacer una evaluación aproximada de la salud del suelo. los métodos presentados en este manual contemplan también los ecosistemas terrestres en general. representan a instituciones académicas y gubernamentales en las que se requiere poner en práctica nuevas políticas para el manejo del suelo que han de ser validadas. cada una con amplia identidad taxonómica. considerado importante o esencial en la función del suelo y. Una de las más importantes es que la mayoría de los colaboradores pertenece a los países que se encuentran más afectados por la deforestación y el cambio en el uso de suelo. con cierta frecuencia. Inevitablemente. los objetivos nacionales de desarrollo y calidad de nuestro ambiente. esto implica la reconciliación de los intereses y preocupaciones de los agricultores pobres. distribuidos en siete países y tres continentes. especialistas en agricultura y empleados técnicos de todos los niveles. no obstante. por lo que algunos taxa han sido excluidos. sin embargo. también donde es necesario. por lo tanto. pero que también corresponde a un grupo funcional mayor. El proceso responde a una necesidad selectiva. se aconseja referir los especímenes a especialistas. son de interés no sólo para expertos en taxonomía. dentro del alcance de la población que se encuentra relacionada con su productividad. Finalmente. Muchas de las técnicas asociadas con una evaluación de diversidad dentro de grupos específicos microbianos han surgido a partir de P rólogo 19 . Durante los últimos cincuenta años se han publicado. los autores han incluido la revolución en metodología molecular que ha incursionado en las ciencias biológicas durante los últimos diez años. manuales metodológicos de muestreo para organismos del suelo. el presente manual contiene notables diferencias respecto de los anteriores. En la medida de lo posible esto aplica a la identificación: las claves recomendadas son los más funcionales. En segundo lugar. tanto nacionales como extranjeros.

Wall Natural Resource Ecology Laboratory Colorado State University Mayo de 2008 20 Manual de biología de suelos tropicales .discusiones entre colaboradores y durante talleres específicamente pensados para la publicación del presente manual. Diana H.

y para su puesta en marcha. asimismo. institución que pertenece al Centro Internacional de Agricultura Tropical (CIAT). a la Red de Macrofauna financiada por la Unión Europea (EU). constituye una actualización de los métodos y protocolos que fueron inicialmente propuestos por investigadores afiliados al Instituto de Biología y Fertilidad del Suelo Tropical del CIAT. sobre todo. para mantener la productividad agrícola y reducir la extensión de la agricultura en paisajes naturales. India e Indonesia.Prefacio Este manual es uno de los resultados del proyecto PNUMA/GEF “Conservación y Manejo Sostenible de Biodiversidad Bajo Suelo” (CSM-BGBD) que surge como respuesta a la necesidad de crear métodos estándares e instrucción práctica para el inventario de la biodiversidad bajo suelo. Kenia. que permitan la comparación de resultados de inventario en áreas específicas de países tropicales con validez científica y estadística. Costa de Marfil. al NERC por el Reino Unido (UK). El manual describe métodos de muestreo y laboratorio para evaluar la biodiversidad de una gama de grupos funcionales básicos de biota de suelo. Este proyecto es ejecutado por el Instituto de Biología y Fertilidad del Suelo Tropical (TSBF). recibe apoyo para su financiamiento del Fondo Global del Medio Ambiente (GEF por sus siglas en inglés). Brasil. El proyecto se inició en 2002 con el objeto de generar información y conocimientos que puedan ser utilizados para un mejor manejo y conservación de la BGBD en espacios de agricultura tropical. al PNUD/ 21 . al (TIGER). El proyecto se lleva a cabo en México. del Programa de Naciones para el Medio Ambiente (PNUMA/UNEP). y. Uganda.

en el de 2004 (Embu. tales como el registro de huellas genéticas del BFNFNL.dentro del trópico húmedo. la gama completa -geográfica y biogeográfica. además. provee detalles adicionales en el caso de grupos funcionales específicos: como el uso de trampas Winkler para hormigas y trampas Pitfalls para escarabajos en muestras de hojarasca. en su caso. termitas. en donde también se habla del principio de grupos funcionales del inventario de organismos de suelo. agosto 2004. saprófitos y patógenos y una amplia gama de artrópodos mayores. Indonesia) y. diciembre 2004. Brasil mayo/2004 y Nairobi. febrero 2005. Londrina. y en varios talleres llevados a cabo desde el inicio del proyecto. en especial. HMA y Ectomycorrhiza. al igual que en varios talleres temáticos de taxonomía específica (técnicas moleculares con énfasis en T-RFLP. o la actualización de métodos para evaluar la diversidad de nematodos. 2003 (Sumberjaya. Nairobi. Kenia. al igual que métodos que no han sido considerados en las publicaciones mencionadas.UNDP-GEF con el apoyo financiero destinado al Proyecto Alternativas de RozaTumba-Quema (ASB). Brasil. Colombia. Los métodos para algunos de los grupos funcionales de organismos de suelo fueron incluidos en un manual pionero. octubre 2003). termitas y hormigas. cuya evolución se muestra en los reportes de 2002 (Wageningen. Manaus. Un manual formal de técnicas para organismos de suelo y organismos que viven en agua dulce y sedimentos marinos fue publicado en 1996. India 2005. como es el caso de aquéllos que se refieren a la mesofauna. elaborado por Anderson e Ingram (1993). Dado que muchas especies aún son desconocidas o no se han descrito. Una 22 Manual de biología de suelos tropicales . Los métodos estándares propuestos contienen avances tecnológicos recientes en genética molecular. Los métodos fueron discutidos y posteriormente perfeccionados en reuniones anuales celebradas entre los años 2002 y 2005. Bangalore. Los métodos que se describen en este manual reflejan una amplia gama de actividades del proyecto CSM-BGBD. hongos entomopatógenos. Los métodos para una evaluación de biodiversidad de suelo fueron descritos en el ASB (Nota de Lectura 6B). La definición de métodos estándares aprovecha la experiencia obtenida con la implementación de los métodos utilizados en los siete países participantes en el proyecto. dentro del alcance de laboratorios nacionales. por parte de la UNESCO. Cali. Países Bajos). editado por G. También cubre. lombrices de tierra. ampliamente. bacterias formadoras de nódulos en leguminosas (BFNFNL) y sus plantas hospederas. en términos de grupos funcionales. una evaluación de la diversidad de especies resulta un proceso poco práctico. al programa DIVERSITAS. Ésta fue la contribución. S. Hall. editado por Swift y Bignell (2001). Kenia).

tenga implicaciones en la BGBD. por lo tanto. así se podrían entender las consecuencias de una pérdida en el BGBD y. La premisa es que la diversificación agrícola (en varios niveles) genera biodiversidad en el suelo y que la producción agrícola sustentable (en los márgenes de la selva tropical) se mejora significativamente. esto se traduce en una alteración del suelo como hábitat. la erosión puede llegar a nulificar todos los demás procesos degenerativos. frecuentemente provocan una reducción de materia orgánica del suelo que forma el sustrato básico para la mayoría de los organismos que en él habitan y.mejor opción sería investigar la pérdida de grupos funcionales básicos dentro de la BGBD que muestran un cambio en el uso de suelo o una intensidad del mismo. en contra de una productividad sustentable. llega a influir sobre la abundancia y diversidad de dichos organismos. no necesariamente se lograría restaurar la BGBD. por lo tanto. Para responder a algunas de las preguntas mencionadas se requiere: P refacio 23 . Además de estos efectos. nivel de nutrientes y densidad). dejándolo como estaba antes de ser alterado. sin embargo. Al mismo tiempo. que se espera. La mayoría de los organismos del suelo se encuentran en los primeros 20 centímetros de su perfil. Es por esto que el control de la erosión y la rehabilitación de suelos fuertemente erosionados deberá considerarse parte de las estrategias para conservar y sustentar un buen manejo de la BGBD. la erosión del suelo significa la más catastrófica de las alteraciones. de manera que causará un impacto inmediato en la BGBD que fácilmente se antepondrá al efecto combinado de todos los factores mencionados. estos cambios de uso de suelo. Aun si se pudiera regresar a sus condiciones originales. La conversión de uso de suelo y la intensificación de su uso. así. como consecuencia del labrado o del creciente uso directo de agroquímicos. van acompañadas por reducciones drásticas en la diversidad de plantas. interpretar esos procesos en el contexto ecológico. La hipótesis actual es que una intensificación en el uso de suelo trae consigo una reducción de la biodiversidad del suelo y a su vez. restablecer la BGBD no implica precisamente devolver los servicios del ecosistema. provoca una pérdida de servicios del ecosistema. generalmente. Además. Los efectos en BGBD son condiciones compuestas por el medio ambiente y por características físicas y químicas del suelo (por ejemplo: pH. poco se sabe de las relaciones entre ambos factores o sobre los mecanismos por los cuales ocurren cambios en la BGBD. hay otros asociados con un incremento en la intensidad del uso de suelo. Quedan muchas interrogantes en cuanto al manejo de BGBD.

J. M. un conocimiento más amplio de prácticas existentes y un uso más efectivo de tecnologías disponibles que no requieran altos insumos. Hall. S. 24 Manual de biología de suelos tropicales . y observar cómo esta relación se modifica y se altera por las condiciones prevalecientes en el medio ambiente (incluyendo condiciones de suelo). • Identificar “puntos de entrada” para mejorar el manejo de la tierra. (ed) (1996) Methods for the Examination of Organismal Diversity in Soils and Sediments. Bogor. S. ASB Lecture Note 6B. • Establecer una relación entre la biodiversidad de la superficie y bajo del suelo en los actuales y alternativos sistemas de uso de suelo. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. South East Asian Regional Research Programme. Estos “puntos de entrada” pueden incluir un mejor entendimiento del uso de prácticas indígenas. Jeroen Huising y David.pdf. I. CAB International. Fátima M. Se espera que los métodos descritos en este manual sean útiles para el diseño y la ejecución de estudios para inventario y monitoreo de la BGBD en todos los niveles. S. Swift.• Una caracterización de la biodiversidad del suelo en un amplio rango de uso de suelo de varias intensidades. G. Moreira. www. e Ingram. M. CAB International. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. Bignell ReFERENCIAS Anderson. Wallingford. Indonesia. E. experimental o de muestreo) hasta un paisaje natural. J. mediante la introducción y/o manejo de biota de suelo (se experimenta con varios manejos alternativos).fao. D. E. International Centre for Research in Agroforestry. 2nd edition. desde bosque natural hasta agricultura de monocultivo. desde una parcela (agrícola.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. Wallingford. caracterizada por un cultivo continuo y un elevado uso de químicos y mecanización. y Bignell.

formadoras de nódulos en leguminosas Reacción en cadena de la polimerasa competitiva Conservación y Manejo Sustentable de Biodiversidad Bajo Suelo Biodiversidad Bajo Suelo Electroforesis en gel con gradiente de desnaturalización Equivalente de ácido European Bioinformatics Institute Ensayo de reducción de acetileno Detector de ionización de flama Universidade Regional de Blumenau Global Environment Facililty 25 .Lista de acrónimos y abreviaturas AC ADP AFLP AHM AM ANOVA ARISA B BFNFNL cPCR CSM-BGBD BGBD DGGE ea EBI ERA FID FURB GEF Análisis de correspondencia Agar dextrosa y papa Polimorfismo en el tamaño de fragmentos amplificados Agar con harina de maíz Agar extracto de malta Análisis de varianza Análisis automatizado del espaciador intergénico ribosomal Bacteriófagos Bacterias fijadoras de nitrógeno.

GF HMA ia ICRAF IFP IM INPA ITS KOH LCCS M MAS MOS NCBI Nd NMP P Pc PCA PCR PFGE PNUMA PP RAPD Rep-PCR RFLP RIA SR SSCP TGGE TRF T-RFLP TROF TSBF-CIAT 26 Grupo funcional Hongos micorrizógenos arbusculares Ingrediente activo World Agroforestry Centre Índice fitoparasítico Índice de madurez National Institute for Amazonian Research (Instituto Nacional de Pesquisas da Amazônia) Espaciadores de trascripción interna Hidróxido de potasio Sistema de clasificación de cobertura de suelo Micófagos Muestreo aleatorio simple Materia orgánica del suelo National Center for Biotechnology Information Nivel de dilución Número más probable Perturbación Porcentaje de colonización Análisis de componentes principales Reacción en cadena de la polímerasa Electrofóresis en campos pulsados Programa de las Naciones Unidas para el Medio Ambiente Parásitos de plantas DNA polimórfico amplificado al azar De fragmentos repetidos palindrómicos-éxtragenicos Polimorfismo de longitud de fragmentos de restricción Resistencia intrínseca a los antibióticos Sensores remotos (imagen) Polimorfismo de conformación de cadena sencilla Electroforesis en gel con gradiente de temperatura Fragmentos de restricción terminal Polimorfismo terminal de la longitud del fragmento de la restricción Árboles en finca Tropical Soil Biology and Fertility Institute of the International- Manual de biología de suelos tropicales .

UC UFAM UFC UFLA UFMG UnB VA VB Center for Tropical Agriculture Unidad de colonización Universidad Federal de Amazonas Unidades formadoras de colonias Universidad Federal de Lavras Universidad Federal de Minas Gerais Universidad de Brasilia Volumen alto Volumen bajo A crónimos y abreviaturas 27 .

.

Bardgett.. 1997. En la Tabla 1.000 en el caso de procariontes. cualquiera que sea el sistema de clasificación utilizado.Capítulo 1 El inventario de la biodiversidad biológica del suelo: conceptos y guía general Mike J. Jeroen Huising Organismos y servicios del ecosistema del suelo El suelo es un hábitat que alberga una amplia gama de organismos dentro de los tres dominios taxonómicos (sensu Woese et al.. la biota (relativa a agentes no bióticos y entre ellos mismos) será evaluada por su contribución relativa a los procesos del ecosistema (sensu Daily. Moreira et al. cuando se hace una evaluación biológica de la salud de los suelos (Lawton et al. Ya que no es ni práctico ni coherente tomar en cuenta todos los organismos presentes. 2005. Bignell. Fátima M. la diversidad de la biota del suelo es elevada en todos los niveles de análisis (véase Swift et al. 2006).5 millones de especies de eucariontes y con una riqueza de especies estimada muy por encima de 10. S. contri29 . Cavalier-Smith.Estos procesos apoyan a los servicios del ecosistema. 1979. 1997. La clasificación taxonómica de organismos vivos aún se encuentra en una situación polémica (Margulis y Schwartz. con más de 1.2004). 2004. Sin embargo..1 se enlistan los principales fila de organismos eucariontes y procariontes que son o pueden ser representativos en la comunidad del suelo. 1998). Brussaard et al. especialmente cuando se trata de los taxa a ser creados en altos niveles y los números de tales categorías altas (como reinos) a ser consideradas. Swift. David E. Moreira y E.. 1998.. 1998. Lavelle. 1996. 1990) y muchos fila. 2004). Wall. Wall.

000 Filum Cycadophyta (gimnospermas) 185 Filum Coniferophyta (gimnospermas) 550 Filum Gnetophyta 70 Filum Anthophyta (angiospermas) 235.000 >10 millones Reino Animalia [37 fila] 750 Filum Tardigradad (osos de agua) d 99.800 y Enchytraeidae) Clase Hirudinea (sanguijuelas) 500 45.000 Clase Oligochaeta(lombrices de tierra 8.000 Clase Gastropodad (incluye babosas y caracoles) 18.000 Filum Annelidad (lombrices segmentadas) Clase Polychaeta 9.4 muy raro en el suelo 3. biota del suelo y principales grupos funcionales a los que pertenecen.000 Filum Mollusca 35.000 cochinillas) Filum Mandibulata (Artropoda) Grupo funcionalb 1 1 1 1 1 1 1 1 1 2.000–40.000 Clase Malacostracad (incluye orden Decapoda con un esqueleto externo calcificado) Orden Isopoda (ácaros de la madera y >11.Tabla 1.000 hepáticas) Filum Filicinophyta (helechos) 12.1 Número de especies descritas en las principales categorías taxonómicas de plantas.000 Filum Hepatophyta (plantas 6.4 2. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Dominio Eucarionte 255.000 Monocotiledoneas 65.000 Filum Crustacead [>6 clases] 25.000 Dicotiledoneas 130. 4 4 común localmente 5 - 30 Manual de biología de suelos tropicales .000 Reino Plantae [12 fila] Filum Bryophyta (musgos) 10.

9 Sólo en la rivera 4. 4 2.) Orden Trichoptera 12. 7. 7 2. 4. 6.000 Orden Coleoptera (escarabajos) >350. escamas) Suborden Heteroptera 25. 9 2. peri55.000 Suborden Homoptera (cigarras. 9 3. 9 4.000 Orden Archaeognatha (pececillos de 350 cobre ó bristetails) Orden Thysanura 700 Orden Blattoptera (cucarachas) 4.000 Orden Dermaptera (tijerillas) 1. 6. mosquitos. avispas. polillas. 180.826 Orden Lepidoptera (mariposas.000 langostas) Orden Thysanoptera (trips) 6. 6 2.000 etc. afidos.000 abejas. 9 2.000 Orden Collembola (colémbolos) 7.800 Orden Orthoptera (saltamontes.000 Orden Isoptera (termitas) 2.162 ciempiés) Clase Diplopoda (milpiés) 10.6 4 2. 4.Tabla 1.000 quitos. 6 4. 9 2. 9 2. 9 6 2. 7 4. mosquitos pequeños) Orden Hymenoptera (hormigas. grillos.000 Clase Chilopoda (ciempiés) 2. 6 2. 9 2.500 Clase Symphyla 200 Clase Pauropoda 700 El Grupo funcionalb 4 4. 4. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Subfilum Hexapoda (Insectos) >900.1 Continúa.000 gegenes. 3. 23. pulgones. abejorros) Familia Formicidae (hormigas) 11.500 Orden Diplura (doble cola) 659 Orden Protura 500 Subfilum Myriapoda (milpiés y 15. 7 31 inventario de la biodiversidad biológica del suelo . 115. >125.000 Orden Diptera (moscas.800 Orden Hemiptera (chinches) >80. 9 2.

000 Orden Pseudoscorpionida 3. 7 Muy raros en suelo 2.000 Order Scorpionida (escorpiones) 2000 400 Filum Gastrotrichad (gastrotricha) d 1000 Filum Acanthocephala (lombrices con cabeza espinuda) 2000 Filum Rotiferad (animales de ruedas) 900 Filum Nemertinad (gusanos planos) Filum Nematoda (nematodos. 4. 9 2.000 Filum Discomitochondria (flagelados 800 y zooflagelados) 10.Tabla 1. 6.7 7 1. 7. incluidas planarias) Número sin Reino Protoctistac [30 fila] determinar Filum Rhizopoda (amibas) Número sin determinar 4000 Filum Dinomastigotad (dinoflagelados) Filum Ciliophora (ciliados) 10.6 7 1. 9 1 32 Manual de biología de suelos tropicales . 7.100 Grupo funcionalb 6 2.455 Orden Palpigradi (micro-escorpiones) 80 Orden Acari (ácaros.000 briz redonda. 6. lom15. garrapatas) 45. 9 6 6 6 7 Parásitos artrópodos 4. alfilerillos) 25. 7 1 5.000 Clase Arachnida [11 órdenes] 93.235 (Pseudoescorpiones) Orden Araneae (arañas) 40. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos critas en el taxón (todos de organismos de suelo/nombre los hábitats) común Subfilum Cheliceratad [3 clases] >100. lombrices enterobius.1 Continúa.000 Filum Diatomacead (diátomos) Filum Oomycota (Oomycetes) Cientos Filum Rhodophyta (alga roja) 4.000 Filum Plathyheminthesd (Helmintos.

9 5 5. familia.Tabla 1. b) Grupos funcionales.000 1.Grupo funcionalb critas en el taxón (todos los hábitats) 16. 8 10 1.. c) Considerados por algunos autores como Protistas o Protozoos y Chromistas.1 Continúa.500 1. Fuente: Moreira et al..nih. reino.2 (de este capítulo). filum.gov.. Hongos de acuerdo con James et al. 2008). (2006). de acuerdo con Woese et al. por su influencia en la calidad y salud del suelo (Hoavelle. 9.. d) Incluye organismos acuáticos y del suelo.000 >70. clase. Clasificación. e) Rappé y Giovannoni (2003). 1996. (1990).nlm. 8 5. de acuerdo con la Tabla 1. Brussard et al. f) National Center for Biotechnology Information: (www. respectivamente. 1997.342.398f 1 sólo parásitos 5. desde el más bajo hasta el más alto nivel: dominio. cuando éstos se incluyen. Reinos de Eucariotas clasificadas de acuerdo con Margulis y Schwartz. consultado el 13 de mayo de 2007). Dichos procesos pueden ser agrupados de acuerdo a cuatro funciones agregadas del ecosistema: El inventario de la biodiversidad biológica del suelo 33 .ncbi. 5.000 >344f >8. género y especies. orden. 1998. buyendo al mantenimiento y a la productividad de los mismos. 10 Nota: a) Considerando las categorías taxonómicas.250 >30. 2006.100 204 >22. excluyendo organismos no clasificados. Categorías taxonómicasa (número total de fila existentes) ejemplos de organismos de suelo/nombre común Filum Chlorophyta (alga verde) Reino Fungi [6 fila] Filum Microsporídia Filum Chytridiomycota (Hongos quitridios) Filum Zygomycota (mohos) Filum Glomeromycota (hongos micorrízicos arbusculares) Filum Basidiomycota (incluidos hongos y algunas levaduras) Filum Ascomycota (incluidas levaduras) Dominio Archaead [4 fila] Dominio Bacteriad [52 fila]e Número de especies des. Procariotas (Dominio Archaea y Bacteria). Kibblewhite et al. 8.000 1. sin cultivo y no especificados. 8 5. la riqueza correspondiente arrojará 3090 y 79.

los microorganismos y los animales involucrados se llaman “descomponedores”. colémbolos y ácaros. siempre que no se incluya a los ingenieros del ecosistema (véase más abajo). porosidad y contenido de carbono. drenaje. Microorganismos específicos del suelo también incrementan la cantidad y eficiencia de absorción de nutrientes por la vegetación. estrechamente asociado con la descomposición orgánica. nematodos. es esencial para todo tipo de agricultura y silvicultura. milpiés. Estos procesos de “bioturbación” influyen y determinan la estructura física del suelo y la distribución de materia orgánica del suelo. mediante la formación de asociaciones simbióticas como las micorrizas y la fijación de N2 en nódulos de raíces. Animales más grandes mejoran algunos procesos porque proveen nichos para un crecimiento microbiano dentro de sus intestinos o excremento. se mantienen físicamente activos dentro del suelo formando canales. El ciclo de nutrientes. Las raíces de plantas. poros. sin embargo. lombrices de tierra y termitas. lombrices de tierra. tales como protoctistas. que ocurre principalmente por actividad enzimática de bacterias y hongos. Bioturbación. crean y modifican microhábitats para otros organismos más pequeños y determinan propiedades del suelo como aireación. Ciclo de nutrientes. el paso que marca la operación del proceso se determina mediante micropredadores. estabilidad del suelo. en gran parte realizada por animales del suelo como ácaros. es decir.1. estabilidad de agregados 34 Manual de biología de suelos tropicales . agregados y montículos. Estas fracciones de MOS varían en su estabilidad y longevidad. Aquí también los microorganismos son mediadores de la mayor parte de las transformaciones. La descomposición de materia orgánica. y moviendo partículas de un horizonte a otro. aunque el atributo “transformadores de hojarasca” es el más utilizado hoy en día para describirlos. Juntos. 2. pero también es incorporado en diferentes reservorios en forma de materia orgánica (MOS). principalmente como CO2 o CH4. los cuales trituran los residuos de plantas y animales. por la biota del suelo. Algunos grupos de bacterias del suelo están involucrados en transformaciones elementales autotróficas. termitas. aunque en un tipo de suelo y medioambiente determinados existe un equilibrio entre el contenido del MOS y las entradas y salidas de carbono en el sistema. sin embargo. y dispersan los propágulos microbianos. que no dependen directamente de la materia orgánica como fuente de alimento. Así. hormigas y algunos otros de la macrofauna del suelo. lo que controla el resto de la biota. 3. Como resultado de la descomposición. estos grupos son afectados indirectamente por factores como el contenido de agua. el carbono orgánico es liberado en la atmósfera.

debe hacerse notar que la interacción entre la descomposición de materia orgánica. N2O).1 muestra la contribución de la biota del suelo a servicios ambientales. hongos y animales invertebrados capaces de invadir plantas y animales. CH4. La Figura 1. como miembros de la comunidad del suelo. tales como los causados por un contenido de MOS más bajo. 4. brotes intensivos de enfermedades en el suelo y plagas. La estructura y las propiedades del suelo también están influenciadas por la producción de excretas de animales. por tanto. En ecosistemas naturales. La biota del suelo incluye un amplio rango de virus. este rango de interacciones puede encontrarse reducido. capacidad de almacenaje y drenaje) y tiene una fuerte influencia sobre la susceptibilidad a la erosión. bacterias.. Los organismos del suelo juegan un papel importante en la regulación de la composición atmosférica y. 1997). incluyendo complejos organominerales estables durante meses o periodos más largos (Lavelle et al. y hasta humanos. bioturbación y ciclo de nutrientes determinará el equilibrio entre la cantidad de carbono secuestrado en el suelo (véase arriba) y entre las emisiones de gases invernadero (principalmente CO2. Lavelle et al. Enfermedades y control de plagas. Especialmente. en el cambio climático. y de causar enfermedades y muerte. A este conjunto de organismos. La bioturbación juega un importante papel en la regulación del equilibrio del agua en el suelo (infiltración.. que incluyen microbívoros y micropredadores que se alimentan de las plagas microbianas y de animales. respectivamente. y también una amplia variedad de interacciones antagonistas microbianas. pueden ser asignados dentro de una o más de las cuatro categorías funcionales genéricas descritas. pero tales epidemias sí son comunes en la agricultura. En los agroecosistemas. 1994. todos los organismos enlistados. por lo tanto. basándose en la función particular que desempeñan o en el proceso específico del suelo del que son mediadores. son relativamente raros. En suelos saludables. Jones et al.y capacidad de retención de agua. 1992. debido a una diversidad biológica disminuida y/o en cambios ambientales del suelo. Para poder interrelacionar El inventario de la biodiversidad biológica del suelo 35 .. se le ha denominado “ingenieros del ecosistema del suelo” (Stork y Eggleton. NOX. Grupos funcionales de la biota del suelo En principio. como resultado de los procesos anteriores. 1997). las actividades de plagas potenciales y patógenas son reguladas por interacciones con otros miembros de la biota del suelo.

Fuente: Kibblewhite et al. Transformaciones C Ensamblaje funcional Descomponedores: Hongos Bacterias Microherbívoros Detrívoros Procesos de entrega basados en el suelo Mantenimiento de la estructura del suelo Ciclaje de nutrientes Mantenimiento de la estructura del suelo Dinámica de la MOS Descomposición Ciclaje de nutrientes Regulación de población biológica Provisión de hábitat Regulación de población biológica 4.36 Funciones agregadas del ecosistema 1. Mantenimiento de estructura del suelo 2. Ciclaje de nutrientes Transformadores de nutrientes: Descomponedores Transformadores de elementos Fijadores de nitrógeno Micorrizas Ingenieros del ecosistema: Megafauna Macrofauna Hongos Bacteria Biocontroladores: Predadores Microherbívoros Hiperparásitos Figura 1.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. 2008 Servicios agrícolas Procesos de entrega basados en el suelo Alimentos y fibras Captura y ciclaje de nutrientes Descomposición de la MO adicionada Dinámica de MOS Mantenimiento de la estructura del suelo Regulación de la población biológica Manual de biología de suelos tropicales Servicios no agrícolas Calidad y suministro de agua Control de erosión Regulación de la composición atmosférica y del clima Degradación y disminución de contaminantes Control de enfermedades y plagas no agrícolas Conservación de la biodiversidad . Regulación de la población biológica 3..

ingenieros del ecosistema.. ni de cuántos de estos grupos deberán definirse dentro de un ambiente de suelo típico. Herbívoros: animales que consumen y parcialmente digieren tejidos vivientes de plantas. con los servicios del ecosistema (Setäla et al. construcción de estructuras agregadas y formación de poros. normalmente definido por criterio trófico (Brussaard. por ejemplo. El inventario de la biodiversidad biológica del suelo 37 . de comportamiento bioquímico o ambiental y. Transformadoras de hojarasca (mucha macrofauna y mesofauna. Microrreguladores (microfauna como nemátodos): animales que regulan ciclos de nutrientes mediante forrajeo y otras interacciones con los microorganismos descomponedores. el Tabla 1. rizobia): microorganismos asociados con raíces que facilitan la absorción de nutrientes. que incluyen minadores de hojas y de tallos. incluyendo el ciclaje de nutrientes. alguna microfauna): invertebrados que se alimentan de desechos orgánicos originados por microbios y por trituradores de este material. por lo tanto. morfológica. también de acuerdo con sus características taxonómicas.organismos específicos del suelo (biodiversidad colectiva) con las categorías genéricas funcionales y. 3. Esta actividad puede ocurrir a varias escalas espaciales. Productores primarios (plantas superiores e inferiores): organismos fotosintéticos que asimilan bióxido de carbono del aire y penetran en el suelo mediante sistemas de raíces. 4. 6. No existe acuerdo preciso en la definición de grupos funcionales. Ingenieros del ecosistema (macrofauna como termitas y lombrices de tierra): organismos que causan un impacto físico mayor en el suelo mediante su transporte. 7. 1998) es necesario tomar en cuenta el concepto de grupos funcionales básicos. descomponedores y microrreguladores por depredación. Pueden incluir predadores. 2. en última instancia. Microsimbiontes (hongos micorrícicos. 1998) pero también calificado en función de la respuesta fisiológica.2 Principales grupos funcionales de la biota del suelo. Descomponedores (hongos o bacterias degradadores de la celulosa): microorganismos que poseen las enzimas polímero-degradadoras. 8. de alguna manera. translocando compuestos orgánicos sintetizados arriba del suelo. y que son los responsables de la mayor parte del flujo de energía en la red alimenticia de los descomponedores. Predadores (mucha macrofauna y mesofauna): animales que regulan a los herbívoros. 5. y chupadores de sabia. 1. transformadores de hojarasca. muchas hormigas. haciéndolo más accesible para los descomponedores o favoreciendo el crecimiento microbiano de excretas en forma de gránulos.

2 Continúa. Los grupos taxonómicos propuestos a continuación son seleccionados de acuerdo con su significado funcional diverso. mientras que otros son muy específicos en cuanto a su taxonomía. cuyos métodos de inventario y caracterización se describen en los siguientes capítulos. 10. probablemente se relaciona con su abundancia relativa y con la biomasa. Plagas y enfermedades del suelo (hongos patógenos. aislado e identificado (Figura 1. a veces. Transformadores procariontes: Archaea y bacterias que transforman de manera específica el carbono (metanotrofa) o elementos nutricionales como N.: depredadores. 9. Véase que algunos grupos funcionales incluyen una amplia gama de taxa relacionados y. 1994) y especies clave (sensu Davic. no obstante. uno de los principales desafíos es seleccionar un subgrupo de la biota del suelo que refleje adecuadamente el espectro taxonómico anticipado y que. 38 Manual de biología de suelos tropicales .2 y se usan para anotar las categorías taxonómicas. 2003). invertebrados. al mismo tiempo.. no relacionados. S o P (nitrificación y fijación de nitrógeno).1.. no obstante. La importancia funcional de cualquier especie o de grupos de especies. Éstas están representadas formalmente en la Tabla 1. en donde el espectro taxonómico completo ha sido objeto de un muestreo representativo en el mismo lugar y al mismo tiempo (Bignell et al. Grupos selectivos de biota de suelo En el diseño de trabajo de campo. 2005). concepto es heurístico y puede modificarse en función del propósito analítico necesario. existe un argumento válido que establece por lo menos diez categorías. Por esta razón y porque muchos componentes de biota de suelo son taxonómicamente difíciles de identificar. incluya todos los grupos funcionales considerados como importantes. existen pocos estudios sobre la salud del suelo agrícola. en cuanto a la fertilidad y calidad del suelo. (razón por la cual se emplea el término “taxa seleccionado”) y por su facilidad relativa a ser muestreado. Éstos son grupos taxonómicos que fueron tomados en cuenta en el proyecto Conservation and Sustainable Management of Below-Ground Biodiversity (CSM-BGBD).2). plagas) especies de control biológico también pueden incluirse (ej. parasitoides e hiperparásitos de plagas y enfermedades). también es importante buscar dentro de los grupos funcionales para descubrir los taxa que alcancen el criterio de ser considerados como ingenieros del ecosistema (sensu Jones et al.Tabla 1. enlistadas en la Tabla 1.

transformadores procarióticos.MACROFAUNA Lombrices de tierra I Escarabajos Otros Hormigas Termitas Diversidad y biomasa alta Diversidad alta Ingenieros del ecosistema. un grupo que incluye muchos organismos con papeles especiales y una diversidad de descomponedores genéricos MICROBIOTA GENERAL Microfauna. tamaños y procesos de ecosistemas ANIMALES.2 Principales grupos funcionales.1 mm.1-2. trituradores de hojarasca. parásitos de Micropredadores.Figura 1. trituradores de hojarasca.0 mm. y microfauna <0. patogénos y antagonistas IV Omnipresentes con diversidad alta indeterminada Descomponedores. nematodos y protoctistas pueden considerarse como componentes de la microbiota general. macropredadores ANIMALES.MICROFAUNA Y MESOFAUNA Nematodos Ácaros Colémbolos Otros Biomasa alta II Alta diversidad y biomasa Micropredadores. Por su parte. transformadores de hojarasca. estudiados en el proyecto CSM-BGBD. antagonistas. clasificados de acuerdo con dominios y reinos.transformadores de hojarasca plantas HONGOS Y BACTERIAS MUTUALISTAS Hongos micorrizógenos Bacterias formadoras de nódulos en leguminosas Omnipresentes con especificaciones típicas de variedad de hospederos (a varios grados) III Omnipresentes Microsimbiontes mejoran la absorción por la raíz y la fijación de nitrógeno Hongos saprotróficos. especialmente protoctistas Archaea y Bacteria El inventario de la biodiversidad biológica del suelo 39 . promotores de crecimiento Nota: la fauna se clasifica de acuerdo con el ancho de cuerpo: macrofauna >2. patógenos. mesofauna 0.0 mm.

En este contexto. protoctistas. arañas. b) el ciclo de nutrientes. b) ocupan espacios que existen en pequeños poros. arácnidos grandes y otros tipos de insectos). hormigas. omnívoros y depredadores.1). en los que viven dependientes de películas de agua. 2 Macrofauna: termitas. también representan factores de interés y preocupación. escarabajos. por ejemplo. Algunas especies de ácaros y formas de larvas de muchos artrópodos de suelo son lo suficientemente pequeñas como para clasificarse dentro de la microfauna. 5 Microfauna: nematodos y protoctistas que. ácaros. e) 40 Manual de biología de suelos tropicales . bacteriófagos. Enchytraeidae. la trituración y digestión de materia orgánica. por ejemplo.Además. lombrices de tierra. la distribución geográfica. la introducción de especies exóticas e invasivas. c) normalmente representan una riqueza genérica y de especies muy alta d) juegan un papel importante en la regulación de abundancia y actividad microbiana. de la mesofauna. al construir galerías y al cavar túneles e ingerir suelo. Algunas especies también resultan perjudiciales porque se convierten en plaga. micófagos. bacterias y depredadores de otros animales del suelo). al cavar sus túneles y mediante la ingestión de materia mineral y orgánica. varios de estos grupos taxonómicos son muy importantes por sí mismos como contribuidores a la diversidad biótica en general. c) el control biológico como depredadores. milpiés (Diplópoda) y otros tipos de larvas de insectos que actúan como transformadores de hojarasca con una importante acción trituradora sobre el tejido de plantas muertas y sus depredadores (ciempiés. a escala pequeña. todos ellos conforman un gran número de especies. nematodos y. probablemente. a) influyen en la tasa de recambio por su papel como forrajeros de raíces (parásitos de plantas). y la pérdida de especies endémicas. hormigas y escarabajos que intervienen en: a) la porosidad y la textura del suelo. mediante el transporte. 4 Mesofauna: colémbolos y ácaros que actúan como transformadores de hojarasca y micropredadores (forrajeros de hongos. al compararse con otros grupos taxonómicos superiores (Tabla 1. 3 Otra macrofauna: cochinillas (Isópoda). Los grupos incluidos en la selección son: 1 Macrofauna: lombrices de tierra. de esta manera contribuyen en procesos orgánicos de trituración a pequeña escala y ejercen un importante papel regulatorio dentro de la biota del suelo. también actúan como reguladores de las poblaciones de biota del suelo. que intervienen en la porosidad del suelo y en sus nutrientes. microfauna y microsimbiontes.

como insectos patógenos. saprotróficos y antagonistas: que determinan o median (en diferentes casos) la viabilidad de cultivos. 7 Bacterias formadoras de nódulos en leguminosas y. Hasta donde se conoce. y enfermedades de las plantas. sean los más vulnerables ante situaciones de estrés y perturbación que afectan a dichos grupos funcionales. otros fijadores de nitrógeno microsimbiontes que transforman el nitrógeno atmosférico N2.2). aunados a la inmensa escala de diversidad encontrada en el suelo. Métodos para inventario de la biodiversidad bajo suelo: principios generales La metodología actual no permite la identificación de todas las especies en el suelo. lo anterior aplica para los trituradores de materia orgánica (véase transformadores de hojarasca en Tabla 1. que dependen de grupos funcionales. en NH3. por ejemplo. 6 Hongos micorrizógenos arbusculares: se asocian con las raíces de las plantas y mejoran la disponibilidad de nutrientes. Los métodos empleados para la extracción de diferentes grupos de organismos del suelo también son muy diferentes de un grupo a otro. compuestos por relativamente pocas especies y/o especies altamente especializadas. que es asimilable para las plantas. En la biota del suelo. entre bacterias. 8 Hongos fitopatógenos. En los casos de Archaea y bacteria. utilizando el concepto de grupos funcionales clave como los descritos anteriormente. en ocasiones. la mayoría de las especies aún son desconocidas. rotación de carbono orgánico en descomposición. el concepto de especies también es muy variable. hongos y animales invertebrados. composición funcional (la naturaleza de los grupos funcionales) y ocurrencia e intensidad de los procesos ecológicos. requieren de un enfoque selectivo para llevar a cabo un inventario de la biodiversidad bajo suelo. reducen ataques patógenos en plantas y mejoran la tolerancia al estrés del medio ambiente. de esta manera. En muchos Fila. Se espera que los servicios de ecosistema. bacterias que nitrifican y denitrifican (como parte de los transformadores procariotas). Aún sigue siendo una pregunta sin respuesta la relación existente entre diversidad de especies. representan un importante control biológico. y contribuyen al potencial control biológico de plagas y enfermedades. Estos factores. bacterias involucradas con el compuesto El inventario de la biodiversidad biológica del suelo 41 . diversidad funcional (el número de grupos funcionales). la caracterización molecular y bioquímica reemplaza al enfoque de identificación tradicional.

en términos de una dis42 Manual de biología de suelos tropicales . En este manual no se abordan problemas taxonómicos. la fragmentación de hábitat y el manejo de cultivos en la diversidad biológica del suelo. La evaluación de la composición de la comunidad biótica depende de la identificación de los especímenes recolectados. Los métodos estándar son necesarios para describir los ecosistemas de manera consistente. que para algunos grupos y en algunos países es un desafío importante. Inventario de biodiversidad bajo suelo en escalas de espacio y tiempo Cambio de uso de suelo como la causa principal del cambio de diversidad biológica del suelo Un inventario puede demostrar si la biota del suelo responde a intervenciones humanas como prácticas agrícolas. el impacto que provoca la intensificación agrícola. lo que exige un alto nivel de conocimientos taxonómicos. para el cual se han desarrollado y probado los métodos. abundancia y composición de las especies. cuando se adopta el concepto de los grupos funcionales principales. Por lo tanto. Este manual aborda métodos para el inventario y caracterización de la biodiversidad del suelo. especialmente. hierro. Si éste es el caso. cobre y azufre quimiolitotrofos. las consecuencias pueden ser negativas. Los métodos han sido desarrollados. esto conlleva a una serie de interrogantes como ¿cuál es el número mínimo de especies dentro de los grupos funcionales que garanticen la resistencia del suelo contra el estrés del ecosistema natural y antropogénico. escogidos y modificados. aunque se dan referencias de claves para la identificación de especies de varios grupos funcionales. puesto que se reflejarán en los métodos a utilizarse. deforestación. hongos micorrizogenos (entre los microsimbiontes) y bioturbadores (ingenieros del ecosistema). En el prefacio se plantea una breve descripción del proyecto.C1 y en las transformaciones de hidrógeno (metanogénicas y metilotróficas). contaminación y cambio climático. para su aplicación en paisajes con diferentes usos de suelo. Esto debería servir como respuesta a un gran número de preguntas en contextos similares. y en relación con que “especies clave (si existen) en los grupos funcionales?. preguntas como las anteriores deberían ser consideradas en la definición del propósito del objetivo de la investigación de la biodiversidad bajo suelo. por ejemplo. centrándose en los grupos funcionales que permitan la evaluación de la diversidad. de manera que sea posible evaluar.

la complejidad de los agroecosistemas ha sido drásticamente reducida. al mismo tiempo. los procesos de disturbio -y recuperación. Sin embargo. si se acompaña de la extinción de especies individuales. En los trópicos. fertilizantes químicos y pesticidas (Kibblewite et al. Para qué muestrear. especialmente. muchas veces enlazadas entre sí. 2008). en la medida que proceda la intensificación. Una solución alternativa sería intensificar y. la biodiversidad arriba del suelo se verá reducida. especialmente en suelos degradados. retener una buena cantidad de diversidad sobre el suelo. tales como cultivo mecánico. además. interrupción de los ciclos elementales globales y respuesta ante los efectos de los gases invernadero y de la erosión. lo cual implica una reducción de la biodiversidad bajo suelo y. Se presume que de esa forma se reducirá la diversidad bajo suelo y que. varias frecuencias). para mejorar la complejidad estructural y diversidad funcional. escalas que determinan la predicción de servicios ecosistémicos. un gran número de agricultores tienen acceso limitado a insumos. Este hecho puede considerarse tanto a nivel de campo como de paisaje. la biodiversidad y complejidad arriba del suelo favorecen el restablecimiento o protección de la diversidad de organismos bajo suelo. dónde y cuándo Aunque éste es un manual de instrucción práctica. por ende.. El principio central es que el significado funcional de la diversidad biológica cambia de acuerdo con las escalas de El inventario de la biodiversidad biológica del suelo 43 . pérdida del potencial para la limpieza de los residuos y contaminantes. produciendo efectos indeseables.que afectan la biodiversidad bajo suelo. en la medida de lo posible. la regulación biológica de los servicios de ecosistema basados en el suelo. El suministro global de alimentos depende de la agricultura intensiva. de los que puedan realizar las funciones biológicas esenciales. Dichas funciones regulatorias frecuentemente se describen como “sustitutos” por insumos.minución de los servicios del ecosistema. debido a cambios en la fertilidad del suelo y/o incrementos de enfermedades en el mismo. El mantenimiento de una variedad de cultivos y otras plantas es aceptado como una práctica que protege al agricultor contra los riesgos a corto plazo. también se manifiestan en diferentes escalas espaciales y temporales (por ejemplo. puede causar pérdidas de función y reducir la habilidad de los sistemas agrícolas para soportar periodos inesperados de estrés. a pesar de que la producción se ha intensificado. debería reflejar un consenso de la teoría ecológica y del pensamiento actual sobre estructuras de la comunidad en diferentes escalas espaciales y temporales. incluso puede producirse la pérdida de la productividad primaria.

. por ejemplo. 2002. puede quedarse corto en relación con el propósito de evaluación de la diversidad de toda el área. en otro lugar. a los servicios del ecosistema en diferentes tipos de comparaciones. es cómo definir estos “grupos” en relación con niveles de escala. o bien. mientras que en el caso de la zona de uso de suelo. al punto de llegar a hacerla ser irrecuperable. en caso de rehabilitación. Las escalas temporales son importantes en los procesos de degradación. espaciales y temporales. La formación del suelo. de manera general. los números o diversidad pueden mantenerse estables. que combina estos elementos dentro de un sistema de uso de suelo. se puede esperar una variación grande. en un mismo paisaje. Por ejemplo. En términos generales. en número y diversidad de lombrices de tierra al moverse de un lugar a otro. puede haber una influencia biótica significativa. se pensaría que el material parental y el clima fueran los factores determinantes en el proceso de formación del suelo. entonces. incluso. si el objetivo del inventario es conservar la biodiversidad bajo suelo. los materiales parentales y los suelos serán los principales determinantes de todos los servicios del ecosistema a nivel paisaje.espacio y tiempo (Swift et al. pero en el caso de dos campos colindantes. esto quiere decir qué se mide. en última instancia podría. si uno o más grupos funcionales importantes estuvieran ausentes o permanecieran en baja presencia en una de las localidades o si el ecosistema original de bosque se hubiera reducido a una presencia mínima en uno de los lugares. Entre dos paisajes o dos regiones. El mayor reto. no obstante. 2004). dónde y cuándo se mide. la erosión de finas partículas de suelo y la reducción al mínimo de materia orgánica compleja que. De la misma manera. a la existencia de termitas o cualquier otro ingeniero del ecosistema que haya presentado mayor actividad en un lugar que en otro. tomando en cuenta los aspectos de la biodiversidad que puedan afectar. en un lugar específico. la diferencia que puede ocurrir en la descomposición o la fijación de nitrógeno simbiótico entre dos paladas de suelo del mismo campo. o bien. el inventario de especies de lombrices de tierra. como se podría esperar. del campo hacia setos que delimitan el terreno. Lavelle et al. a escala regional. los ciclos de vida de diferentes 44 Manual de biología de suelos tropicales . Esto quiere decir que. El clima. El objetivo debería ser reducir la variabilidad intragrupo y maximizar la variabilidad entre grupos. Asimismo. mientras se mantuviera en un paisaje mixto. probablemente es cuestión de saber cuáles microorganismos existen en cada una. constituye uno de los servicios del ecosistema que integra procesos en todas las escalas. puede que se deba al drenaje o manejo previo del lugar. la pérdida progresiva de macroporos. destruir la capacidad productiva. con el propósito de lograr lo anterior..

La Tabla 1. a escala de paisaje. se enfatiza en el capítulo 2 de este manual. 2004). será un determinante más de dicho nivel.3 muestra un resumen de niveles jerárquicos modificados a partir de los propuestos por Lavelle et al. más útil como indicador de la respuesta del suelo al manejo. El patrón de uso de suelo superpuesto en función de dichos efectos de clima. Paisaje. en este caso. derivados de la base mineral y vegetal. como se indica más adelante. que afectan a la biodiversidad bajo suelo (y servicios ambientales asociados) y el componente de la biodiversidad bajo suelo. al igual que en los protocolos de medición. mientras que las fecundidades también varían y. La biodiversidad bajo suelo. para explicar las posibles variaciones en la biodiversidad bajo suelo. por lo tanto. No obstante. Los cuatro niveles de escala espacial en muestreo. cada proyecto necesitará determinar su propia escala en función de sus objetivos. deberá capturar la distribución. también tendrán una importante influencia en la biodiversidad. tamaño y forma de estos gradientes y fragmentaciones. al igual que los procesos de cambio relacionados. en el caso del ecosistema de suelo y sedimentos (Wall. comparado con los efectos que produce la vegetación misma. como calidad y suministro de agua o control de erosión y no parece que éste juegue un papel importante. El inventario de biodiversidad bajo suelo. por los gradientes o transiciones de las condiciones de humedad o por los gradientes de las propiedades del suelo. (2006). 1. incluyendo el descubrimiento de especies invasivas exóticas es. La protección y conservación de los principales agroecosistemas y hábitats representa la mejor El inventario de la biodiversidad biológica del suelo 45 . vegetación y tipo de suelo. la distribución espacial de la biodiversidad bajo suelo estará fuertemente influenciada por los gradientes de altitud y temperatura. son usados en el proyecto CSM-BGBD (véase prefacio) y están considerados como ejemplo. El impacto en el diseño de muestreo.taxa de biota varían de horas a años y pueden incorporar estados obligados de inactividad. En el nivel más alto. de gran relevancia en ese nivel. A nivel paisaje es difícil evaluar el efecto de la biodiversidad bajo suelo sobre algunos servicios del ecosistema. Las características espaciales de la distribución de uso de suelo (“parches” de uso de suelo. como puede ser dentro de los bosques). ampliamente discutidos. el tiempo requerido para que una población creciente alcance un tamaño crítico mínimo donde es autosuficiente. geología. también será diferente de un organismo a otro. Los principales conceptos teóricos que corresponden a estos criterios son: apertura y conectividad.

El terreno o parche.. los cambios relacionados con el uso y cobertura del suelo. En este nivel. Parcela o parche. Estas áreas muestran. Vanlauwe et al. tramos de bosque y otros elementos de manejo de paisajes. la composición y actividades funcionales de la biota son de gran interés y. pero son asociados con el manejo. cuando se trata de agrosilvicultura. éste es el caso de algunos árboles donde ciertos organismos de suelo hacen uso de sus nichos. es en este nivel donde la biodiversidad bajo suelo debería estudiarse de manera minuciosa. pertenecientes a varios niveles tróficos y grupos funcionales que gobiernan la estabilidad de redes alimenticias y la provisión de funciones de apoyo. A nivel de parcela. tal es el caso de un área con plantaciones comerciales de té o la caracterizada por la agricultura de autoconsumo. Las áreas de uso de suelo se definen en función de su uso y régimen de manejo (Huising.opción para dicha intervención. 3. 2. la estructura comunitaria y sus interacciones son reguladas por la arquitectura del suelo del lugar en específico (Lavelle et al. si no es demasiado grande. de cientos de años. rompevientos. Las interacciones laterales son componentes muy importantes para la biodiversidad bajo suelo. incluso. 2007.. queda dentro de los dominios funcionales de los ingenieros del ecosistema. en el caso del inventario de biodiversidad bajo suelo. describen los gradientes de la fertilidad del suelo en función de los recursos destinados al terreno. Cambios en la arquitectura del suelo. típicamente. incluyendo a las raíces de suelo. A este nivel. que implican una pérdida de sus aportes e impactos. por lo tanto. respecto al cambio de uso de suelo. La escala de tiempo de estos procesos (cambio de la composición de uso de suelo y configuración de paisaje) para ser observable necesitaría de varios o. por ejemplo. aunque sean provocados por cambios en la composición funcional y actividad de los ingenieros del ecosistema o del arado del suelo. son visibles en escalas de tiempo más cortas que pueden abarcar desde pocos años hasta varias décadas. La intensificación de uso de suelo. y para la manera en cómo funciona el sistema. La biodiversidad sobre el suelo se determina por la variedad de cultivos encontrados en el área y por los elementos vegetales asociados con barbechos. también lo es la abundancia de especies relativas. Área de uso de suelo. normalmente. tendrán un 46 Manual de biología de suelos tropicales . una combinación específica de tipos de cobertura. 1993). 2006 y Tittonell et al. Los gradientes de las propiedades de suelo sí ocurren en este nivel. sobre todo. se asocia con la extracción de elementos vegetales como árboles.. cercos vivos. 2006). de manera que la relación entre el patrón de distribución espacial de la biota sobre el suelo con la de bajo suelo son particularmente interesantes.

la competencia y la eficiencia son de particular relevancia y. pertenecientes a grupos funcionales definidos o a niveles tróficos dentro de la cadena alimenticia. dado que ésta es la unidad fundamental de la función del suelo. según lo describe Swift (1998). del agregado individual y de la partícula individual. etc.3 son parcialmente derivadas del concepto “el manejo jerárquico de la biota del suelo”. principalmente. puede servir para corregir desequilibrios en la composición funcional o para mejorar algunas funciones en particular. La redundancia funcional entre los transformadores primarios (especies o familias diferentes que cumplen una misma función). la introducción de depredadores para el control de una enfermedad en particular. Nicho. también despiertan gran interés. 4. La lista de intervenciones y mediciones correspondiente a la biodiversidad bajo suelo. Las opciones para intervenciones de manejo en una escala de subparcela son actualmente limitadas. no es necesariamente exhaustiva. el grado de diversidad genética. dentro de los microorganismos. Cambios estructurales en la comunidad biótica (conexiones en la cadena alimenticia. pero un entendimiento de los procesos e interacciones es vital. 2001. Éstos existen en la escala de los horizontes de suelo. subparcela o microhabitat. El manejo de materia orgánica y el uso de agroquímicos causarán un mayor impacto en la estructura de la red alimenticia. A nivel parcela. por lo tanto. en la estructura de la red alimenticia. condicionados por los organismos de suelo en la producción de servicios de apoyo tales como mantenimiento de la estructura de suelo y la descomposición de materia orgánica introducida. para mayores detalles y terminología). por ende. Las “intervenciones” enlistadas en la Tabla 1. reflejándose la dependencia de los organismos más pequeños en los ingenieros del suelo para el suministro de sus sustratos (véase Lavelle y Spain. tienen escalas de tiempo relativamente cortas y mostrarán variaciones estacionales. sino más bien ilustrativa. composición funcional) pueden necesitar de varios años. los procesos involucrados.. El inventario de la biodiversidad biológica del suelo 47 . termitósferas. la inoculación con especies microbianas. en relación con esto. Cualquier tipo de inoculación causará un impacto directo sobre la diversidad bajo suelo y.efecto sobre las interacciones tróficas y. Tal intervención debería apoyarse en el inventario y la abundancia relativa de especies. como en la cadena alimenticia. drilósferas. Este nivel se refiere a los microhábitats que alojan a los microbios y a los componentes de la microfauna del sistema de suelo que los regulan. son segregados en los dominios funcionales: rizósferas.

Capa de nivel de agregación Paisaje Tipo de unidad Medida/ parámetro de biodiversidad Área caracterizada Sin especificar: Cambio de uso de Diversidad biopor un mosaico de tal vez. manejo ecosistemas: integrado de patrón de distrirecursos naturales bución espacial. Número de cla. procesos asociados de cambio y componentes relevantes de la biodiversidad. corredores biológicos.de suelo. de un país. de relevancia específica para la biodiversidad y mantenimiento de la provisión de servicios de ecosistema. de detalle de la biológicas y bio. cuenca mayor. saje. Tabla 1. mancífico (depentenimiento de de especies y régimen de especialmente diente del nivel áreas de refugio manejo. 3–20 tipos de Intensificación Diversidad Área con uso de áreas de uso de de uso de suelo. y prácticas de conservación del suelo. parches de selva. dentro de degradación diversidad y tico y patrón de composición cobertura de suelo un paisaje espe.existiendo una superposición entre niveles de escala dentro de los parámetros a medir.3 Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. unidades de referencia. por ejemplo. funcional. suelo caracteríssuelo.cas e invasoras. varias suelo: protección lógica de suelo: uso de suelo y de por bioma o por de usos de suelo y especies exótiecosistemas como región dentro elementos de pai. del suelo.relacionada con diversidad arriba ingenieros de clasificación).Proceso/ ses o unidades intervención Área de uso de suelo 48 Manual de biología de suelos tropicales .

3 Continúa. el inventario bajo suelo de la biodiversidad. por suelo. especies. parche Tipo de unidad Número de cla. de agentes de control biológico. na. inoculación con microsimbiontes. • Abundancia (total) y biomasa (en el caso de animales) de taxa. materia orgánica. microhábitat horizontes de suelo. Datos requeridos Los métodos expuestos en este manual. drilósfera. funcional. o a nivel más alto o más bajo (por ejemplo. ejemplo. utilizando los métodos previstos en este manual. proveen un gran número de parámetros para la evaluación de la biodiversidad bajo suelo. dependiendo del tipo de análisis realizado: En cuanto a la biodiversidad: • Riqueza taxonómica a nivel de especie. rizósfera. 10 a 100 por Área con un uso particular y mane. • Proporciones relativas de GF. campo agrícola.Proceso/ ses o unidades intervención Medida/ parámetro de biodiversidad Intensificación de Abundancia manejo de suelo y relativa de cultivos. selva. para lo cual se indican en los capítulos 3 y 9 los mejores métodos.Tabla 1. etc. inoculación. dentro mejoramiento de y entre grupos funcionales y sistemas de cultivo y manejo de niveles tróficos.área de uso de jo particular. los datos tendrán que ser acumulados en cada punto de muestreo. etc. Nicho Por ejemplo. • Abundancia y biomasa de los grupos funcionales (GF). Biomasa y actiManejo de vidad microbiabiota clave. cepas para microsimbiontes). provee los siguientes datos e información. Capa de nivel de agregación Parcela. diversidad introducción genética. erosión. El inventario de la biodiversidad biológica del suelo 49 . parcelas de vegetación. composición labranza mínima. Sin tomar en cuenta los objetivos específicos y el diseño experimental de cualquier estudio. que consisten en el uso oportuno de tiempo y recursos. Por regla general.

Soderstrøm. Behan-Pelletier. Vosti. R. Brussaard. P. (2005) ‘Belowground diversity assessment: developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. B.. vol 26. pp. Cavalier-Smith. Cavalier-Smith. F. D. Bignell.. Washington DC. functional groups and ecosystem processes’. y Swift. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. 123–135. Referencias Bardgett. T.Ecology.. L. Didden. Lavelle. Bignell. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. vol 9. response 11. Huising. Huang. Nwaga. Características de vegetación. V. D. S. Brussaard. Malloch. Propiedades físicas y químicas básicas: pendiente y aspecto del suelo. J. S. J.. Palm. M. Oxford University Press. Hole. A. V. Conservation Ecology.. 203–266. Applied Soil. Prácticas actuales de manejo de suelo y cultivos. vol 7.. (1997) ‘Biodiversity and ecosystem functioning in soil’. C.. Tiedje.. P. 563–570. D. Pashanasi. Columbia University Press. D. Historia precisa del uso de suelo desde su estado de selva no perturbada hasta otro tipo de vegetación pre-cultural. Biological Reviews. J. T. Moreira. Daily. (2004) ‘Only six kingdoms of life’. L.. Tondoh. vol 5. E. pp. A pattern recognition approach to land use inventory at the sub-regional scale 50 Manual de biología de suelos tropicales . Klopatek. C. T. D... J. En cuanto al suelo. guilds. V. Island Press. D. Folgarait. R. (1981) ‘Effects of animals on soil’... intensidad de uso y cobertura de suelo: • • • • • • Cultivo aparente o uso de barbecho. uso del suelo. pp. Hawksworth... Ambio. L. D. P. Freckman. Susilo. D. F. Proceedings of the Royal Society of London Series B. (2003) ‘Linking keystone species and functional groups: A new operational definition of the keystone species concept’. A. G. pp. Gupta... W.. E. Dibog.. issue 1. Geoderma. Promedio de datos climáticos y precipitación real hasta la fecha de muestra. 1251–1262. (2005) The Biology of Soil. C. A. Hattori. New York.. y Virginia.. Oxford.. Davic.• Índices cuantitativos generales de riqueza y equitatividad. (ed) (1997) Nature’s Services.. X. (1998) ‘A revised six-kingdom system of life’. P.Rusek. vol 73. D. in C. B. pp.. 75–112. vol 271. J. Sanchez. R. Fragoso. P. (1998) ‘Soil fauna. F. Brown.

. (2006) ‘A molecular phylogeny of the flagellated fungi (Chytridiomycota) and a proposal for a new phylum (Blastocladiomycota)’. V. Ritz. M. V. E. W. Abe. Bignell. C. Siqueira. Freeman.using remote sensing and GIS applying an object oriented and data-driven approach’. P. Jones. (1998) Five Kingdoms – An Illustrated Guide to the Phyla of Life on Earth.. Springer. James. Lavelle. Boulton. R. 685–701. J-P. Larsen. (1996) ‘The role of species in ecosystems: Aspects of ecological complexity and biological diversity’.. (2004) ‘Connecting soil and sediment biodiversity: The role of scale and implications for management’. N. S. S.. Bignell. W. (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. y Dillion. Margulis. Spain. Biology International.. (1996) ‘Diversity of soil fauna and ecosystem function’. Porter.. St John. pp. 3rd edition. P. Y... M. B. S. M.. P. El inventario de la biodiversidad biológica del suelo 51 . pp. Bignell. y Brussaard. D. Brown.. J. F. Heal. H. S. 72–76.. 3–16. Decaëns. Thesis.. Srivastava. Aubert. V. S. pp.. 373–386. E. P. Nature (Lond). T. M. vol 98. P. K... Lepage. D. P. E.. pp. (2006) ‘Soil invertebrates and ecosystems services’. Lavelle. pp.. Berlin. Stork.. The Netherlands.. P. CAB International. J. S. y Rossi. G. M. Moreira. Wallingford.. Longcore. O. D. D. K. E. M. y Shachak. Washington. DC Lavelle. P. P. Austen. S3–S15. Volters. Lawton. Oikos. R.. T. P. H. Margerie.. Dordrecht Lavelle.. Island Press. K. Holt. H. G. vol 363. F. N. Wall (ed) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. G. Letcher. Barot. W. V.. vol 33.. vol 391.. B. P. T. Giller. in T.. y Swift.Griffith. M. 159–193. M. Ph.. S.D.. Levin y M.. D. Bloemers. Mozley-Standridge. (1998) ‘Biodiversity inventories. in D.. J. H. Mawdsley. C.. (1994) ‘Organisms as ecosystem engineers’. J. L.. J. H. y Schwartz. (2001) Soil Ecology. E. F. European Journal of Soil Biology. y Paul. M. Higashi (eds) Biodiversity. M. A. G.pp. E. E. G. 860–871. (1997) ‘Soil function in a changing world: The role of invertebrate ecosystem engineers’.. Lavelle. W.. A. A... Garey. Hawkins. Mora. Powell. (2008) ‘Soil health in agricultural systems’. Hammond. A. P.J. Kibblewhite. L. J. Lawton. P. Behan-Pelletier. A...S. Ineson. vol 42. J. M. Hodda.. Brown. Philosophical Transactions of the Royal Society Series B. Wageningen Agricultural University. pp. R. y Vilgalys. Bureau. Hunt.. Kluwer Academic Publishers. The Inventory of Soil Biological Diversity 15ES_HTSB_11-6 13/6/08 18:14 Page 15 European Journal of Soil Biology. M. Blouin. Eggleton. indicator taxa and effects of habitat modification in tropical forest’.vol 69.. V. Mycologia. an Ecological Perspective. J. vol 33. New York. Lawton. D. H.. M. y Watt. Roger. D. G.

inJ. M. vol 9. J. Vanlauwe B. (2006) ‘Within-farm soil fertility gradients affect response of maize to fertilizer application in western Kenya’. Ecosystems and Environment. E. O. Mikola. E. de Ridder. C. Guilherme. and Eucarya’. SBCS/UFLA/DCS. M. Siqueira. Kandler. E. J. Agricultural systems. Brazil. y Van Noorwidjk. Stork. 113–134. Washington. vol 57.Rappé. H. Laakso. pp. 23–32 Swift. Wall. vol 94. American Journal of Alternative Agriculture. Carvalho (eds) Soil Fertility. pp. vol 76. N. M. A. W.. R. Lopes. pp. S. 11–24. Nutrient Cycling and Agroecosystems. (2002) ‘Biodiversity and ecosystem services in agricultural landscapes – are we asking the right questions?’ Agriculture. (1979) Decomposition in Terrestrial Ecosystems. K. B. M. (1990) ‘Towards a natural system of organisms: Proposal for the domains Archaea. O. O. J. Setäla. Moreira. Vanlauwe. (2007) ‘Heterogeneity of crop productivity and resource use efficiency within smallholder Kenyan farms: Soil fertility gradients or management intensity gradients’. (1998) ‘Functional diversity of decomposer organisms in relation to primary production’.. Soil Biology and Plant Nutrition interrelationships. vol 7. Woese. V.. vol 104. Swift. M. (ed) (2004) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. Lavras. H. pp. Heal. Tittonell. N. F. J. R. (1998) ‘Towards the second paradigm: Integrated biological management of soil’. vol 87. G. S. y Mukalama. (2003) ‘The uncultured microbial majority’. J. P. A. 4576–4579. L. M.. (1992) ‘Invertebrates as determinants and indicators of soil quality’. S. P. J. y Anderson. pp. y Wheelis. Annual Review of Microbiology. L. 369–394. Applied Soil Ecology. M. S. pp. D. P. M. y Giller. Tittonell. Izac. N. J. 171–182. M.. y Eggleton. J. N.. Bacteria. Furtini Neto y J.. Faquin. Swift. V. Blackwell. Oxford. 52 Manual de biología de suelos tropicales . pp. Island Press. G.. pp. Proceedings of the National Academy of Sciences USA. y Giovannoni. A. 25–31. y Huhta. 376–390.

En una primera escala. Louzada. Fátima M. Ronald Zanetti. en un punto predeterminado del paisaje. mismos que se describirán en los siguientes capítulos. Huang (†) INTRODUCCIÓN Gran parte de este manual contiene instrucciones de cómo tomar mediciones una vez que se tiene un sitio de muestreo. es necesario escoger el lugar dónde se tomarán las muestras de suelo para los análisis químicos. Cares. que aplica en todos los casos (Cochran. El problema de localizar los puntos de muestreo se presenta a diferentes escalas. también incluye cómo determinar la localización de estos sitios de muestreo: lo que se discutirá más abajo. Moreira. Hay numerosos textos que describen la teoría y su aplicación (ej. S.Capítulo 2 Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo E. 1977). Richard Coe. Jeroen Huising. Existe una larga tradición de muestreo en la ecología de campo y. Gregoire y Valentine. Southwood y Henderson. se necesita determinar en dónde va a estar localizado todo el estudio. Entonces ¿para qué se necesita otro capítulo que discuta las técnicas de muestreo de la biodiversidad del suelo? A pesar de los conocimientos y experiencias en rela53 . La base del problema radica en el muestreo. una gran experiencia al respecto. Julio N. el problema gira en torno a cómo escoger el número y localización de los puntos de muestreo en el paisaje en cuestión. Francis-X. 2007). se encuentra el problema de la elección de los sitios. se cuenta con una teoría de muestreo bien establecida. 2000. Juvenil E. En algún punto entre estos dos. Además. por tanto. Susilo. En cuanto al argumento es más complicado que una mera elección al azar. Souleymane Konaté. en otra. Meine van Noordwijk y Shiou P. en los cuales se llevarán a cabo los protocolos de medición.

(1989) lo explican con detalle en el contexto de muestreo ecológico. en cualquier proyecto habrá desacuerdos y discusiones en cuanto a las estrategias de muestreo. 4 Los objetivos del estudio determinan el diseño. Por ejemplo. o bien. el acceso a sitios de muestreo ideales puede ser restrictivo. Son varias las razones para ello: 1 La aplicación de una teoría completa o de métodos tan extensivos como los utilizados en otros estudios. En este capítulo se describen algunas opciones para muestrear la biodiversidad del suelo y las ventajas o desventajas de los diferentes enfoques. es posible que no sea fácil tomar tantas muestras como se desearía. debido al tiempo y al costo. OBJETIVOS DEL ESTUDIO Y BASES DEL MUESTREO La mayoría de los autores que escriben sobre diseños de investigación puntualizan que el diseño se determina en función de los objetivos.ción con el tema. 5 Los investigadores toman diferentes posturas filosóficas relacionadas con el enfoque de muestreo. Muchos de los debates sobre los métodos apropiados de muestreo se deben a diferencias de opinión en cuanto a los objetivos exactos del estudio. estos podrían no estar completamente desarrollados o los objetivos múltiples podrían sugerir diferentes enfoques para el muestreo. Kenkel et al. o qué es una réplica. 3 Puede haber límites en cuanto a la teoría. pueden discrepar en lo referente al carácter práctico del estudio que está siendo diseñado. Por ejemplo. Sin embargo. el tamaño de muestra requerido depende de la variación entre las muestras. 2 La aplicación de una teoría de muestreo puede requerir de información con la que no se cuenta hasta que los datos han sido colectados. Si datos similares no han sido colectados antes. Ford (2000) hace referencia a una amplia discusión de los objetivos de investigación en ecología. están los que “Ven lo que está ahí. Comúnmente hay malos entendidos de algunos de los principios básicos. entonces esta variación es desconocida. entonces tratan de entenderlo” y aquéllos que “empiezan con una hipótesis y tratan de probarla”. 54 Manual de biología de suelos tropicales . se presenta un ejemplo del enfoque utilizado en el proyecto CSM-BGBD. tales como por qué el trabajo de muestreo debe ser de manera aleatoria. A continuación.

Si el objetivo es estimar la media poblacional (la biomasa media de escarabajos por m2 dentro del área de estudio. por lo que prefieren mantener la mente abierta y partir de la observación. Otra alternativa al MAS consiste en usar un muestreo sistemático usando una cuadrícula. en ecología. Otra alternativa es formular algunas hipótesis predictivas para explicar los patrones en la biodiversidad. dividir la población en sub-poblaciones o estratos. y su error estándar puede ser estimado sin hacer supuestos acerca de la variación dentro de la población (técnicamente. Un enfoque de muestreo consiste en colectar datos usando el método de MAS o mediante una cuadrícula. el caso de las orillas de un estanque. existen pocos estudios ecológicos cuyo objetivo sea estimar la media poblacional. Cuando el objetivo es identificar todas las especies de un grupo dado en el área de estudio entonces el MAS resulta inapropiado. Si el objetivo del estudio es estimar la biomasa media de escarabajos en general. se han hecho imD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 55 . lo que se discutirá en la sección de muestreo aleatorio y sistemático. entonces. La mayoría de los estudios. Piense en un nicho raro en el paisaje (por ejemplo. análisis de conglomerados y ordenación) y luego explicarlos (por ejemplo. La teoría. esto es atractivo. y la precisión aumenta con un tamaño de muestra fijo. indica cómo la precisión de la estimación puede ser controlada mediante la elección de la muestra. Por supuesto. pero si el propósito es realizar un inventario de especies. existe una estimación del error de muestreo basada en el diseño).El muestreo aleatorio simple (MAS) constituye el punto de partida para la discusión sobre cómo muestrear. intentando describir patrones (por ejemplo. La media de la muestra es una estimación imparcial de la media poblacional. su imaginación y descubrimientos potenciales podrían estar restringidos. y luego diseñar un estudio cuyo objetivo específico sea probar estas hipótesis. encontrando correlaciones con variables ambientales). Intuitivamente. no importará si los nichos raros son omitidos o no. o el número promedio de especies de hongos en 1 cm3) el MAS adquiere propiedades relevantes. y en cada estrato tomar una muestra aleatoria). situado en el lindero entre el bosque y la pradera. intentan entender los patrones en la biodiversidad. Un ejemplo de un objetivo que requiere diferentes enfoques de muestreo son los inventarios. existirá solamente una pequeña porción del área de estudio ocupada por este tipo de nichos. No obstante. argumentando que si se empieza partiendo de un objetivo limitado. incluyendo los del proyecto CSM-BGBD. a través de la estratificación (es decir. entonces los nichos raros deben ser incluidos. Los seguidores del primer enfoque pueden argumentar que no quieren ser prejuiciados por hipótesis previas.

1). • La MOS y la P pueden estar correlacionadas. frecuentemente. frecuentemente. si se trata de entender la relación entre la biodiversidad del suelo y la MOS o la P. pocos puntos con valores altos o bajos. aunque ésta sea implícita. además. sin alguna noción de los factores ambientales que puedan controlar la biodiversidad. Se requiere de estudios minuciosamente planeados para poder probar dichas explicaciones. Por ejemplo. Sin embargo. separar los efectos de las dos variables. parcelas con un valor alto de P. La estratificación puede usarse para incrementar el número de puntos con MOS más extremos y mejorar la estimación de la relación sin incrementar el número de muestras. 2 De hecho. relativamente. deberían ser medidos en los sitios de muestreo. cada investigador debería estar abierto a la posibilidad de observaciones no anticipadas y explicaciones verdaderamente nuevas. Entonces es difícil y hasta imposible. haciéndolo más eficiente. son los puntos más extremos los que proporcionan más información (Figura 2. Si las hipótesis implícitas se hacen explícitas el diseño de los estudios pueden ser mejorado. Este último punto subraya o enfatiza gran parte de lo que sigue en este capítulo. está determinada por el nivel de Perturbación (P) y el nivel de Materia Orgánica del Suelo (MOS) y se colectan los datos por medio del MAS o por muestreo de cuadrícula. 56 Manual de biología de suelos tropicales . es imposible elegir cuáles. por ejemplo. entre un número infinito de factores. entonces es probable que: • La mayoría de los sitios de muestreo tengan valores de P y MOS alrededor de la media con. existen tres razones para tratar de diseñar un estudio con objetivos específicos que incluyan hipótesis comprobables: 1 Los descubrimientos inesperados usualmente tienen la naturaleza de formulación de hipótesis observacionales que sugieren explicaciones. los que proponen el enfoque “no hipotético” en realidad parten de alguna forma de hipótesis.portantes descubrimientos por casualidad. tienen valores bajos de MOS. Si suponemos la hipótesis de que la biodiversidad del suelo en parcelas agrícolas. no obstante. sin seguir estudios planeados. el estudio podría ser diseñado para incluir específicamente algunas muestras con valores altos de P y de MOS y otras muestras con valores bajos de P y de MOS. 3 Si se parte de hipótesis específicas. No obstante. es posible mejorar el diseño del estudio.

no siempre resulta viable. En términos ideales. Si tenemos que utilizar un diseño de estudio observacional. En el presente estudio.Entonces. puede que sea imposible o inútil producir un solo índice de biodiversidad del suelo. El objetivo global del proyecto CSM-BGBD fue comprobar la hipótesis de que un incremento en la intensidad del uso del suelo cambia la biodiversidad del suelo (más específicamente. dicha investigación iría acompañada de un experimento. Las discusiones en este capítulo sólo consideran esquemas alternativos de muestreo para datos colectados por el método transversal. en lugar del experimental. se utiliza una aproximación transversal. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 57 .1 y las relaciones pueden ser más complejas que el caso de dos líneas rectas. se aplican los mismos principios de diseño. generalmente. Si éstas se seleccionan explícitamente. La única manera cierta para determinar el efecto de un cambio. entonces se abren nuevos debates con una probabilidad de mejorar el diseño del estudio. como el que se observa en la Figura 2. y sus efectos combinados pueden ser estimados. que indiquen lo que pasaría con la biodiversidad del suelo si los usos de suelo cambian en el futuro. Lo anterior. tampoco es viable en un proyecto de duración fija y corta. considerando un rango de usos de suelo en un momento específico de tiempo. Cuando se determina la distancia entre los sitios de muestreo y el tamaño total del área de estudio. sin embargo. lo ideal sería llevar a cabo un estudio longitudinal. Aunque la validez de este enfoque puede ser cuestionable. es hacer justamente el cambio y esto precisamente constituye la base de un enfoque experimental. señala una pérdida de biodiversidad del suelo). como en muchos otros. en donde las parcelas sean monitoreadas a través del tiempo para observar si los cambios en la biodiversidad del suelo pueden ser correlacionados con cambios en el uso del suelo. muchas veces es la única opción disponible. Otro ejemplo de una hipótesis implícita en muchos de los estudios es la escala espacial en la que ocurren los patrones interesantes. En la práctica. Este planteamiento es muy amplio. puesto que se desconoce el tiempo necesario para el monitoreo. pero aún puede resultar útil cuando se enfoca con un diseño de muestreo. los efectos de ambas variables. sin embargo. Se espera que las correlaciones entre la intensidad de usos de suelo y la biodiversidad del suelo reflejen alguna conexión causal. el investigador hace una selección de las escalas importantes para su estudio.

Los detalles de cómo dichos factores prácticos y teóricos pueden mezclarse. por estratificación. por lo tanto. ENFOQUES PRÁCTICOS El diseño de un esquema de muestreo exitoso y práctico es todo un arte.1 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. tiempos y disponibilidad de expertos. la necesidad de transportar con rapidez las muestras desde el campo hasta el laboratorio. b) si se incluyen de manera deliberada valores de MOS más extremos. Asimismo. Paso 1: Defina objetivos Como se indicó en la sección de objetivos del estudio y bases de muestreo.Figura 2. desde un principio deberán ser expresados de manera clara y precisa. serán diferentes para cada estudio y darán a cada investigación un aspecto único. por ejemplo. con base científica y de las propiedades que ofrecen los diversos métodos. podría surgir una serie de restricciones adicionales. Requiere de un entendimiento profundo. no obstante. Escríbalos y compártalos con otros para 58 Manual de biología de suelos tropicales . esto aumentará la precisión de la estimación de la pendiente. es posible que se especifiquen algunos pasos del proceso en general que se deben seguir en cualquier estudio. Sin embargo. es necesario que se combine con las restricciones prácticas impuestas por costos. dando un estimado pobre de la pendiente. los objetivos determinan todos los aspectos del diseño. o bien. el acceso limitado a localidades deseadas para muestrear.

La Figura 2. Una herramienta que ayuda a refinar los objetivos es la presentación de resultados simulados. Si bien puede haber aspectos sobre los cuales tenga poca idea. Estos incluyen: mapas topográficos (ej. ¿Cuáles cumplen con sus objetivos y proveen evidencia para su hipótesis?. otros que han trabajado en el mismo sitio. Cada estudio cuenta con aspectos únicos y siempre habrá estudios previos de los cuales puede aprender: ésto le permitirá entender qué aspectos de los métodos utilizados han tenido éxito y cuáles limitan la eficiencia y calidad de los resultados. otros que tienen experiencia en los métodos que va a utilizar. anótelas y numérelas. mapas de uso de suelo (ej.que pueda discutir algunas sugerencias. su propia experiencia. diseños utilizados en otros estudios y su imaginación. Consiga el mayor número de comentarios y sugerencias de los expertos en la materia. Paso 3: Reúna datos relacionados Reúna información o antecedentes que serán necesarios para diseñar los detalles del muestreo. Estos expertos pueden ser investigadores que trabajan sobre temas similares en otros lugares. Imagínese que ha finalizado el estudio y ha obtenido resultados ¿Qué tablas y gráficas le gustaría presentar?. para ayudar a decidir cuáles son las temporadas idóneas para el muestreo de campo). D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 59 . mapas de cobertura del terreno). Anote específicamente el tamaño de las muestras utilizadas y la variación de los resultados.1 es un ejemplo simple. Después deberá comprobar con cuidado que: a) los resultados realmente logren los objetivos y b) que el diseño de muestreo simulado realmente pueda mostrar estos resultados. indican la estratificación por altitud o nos permiten entender los problemas de acceso)... Paso 2: Consulte otros estudios Consulte los estudios relacionados con su investigación.. Escriba el diseño con tantos detalles como sea posible. Paso 4: Elabore un diseño Elabore un diseño tentativo utilizando una combinación de principios generales. para identificar los principales usos del suelo que se incluirán en el estudio). datos meteorológicos (ej. o bien. imágenes de detección remota (ej. siempre deberá plantear un proyecto realista..

Un buen estadista. JERARQUÍA.Paso 5: Revise su diseño Comparta su diseño con otros investigadores para que expresen su punto de vista y sus comentarios. revise los objetivos a la luz de nueva información. Una investigación piloto abre la posibilidad de evaluar el aspecto práctico del esquema de muestreo. que expresan su opinión acerca de su tema. permita probar y refinar los protocolos de medición.. esto dará una indicación de la variabilidad. REPLICACIÓN Y TAMAÑO DE MUESTRA La mayoría de los diseños de estudio son jerárquicos y el problema de muestreo no sólo consiste en seleccionar el sitio de muestreo dentro del área de estudio. que han usado métodos similares o que han trabajado en la localidad o simplemente. Trate de incluir un estadista con experiencia en investigación en ecología. probablemente. Paso 7: Revise los pasos En cualquier paso. De nuevo. lo que puede ser útil para ayudar a decidir el tamaño final de la muestra. procese algunos datos hasta llegar a un análisis estadístico. procedimientos de manejo de datos. El proyecto CSM-BGBD es un buen ejemplo. éstos pueden ser personas que han trabajado con temas similares. puede ser que tenga que retroceder a un paso anterior para volver a intentar. En cada área. considerará algunos aspectos que pueden pasar desapercibidos por el ecólogo. un error común es obtener información que sugiere que los objetivos son inalcanzables. pero deberás seguir adelante. Dentro de cada sitio de estudio alrededor de 100 puntos de muestreo fue60 Manual de biología de suelos tropicales . De ser posible. puesto que involucra varios países. etc. En particular. también permita estimar el tiempo del muestreo y el procesamiento de las muestras. Asimismo. Dentro de cada país. fueron seleccionadas una o más áreas de estudio. Paso 6: Realice una prueba piloto Pruebe su enfoque. uno o más sitios de estudio (etiquetadas como “ventanas”) fueron seleccionados.

evaluada mediante un análisis estadístico) que las muestras de bosque contienen mayor diversidad que las de los campos cultivados. ya que estos patrones pueden utilizarse para hacer predicciones y pueden reflejar algunas reglas o procesos. sólo podemos hacer afirmaciones sobre el monte Kenia con base en los datos obtenidos y no es posible extrapolarlos a otros lugares. La selección de algunos países puede estar basada en función de su política o de los intereses de algunas agencias financiadoras e investigadores que dirigen el proyecto. relacionados con los usos de suelo. es necesario repetir observaciones con el fin de determinar si los patrones son realmente consistentes. Suponga que cuenta con diez muestras tomadas de un bosque y diez en las cercanías de campos cultivados y que las muestras de bosque tienen consistentemente una alta biodiversidad del suelo ¿qué podría concluir? Si las muestras fueron seleccionadas de manera apropiada. dicha selección se deberá basar en los objetivos del estudio y en la aplicación de algunos principios. El muestreo implica que el conjunto sobre el que nosotros queremos hacer inferencias (“la población”) necesita ser delimitado antes de que un esquema de muestreo pueda ser planteado. puede concluir (con un grado conocido de incertidumbre. La intención es saber a qué se refieren sus resultados. estrictaD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 61 . que trata de mantener la consistencia de patrones y relaciones. ¿cuáles son? En los niveles más altos. El objetivo de la investigación es encontrar algunos patrones. Los patrones de interés son los que mantienen una consistencia a través de un número de casos. Por lo tanto.ron seleccionados y en cada punto se tomaron muestras (el protocolo de medición determina más capas en la jerarquía. entonces también se necesitará una muestra de otros bosques. en algún nivel. Si se desean resultados que apliquen a los límites del bosque de África del Este en general. La segunda idea es la de replicación. las respuestas no necesariamente estarán basadas en la ciencia. Sin eso. se podría estudiar la biodiversidad del suelo en fincas alrededor de los límites del bosque en el monte Kenia. Como ejemplo. En cada capa jerárquica. como consecuencia de la extracción de cuatro muestras tomadas para la caracterización del suelo y sub-muestras de éstas para los análisis químicos). Lo primero es centrarse en la idea de una teoría de muestreo de una “población”. se plantean las mismas preguntas: ¿cuántas unidades deberían de ser seleccionadas?. pero. aunque. tales como los patrones de la diversidad del suelo. lo que requerirá de una muestra de fincas pertenecientes a esta localidad. La terminología es confusa y no tiene nada que ver con una población biológica.

2b se pueden observar tres ventanas más pequeñas para muestrear tres diferentes parches de bosque y no uno solo. Si este proceso de reducir el tamaño de las ventanas mientras se incrementa su número se continúa.2c). muestras múltiples de un mismo bosque no sirven al mismo propósito. El objetivo es muestrear un paisaje con dos usos de suelo. Sin embargo.2a. las unidades de nivel más alto. Una crítica a este tercer tipo de diseño es que todos los sitios de muestreo en tierras agrícolas quedan cerca de un límite de bosque. pero queda claro que la escala en que se anticipan o hipotetizan los patrones. etiquetados como: “bosque” y “agricultura”.mente hablando. como los sitios de estudio pueden proveer un nivel de replicación. a través de un diseño que replique bosques y otros elementos de uso de suelo. En la Figura 2. representan una “regla” aplicable ampliamente. Por ejemplo. del diseño de muestreo. los bosques en general. Algunas de las implicaciones de estas ideas en el muestreo de cuadrícula son ilustradas a través de un ejemplo simplificado que se muestra en la Figura 2. La palabra “escala” es confusa y controversial en la ecología (Peterson y Parker. Si busca una conclusión válida para los bosques. puesto que representan “pseudo-réplicas”. para poder examinar las diferencias en la biodiversidad del suelo. Un enfoque más certero es asegurar una replicación válida y algunos resultados genéricos. Dentro de un estudio jerárquico. En la Figura 2. El que muestras repetidas dentro de un bosque sirvan para ser interpretadas de igual manera que las muestras de diferentes bosques depende de las propiedades de los datos y no. deberá buscar una consistencia en varias de ellos. entonces en algún momento se perderán las ventajas posibles de muestrear por cuadrícula y se terminará con un diseño que podría parecer un muestreo aleatorio de sitios individuales. patrones consistentes entre sitios. utilizando más ventanas y más pequeñas (Figura 2. la 62 Manual de biología de suelos tropicales . 1998). Una respuesta a esto es definir una nueva categoría de “límites de bosque” y asegurar ventanas en los tres sitios de muestreo (Figura 2. probablemente. sólo podrá concluir que ese bosque en particular es más diverso y no. por lo que no pueden ser considerados representativos del uso de suelo. Dicha cuadrícula es una “ventana” con 77 puntos de muestreo (intersecciones) definidos. Nótese que no es necesario muestrear todos los usos de suelo en cada ventana. determina el nivel jerárquico donde se requiere tener réplicas.2d). varios bosques son muestreados. ha sido construida una cuadrícula de tal manera que incluya los dos usos de suelo. La replicación puede aumentarse y abarcar más área total observada. Dentro de cada sitio de estudio se podrán establecer conclusiones más contundentes si por ejemplo.2. por lo tanto.

c) incrementando la replicación. d) reconociendo los límites como otra categoría. El mensaje es claro: “el nivel de paisaje” no está bien definido y. Entonces la hipótesis necesita una muestra de una unidad de 1 km². En otras áreas de la ecología. La réplica dentro de la unidad es importante para determinar la precisión con que la biodiversidad del suelo es medida para cada unidad. Una hipótesis diferente sería “la biodiversidad del suelo en parcelas agrícolas decrece con la reducción de la cobertura del bosque en el paisaje”. En este caso. con la definición de algunos sitios dentro de cada unidad. Para poder evaluar la biodiversidad del suelo dentro de un 1 km². sin embargo. con varios niveles de cobertura de bosque. se basan en datos de diferentes niveles jerárquicos: uno. utiliza datos en el nivel de parcela y el otro. por lo tanto. datos en el nivel de unidades de 1 km². b) tres cuadrículas que muestrean tres diferentes parches de selva. Los dos ejemplos del párrafo anterior son análisis que utilizan factores del paisaje. afectan los procesos. no queda claro el diseño de muestreo que se necesita. es decir.2 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. la escala espacial en que se evaluó la cobertura del bosque. Ahora es la réplica quien determina la necesidad de varias áreas en cada nivel de cobertura de bosque. se requerirá de más muestras. pero no es relevante para afirmar la consistencia del patrón a través de la unidad de 1 km² necesaria para examinar las hipótesis. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. hipótesis puede ser “la biodiversidad del suelo en parcelas agrícolas decrece con el aumento a la distancia del límite del bosque”. si se intenta hacer un “análisis en el nivel de paisaje”. factores del paisaje como la fragmentación del bosque.Figura 2. Lo anterior. puede ser investigado con parcelas (sitios de muestreo) en un intervalo de distancias. se necesita definir el significado de “en el paisaje”. los objetivos de un proyecto de biodiversidad del suelo pueden incluir “análisis del paisaje”. con réplicas en cada distancia. suponiendo que fue definida como áreas de 1 km². D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 63 .

dada la necesidad de planear campañas de campo por adelantado. Patrones a escala más grande. Otra complicación surge a partir de las respuestas multivariadas de interés. Cuando la investigación es dirigida a medir respuestas económicas para decisiones de manejo (por ejemplo. 1996) permite que el diseño responda a patrones que se detecten. la diversidad del suelo entre dos usos de suelo) que es importante detectar. muchas veces no es posible especificar un tamaño de muestra que resulte importante. cuando el objetivo de la investigación es detectar y entender algunos procesos. sin embargo. Si bien existe cierta atracción por esta idea. los métodos estándares están disponibles para ayudar a seleccionar el tamaño de muestra. con muchas mediciones que sólo están disponibles después de un largo periodo de muestreo en campo. en la práctica. a diferentes escalas. es improbable que sean prácticos para los estudios de biodiversidad del suelo porque el trabajo necesita planearse en distintas fases de campo y de laboratorio. Los métodos requieren conocimiento de dos cosas: de la magnitud de las diferencias (por ejemplo. al igual que el software para iniciar el análisis. pero normalmente resulta difícil especificarlos. Una variedad de diseños a multi-escala han sido utilizados en estudios ecológicos. El muestreo adaptativo (Thompson y Seber. La idea de estos diseños es elegir posiciones de muestreo. Aunque sean teóricamente atractivos. se incluyen ambos 64 Manual de biología de suelos tropicales . pero saber qué relevancia tendrá en nuevos ambientes puede ser desconocida. como la diversidad de diferentes grupos funcionales. 1993) permiten continuar con el muestreo hasta que algunos criterios se cumplan. Los métodos estándares presumen que existe una respuesta medible de la biodiversidad del suelo que se puede utilizar para obtener el tamaño de muestra. números. puedan ser investigados.Una vez que se sepa lo que hay que replicar. Por lo tanto. Enfoques secuenciales (Pedigo y Buntin. es improbable su viabilidad. de tal manera que los patrones. el tamaño de muestra se ha basado en una combinación de información de métodos formales (lo que puede indicar los órdenes de magnitud requeridos). Queda claro que la decisión sobre el tamaño de muestra depende de esto. la respuesta de un cultivo a un fertilizante) entonces es viable especificar la respuesta mínima que es importante detectar. No obstante. Una estimación aproximada de la varianza puede ser obtenida de estudios previos. biomasas y proporciones de estos grupos funciones o especies. y estudios previos similares y pilotos. etc. medida de diferente manera. Los patrones a escala fina requieren puntos muy cercanos. y la variabilidad entre réplicas del mismo uso de suelo. ningún estudio real ha multiplicado las respuestas de interés. requieren puntos más lejanos. Por lo tanto.

pero únicamente un volumen de suelo muy limitado puede ser examinado en la mayoría de las mediciones de biodiversidad del suelo y se toman varias muestras para poder representar toda la parcela. podrá alterar otros grupos. todas las mediciones se realizan a nivel de parcela. simplemente es práctica. para cada uso de suelo. antes de cuantificar la biodiversidad del suelo. se requiere tomar muestras (ver esquema de puntos de medición abajo). puesto que habría demasiadas muestras para procesar si no fuera así. y los diferentes usos de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 65 . los estratos son áreas con diferentes usos de suelo y la idea es obtener. En cada sitio de muestreo seleccionado. muestras de cada uno de ellos. no en función de un punto. Normalmente. Cuando varios grupos de especies están siendo evaluados. seguramente las relaciones entre ellos son importantes. Piense en un lugar seleccionado. normalmente sólo resulta posible examinar un grupo en una muestra de suelo dada y la extracción de la muestra de un grupo. Así. ENFOQUE DE OBJETIVOS: ESTRATIFICACIÓN En la introducción de este capítulo. se sugiere que un buen enfoque en los objetivos de un estudio mejorará la eficiencia en su diseño e incrementará la posibilidad de lograrlos.. dentro de cada parcela se reúnen las muestras. sino de una parcela. En este sentido. esto significa que la variación y los patrones en la escala dentro de la parcela (por ejemplo. Stein y Ettema. lo que quiere decir que se mezclan varias muestras de suelo. el número promedio de escarabajos por m2) sin tomar en cuenta un diseño. de tamaños adecuados. No obstante. <10 m) no se han examinado. quizá en un área del orden de 100 m². El objetivo de descubrir y entender los efectos del uso de suelo en la biodiversidad del suelo. 2003). requieren establecer comparaciones en diferentes usos de suelo. esto quiere decir que se tiene que medir en el mismo lugar. Si los datos se usan para hacer afirmaciones sobre el área de estudio en general (por ejemplo. 2002. existen dos razones para ello: una. Algunas veces se piensa que este enfoque puede estar “sesgado” porque los tipos de uso de suelo para tomar las muestras se determinan a priori. de manera deliberada. Necesitará muestrear dentro de toda esta parcela. la segunda. responde a la necesidad de contar con mediciones iguales de diferentes grupos funcionales del suelo. lo que asegura que se obtengan muestras realmente representativas. Un buen enfoque para mejorar el diseño de muestreo es el uso de la “estratificación”.y los diseños eficientes tienen una estructura en forma de conglomerado (Urban et al. entonces los resultados pueden estar sesgados.

entonces existen dos prerrequisitos: 1 Se necesita saber cuáles son los usos de suelo a comparar y contar con definiciones precisas de ellos. entonces probablemente muchos de los sitios de muestreo seleccionados terminarán siendo posiciones ambiguas en lo que se refiere a la definición de uso de suelo. con frecuencias proporcionales a su ocurrencia en el área de estudio. Resulta más eficiente incluirlas en un número 66 Manual de biología de suelos tropicales . es probable que la muestra incluya únicamente algunas observaciones de estas categorías. Si se emplea este enfoque. 2 Las localizaciones de estos usos de suelo deben ser conocidas. éstos deberán ser incluidos específicamente en el muestreo. a partir de las cuales no se podrán establecer conclusiones. sin embargo. ¿dónde se encuentra el límite entre “pastizales con árboles” y “bosque secundario”?.suelo pueden no estar representados en las muestras. La predefinición. rasgos lineales. las áreas ambiguas pueden ser excluidas del muestreo. pero si el objetivo es investigar los efectos de uso de suelo. el diseño no es parcial para el objetivo de comparar los usos de suelo y además es eficiente. puesto que no habrá certeza en cómo clasificarlas. de no ser así. podemos elegir un tamaño idóneo de muestra para cada uso de suelo. tiene que considerarse en algún momento. Sin embargo. Si los objetivos incluyen investigación en límites entre áreas de diferentes usos de suelo o de nichos raros. Se requiere de un mapa de uso de suelo del área bajo estudio. Con un enfoque de muestreo estratificado. al igual que la necesidad de definir con precisión. Si se cuenta con un total de N muestras para comparar dos usos de suelo entonces. en ausencia de alguna otra información. En un enfoque estratificado. El primer aspecto hace que algunos investigadores se sientan incómodos ante la idea de que una predefinición de uso de suelo para la investigación excluya el descubrimiento de patrones potencialmente importantes. si el objetivo es hacer un inventario del paisaje. por ejemplo. tiene sentido excluir tales sitios. ¿cuándo se debe uno de mover a lo largo de un gradiente para incrementar la cobertura de árboles? Aquí tenemos otra ganancia potencial en la eficiencia del pensamiento a través de estos requerimientos en el diseño y no sólo en la etapa de análisis. el mejor diseño es tener N/2 en cada uno de los dos grupos. Por ejemplo. Por supuesto. Si un diseño de muestreo no toma en cuenta el uso de suelo. ni aquellas zonas de transición que puedan ser importantes. no es deseable excluir algunos usos de suelo.

o en imágenes de SR y utilizar esto para definir los estratos. de tal modo que: a) cada punto tenga las mismas posibilidades de ser seleccionado. ya que existe la posibilidad de la interpretación de imágenes por sensores remotos (SR). Un enfoque común no aleatorio es una selección subjetiva de los sitios de muestreo. entonces dicha área queda representada por esa ventana y el hecho de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 67 . cuando se toman muestras en lugares considerados interesantes o importantes. por lo tanto. cuando una “ventana” única se coloca en un área. de la propiedad inherente del diseño. Por ejemplo. y seleccionar los sitios de muestreo de manera aleatoria. El muestreo aleatorio estratificado requiere hacer lo mismo en cada estrato. Nótese que muchos de estos argumentos también aplican cuando los factores hipotéticos que influyen sobre la biodiversidad del suelo. o bien. no es una limitante.suficientemente grande. los estudios ecológicos no siempre usan un muestreo aleatorio. esto es equivalente a limitar el área de estudio. por ejemplo. algunas veces por una buena razón. influenciadas por el uso de suelo. puede ser útil hacer un monitoreo rápido de la MOS. si los objetivos no lo requieren. la limitante de este enfoque es la posible falta de “representatividad” del área de muestreo (la medida en que los resultados pueden razonablemente ser asumidos para aplicarlos a una población más grade) porque ésta depende de la percepción del ejecutor y no. si los objetivos lo requieren. El no contar con un mapa de usos de suelo. Sin embargo. Ello queda. tales como la MOS o la frecuencia de fuego. Si se toma un tamaño de muestra subjetivo igual a 1. calibrarlo en un mapa de uso de suelo. Aunque a veces es necesario. Cuando se usan variables como la MOS en la estratificación. sino variables ambientales. MUESTREOS ALEATORIO Y SISTEMÁTICO Las razones esenciales para utilizar el muestreo aleatorio simple (MAS) fue descrito anteriormente y son detalladas en textos tales como Cochran (1977). el que estos no tengan una resolución idónea. abierto al debate cuando los resultados son presentados. no son usos de suelo per se. Para la implementación del MAS es necesario delimitar el área de estudio. excluirlas (dándoles un equivalente de tamaño cero). resultan muy útiles en la práctica. y b) la selección de un punto no cambie la probabilidad de incluir cualquier otro punto. que frecuentemente sirven como base para seleccionar unidades de muestreo a niveles jerárquicos más altos. El uso de un software para ayudar en la aleatorización y un GPS para localizar los puntos de muestreo en el campo.

que esa área sea o no, representativa dependerá únicamente de la habilidad del ejecutor. El muestreo sistemático tiene muchas aplicaciones en la ecología, usando transectos de una dimensión o cuadrículas de dos dimensiones. En el caso de los transectos, las muestras son seleccionadas en puntos que se encuentran a una distancia fija entre sí, a lo largo de una línea predeterminada. Para un muestreo de cuadrícula, una cuadrícula rectangular (usualmente) es definida en el área y las muestras son tomadas en cada punto de intersección. Las ventajas potenciales de este tipo de muestreo sistemático se derivan de la teoría y de la práctica. Las ventajas de la práctica incluyen:
• La facilidad de localizar puntos de muestreo, describir su ubicación y los medios de llegar a los puntos de muestreo; por ejemplo, el protocolo puede ser algo tan simple como “desde el punto de partida, camino al norte y muestreo cada 50 m”. • La facilidad de planear el trabajo de campo; por ejemplo, de estimar el tiempo requerido para muestrear un número fijo de puntos. La razón estadística para utilizar muestreos sistemáticos es que pueden ser eficientes (Webster y Oliver, 1990). Si se considera un estudio con el propósito de calcular la media o el total de algún parámetro (por ejemplo, el carbono total en el suelo en el área de estudio o la media de escarabajos por m2). Si la cantidad medida no es constante, una muestra que utilice la cuadrícula dará una mejor estimación que una simple muestra al azar del mismo tamaño, lo que frecuentemente es el caso de variables ambientales y biológicas. La eficiencia se basa en el hecho de que puntos cercanos son similares, por tanto, no proporcionan mucha información nueva; mientras que en la cuadrícula las muestras están de manera uniforme en toda el área de estudio. Por razones similares, el enfoque de cuadrícula resultará útil para compilar el inventario de un área bajo estudio, salvo que puede excluir nichos raros (véase abajo). Sin embargo, hay aspectos negativos: • Algunos puntos de la cuadrícula tendrían que ser excluidos del estudio, tales como caminos o cuerpos de agua. • Las cuadrículas incluyen muestras de diferentes usos de suelo, con un tamaño más o menos proporcional en cada tipo de uso de suelo. En particular, tipos de uso de suelo raros pueden ser omitidos, lo que se puede compensar moviendo
68
Manual de biología de suelos tropicales

la ventana y añadiendo puntos, aunque el proceso podría llegar a ser arbitrario y subjetivo. • Algunas veces no es posible caracterizar el uso de suelo claramente en cada punto de muestreo. Estos puntos están relacionados con el problema discutido en la sección “enfoque de objetivos: estratificación”. Si el objetivo del estudio es comparar clases de uso de suelo, entonces el muestreo por cuadrícula, a veces, no los captura de forma óptima, de manera que las cuadrículas y los transectos probablemente son más apropiados para muestrear la biodiversidad del suelo, cuando a) no existe ningún objetivo explícito o hipótesis que involucre comparaciones o relaciones con variables ambientales, o b) la hipótesis se refiere a una unidad espacial de un nivel más alto que la escala en que el muestreo por cuadrícula o por transecto fue hecho. Por ejemplo, Swift y Bignell (2001) recomiendan transectos de 40 m de largo, pero éstos quedan dentro de cada clase de uso de suelo. Cuando se comparan usos de suelo, se hacen réplicas de los transectos y se asignan aleatoriamente los estratos definidos por diferentes usos de suelo. De esta forma, el muestreo sistemático por cuadrícula o transecto, normalmente, es combinado con un muestreo aleatorio. Por ejemplo, puede haber varias cuadrículas definidas como se aprecia en la Figura 2.2d, con una localización y orientación hecha al azar. De manera similar, el punto de inicio y la orientación de los transectos que se repiten pueden ser hechos aleatoriamente. Los transectos también pueden ser útiles cuando se alinean con gradientes ambientales considerados importantes; esto se conoce como “gradsectos” (Wessels et al., 1998). Con la aleatorización en algún nivel en la jerarquía, es posible hacer un análisis estadístico basado en las propiedades aleatorias del diseño; por ejemplo, si un número de cuadrículas pequeñas es colocado aleatoriamente en el área de estudio, entonces contamos con las réplicas necesarias para establecer una consistencia, a través de patrones encontrados. El análisis estadístico elegido para una muestra tomada en un diseño sistemático no puede estar basado en la aleatorización, porque los sitios no fueron seleccionados de manera independiente dentro de cada cuadrícula. Existen dos posibles enfoques para el análisis: el primero asume que los datos se comportan de forma aleatoria (por ejemplo, las propiedades estadísticas son las mismas, como si el punto hubiera sido localizado aleatoriamente); el segundo, es utilizar un modelo explícito de patrones espaciales. En la mayoría de los análisis que buscan relaciones entre variables ambientales y la biodiversidad del suelo se usa el primer análisis,
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

69

principalmente, porque las alternativas son complejas. Las consecuencias de suponer esto son raramente investigadas. Es claro que la distancia y el tamaño total de la cuadrícula determinan la escala de los patrones que pueden ser detectados. No es posible observar patrones (por ejemplo, agregación de la biodiversidad del suelo) a escalas espaciales menores que las distancias entre los puntos de la cuadrícula; de la misma manera, tampoco será posible detectar patrones más grandes que el tamaño total de la cuadrícula. Sólo se pueden reconocer los patrones cuando existen varias repeticiones dentro de la misma cuadrícula. Es este aspecto de escala de patrones, definido por los objetivos del estudio, el que debería determinar los espacios y el tamaño total de la cuadrícula. Algunas veces se sugiere que los espacios deben ser de tal manera que los puntos vecinos no estén correlacionados. Esta noción de correlación espacial es importante, pero también confusa. La correlación entre las mediciones de una determinada distancia, no es una cantidad absoluta, pero es una medida relativa a un promedio (técnicamente, el problema tiene que ver con el recambio). Para poder ver esto, piense en analizar datos de una sola ventana en Kenia, donde los puntos de una distancia de más de 200 m entre sí, pueden no indicar similitud en la biodiversidad del suelo, pero si juntamos los datos con otra base de datos global se esperaría encontrar similitud, no sólo en los puntos que pertenecen a una misma ventana, sino entre todos los puntos dentro de Kenia. HABLANDO DE VARIABILIDAD La experiencia de estudios pasados sugiere que se debería de esperar un alto nivel de variación en muchas de las mediciones principales de la biología del suelo. Aún cuando se trata de distancias cortas, se puede esperar una variación grande en número y diversidad de diferentes grupos funcionales. En paisajes agrícolas tropicales la variación dentro de una categoría de uso de suelo puede ser debida a las prácticas de manejo, la variación en las características de la vegetación, las diferencias históricas en el uso de suelo de la parcela, efectos de borde, posición topográfica y características biofísicas. Si los métodos formales para determinar los requerimientos del tamaño de muestra fueran seguidos, probablemente indicarían un tamaño de muestra mucho más grande de lo es viable o costeable, ¿Qué se debe hacer entonces? Primero, ¡no tiene sentido no hacer nada! Simplemente, si se sigue con un tamaño de muestreo preconcebido, no se alcanzarán los objetivos; si el plan original fue
70
Manual de biología de suelos tropicales

trabajar con diez muestras por cada uso de suelo dentro de un sitio de referencia, y las indicaciones son que se necesitan alrededor de 100 muestras por cada uso de suelo, no tiene sentido continuar, puesto que se terminarán obteniendo resultados vagos y no concluyentes, los cuales se traducirán en errores estándares altos y sin efectos significativos cuando se analizan los datos. Tres son las posibles opciones: 1. Incrementar el tamaño de muestra. 2. Utilizar métodos de muestreo para reducir la variabilidad. 3. Reducir la amplitud del estudio. La primera opción no resulta práctica en la mayoría de los casos, pues siempre hay limitaciones de tiempo, dinero, recursos y experiencia. Existen varios métodos para reducir la variabilidad de las muestras; los más útiles consisten en la estratificación y la congruencia. Nótese que el uso del término “estratificación” se usa para el muestreo, pero es diferente a cómo se aplica en “enfoque de objetivos: estratificación” (arriba). Si algunas fuentes de variabilidad pueden ser previstas, éstas pueden ser usadas para definir estratos y removerlas del análisis. Por ejemplo, si el sitio de estudio cubre un rango de altitudes, se puede esperar una variación en la biodiversidad del suelo dependiendo de la altitud. La estratificación, entonces, divide el sitio de estudio en zonas de altitud y los sitios de muestreo dentro de cada una de ellas. En esta fase del análisis de datos, la variación de los usos de suelo se compara dentro y entre estratos para no oscurecer los resultados. Este enfoque requiere que algunos (no todos) de los diferentes usos de suelo estén localizados dentro de zonas de altitud. Si el uso de suelo únicamente varía con la altitud, entonces los dos factores están confundidos y sus efectos en la biodiversidad del suelo no se distinguen. Dado que existe una variación ambiental, la variabilidad en la biodiversidad del suelo estará en respuesta a la variación ambiental. Consecuentemente, los estratos pueden ser útiles para definir puntos de muestro cercanos geográficamente. Las ventanas en la figura 2.2 pueden ser vistas de esta manera. Comparar conlleva la idea de la estratificación a un extremo. Imagine que si dos de los usos de suelo a comparar son bosque y campos de maíz, se puede esperar que la biodiversidad del suelo dependa de muchas variables ambientales, tales como el clima, topografía, y geología. Estas variables ambientales varían típicamente de manera irregular, con sitios cercanamente similares. De esta manera, si seleccionamos parcelas de bosque y maíz que están cercanas, las diferencias entre ellas, principalmente, se deberán al uso de suelo y no, a otros factores, lo que nos
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

71

permite eliminar las variables que “meten ruido” en el análisis. Entonces, el enfoque sería identificar y muestrear, por ejemplo, diez pares de sitios, donde cada par esté formado por parcelas de bosque y maíz cercanas, situadas a cada lado de un lindero de uso de suelo. Formalmente, cada par constituye un estrato de tamaño 2. Más de dos usos de suelo pueden incluirse en el diseño. Las ideas de diseño para experimentos de bloques incompletos son relevantes para seleccionar pares de usos de suelo similares. Controlar la variabilidad mediante la reducción del área de estudio, muchas veces es la mejor solución. El área podría ser reducida, si se reduce el tamaño del sitio de muestreo, reduciendo naturalmente la heterogeneidad, lo que puede ser insatisfactorio porque también reduce la generalidad de los resultados. Si únicamente tomamos muestras en un área pequeña, entonces no existe una base para asumir que se han encontrado patrones ampliamente aplicables. Otras maneras de reducir el ámbito del sitio de estudio son: No incluir todos los usos de suelo encontrados en el área de estudio, sino una selección que cubra un gradiente de intensidades de uso de suelo o que represente alguna transición típica en el uso de suelo. Ajustarse a la definición de una clase de uso de suelo. Por ejemplo, en lugar de tomar un “campo de maíz” como uso de suelo, se podrá limitar la atención a campos de maíz que han sido cultivados continuamente durante los últimos diez años, que no han sido fertilizados en los últimos tres años y que son trabajados con azadón. Evitar tomar muestras en sitios ambiguos, como aquellas que se encuentren cerca de linderos. Mientras esto ayudará a detectar y medir el efecto de la intensidad de uso de suelo en la biodiversidad del suelo, pueden ser inconsistentes con los objetivos del inventario de las especies. Un compromiso entre los dos objetivos puede ser necesario. Esto es común en el diseño de proyectos y, en resumidas cuentas, no se puede esperar encontrar todo en un tamaño limitado de muestra. ESQUEMA DE MEDICIÓN DE PUNTOS Una vez localizados los puntos de muestreo, tiene que ser definido un protocolo de medición, lo que implica la necesidad de un muestreo adicional. El esquema básico
72
Manual de biología de suelos tropicales

de muestreo por puntos adoptado por el CSM-BGBD se presenta en la Figura 2.3, que a la vez se complementa con la Tabla 2.1. Aunque el esquema de medición utilizado para el muestreo de grupos funcionales que son descritos por los procedimientos del proyecto alternativas de roza, tumba y quema (Swift y Bignell, 2001), es diferente de lo que fue propuesto por Swift y Bignell para adecuarse al enfoque basado en la cuadrícula. Por ejemplo, los pocos monolitos en cada punto de muestreo son compensados por el gran número de puntos de muestreo, que resulta en aproximadamente el mismo número de eventos de muestreo. No obstante, los resultados preliminares han indicado que con un pequeño monolito por punto de muestreo no todas las especies pueden ser capturadas. Si éste es el objetivo para llevar a cabo el muestreo, se prevén opciones adicionales para incluir monolitos más grandes. Macrofauna: un solo monolito, trampas de caída (pitfall) y, por lo menos un transecto de 20 m son colocados en cada sitio de muestreo. El muestreo por transectos se amplía para incluir hormigas y escarabajos, en adición a las termitas. En un esquema alternativo adicional los monolitos pueden ser excavados para mejorar el muestreo de lombrices de tierra y se puede introducir un sistema simple para tomar muestras de termitas. Nótese que en las parcelas pequeñas, los sistemas de cultivo pueden estar altamente disecados o los terrenos son difíciles, por lo tanto, no es necesario que el transecto sea lineal. Un transecto puede tener un ángulo de 90 grados, y muestrear parcelas de forma irregular o para evitar arroyos, fuertes pendientes o rocas. Los árboles caídos deben incluirse en el transecto si estos quedan sobre la línea (Swift y Bignell, 2001). Mesofauna: 12 extracciones de suelo tomadas en círculos concéntricos alrededor de un solo monolito a 3 y 6 metros de radio, y extraídas utilizando el método Berlese. Adicionalmente, las trampas pitfalls sin cebo abiertas durante un periodo de 24 horas sirven para colectar mesofauna y macrofauna que viven en la superficie. Las trampas pitfalls generalmente son apropiadas para hormigas, algunos escarabajos, algunos saltamontes, milpiés y arañas. Muestras de suelo extraídas con sacabocado por el método de Berlese contienen colémbolos, ácaros y en sitios húmedos enquitreidos. Microfauna: muestreos con sacabocado de manera similar en 12 extracciones de suelo de dos círculos concéntricos, a 3 y 6 metros de radio del monolito. La “microfauna”, principalmente se refiere a nematodos, aunque también a pequeños ácaros (y larvas de ácaros) extraídos de las muestras de suelo; por el método Berlese pueden cuantificarse.
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

73

Figura 2.3 Esquema de muestreo por puntos para toda la biota. El muestreo se puede ampliar si se usa uno o dos transectos para termitas, hormigas y escarabajos, mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.

Monolito Núcleo de suelo para mesofauna Núcleo de suelo para nemátodos y microbios Muestras para análisis físicoquimicos Transecto 1 m2 para muestra de hojarasca (Winkler) Trampa pitfall

Microsimbiontes y hongos del suelo: muestreos de manera similar mediante 12 extracciones de suelo con sacabocado, puestas en dos círculos concéntricos alrededor de un solo monolito, a 3 y 6 metros de radio. Parámetros físicos y químicos del suelo: cuatro extracciones de suelo con sacabocado puestas en un círculo de 6 metros de radio de un monolito. En el caso de estudios de co-ubicación, una extracción adicional de suelo puede tomarse de la pared exterior de la zanja del monolito (véase Capítulo 3, muestreo de macrofauna). En un esquema alternativo (Figura 2.4) los usos de suelo pueden ser muestreados por una combinación de monolitos principales y subsidiarios, transectos de 50 metros, cuadrantes de hojarasca espaciadas y trampas pitfalls. El muestreo casual alrededor de los transectos puede ser empleado y también trampas Malaise colocadas para capturar insectos voladores mayores. El protocolo difiere de la propuesta anterior, en lo concerniente a los puntos del transecto, cuadros de hojarasca, trampas pitfalls y monolitos subsidiarios colocados en líneas paralelas de 50 m, con una separación lateral de 10 m. Este protocolo debe ser tomado básicamente como una extensión del propuesto anteriormente y se considera aplicable en donde se le dé más importancia al muestreo de todas las especies que existen dentro del área y en los casos donde la frecuencia de muestreo es baja (número de parcelas muestreadas) por las razones explicadas anteriormente. Estas modificaciones
74
Manual de biología de suelos tropicales

resultan más adecuadas cuando se encuentran diferentes usos de suelo en todos los sitios. CONSIDERACIONES PRÁCTICAS EN LA ORGANIZACIÓN DEL TRABAJO DE CAMPO La colecta de muestras o la medición directa en el campo deberían, en la medida de lo posible, realizarse de forma secuencial y durante una sola salida. En el caso de parámetros físicos y químicos del suelo que permanecen estables en el tiempo, el muestreo puede hacerse en un momento diferente. Lo anterior, por supuesto, no se aplica en el caso de características dinámicas del suelo, por ejemplo, el contenido de agua en el suelo.
Figura 2.4 Esquema alternativo para muestrear macrofauna, utilizando un transecto de 50 m.
Extracción Winkler Transecto Mini-monolito

Trampa pitfall Monolito adicional
12 muestras de suelo (12 x 12 x 10 cm)
MS MS MS MS

Monolito principal 10 m

10 m 10 m 5m 50 m
MS MS MS

MS MS

Monolito adicional

MS MS MS

30 cm Hormigas de hojarasca Hormigas endogeas Termitas

2m

D iseño

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

75

Tabla 2.1 Grupos de organismos del suelo colectados utilizando diferentes métodos de captura.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Manual de biología de suelos tropicales
Suelo Mesofauna Descripción X X X X X X X X

76
Trampas pitfall con cebo* - 3 trampas por punto de muestreo. Las trampas se deben quitar después de 48 horas en campo. Transectos semi-cuantitativos 2 x 20 m uno por punto de muestreo, perpendicular a la pendiente Trampas Winkler para muestras pequeñas de hojarasca (1 x 1 m) a lo largo del transecto, 3 Winkler por punto de muestreo Núcleos de suelo con hojarasca (3.5 x 3.5 x 5 cm),12 submuestras por punto de muestreo (profundidad de 0-5 cm). Para mesofauna se hace una muestra compuesta (1er opción), o 4 muestras compuestas por 3 submuestras de cada cuadrante (segundo opción) o 3 muestras compuestas por 4 submuestras. Núcleos de suelo para microbios de 0-20 cm de profundidad sin hojarasca. En círculos a 3 y 6 m, del punto de muestro, una muestra compuesta de 12 submuestras por punto de muestreo.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

Trampa (pitfall)

X

X

X

Transecto

X

X

Trampa Winkler

X

X

X

Embudo de Berlese

X

X

X

Varios

Tabla 2.1 Continúa.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Monolito X

X

X

X

X

X

X

Mesofauna

D iseño
Suelo Descripción Monolito (25 x 25 x 30 cm), incluyendo hojarasca, una muestra por punto método TSBF. Muestra de suelo, una muestra compuesta de suelo por al menos 4 submuestras para análisis físicos y químicos, profundidad 0-10; 10-20; 20-30 cm.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

*Nota.- El cebo sugerido para las trampas pitfall es excremento de monos o de humanos, el cual es muy efectivo para extraer escarabajos coprófagos (Coleoptera) y, al mismo tiempo, no interfiere con la captura de escarabajos saprofíticos (Scarabaeidae, Aphodidae, Trogidae) y predadores (Sistiridae, Staphilinidae). El excremento de omnívoros, resulta más adecuado, en el caso de áreas de selva tropical porque los omnívoros predominan en estos ambientes

77

La colecta de muestras de los principales grupos funcionales de organismos del suelo, requiere de la colaboración de mucha gente en cada punto de muestreo, con el riesgo de lastimar el cultivo en pie, al igual que afectar el inventario, especialmente de aquellos organismos con alta motilidad o sensibles a la intromisión humana. Por ejemplo, las lombrices de tierra epígeas y algunos tipos de termitas comedoras de tierra son sensibles al disturbio, y especialmente a las pisadas, por lo que se alejarían rápidamente. Por lo tanto, es importante reducir el número de personas involucradas en la colecta de las muestras, aunque se necesita un número suficiente de manos para poder manejar y procesar las muestras. Durante el entrenamiento de técnicos y asistentes de campo, es necesario prestar atención a los riesgos que pudieran surgir en cada grupo específico de organismos de suelo. El riesgo de contaminación cuando se trata de microorganismos debe ser entendido y la importancia de utilizar procedimientos adecuados para evitar la contaminación debe ser enfatizada, especialmente en las personas inexpertas. El mismo principio rige cuando existe la posibilidad de que dichos organismos escapen de los sitios de muestreo, como consecuencia de una severa perturbación. Otra preocupación es el gran volumen de suelo que será colectado durante el muestreo y la necesidad de reducir dicho volumen para transportarlo. Desde este punto de vista, la extracción de especímenes de las muestras se hace mejor en, o cerca, del sitio de muestreo. También, en el sitio de muestreo se deben agrupar todas las muestras y extraer sub-muestras para su posterior análisis. El tiempo y la temperatura a la que se almacenan las muestras juegan un papel importante, dado que muchos organismos del suelo pueden morir a temperatura ambiente, en la superficie del suelo, o cuando son guardados en bolsas o contenedores durante unas cuantas horas. Para poder evitar dichos riesgos es importante identificar una instalación local adecuada antes de colectar las muestras o, hacer la extracción inmediata in situ de los especímenes. En algunas ocasiones, por ejemplo, el embudo de Berlese para la mesofauna y de Winkler para la extracción de hormigas y escarabajos de la hojarasca, pueden instalarse en el campo para su uso inmediato; en otros casos, cuando los organismos necesitan ser cultivados in vitro o cuando las propiedades del suelo necesitan ser determinadas, es necesario disponer de un transporte rápido para su traslado hacia el laboratorio. Bajo ninguna circunstancia las muestras deberán permanecer bajo el sol, ni aun cuando el protocolo de extracción requiera de un secado final de la materia. Otros detalles sobre las precauciones a tomar en cuenta y consejos
78
Manual de biología de suelos tropicales

sobre la logística general, se pueden encontrar en los capítulos que tratan grupos y métodos específicos.

MUESTREO EN EL PROYECTO CSM-BGBD
La jerarquía de muestreo
En el proyecto fueron seleccionadas áreas de siete países tropicales, con el propósito de evaluar la pérdida de biodiversidad del suelo con el incremento en la intensidad del uso de suelo. Los sitios se localizaron en las principales regiones biogeográficas de los trópicos, desde la selva tropical húmeda Amazónica hasta la selva montañosa del Himalaya, en la India; áreas que presentan una biodiversidad global importante. Cada sitio incluyó un intervalo de usos de suelo desde selvas prístinas relativamente no perturbadas, hasta tierras agrícolas sometidas a uso intensivo, para determinar tendencias comunes, que puedan ser observadas en el cambio de la biodiversidad del suelo en relación con la intensidad del uso del suelo. El uso de métodos estándares de muestreo en los países y sitios de estudio, permite hacer comparaciones entre los sitios. Se adoptó un enfoque para el muestreo dentro de los sitios que hace uso del muestreo por medio de ventanas. Una ventana es (usualmente un rectángulo) una parcela de tierra que incluye en el estudio varios usos de suelo locales y se consideran “representativos” de los sitios de estudio. Típicamente, las ventanas miden entre 2 y 5 km²; estas ventanas de muestreo varían en tamaño y número debido a la configuración del uso del suelo en cada sitio, y sólo se presentó un caso donde el acceso fue problemático. Por ejemplo, se utiliza una ventana más grande para incluir los usos de suelo relevantes en el área y hasta seis ventanas más pequeñas se distribuyen dentro del área para los diferentes usos de suelo requeridos. Una cuadrícula regular (con espacios variables, véase a continuación) se utiliza para identificar un conjunto de posibles puntos de muestreo dentro de cada ventana; los puntos corresponden a las intersecciones de las líneas en la cuadrícula. El muestreo de cuadrícula se usó por las razones descritas anteriormente, eficiencia estadística y para racionar el trabajo de campo. Además, el inventario es de naturaleza exploratoria, sin tomar en cuenta la hipótesis general formulada, pues quedan pendientes las siguientes preguntas: ¿cuáles de los factores que determinan las prácticas intensivas de uso de suelo influyen en la distribución y riqueza de la biota del suelo? y, ¿a qué escala los patrones de distribución espacial se manifiestan? Este
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

79

enfoque es similar al usado para el proyecto de BioAssess, financiado por la Unión Europea, cuyo objetivo, similar al de éste proyecto, fue evaluar la biodiversidad en función de la intensidad del uso del suelo en paisajes agrícolas (véase Ponge et al., 2003; Federoff et al., 2005). La biodiversidad del suelo se muestrea en el nivel de parcela (punto de muestreo o sitio). La cuadrícula define una serie de parcelas, con un objetivo de cerca de 100 a 200 parcelas por ventana. La parcela es un área de, por lo menos, 25 x 25 m determinada por el área mínima requerida para colectar todas las muestras necesarias y realizar su medición, tal y como se describió anteriormente. El principio de co-ubicación es adoptado para análisis de muestras físicas y químicas del suelo y para los inventarios de la biodiversidad del suelo. Al mismo tiempo las ventanas permiten comparar la biodiversidad del suelo entre los componentes del paisaje.

Localización y definición de las ventanas de muestreo y cuadrícula
La posición de las ventanas dentro del sitio de estudio se hace de tal modo que abarque los diferentes usos de suelo. Generalmente, una ventana no puede abarcar los diferentes usos del suelo, por lo que son necesarias otras ventanas más pequeñas. La Figura 2.5 describe las distintas configuraciones utilizadas. La Figura 2.5a ilustra el uso de una ventana de 9 x 11 puntos de muestreo (además de algunos puntos adicionales de muestreo). La figura 2.5b ilustra el uso de 6, 3 y 2 ventanas separadas. En el caso donde se usan seis ventanas separadas, una ventana medirá 1 km², dependiendo de la distancia entre los puntos de la cuadrícula. En sitios caracterizados por fuertes pendientes se esperaría que el gradiente del uso del suelo esté orientado en la misma dirección, y las ventanas estarán entonces localizadas a lo largo del gradiente (Figura 2.5b). En los linderos de la selva en los trópicos, frecuentemente se observa que el patrón de distribución de usos de suelo refleja un gradiente de intensidad de uso de suelo, con un uso más intensivo a mayor distancia de la selva. En tales casos, las ventanas de muestreo se localizan a lo largo de tal gradiente. Se necesita, por lo tanto, contar con suficientes conocimientos de la región antes de seleccionar los sitios de muestreo. Cuando algunos gradientes no son obvios, la selección de las ventanas deberá cubrir dos o tres de los usos de suelo más importantes y, por tanto, también las transiciones observadas con mayor frecuencia de un tipo a otro tipo de uso de suelo. Por ejemplo, en los márgenes del bosque puede darse la transición de bosque a pastizal, bosque a tierras de cultivo o bosque a grandes plantaciones, en donde
80
Manual de biología de suelos tropicales

b) ilustración de la división de una cuadrícula entre seis. el área ocupada por cada uso de suelo.5 Ejemplos de diferentes configuraciones de ventanas de muestreo. De esta forma. lo que facilitará la selección de las ventanas. Cuando únicamente están disponibles materiales análogos. Mapas detallados de uso de suelo y de vegetación también son adecuados para este propósito. antes que un cambio de uso de suelo per se. Esto permitirá un análisis comparativo de transiciones de uso de suelo (por medidas relativas). Número de parcelas de muestreo y tamaño de la cuadrícula El número total de puntos de muestreo por área de referencia se mantiene fijo entre 100 y 120. Lo anterior se obtiene mediante varias configuraciones de ventana(s) D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 81 . con puntos de muestreo adicionales. mientras minimiza los cambios en la biodiversidad del suelo que surgen de los diferentes usos. a) cuadrícula completa. se hace una selección manual por interpretación visual. Figura 2.una ventana cubre cada transición típica de uso de suelo. utilizando un papel traslúcido sobre la fotografía. dispuestas a lo largo del gradiente. tres y dos ventanas. dentro de una ventana definida puede ser determinada utilizando software de Sistemas de Información Geográfica (SIG) estándar. Cuando se encuentran disponibles mapas digitales de uso de suelo. según se requiera. Para la selección de las ventanas de muestreo se utilizaron fotos aéreas o imágenes de satélite de alta resolución. se introduce un elemento de replicación. variaciones topográficas o climáticas.

Mientras el tamaño de muestra sigue siendo más o menos igual en los transectos y cuadrículas. cada uso de suelo es evaluado en.de muestreo y las dimensiones de las cuadrículas. Por ejemplo. del cual un mínimo de cinco monolitos son cavados para muestrear la macrofauna y cinco muestras conjuntas para los microsimbiontes. por lo menos. De esta manera.. es que únicamente se toma un monolito y una muestra agrupada para los microsimbiontes por parcela. 2003). termitas y hormigas). descritos anteriormente. el diseño 82 Manual de biología de suelos tropicales . El número total de puntos de muestreo concuerda con otras estrategias de muestreo propuestas en ejercicios similares de evaluación de la biodiversidad. Se añaden puntos de muestreo donde el uso de suelo es altamente variable. el número de puntos de muestreo deberá incrementarse de 5 a 8 por transecto (es decir. con un transecto extendido en el caso de algunos grupos (por ejemplo. el proyecto BioAssess (Ponge et al. termitas). 2001) tendrá un esfuerzo de muestreo comparable. Davies et al. más puntos en la misma parcela). en el caso de por lo menos algunos de los grupos funcionales (ej.. otra opción es ensamblar de una manera sinóptica por combinación de transectos a lo largo de diferentes años o en proyectos no relacionados (ej. el esfuerzo de muestreo promedio probablemente varía. 2003) recomienda un número similar de puntos de muestreo. La captura adicional de especies requiere de un esfuerzo de muestreo considerable. La principal diferencia con el enfoque de muestreo de cuadrícula. Los resultados del inventario del proyecto CSM-BGBD indican que es necesario un esfuerzo mínimo de muestreo de 100 a 120 puntos para poder capturar la mayoría de las especies dentro del sitio. en parte por consideraciones logísticas. un transecto de 40 x 5 m. Con 100 a 200 puntos por área de referencia generalmente se llega al punto donde la curva de acumulación de las especies para grupos de macrofauna es asintótica. En este sentido Swift y Bignell (2001) argumentan. 2002. que para incrementar la confiabilidad de los datos del esquema basado en transectos. dando un total de 90 a 105 monolitos muestreados (y el mismo número de muestras agrupadas para evaluar los microsimbiontes) aproximadamente igual al número de puntos en la cuadrícula. En este último. Eggleton et al. y el procedimiento recomendado por el proyecto ASB (Swift y Bignell. suponiendo que existan entre seis y siete usos de suelo distintos por cada área de referencia (correspondientes a seis o siete clases de usos de suelo generalmente definidos en el sistema de clasificación de usos de suelo) donde cada uso de suelo es muestreado por tres transectos. En un muestreo basado en transectos la idea de replicación recomendada por Swift y Bignell (tres transectos por cada uso de suelo) casi nunca se logra..

Dado el alto nivel de variación en las medidas de los componentes de la biodiversidad del suelo. Se le da prioridad al tipo de agricultura de subsistencia a la hora de incrementar el número de muestras porque es precisamente en esta categoría dónde se espera que ocurra una mayor variación debido al manejo. Número de puntos de muestreo por categoría de uso de suelo Con seis o siete tipos de uso de suelo en cada área determinada. en lo que concierne a la evaluación de la diversidad de especies. un promedio alrededor de 15 puntos por clase de cobertura de suelo resultan de muestrear la cuadrícula. 1998). si esta prueba confirma alta variabilidad en la biodiversidad del suelo dentro de las D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 83 . Reducir el número de puntos de muestreo por categoría de uso de suelo mientras se mantiene el número de categorías de uso de uso de suelo investigado puede comprometer el objetivo de obtener resultados estadísticamente verificables. es importante considerar el número mínimo de puntos requeridos para cada categoría de uso de suelo. pero aun así se requiere de una campaña organizada en el campo y de instalaciones establecidas para poder procesar y analizar las muestras. historia.. basándose en otros datos o en un estudio piloto. Se aconseja hacer una prueba piloto para informar el diseño de muestreo. etc. Con menos categorías de uso de suelo presentes. Si la capacidad para procesar y analizar esta cantidad de muestras no está disponible. El número de muestras requeridas por uso de suelo deben ser representativas de la biodiversidad del suelo presente y entonces. normalmente no todas las especies son capturadas y hará más difícil demostrar las diferencias en biodiversidad del suelo entre los tipos de usos de suelo que normalmente se caracterizan por una alta variabilidad en la riqueza de especies. restringir el número de usos de suelo de manera que el esfuerzo total sea compatible con la capacidad de procesamiento. el procedimiento correcto para reducir el número total de puntos de muestreo deberá ser estimado. identificación y catalogación de especímenes son los pasos que requieren mayor tiempo en el proceso (Lawton et al.de muestreo se ajusta a los objetivos del inventario del área de estudio. En números pequeños o en una distribución irregular de puntos de muestreo en los diferentes usos de suelo. el número de puntos por categoría de uso de suelo aumenta. La colecta de muestras rara vez es el paso que limita la evaluación de la biodiversidad porque la extracción. La experiencia del proyecto CSM-BGBD indica que el procesamiento de 100 a 120 muestras es viable con los recursos generalmente disponibles.

Este procedimiento permitirá eliminar los puntos que caigan en tipos de uso de suelo no especificados. se puede partir de una cuadrícula vacía (que únicamente contenga posibles puntos de muestreo). El enfoque de la cuadrícula asume un acceso libre al terreno o parcela donde se localizan los puntos de muestreo. Esto implica adoptar un nivel más alto de detalle en el sistema de clasificación de uso de suelo y. La segunda opción es seleccionar puntos adicionales dentro de las ventanas entre los puntos existentes de la cuadrícula para aquellas categorías de uso de suelo que están siendo muestreadas. de forma separada hasta que se cumpla con el requerimiento del número mínimo de puntos de muestreo. posteriormente. mientras se cumplen los requerimientos para el número mínimo de puntos de muestreo para cada categoría de uso de suelo.6. Para poder seleccionar o eliminar sitios de muestreo (parcelas) es necesario conocer los usos de suelo en cada punto de la cuadrícula y se requiere de un inventario de uso de suelo previo al muestreo de la biodiversidad del suelo. Posteriormente. seleccionar las clases de uso de suelo que cubren un claro gradiente en intensidad de usos de suelo. se define una cuadrícula mayor (resaltando el número de intersecciones). de tal manera que se cumpla el criterio para un mínimo número de puntos de muestreo en cada uno de los tipos de uso de suelo. Adaptación del enfoque de muestreo a condiciones de campo Hay dos estrategias disponibles para asegurar una representación de los usos de suelo y clases de cobertura en el muestreo. se necesita una 84 Manual de biología de suelos tropicales . La definición de un sistema de clasificación de uso de suelo se detalla en el Capítulo 11. Para este propósito. donde la distancia mínima entre puntos necesita ser respetada. De la misma manera. Una estrategia es usar una “cuadrícula estratificada” según lo ilustrado en la Figura 2. Cuando éste no es el caso. de acuerdo con los principios detallados en “Hablando de variabilidad” (arriba). Esta opción se puede observar en la Figura 2. con el propósito de seleccionar aleatoriamente puntos de muestreo para cada categoría de uso de suelo. Aunque la inserción de puntos adicionales es conveniente. se aplica un procedimiento no-sesgado para restar un número de puntos que permitan contrarrestar el incremento en el número total de puntos de muestreo que resulta de ampliar la cuadrícula.categorías de uso de suelo. deberán hacerse algunos intentos para aleatorizar la selección de los puntos originales para ser divididos en dos. Esta estrategia implica incluir ventanas de muestreo irregulares.5a. entonces se hace un ajuste de la definición de clases de uso de suelo.

el acceso a las tierras de los agricultores estuvo restringida. estrategia de muestreo alterna. con D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 85 . En el área determinada en La Amazonia en Brasil. Distancia entre los puntos de muestreo La distribución de los organismos del suelo puede reflejar gradientes.6 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. debido al aislamiento de las comunidades. de una a tres ventanas fueron colocadas en cada comunidad disponible.Figura 2. por ejemplo. colocando una cuadrícula fija dentro de dichas ventanas. Por ejemplo: en un área determinada en México. aquéllos de carbono orgánico y prácticas de cultivo. Los patrones de distribución de los organismos del suelo puede correlacionarse con la topografía. en lugar de utilizar una cuadrícula regular que cubriera un área mayor. En este caso las tierras seleccionadas fueron aquéllas que pertenecían a agricultores que sí permitieron el acceso y se adoptó un patrón específico para muestrear dentro de estas tierras.

Existen varias teorías para explicar la riqueza extremadamente alta de las comunidades del suelo y el bajo grado de especialización en recursos. en la mayoría de los casos. vegetación secundaria muy densa dentro de parcelas barbechadas).los parches de vegetación. Una distancia de 200 m parece aceptable porque permite un área relativamente mayor de muestreo a través de la cuadrícula y es probable que refleje los usos de suelos más dominantes en la muestra. el muestreo en cuadrícula permite examinar patrones espaciales a escalas entre la distancia inter-muestra y el tamaño de la cuadrícula. con gradientes de recursos del suelo. con parcelas muy pequeñas (menos de 0. se debe considerar aumentar la distancia entre los puntos. anidadas en estructuras más grandes. razón por la que no fueron considerados esquemas de muestreo adecuados para llevar a cabo un análisis de la distribución espacial. Ettema y Wardle (2002) mencionan que la biomasa microbiana y los colémbolos son espacialmente dependientes en intervalos de más de 200 m. Por estas razones. atravesar de un punto a otro. 86 Manual de biología de suelos tropicales . En el caso del proyecto de la biodiversidad del suelo. se pueden reducir los espacios en la cuadrícula. la distribución y agrupación de organismos de suelo también son gobernadas por fuerzas intrínsecas de procesos poblacionales tales como dispersión. Sin embargo. a 100 m. con la ubicación de árboles individuales. Al mismo tiempo reduce la dependencia espacial de las observaciones para la mayoría de los principales grupos de organismos del suelo. con muchos grupos diferentes de organismos del suelo estudiados. Por otro lado.5 ha) y donde no es posible atravesar (ej. dependiendo de los organismos implicados. reproducción y competencia (Lavelle y Spain. la investigación de la distribución de patrones específicos no representa un objetivo deseado. En la literatura se pueden encontrar varios ejemplos de la estructura espacial de la biota de suelo sobre distancias de menos de un centímetro hasta de cientos de metros en el campo. También se registra una distribución parchada en una escala miniatura de centímetros a metros. tales como las lombrices de tierra. si las parcelas individuales miden más de dos a cuatro hectáreas. o bien. No obstante. al mismo tiempo permite. en la Amazonia. que las termitas siguen patrones espaciales en un intervalo de hasta 330 m y que la distribución de especies de nematodos muestra tamaños de parches entre 6 a 80 m. 2001). en el caso de paisajes altamente fragmentados. los espacios en la cuadrícula fueron reducidos en el área determinada en Brasil.

Existn un número de factores interrelacionados: bióticos y abióticos (ej. a fin de permitir un análisis completo de los datos para identificar los parámetros que explican la variabilidad en la biodiversidad del suelo. deberían registrarse para la ventana e incluso para el área seleccionada. Es posible que la variabilidad en abundancia y diversidad de organismos del suelo dentro de una categoría de usos de suelo pueda ser mayor que la variabilidad entre categorías de uso de suelo. La historia del sitio. en términos de los factores que determinan la biodiversidad del suelo. la información sobre la precipitación anual. temperatura y humedad media. pH. especialmente en sistemas tan diversos como los representados en los trópicos. Al mismo tiempo. la diversidad del suelo es inventariada independientemente a lo largo de un gradiente de intensidades de usos de suelo para cada área seleccionada. las condiciones bióticas y abióticas. junto con la altitud. asumir que una categoría de uso del suelo está en una escala correcta para acomodar su variación puede ser incorrecto. como parte del proceso del inventario.Inventario de uso del suelo y caracterización del sitio La hipótesis central plantea que la mayor variación en la biodiversidad del suelo está asociada con la diferencia en la intensidad de usos de suelo. C y N total.) que afectan la distribución de organismos del suelo y se asume que las principales categorías de uso de suelo proporcionan una diferencia significativa. textura (la proporción arcilla/arena/limo). días de lluvia. con referencia especial al uso del suelo también es importante de conocer (aunque no siempre se cuenta con este dato). lo indicado será incluir una descripción detallada de uso y cobertura del suelo. así como las características de uso y manejo del suelo pueden variar considerablemente entre regiones. El conjunto básico de las propiedades físicas y químicas del suelo debería incluir densidad aparente. pF (tensión de humedad del suelo). y de las características del suelo. duración de secas y la precipitación acumulada hasta la fecha de muestreo. La definición de clases de uso de suelo resulta importante y se discute en el Capítulo 11 de este manual. cationes D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 87 . Sin embargo. descrita a nivel de las principales categorías de uso de suelo. materia orgánica del suelo) y características de manejo (tipo de labranza. etc. uso de químicos. y debido a que las características completas del sitio no pueden ser obtenidas solamente por la apariencia del uso del suelo. pendiente y aspecto. Por lo tanto. Debido a que se sabe muy poco sobre la importancia relativa de los factores antes mencionados. diversidad de plantas.

la época seca será la más apropiada para muestrear. En los casos de hongos fitopatogénos y hongos ectomicorrízicos.intercambiables. pero inmediatamente adyacentes a la zanja de cada monolito (la zanja exterior probablemente sea el mejor lugar). Al3+ y H+. puesto que de esta manera surge la posibilidad de correlacionar las propiedades del suelo con la presencia o ausencia de un taxa en particular y grupos funcionales (véase Anderson e Ingram. Una descripción de los sitios puede ser completada por el tipo de vegetación. Sin embargo. Para el muestreo de otras variables relacionadas con la caracterización del sitio. ver Anderson e Ingram (1993). Muestras de suelo son tomados de suelos no perturbados. 1993). especies de plantas y la riqueza de géneros. 2005). acumulación y abundancia de hojarasca. cuando el método depende del conteo e identificación de esporas. en la práctica. por esta razón se hace el muestreo al final de la época de lluvias 88 Manual de biología de suelos tropicales . por ejemplo. la actividad de las lombrices de tierra es mayor al final de la época de lluvias (Tondoh y Lavelle. el porcentaje de cubierta vegetal. características como la altura media del dosel. P. Además. por ejemplo. Épocas de muestreo Los organismos del suelo responden a cambios estacionales. dependiendo de los métodos utilizados. los inventarios deberían elaborarse durante la época de lluvias y también en la época de seca. en áreas de bosque. La producción de esporas responde a la fenología de las plantas y. la evolución de las estructuras y ciclos reproductivos (como la formación de esporocarpos) se sincronizan con los cambios estacionales que ocurren dentro del hospedero y son mejor observados durante y hacia finales de la época de lluvias. La diversidad y abundancia de especies de leguminosas son de particular importancia en relación con la presencia de las bacterias formadoras de nódulos en leguminosas. área basal. cobertura dominante/abundancia de flora en el nivel del suelo. en el caso de cultivos anuales las esporas son más abundantes durante la época seca. Idealmente. y los resultados del inventario de la riqueza de especies y abundancia (relativa) mostrarán marcadas diferencias entre las épocas. También. no siempre suele ser factible. CIC. ayudan a elegir sitios a lo largo de un gradiente de diversidad botánica que tiene alguna relación con sus posiciones actuales en las cronosecuencias e intensidades de perturbaciones. El Capítulo 11 proporciona más detalles sobre los requerimientos respecto de usos de suelo específicos. lo que puede ser diferente. Respecto de hongos micorrizógenos arbusculares. debido a la senescencia de las raíces.

vol 105. Boulton. T. Stork. Wallingford.. Ecosystems and Environment.. M. Lo último puede realizarse con el objetivo específico de investigar cambios temporales en la biodiversidad del suelo. London. L. F. Trends in Ecology and Evolution. L. Ecosystems and Environment. 72–76. Vegetatio. Columbia University Press.. C. H. J. P. J.. M. B. y Spain.con la opción de tomar muestras adicionales durante la época de secas. L. Agriculture. Cambridge University Press. y Hernandez. D. E. 847–877. pp.. Lavelle. Hammond. M. indicator taxa and effects of habitat modification in tropical forest’. D. vol 83. Wiley... F. pp. (2002) ‘Termite diversity across an anthropogenic disturbance gradient in the humid forest zone of West Africa’.. Holt... G.. (eds) (1993) Handbook of Sampling Methods for Arthropods in Agriculture. Chapman and Hall/CRC Press. 3rd edition.. pp. B. y Wardle. E. pp. Agriculture. G. REFERENCIAS Anderson. I. y Buntin. (eds) (1998) Ecological Scale: Theory and Applications. S. A. E... y Watt. D. Bignell. A. Eggleton. L. vol 90. D. Kluwer Academic Publishers. D. F.. New York. T.. (2002) ‘Spatial soil ecology’. e Ingram. New York.E. Hodda. Larsen. 195–207. Srivastava. Gregoire. Dordrecht Lawton. F. Federoff. y Madong. CRC. Ponge. CAB International. A. Dibog. (2000) Scientific Method for Ecological Research. S. R. T. vol 30. (2007) Sampling Strategies for Natural Resources and the Environment. Ettema. vol 391. Eggleton. Nature (Lond). N. H. 2nd edition.. Ford.. E. Cambridge. D. Journal of Biogeography. Mawdsley. B. J. D . G.. Fernández-González. Kenkel. P. D. J. (1989) ‘On sampling procedures in population and community ecology’. Peterson. Bignell. 89–202. D.. Hauser. P. (1977) Sampling Techniques. T. R. y Parker. G. Gathorne-Hardy. P. P. L. vol 17.. N. (2003) ‘Evolution of termite functional diversity: Analysis and synthesis of local ecological and regional influences on local species richness’.. Davies. D. A. Dubs. G. y Podani. C. N. J-F. y Lavelle. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 89 . Juhfisz-Nagy. (1998) ‘Biodiversity inventories. Norgrove. Eggleton. T. (2001) Soil Ecology. (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. P. Pedigo. pp177-183. (2005) “Small-scale response of plant species to land-use intensification”. P. New York. V. Bloemers. 283–290. y Valentine. P. S. pp. Jones. Cochran W.

www. ASB-Lecture Note 6B . pp. K. 31–47. (2000) Ecological Methods. Haese. M. pp. J. Indonesia.. vol 9. Ecosystems and Environment. Oxford University Press. Stein.worldagroforestrycentre. (2003) ‘An overview of spatial sampling procedures and experimental design of spatial studies for ecosystem comparison’. P. y Lavelle. (1998) ‘An evaluation of the gradsect biological survey method’. vol 35. Pierce. T. Sousa. J. Wessels. A. Biodiversity Conservation. 200–202. (2002) ‘Extending community ecology to landscapes’. y Bignell. D. E. (2003) ‘Collembolan communities as bioindicators of land use intensity’. Eudrilidae) in Ivory Coast’. S. J. Ecoscience. T. y Lavelle. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta.Ponge. Oxford. Dubs. y Seber. Thompson. 813–826. (eds) (2001) Standard Methods for the Assessment of Soil Biodiversity and Land-use Practice.. A. R. J. A. Agriculture. (1996) Adaptive Sampling. International Centre for Research in Agroforestry. Oxford. M. pp.. F. vol 7.. 90 Manual de biología de suelos tropicales . Urban. y Ettema. Wiley.. D. Journal of Tropical Ecology.. E. S.org/SEA/Publications. Bogor. P. K. Swift. y Oliver. J. y Henderson. P. C. E. S. R. Blackwell Science... E. 3rd edition. M. van. F. S. A. pp. South East Asian Regional Research Programme. Tondoh. Federoff. y Lookingbill. K. 1093–1121. J. vol 21. D. (1990) Statistical Methods in Soil and Land Resource Survey. G. 493–500. P. F. Southwood. A. Goslee. Jaarsveld. Webster. Grimbeek. pp. L. Gillet. New York. y van der Linde. vol 94. Soil Biology & Biochemistry.

Una diversidad de organismos de suelo se incluye en esta categoría (capítulo 1). Otros son trituradores que deshacen la materia orgánica y un buen número de estos grupos son macropredadores. 91 . Reginaldo Constantino. termitas. Souleymane Konaté. Las lombrices de tierra son. Debido a su importante papel en los procesos del ecosistema y a su sensibilidad ante condiciones ambientales. en la creación de macroporos y en la transformación y redistribución de materia orgánica. sin embargo.Capítulo 3 Macrofauna David E. que habitan especialmente en ambientes tropicales. por tanto. Francis-X. indicativos de la biodiversidad de suelo y de los efectos del cambio de uso y prácticas de manejo del mismo. o que tienen una anchura o diámetro de más de 2 mm. el grupo macrofauna incluye aquellos animales del suelo que miden más de un centímetro de largo. Susilo. en ambientes tropicales. Bignell. los grupos de macrofauna frecuentemente son utilizados o propuestos como indicadores de la calidad biológica del suelo. Julio Louzada. hormigas y escarabajos. debido a su biomasa. Jérôme Ebagnerin Tondoh y Ronald Zanetti INTRODUCCIÓN Este capítulo describe los métodos para realizar el inventario de la macrofauna del suelo. Además. como ingenieros del suelo. los invertebrados más importantes en el suelo de regiones templadas. Csaba Csuzdi. predominan las termitas y las hormigas. e influyen de manera notable en las propiedades físicas y químicas de los suelos. Mucha macrofauna desempeña un importante papel en los ecosistemas del suelo. se consideran un componente determinante de la biota del suelo. aunque éste se concentra en los grupos más significativos: lombrices de tierra. probablemente. Agus Karyanto. sobre todo.

y la extracción Winkler es el método más idóneo para la captura y extracción de hormigas de muestras de hojarasca. 2000). el método de transecto es más adecuado para un inventario de termitas. Se entiende que los métodos propuestos son aplicados en ambientes tropicales. En este capítulo se describen métodos propuestos para realizar un inventario de macrofauna. 1993) consolidados y mejorados por Swift y Bignell (2001). al mismo tiempo. que sirvan como indicadores para monitorear el cambio de efecto de uso de suelo. utilizando cualquiera de los métodos enlistados en el capítulo 2. por ende. sin embargo. podrán ser utilizados más ampliamente. en el caso de termitas. se explica que no existe un sólo método para llevar a cabo un inventario de un grupo específico de macrofauna. mientras que las trampas pitfall con cebo son apropiadas para la captura de escarabajos. cuyo énfasis se concentra en un grupo específico de organismos asociados y. los que generalmente se refieren como métodos “TSBF”. No obstante. Éstos están basados en monolitos de suelo y. Como en el caso de otros grupos de biota de suelo. demuestra cómo ha crecido durante los últimos años nuestra percepción de la importancia de estos organismos. y no simplemente tres páginas que fueron impresas en los métodos originales “TSBF”. en cada una de las siguientes secciones que describe un método en particular. por lo tanto. Nuevos esquemas son propuestos en el diseño de monolitos para mejorar el muestreo de lombrices de tierra. en la generalidad de la macrofauna. en un transecto corto (20-40 X 2m) al que ahora han sido añadidas trampas pitfall (principalmente para escarabajos) y otras guías para muestreo casual.generalmente alta. forman un importante componente de la red alimenticia en el suelo. con la extracción de los insectos de los marcos de hojarasca por el método Winkler (Bestelmeyer et al. algunos grupos representativos de macrofauna específica son capturados. Un avance mayor consiste en utilizar el principio de transecto para hormigas y escarabajos. cada uno de los métodos descritos es idóneo para un grupo en particular: los monolitos son especialmente escogidos para el inventario de lombrices de tierra. se requiere de métodos estándares en el muestreo para diversidad. Generalmente. En el capítulo 2. este capítulo se estructura de acuerdo con el método utilizado y no tanto en función del grupo funcional. 92 Manual de biología de suelos tropicales . abundancia y biomasa. tal y como fueron aplicados en el proyecto CSM-BGBD. el punto de partida de desarrollo de los protocolos han sido los procedimientos de Anderson e Ingram (1989. el hecho de que se pueda dedicar un capítulo entero al muestreo de macrofauna. Para poder contar con datos de diversidad y abundancia de lombrices de tierra.

En una variante del método. Este transecto también puede ser utilizado para hormigas y escarabajos. la anchura aproximada del monolito más dos anchuras de zanja. en su mayor parte. véase el capítulo 2. En el caso de la hojarasca. éstos. Monolito TSBF Los procedimientos generales. aislando el monolito como un pilar no perturbado (Figuras 3. junto con monolitos extraídos del suelo. esto se puede hacer de manera sencilla. Su abundancia y biomasa podrán ser calculadas con base en las muestras de 0.INVENTARIO DE MACROARTRÓPODOS DE SUELO. excavados de la zanja y la hojarasca pueden ser colectados. 10-20 cm y 20-30 cm. Se revisa manualmente la hojarasca y cada capa de monolito por separado. La muestra de suelo en botes se debe guardar alejada del sol directo y deberá ser revisada antes de 24 horas. Para la discusión del número y posicionamiento de monolitos. Si no hay mucho tiempo o si la luz es insuficiente (colectar en selva cerrada es difícil porque la luz disminuye muy temprano).1a y 3. hay que meter la muestra en un bote de 19 L y llevarla al laboratorio. Primero se coloca un marco de 25 x 25 cm para marcar la posición del monolito y cualquier hojarasca o madera dentro de él es removida e introducida en una charola (Figura 3. sirve como un buen recipiente para la M acrofauna 93 . es decir. con un reborde. utilizando un machete o parang tomado de forma horizontal y agarrado por ambos lados. Para revisar el suelo es conveniente utilizar la superficie de una mesa grande de campo para llevar a cabo la extracción. HOJARASCA Y LOMBRICES DE TIERRA EN PARTICULAR.50 m². Se aísla el monolito utilizando una pala a unos pocos centímetros fuera del marco y luego se cava una zanja a su alrededor de 25 cm de ancho y 30 cm de profundidad.1b). una charola de plástico grande de cocina.. 2000). son dictados por Anderson e Ingram (1993). con dimensiones de 50 x 50 x 20 cm de profundidad para lombrices de tierra.1c y 3. serán milpiés y lombrices de tierra con bajas densidades de población. aunque es mejor si se muestrea la hojarasca delimitada por marcos dispuestos en una línea paralela. todos los invertebrados mayores de 10cm de largo. con la adición de trampas pitfall (Swift y Bignell. 2001) y las extracciones con trampas Winkler (Bestelmeyer et al. UTILIZANDO MONOLITOS DE SUELO Macroartrópodos de hojarasca y de suelo. de 0-10 cm.1d). Se utiliza un transecto adicional de 20 x 2 m para muestrear las termitas. Se divide el bloque del monolito en tres capas. preferentemente en el lugar y bajo sombra. de manera que puedan trabajar varios asistentes en la misma muestra de suelo o en muestras diferentes. pero que representan una biomasa importante.

Las lombrices de tierra y moluscos. no usar bolígrafo o pluma): • Fecha y clave de identificación del lugar. • En el caso de transectos o monolitos alineados. Para evitar confusión en lugares ricos. en el caso de las termitas. Se añadirá una etiqueta dentro del alcohol o formaldehído. las etiquetas se pueden hacer cuando se ha completado la extracción en cada sección del transecto. termitas y escarabajos colectados. Se diseccionarán los pedacitos de madera en diferentes piezas para ver si hay termitas. en una charola. como en el caso de un transecto. hojarasca. 94 Manual de biología de suelos tropicales .2. deberán preservarse en alcohol al 80%. En otros casos. suelo. suelo de raíz de árbol. el periodo destinado deberá incluir el tiempo para el llenado de la etiqueta. madera seca. las etiquetas deberán escribirse en el momento en que los especímenes sean introducidos en los tubos o frascos. Protocolo de muestreo alternativo para evaluar la abundancia y diversidad de lombrices de tierra en ecosistemas tropicales Introducción Este protocolo alternativo combina el llamado monolito de suelo TSBF (25 x 25 x 30 cm) y tres grandes monolitos (50 x 50 x 20 cm) para evaluar la abundancia y diversidad de lombrices de tierra a nivel local y de paisaje en ecosistemas tropicales. las pequeñas ramas deberán romperse y ser golpeadas en la charola para que se desprenda cualquier insecto que contengan. se conservan en formol (formaldeído) al 4% para evitar la supuración de la mucosa. en la que se anotan los datos siguientes (con lápiz o tinta indeleble. cuando se hace la extracción durante un tiempo determinado.). de 5 mm. El tamiz retiene las hormigas que pueden ser aspiradas. sin embargo. La información es importante para establecer la naturaleza de los organismos encontrados (especialmente la diversidad de grupos funcionales) y para construir una curva de acumulación de especies. madera podrida.3 ó 4). al igual que obreras. pasándolo a través de un tamiz de malla grande. montículo. el número de la sección en el transecto en donde se encontró el espécimen (1. • El microhábitat en cuestión (madera nueva. hormigas o escarabajos. etc. se incluirán soldados. Las hormigas pueden ser extraídas tomando un puñado de suelo. Las hormigas. generalmente. Se deberá utilizar un tubo o frasco por cada especimen o población encontrada (o colonia aparente).revisión.

cinco monolitos por parcela bajo estudio. para ejemplos de América del Sur. Barrios et al. satisface el requerimiento de rapidez y la necesidad de tomar en cuenta la heterogeneidad del suelo a nivel parcela. véase Bhadauria et al.Figura 3. por lo menos. (1994. 2004). 1993) para macroinvertebrados. antes de muestrear el monolito. Por más de una década. un monolito cuadrado de suelo de 25x25 cm y de 30 cm de profundidad.1 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). los monolitos se distribuyen a lo largo de un transecto corto (40 m) con. En todos los casos. (2004). A B C D Nota: las ilustraciones A y B muestran la colocación de un marco de madera para delimitar el monolito y la limpieza de hojarasca suelta. la mayoría de los estudios sobre lombrices de tierra han sido elaborados utilizando el método TSBF (Anderson e Ingram. siendo la unidad de muestreo. Dlamini y Haynes (2004) para el muestreo de lombrices de tierra en África. (2002) y Mathieu et al. Haymes et al. (1995). (2000) para Asia y Decaëns et al. (2003). véase Gilot et al. M acrofauna 95 . La ilustración C muestra un monolito grande (50 x 50 x 30 cm) y la D un monolito pequeño (25 x 25 x 30 cm) y la excavación de la zanja.

cubriendo grandes áreas. cuando se sabe que las lombrices de tierra son más activas (Tondoh y Lavelle. Los monolitos de tamaño medio (50 x 50 x 40 cm) fueron utilizados por Ortiz-Ceballos y Fragoso (2004) para evaluar el impacto de una cobertera en poblaciones de lombrices de tierra. (1999) y Agosti et al. por ejemplo. 1999... Tal avance será crucial para desarrollar indicadores de degradación de suelo (Moreno y Halffter. Este esquema de muestreo estratificado. Se seleccionan cinco puntos de muestreo al azar. el muestreo debería realizarse al final de la temporada de lluvias. el reto será desarrollar un protocolo de muestreo rápido para muestrear a nivel paisaje. 1978). Recientemente. utilizando grandes monolitos de suelo de 1 m² x 40 cm de profundidad. bajo diferentes prácticas de manejo de suelo (Fragoso et al. una combinación más eficiente de 100 x 100 x 40 cm para grandes y de 25 x 25 x 30 cm para monolitos pequeños de suelo. Como las prácticas agrícolas contemporáneas muestran un mosaico de tipos de uso de suelo. 2002). Lavelle. 10-20 cm y 20-30 cm. aunque pocas investigaciones se han enfocado a la evaluación de la abundancia y diversidad de lombrices de tierra en paisajes agrícolas. pero consumen mucho tiempo y resultan tediosos.. Decaëns y Jiménez. (2000). en cada tipo de uso de suelo. 1998) porque las lombrices de tierra son reconocidas por presentar sensibilidad ante la perturbación antropogénica (Fragoso et al. 2002). Burel et al. 2005). aunque pequeños monolitos han sido utilizados con éxito para identificar cambios importantes en la diversidad de lombrices de tierra a nivel parcela. debido a su especificidad de grupo funcional. Vincent. que combina pequeños y grandes monolitos. Decaëns y Jiménez. respectivamente. Fragoso et al. 1997. 2001. Se pueden usar argumentos similares para justificar un muestreo más extensivo de lombrices de tierra. se estudió la demografía de lombrices de tierra. ha sido reportada para monitorear la dinámica de población de la lombriz peregrina Hyperiodrilus africanus (Tondoh y Lavelle. en cada punto de muestreo se extrae un pequeño monolito de 25 x 25 x 30 cm que se rebana en tres capas: 0-10 cm. Las lombrices de tierra son colectadas a mano. la carencia relativa de centros de colonias y su distribución altamente parchada. Originalmente. Protocolo de muestreo De manera ideal.A pesar del éxito relativo del método TSBF para estimar la abundancia y diversidad de los macroinvertebrados del suelo. 2005). han propuesto protocolos de muestreo más exhaustivos para muestrear termitas y hormigas. 1969. permite tomar en cuenta la variación a 96 Manual de biología de suelos tropicales . 1997. Eggleton et al.

De manera adicional. se extraen tres grandes monolitos de 50 x 50 cm y de 20cm de profundidad. Los individuos después son identificados. como en los pequeños monolitos. perpendicular a la pendiente. El transecto aparece representado esquemáticamente en la Figura 3. cuando se considere apropiado (TSBF modificado.3) y son almacenadas en una solución de formol al 4% para su posterior identificación. Cada monolito mayor se separa en dos capas (0-10 y 10-20cm) y no en tres. porque la mayoría de los especímenes (57-99%) son localizados en los primeros 20cm durante la temporada de lluvias (Tondoh y Lavelle. Monolitos adicionales son extraídos para poder tomar en cuenta la heterogeneidad a nivel de la parcela. con un punto de partida elegido al azar.2. 1993).2 Esquema de alineación de monolitos complementarios de lombrices de tierra. Monolitos grandes (50x50x20 cm) Monolito pequeño (25x25x30 cm) nivel parcela de las poblaciones. Anderson e Ingram. las lombrices de tierra son muestreadas. 1993). Las lombrices de tierra se colectan a mano (Figura 3. en intervalos de 5 m. a lo largo de un transecto. contados y pesados. M acrofauna 97 . En cada punto seleccionado. 2005). de acuerdo con el procedimiento de TSBF (Anderson e Ingram.Figura 3. mientras la variación a nivel paisaje se hace con un muestreo en los usos de suelo más representativos.

previamente agrupados como morfoespecies. Identificación de lombrices de tierra y estimaciones de su abundancia Especímenes de lombrices de tierra. 1971. las monografías de Gates (1972). la revisión de Eisen (1900) y estudios seleccionados de varios autores (Righi.Figura 3. sin embargo. por lo tanto. Fragoso y Rojas-Fernández.3 Separación a mano de lombrices de tierra en charolas de plástico. Las especies de lombrices de tierra peregrinas comunes. 2005) son los principales puntos de referencia. Para la identificación de lombrices de tierra de la India y del Sureste de Asia. Desgraciadamente. Sims e Easton (1972). Para las especies africanas de Eudrilidae y Acanthodrilidae (Benhamiinae) se pueden utilizar las revisiones de Sims (1980. Easton (1979) y Julka (1988) son las apropiadas. utilizando las claves desarrolladas por Blakemore (2005). 2001. cuando sea necesario. 1995. pueden ser identificados a nivel de familia. que se encuentran distribuidas en toda la región tropical. no existen a la fecha monografías disponibles para la identificación de lombrices de tierra de América Central y América del Sur. las especies nativas requieren de la pericia específica del país. Zicsi. 1994. 1987) y Csuzdi (1996) y. debido a la carencia de guías comprensivas para su identificación. se debe consultar la descripción original de especies. son identificables a nivel especie utilizando las guías y descripciones dadas por Blakemore (2002). La abundancia de lombrices de tierra se estima 98 Manual de biología de suelos tropicales .

Se pueden utilizar tres categorías de expresión de la riqueza de especies: 1) el número de especies registrado en todos los monolitos. Lavelle 1983. 1977)... Dentro de un ecosistema dado.. Desde el punto de vista ecológico. no pigmentadas y que viven dentro del suelo. El análisis de comunidades de lombrices de tierra. La diversidad de lombrices de tierra se estudia en dos niveles complementarios: diversidad taxonómica y funcional (Bouché. 1977. producen excretas dentro del perfil del suelo y sobre la superficie. Lombrices epígeas: de tamaño pequeño. 1997 y Lavelle et al. a nivel de la superficie del suelo. 2. dos grupos de lombrices de tierra pueden ser distinguidos de acuerdo con su origen: especies nativas o exóticas. con este enfoque. El segundo nivel de diversidad taxonómica trata de la biogeografía de lombrices de tierra (Fragoso et al. regional y continental. introducidas por interferencia humana. Especies nativas son las caracterizadas por una distribución restringida a nivel local. 1983. éstas han sido llamadas peregrinas para indicar su amplia distribución a niveles regionales y continentales (Lee.. La relación nativas vs exóticas puede utilizarse como un índice para calcular la extinción de especies nativas o como un claro indicador de la invasión de especies exóticas o peregrinas. Fragoso et al. se lleva a cabo mediante la identificación en cada tipo de uso de suelo de especies nativas y exóticas o peregrinas. las comunidades de lombrices de tierra pueden dividirse en tres grupos (Bouché.. El primer nivel de diversidad taxonómica trata del número y de la identidad de especies de lombrices de tierra. Lavelle. 1997). Blanchart et al. mientras que las especies exóticas son. 1997.como el número de individuos por m² y la biomasa como g de individuos por m². 1987). 2) la diversidad promedio expresada en términos de la media de número de especies por cada tipo de uso de suelo y 3) el índice ShannonWiener de diversidad (Pielou. El aspecto funcional de la diversidad resulta de gran interés para evaluar la relación entre diversidad y servicios del ecosistema.. La estructura de las comunidades de lombrices de tierra puede ser caracterizada por la densidad y biomasa de lombrices nativas y exóticas La importancia de la diversidad funcional en las lombrices de tierra ha sido ampliamente documentada (Lavelle. 1981): 1. 1997). con pigmentación y que viven en la hojarasca. 1996). 1977. Los servicios que proveen las lombrices de tierra al ecosistema se relacionan con el impacto de su actividad en el sistema de suelo (Lavelle et al. M acrofauna 99 . Como resultado de su actividad. Fragoso et al. Lombrices endógeas: de tamaño medio. en casi todos los casos. en cada tipo de uso de suelo. 1997).

A las lombrices de tierra se les puede asignar una categoría ecológica o grupo funcional y posteriormente comparar dichos grupos con base en su densidad y biomasa. HORMIGAS. Los datos obtenidos son cualitativos (identificación y número de especies) y/o semi-cuantitativos (abundancia relativa de especies y/o grupos funcionales específicos). presentan una alta resolución. fue desarrollado para bosques o localizaciones recientemente derivadas como en la agricultura de roza. aunque se ha acortado a 20 m en el protocolo estándar.. utilizando cinta naranja o amarilla fluorescente o a prueba de agua y un palo de 2 m. para el proyecto CSM-BGBD y a 50 m en el esquema alternativo de muestreo (véase Capítulo 2). cinta métrica de 30 m o preferiblemente cuerda de nylon o mecate. relativamente. tumba y quema. Cada persona lleva un machete o parang afilado. pero comen en la superficie. Sus actividades forman una red densa de túneles dentro del suelo. La mayoría de las lombrices de tierra que pertenecen a los tipos endógeos y anecicos son destacados ingenieros del ecosistema (Lavelle et al. 1997) porque son activas mezclando y cavando el suelo. Lombrices anecicas: de tamaño grande. aunque se considera que. tal y como se describe y desarrolla más adelante. Equipo requerido Brújula. marcada en secciones de 5 m. una 100 Manual de biología de suelos tropicales . MÉTODOS DE TRANSECTO PARA TERMITAS. sin pigmentación y viven en el suelo. ESCARABAJOS Y LOMBRICES de tierra Introducción Este método utiliza un transecto de 100. se basa en un transecto de 100 m. y sigue las descripciones formales de Jones e Eggleton (2000).3. 50 o 20 x 2m. Swift y Bignell (2001). Este método se considera de bajo impacto y resulta idóneo para ser usado por aquellos que no son especialistas en termitas y puede ser completado en cada punto de muestreo por dos personas en un día (dos días para un transecto de 100 m). El método. modificando así las propiedades hídricas y químicas del mismo. por lo que los transectos se tratan separados de los monolitos y de las trampas pitfall.

alrededor de 40 frasquitos de aproximadamente 1 x 5 cm. de manera simultánea. Si la línea atraviesa un árbol. evitando grandes arroyos. un cuchillo de campo de hoja fija. Las líneas de transecto no necesariamente tienen que ser rectas. El muestreo se estratifica por M acrofauna 101 . cuando se trata de decidir sobre la línea ideal. sin embargo. Un equipo de dos personas será capaz de muestrear entre 8 y 12 secciones por día (2 a 3 transectos). el transecto puede incorporar otros fenómenos naturales del ambiente biótico que contribuyen a su heterogeneidad física. una charola de plástico o metal con reborde alto.cuchara de albañil. En una parcela pequeña. tales como pendientes. siempre que por lo menos una parte del sistema de raíces quede dentro de la cinta de muestra de dos metros de ancho. acantilados o caminos en uso que no sean hábitats adecuados para termitas. dos pares de pinzas. de alrededor de 8-10 cm. El tiempo requerido para realizar transectos de 20 m es de 30 minutos de muestreo por dos personas. Si se emplean otros transectos en la misma parcela (por ejemplo. en cada sección de 5m. para poder replicar un monolito) los transectos deberán posicionarse para evitar interferencia mutua y separarse. a una distancia suficiente para evitar cualquier perturbación durante el muestreo. con alcohol al 80% (se necesitarán más para hábitats ricos en termitas). Frecuentemente se necesita evaluar. por lo menos. siempre que no se crucen con ellas mismas. puede ser útil para picar madera o suelo. de área basal muy grande. ese tiempo podrá reducirse si se trabaja con varios equipos de dos personas. un transecto puede curvarse sucesivamente por dos ángulos de 90° para que corra hacia atrás hasta su punto de partida. para evitar pisadas excesivas en un solo lugar. dirección del transecto con la brújula y cualquier cambio de dirección. No obstante. estrechas zanjas con arroyos o cortes en el dosel. Se debe asegurar que las líneas de pitfall se mantengan sin perturbación en todo momento. Alternativamente. Se coloca el transecto de manera que visualmente atraviese los alrededores de manera homogénea. se pueden colocar dos transectos de 50m (o de 10 m) para que queden en paralelo. Es necesario anotar el punto de partida. de modo subjetivo. a 15m de distancia. 50 o 100 m junto al monolito. el transecto se puede desviar hacia un lado. para evitar obstáculos naturales. Procedimiento Se traza una línea de transecto de 20. pero los dos “brazos” principales de la línea del transecto deberán encontrarse. pueden inclinarse para alcanzar ángulos de hasta 90°. especialmente en los casos de pequeñas parcelas. en diferentes secciones.

4). El tronco de un árbol vivo puede ser investigado para ver si contiene túneles de termitas a una altura accesible. sin olvidarse de las ramificaciones o de los helechos que pueden acumular suelo que contenga termitas. sin necesidad de usar una escalera o tener que trepar (alrededor de 2 m). junto con sus cámaras centrales. Es imposible muestrear con lluvia fuerte. nidos subterráneos epígeos y arbóreos y montículos de una altura de hasta 2 m sobre la superficie del suelo (incluyendo nidos de bolsitas suspendidos en la vegetación). de 50 ó 100 m. Idealmente. otros invertebrados. o cubierta de pedazos de suelo. incorporada en el suelo de superficie. El suelo. En la mayoría de las localizaciones no es necesario colectar cada termita y las especies más comunes podrán ser ignoradas después de muestrearse inicialmente para poder buscar las formas más raras o crípticas o para buscar soldados en especies que tengan una relación relativamente baja de soldado/obrero (tomando en cuenta que algunas especies no tienen soldados). por lo tanto. esto ayuda mucho a ver las termitas (Figura 3. frecuentemente contiene termitas. es aconsejable comprobar la periferia y la base de la estructura. por ello se permite interrumpir la labor 102 Manual de biología de suelos tropicales . se recomienda completar no más de 12 secciones en un día. Los palitos deberán romperse en pedazos y golpearse moderadamente en las charolas para desplazar cualquier termita u hormiga que contengan. Los pedazos más grandes de madera deberán cortarse tomando en cuenta que pueden estar infectados en alguna parte.nichos. nidos de termitas o pistas de tierra en troncos de árboles y otra vegetación. Los siguientes micronichos son investigados con detalle: hojarasca y la superficie del suelo hasta una profundidad de alrededor de 5 cm. acumulaciones profundas de hojarasca y suelo entre grandes raíces que funcionan como retenedores. la hojarasca y los restos de madera pueden diseccionarse rápidamente en charolas. escarabajos y lombrices de tierra en nichos crípticos o cuando escasea la luz. La madera podrida. Otras especies pueden habitar montículos y nidos o podrán coexistir con los que están construyéndolos. Los colectores deberán trabajar de manera constante (no frenética) en cada uno de los periodos de muestra de 30 minutos y tratar de mantener el mismo nivel de eficiencia de muestreo en cada sección del transecto. un transecto de entrenamiento. debería muestrearse la primera vez bajo la supervisión de un colector experimentado. madera en todas sus etapas de descomposición. por esta razón y para poder minimizar la necesidad de tener que trabajar con escasa luz. posiblemente. lombrices de tierra y. Normalmente se requiere de un corto periodo de entrenamiento u orientación para que colectores sin experiencia puedan muestrear con la misma eficiencia que un experto. También resulta de ayuda descansar unos minutos entre secciones.

Esto dependerá de la naturaleza del lugar y de la topografía.4 Extracción de termitas de una muestra de suelo en una charola de aluminio. por ejemplo. para dividir cada sección en dos subsecciones de 2. es importante observar el protocolo de muestreo con precisión. Procesamiento de especímenes Los especímenes representativos de las termitas encontradas deberán ser preservadas en alcohol al 80% y. Se recomienda que el suelo se extraiga en. hasta que mejoren las condiciones climatológicas. se puede usar un pincel de artista humedecido con alcohol para depositar el espécimen en el frasco colector. de manera que mientras uno muestrea la madera.5 x 2 m.Figura 3. previo acuerdo. En los transectos donde se encuentran pocas termitas. sin dañarlos. en lo posible. en el M acrofauna 103 . una docena de lugares separados en cada sección del transecto. Alternativamente. sin interrumpir el trabajo. sección a sección. cada persona trabaja en una cinta de un metro de ancho. Nota: las pinzas finas son idóneas para atrapar insectos con cuidado. el otro examina el suelo y las raíces de los árboles. contener soldados y obreros. Se debe destinar un tubo de especímenes para cada población (o colonia aparente). en lados opuestos de la línea. a pesar de que se trate de una pequeña cosecha. por lo menos. El trabajo puede dividirse entre los colectores.

se deberán escribir las etiquetas (o las notas de campo) tan pronto como se hayan colocado las termitas en los tubos de especímenes. todas las etiquetas seguirán el mismo patrón. madera podrida. suelo a raíz de árbol). etc. reduciendo así las posibilidades de cometer errores en la numeración. En otros lados. para los taxónomos expertos. como una muestra independiente. se podrán escribir etiquetas o notas. • Número de sección en el transecto donde se encontró el espécimen (1. los números de las etiquetas estarán relacionados. utilizando una impresora láser. Se generan diez secuencias al azar de las secciones por 104 Manual de biología de suelos tropicales . en orden secuencial. los siguientes datos: • Fecha y clave del transecto. donde se anotan. sin embargo. montículo. se podrán imprimir etiquetas numeradas. Los especímenes pueden resultar dañados o afectados en su color por el suelo o basura contenido en el frasquito. Para evitar la confusión. se añade alcohol fresco y se escriben las etiquetas nuevas). en el campo únicamente se añaden las etiquetas a los frasquitos y se toma nota en la libreta de campo de los números por sección y del transecto. Las termitas deberán separarse en unidades taxonómicas reconocidas. madera seca. por morfoespecies o especies nombradas. los treinta minutos para el trabajo deberían incluir el etiquetado. por lo tanto. suelo. Alternativamente. hojarasca. La información referente al micronicho en donde se encuentra cada espécimen es importante para poder establecer la naturaleza de la comunidad de termitas (especialmente la diversidad funcional del grupo) y para construir una curva de acumulación de especies. Al tratar cada sección de 5 m. se podrá construir una curva de acumulación por especies basada en especímenes o simplemente por especies.). Todas las notas de campo se guardan en la libreta y. lo que facilitará el trabajo. Lo anterior hace que el procesamiento sea más eficiente. con pluma o bolígrafo. que se cortarán y pegarán en una libreta de campo. 3. al completar cada sección del transecto. razón por la cual deben limpiarse lo antes posible (se separan las termitas del suelo o de la hojarasca. 2.cual se introducirá una etiqueta. en lugares ricos en termitas. con lápiz o tinta indeleble y no. por lo que se podrán leer con mayor facilidad. • El micro hábitat en cuestión (madera fresca. el mismo día en que son colectados o tan pronto como sea posible. razón para destinar un mínimo de dos días a cada transecto de 100 m (proporcional para transectos más cortos).

Una manera más realista sería obtener la lista final. lo que resulta muy laborioso en términos de tiempo. 2004). Las especies y morfoespecies encontradas por transecto pueden ser desde sólo unas cuantas hasta más de 50. se calcula la media acumulativa de especies de los diez juegos de 20 secciones para cada sección y se construye una curva de acumulación de especies. La colección entera deberá ser preservada durante un tiempo después de la identificación para su posterior confirmación y se debe de depositar.medio de un trazo (en cada secuencia) de 20 secciones al azar. en el lugar 1. o bien. en el lugar 2. sean las mismas que “A”. tales como Jackknife de primer orden y Jackknife de segundo orden. parcialmente compuesta por especies identificadas y. el resto. Una taxonomía pobre podría resultar en una baja o sobreestimación de diversidad y similitud de especies y hacernos llegar a establecer conclusiones erróneas. normalmente requiere una pericia taxonómica alta. pero esto muchas veces no es posible para algunos grupos de organismos de suelo. dependiendo del lugar y de la región biogeográfica. entre otros (Magurran. 2000. género y especie. El número de especies encontradas en cada sección se usa para calcular el número acumulativo de especies. a nivel especie. indicando que se encontrarían pocas o nuevas especies con transectos adicionales en el área. es decir. es importante utilizar el mismo esfuerzo de identificación y métodos. M acrofauna 105 . trabajando desde niveles altos como órdenes hasta familia. 2004) que son implementados por el software libre EstimateS (Colwell. de manera permanente. La riqueza específica del lugar puede ser estimada utilizando métodos de extrapolación. será identificar cuáles son las que están presentes en la muestra. en un museo. Cuando se comparan datos de diferentes hábitats o localidades. La identificación de organismos de suelo. debería subir y posteriormente inclinarse. sin reemplazo. Identificación El primer paso para compilar una lista de especies y organizar los datos del ensamble de las especies encontradas. se identificaría a nivel género y. finalmente. para cada selección de las diez secuencias. la identificación consiste en la determinación de la posición de un espécimen en la clasificación existente. un subjuego en una colección de una institución nacional. Chao y ACE. se separaran en morfoespecies. Las muestras y los especímenes necesitan ser etiquetados y organizados cuidadosamente. Una curva ideal debería ser asintótica. También es importante que las morfoespecies “A”. Lo ideal sería que todos los especímenes fueran identificados hasta especie.

1999). excluyendo animales.Los métodos comunes de identificación de la fauna del suelo incluyen: a) uso de claves de identificación publicadas. lo cual generalmente resulta más práctico que un “orden taxonómico” subjetivo. será el Código Internacional de Nomenclatura Zoológica (Comisión Internacional de Nomenclatura Zoológica. fueron identificadas plenamente a nivel especie. por lo tanto. El formato de los nombres deberá seguir el código respectivo de nomenclatura. Se utilizan. En el caso de animales. Consulta un catálogo taxonómico que te permita comprobar la validez y cómo se deletrean los nombres. Los paréntesis. Se muestran tres niveles de identificación. La abreviación “cf” en el caso de Coatitermes y Armitermes. hormigas y escarabajos en el apéndice 1 y listas más especializadas en las publicaciones 106 Manual de biología de suelos tropicales . si existen. para grupos de organismos diversos o poco conocidos. que deberán ser respetadas: los géneros y especies se imprimen en cursiva. compare). (abreviación del latín confer. se utilizan con la misma connotación o de manera similar. Termes sp. Se trata de una lista organizada en orden alfabético. a modo de rutina. b) comparaciones con descripciones. nunca se deben utilizar nombres manuscritos no publicados. Tal abreviación se usa para indicar que la identificación es incierta. Nota que las abreviaciones “sp” y “cf” no aparecen en cursivas. similis. El dato de autor y año de publicación no forma parte de un nombre de especies y su uso es opcional. La Tabla 3. el Código Internacional de Nomenclatura Botánica (Greuter et al. ocasionalmente.1 presenta un ejemplo de una lista de especies. 1992). N. el Código Internacional de Nomenclatura de Bacterias (Sneath. Lista de guías y catálogo de identificación Se puede consultar una lista integrada de claves de identificación para termitas. tienen un significado y su uso se determina de acuerdo con las reglas de nomenclatura. A y Termes sp. de manera particular. y para bacterias. los Códigos de Nomenclatura contemplan reglas muy estrictas de formato para nombrar autores. por ejemplo. El paréntesis que abarca el nombre de los autores indica que la especie fue originalmente descrita en otro género y después se transfirió al género actual. B fueron identificadas únicamente a nivel género y morfoespecie. técnicas moleculares para la identificación de microorganismos. 2000). aunque frecuentemente se recomienda. para plantas. c) comparaciones con colecciones de referencia y d) envío de especímenes a un experto taxónomo. corniger y N. Otras abreviaciones. No obstante. pero no es obligatorio.

7 Angularitermes sp. 4 Angularitermes sp. 11 Angularitermes sp. 6 Angularitermes sp. 5 Angularitermes sp. 16 Angularitermes sp. 12 Angularitermes sp. No. 2 Angularitermes sp. Angularitermes sp. peruanus Caetetermes taquarussu Constrictotermes cavifrons M acrofauna 107 . Especie Selva Barbecho Cultivo Agroforestal Pastizales 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Kalotermitidae Angularitermes nasutissimus Angularitermes sp. 1 Angularitermes sp. 8 Angularitermes sp. 14 Angularitermes sp.1 Ejemplo de lista de especies.Tabla 3. 18 Angularitermes sp. 15 Angularitermes sp. 9 Angularitermes sp. 17 Angularitermes sp. 19 Araujotermes nanus Armitermes holmgreni Armitermes minutus Armitermes teevani Atlantitermes osborni 1 1 1 13 9 13 46 2 2 1 15 7 1 1 1 1 1 2 2 6 1 7 3 4 1 3 1 2 1 1 5 1 1 1 1 1 4 14 1 6 1 6 25 8 1 1 2 19 20 3 1 9 4 10 71 47 3 10 1 2 16 7 1 3 Armitermes cf. 13 Angularitermes sp. 3 Angularitermes sp. 10 Angularitermes sp.

1 Continúa. A Nasutitermes sp. J Nasutitermes surinamensis Nasutitermes unduliceps 1 Nasutitermes wheeleri Neocapritermes pumilis Neocapritermes sp. No. Neocapritermes talpa 1 2 6 1 1 1 108 Manual de biología de suelos tropicales .Tabla 3. Curvitermes odontognathus Cylindrotermes flangiatus Cylindrotermes parvignathus Embiratermes parvirostris Heterotermes tenuis Labiotermes psilus Microcerotermes strunckii Nasutitermes callimorphus Nasutitermes corniger Nasutitermes gaigei Nasutitermes guayanae Nasutitermes octopilis Nasutitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 Coptotermes testaceus Cornicapritermes mucronatus Cornitermes pugnax Cornitermes sp. I 5 1 10 9 10 1 22 4 1 1 1 3 85 1 6 29 1 35 6 1 89 4 2 8 3 2 7 4 1 10 7 1 18 2 2 3 15 1 12 17 21 1 56 29 6 2 11 1 9 1 5 29 1 1 2 16 1 1 1 37 19 1 Nasutitermes sp.

8 72. 3 Subulitermes baileyi Subulitermes microsoma Syntermes molestus Syntermes spinosus Syntermes territus Termes hispaniolae Termes medioculatus Triangularitermes sp.4 M acrofauna 109 .96 34.8 203 18 13 2. Especie Selva Barbecho Cultivo Agroforestal Pastizales 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Neocapritermes taracua Neocapritermes villosus Obtusitermes sp.81 14. Planicapritermes planiceps Rhinotermes hispidus Rhinotermes marginalis Rotunditermes bragantinus Rugitermes sp.4 3 2 1 229 35 18 2. 1 Ruptitermes sp.01 .1 Continúa. 3 Triangularitermes triangulariceps Velocitermes sp.3 52. 2 Ruptitermes sp.80 14.04 .3 17.80 .90 26.1 25. No.91 . Ruptitermes sp.3 50.41 0.7 Estimación de Jackknife 1 74.4 1 5 2 2 1 3 8 7 471 50 39 2.1 3 119 15 10 2.Tabla 3.2 18.90 25.6 81.6 4 Muestras Especies Transectos Índice Shannon(H) Índice Simpson Rarefacción (100 muestras) Estimación de Chao 86. 1 6 8 1 1 1 2 1 1 1 2 3 9 3 6 5 1 1 5 1 1 1 9 9 259 52 20 3.3 25.

antes de tomar las muestras. cuentan con sus propios manuales.taxonómicas para termitas. al final del presente capítulo. será el entrenamiento o bien que el procesamiento de especímenes esté a cargo de un taxónomo con experiencia. por lo tanto. desde muestreo en campo hasta identificación y análisis de datos. Invariablemente. varían entre el taxa y entre regiones. junto con su calidad. pues dichos ensambles son delimitados por una clasificación taxonómica basada en historia y filogenia y no. pero este término no es correcto. Una de las principales propiedades de un ensamble es “la diversidad de especies”. Lo más importante es la diversidad funcional del grupo. La caracterización de un ensamble de especies involucra varios pasos. Las termitas pueden colocarse dentro de las siguientes categorías tróficas: • Las que se alimentan del suelo. Existe también una “literatura gris” extensiva de reportes de talleres. la disponibilidad de claves adecuadas publicadas. en relaciones ecológicas actuales. Interpretación de resultados Los ensambles de especies son grupos de especies relacionadas taxonómicamente. Aunque la información básica generada es la de riqueza especifica. formar un grupo funcional (GF) uniforme y su composición también puede verse afectada por los métodos de muestreo utilizados. con un grado de selección de limos y fracciones de ar110 Manual de biología de suelos tropicales . Los ensambles pueden o no. por ende. por lo que muchos museos o instituciones científicas dedicadas a la taxonomía y conservación de la biodiversidad. Los ensambles de diferentes hábitats o localidades pueden compararse con varias estimaciones o índices y agruparse de acuerdo con sus similitudes. aparentemente. Casi siempre la muestra no contiene todas las especies presentes en el hábitat. Algunas veces se refieren a “comunidades de especies”. conferencias y documentos producidos por proyectos de desarrollo internacional sin una distribución global. esto se obtiene como resultado de la anotación del número de especies y morfoespecies. los cuales no están disponibles para el público en general. otra información puede ser obtenida del transecto. de un hábitat o área geográfica específica. la cual se puede definir y estimar por varios métodos. en los apéndices 2 y 3. es necesario extrapolar de la muestra y utilizar estimaciones comparables de la diversidad local. que se centran en una sola región. Las termitas distribuidas en el perfil de suelo. pueden consultarse en la lista de literatura. El mejor enfoque para identificación. Si los detalles bibliográficos no están incluidos en la tabla. la capa de hojarasca orgánica y/o montículos epigeos se alimentan del suelo mineral.

pero que se alimentan en otro lado y muchas Macrotermitinae que cultivan jardines de hongos. Este tipo de termita forrajera usualmente es más conspicua que otros tipos alimenticios. o mezclada con hojas podridas en complejos de limo . Las que se alimentan de madera. subterráneos o epígeos. quedan proporciones más altas de materia orgánica del suelo y sílica. Las que se alimentan del suelo y de madera. Ruptitermes y otras especies de Constrictotermes en América del sur que se M acrofauna 111 .• • • • cilla. Las termitas que buscan hojas muertas. 1996). pastos vivos o secos y pequeños pedazos de madera. Las que forrajean la hojarasca (Termitas forrajeras). o bien. El término “madera” incluye ramas muertas. Este grupo es sinónimo de “alimentadores medios” sensu DeSouza y Brown (1994). reconocida por Collins (1989). todos menos los que se encuentran en una fase de descomposición terminal. Las termitas que se alimentan de madera y que cavan túneles en piezas más grandes de madera. normalmente compuestas por obreros y soldados forrajeros. Aunque el material digerido es altamente heterogéneo. Hospitalitermes hospitalis en el sureste de Asia. Este grupo incluye termitas con nidos arbóreos. hojarasca y superficie del suelo y porque hace agujeros que se abren en la superficie. que pueden volverse centros de colonias. Las termitas que se alimentan de madera muy podrida. debajo de troncos o en suelo adherido a la superficie de troncos en estado de putrefacción. provenientes de pasajes subterráneos o la formación de columnas descubiertas de individuos. pero no en la misma categoría de “alimentadores de madera podrida”. incluye especies que se alimentan de hongos. todavía unidas del árbol viviente y árboles muertos en pie.. junto con por lo menos una termita inferior del sur de África Hodotermes mossambicus con un hábito similar. Esta categoría sigue la lista de alimentación de termitas de acuerdo con Wood (1978). algas. Este grupo incluye algunos Macrotermitinae subterráneos y constructoras de montículos y otras Nasutiterminitinae y algunas otras que se alimentan en la superficie del suelo. normalmente cortan el material antes de consumirlo o lo llevan a sus nidos. al igual que otros que se han caído y se conservan aún frescos. la cual se ha vuelto fácilmente desmenuzable y que se asemejan al mismo suelo o que predominan dentro del suelo.raíces. briofitas y líquenes en la corteza de los árboles (por ejemplo. Las termitas de alimentación especializada o incidental. y menos tejidos de plantas reconocibles que en otros grupos (Sleaford et al. por razones de las numerosas galerías o placas de suelo que construye encima de la madera.

). y suelo y madera) como las definidas arriba. La identificación del grupo funcional puede hacerse de acuerdo con el color abdominal en especímenes vivos (las alimentadas de suelo y suelomadera son más oscuras). Si se dificulta la selección de un grupo funcional.alimentan de líquenes). otros aspectos biológicos como el lugar donde anidan (las que anidan en árboles normalmente no se alimentan de suelo). • Las que anidan de manera hipogea. de manera similar. la ausencia de soldados (generalmente indica las que se alimentan del suelo) y la afiliación taxonómica (por ejemplo. una aproximación útil se obtiene dividiendo las especies en “alimentadas de suelo” o geófagas (alimentadas de suelo. incrementa las proporciones de otros grupos funcionales. y “las que no se alimentan de suelo” (todas las demás). las que se alimentan de excrementos o las carroñeras de cuerpos de vertebrados (probablemente consumidos oportunamente. aunque el excremento se puede considerar como forma de basura descompuesta) y también ciertas habitantes secundarias de montículos de termitas que se alimentan de los forros hechos de rica materia orgánica. encontrada en las cámaras interiores como inquilinas obligadas (Por ejemplo: Ahamitermis y Incolitermis. Los centros son pocos definidos y amorfos (especialmente en 112 Manual de biología de suelos tropicales . Ophiotermes y Tuberculitermes. que habitan dentro de los nidos de Constrictotermes). Inquilinitermes. pero la perturbación o un periodo de secas. Las termitas cuyos centros de colonia normalmente se concentran en troncos muertos o árboles en pie.Gay y Calaby. según las siguientes categorías: • Las que anidan en madera. en Australia. suelo. 1970. Algunas termitas también se alimentan de tejido de planta viva. Algunas veces la madera muerta es gradualmente reemplazada por material acartonado o por panales de hongos. el lugar de su descubrimiento (en madera. Termitas cuyos centros de colonia quedan bajo el suelo. especialmente bajo condiciones desfavorables. La forma de distribución de dichas categorías indica la estructura de la comunidad de termitas. en África oeste y central. generalmente. 1997. las Macrotermitinae no se alimentan del suelo. es posible comparar ensambles de termitas en base a tipos de nidos. la mayoría de la Apicotermitinae se alimentan de suelo o de suelo y madera). Las categorías no son mutuamente excluyentes y muchas especies toman sus alimentos de por lo menos dos fuentes diferentes. etc. aunque ninguna especie es realmente fitófaga. Eggleton y Bignell. las comunidades de selva son frecuentemente dominadas por las que se alimentan de suelo.

Termitas cuyos centros de colonia se sitúan arriba del suelo. con estructura interna poco obvia. Figura 3. • Montículos arbóreos. pero excluyen montículos arbóreos. Nidos que se sujetan a árboles y que se localizan en diferentes alturas. adiciones y ocupación por parte de habitantes secundarios. Este grupo incluye especies que son habitantes secundarias facultativas de montículos epigeos. Estos montículos. aunque algunas forman nidos subterráneos complejos (por ejemplo Marcotermitinae).los Apicoterminotenae que no tienen soldados). pero con una tendencia a volverse más irregulares con el paso del tiempo por razones de erosión. hechas de acuerdo con especificaciones típicas de la especie. que se forman por sí solos o que se asocian con los contrafuertes de los árboles. usualmente construidos con material de apariencia acartonada (cartón). En la mayoría de los casos.5 Ejemplo de curva de acumulación de especies con una desviación estándar. M acrofauna 113 . • Montículos epigeos. utilizando permutaciones de datos al azar. estos nidos están conectados con el suelo mediante pistas cubiertas que pueden ayudar a distinguir algunos nidos de termitas arbóreas de los de hormigas. normalmente están bien definidos y constituyen estructuras altamente complejas.

en la secuencia en que fueron anotadas en el campo. mediante la prueba Fisher. en relación con el número de unidades de muestreo. tiempo (o persona por tiempo). Las curvas de acumulación de especies pueden ser obtenidas reiterativamente mediante remuestreo al azar de los monolitos de suelo o por secciones de transectos.Curvas de acumulación de especies Las curvas de acumulación de especies son gráficas que representan la relación entre el esfuerzo de muestreo y el descubrimiento de las especies en un hábitat o región. Aunque algunos autores consideran estos nombres como sinónimos. HORMIGAS. El esfuerzo de muestreo puede ser medido por espécimen. tienen diferentes sig114 Manual de biología de suelos tropicales . tales como el de componentes principales (PCA). Los análisis de multivariados. la curva es asintótica y tiende a inclinarse.. Otro método será normalizar la densidad y la biomasa de las lombrices de tierra antes de llevar a cabo el análisis paramétrico de varianza (ANOVA). trampa. en el caso de lombrices de tierra. La prueba Kruskal-Wallis ANOVA puede utilizarse para probar si existe un efecto significativo de los tipos de uso de suelo en relación con la abundancia de lombrices de tierra. el de correspondencia (AC) y el de co-inercia pueden ser útiles para determinar factores que afectan la densidad y la diversidad de lombrices de tierra. La relación entre abundancia de lombrices de tierra y el índice de uso de suelo se comprueba utilizando regresiones. se pueden obtener utilizando permutaciones (reiteraciones) de los datos al azar (Figura 3. número de especies y. se establece la comparación de la media del índice Shannon-Wiener. con desviaciones estándar. 1997). 2000).0b1 (Colwell. o área. UTILIZANDO EL MÉTODO WINKLER Introducción Las hormigas pueden clasificarse en grupos funcionales o gremios. Para más análisis estadísticos. muestra. utilizando el software de EstimateS versión 6.5) u otros métodos que normalmente requieren de programas computacionales especializados. OTRA MACROFAUNA Y MESOFAUNA EN HOJARASCA. con un 5% de nivel de probabilidad. En el caso de un esfuerzo de colecta grande. Las curvas más sofisticadas. producción de excretas por cada tipo de uso de suelo. hasta 500 veces. en todos los paisajes agrícolas (Thioulouse et al. es únicamente una gráfica del número de especies acumuladas. La forma más simple de estas curvas es conocida como la curva del colector.

Bothroponera y Odontomachus).. Crematogaster y Pheidole. de modo que minimizan el contacto con otras hormigas que no ocupan este hábitat (Brachyponera spp. mientras que los grupos funcionales se refieren a especies que utilizan estrategias similares para explotar el recurso y pueden estar formados por más de un gremio. 1986). • Especies especialistas en clima y suelo: estas especies (Melophorus spp.nificados: los gremios son un grupo de especies que utiliza el mismo tipo de recurso para su supervivencia (Terborgh y Robinson. las pertenecientes al género Camponotus.. debido al tamaño relativamente grande de su cuerpo y a su comportamiento sumiso.. • Especies crípticas: especies de hormigas forrajeras que normalmente anidan bajo el suelo (en la capa de suelo y hojarasca).. se recomienda utilizar el de Andersen (1997). • Especies forrajeras solitarias de tamaño relativamente grande: predadoras solitarias que manifiestan muy poca interacción con otras especies de hormigas (especies dentro de los géneros Myrmecia. morfológicas y de comportamiento que reducen su interacción con la dominante Iridomyrmex spp. Los siguientes son ejemplos de gremios en la selva brasileña de la Costa Atlántica (Delabie et al. originalmente diseñado para hormigas australianas. son cosmopolitas. • Especies dominantes: especies muy abundantes y agresivas que influyen sobre la distribución y el comportamiento de otras especies de hormigas.) muestran adaptaciones fisiológicas. pues es la más usada en diferentes paises. Eurhopalothrix spp. no especialistas y altamente competitivas. • Especies subordinadas asociadas: incluyen. Aphaenogaster spp. • Especies oportunistas: escasamente competitivas. M acrofauna 115 . Ejemplo: Iridomyrmex spp. y Notoncus spp. en su mayoría. Aunque han sido varias las propuestas de esquemas de clasificación de grupos funcionales. Meranoplus spp.. hormigas no especialistas que frecuentemente viven en ambientes perturbados (Rhytidoponera spp.). Paratrechina spp. que pueden coexistir con la dominante Iridomyrmex spp. 2000).. • Especies generalistas myrmicines: especies que pertenecen al género Monomorium.).

normalmente miembros de Attini. ejemplos: Gnamptogenys (hormigas y otros insectos depredadores). predadoras especialistas que comen otras hormigas.• Especies omnívoras: especies que se alimentan de varias fuentes. • Especies predadoras de suelo: especies que se establecen en el suelo y en la hojarasca. Mycocepurus. • Especies de hormigas dominantes en suelo u hojarasca: hormigas forrajeras de hojarasca y suelo o de la superficie. • Especies de hormigas legionarias: también conocidas como “formigas da correição”. donde son forrajeras. ejemplo: Acropyga. 1995). Apterostigma. • Especies cultivadoras de hongos: especies que utilizan hongos simbióticos. por ejemplo. Paratrechina. • Especies predadoras especialistas: especies que se alimentan de un solo tipo de presa. • Especies de hormigas arbóreas dominantes: especies omnívoras que anidan en árboles. Utilizan hojas frescas. es conveniente escoger las clasificaciones más cortas. son generalistas o especialistas dentro de las especies predadoras. • Especies de hormigas subterráneas: dependen de gotitas de aguamiel y comen secreciones de azúcar de otros insectos. se subdividen en dos grupos: a) predadoras generalistas grandes. ejemplo: Azteca y Crematogaster. probablemente comedoras de larvas de termitas del género Syntermes (Delabie. ejemplo: Amblyopone (predadoras de termitas) y Thaumatomyrmex (predadoras de miriápodos) y Strumigenys (predadoras de colémbolos). Labidus (predadoras generalistas) y Neivamyrmex y Normamyrmex. para trabajo de campo práctico. ejemplos: Acromyrmex. Anochetus e Hypoponera. Myrmicocrypta. carroña y restos de plantas para cultivar sus hongos. la empleada en el taller CSM-BGBD (2005): 116 Manual de biología de suelos tropicales . Campanotus. Pheidole y Solenopsis. ejemplos: Eciton. • Especies predadoras generalistas: especies que se alimentan de diferentes tipos de presas. Solenopsis (especies grandes) y Wasmannia. Sericomyrmes y Trachymyrmex. Atta. son altamente agresivas y presentan una influencia competitiva sobre otras especies. Pachycondyla y Centromyrmex (inquilinas de nidos de termitas). forrajean toda la vegetación arriba de la superficie y en la hojarasca. incluyendo los restos de animales muertos. También existen otras clasificaciones funcionales. ejemplo: Odontomachus y Ectatomma. por ejemplo. ejemplo: Megalomyrmex. Cyphormyrmex. b) verdaderas omnívoras: Brachymyrmex.

con un centro de colonia epigeo o arbóreo. Se recoge primero la hojarasca. hacia arriba. b) transportar al laboratorio dentro de una bolsa segura. cuando los Winklers no se encuentren disponibles. preferentemente colocados a lo largo de la línea de transecto. conforme se seque la hojarasca. lentamente las hormigas y otros insectos migran hacia afuera y se caen en el alcohol. con el centro de colonia epigeo o arbóreo. los cuales son colgados en un lugar cubierto. con un centro de colonia subterráneo. • Herbívoras. Este procedimiento permite separar la macrofauna pequeña y alguna de la mesofauna M acrofauna 117 . trabajando desde el borde hacia el centro. por lo menos.• Carnívoras (especialistas o generalistas). cerrado pero ventilado. con el centro de su colonia en las capas superficiales de hojarasca. • Carnívoras (especialistas o generalistas). 1999). sobre una sábana blanca. La fracción fina queda en el fondo de la bolsa del tamiz. de manera que se puedan separar los fragmentos más gruesos. en alcohol al 70%. se puede pasar la hojarasca burda por una malla de 2 mm. con un centro de colonia en las capas superficiales de hojarasca. con el fin de maximizar la recuperación de los especímenes (Delabie. junto con las hormigas y se transfiere a bolsas en campo. con un centro de colonia subterránea. Se coloca un frasco con alcohol al 70% en la base de la trampa Winkler. se mantiene la trampa durante por lo menos 72 horas. como complemento o alternativa. Se tamiza cada muestra de hojarasca para remover pedazos grandes. de manera que no escape ningún insecto. posteriormente. tres cuadrantes de 1 m2. con guantes de cuero. véase también el Capítulo 2). realizando movimientos laterales. el contenido de las bolsas de campo se transfiere a redes. Se utiliza un marco para delimitar un área de un 1 m2 y se remueve la hojarasca a mano. Se almacenan los especímenes en tubos cerrados y etiquetados. ventilado y bajo condiciones ambientales. Procedimiento de muestreo El procedimiento completo se lleva a cabo en tres fases: a) tamizar en campo para separa la hojarasca fina (con hormigas) de la materia más gruesa. junto a la coordenada GPS y al monolito (Ilustración 1. • Herbívoras. c) extraer las hormigas dentro de la trampa Winkler. estas redes se fijan dentro de la trampa Winkler. que se encuentra en. Esto debe hacerse con suficiente habilidad. Una vez en el laboratorio. • Carnívoras (especialistas o generalistas). • Herbívoras.

en este caso. que se entierran de manera que la parte superior del envase quede exactamente al ras del suelo. • La trampa Winkler consiste en una bolsa porosa de algodón o nylon.. deberá ser pesada al final de la extracción. plástico o aluminio para delimitar el área de muestreo. de alrededor de 5 mm. de 25 cm de ancho y 37 cm de largo. Como variación de este método. que entre dentro de una bolsa resistente de nylon o tergal. • Tamiz de malla grande. Se achica el fondo de la bolsa para que se pueda colocar un frasco de aproximadamente 200 ml de capacidad. hasta el lugar donde se encuentren las trampas Winkler. contenida en la trampa Winkler. a prueba de insectos y mide 1. una por cada trampa.5 m de largo. se marca un límite de búsqueda de 30 minutos por cada metro cuadrado de hojarasca muestreada. • Redes. las cuales serán llenadas holgadamente con la hojarasca trasportada en las bolsas del campo y se colocaran en el centro de la trampa Winkler para dar paso a los invertebrados. latas. 25 cm de ancho y 20 cm de profundidad central. botellas de plástico. por ejemplo. • Bolsas de nylon. tazas. se pueden recolectar los especímenes de la sábana. de aproximadamente 1. después de limpiar la hojarasca suelta en el punto donde se va a colocar la trampa. 2000) es la siguiente: • Marco con una medida de 1 x 1 m de madera. de esta manera. vasos. el cual contiene alcohol al 70%. La lista completa de los materiales para la extracción con trampas Winkler (Bestelmeyer et al. utilizando un aspirador manual (pooter). tarros. la parte superior del envase puede situarse a 1 cm más arriba de 118 Manual de biología de suelos tropicales . dichas trampas están hechas de envases profundos relativamente pequeños. La hojarasca seca. las cuales se usarán en campo para transportar el material tamizado. de aproximadamente 34 cm de ancho x 55 cm de largo. OTRA MACROFAUNA Y MESOFAUNA QUE SE ENCUENTRAN EN LA HOJARASCA: TRAMPAS PITFALL CON Y SIN CEBO Introducción Las trampas pitfall o de caída constituyen un método efectivo de recolección de muestras de los invertebrados meso y macro que viven en la hojarasca.del material orgánico y.50 m de largo. ESCARABAJOS.

presentan algunas desventajas: sobre todo que no muestrean todos los grupos taxonómicos con la misma eficiencia (escarabajos. la macrofauna y parte de la mesofauna (especialmente. El diámetro más pequeño ofrece la ventaja de sufrir menos perturbación al momento de insertar la trampa. Una típica trampa pitfall puede observarse en la Figura 3. colémbolos). las dimensiones no son fundamentales. ahogándose en agua contenida en el fondo de la trampa. Las trampas pitfall no son cuantitativas y dado que. normalmente. Las trampas se colocan bajo cubierta para evitar que entre la lluvia y funcionan como colectores de artrópodos que viven en el suelo y que caen en el envase. al igual que a actos de vandalismo. éstas ofrecen ventajas adicionales: se puede muestrear.la superficie y se construye una rampa de suelo suelto a su alrededor. Las pitfall son baratas. las pitfall son proclives a sufrir daños ocasionados por mamíferos y aves. ortópteros juveniles. Las trampas normalmente se limpian y se recolocan una vez al día. Nota: frascos con diámetro de 10 a 20 cm generalmente son efectivos. Además. de manera simultánea.6. puesto que en ambas existe un alto grado de autocorrelación entre muestras adjuntas. por lo que se utilizan frecuentemente en los trabajos de inventario de la biodiversidad. mientras que los insectos alados se escapan). se pueden utilizar específicamente para atrapar animales nocturnos. miriápodos. M acrofauna 119 . de fácil instalación. se encuentran dispuestas de manera lineal (para facilitar la instalación y el retiro) sufren la misma desventaja que los transectos. arañas y otros arácnidos grandes tienden a dominar. No obstante. pero la trampa debe ser lo suficientemente amplia como para poder colectar un número razonable de especímenes y suficientemente profunda Figura 3. hormigas.6 Esquema de una trampa pitfall con cebo.

para impedir la fuga. Los clavos galvanizados o de madera son la mejor opción para elevar el techo hasta dos Figura 3. sin embargo. Un aditamento usual a las trampas es un techo inclinado para protegerlas de la lluvia. éstos pueden ser improvisados en el campo.7 Trampa pitfall improvisada. ésta descansará sobre palitos o clavos. una caja Petri de vidrio invertida. 120 Manual de biología de suelos tropicales . Entre 1 o 2 cm de agua en el fondo y un poquito de detergente serán suficientes para ahogar o inmovilizar a la mayoría de los animales y el detergente contrarrestará las propiedades hidrofóbicas de muchas cutículas de artrópodos. es lo ideal. hecha con un vaso. cuatro palitos pequeños y una cubierta de celofán.

El número de réplicas puede basarse en curvas de acumulación de especies y ha de ser seleccionado para lograr un 85% o más de las especies buscadas. plástico. de manera alternativa. El vidrio pesa más que el plástico. 2001). ¿cuál sería el número apropiado de trampas pitfall requeridas para colectar el 85% o más de las especies capturables en una unidad vegetal dada? En el muestreo basado en transectos (Swift y Bignell. Las trampas pitfall pueden usarse en cualquier sustrato a nivel del suelo. madera podrida y turba. Se puede argumentar que cuando se trata de sol directo. pero se puede utilizar. Estudios que se enfocan a la abundancia. lo que resulta atractivo para los artrópodos diurnos activos en la superficie. también crea un microhábitat como si fuera una cueva. Colocación de trampas Mientras las pitfall son estrictamente no cuantitativas. retardando así la descomposición. el número de especies obtenidas por medio de las trampas pitfall se incrementa cuando éstas son colocadas en un máximo de unidades vegetales. dentro de un rango de unidades vegetales. muestran que un nivel de captura aproximada puede obtenerse mediante la replicación de trampas pitfall. En estudios referidos a riqueza de especies. con una respuesta negativa a la luz. madera u otro material lo suficientemente pesado como para que no lo eleve el viento o que pueda ser afectado por la lluvia o el sol y que además no sea comestible para las termitas. de manera que permitan el acceso a las trampas. El uso de envases de color fuerte o con dibujos puede mejorar la captura de parasitoides u otros insectos voladores que serán atraídos por los colores.7). una solución de hidrato de cloruro al 5% o una mezcla de ácido láctico/ácido acético (10% de cada uno de ellos.o tres centímetros. pueden ser útiles para la estimación de la diversidad alfa. de manera que no atraiga insectos voladores. Pueden emplearse para muestrear artrópodos en madrigueras. por lo que el techo se mantendrá más estable. el techo debería ser opaco para evitar un efecto invernadero dentro de la trampa. pero deberán evitarse siempre que se pueda. al mismo tiempo que ayuda a mantener el contenido fresco. En algunas variaciones de este procedimiento se añade sal como conservador. combinados con un poco de glicerina) para mejorar su conservación. las pitfall normalmente se colocan en paralelo y M acrofauna 121 . con la excepción de agua y roca. aunque su aplicación más común es en un sustrato de suelo para la fauna de artrópodos activa en la superficie del suelo (Figura 3. En otras palabras. ajenos a la fauna del suelo. hojarasca. El techo puede hacerse también de loseta de cerámica. éste deberá ser gris claro.

ello depende del largo del transecto. las partículas más grandes. con el fin de hacer un hoyo del tamaño del vaso a introducir. Se usa el relleno para construir una rampa. 122 Manual de biología de suelos tropicales . fuera del área principal de actividad. En el sistema de muestreo recomendado para el proyecto CSM-BGBD. especialmente a pisadas. capítulo 2. deberán ser extraídas a mano. donde se puede colocar una colección de pitfall de manera cercana (véase "cercas movibles”). Cuando una parcela es botánicamente compleja y varias unidades vegetales pueden ser reconocidas. ordenar el lugar entero. podrá hacerse en cualquier momento. que cae en la trampa durante su colocación. extracciones de núcleos de mesofauna y de microsimbiontes y. cualquier microhábitat de interés podrá ser investigado. colocados en la superficie del suelo. Se debe tener especial cuidado para evitar remover suelo y raíces. El número recomendado es de 3 a 5 trampas por cada punto de muestreo. una precaución sensata sería. en forma de “V” o de embudo. 2 Se coloca la trampa pitfall en el hoyo y el borde externo se llena de tierra procedente de la excavación. 1 Se utiliza una cuchara de albañil para cortar y sacar las raíces y suelo. se aplana con cuidado para mantener el mismo nivel que el borde de la trampa. a una distancia de alrededor de 5 m. las pitfall pueden ser distribuidas de la misma manera que en el muestreo casual para hormigas y termitas. se sugiere que las pitfall sean colocadas a lo largo de la línea de transecto y a un lado de los cuadrantes de 1 m² del muestreo para hojarasca. puede soplarse hacia afuera. de manera que se minimice al máximo la perturbación del microhábitat adjunto. 3 El suelo fino. el monolito. pero esto no trata de ser prescriptivo. La colecta de las pitfall es sensible a la perturbación.a cada lado. por lo tanto. es decir. de manera que los animales caminen sin obstáculos hacia el borde de la trampa. Se muestrea. Un muestreo ocasional. se canalizan los animales móviles hacia la base de la “V” o embudo. No se especifica el número. De esta manera. sugerido por Southwood (1978) hace uso de tablas de madera o de algunos obstáculos similares de hasta 30 cm de alto. según el orden de vulnerabilidad decreciente: primero las pitfall (de un día para otro) seguidas por los transectos. Instalaciones de las trampas pitfall Las trampas pitfall deben ser introducidas en el suelo con el borde superior del envase al ras del mismo o de la superficie de la hojarasca. finalmente. Un esquema variable de muestreo con pitfall.

etc. Se añade un poquito de detergente como agente tensoactivo. se utiliza por separado un colador de 53 µm. resulta útil para identificar la localización de la trampa y para prevenir pisadas accidentales. a no ser que la frecuencia de mantenimiento sea de 24 horas o menos. Los especímenes deberán procesarse el mismo día en laboratorio o la base de campo. tales como hojas. lo que servirá para separar los últimos ejemplares. la sal y el detergente. El lavado de ejemplares en agua fresca es esencial porque el detergente y la suciedad forman una película sobre los insectos. Se retira cualquier basura grande restante y se trata de retirar al máximo la tierra u otra basura orgánica. con el fin de remover la suciedad. ver abajo). Se extraen los elementos grandes. 7 Se coloca un indicador con el número de lugar y trampa (en tinta indeleble o lápiz) cerca de la trampa. Cada trampa se debe procesar de manera separada y se coloca en la bolsa o frasco una etiqueta con la identificación del lugar. trampa y fecha de recolección. enjuagando el contenido de cada bolsa en la red. utilizando un flujo suave de agua. lo que dificulta que sean manipulables y visibles bajo M acrofauna 123 . esta película es difícil o hasta imposible retirar una vez que los ejemplares quedan conservados. situado en su parte superior. 6 Se coloca el techo sobre los soportes. se agita suavemente el contenido restante del vaso para levantar los especímenes del fondo y se filtra con una red de acuario. siempre se necesitará sal u otro tipo de conservador en climas tropicales. colocado verticalmente con un pedazo de cinta o banderín amarillo o naranja. un palito. que hayan caído en la trampa.5 cm de cada soporte visible. si se les introduce directamente en alcohol. animales más grandes. utilizando un frasco para enjuague o pipeta de agua. El mantenimiento y el procesamiento de especímenes El mantenimiento de las trampas se lleva a cabo de la siguiente forma: se quita el techo y se levanta el vaso interior que contiene el cebo (en el caso de que lo contenga. arriba del substrato. durante varios minutos. El detergente facilitará la inmovilización por ahogamiento de animales activos. dejando así 2. 5 Se llenan las trampas hasta alrededor de ¼ de su capacidad con agua y suficiente sal como para lograr una solución saturada (en caso de escoger una solución salina). palitos.4 Se insertan tres soportes de techo en el suelo alrededor de la trampa. Para poder retener los colémbolos. Se transfieren los especímenes en bolsas de plástico o frascos desde la red.

se invierte el contenido de la red en una bolsa de especímenes y con un atomizador o piseta. Para mejorar la capacidad de captura con trampas pitfall Es posible mejorar la capacidad de captura con las trampas pitfall haciendo varios cambios en el diseño de la trampa o usando cebo atractivo para artrópodos. Para el procesamiento de ejemplares de colémbolos véase Capítulo 4 (Mesofauna). lleno de alcohol. esto se lleva a cabo con la suspensión del cebo en un pequeño bote colocado en la boca del envase principal. El cebo deberá separarse del líquido conservador. El cebo puede ser estiércol. por supuesto. en espera de futuros procedimientos. se encuentra fácilmente disponible. y se introducen las etiquetas (escritas con tinta indeleble o con lápiz). Después de siete días se debe cambiar el alcohol y.microscopio. el porcentaje de todas las trampas estará ocupado por una sola especie) porque no se puede determinar 124 Manual de biología de suelos tropicales . El excremento humano fresco también es apetecible para una gran variedad de escarabajos y. Se cubre con alcohol la muestra hasta la altura de los ejemplares que se encuentran dentro de la muestra. Una variante de este proceso es usar dos filtros para colémbolos (malla 53 µm y 38 µm) se utilizan para separar estos animales de la otra fauna (ver Capítulo 4). se lava suavemente el contenido de la red y los lados de la bolsa o frasco con el fin de que los ejemplares caigan hasta el fondo. Se recomiendan dos trampas de este tipo más tres de diseño convencional por cada punto de muestreo. El hecho de usar cebos atractivos implica un mejoramiento general para la captura de una gran variedad de artrópodos. Las muestras almacenadas deberán quedarse en una bolsa doble o frasco. Se pueden preparar trampas pitfall adicionales (opcional) con un contenido de 120 ml de etanol al 95% + glicerina (9:1) que se dejan en campo durante 72 horas. Las trampas con cebo no podrán utilizarse en una evaluación semi-cuantitativa como medio de captura (por ejemplo. carroña. se refrigeran o se congelan las muestras. o sustancias sintéticas atractivas (por ejemplo. La principal modificación en el diseño consiste en agrandar su diámetro. porque la capacidad de captura de las pitfall está en función del tamaño de su circunferencia. frutos caídos u hongos en descomposición que resultan indistintamente atractivos para los detritívoros y algunos otros tipos de artrópodos. se usa alcohol al 95% en el caso de colémbolos y al 70% para otros especímenes. si es posible. rojo o azul) para atraer moscas o parasitoides. feromonas). El uso de cebos resulta controversial porque el muestreo se sesga hacia los animales con un marcado olfato. Después de este lavado. cebos de color (amarillo.

trampas Winkler. siempre que sea posible agruparlas en familias o subfamilias. • Agua: agua de la llave o de una fuente natural. • Bolsas de plástico para muestreo con sello (tipo ziplock son las más convenientes para el almacenamiento de especímenes de campo) o frascos. transectos. • Indicadores de plástico o de madera. Si no se cuenta con una balanza disponible en el campo. Para completar la lista. • Cubeta o envase para agua. se combinan los resultados de los monolitos. • Techo de 200 x 200 mm (uno por trampa). REGUISTRO E INTERPRETACIÓN DE DATOS Parámetros Registre el número y peso fresco de todos los organismos e identifique. se hace una lista de especies. La presencia y el peso de hongos cultivados por las termitas (si los hay) también deberán anotarse. 2 o 6B) • Etiquetas tipo tarjeta. se puede estimar el peso fresco para ejemplares conservados. • Red de acuario o similar (de malla fina). M acrofauna 125 . pesados después de un secado con papel absorbente. por lo menos. • Sal. Lista de materiales requeridos • Trampas pitfall: vasos de plástico de 1000 ml (con dimensiones de 180 mm de diámetro superior x 120 mm de profundidad). • Soportes del techo: clavos de madera o galvanizados de 152 mm (seis pulgadas). sino también de la movilidad relativa. sin embargo. loseta de color gris claro. hasta el nivel de determinación taxonómica y funcional más alta posible. esto es aplicable para las lista de especies de la localidad. • Lápiz de grafito (ej. no. trampas pitfall junto con un muestreo casual. • Alcohol al 70 al 90%. • Detergente puro: detergente líquido no perfumado para platos.el área en donde se llevó a cabo el muestreo y la captura no sólo depende de la abundancia de animales. utilizando el nombre genérico y por orden alfabético.

Tabla 3. con la excepción de las lombrices de tierra y milpiés. la especie A es la misma especie en toda el área de muestreo. La abundancia se estima como número o individuos por m2. se multiplica el número crudo de cada monolito x 16. Por ejemplo. Árboles talados 163 BS6.827 22-977 5-16. Fuente: datos de especies de Jones et al. deberán enlistarse sin letras: Ejemplo Colobobsis sp. A. y Crematogaster sp. Hule 128 BS10. Selva primaria 2. Es importante que la designación de letra sea consistente entre las localidades. de cada monolito y de cada estrato. Cassava 26 Media aritmética Nivel del estrato (Promedio de todas individuos m-2 (n=5) las localidades) 46 0–10 cm 106 10–20 cm 55 20–30 cm 49 Media geométrica individuos m-2 (n=5)* 971 65 47 11 25 2 10 Media geométrica individuos m-2 (n=5)* 15 80 44 4 95% de confianza 347-12.892 BS3. 2003. a través de un gradiente de perturbación de la selva. Incorpore la lista de especies en una tabla que muestre las localidades donde fue encontrada cada una.445 2-1. Sitio Media aritmética individuos m-2 (n=5) BS1.2 Densidad numérica (individuos m2) de termitas en siete localidades. los cuales se muestrean en el mo126 Manual de biología de suelos tropicales . Las especies identificadas únicamente a nivel género. Alang-alang 3 BS14. Las morfoespecies deberán enlistarse por letra: Ejemplo Crematogaster sp.Las especies plenamente identificadas deberán enlistarse con su nomenclatura binomial (género y especie) y la autoridad que las describió completas: Ejemplo Dorylus laevigatus Smith. Paraserianthes 512 BS8. Selva de hule 211 BS12.772 0-20 2-534 95% de confianza 3-64 43-148 24-78 1-50 * Datos retrotransformados. en la provincia Jambi del centro de Sumatra.. B.046 2-9.

puedan ser parámetros útiles de población. El peso de los desconocidos puede entonces estimarse desde la curva. Donde se dispone de especímenes de insectos de varios tamaños. (1997). los datos primarios deberán transformarse en log10(x+1).. Se citan las medias para datos no transformados.nolito y la zanja (véase monolitos arriba). tal y como se muestra en la tabla 3. número de pitfall respecto al total. es posible asignar dominancia y. En casos difíciles. También partiendo de que un transecto completo representa una muestra única y grande. Para la información completa obtenida de transectos. Para poder estimar el 95% de límite de confianza. Eggleton et al.m-2 de manera similar a como se calcula la abundancia. véanse las discusiones en Eggleton y Bignell (1995). el número de veces que se descubren colonias separadas en el caso de hormigas o termitas. Este concepto no se puede aplicar de la misma manera para las pitfall. incluyendo el 95% de los límites de confianza y con los datos transformados se obtiene una media geométrica. datos transformados y los límites de confianza para log10(x+1). resulta más conveniente M acrofauna 127 . en especímenes representativos que cubren todo el rango de tamaños. Woodcock (2005) y Jones et al. existe un método alternativo que consiste en calibrar la biomasa viva con el ancho de cabeza. En el caso de transformaciones a log de los datos. o sea. 1996). junto con las medias geométricas. Jones e Eggleton (2000). Algunos indicadores de la abundancia relativa se pueden obtener a partir de la frecuencia de encuentro de diferentes especies (número de secciones de un transecto en donde se localizó la especie con respecto al número total muestreado. se calculan las medias aritméticas. Cuando no hay demasiados ceros (muestras sin organismos) este procedimiento debería normalizar los datos y producir varianzas homogéneas de grupo a grupo. Se evita el uso del peso seco debido a las diferentes temperaturas de los hornos que usan algunos investigadores y por el contenido variable de agua de los diferentes tipos de organismos. si es posible. (2005).). o para otros grupos individuos separados a lo largo del transecto completo. finalmente. se puede probar una transformación loglog. también es posible que el número total de encuentros. también para cada grupo taxonómico superior y se combinan los datos de todas las especies.2). se determina la abundancia para cada taxón. Los datos transformados pueden usarse para histogramas y comparaciones de lugar a lugar (Eggleton et al. etc. Se estima la biomasa en g. Se aplican estadísticas descriptivas al juego de datos transformados. derivar en índices de diversidad de especies y de equitatividad. se utiliza peso fresco o la masa de un espécimen parcialmente seco. por lo tanto. y prepare una tabla resumida.

la clasificación de lombrices de tierra (ya mencionada) puede aplicarse a todos los invertebrados del suelo. de manera que monitorear datos sin estimaciones de biomasa proporciona información incompleta y. definido por su hábito alimenticio y su distribución en el perfil del suelo. por tanto. Especies endógeas que viven en el suelo y se alimentan de materia orgánica y de raíces muertas. Este grupo incluye. Se debe mostrar riqueza de especies/morfoespecies. cucarachas. puesto que no implica pesar especímenes individuales o hacer otras medidas para estimar la biomasa. Especies anécicas son las que retiran hojarasca de la superficie del suelo a través de su actividad alimenticia. Nota: determinar solamente la abundancia resulta fácil. como arriba. ingiriendo grandes cantidades de materia mineral. La macrofauna activa en la superficie incluirá a los organismos muestreados en las trampas pitfall. es decir. cochinillas y grillos). muchas tasas de procesos en el ecosistema son proporcionales a la biomasa y no a la abundancia. ciempiés. pero no redistribuyen activamente materiales de las plantas (aunque el material despedazado sea más fácilmente transportado por el viento o el agua que el material de donde deriva). sin embargo. una variedad de artrópodos (hormigas. en su mayoría. menos informativa. elementos minerales y materia orgánica se redistribuyen con esta actividad y también se acompañan de efectos físicos sobre la estructura del suelo y las propiedades hídricas. y liberar nutrientes. Especies epigeas que viven y se alimentan en la superficie del suelo. Se prepara una tabla resumida. Para poder establecer una comparación. Los dos grupos principales son las lombrices de tierra y las termitas que se alimentan del suelo. abundancia y biomasa en forma gráfica. Cantidades considerables de suelo. milpiés. las cuales pueden ser incluidas en una o más 128 Manual de biología de suelos tropicales . Ensambles pueden ser comparados por la proporción relativa de especies o unidades taxonómicas (morfoespecies).trabajar en (mg+1) y luego se transforman y se expresa en gramos. escarabajos. el efecto de estos invertebrados es fraccionar y despedazar la hojarasca. Análisis Los análisis se deben llevar a cabo por grupo funcional. pero también algunos arácnidos. caracoles y pequeñas lombrices de tierra completamente pigmentadas. Las lombrices de tierra y las termitas que no se alimentan de suelo constituyen los principales grupos dentro de esta categoría.

Los índices de diversidad y de similaridad útiles incluyen: ShannonWiener. Se recomienda probar la clasificación de un grupo funcional (GF) adicional para la macrofauna. Nota: los términos “ingeniero de ecosistema y especies claves” con frecuencia son utilizados. M acrofauna 129 . que son complejos organominerales. y forman heces longevas y estables. Simpson. ICE y EstimateS. termitas y escarabajos capturados con cebo. Macropredadores (especies predadoras >0. lombrices epigeas y ácaros grandes) ingieren una mezcla de materia orgánica y biomasa microbiana y forman heces holorgánicas de corta vida. Jackknife. Lista por familia de los otros escarabajos. pero ocasionalmente más pequeños) ingieren una mezcla de materia orgánica y minerales. La riqueza de especies actual puede ser estimada por medio de Sob. 1978 y Krebs. Las especies clave (termitas y posiblemente algunos transformadores de hojarasca) proveen oportunidades físicas de nichos para organismos de nivel más bajo y determinan la estructura de la comunidad de estos organismos. Este grupo incluye invertebrados grandes (> 1cm) y medianos (0. Los grandes invertebrados (> 1cm. termitas y lombrices anécicas y endógeas). utilizando las siguientes categorías: Los ingenieros del ecosistema (normalmente hormigas. pero algunos animales más pequeños (varios ácaros) pueden tener funciones análogas. como sinónimos. ACE. Conjunto mínimo de datos por punto muestreado De todo el muestreo Lista de especies/morfoespecies para hormigas.categorías funcionales. normalmente procedentes de varios grupos de artrópodos). por categoría de uso de suelo y por ventana de muestreo. de forma incorrecta. 1998). CONJUNTO mínimo DE DATOS El conjunto mínimo de datos puede ser expresado por cada punto de muestreo.2 cm. Jacquard y Sorensen (véase Southwood. Transformadores de hojarasca (normalmente artrópodos no sociales o semisociales. según se explica a continuación.2 a 1cm).

). etc. Todos los escarabajos Otros invertebrados Todos los invertebrados. etc. con la excepción de lombrices de tierra). en su defecto las que se alimentan de madera o de suelo). Abundancia total en número m2 de forma separada para: Todas las hormigas (y por grupo funcional GF1. Todas las termitas (y por GF 1. Nótese que un encuentro es un evento en una sección de 5 m del transecto. varía de 0 a 4 para transectos de 20 m y de 0 a 20 para transectos de 100 m. GF 2. Todas las lombrices de tierra (además por GF 1.. etc. 130 Manual de biología de suelos tropicales . GF2. Desde el transecto o los transectos Abundancia relativa de termitas.Lista de los otros invertebrados en la resolución taxonómica la más alta posible.) también pueden estimarse. Se hace un cálculo para cada GF. utilizando todas las secciones de transectos disponibles para el muestreo. el número de encuentros. números totales por cada grupo funcional (GF1.). por lo tanto. etc. Para cada taxón se indica el método de muestreo empleado: C = casual T = transecto W = Winkler P = pitfalls M= monolito (Para el monolito no observar estratificaciones de 3 x 10 cm. En el caso de las hormigas. GF2. Datos de abundancia para hormigas y escarabajos (número de individuos m²). Se pueden juntar los datos obtenidos de diferentes transectos en puntos de muestreo separados. La abundancia relativa para cada GF está dada por el número de encuentros de divididos entre el número total de encuentros de todos los GFs. GF 2. De las trampas Winkler Frecuencia de especies por muestra.

otros invertebrados y todos los invertebrados (igual a lo indicado para datos mínimos por punto de muestreo). GF 2. etc. lombrices de tierra y escarabajos capturados con cebos. separado para hormigas (y para grupos funcionales GF1. todas las termitas (y para los grupos GF 1. etc.). como % ± SD. W= Winkler. Conjunto mínimo de datos por uso de suelo Las categorías de uso de suelo son anotadas y cuando esto no es posible se clasifican de acuerdo con la intensidad de uso de suelo. todos los escarabajos. De los transectos Abundancia relativa media de termitas GF 1. todas las lombrices de tierra (y por grupos GF 1. Lista de familias para los demás escarabajos Lista de invertebrados en la resolución taxonómica la más alta posible Para cada taxón se indica el método de muestreo empleado. etc. De todo el muestreo Listas de especies/morfoespecies para hormigas. GF 2. termitas.). P= Pitfalls y M= Monolito De los monolitos Es necesario proveer la abundancia media como: a) Número de individuos m² ±SD b) Media geométrica ± 95% de intervalo de confianza c) Media aritmética ± 95% de intervalo de confianza donde n = número de puntos por uso de suelo. T = Transecto. etc. GF 2.De las trampas pitfall Se desglosa los taxa no muestreados por otros medios (únicamente). o en su defecto las que se alimentan de madera o de suelo). GF 2. donde n = número de puntos por uso de suelo.. utilizando las mismas claves que las especificadas anteriormente: C= Casual. M acrofauna 131 .

132 Manual de biología de suelos tropicales . donde n = número de puntos por uso de suelo. Por ejemplo. la escala del esfuerzo requerida para poder evaluar la biomasa es enorme (véase Eggleton y Bignell. se dice que la abundancia de individuos no se debe usar en el caso de hormigas porque son insectos sociales que se organizan en colonias formadas por miles de individuos que se alimentan en grupos. De manera similar. será sobreestimada (Colwell y Coddington.. muestreo anidado y estratificado ejemplo Eggleton et al. si el muestreo se hace en una colonia. en base de lugar a lugar. El uso de datos crudos de abundancia y de biomasa en la interpretación de la función del ecosistema resulta controversial. Abundancia media de escarabajos como individuos m² ± SD. existen contra argumentos de que los insectos sociales pueden evaluarse correctamente en cuanto a su abundancia y biomasa. Lawton et al. Desafortunadamente.) como individuos m² ± SD. 1995. 1994).. La frecuencia de especies por muestreo presenta un parámetro alternativo. etc. GF 2. cuando su abundancia o biomasa lo justifique. se argumenta que los organismos se deben asignar únicamente como ingenieros del ecosistema. incluyendo los resultados de intensificación de uso de suelo. el cálculo retrospectivo hasta llegar a la densidad numérica. Conjunto mínimo de datos por ventana de muestreo De todos los métodos de muestreo Recambio de especies a lo largo del gradiente como la β de Whittaker.De las trampas Winkler Abundancia media de hormigas (y como GF 1. 1996) y que la biomasa es tan importante para la determinación del impacto ecológico que no se puede prescindir de ella o sustituirla. no obstante. Para todas las abundancias medias totales y las abundancias medias relativas de los GF Correlación con parámetros individuales del gradiente. si el régimen de muestreo es suficientemente robusto (incluyendo réplicas adecuadas. ejemplo Diversidad β.

P. (2000) ‘Soil microarthropods of a rubber plantation and a natural forest’. 2045–2054. E. Brandão. REFERENCIAS Agosti. S. 431–439. Ecological Bulletins. S. K.eis. CAB International. Majer. J. Ito (eds) A Series of Searchable Texts on Earthworm Biodiversity. (2002) Cosmopolitan Earthworms – An Eco-Taxonomic Guide to the Peregrine Species of the World. (2000) ‘Diversity and distribution of endemic and exotic earthworms in natural and regenerating ecosystems in the central Himalayas.htm. 25. R. pp. (eds) (1989) Tropical Soil Biology and Fertility: A Handbook of Methods. Anderson. Delabie. Andersen. pp. Wallingford. W. E. E. pp.. pp. y Lavelle. M. R. M.. Halder. Constantino. pp. R. COE Soil Ecology Research Group. India’. R.. S. I. L.. Bhadauria T. T. K. 35.bio-eco. Smithsonian Institution. J. T. VermEcology. P. e Ingram. Lavelle. Ecology and Systematics from Various Regions of the World. Lebissonnais. A... e Ingram. 29. T.. pp. y Saha. CAB International. (2005) ‘Introductory key to revised earthworm families of the world’. Soil Biology and Biochemistry.. Biology and Fertility of Soils. M acrofauna 133 . Lohm and T.T.. y Schultz T. Bouché. M. Environmental & Ecology. J. Anderson. Australia. B. 1st edition. 122–132. E. Kaneko and M.338–347. Blanchart. y Valentin.. 3. Soil Biology and Biochemistry. D. Yokohama National University. (eds) (2000) Measuring and Monitoring Biological Diversity. Bestelmeyer. 143–147. N.. Agosti. Kippax.jp/eng/index. H. M. C.. Barrios.ynu. Ramakrishnan. Japan. y Srivastava.. vol. C. C. www. D. Alonso. Standard Methods for Ground-living Ants. Blakemore. G. DC. J. 24.. I. F. Blakemore. J.. vol. Persson (eds) Soil Organisms as Components of Ecosystems. vol. J. in U. R..1998). lo que compromete la caracterización de la heterogeneidad del paisaje porque restringe el número de puntos de muestreo que pueden ser utilizados. 32. Wallingford. in N. vol. vol. T. vol. (1977) ‘Stratégies lombriciennes’.ac. Y. Journal of Biogeography. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. J. N. J. Brown. B. (1997) ‘Regulation of soil structure by geophagous earthworm activities in humid savanna of Côte d’Ivoire’. Alonso L. Washington. Pashanasi. (2002) ‘Effects of land-use system on the soil macrofauna in western Brazilian Amazonia’. (1997) ‘Functional groups and patterns of organization in North American ant communities: A comparison with Australia’. Braudeau. Leeanne. D. Bhattacharya. P. 2nd edition. 433–460.

CSM-BGBD (2005) Global workshop on ant and termite sampling and identification. pp.-C. K. pp. (1996) ‘Revision der Unterfamilie Benhamiinae MICHAELSEN. Colwell. Termitidae. 157–168. vol. P. Delabie. Paillat.edu/estimates. Alonso and T. Colwell.. 47–60. J. J. T. Formicidae. H.. H. 240. Version 7. pp. pp. C. 301–312 Decaëns. Morvan. Fragoso. S. N. vol. F. C. 1897 (Oligochaeta: Acanthodrilidae)’. E. Jiménez. Leith and M. Philosophical Transactions of the Royal Society (Series B). (2002) ‘Earthworm communities under an agricultural intensification gradient in Colombia’. C. vol. Amsterdam. (2000) ‘Litter ant communities of the Brazilian Atlantic rain forest region’. K. C. E. 30. vol. Nasutermitinae)’. T. Delabie. (2000) ‘Statistical Estimate of Species Richness and Shared Species from Samples. D. Resumos Feira De Santana. pp. Elsevier Science Publishers. Ecosystems and Environment. (1995) ‘Inquilismo simultâneo de duas eespécies de Centromyrmex (Hymenoptera. Delettre.. Barros. Version 6. G. J. I.. 19. Plant and Soil. Brunel. Decaëns. Schultz 134 Manual de biología de suelos tropicales . R. G. Le Coeur. Agosti. Escobar. J. (2004)‚‘Soil macrofauna communities in permanent pastures derived from tropical forest or savannas’.. y Lavelle. J.. 12. y Lefeuvre. Clergeau. J..eeb. Blanchart. Jiménez. (1989) ‘Termites’. Dubs. H. A. Feira De Santana. and Rippstein. vol. 347–367. Agriculture.ucon. Baudry. 103. J. S. y Coddington. J.. D. 58–68. Majer. Sociedade Nordestina De Zoologia. J. P. M. 605–609. Tropical Soil Biology and Fertility Institute of CIAT. Nairobi. Collins.. Csuzdi. uconn. in H.. vol. J. pp. 345. (1994) ‘Impact of land management on soil macrofauna in the Oriental Llanos of Colombia’. J.. C. Butet. pp..edu/EstimateS.eeb. Encontro De Zoologia Do Nordeste. Mitteilungen aus dem Zoologischen Museum in Berlin. Colwell. J.. A. y Jiménez. São Paulo. K. 72. Lavelle. C. vol. 101–118. Delabie. Acta Oecologia. G. N. (1998) ‘Comparative biodiversity along a gradient of agricultural landscapes’. T. Ponerinae) em cupinzeiros de Syntermes sp. http://viceroy. J. (1994) ‘Estimating terrestrial biodiversity through extrapolation’. (1999) ‘Comunidades de formigas (Hymenoptera: Formicidae): Métodos de estudo e estudos de casos na Mata Atlântica’.. vol.. F. R. in D. T.. E. Kenya. A. Software and User’s Guide’.. Revista Brasileira De Entomologia. 39. y Nascimento. European Journal of Soil Biology. Petit. A. Y. D. J. C. R. (2005) ‘EstimateS.Burel.5: Statistical Estimation of Species Richness and Shared Species from Samples. (Isoptera.. Agosti..0b1’. Werger (eds) Tropical Rain Forest Ecosystems. Thenail. Chauvel. pp133-143.. P. Decaëns. http://viceroy. L.

. Ecotropica. Journal of African Zoology. Eggleton. M. London. pp. 2. Pleinogaster and Polypheretima’. J. 87–276. Southern Cameroon. Series B. vol. P. South Africa’. C. 119–128. J. 10. Metapheretima. D. (1997) ‘The species richness and composition of termites (Isoptera) in primary and regenerating lowland dipterocarp forest in Sabah. (2004) ‘Influence of agricultural land use on the size and composition of earthworm communities in northern KwaZulu-Natal. Megadrilogica. G. M acrofauna 135 . (1997) ‘The incidence of secondary occupation of epigeal termite (Isoptera) mounds by other termites in the Mbalmayo Forest Reserve. (1994) ‘Effects of habitat fragmentation on Amazonian termite communities’. vol. Eisen. pp. DeSouza. y Bignell. Wood. Stork (eds) Insects in a Changing Environment. R. (1900) ‘Researches in American Oligochaeta with especial reference to those of the Pacific Coast and adjacent islands’.. F. Bignell.. New Acanthodriline genera and species (Megascolecidae. Fragoso. E. MacDonald. y Bignell. P. D. vol. 354. (1999) ‘Termite assemblages. Easton. D. pp. R. F. DC. V. E. 51–68.. W. E. 6. Haynes. C. 3. y Brown. N. and its biological significance’. N.. 27. (1994) ‘Earthworms from Southeastern Mexico. Davies. Series B. vol. 351. Bulletin of the British Museum (Natural History) Zoology. D. T. 35. R. vol. 197–206. (1996) ‘The diversity.(eds) Measuring and Monitoring Biological Diversity: Standard Methods For Groundliving Ants. G. O. E. P. A. Eggleton. D. G. G. Harrington and N. Academic Press. Davies. y Rojas-Fernandez. Journal of Tropical Ecology. 77–88.. P. K... E. abundance and biomass of termites under differing levels of disturbance in the Mbalmayo Forest Reserve. East Malaysia’. Sands. pp... E. Smithsonian Institution. y Bignell. pp. pp. Eggleton. J. Philosophical Transactions of the Royal Society of London. D. A. 489–498. Washington.. R. pp. 111. East Malaysia’. 1–12. Philosophical Transactions of the Royal Society of London. vol. T. 1–128. C. Planapheretima. A. Applied Soil Ecology. Jeeva. Eggleton. (1995) ‘Monitoring the response of tropical insects to changes in the environment: troubles with termites’. Homathevi. Jones. G. Oligochaeta)’. R. Eggleton. pp. Mawdsley. forest disturbance and greenhouse gas fluxes in Sabah. (1979) ‘A revision of the ‘acaecate’ earthworms of the Pheretima group (Megascolecidae: Oligochaeta): Archipheretima. D... Jones. Proceedings of the Californian Academy of Sciences. Southern Cameroon’. Lawton. vol. Dlamini. pp. M.. vol. Homathevi. P. T.. D. 1791–1802. y Maryati. Jeeva. P. in R. y Maryati. vol.. H. Bignell.

Blanchart. Skog. M. J.. Trehane. Gates.. Ecosystems and Environment. in S. J. M. Koeltz Scientific Books. Academic Press. E. Megadrile Oligochaeta (Earthworms) Family Octochaetidae. Lavelle. E. South Africa’. P. Dominy. Brussard and P. Blanchart. y Calaby. P.. P. (2003) ‘Effect of agricultural land use on soil organic matter status and the composition of earthworm communities in KwaZuluNatal. W. Weesner (eds) Biology of Termites. Julka. (2003) ‘Termite assemblage collapses along a land-use intensification gradient in lowland central Sumatra. P.-M. Zoological Survey of India. P. International Trust for Zoological Nomenclature. Demoulin. M. pp. Applied Soil Ecology.. in K. Calcutta. y Tondoh.. Lavelle. T. (2005) ‘Methods for sampling termites’. Burdet. 186–189. J... Blanchart. D.. Fragoso. (2000) ‘Sampling termite assemblages in tropical forests: Testing a rapid biodiversity assessment protocol’... P. pp.. P. in P. Patron. CAB International.. y Eggleton. soil biodiversity and agroecosystem function in the tropics: The role of earthworms’... an introduction to the systematics and biology of Megadrile oligochaetes with special reference to South-East Asia’. Senapati.. 6. H.. A. M. y Eggleton.. P. Lavelle. F. Blackwell.Fragoso. C.. Haynes. pp. H.. V. vol. Martinez. G. Greuter. Bignell. K.. Transactions of the American Philosophical Society. Pashanasi. D. D. E.. y Graham. Konigstein. G. (1995) ‘Biological activity of soil under rubber plantation in Côte d’Ivoire’. D. vol. H. R. F. W. New York. J. C. London..-X. pp. F. B. structure and influence of management pratices’. y Guillaume. pp. (1999) ‘Earthworm communities of tropical agroecosystems: Origin. Lavelle. C. P. R. Jones. Kouassi. Filgueiras. Jiménez. Gilot. J. H. R. Senapati. Gillison. Hendrix (eds) Earthworm Management in Tropical Agroecosystems. Oxford. Keli. Decaëns. H. J. Suryo. S. y Hawksworth. J. Journal of Applied Ecology.. Jones. J. Susilo. 62. E. (1988) The Fauna of India and the Adjacent Countries. vol. McNeill.. C. T. Brown.. T. L. J. Jones. T.. Gay. 191–203. Turland N. J. Barrie. Acta Zoologica Fenica.. J. Krishna and F. J. vol. (1972) ‘Burmese earthworms. D.. Silva. E. y Eggleton. Wallingford. Leather (ed) Insect Sampling in Forest Ecosystems. Nicolson. G. E. F. C. E. 95. T.. y Kumar. 196.. Journal of Applied Ecology. B. Indonesia’. (1997) ‘Agricultural intensification. 380–391. Verkerk. (2000) International Code of Botanical Nomenclature (St Louis Code). 136 Manual de biología de suelos tropicales . B. D. 453–464 International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature. (1970) ‘Termites of the Australian region’.. 17–35. vol. J. T. vol. Agriculture. C. 1–326... S. G. L. 4th edition. 40. A. 37. pp.

(1995) ‘Colombian earthworms’. Biology and Fertility of Soils. and Fragoso. Oxford. 72–76. in A. J. y Halffter. D. vol. Omodeo (eds) On Earthworms: Selected Symposia and Monographs. pp. R. E. M. Hodda. M. E. Boulton. and diversities of bats in a fragmented landscape’. European Journal of Soil Biology. P. Blackwell Science. N. 391. C. vol. Stork. pp. B. Holt. C.. Roger.. Modena. y Watt. J. indicator taxa and effects of habitat modification in tropical forest’. K. Eggleton. 2nd edition. (2000) ‘Assessing the completeness of bat biodiversity inventories using species accumulation curves’. M... Lavelle. Biodiversity and Conservation.. 13. Ecole Normale Supérieure 12. Acta Oecologia – Oecologia Generalis. G. P. pp. Université Paris VI. y Rouland-Lefèvre. D. Rossi. J. vol. 37. Lavelle. 1–95. P. Srivastava. (1996) ‘The measurement of diversity in different types of biological collections’. F. Hammond. Nature (Lond). P. Bignell.. (2004) ‘A multi-scale study of soil macrofauna biodiversity in Amazonia pastures’. Pielou. A. Righi. vol. N.. 159–193. Lavelle. (1998) ‘Biodiversity inventories. y Dhillion. P. Biology and Fertility of Soils.. vol. P. Bourlière (ed) Tropical Savannas. in F. S. Bignell. (1983) ‘The soil fauna of tropical savannas. pp. (1971) ‘Sobre a familia Glossoscolecidae (Oligochaeta) no Brasil’.Krebs. Lavelle.. 33. G. pp367–382 Ortiz-Ceballos. Mathieu. Wolters.. Lawton..... vol. A. E. Laboratoire de Zoologie. Amsterdam. C. 40. Journal of Theoretical Biology. 149–158.. Magurran. O. (2004) ‘Earthworm populations under tropical maize cultivation: The effect of mulching with velvet bean’. 213–226. pp. M. Mora. Thèse de Doctorat. H. G. Bonvicini and P. D. France. Journal of Applied Ecology. E. Lee. B. 438–445. 117–133. E. populations et fonction dans l’écosystème’. I. Lavelle. pp. y Halffter. C. 485–607. Bloemers. Heal. (2001) ‘Spatial and temporal analysis of. Studies on Tropical Andean Ecosystems. (1978) ‘Les vers de terres de la savane de Lamto (Côte d’Ivoire): Peuplements. (2004) Measuring Biological Diversity.-P. Pearson Education. pp. T. pp. vol. Larsen.. P. D. C. (1981) ‘Strategies de reproduction chez les vers de terre’. E. J. G. 4. II The earthworms’. P.. Moreno.. G. (1997) ‘Soil function in a changing world: The role of the invertebrate ecosystem engineers’. vol. 2.. Righi. 300–305. M acrofauna 137 . Mawdsley. S. Unione Zoologica Italiana 2. 10. vol. M. (1998) Ecological Methodology. Arquivos de Zoologia. D. Elsevier Publishing Company. A. A. P. 20. Moreno. V. (1987) ‘Peregrine species of earthworms’. C. 39. Lepage. London. Grimaldi. vol.. E. Mucchi. pp.

fao. Wood. pp. y Olivier. pp. Dolédec. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. Sims.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment.pdf. Biological Journal of the Linnean Society. pp. Ecological Entomology. (1978) ‘Food and feeding habits of termites’. S. E. A. W. P.Sims. South East Asian Regional Research Programme. y Eggleton. E. Bulletin of the British Museum (Natural History) Zoology. (2001) ‘Revision der Untergattung Martiodrilus (Maipure Righi. 103–124. Thioulouse. ASM Press. vol. Bignell. Modena. pp. 493–500. G. London. 21. 33. Leather (ed) Insect Sampling in Forest Ecosystems. (1997) ‘ADE: A multivariate analysis and graphical display software’. 1995) (Oligochaeta: Glossoscolecidae). selected symposia and monographs’. Woodcock. Kikkawa and D. www. y Bignell. 7. P. Swift. vol. E. (1987) ‘A review of the Central African earthworm family Eudrilidae (Oligochaeta)’. Chessel. ASB Lecture Note 6B. J.. Cambridge. R. in A. F. VA. 113–131. R.. (1978) Ecological Methods with Particular Reference to the Study of Insect Populations. A. Vincent. Tondoh. M. P. in J. Cambridge University Press. y Easton. (1996) ‘A pilot analysis of gut contents in termites from the Mbalmayo Forest Reserve. Omodeo (eds) ‘On earthworms. Cameroon’. P. Opuscula Zoologica Budapest. (1986) ‘Guilds and their utility in ecology’. 4. International Centre for Research in Agroforestry. 138 Manual de biología de suelos tropicales . Indonesia. B. M. vol. R. Zicsi. Regenwürmer aus Südamerika’. Bogor. D. vol. 2nd edition. Pattern and Process. J. France. in S. 279–288. (1992) International Code of Nomenclature of Bacteria: Bacteriological Code. 1990 Revision. (1972) ‘A numerical revision of the earthworm genus Pheretima auct. M. Mucchi. pp. Unione Zoologica Italiana 2. Anderson (eds) Community Ecology. J. S. E. (1969) ‘Recherche sur le peuplement en Oligochète de la savane de Lamto (Côte d’Ivoire)’. Blackwell Science. R. Oxford. E. 39. Thèse de 3e cycle. vol. (1980) ‘A classification and the distribution of earthworms. Terborgh. T. Southwood.. vol. G. suborder Lumbricina (Haplotaxida: Oligochaeta)’. Herndon. Oxford. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. W. Pagliani and P. Sneath. pp. H. Journal of Tropical Ecology. Statistics and Computing. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition’. V. y Lavelle. Sleaford. 21. W. 75–83. Eudrilidae) in Ivory Coast’.. y Robinson. A. J. D. Blackwell. D. Chapman and Hall. Université Paris VI. (2005) ‘Pitfall sampling in ecological studies’. 169–268. R. in M. Sims. Brian (ed) Production Ecology of Ants and Termites. T.

vol. 95–130. Regenwürmer aus Südamerika 39. A.Zicsi. pp. M acrofauna 139 . 92. Berichte des Naturwissenschaftlicher-Medizinischer Vereins in Innsbruck. (2005) ‘Über den heutigen Stand der Regenwurmfauna (Oligochaeta) Ekuadors mit einem Bestimmungsschlüssel der Glossoscoleciden-Arten’.

de Asia.G. protocolos de muestreo por región. Notas Clave de géneros de hormigas de Borneo (útil en el S. Publicación clave para géneros de la región Neotropical. Incluye una revisión de la biología ecología. Hormigas Neotropicales Fernández. pp. Disponible y económica. 35 pp. vol. Bien ilustrada clave de fácil identificación para los soldados. XXVI. (1984). Alexander von Humboldt. pp1-244. Fácil de usar. Claves de identificación de termitas. F.Apéndice 1. 36. Colombia. Clave un poco obsoleta de géneros de termitas del Norte de Borneo. 30. E.R. 12-26 octubre. taxonomía y la importancia económica de las hormigas. pp. útil para Sumatra. 1-398. Clave moderna y de fácil interpretación.E. Título y referencias ‘Manual for Bornean Ant (Formicidae) Identification’. (2001). Tho. de Asia Hashimoto. ‘The termites (Isoptera) of Gunung Mulu National Park with a key to the genera know from Sarawak’. ‘A review of the South-east Asian Nasutitermitinae (Isoptera Temitidae). y Homathevi. 1-374. R. P. Trabajo estándar. escarabajos y hormigas. N.E. Borneo Java y Sulawesi. de fácil manejo. pp. Y. Y. M. F. pp 95162. Universidad Malasis Sabah. pero no cubre toda la diversidad de animales que se alimentan del suelo. 1485-1506. Sarawak Museum Journal. 140 Manual de biología de suelos tropicales . 65-87. Bogota. vol. (2 003). ‘Termites of Sabah’ Forest Record 12. S. vol. dentro del clado Termes. (1992) ‘Termites of peninsular Malaysia’ en L. ‘Introducción a las hormigas de la región Neotropical’ Instituto de Investigaciones de Recursos Biológicos. with descriptions of one new genus and new species and including a key to genera’ Journal of Natural History. 2003. Región y autor Hormigas del S. Bien ilustrada con sinopsis genérica. (2003) Termitas del S. Kirton (ed) Malaysian Forest Records. Kepong. Gathorne-Hardy. de Asia Thapa. incluyendo Indonesia). Preparado por “Tools for Monitoring Soil Biodiversity in the ASEAN Region”. (1984) Collins. Forest Research Institute of Malaysia.

B. Termitidae) from the Ethiopian region’. A. Universiti Malaysia Sabah. 12–26. Escarabajos de Asia Chung. pp. A.Cox. Clave moderna. 1-374. preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. London pp. International Institute of Entomology (and Institute of escarabajos. Webb. curation and data management. incluyendo Indonesia. C. Supplement 4. ‘A review of the termites of the genus' Antitermes the Ethiopian region. ‘Manual for Bornean beetle (Coleoptera) family identification’. pp. pp. Thapa. W. Coleoptera. de fácil manejo. (1961).. Octubre 2003. (1981). Claves hasta especies. Adaptación de Chung. (1959). CAB International). fácil de usar. Hormathevi. R. de Asia. Un poco anticuado. R. A. La autoridad estándar del momento para este genero. 3. M. Ibadan University Press. L. Termitas africanas Sands. Clave de géneros de imagos y soldados. R. (2003) Título y referencias ‘Manual for Bornean Termites (Isoptera)’ preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. pp. G. Y. (2006). Universiti Malaysia Sabah. Trabajo estándar. Coleoptera. Lo que opera actualmente sobre esta subfamilia en África. Notas Clave inédita de géneros de termitas en el S. M acrofauna 141 . 12–26 Octubre 2003. con muchas referencias que incorporan descripciones taxonómicas recientes. tanto para imagos como soldados. G. Región y autor Homathevi.Apéndice 1. Bien ilustrada. “Termites of Sabah”. (1990). The Natural History Museum. (1965). Escarabajos en general. y Madge R. Universiti Malasia Sabah. 2003. corta y bien ilustrada de familias con una sinopsis diagnóstica de más de 100 familias y casi 50 subfamilias. 1–384. 36 p. S. vol 8. Explicación detallada de la IIE Guides to insects of importance morfología y agrupaciones de to Man. 2006. Bulletin of the British Museum (Natural History). 1-28. Training course on Arthropod preservation. C. Nigeria. Booth. Bulletin of the British Museum (Natural History). 1–172. R. 129-156 Keys to the Genera of the African Termites. ‘A revision of the termite subfamily Nasutitermitinae (Isoptera. Continúa. 2–38.E. (2003). Clave bien ilustrada a nivel género de soldados. 18-22 Septiembre. Sabah Forest Record 12 pp. Sands W.

soldados mayores y soldados menores. pp 1–23. (1966). Wallingford. Ruelle. (1998). vol. Incluye una sinopsis de familias y subfamilias en forma de clave con notas e identifica caracteres diagnósticos.Apéndice 1. Sands. Región y autor Bouillon. Series B. 1–115. A. (1971). incluye detalles del enrollamiento del intestino y de cómo está conformada la válvula entérica para identificar algunas Apicotermitinae. Harris W. anticuada. Longman. Their Recognition and Control. ‘Report on a survey of the termites of Zimbabwe’. Sociality. y Mathot. en: T. G. S. L. Clave completa muy ilustrada y detallada. (2000). Kluwer Academic Publishers. V. Clave corta. Bignell and M. 365–444. Título y referencias Quel est ce termite Africain? Zooleo. Symbioses Ecology. E. Lo que opera actualmente este género. ‘Taxonomy and phylogeny of termites’. únicamente para géneros principalmente en el contexto africano. Notas Clave a nivel familia de imagos y soldados. Occasional Papers of the National Museums of Rhodesia. Clave hasta género para soldados y muchos géneros ilustrados de manera detallada a nivel de especies (en francés). Termitas neotropicales Constantino. 500 pp. London. 1–40. Mitchell B. muy útil para termitas subterráneas crípticas. pero recomendada para formarse. J. 142 Manual de biología de suelos tropicales . Higashi (eds) Termites: Evolution. pp. vol 67. Clave de especies para imagos. pp. A. Zootaxa. pp. Kambhampati. (1970) A revision of the termites of the genus Macrotermes from the Ethiopean (Isoptera: Termitidae) Bulletin of the British Museum (Natural History) Entomology vol. D. Termites. ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. W. utilizando imagos. y Eggleton P. más 32 referencias. “The Identification of Worker Castes of Termite Genera from Soils of Africa and the Middle East”. pero útil para confirmaciones. especialmente Apicotermitinae y todas las que se alimentan del suelo. CAB International. (2002). pp. obreros y soldados. R. Abe. Estudio comprensivo que incluye claves hasta géneros de soldados. 187–323.. Continúa. 1. Natural Science 6. de difícil manejo. 24. (1980). no muy útil como clave. E. Estudio prestigiado.

C. géneros y especies para imagos y soldados. (sin fecha). M. vol. No publicado. incluyenCountries: Isoptera (Termites). Williams R. 'Guidelines for data collection for ants’. Centre for Overseas Pest Research.Uganda. Kenia. imagos y soldados. B. (1997). utilizadas en taxonomía. Sinopsis ilustrada de subfamilias y su distribución. Excelente para entrenaPest Research. 672 pp. Clave detallada y de fácil manejo A Key to the Genera of the Termitinae by the Soldier Caste. Fisher. 801 pp. Ward. B.Apéndice 1. K. ‘Equipment specifications’ Department of Entomology. Los volúmenes I y II contienen claves hasta familias. (1983). C. (sin fecha). P. Harvard University. (1989). Department of Entomology. Documento de base. R. M. reporte detallado con definiciones de características morfológicas. UC Davis. con una amplia bibliografía. vol. P. Harvard University. No publicado. S. Tanzania y Zanzibar. Documentos variados Roowal. L. Título y referencias Notas No es una clave. II. Listas de material requerido para un muestreo de hormigas con precios en $US del 2001. ed) International Centre of Insect Physiology and Ecology. Continúa. miento avanzado. ‘Taxonomy of Termites’. C. y Chhotani. Bibliografía completa. Chhotani. pero sí un listado Checklist of the Species of Termites que identifica la distribución entre (Isoptera) Recorded from East Africa. (2001). The Fauna of India and Adjacent Countries: Isoptera (Termites). B. A. M. M acrofauna 143 . (Family Termitidae) Zoological survey of do Sri Lanka. Fisher. O. Darlington. subfamilias. Calcutta. O. Sands W. E. Guías para caracterización del sitio y anotaciones relacionadas con el muestreo de hormigas. eje de muchas claves privadas de museos nacionales. y Williams. India. (2001). B. Entomology department. Los volúmenes I y II cubren todo el The Fauna of India and Adjacent subcontinente de la India. (2003). Centre for Overseas para géneros de África del Oeste y Central. Zoological Survey of India. incluye claves hasta familias y subfamilias. 'Ant subfamilies’. (J. Calcutta. Región y autor Claves inéditas de termitas y listas de comprobación Wanyoni. I.

“Glossary of morphological characters used in ant taxonomy”. Completo. Región y autor Jones. D. Harvard University 144 Manual de biología de suelos tropicales . lombrices de tierra diplópodos. Department of Entomology. Harvard University Entomology. Bibliografía amplia y actual. 12–26 October. No publicado. T. 1–39. pp. sin fecha). (Anónimos. termitas. pero sin ilustraciones.Apéndice 1. prepared for ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. escarabajos del suelo. 2003. Notas Revisión moderna y completa de la naturaleza de la biodiversidad del suelo y métodos de evaluación rápidos para hormigas. Continúa. Isópteros y arañas (Araneae). (ed) 2003. Universiti Malaysia Sabah. lectura obligatoria. Título y referencias ‘Tools for the Rapid Assessment of Soil Invertebrate Biodiversity in the ASEAN Region’.

únicamente Kalotermitidae). Clave de soldados de Paracomitermes (anticuado). (2006). Revisión de mapas de distribución de especies del Nuevo Mundo con clave de soldados y alados. Las claves hasta género son dadas en Krishna (1961. Revisión y claves (anticuado y en alemán). Constantino (2001). Referencia Contenido RHINOTERMITIDAE Heterotermes TERMITIDAE Amitermes Anoplotermes Atlantitermes Cornitermes Cyranotermes Cyrilliotermes Labiotermes Light (1932). Clave de soldados de América del Sur. Claves de soldados de especies de Las Antillas (anticuado). Nasutitermes Parvitermes Procornitermes Holmgren (1910). Revisión de Labiotermes sensu stricto. Constantino (1997). Revisión y claves. con claves. Clave de soldados.Apéndice 2. Fontes (1985). Revisión y claves. Araujo (1954). Revisión y claves de soldados (en portugués). Constantino et al. Género KALOTERMITIDAE Cryptotermes Eucryptotermes Procryptotermes Bacchus (1987) Scheffrahn y Krecek (1999). Revisión mundial con revisión de claves de las especies antillanas con claves hasta la diagnosis de los soldados. Scheffrahn y Krecek. Clave de soldados. Emerson y Banks (1965). Scheffrahn y Krecek (2001). Claves de soldados de especies de Las Antillas (anticuado). Emerson (1952). Neocapritermes Parvitermes Krishna y Araujo (1968). Revisión y claves. 2002). Emerson (1952). M acrofauna 145 . Cancello (1986). Constantino (1990). Revisión y claves. Revisión y claves (anticuado). Snyder (1926). Scheffrahn and Krecek (1993). Trabajos taxonómicos con claves de especies de algunos géneros neotropicales. Constantino y DeSouza (1997). Mill (1983) y Constantino (1999. Clave de soldados. Clave de alados (anticuado).

Continúa.Apéndice 2. Género Procornitermes Referencia Emerson (1952). Revisión y claves (anticuado). Claves de soldados (anticuado). Fontes y Bandeira (1979). Emerson (1945) . Revisión y claves. Claves de soldados. Constantino (1995). Cancello (1986). Contenido Revisión y claves. Revisión y claves de soldados (en portugués). Rhynchotermes Rotunditermes Syntermes Fontes (1985). 146 Manual de biología de suelos tropicales .

vol. Termitidae. A. C. S. L. Literatura especializada en termitas neotropicales Araujo. vol.. 181–189. pp. Nasutitermitinae)’. Constantino. 125–131. pp. A. vol. A. pp. no 2208. University of Kansas Science Bulletin. Goeldiana Zoologi. Emerson. Constantino. (1952) ‘The Neotropical genera Procornitermes and Cornitermes (Isoptera. A. 55. H. distribution and ecology (Isoptera. (1986) ‘Revisão de Procornitermes Emerson (Isoptera. pp. vol. Emerson. A. R. 1–44.. pp. R. Revista Brasileira de Entomologi. M. pp. (2002) ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. 475– 540. S. 1–33. R. A. American Museum Novitates. 455–518. Termitidae)’. (1965) ‘The Neotropical genus Labiotermes (Holmgren): Its phylogeny. vol. 1. pp. 31. (2001) ‘Key to the soldiers of South American Heterotermes with a new species from Brazil (Isoptera: Rhinotermitidae)’. Tropical Zoology. F. Sociobiology. (1990) ‘Notes on Cyranotermes Araujo with description of a new species (Isoptera. Constantino. Bulletin of the American Museum of Natural History. Cuezzo. 463–472. 1–40. Constantino. O. 7. 83. pp. 1–91. pp. F. E. E. with a new species from Brazil (Isoptera: Termitidae: Nasutitermitinae)’. R. pp. (1954) ‘Notes on the genus Paracornitermes Emerson 1949 with description of two new species (Isoptera. R. 1–11. (1997) ‘Notes on Eucryptotermes with a new species from central Amazonia (Isoptera: Kalotermitidae)’. Constantino. vol. 205–213. y DeSouza. Bulletin of the American Museum of Natural History. (2006) ‘A taxonomic revision of the Neotropical termite genera Labiotermes Holmgren and Paracornitermes Emerson (Isoptera: Termitidae: Nasutitermitinae)’. pp.Apéndice 3.. pp. Termitidae. 189–236. R. 99. vol. Termitidae. Nasutitermitinae)’. E. vol. Bacchus. (1987) ‘A taxonomic and biometric study of the genus Cryptotermes (Isoptera: Kalotermitidae)’. Constantino. E. Cancello. y Vasconcellos. Schmidt. (1945) ‘The Neotropical genus Syntermes (Isoptera: Termitidae)’. N. A. paper 1340. y Banks. Insect Systematics and Evolution. Constantino. Nasutitermitinae)’. 10. 30. vol. Zootaxa. F. K. Emerson. vol. 427–472. Carvalho. Tropical Pest Bulletin. 36. Papéis Avulsos de Zoologia (São Paulo). R. pp. 2. Nasutitermitinae)’. M acrofauna 147 . paper 67. Termitidae. (1995) ‘Revision of the Neotropical termite genus Syntermes Holmgren (Isoptera: Termitidae)’. (1997) ‘Key to the soldiers of Atlantitermes Fontes 1979. Acioli. R. Zootaxa..

Florida Entomologist. R. y Krecek. Holmgren. pp. vol. (1910) ‘Versuch einer Monographie der amerikanische Eutermes – Arten’. H. 171–325. (1983) ‘Generic keys to the soldier caste of New World Termitidae (Isoptera: Insecta)’. L. Bulletin of the American Museum of Natural History. 303–408.Fontes. Proceedings of the US National Museum. 107–110. pp. vol. 179–190. R. 1–76. pp. Nasutitermitinae)’. y Krecek. (1932) ‘Contribution toward a revision of the American species of Amitermes Silvestri’. 84–138. y Araujo. 9. a new subterranean termite (Isoptera: Termitidae) from Cuba and the Dominican Republic’. Nasutitermitinae)’. F. (1999) ‘Termites of the genus Cryptotermes Banks (Isoptera: Kalotermitidae) from the West Indies’. pp. R. H. University of California Publications in Entomology. N. J. Krishna. (1926) ‘Termites collected on the Mulford Biological Exploration to the Amazon Basin 1921–1922’. pp. (2001) ‘New world revision of the termite genus Procryptotermes (Isoptera : Kalotermitidae)’. K. Snyder. vol. vol. 122. G. vol. 335–414. H. pp. J. 111–171. 148 Manual de biología de suelos tropicales . (1985) ‘New genera and new species of Nasutitermitinae from the Neotropical region (Isoptera. Bulletin of the American Museum of Natural History. 5. 94. Annals of the Entomological Society of America. (1968) ‘A revision of the Neotropical genus Neocapritermes (Isoptera. R. 3. Revista Brasileira de Entomologia. 23. y Bandeira. (1961) ‘A generic revision and phylogenetic study of the family Kalotermitidae (Isoptera)’. E. 7–25. vol. Termitidae. pp. L. Systematic Entomology. pp. Revista Brasileira de Zoologia. 13. vol. Fontes. y Krecek. L. Mill. Scheffrahn. 138. vol. pp. pp. Termitidae. pp. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten. T. (1979) ‘Redescription and comments on the Neotropical genus Rotunditermes (Isoptera. Light. Termitidae)’. Scheffrahn. J. R. 603–607. 530–539. 76. R. (1993) ‘Parvitermes subtilis. 68. E. A. K. vol. A. Krishna. Insecta Mundi. Scheffrahn. vol. vol. S. 27.

localizadas a por lo menos 14 m del centro del monolito. bien por el método Berlese-Tullgren o por el de Berlese modificado.0 mm. Protura. sin embargo. descrito en el Capítulo 2. Enchytraeidae. los núcleos de suelo se localizan en dos círculos concéntricos. b) del contenido líquido de las trampas pitfall. respectivamente. Cahyo Rahmadi. La mesofauna se colecta utilizando dos métodos de muestreo: a) una muestra compuesta que contiene varios núcleos de suelo y hojarasca extraída de la superficie. formas de larvas de especies de macrofauna también caen dentro del rango de tamaño de mesofauna. mientras las trampas pitfall se utilizan para colectar los que habitan en la superficie del suelo. sirven para colectar mesofauna que habita en el suelo mineral. acari y otra mesofauna del suelo: el método Berlese Agus Karyanto. a 3 m y 6 m de radio del monolito. 149 . El muestreo de la mesofauna (y otra biota del suelo) se encuentra integrado como parte de la estrategia global del inventario de la biodiversidad bajo del suelo. Elizabeth Franklin. y cuya abundancia no puede ser evaluada con exactitud por medio de la selección manual del suelo. Pauropoda y otros Nematodos son típicos representantes de la mesofauna. Acari (ácaros). en principio. Collembola (colémbolos). Susilo y Jose Wellington de Morais INTRODUCCIÓN La mesofauna está conformada por animales cuyo tamaño de cuerpo oscila entre 0.Capítulo 4 Collembola. Francis-X.2 y 2. Los núcleos de suelo. En cada punto de muestreo. por debajo de la hojarasca de la superficie y en la hojarasca en sí. y se complementan con pitfall.

En 1918. Lo anterior es aplicable para los grupos mayores de microartrópodos del suelo o a partir de las proporciones de abundancia y diversidad entre los grupos de mesofauna del suelo. forrajean en hongos y algas. MÉTODOS DE MUESTREO Los protocolos aquí descritos abordan principalmente los de los ácaros y colémbolos presentes en los horizontes minerales y en la hojarasca. sin embargo.) es suficientemente eficaz como para poder capturar colémbolos que viven en la superficie del suelo (edáficos). Tullgren modificó el método Berlese. son sedentarios (con la excepción de algunas familias como Galumnidae y Scheloribatidae). después de muertos. de manera que la muestra se seca lentamente. composición de especies y diversidad en un hábitat específico son buenos indicadores de un suelo “sano” (Minor. su abundancia. El principio es colectar pequeños núcleos o bloques y combinarlos para hacer una sola muestra compues150 Manual de biología de suelos tropicales . El método pitfall (Capítulo 3. y algunos son predadores. constituyen un componente integral de la estructura del suelo. por ejemplo. En este sistema circula agua caliente entre las paredes dobles de latón del embudo (o embudos).El método Berlese es un sistema de extracción por embudo para separar los pequeños artrópodos del suelo. se convierten en un importante desecho nitrogenado. con una diversidad de especies también muy alta y. fue desarrollado por Antonio Berlese. en contraste con los grupos más oportunistas como los colémbolos. no resulta útil para colectar ácaros oribátidos (Acari: Oribatida) porque estos animales. Se sugiere que para un muestreo normal ambas extracciones de embudo y pitfall deben emplearse de manera conjunta. en suelos no perturbados. su densidad puede alcanzar cientos de miles de individuos por m². se alimentan de nematodos vivos (Siepel. Debido a su papel regulador en la descomposición y el reciclaje de nutrientes. 1990). 2004). Los ácaros oribátidos (también conocidos como Cryptstigmata a los que se refieren como ácaros escarabajos o ácaros de caja) son artrópodos numéricamente dominantes en los horizontes orgánicos de la mayoría de los suelos. a finales del siglo XIX. reemplazando la envoltura de agua por un foco de luz eléctrica. 1990). asimismo. Estos ácaros se alimentan de materia de plantas vivas o muertas y de carroña. se pueden encontrar entre 50 y 100 especies (Norton. a su vez. Sus heces fecales proporcionan una amplia superficie para la descomposición primaria por hongos y bacterias y. al igual que en la formación de la estructura de suelo. normalmente.

son dañinos para los animales que se encuentran en la muestra. también se deben proteger de la lluvia durante el traslado. se colectan en el campo. utilizando una pequeña cuchara que tome un volumen constante de aproximadamente 100 ml. utilizando un sacabocados. Una vez en el laboratorio. La muestra compuesta de suelo se divide en 10 bolsas de nylon.5 x 3. las muestras del suelo pueden ser colectadas en muestras de 3. la fauna también puede morir. acari y otra mesofauna del suelo 151 . ésta deberá situarse en el asiento del pasajero. con o sin hojarasca. porque si éstas se mojan o humedecen demasiado. porque la tela permite que circule el aire. Dichas muestras deben permanecer alejadas del calor del motor del vehículo y de su sistema de escape. se colocan todos los costales de tela bajo techo. donde serán identificadas. Se ha observado que los costales de tela son muy eficientes para almacenar temporalmente y transportar las muestras durante largas distancias y tiempos. tanto la luz solar como el calor del motor. De la misma manera. De manera alternativa. C ollembola . De manera alternativa.1a y b). para ello es recomendable utilizar un vehículo con aire acondicionado.5 x 3. el suelo de 12 sub-muestras se coloca entonces en una bolsa de 5 kg como una muestra compuesta. para evitar que la mesofauna muera. se utilizan tres o cuatro muestras compuestas y no sólo una.5 x 5 cm de profundidad. y toma muestras a una profundidad de hasta 5cm que posteriormente se transfieren a un recipiente de plástico de 300 ml de volumen (Figuras 4. lo que provocaría la muerte de la mesofauna antes de su extracción. se etiquetan y se transfieren a un costal de tela de 30 x 35 cm de tamaño. con una capa de papel para mantener un ambiente de humedad estable dentro de la caja.ta. se debe evitar que la muestra se exponga a sol directo durante el encostalado en el campo. evitando que la temperatura se eleve. Si se transporta la muestra sin aire acondicionado. Este aparato mide 3.5 cm de ancho y 10 cm de alto. la cual es entonces sub-muestreada por extracción por el método de BerleseTullgren. Ahora las muestras estarán listas para su traslado al laboratorio. el suelo deberá someterse de inmediato a su extracción. con un promedio de un kilo por bolsa. Así. Al llegar al campo de base o laboratorio. de acuerdo con su localidad de muestreo. Las muestras de suelo. No se debe usar un costal de plástico porque la temperatura del suelo puede aumentar sustancialmente. El siguiente paso es almacenar las muestras en cajas grandes para transportarlas hasta el laboratorio. Enseguida se empacan las muestras en una caja de cartón.

de 1. hormigas. para evitar que otros insectos voladores pasen a formar parte de la muestra.2) es utilizado para extraer la mesofauna activa que habita en las muestras de suelo y en la hojarasca. Se coloca un tamiz (de 8 cm de diámetro y 5 cm de altura) con muestras de suelo y hojarascas encima del embudo.5 mm.Figura 4. Morais y E. deberá contener cuatro agujeros de 4 mm de diámetro para permitir que animales mayores escapen hacia abajo. cerca del área de referencia. Se calientan ligeramente los embudos. b) se utilizan guantes como precaución contra enredaderas. se mantiene el aparato en el laboratorio del campo de base. dividido en compartimentos superiores e inferiores. cada compartimento contará con un marco para sostener los embudos de plástico (Figura 4. Franklin. La manera ideal es utilizar un contenedor de madera de alrededor de 160 x 50 cm.1 Sacabocados de metal para muestrear la mesofauna en la hojarasca y en el suelo mineral. dejando los focos encendidos cada vez 152 Manual de biología de suelos tropicales . éstos se suspenderán a 14 cm por encima del tamiz. utilizando una pequeña cuchara o cuchillo de campo. aunque también se podrían usar los de 40 W. se debe incrementar el calentamiento de manera gradual cada día.2 a) al igual que puertas. utilizando para ello focos eléctricos (los de 25 W son ideales). arañas y otros artrópodos. Cortesía de: J. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado.W. El tamaño de malla del tamiz. A B EXTRACCIÓN Método Berlese-Tullgren El aparato Berlese-Tullgren (Figura 4.

evitando así que las especies que se mueven con mayor lentitud queden atrapadas en las capas secas y duras del suelo.durante mayor tiempo. acari y otra mesofauna del suelo 153 . hasta que mantengan un peso seco constante que generalmente tarda unos 8 días. Franklin. Típicamente. El principio básico del aparato Berlese-Tullgren es que los organismos de suelo responden al incremento de temperatura o sequedad en el suelo migrando hacia abajo hasta que finalmente caen a través de la malla. Nota: nótese que las patas están sumergidas en agua para evitar la invasión de hormigas y de otros insectos. para evitar que el material de la muestra se seque demasiado rápido. Figura 4. si se dejan durante más tiempo nacen los C ollembola . por un periodo de hasta 8 días.W. la temperatura de la muestra se aumenta gradualmente de 27°C hasta aproximadamente 40-45°C.2 a) contenedor de apoyo para embudos Berlese–Tullgren. la cual contiene un conservador. esto inmovilizará a la mesofauna antes de que se escape. Morais y E. b) sistema Berlese–Tullgren en operación. para una mayor efectividad. Las muestras se quedan en el aparato hasta que estén completamente secas. el embudo deberá presentar una superficie lisa y una fuerte pendiente. Se ajusta la posición de la lámpara para asegurar que la temperatura del suelo suba gradualmente. Cortesía de: J. de modo que los animales que caen por la malla lo hagan de manera rápida hasta llegar a la botella que los recibe. en una botella que los recibe hasta la base del embudo. es decir. por lo tanto.

al tiempo que utilizan el mismo principio para extraer un solo núcleo o una muestra conglomerada mayor.. es el adecuado para el secado sin electricidad. El uso de un foco puede atraer insectos nocturnos. pueden moverse con facilidad desde el lugar del muestreo y ser ajustados para acomodar un gran número de muestras. lo único que se requiere es un embudo más grande y un tiempo de secado más largo. el sistema Berlese-Tullgren y. que se muestra en la figura 4.huevos y las formas inmaduras se vuelven adultos. generalmente. El envase receptor se llena con etanol al 96% para su conservación y durante intervalos de 4 a 5 días se cambia el envase receptor. Son baratos y sencillos. 2002). En la presencia de luz. el tiempo de espera será de 7 a 14 días. Un sistema Berlese que opera sin luz muchas veces permite una mejor extracción. en donde se coloca un tamiz con una malla de 2 x 2 mm (malla 13). Asimismo. el de Berlese. se utiliza formol al 4% o etanol.5). al 96%. especialmente si el embudo Berlese no está perfectamente cerrado.3. El método Berlese modificado Cuando no se cuenta con electricidad. 2006). Para evitar lo anterior. cuando se compara con otros métodos de muestreo. el embudo se coloca sin luz y el proceso de calentamiento-secado se lleva a cabo simplemente a temperatura ambiente. con la colocación de una bombilla de 10 a 40W. el agujero de ventilación de la tapa deberá cerrarse durante la noche. el tiempo de incubación (tiempo necesario para extraer la fauna del suelo) es aproximadamente de 4 a 5 días. arriba de las muestras de suelo. en cierta manera. Una ventaja de dichos sistemas es que se pueden operar a diferentes escalas. aun en regiones remotas (Frankin y Morais. por lo que las muestras serán menos representativas. éste se cerrará con una tapa para prevenir la entrada de otros insectos. es uno de los más usuales para la extracción en la evaluación de la diversidad y densidad de microartrópodos del suelo (André et al. en este caso. 154 Manual de biología de suelos tropicales . un embudo de aluminio modificado de Berlese. aunque tomará más tiempo. dependiendo de las condiciones de humedad inicial del suelo. el equipo completo requerido es barato y puede ser fácilmente improvisado (Figura 4. El aparato Berlese sensu stricto puede transformarse en un modelo Berlese-Tullgren. A pesar de una eficiencia menor. Como líquido conservador.

PROCESOS DE ACLARADO Y MONTAJE DE ESPECÍMENES Para su identificación. con embudo superior de 40 cm de diámetro. R. Y.3 Embudos Berlese llenos de suelo y hojarasca. Figura 4. Suhardjono LIPI Bogor. los especímenes de mesofauna son montados sobre laminillas. después de su aclarado. El proceso de montaje debe realizarse bajo un microsC ollembola . Fuente: cortesía del Dr. de 50cm de altura.4 Embudo Berlese modificado. acari y otra mesofauna del suelo 155 . hecho de aluminio.Figura 4.

. Los taxa con cutículas delicadas. como algu156 Manual de biología de suelos tropicales . durante dos a cinco minutos. se transfieren los especímenes a una solución de cloral fenol. durante unos minutos.Figura 4. fácil y seguro. Coelho. mediante el lavado y removido de las grasas y pigmentos del cuerpo.5 Equipo básico requerido para llevar a cabo extracciones Berlese-Tullgren núcleo por núcleo. aunque Greenslade et al. (2008) propusieron una solución de KOH 10% durante 1 a 5 minutos. Un método más simple de aclarado es utilizando ácido láctico. 2008). hasta neutralizar la reacción.. la observación de la morfología. y da buenos resultados (Greenslade et al.R. dependiendo del tamaño. en donde se sumergen y calientan durante los diferentes periodos de tiempo. con o sin calentamiento. normalmente. aunque el hidróxido de potasio (KOH) y el ácido láctico son alternativas efectivas. Después de la inmersión en KOH. Cortesía de: M. copio de disección. Los especímenes pueden ser aclarados con un 15% de KOH. requiere de un microscopio compuesto. normalmente se usa una solución de Nesbitt (su composición se describe a continuación). este método es más barato. dependiendo del pigmento y de la grasa del cuerpo del animal. Para ello. Proceso de aclarado El aclarado consiste en volver más transparente el tejido de los especímenes.

con el propósito de identificarlos viendo la quetotaxia de cada parte. el medio líquido Hoyer. se recomienda la disección en el caso de Symphypleona y de las Paronellidae y Entomobrydae mayores (6 a 8mm). fúrcula. En cada caso se debe regular y controlar el tiempo. porque el ácido láctico continúa aclarándolos y ablandándolos. mientras que para los Entromobrymorpha. En el caso de especímenes mutilados. tales como cabeza. Los ácaros esclerotizados pueden ser aclarados con lactofenol (compuesto por ácido láctico. tubo ventral y en los segmentos V y VI abdominales. De nuevo.. Después de su identificación. si no se hace. acari y otra mesofauna del suelo 157 . Para dicho montaje se requiere de una solución Berlese. por lo menos. Las especímenes son montados en laminillas y secadas en el horno a 70°C durante.nos Diplura. estos especímenes deberán sumergirse en una mezcla de 50% de ácido láctico/etanol durante unas horas. la posición indicada es látero-lateral. por ejemplo. Symphypleona y Neelipleona. Las partes diseccionadas del cuerpo de los Entromobrymorpha deberán colocarse de forma dorso-ventral sobre el portaobjetos. los especímenes pueden destruirse o desarticularse. Otras soluciones. sin calentamiento. patas. siete días. en proporciones 50:25:25) o simplemente con ácido láctico (frío o caliente). utilizando el ejemplo de los colémbolos. los especímenes deben transferirse a otro medio. en el C ollembola . muchos ácaros oribátidos se guardan en viales etiquetados. La posición de los especímenes sobre el portaobjetos difiere entre los órdenes: por ejemplo. también pueden usarse para el proceso de montaje (Tabla 4. Para un almacenaje permanente. abdomen pequeño y fúrcula (dorsoventral). 2008). los colémbolos Poduromorpha se deben colocar en posición dorso-ventral. La disección se realiza en varias partes del cuerpo. Los ácaros también pueden aclararse y conservarse trasladándolos del alcohol a un medio de Hoyer. es aconsejable montar todas las partes del cuerpo en una sola preparación. mientras que las partes del cuerpo de los Symphypleona grandes se montarán de la siguiente manera: cabeza (dorsoventral). Normalmente. al que se añade un 5% de glicerina. Algunos grupos necesitan ser disecados o disectados antes del montaje. como característica clave.1). con alcohol 70%. para que puedan ser bien identificados. Montaje No existen métodos totalmente satisfactorios para el montaje (Greenslade et al. cristales de fenol y agua destilada. Protura y Pauropoda no deben meterse en una solución concentrada de ácido. abdomen grande (látero-lateral).

esta última dirección también concentra la literatura principal.edu/course/ent591k/kwikey1. aunque también se puede usar para otros grupos de mesofauna.cals. 15 g de goma arábiga. donde se indican las características distintivas de varios grupos de invertebrados. Para aclarar especimenes solución Nesbitt’s 10% KOH ó NaOH Montaje de especimenes : medio líquido de Berlese 25 ml de agua destilada. Se encuentran disponibles varias páginas en la web. www.massey. Se coloca de manera parcial un cubreobjetos sobre la depresión y se empuja el espécimen por debajo del recubrimiento.ac.htm o http://soilbugs. 40 g de hidrato de cloro y 2. Trave (1965). A nivel de especies. 10 g de glucosa y 5 ml de ácido acético glacial. sin embargo. Tabla 4. 5 ml de glicerina. 158 Manual de biología de suelos tropicales . una identificación más allá de este nivel. 50 g de hidrato de cloro. en el caso de la mayoría de los grupos de artrópodos de suelo. IDENTIFICACIÓN DE ESPECÍMENES Y ANÁLISIS DE DATOS Identificación La mayoría de los invertebrados del suelo pueden identificarse hasta orden o familia con la ayuda de trabajos estándares de referencia. Por ejemplo. hacia el borde de la depresión. pero las preparaciones pueden hacerse semipermanentes sellando el recubrimiento con barniz de uñas transparente.5 ml de ácido hidroclórico 20 ml de agua destilada.1 Composición química para aclarar y montar especímenes. El medio líquido de Hoyer es un agente temporal y no se endurece con calentamiento. resulta difícil. 50 ml de agua destilada. 30 g de goma arábiga. Montaje de especimenes: medio líquido de Hoyer Nota: montaje Berlese: calentar a 70°C durante 7 días. ofrecen una buena discusión de fondo acerca de cómo aclarar y montar ácaros. 200 g de hidrato de cloro y 20ml de glicerina. de donde se pueden obtener guías de ayuda para la identificación. la pericia taxonómica quizás sea el factor determinante en la selección de una taxa para su estudio posterior. Krantz (1978) y Norton (1990). El espécimen puede rodarse suavemente hasta conseguir la orientación deseada.ncsu.caso de ácaros de suelo. El espécimen se traslada a unas gotas de ácido láctico o glicerina en un portaobjetos excavado. se hace un montaje temporal. tales como los de Bachelier (1978) y Dindal (1990).php.nz/key.

Opiliones. ya que contiene guías de identificación ilustradas. de especies para algunos grupos como Nematoda. El libro se escribió para un fácil manejo. Análisis de datos El número de individuos en cada orden y en cada lugar. Pseudoscorpionida. Desafortunadamente. Enchytraeidae. es mostrado en Dindal (1999). Isopoda. C ollembola . Protura. 1981b. por lo menos. Publicaciones de Yoshii (1981a. Pauropoda. a nivel genérico. son combinadas para crear una muestra compuesta que se somete a extracción. por lo que es recomendable tanto para principiantes como para profesionales.permitiendo así. en las familias Entomobryidae y Paronellidae. Scorpiones.1982b y 1983) pueden utilizarse para identificar colémbolos a nivel especies. familias. hasta nivel de familia y. Mites. al igual que referencias de la taxonomía actual de estos grupos. Los subórdenes de ácaros y muchas familias de colémbolos son de fácil identificación. Isóptera. Coleoptera. utilizando pequeños núcleos o bloques. 1982a. Asimismo. El libro contiene claves de identificación para todas las clases. la identificación de colémbolos. la identificación a nivel género y/o especies. Bachelier (1978) ofrece buena información de fondo dentro de las amplias unidades taxonómicas de artrópodos del suelo e incluye guías ilustradas para varios grupos. taxonomía y ecología de grupos de la biota del suelo. La base de identificación y clasificación se encuentra resumida en las referencias que se citan a continuación.. Diptera y Hymenoptera. Las muestras colectadas. Collembola. Symphyla. algunas veces. acari y otra mesofauna del suelo 159 . Balogh y Balogh (1990) ofrecen una breve caracterización y claves de identificación para ácaros oribátidos que habitan en la región neotropical. son escasas las guías específicas para este grupo en los trópicos. Balogh y Mahunka (1983) y Balogh y Balogh (1992). se encuentra disponible en Greenslade et al. 1999). una vez conocida su morfología y características básicas (Crossley y Coleman. quienes ofrecen guías y figuras a nivel genérico para ácaros que pertenecen a la suborden Oribatida. es utilizado para estimar su abundancia. al igual que una lista de comprobación y bibliografía de especies descritas en esta área. Adis (2002) ofrece guías ilustradas para principiantes y cualquier persona interesada en Arachnida y Myriapoda Neurotropicales. órdenes. Araneae. a nivel familia. están disponibles en Kranz (1978) y Dindal (1990). 2008. algunos géneros y listas de especies terrestres conocidas. Balogh (1972). Los recursos para la identificación de ácaros. Chilopoda. Diplura. por ejemplo. Un estudio completo de la biología.

reality or conning?” Oikos.. Dado que los grupos de lugares similares ofrecen una fauna similar y que la mayoría de animales del suelo pueden distribuirse en los grupos funcionales básicos (Ruf et al. (1978) “La faune des sols. (2002) “Soil biodiversity: Myth. y Lebrun. por lo tanto. G. un nuevo estimador estadístico que toma en cuenta especies compartidas no detectadas. Este procedimiento mejora la eficiencia de la extracción porque maximiza las posibilidades de captura de grupos o especies representativos. Los datos obtenidos deben. J. El programa DIVERS. Este índice resulta especialmente útil para eliminar invertebrados hiper-diversos. Paris. o bien. no 38. 2005. Este estimador. Ducarme. incluir la riqueza de especies en el caso de los taxa seleccionada para la identificación a nivel especies. ejemplo: ácaros oribátidos. 3–24.. 160 Manual de biología de suelos tropicales . con numerosas especies raras. pueden ser calculados utilizando el programa EstimateS (Colwell. Bachelier. 2006). 2003). del paquete de metodología ecológica para Windows. Pensoft. predadores. La comparación de la composición de taxa entre usos de suelo debería llevarse a cabo utilizando un análisis jerárquico de agrupación y la unión promedio de agrupaciones de los datos transformados.). El número de individuos normalmente se transforma de forma logarítmica log: x’=log10 (x+1) para evitar dar mayor peso a las especies dominantes en el análisis de datos (Ludwig y Reynolds. Ph. junto con otros índices de diversidad. (2002) Amazonian Arachnida and Myriapoda. puede usarse para calcular los índices de riqueza de especies. Se ha demostrado que datos a nivel género y familia. de acuerdo con su función ecológica mayor (detritivoros. 2006). vol. Initiations et Documents Techniques. los taxa escasamente conocidos también se pueden clasificar a niveles taxonómicos más altos (orden o familia). REFERENCIAS Adis. También puede llevarse a cabo un análisis adicional como rarefacción y estadística multivariada. Sofia-Moscow. son écologie et son action“. André. también pueden detectar los efectos de la perturbación con poca pérdida de información y llegar a ser una herramienta preliminar para describir patrones y sucesiones en ecosistemas del suelo perturbado por humanos (Caruso y Migliorini. 96.utilizando el método Berlese-Tullgren. ácaros oribátidos y hormigas.. H. M. 2006. etc. basada en la correspondencia estadística entre combinaciones de singletons y de otras especies raras (estimador de abundancia Chao-SØrensen) fue desarrollada por Chao et al. X. pp. ORSTOM. 1988). fitofagos. tales como colémbolos.

F.eeb. Brill. (2006) ‘Micro-arthropod communities under human disturbance: Is taxonomic aggregation a valuable tool for detecting multivariate change? Evidence from Mediterranean soil oribatid coenoses’. Minor. John Wiley and Sons. (1988) Statistical Ecology: A Primer on Methods and Computing. R. J. L. in J. vol. Colwell. in D. no 1. John Wiley and Sons. Amsterdam. (1990) Soil Biology Guide. Oregon State University Book Store Inc. 46–53. Version 8 User’s Guide and Application’. y Shen. y Reynolds. Oregon. Y. K. A. (2005) ‘A new statistical approach for assessing compositional similarity based on incidence and abundance data’. R. Chazdon. T. (2004) ‘Soil mites and other animals’. acari y otra mesofauna del suelo 161 . L. Dindal. J. (1990) ‘Acarina: Oribatida’. (2006) ‘Soil Mesofauna in Central Amazon’. http://viceroy. Balogh. J. (1999) ‘Microarthropods’. in M. E. Budapest.. 2. K. J. no. Ecology Letters. y Suhardjono. y Coleman. R. y Mahunka.massey. E. 59–65. Chao.Balogh. (1992) The Oribatid Mite Genera of the World. Chazdon. www. W. Leiden (in press). J. in F. C ollembola . L. Krantz. M. 148–159.nz/~maminor/mites. (1990) ‘Oribatid Mites of the Neotropical Region II’.ac. M. (2006) ‘Abundance-based similarity indices and their estimation when there are unseen species in samples’. J. uconn. y Shen. Colwell. S. New York. Colwell.edu/estimates. P. Brussaard (eds) Soil Biodiversity in Amazonian and Other Brazilian Ecosystems. 8. Wallingford. Hungarian Natural History Museum Press.. R. Elsevier. y Balogh. A. S Moreira. CRC Press. 62. Acta Oecologica. Bedos. Boca Raton. P. Caruso. (1972) The Oribatid Genera of the World. John Wiley & Sons. J. html. pp. (2008) Handbook to Collembola of Indonesia. L. pp. Chao. Akadémiai Kiadó. Budapest. D. Deharveng. pp. Norton. Crossley. O. (1978) A Manual of Acarology. Mahunka (eds) The Soil Mites of the World. W. no. Ludwig.. pp.. 2. Greenslade. accessed 10 January 2008. A. Sumner (ed) Handbook of Soil Science. vols 1 and 2. y Morais. P. L. J. 779–803. (2006) ‘EstimateS: Statistical estimation of species richness and shared species from sample. 142–162. Biometrics. T-J. R. A. vol. 30. Balogh and S. pp. (1983) Primitive Oribatids of the Palaearctic Region.. K. y Balogh. R. New York. pp. D. G. Balogh. M. CABI Publishing. Fauna Malesiana. T-J. R. Amsterdam. Franklin. Balogh. vol. Dindal (ed) Soil Biology Guide. A. Siqueira and L... Elsevier. New York. y Migliorini. 361–371. D.

Oribatida. 8112. Oribatida. Entomological Report from the Sabah Forest Research Centre No. R. Nothrus silvestris Nicolet (Acari. (1990) ‘Niche relationships between two panphytophagous soil mites. 2. vol. J. J. 81-12. Yoshii. Nothridae) and Platynothrus peltifer (Koch) (Acari. 7. Japan International Cooperation Agency. Yoshii. Beck. EX-1 JR. 2. EX-1 JR. pp. 1–70. J. (1982a) ‘Lepidocyrtid Collembola of Sabah’. 98. 1–28. vol. Yoshii. 4. y Spelda. Ecosystems and Environment. Fert. 1–70. pp1–38. R. Entomological Report from the Sabah Forest Research Centre No. (1982b) ‘Studies on the Collembolan Genera Callyntrura and Dicranocentroides’. Entomological Report from the Sabah Forest Research Centre No. (1981a) ‘Paronellid Collembola of Sabah’. (1965) “Quelques techniques de récolte. (2003) “A biological classification concept for the assessment of soil quality: “Biological soil classification scheme” (BBSK)’. Revue d’Écologie et de Biologie du Sol. pp.. pp. Biol. pp. R. Entomological Report from the Sabah Forest Research Centre No. (1981b) ‘Neanurid Collembola of Sabah’. Agriculture. Yoshii. 1–3. Travè. Römbke. pp. Siepel.. 9. R. Yoshii. pp. no.. H. d’observation et de conservation des Oribates (Acariens) et autres microathropodes”. P. Japan International Cooperation Agency.Ruf. 263–271. Japan International Cooperation Agency. 6.. pp. Japan International Cooperation Agency. R. Japan International Cooperation Agency. Soils. de triage. Entomological Report from the Sabah Forest Research Centre No. K. 5. Hund-Rinke. 139–144. 23–47. (1983) ‘Studies on Paronellid Collembola of East Asia’. no. 162 Manual de biología de suelos tropicales . 1–38. 3. Dreher. L. A. Camisiidae)’. vol.

ellos son responsables del 10 a 15% de la respiración de los animales del suelo (Sohlenius. además de estos bene163 . los cuales se consideran uno de los grupos de animales más abundantes y más diversos en el planeta. los nematodos están presentes en cualquier lugar donde exista carbono orgánico. sin embargo. ellos juegan un papel importante como agentes de ciclado de nutrientes y como reguladores de la fertilidad del suelo mediante el flujo de energía y la movilización y utilización de nutrimentos (Procter. algas. Derivado de su evolución. animal y de plantas. mientras que las formas de vida libre se alimentan de microorganismos (bacterias y hongos). los nematodos parásitos tienen la capacidad de colonizar y alimentarse de tejidos de plantas y animales. 1980. La palabra nematodo deriva del griego “nema” que significa “forma de un hilo”. Huang (†) INTRODUCCIÓN Los nematodos del suelo son pequeños invertebrados dependientes del agua. protozoarios. son conocidos como una amenaza para la salud humana. Petersen. 1982).Capítulo 5 Nematodos del suelo Juvenil E. los nematodos se adaptaron a la exploración de una amplia variedad de fuentes de alimento. Aunque la biomasa de nematodos en el suelo es pequeña (10¹ a 104 mg peso seco m-2). ya que poseen un cuerpo alargado y cilíndrico. De esta manera. Cares y Shiou P. Los nematodos en una primera aproximación. otros nematodos y microinvertebrados. Debido a su gran capacidad de adaptación. en todas las latitudes del planeta y desde fondo del mar hasta la cima de las montañas. 1990).

compuestos por lo general de cinco grupos funcionales principales: parásitos de plantas.ficios para el ecosistema. mientras otros ocupan áreas más restringidas. así como su ciclo de vida corto y sensibilidad ante alteraciones ambientales. equipados en su mayoría con un estilete pequeño y delicado (Ilustración 2b). Por tal motivo. Su omnipresencia y abundancia en todo tipo de suelos y hábitats acuáticos. bacteriófagos. también participan en importantes servicios del agroecosistema al fungir como agentes de control biológico de plagas de insectos. así como alimentarse y diseminar bacterias benéficas y fitopatógenas. Los micófagos. en algunos casos. patogénicos. los califican como poderosos bioindicadores de condiciones ecológicas (Huang y Cares. algunos nematodos micófagos son pueden comportarse como parásitos facultativos de plantas. Los omnívoros tienen la cavidad bucal armada con un estilete hueco (Ilustración 2e). Se distinguen también entre ellos mismos por su 164 Manual de biología de suelos tropicales . tal es el caso de los nematodos entomofílicos Deladenus siricidicola o los entomopatógenos Steinernema carpocapsae y Heterorhabditis bacteriophora. Como típicos estrategas r. se alimentan de las hifas de hongos saprofíticos. los nematodos están bien representados a lo largo de la red trófica del suelo. Los nematodos bacteriófagos. microinvertebrados y protozoarios. los nematodos bacteriófagos pueden incrementar su población ante cualquier perturbación del suelo o bien. 2006). por lo que pueden fungir como micófagos. herbívoros y también como depredadores al alimentarse de otros nematodos. mediante el cual puede causar pérdidas significativas en varios cultivos. pueden regular el nitrógeno y el fósforo disponible para las plantas. Los nematodos del suelo viven en grupos o gremios. mismos que carecen de estilete (Ilustración 2c). influir en la nodulación por parte de bacterias tipo Rhizobium. una condición que puede interpretarse como indicador de la fertilidad del suelo (Ferris et al. con la capacidad de alimentarse de cualquier fuente. o en algunos casos. depredadores y omnívoros (Ilustración 2). en la mayoría de los casos la identificación de los diferentes grupos funcionales puede lograrse en base a la morfología de su aparato bucal. En el caso de nematodos parásitos de plantas. son polífagos. pueden alimentarse de bacterias y esporas de hongos. Algunos nematodos viven en un amplio rango de ambientes. bajo condiciones de enriquecimiento de nutrimentos. micófagos. 2001). bacteriófagos. poseen un estilete que les permite alimentarse de otros nematodos. benéficos y micorrízicos. Aunque la identificación de estos organismos requiere de intenso entrenamiento. el aparato bucal incluye un estilete tipo aguja (lustración 2a). Los nematodos depredadores tienen la cavidad bucal equipada con una o más estructuras en forma de dientes (Ilustración 2d).

poseen una baja movilidad. Para colectar el suelo se utiliza un nucleador de acero y las muestras se toman en cuatro puntos equidistantes en el círculo pequeño.1). tomando en cuenta su diversidad. por tal motivo. producen muchos huevecillos pequeños. y ocho puntos en el círculo grande. Según lo propuesto por Bongers (1990) y Bongers y Borgers (1998).sensibilidad a la perturbación del suelo y a los contaminantes químicos. una ausencia de dauerlarva y sensibilidad ante contaminantes y otros factores de perturbación. abundancia y estructura de comunidad. muestran la presencia de dauerlarva e incrementan sus poblaciones cuando existen condiciones ricas en alimentación. puede presentar un índice de sistemas de uso de suelo y cambios de uso de suelo y medir los niveles de perturbación provocados por contaminantes y otros factores. Las muestras son transportadas al laboratorio en una caja aislada y almacenadas a 4° C hasta su extracción. se agita durante 30 segundos y se deja reposar otros 2 minutos para que las partículas del suelo se sedimenten. lo cual deberá hacerse con la mayor rapidez posible. pero más grandes. MUESTREO DE SUELO En cada punto de muestreo dentro de un sistema de cuadrícula (véase Capítulo 2). Los doce núcleos de suelo se depositan en una bolsa de plástico que deberá sellarse para evitar su desecación y además protegerla de la luz solar. un análisis apropiado de la comunidad de nematodos. los nematodos persistentes (similares a estrategas k) se caracterizan por necesitar un largo tiempo de generación. y los nematodos se colectan directamente en un tamiz de 400 mallas (tamaño de malla de 37 µm) (Figura 5. respectivamente). los nematodos colonizadores (similares a los estrategas r) típicamente poseen un tiempo de generación corto. Por otra parte. con un radio de 3 m y 6 m. la cual se vacía a una cubeta con 2 litros de agua. todos los núcleos de suelo se deben tomar a una profundidad de 20 cm. se trazan dos círculos concéntricos. EXTRACCIÓN DE NEMATODOS La muestra de suelo se mezcla completamente y se toma una submuestra de 300 ml. Esta suspensión se pasa a través de tamices de 40 a 60 mallas (tamaño de malla de 250 a 350 µm. respectivamente. A esta última suspensión de nematodos se le pueden eliminar aún más partículas de N ematodos del suelo 165 . además son los más resistentes a la perturbación del suelo y a contaminantes químicos. producen pocos huevillos.

suelo mediante un método modificado de centrifugación con flotación de azúcar (Jenkins. el sedimento o botón dentro del tubo de centrífuga se resuspenden en solución de sacarosa (456g L-1) (Figura 5.500 rpm durante 5 minutos y el sobrenadante se descarta. La suspensión.000 rpm durante uno a dos minutos.2b). la suspensión acuosa se centrifuga primero a 3. para luego colectarse en un vaso de precipitados (Figura 5. se distribuye en tubos de ensayo para su fijación. 1964). En este procedimiento. Los especímenes que se hallan sobre la malla se lavan y arrastran con agua. juego de tamices de metal (de tamaño de malla 45 arriba y 400 abajo). 166 Manual de biología de suelos tropicales . Posteriormente.2a) y se centrifuga de nuevo a 1.3b) y. contenida en el vaso. Posteriormente. FIJACIÓN Y CONTEO DE NEMATODOS Los nematodos extraídos se matan con agua caliente a 50-60°C durante un máximo de un minuto (Figura 5. los nematodos se colectan a partir del sobrenadante utilizando un cernidor con tamaño de malla de 37 µm (Figura 5. posteriormente se fijan con solución Golden 2X (Hooper. y a la derecha. se añade un volumen igual de solución Golden Figura 5.1 A la izquierda. éstos se dejan reposar durante 30 minutos y se remueve el exceso de sobrenadante utilizando una pipeta o por medio de succión al vacío (preferentemente). 1970). suspensión de suelo en reposo. dejando así una suspensión de nematodos de 10 a 20 ml.3a). Una vez calentados los tubos.

2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos. 2X. a b Figura 5. La suspensión resultante se ajusta a un volumen de 15 ml y se cuenta el total de nematodos en la población mediante la toma al azar. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa. N ematodos del suelo 167 . el número total se obtiene de multiplicar la media de tres conteos de manera que el número total representará el número medio de 3 conteos de submuestras x 15. La rejilla que contiene a los tubos se sumerge en un recipiente con agua.3 a) Nematodos recuperados mediante el lavado de malla de 400.Figura 5. con lo que se obtiene una concentración final de formol 3.2%. de alícuotas de 1 ml. b) muerte de nematodos en agua caliente.

se tapa la caja y se deja nuevamente en el desecador durante la noche. Nickle y Hooper.1) y el volumen resultante se vacía por completo en una caja Petri de 5 cm de diámetro.5. Cares y Huang. 1951. Andrássy. 168 Manual de biología de suelos tropicales .. mientras que la composición de las soluciones se puede observar en la Tabla 5.4). aunque en la última ocasión no es necesario añadir solución Seinhorst II pero sí incubar a la misma temperatura durante otras 48 horas para evaporar todo el alcohol. la caja se retira del desecador y se deja evaporar a la misma temperatura durante un mínimo de cuatro horas. Se hace una selección al azar de aproximadamente 100 nematodos montados para su identificación a nivel de género. 1988. 1983. utilizando una gota de glicerina deshidratada como medio de montaje. Maggenti. en esas condiciones se retira la tapa de la caja para que se reduzca por lo menos a la mitad de su volumen. 1991. 1993. Al segundo día. Smart Jr y Nguyen. Estos pasos se repiten tres veces. Jairajpuri y Ahmad. 1991. la caja se coloca en un desecador a 43°C durante la noche (Figura 5. Bongers. al final. Después de este proceso. 1961. Fortuner.7). utilizando un microscopio compuesto (se requiere un aumento de 400 a 1. 1988. Decraemer. Geraert. Hunt. Loof. La identificación de nematodos por caracteres morfológicos se basa en la literatura taxonómica especializada (Goodey. 1994. 1991. El volumen de la caja se reestablece con solución Seinhorst II. 1991.1. Smart Jr y Nguyen. 1959) suele modificarse para evitar la laboriosa tarea de pescar individualmente cada nematodo y elaborar numerosas preparaciones permanentes. la preparación se sella utilizando bálsamo de Canadá (Huang et al.INFILTRACIÓN CON GLICERINA Y OBSERVACIÓN DE NEMATODOS El método de Seinhorst (Seinhorst. los nematodos de la caja se montan en laminillas. Tabla 5. 1991.000 x).1974. 1991.6). 2000. May et al. se coloca una tira de cinta adhesiva para evitar que el cubreobjetos aplaste a las especímenes. Anderson y Potter. La modificación consiste en reducir a 3 ml el volumen de la suspensión (Figura 5. Raski. 1991. Antes de colocar el cubreobjetos de vidrio sobre la gota. 1992. Baldwin y Mundo-Ocampo.5. 1984) (Figura 5.. Thorne. Goseco et al. 2001). 1991. 1991. El procedimiento se ilustra en la Figura 5. 1996. 1991. luego se añaden 7 ml de la solución Seinhorst I (Figura 5.

Evaporación a 43°C durante 4 hrs para reducir a la mitad del volumen Completar volumen con Seinhorst II Evaporación a 43°C durante 4h para reducir el volumen a la mitad Desecador a 43°C durante la noche N ematodos del suelo 169 .Figura 5.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos Figura 5. Nematodos en: Golden (3 ml) + Seinhorst I (7 ml) Evaporación a 43°C durante 4h para reducir el volumen a la mitad Completar volumen con Seinhorst II Desecador a 43°C durante la noche Desecador a 43°C durante la noche Desecador a 43°C durante la noche Evaporación a 43°C durante 48 horas.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos. Las cajas Petri no deben contener más de una tercera parte de líquido.

Foto: Marcella A.7 Charola con montajes permanentes de especímenes de nematodos. Foto Francisco Franco. 170 Manual de biología de suelos tropicales . Nota: el fondo del contenedor se mantiene a 43°C. Figura 5. Teixeira.Figura 5.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina.

Los datos de frecuencia y abundancia de los diferentes grupos tróficos se usan para calcular el Índice de Diversidad Trófica y varios cocientes que consideran la abundancia relativa de los grupos tróficos. donde S = número de géneros y N = número total de nematodos].1 Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina. cuando un nematodo tiene dos tipos de hábitos alimenticios. Equitatividad del Índice de Diversidad de Simpson [Es = Ds/Ds max’ donde Dsmax = 1 – 1/S Equitatividad del Índice de Diversidad de Shannon (J’= H’/H’max’ donde H’max = Log2 S]. Golden X Formol (+ 40% formaldehído) Glicerina Agua destilada Alcohol 96% Glicerina Agua destilada 8 partes 2 partes 90 partes Seinhorst I 20 partes 2 partes 78 partes Golden 2X 16 partes 4 partes 80 partes Seinhorst II 95 partes 5 partes ÍNDICES Y PARÁMETROS PARA LA CARACTERIZACIÓN DE POBLACIONES DE NEMATODOS Los nematodos identificados a nivel de género pueden dividirse en cinco grupos tróficos: parásitos de plantas. empleando las fórmulas que se mencionan líneas adelante. Índice de Diversidad de Shannon [H’ = . Índice de Riqueza de Género [d = (S – 1)/log N. donde pi = porcentaje de género ‘i’ en la abundancia total]. Los datos sobre frecuencia absoluta. abundancia total y abundancia relativa de cada uno de los géneros. N ematodos del suelo 171 . pueden utilizarse para calcular índices de diversidad y equitatividad. bacteriófagos.Tabla 5. Si un nematodo posee dos tipos de hábito alimenticio. (1993). Índice de Diversidad de Simpson [Ds = 1 – Σ(pi)². todos ellos basados en los criterios de Yeates et al. depredadores y omnívoros. su número poblacional se divide entre dos para cada hábito.Σpi log2 pi]. micófagos.

el Índice de Madurez (IM) (que incluye únicamente nematodos de vida libre) (Tabla 5. Magurran. 1998).2 Familias y valores cp utilizados para el índice de madurez* Familia Neotylenchidae Anguinidae Aphelenchidae Aphelenchoididae Rhabditidae 172 valor cp 2 2 2 2 1 Familia Achromadoridae Ethmolaimidae Cyatholaimidae Desmodoridae Microlaimidae valor cp 3 3 3 3 3 Manual de biología de suelos tropicales . 1978. asignándoles un “valor cp” en una escala de 1 a 5. Krebs. Σ(vi x fi) (donde vi = valor c-p de 1 a 5 para el género ‘i’. presentan dauerlarvae o estadios de sobrevivencia y crecen bajo condiciones de riqueza de alimento. producen muchos huevecillos pequeños. respectivamente). Los colonizadores cp1 se caracterizan por tener tiempos generacionales cortos. Tabla 5. La relación micófagos/bacteriófagos (M/B) y (micófagos+bacteriófagos)/parásitos de plantas [(M+B)/PP]. baja movilidad. donde pi = abundancia relativa de un grupo trófico . 1994]. y el cociente IFP /IM como un indicador de fertilidad del suelo. se han utilizado varios índices para la evaluación del suelo. Bongers (1990) dividió a los nematodos del suelo en una serie desde los colonizadores (c) hasta los persistentes (p) (similar a los estrategas r y k. y fi = frecuencia relativa del género ‘i’). ausencia de dauerlavae y elevada sensibilidad ante la presencia de contaminantes y otros factores de perturbación (Bongers y Bongers.2) y el Índice Fitoparasítico (IFP) (que incluye únicamente parásitos de plantas) (Tabla 5. 1990). Para medir el nivel de perturbación del suelo (Bongers. Por el contrario. Porcentajes de criconematidos y de dorylaimidos en la población. Yeates (1994) amplió el Índice de Madurez para incluir a todos los nematodos del suelo (mIM). 1988. Bongers y Bongers (1998) propusieron IM2–5 (igual que IM. siempre están activos. véase Norton.3). pero excluyendo a los nematodos cp1) para evaluar factores de estrés inducidos por contaminación. Índice de Diversidad Trófica [T = 1/ Σ(pi)². la producción de pocos huevecillos pero muy grandes. En base a estos conceptos. los persistentes cp5 se distinguen por tiempos generacionales largos.

2 Familias y valores cp utilizados para el índice de madurez* Familia Alloionematidae Diploscapteridae Bunonematidae Cephalobidae Ostellidae Panagrolaimidae Myolaimidae Teratocephalidae Diplogasteridae Neodiplogasteridae Diplogasteroididae Tylopharyngidae Odontopharyngidae Monhysteridae Xyalidae Linhomoeidae Plectidae Leptolaimidae Halaphanolaimidae Diplopeltidae Rhabdolaimidae Chromadoridae Hypodontolaimidae Choanolaimidae valor cp 1 1 1 2 2 1 2 2 1 1 1 1 1 1 2 3 2 3 3 3 3 3 3 4 Familia Odontolaimidae Aulolaimidae Bastianiidae Prismatolaimidae Ironidae Tobrilidae Onchulidae Tripylidae Alaimidae Bathyodontidae Mononchidae Anatonchidae Nygolaimidae Dorylaimidae Chrysonematidae Thornenematidae Nordiidae Qudsianematidae Aporcelaimidae Belondiridae Actinolaimidae Discolaimidae Leptonchidae Diphtherophoridae valor cp 3 3 3 3 4 3 3 3 4 4 4 4 5 4 5 5 4 4 5 5 5 5 4 3 Nota: *Bongers (1990). . Tabla 5.Tabla 5.3 Familias y valores cp utilizados para el índice fitoparasítico cp2 Tylenchidae Psilenchidae Tylodoridae cp3 Dolichodoridae Hoplolaimidae Pratylenchidae cp4 Trichodoridae cp5 Longidoridae N ematodos del suelo 173 Nota:*modificado de Bongers (1990).

Applied Soil Ecology. Baldwin. Bongers. y Huang. (1983) A taxonomic review of the suborder Rhabditina (Nematoda Secernentia). (1998) ‘Functional diversity of nematodes’. J. J. Nickle (ed) Manual of Agricultural Nematology. R. J. 10. (1991) ‘Stunt nematodes: Tylenchorhynchus. E. vol. in F. Cares.Tabla 5. vol. S. 275–362. T. 83. O. 185–223. in W. New York. Cares. y Mundo-Ocampo. 177–235. P. T. Bibliotheekuitgave no. Chave sistemática simplificada para gêneros Parte II”. vol. 163–183. E. 529–586. Marcel Dekker. Pirola. Nickle (ed) Manual of Agricultural Nematology. 14–19. T. pp. M. y Huang. Bibliotheekuitgave no 46. and related genera’. T. Revisão Anual de Patologia de Plantas. (2000) “Taxonomia atual de fitonematóides. R. no. J. The Netherlands. Bongers. REFERENCIAS Anderson. 8. 2nd edition. Bongers. I. Pirola. Oecologia. pp. The Netherlands. P. R. (1988) De Nematoden van Nederland. V. (2001) “Taxonomia de fitonematóides. (1994) De Nematoden van Nederland. 174 Manual de biología de suelos tropicales . y Bongers.3 Continúa cp2 Ecphyadophoridae Paratylenchidae Anguinidae cp3 Heteroderidae Hemicycliophoridae cp4 cp5 Nota: * modificado de Bongers (1990). G. J. S. Koninklijke Nederlandse Natuurhistorische Vereniging. E. pp. Siqueiera and Brussaard. Budapest. New York. 46. 239–251. London. CABI Publishing. L. Schoorl. pp. M. Bongers. in W. Cares. Moreira. J. 3. y Huang. (1991) ‘Heteroderinae cyst. pp.and non-cyst-forming nematodes’. S. (eds) (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. Andrássy. Chave sistemática simplificada para gêneros Parte I”. (1990) ‘The maturity index: An ecological measure of environmental disturbance based on nematode species composition’. Eötvös Lorand University. Schoorl. pp. y Potter. Revisão Anual de Patologia de Plantas. P. Koninklijke Nederlandse Natuurhistorische Vereniging. 9. Merlinius. pp. Marcell Dekker. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian amazon and savanna vegetation’. W. M. vol.

Indiana. 1st edition. Leiden. R. Hooper. Ferris. (1970) ‘Handling. in W. Nickle (ed) Manual of Agricultural Nematology. Siqueira and L. pp. (1991) ‘The family Pratylenchidae Thorne. 163–183. vol. (1964) ‘A rapid centrifugal flotation technique for separating nematodes from soil’. Applied Soil Ecology. F. A. Ministry of Agriculture. R. no 3. New York. Fisheries and Food. V. Bittencourt. 341–342. M. 4th edition. Purdue Nematode Collection Department of Entomology. W. New York. 34–39. New York. and Trichodoridae: Their systematics and bionomics. H. R. S. vol. pp. T. R. G. in J. Huang. staining and mounting nematodes’. 662–665. (1993) Aphelenchida. (2001) ‘A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept’. New York. CAB International. W. pp. y Silva. 147–190. pp. Paratrichodorus. Ltd. Journal of Nematology. P. R. 1949’. J. Brill. Methuen and Co.Decraemer. no 9. pp. 669–720. R. pp. J. C. Bongers. Krebs. Nickle (ed) Manual of Agricultural Nematology. Harper Collins College Publishers. 16. J. Jenkins. Moreira. F. J. Marcel Dekker. and Monotrichodorus’. Wallingford.. Ferris. West Lafayette. F. pp. M. Marcel Dekker. (1991) ‘Stubby root and virus vector nematodes: Trichodorus. (1992) Dorylaimida: Free-living. S. (1984) ‘Preparing nematode permanent mounts with adhesive tapes’. 13–29. Nickle (ed) Manual of Agricultural Nematology. no 1. Geraert. E. London. 795–826. in W. P. New York. in W. M. D. pp. C.. Wallingford. (1991) ‘Tylenchidae in agricultural soils’. J. M. Nickle (ed) Manual of Agricultural Nematology. R. C. Marcell Dekker. (1951) Soil and freshwater nematodes. Longidoridae. J. pp. (1991) ‘The Hoplolaimidae’. Marcel Dekker. and Ahmad. fixing. Marcel Dekker. R. in W. Southey (ed) Laboratory Methods for Work with Plant and Soil Nematodes. (1974) Revision in Leptonchoidea (Nematoda: Dorylaimida). W. y Ferris. M. O. Brussaard (eds) Soil biodiversity in Amazonian and other Brazilian ecosystems. Nickle (ed) Manual of Agricultural Nematology. (1994) Ecology: The Experimental Analysis of Distribution and Abundance. (1991) ‘Nemata: Higher classification’. D. T. in W. y Goede. y Cares. S. G. 48.. Purdue University. 18. N ematodos del suelo 175 . E. 363–422. Plant Disease Reporter. vol. Fortuner. Huang. E. Technical Bulletin No 2. Jairajpuri. C. Loof. CAB International. A. Goodey. Predaceous and Plant Parasitic Nematodes. Allotrichodorus. 587–626. pp. R. R. E. in F. Goseco. Maggenti. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian Amazon and savanna vegetation’. New York. Hunt. S.

pp. University of Florida. vol. New York. (1990) ‘Global overview of the functional roles of soil-living nematodes in terrestrial communities and ecosystem’. Pedobiologia. Bongers. R. Yeates. (1988) Illustrated Key for Identification of Common Nematodes in Florida. D. (1961) Principles of Nematology. B. y Georgieva. in W. May. Gainesville. 761–794. pp. R. W. 25. (1988) Ecological Diversity and its Measurement. 2. Oikos. biomass and contribution to energy flow by soil nematodes in terrestrial ecosystems’. G. K.. Raski.. C. R. (1993) ‘Feeding habits in soil nematode families and genera . no. K. F. 315–331. Nickle (ed) Manual of Agricultural Nematology. T. 97–101. New York. 1. no. W. 3. D. pp. Yeates. J. pp. New York. D. H. leaf. 465–508. 39.Magurran. Nickle (ed) Manual of Agricultural Nematology. P.an outline for soil ecologists’. 627–668. 22. Journal of Nematology.’. pp.. (1978) Ecology of Plant Parasitic Nematodes. J. Nickle (ed) Manual of Agricultural Nematology. R. Seinhorst. vol. de Goede. Lyon. New York Petersen. 67–69. B. (1991) ‘The Aphelenchina: Bud. McGraw Hill Co. no. G.. 176 Manual de biología de suelos tropicales . y Hooper. 186–194. pp. Cambridge University Press. 306–329. in W. H. (1982) ‘Structure and size of soil animal populations’. and Nguyen. 1–7. G. 38. pp. Mullin. Marcel Dekker. y Nguyen. W. Smart Jr. C. and insect nematodes’. Thorne. vol. vol. Norton. Freckman. M. vol. (1996) Pictorial Key to Genera of Plant Parasitic Nematodes. pp. G. G. W. Sohlenius. 34. S. Cornell University Press.. Smart Jr. W. W.. K. H. (1980) ‘Abundance. New York. and Dolichodorus spp. (1959) ‘A rapid method for the transfer of nematodes from fixative to anhydrous glycerin’. 4. Marcel Dekker. R. (1994) ‘Modification and quantification of the nematode maturity index’. C. D. A. G. Procter. pp. (1991) ‘Sting and awl nematodes: Belonolaimus spp. E. Nematologica. Marcell Dekker. Oikos. y Loeffer. L. S. D. Cambridge. vol. Nickle. John Wiley and Sons. 5th edition. C. J. Journal of Nematology. G. in W. B. (1991) ‘Tylenchulidae in agricultural soils’. New York.

Ilustración 1. que contiene alcohol al 70%. por un marco. Sistema de extracción de hormigas y escarabajos con trampas Winkler a) Delimitación de un metro cuadrado de hojarasca. d) Transferencia del material tamizado a bolsas de nylon en campo. b) Colecta de la hojarasca utilizando guantes de cuero. desde el borde hacia el centro. c) Introducción de la hojarasca en un tamiz para separar los fragmentos más gruesos. f y g) Se fijan las redes al interior de la trampa Winkler previamente colgadas en un espacio bien aireado con un frasco colocado en el fondo. i . e) Cada muestra de hojarasca tamizada se transfiere a una red.

A y B: Estoma con estilete C: Estoma sin estilete D: Diente dorsal E: Odonto estilete ii Manual de biología de suelos tropicales . Fotomicrografías de la región anterior en las que se muestra el aparato bucal (flechas) de nematodos de suelo pertenecientes a diferentes grupos funcionales: A) parásito de plantas. B) micófago. C) bacteriófago. E) omnívoro. Fotos: Juvenil Cares.Ilustración 2. D) depredador.

PAB vol 319. I lustraciones a color iii . cr CL CL d) Características de dos aislamientos de Bradyrhizobium (CL de crecimiento lento) y de R. b) Plantas de Prosopis juliflora en agar inclinado con solución de nutrientes. a) Siratro en bolsa de plástico con solución de nutrientes Pheseolus vulgaris c) Pruebas en plantas de Pheseolus vulgaris para ver la eficiencia de aislamientos en Jarras de Leonard. Pasos de la metodología para caracterizar a las bacterias fijadoras de nitrógeno y formadoras de nódulos en leguminosas (BFNFNL) aplicada en el proyecto CSMBGBD.Ilustración 3. Fotos: F. tropici (CR crecimiento rápido) creciendo en YMA f) Perfiles de Rep-PCR de e) Perfiles de proteínas totales obtenidos por electroforesis diferentes cepas. Moreira excepto e) de Lima et al. 2009. en gel de poliacrilamida..

h) esporas de Acaulospora sp. obsérvese el escudo redondo de germinación de color café que contrasta con el color hialino de la espora. d) células auxiliares nudosas diferencias por miembros del género Scutellospora. típica de la familia.Ilustración 4. Fotos: Sidney Stümer. mostrando algunos sáculos esporíferos todavía fijados a la espora (flecha). iv Manual de biología de suelos tropicales . b) espora de Scutellospora scutata con la célula suspensora bulbosa (flecha). Esporas y estructuras producidas por especies de HMA de la familia Acaulosporaceae: e) espora de Entrophospora colombiana mostrando la pared de la espora. c) detalle de la ornamentación de la pared de la espora (verrugas) de Scutellospora coralloidea. pared germinal 1 (gw1) y pared germinal 2 (gw2) con su capa más interna en reacción con el reactivo Melzer. Esporas y estructuras producidas por especies de hongos micorrizógenos arbusculares de la familia Gigasporaceae: a) espora de Gigaspora albida mostrando la célula suspensora bulbosa (flecha). f) espora de Entrophospora colombiana mostrando las dos cicatrices (flecha). g) espora de Acaulospora scrobiculata mostrando la cicatriz (flecha) que queda en la espora después de que se suelta el sáculo esporífero.

edu. b) Espora de Glomus sp. Esporas y estructuras producidas por especies de HMA de la familia Archaeosporaceae (e y f) y Paraglomeraceae (g y h): e) espora de Archaeospora Leptoticha con sáculo esporífero. brasilianum que fueron tomadas de http:// invam. obsérvese que la capa más profunda de la pared de la espora se separa y se asemeja a la pared germinal. L2 y L3). excepto de Paraglomus occultum y P.Ilustración 5. f) Detalle de Archaeospora Leptoticha mostrando salientes y depresiones en las capas 2 y 3 de la pared de la espora (flecha). g) Espora de Paraglomus occultum mostrando la estructura de la pared de la espora formada por tres capas (L1.wvu. h) Espora de Paraglomus brasilianum mostrando la estructura de la pared de la espora formada por tres capas (L1. c) Esporocarpo de Glomus clavispora. I lustraciones a color v . mostrando la pared de la hifa de sostén de manera continua con la pared de la espora. d) Esporocarpo de Glomus sp. Fotos: Sidney Stümer.caf. Esporas y estructuras producidas por especies de HMA de la familia Glomeraceae: a) Espora de Glomus clarum mostrando la hifa de sostén. L2 y L3) (obsérvese que la capa L2 está ornamentada con pequeñas crestas).

b) muestra de agua con cebo. Aislamientos de hongos zoospóricos de muestras del ambiente (Oomycota y Chytridiomycota): a) muestra de suelo con cebo. vi Manual de biología de suelos tropicales .Ilustración 6. f) Pythium liberando zooesporas. e) Oogonio y anteridio de Pythium. c) cultivo puro en cebo. d) esporangio de Phytophthora.

Ilustración 7. Abreu. d) continuando con el procedimiento de lavado. Fotos: Lucas M. h) colonias de hongos en medio de cultivo para retardar el crecimiento. e) partículas de suelo lavado. b) tamices con diferentes mallas. Técnica de lavado del suelo para el aislamiento de microhongos del suelo: a) Pre-lavado. c) suelo pre-lavado. f) medio de cultivo en placas. g) placa con partículas de suelo para su incubación. I lustraciones a color vii .

A C Banda costal Banda “s” Banda “s” D B E Cabeza Punta del oviducto Mesonoto Aculeo Mediotergio Abdomen Terminalia viii Manual de biología de suelos tropicales . E) Adulto de mosca de la fruta y detalle del aculeo.Ilustración 8. B) Trampa MacPhail con cebo. D) Extracción del aculeo. C) Patrones alares típicos con bandas. A) Larvas y pupas de la mosca de la fruta en el suelo.

por lo tanto. pues proporciona alrededor del 70% de todo el nitrógeno requerido en los ecosistemas naturales y agroecosistemas (Burns y Hardy. considerando un área de 21 millones de hectáreas. usadas para la inoculación. En Brasil. Moreira LA IMPORTANCIA ECONÓMICA Y ECOLÓGICA DE LA SIMBIOSIS DE BACTERIAS FORMADORAS DE NÓDULOS EN LEGUMINOSAS (BFNFNL) La fijación biológica de nitrógeno es uno de los procesos más importantes para mantener la vida en el planeta. se utiliza en algunos países con un pequeño y selecto grupo de leguminosas con el propósito de reemplazar el uso de fertilizantes químicos de nitrógeno.Capítulo 6 Bacterias formadoras de nódulos en leguminosas Fátima M. donde se cosecharon cerca de 57 millones de toneladas de soya. al mismo tiempo.3 billones de gastos en fertilizantes mediante la aplicación de esta biotecnología. provienen de una diversidad que se encuentra en el suelo. 177 . Las cepas. La inoculación con cepas de BFNFNL altamente eficientes y adaptadas a las condiciones ambientales dominantes. debido a las múltiples interacciones que se dan entre organismos del suelo y plantas. se ahorraron alrededor de US$ 3. S. en el caso de la soya. 1975). manteniendo así la armonía con el medio ambiente. la biodiversidad del suelo puede afectar el comportamiento de la formación de nódulos de manera positiva o negativa. la inoculación con cepas de Bradyrhizobium reemplaza completamente la aplicación de fertilizantes sintéticos. En el año 2006. un conocimiento de la diversidad de BFNFNL en el suelo deberá ser el primer paso para el manejo y la conservación de este recurso genético de tanto valor.

Jourand et al. 1998 Wang et al. 1993 Amarger et al. por esta razón. Las citas referidas describen a las especies y/o comprueban su capacidad de nodulación. 2001. Tabla 6.Familia/Género/Especie α-Proteobacteria-Orden Rhizobiales Referencia Rhizobiaceae Rhizobium R. galegae R. 2001. gallicum R. giardinii biovars phaseoli. (Ulmaceae).TAXONOMÍA ACTUAL DE BFNFNL Las bacterias fijadoras de nitrógeno. una taxa a nivel familia de bacterias creada expresamente para acomodar organismos que pueden formar nódulos en leguminosas. Filum/Orden. El término rhizobia se deriva de Rhizobiaceae (Conn. Methylobacterium Methylobacteriaceae y Dovosia Hyphomicrobiaceae) también pueden formar nódulos en leguminosas (Moulin et al. mongolense R. trifolii. 1984 Lindström. Familia. huautlense R. 1998 Wang et al. 1999a . aunque se continúa usando en alguna literatura. giardinii R. el nombre ”rhizobia” ya no resulta idóneo para describir bacterias formadoras de nódulos. Chen et al. 2004 Rivas et al.1).. 1997 Amarger et al. 1989 Martinez-Romero et al. 2003) (Tabla 6. Sy et al.. 2001. viceae R.1 Filum/Orden. etli R. tropici R. 1997 van Berkun et al. 2002. 1889.proteobacteria (por ejemplo.. etli biovar mimosae 178 Manual de biología de suelos tropicales Frank. forman nódulos en las raíces (y algunas veces en los tallos) de algunas especies de leguminosas y en las raíces de Parasponia spp. Especie de bacterias formadoras de nódulos en leguminosas.. Una extensión reciente de conocimientos acerca de las bacterias formadoras de nódulos en leguminosas fue el descubrimiento que estableció que las bacterias pertenecientes al β-proteobacteria (género Burkholderia y Ralstonia/Cupriavidus) y a otras familias de la α. 1879. hainanense R. Género. leguminosarum biovars phaseoli. conocidas anteriormente como rizobios.. Jordan. 1997 Chen et al. 1991 Segovia et al. 1938).

2009 Tian et al. 2011 Dangeard. 2009 Hou et al. xinjiangense E. alamii R. 1988. meliloti E. 1926. 2008 Berge et al. yanglingense R.1 Continúa. 2009 Lin et al. 2008 Ren et al. 2007 Gu et al. 2002 Toledo et al. indigoferae R. 2008 Ramirez-Bahena et al. morelense E. 2003 B acterias formadoras de nódulos en leguminosas 179 . 1994 Rome et al. Chen et al. 2011 Zhang et al. 2001 Squartini et al. teranga E. Jordan et al. saheli E. kostiense E.Tabla 6. alkalisoli R. 2002 Wei et al. miluonense R. arboris E. sullae R.Familia/ Género/Especie R. 1996 Nick et al. 1988. 2009 Li et al. tibeticum R. oryzae R. 2003 Quan et al. fabae R. fredii E. 2002 Wei et al. 1984. pisi R. 2008 Peng et al. 1994. 2003 Scholla & Elkan. de Lajudie et al. 1988 de Lajudie et al. Chen et al. 2006 Hunter et al. vignae R. 1999 Nick et al. loessense R. de Lajudie et al. 1984. americanum Referencia Tan et al. Filum/Orden. tubonense Ensifer (Sinorhizobium) E. selenireducens R. multihospitium R. kummerowiae E. 1994 Chen et al. daejeonense R. 2002 Wang et al. 2008 Han et al. 2005 Valverde et al. medicae E. 1999 Wei et al. lusitanum R. Young. 1994 de Lajudie et al. mesosinicum R.

garamanticus E. pachyrhizi B. liaoningense B. 1998a. iriomotense Bradyrhizobium (Blastobacter) B. kummerowieae Bradyrhizobiaceae Bradyrhizobium B. 2008 Jordan. 2007 Rincon-Rosales et al.canariense B. 2002. Young et al. jicamae B. 1997 Chen et al. numidicus Allorhizobium* A. 1995 Yao et al. yuanmingense B. 1984 Kuykendall et al. mexicanus E. elkanii B. 2009 Merabet et al. 2003. Young.Tabla 6. 1982. 2006 Jordan et al. 1992 Xu et al. chiapanecum E.adiobacter/ tumefasciens Shinella S. van Berkun et al. 2009 Ramírez-Bahena et al. 2003 Lloret et al. denitrificans** Xanthobacteraceae Azorhizobium A. (2010) Merabet et al.Familia/Género/ Especie E. (2010) de Lajudie et al. japonicum B. caulinodans A. 1988 Moreira et al. 2009 Lin et al. 2008 van Berkun & Eardly. loti M.1 Continúa. 2001 Cummings et al. Filum/Orden. 2009 Islam et al. 1997 Manual de biología de suelos tropicales . adhaerens E. doebereinerae Phyllobacteriaceae Mesorhizobium M. Jarvis et al. 1982. 1984. Willems et al. 2006** Dreyfus et al. 2002 Vinuesa et al. huakuii 180 Referencia Casida. (Rhizobium) undicola Agrobacterium* A (Rhizobium). Jarvis et al. 1991. Jarvis et al. 2005a Ramírez-Bahena et al.

2009 Vidal et al. Jarvis et al. 2010 Valverde et al. septentrionale M.alhagi Phyllobacterium P. 2004 Wang et al. lupini O. 1997 Nour et al.1 Continúa. caraganae M. 2004 Trujillo et al. ciceri Hyphomicrobiaceae Devosia D. plurifarium M. 2005 Zurdo-Pineiro et al. 2001 Gao et al. 2001. 2010 Rivas et al. mediterraneum M. 2009 Chen et al. 1997 De Lajudie et al. Filum/Orden. 1995. trifolii P. neptuniea Referencia Nour et al. temperatum M. gobiense M. 2006 Sy et al. albiziae M. 2007 Imran et al. tarimense M.Familia/Género/ Especie M. 1994. 2009 Nandasena et al. Jarvis et al. 1998b Wang et al. 1999b Velásquez et al. 2007 Gu et al. 2005 Mantelin et al. 2004 Gao et al. ciceri M. 1995. 2002. australicum M. 2008 Li et al. 2006 Mantelin et al. nodulans Brucellaceae Ochrobactrum O. Jarvis et al. Jourand et al. 2009 Nandasena et al. leguminum*** Methylobacteriaceae Methylobacterium M. tianshanense M. ifriqiyense*** P. 2008 Han et al. shangrilense M. metallidurans M. cytisi O. 1997 Chen et al. opportunistum M.Tabla 6. amorphae M. 2008 Han et al. chacoense M. 2003 B acterias formadoras de nódulos en leguminosas 181 .

vitis y (Young et al. yakushimensis β-Proteobacteria Orden Burkholderiales Burkolderiaceae Burkholderia **** B.. pero descubrieron que pueden formar nódulos en leguminosas y la propusieron para que se incluyera en el género Bradyrhizobium. 2002 Vandamme et al.cepacia genomovar VI) B. A. tuberum B. 2004) y más tarde del género Cupriavidus (Vandamme y Conye. caribensis B. tumetaciens (syn. Las leguminosas contienen alrededor de 20 mil especies.Familia/Género/ Especie D. Filum/Orden.. Arubi y A. adiobacter). pero su capacidad de nodular no fue comprobada. rhizogenes. **** Estos autores no describieron el género. en su mayoría herbáceas) (Lewis et al.800 spp. nodosa B. Mimosoideae (3270 spp. 2005). pero descubrieron que pueden formar nódulos en leguminosas ***** El género Wautersia (Vaneechoutte et al. 2001 Vandamme et al. 2002 Achouak et al. Vandamme & Conye 2004 Notas: * Se propuso incluir a las especies Agrobacterium como A. 2004 Chen et al. Vermis et al. plantas leñosas. distribuidas en las subfamilias Caesalpinoideae (2250 spp. dolosa (B. Vandamme et al.. A. 1999. 2007 Chen et al. en su mayoría plantas tropicales leñosas). 2001) y A. *** Fueron aislados de nódulos.Tabla 6. Hasta 1989. 2002 Vandamme et al. phymatum B.. 2002. subtrópico y zona templada) y Papilionoidae (13. sabie Cupriavidus (Ralstonia) C. (Ralstonia) taiwanensis ***** Referencia Bautista et al. larrimoorei (Young 2004) en Rhizobium. 2006 Chen et al. 2004) fueron propuestos para acomodar dichas especies de Ralstonia. 2008 Chen et al. 2001. ** Estos autores no describieron estas especies. del trópico. El alcance de la simbiosis con BFNFNL entre leguminosas queda todavía sujeta a investigación. 2010 Moulin et al. únicamente el 57% del género y el 20% de las espe182 Manual de biología de suelos tropicales . mimosarum B.1 Continúa..

Para poder aislar o enumerar BFNFNL en una población microbiana diversa. especialmente en Brasil (Magalhães et al. en selvas tropicales). Mimosoideae y Papilionoidae. los nódulos pueden muestrearse en plantas cultivadas en el campo (colecciones in situ). Moreira et al. 2004) y Mesorhizobium thiogangeticum (Ghosh et al. respectivamente (Faria et al. la taxonomía del BFNFNL estaba basada en cepas aisladas de cultivos de zonas templadas. 1992. únicamente el 25% de las especies existentes han sido examinadas. 1982. en 1984 (véase Tabla 6. ahora que se encuentran disponibles las que han sido aisladas de otras especies y regiones. muestran una B acterias formadoras de nódulos en leguminosas 183 ..cies habían sido examinadas por la formación de nódulos y los porcentajes de las especies que sí podían formar nódulos se encontraron en porcentajes de 23.. 2007). para poder estimar la población de BFNFNL en el suelo... por ejemplo. El proceso de infección de la planta es el resultado de la formación de nódulos en sí. Tres especies de los géneros descritos de BFNFNL no fueron incluidas en la tabla porque no fueron aisladas de nódulos ni la capacidad de nodulación se comprobó hasta el momento: Rhizobium cellulosilyticum (García-Fraile et al.. y se esperan más revisiones en un futuro. se estima que hoy en día. 2006) EVALUACIÓN DE DIVERSIDAD DE BFNFNL EN EL SUELO Los estudios sobre poblaciones y diversidad de BFNFNL dependen de un aislamiento exitoso de nódulos de raíces y ocasionalmente de tallos. 1989). se requiere de un método que separe claramente BFNFNL de otras especies bacterianas y que permita un muestreo fácil y sistemático de los nódulos.. y que han sido desarrolladas nuevas técnicas de genética molecular. Sin embargo... es posible que nuevas simbiosis se identifiquen en el futuro. 1989. Aunque se han llevado a cabo búsquedas extensivas para nuevos géneros y especies formadoras de nódulos. 90 y 97% entre Caesalpinoideae. Aunque algunas plantas hospederas se consideran muy promiscuas. De esta manera. Faria et al. ha ocurrido una revolución en la taxonomía con 90 especies y 10 géneros adicionadas a las 4 especies y a los 2 géneros originales enlistados por Jordan.. como la que surge en el suelo. de leguminosas hospederas. puede proveer información sobre la composición taxonómica de poblaciones de BFNFNL y determinar el grado de especificidad entre cepas específicas y candidatos hospederos. en ecosistemas naturales (por ejemplo.1). El cultivo posterior y caracterización de BFNFNL y de los nódulos. Odee et al. tradicionalmente. 1992). 1995). Bradyrhizobium betae (Rivas et al. aunque este método puede resultar difícil en el caso de hospederas perennes o leñosas (Moreira et al.

El bioensayo para BFNFNL puede hacer uso de hospederos promiscuos. 2007) y Burkholderia. también cabe la posibilidad de que sea nodulado por especies de rápido crecimiento como Rhizobium (Pereira. 1966. acetileno a etileno (Dilworth. normalmente considerada como hospedero de Badyrhizobium. aisladas e identificadas. Antes de escoger las plantas hospederas para realizar un bioensayo.. es deseable hacer uso de una variedad de especies de plantas hospederas candidatas y cuantas más sean empleadas. pero.. 2006 y 2008. la comparación de BFNFNL. De manera similar. Resultados obtenidos en Brasil (Alto río Solimões) muestran que caupí (Vigna unguiculata) captura más especies que M.. punto de referencia CSM-BGBD. La nitrogenasa es la enzima responsable de la reducción del gas nitrógeno a amoniaco. 1987 demostraron que Vigna unguiculata. y. de hecho. 2000. se reporta que suele estar nodulado por la especie Bradyrhizobium (Woomer et al. 1997. únicamente.. 1988a). más variedad resultará de cepas de BFNFNL. en la mayoría de los casos. 2000). de rápido crecimiento.. 184 Manual de biología de suelos tropicales . Moreira. ningún hospedero promiscuo puede ser nodulado por todas las especies o cepas existentes de BFNFNL y. donde sea posible. Odee et al. 2009). siratro (Macroptilium atropurpureum) atrapa BFNFNL en los 98 puntos de muestreo del proyecto CSM-BGBD (Lima et al. representa una comprobación útil de la exactitud del procedimiento en el laboratorio. Para poder evaluar la diversidad de BFNFNL en el suelo. Lima. 1970). 1993. de manera natural. aisladas de nódulos formados de manera natural.. Resultados preliminares de Taita. con los que se muestrea con el bioensayo. atropurpureum y que el frijol Phaseolus vulgaris. no existe ninguna cepa de BFNFNL que sea lo suficientemente promiscua como para nodular a todas las especies leguminosas. de manera contraria. También reduce. en Kenia... Por lo anterior. entre otros sustratos. 2009). debería incluirse una especie leguminosa nativa como trampa hospedera. por ejemplo: Macroptilium atropurpureum es uno de los hospederos ampliamente conocido (Vicent. Las especies encontradas posteriormente deberían compararse con las especies que forman nódulos en el lugar. de crecimiento lento. entre otras (Moreira et al. se recomienda llevar a cabo experimentos preliminares para cada tipo de suelo.. Lewin et al. en la mayoría de los casos. indican que M.baja especificidad. tiene una especificidad muy baja y puede ser nodulada por Rhizobium spp. 2002. atropurpureum fue nodulado. cultivados en muestras de suelo tomadas del campo o inoculadas con suspensiones del suelo (Moreira et al. por Bradyrhizobium spp. Aunque algunas de las asociaciones mencionadas pueden ser relativamente específicas. Lima et al. Pereira.

resulta idóneo Macroptilium atropurpureum (siratro). dado lo afanoso del procedimiento. Una descripción previa fue hecha por Moreira en 2004. Por ejemplo. 1966). puesto que deben quedarse intactos para su aislamiento posterior o secarse cuando requieran ser almacenados durante un largo periodo. es barato y fácil de realizar aun en condiciones de campo. 1987). aplicados en el proyecto CSM-BGBD. Paso 1A: recoger muestras de suelo del campo. como trampas para aislar las BFNFNL de las muestras del suelo. Aunque el uso de ERA para obtener estimaciones cuantitativas de fijación de nitrógeno a la nutrición de la planta ha sido ampliamente discutido (Boddey.1. con esto se B acterias formadoras de nódulos en leguminosas 185 . Los nódulos sin actividad de la nitrogenasa pueden estar senescentes o ser inefectivos.. 1992). es que destaca por su gran sensibilidad y velocidad. La actividad de la nitrogenasa constituye una información invaluable porque en muchos casos es imposible verificar que los nódulos aún son efectivos y viables (color interior rojo). deben utilizarse semillas de la misma procedencia. Paso 2A: para el proyecto se utiliza el método convencional de uso de especies promiscuas. ya que posee pequeñas semillas y resulta fácil de manipular bajo condiciones controladas en bolsas de plástico y jarras de Leonard. la gran ventaja de un ensayo de reducción de acetileno (ERA). Esta reacción se utiliza como técnica para medir la actividad de la nitrogenasa. Bajo estas circunstancias. sin embargo. Cuando se llevan a cabo varios experimentos. y estará limitado por el tiempo disponible y las facilidades que ofrezca el laboratorio. METODOLOGÍA APLICADA EN EL PROYECTO CSM-BGBD: UNA REVISIÓN GENERAL Los pasos utilizados en la metodología para la caracterización de BFNFNL.Schollhorn Burris. cuyos seis pasos a seguir se muestran en la ilustración 3a hasta la 3f. 1987. dentro de cámaras de crecimiento o invernadero. El ensayo también puede usarse para confirmar una nueva simbiosis de BFNFNL o en el caso de nódulos no usuales (Moreira et al. Es por ello que se emplea una única especie promiscua como trampa. Giller. el personal que no posee la suficiente experiencia podrá confundirlos con estructuras no inducidas por BFNFNL. el uso de especies múltiples no es viable con un gran número de puntos de referencia (por ejemplo 100). con una solución nutritiva. se encuentran resumidos en la Figura 6. dado que la anatomía de los nódulos varía ampliamente en forma y en tamaño. resulta muy útil para la detección simple de fijadores de nitrógeno. tal y como se describe a continuación.

utilizando la técnica de infección de planta. 2A. (Ilustración 3. dos controles sin inoculación (con o sin mineral N). 1A. eficiente. secuencia del gen (16S rRNA para todos los géneros.55% 1. tamizar según características de cultivo y REP-PCR o perfiles de proteína (Ilustración 3. capturadas con suspensiones de suelo 1:1. peso de materia seca y peso seco de planta (contenido N). tales como dnaK. capturando BFN: técnica de infección de planta: inoculación de especies promiscuas. fijadoras de nitrógeno en diversos sistemas de uso de suelo. 12 muestras compuestas de suelo por punto. Caupí (opcional) 3. Eficiencia de poblaciones nativas: número de nódulos. Siratro* 2. colectadas bajo condiciones asépticas Área de referencia /Uso del suelo/ Puntos de muestreo 1B. con la muestra de suelo. Capítulo 2).1 Evaluación de bacterias formadoras de nódulos en leguminosas. 3A. en caso necesario. * Puede usarse para conteo NMP (opcional). a). índices de diversidad. Jarra de Leonard. Aislamiento de NLB de nódulos ** en YMA/79 con azul de bromotimol (Ilustración 3. Nota: 1A. Nódulos de especies de plantas locales 5. Caracterización de aislados verificados. resumida en seis pasos. 2e) 1C. cuando se aprecian diferencias significativas entre tratamientos 4. Frijol (opcional) 4. Origen del hospedero. basados en una 186 Manual de biología de suelos tropicales . Caracterización de cultivos (son necesarios los experimentos preliminares con suelo de selvas y cultivos de leguminosas para determinar el número de aislamientos requeridos para caracterizar las comunidades de simbiontes en su conjunto. c) 2 B. Almacenaje en frascos con gel de sílice o CaCl2 4. ** Algunos nódulos pueden guardarse en gel de sílice para su aislamiento. Ensayo de reducción con acetileno (opcional) 3 B. Captura de BFN. contenido de N por planta (opcional). peso seco de materia aérea de planta. agar inclinado (Ilustración 3. más un control de una cepa conocida. otros genes. representativos de grupos previos. Dos controles sin inoculación (con o sin mineral N) más un control con un tipo eficiente (Ilustración 3. Bioensayos con aislados: verificación (postulados de Koch) y propiedades simbióticas (número de nódulos y peso seco de materia). b). Claves de identificación de plantas.Figura 6. solución de nutriente de suelo o NaCl a 0. especialmente para Bradyrhizobium). Doce muestras en cada punto de muestreo (véase esquema global CSM-BDBG. d) caracterización de cultivo 3 A. 2A. Especies nativas (opcional) Bolsas de plástico (Ilustración 3. f (ii). 6. La eficiencia de poblaciones nativas es evaluada con la floración.

aún dispersos. Cuando un equipo puede manejar más de una trampa de especies. debido a diferentes relaciones simbióticas (diferentes especies de plantas) y condiciones ambientales. pueden cultivarse especiestrampas en bolsas de plástico. pueden ser diferentes en cada país. Después de las tres especies mencionadas (siratro. deberán corregirse para los ensayos. Se selecciona Phaseolus vulgaris con base en que en varios países existen datos. ni forma parte de la metodología estándar. Para poder capturar BFNFNL. incluyendo algunas especies nativas que. éste no es obligatorio. las cuales se describen a continuación. Incluye características de cultivos obtenidos en el paso número 4. aunque también se puede aplicar a otros géneros). B acterias formadoras de nódulos en leguminosas 187 . es fácil de medir y proporciona información útil sobre la variabilidad y eficiencia de las poblaciones nativas. esto puede servir como un punto de referencia. aunque sería imposible estandarizar esta selección. Representantes de racimos. jarras de Leonard o en macetas que contengan las muestras de suelo. Bradyrhizobium. para trampas promiscuas adicionales se recomienda usar Vigna unguiculata (como segunda especie) y Phaseolus vulgaris (frijol) como tercera especie. Los suelos con un alto contenido de N deberán evitarse. caupí y frijol) se pueden seleccionar otras. Las muestras de suelo en macetas pueden usarse únicamente cuando haya disponibilidad en los laboratorios y se deben seguir todas las técnicas asépticas normales de la microbiología. Las dos especies fueron escogidas por ser bastante promiscuas y porque se cultivan en muchos países. por supuesto. otros factores limitantes como deficiencias de macro y micronutrientes. Paso 3 A: aunque la eficiencia bajo condiciones controladas no refleja lo que está pasando in situ.evita cualquier variación de NFNLB debida a las plantas. basados en características de cultivo (si este es el caso) y/u otro método deben ser secuenciados para 16SrRNA y otros genes como dnaK (por ejemplo. sobre poblaciones de BFNFNL donde se utiliza el frijol común como especie-trampa. Dada la complejidad del primer ejercicio. acidez y un alto contenido de Al. El criterio para la selección debe basarse en que la especie-trampa sea ecológica y económicamente relevante para el país. en el tamizado de la colección entera de aislamientos (para conseguir racimos) y elementos repetitivos extragénicos palindrómicos/secuencias de DNA (REP-PCR) (u otros métodos como perfiles de proteínas por electroforesis con SDS-PAFE/poliacrilamida gel puede ser complementario). Las semillas que se encuentren disponibles en la localidad proveerán información útil para agricultores del lugar. incluso puede indi- curva de extinción de especies). Las especies-trampas pueden usarse para capturar y contar BFNFNL o simplemente para capturarlas.

. 2001). a los del bioensayo y a los nódulos colectados en campo. formados en el campo. 188 Manual de biología de suelos tropicales . en los diferentes sistemas de uso de suelo. 3B: se recomienda también que las BFNFNL sean aisladas de especies leguminosas (nativas e introducidas) que nodulan naturalmente. en condiciones de laboratorio (Bala et al. Este número se encuentra en el punto (asíntota) donde la curva alcanza su mayor nivel.. tal y como se explicó anteriormente. hará posible la mejor evaluación de diversidad y de eficiencia de la especie-trampa. de ocho metros de radio alrededor de cada punto de muestreo. para una especie hospedera en particular. Una comparación de BFNFNL aisladas de nódulos del campo y de nódulos introducidos en una especie-trampa. Cuando se usa la técnica de infección por planta.. En la literatura se ha discutido que. 2005). por lo menos. Paso 1C: las especies de leguminosas en un área específica. con una inoculación de suspensiones de suelo. Paso 1B/2B. deben ser inventariadas para que las relaciones con poblaciones naturales de BFNFNL puedan determinarse. Las curvas de muestreo (acumulación o escasez) pueden revelar el número de aislados requeridos para evaluar correctamente la diversidad. se necesitarán más aislamientos para obtener una buena resolución. los aislados de estos nódulos. cultivadas en una serie de diluciones de suelo. se necesitan entre 30 y 50 nódulos. y los de plantas. esto indica que no se han detectado todas las especies y que muestras adicionales (aisladas de nódulos) deberán ser analizadas. Paso 4: después de la aparición y crecimiento de nódulos. de esta forma estarán disponibles para futuros aislamientos. lo que permite la construcción de curvas de muestreo para evaluar si la diversidad en un lugar ya ha sido completamente caracterizada. Se necesitará aplicar las curvas de muestreo a todos los aislados. es decir. por ejemplo. 2001) porque los tipos de BFNFNL capturadas pueden variar también con la dilución (Bala et al. las BFNFNL deben ser aisladas.car la existencia de cepas eficientes en las poblaciones del suelo. pertenecientes a los diferentes sistemas de uso de suelo en cuestión. junto con los de nódulos recogidos de plantas nativas que naturalmente forman nódulos. y quizá más de 100 por uso del suelo (Jesús et al. Los nódulos se almacenan en sílica gel (Figura 6. Considerando que estas curvas se obtienen con base en el número de diferentes cultivos que todavía pueden mostrar características genéticas variables. los nódulos deberán muestrearse a partir de plantas que nodulen y representen niveles secuenciales de diluciones (Moreira y Pereira. proporcionarán los datos de la diversidad. en caso de no alcanzarlo. 2001).2). Se sabe que la diversidad genética en poblaciones naturales de las NFNLB del mismo lugar puede presentar diferencias entre los aislados de nódulos.

El aislamiento de BFNFNL de nódulos deberá hacerse en el medio 79 con azul de bromotimol (Fred y Waksman, 1928). El medio 79 se conoce también como YMA (Vincent, 1970) (anexo 6.1); esto permite la caracterización completa del cultivo (tasa de crecimiento, cambio de pH, producción de exo-polisacáridos, morfología de colonia, color, tamaño, etc.). Para obtener grupos a partir de estas características de cultivo. La diversidad genética de poblaciones de BFNFNL puede evaluarse al agrupar los perfiles que resultan de rep-PCR, utilizando un software como Gelcompar (Brujin et al., 1997) o mediante el uso de otra técnica: perfiles de proteínas por electroforesis con gel de SDS-Poliacrilamida; que dan una buena resolución a nivel cepa (Paso 6); sin embargo, esto puede ser opcional, de acuerdo con los recursos disponibles en cada país y debe llevarse a cabo después del paso 5 para evitar perder el tiempo con contaminantes. Finalmente, los representantes de cultivos de los clados generados mediante el agrupamiento por Rep-PCR u obtenidos mediante otros métodos se secuenciarán para obtener el gen 16SrRNA (Paso 6). Cuando existen recursos suficientes, dnaK u otros genes involucrados en el mantenimiento de la bacteria, tales como atpD, rpoB, recA, glnII (Parker, 2004; Vinuesa et al., 2005b; Gaunt et al., 2001), pueden ser probados para algunas cepas de género que no hayan sido bien discriminadas por 16 SrRNA, como en el caso de Bradyrhizobium.
Figura 6.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. Fuente: Moreira y Pereira, 2001.
1 ml de C2H2 Muestra de gas Tapón de goma (a) Vial (10 ml) 30 minutos a 1 hora Tapón de goma Tubo al vacío

Nódulo Nódulo efectivo Nase C2H2+2H++2e 2C2H4 Tubo de ensayo 8.5 ml (b)

Tapón de rosca Tapón de rosca, nódulo, algodón y sílica gel o CaCl2

B acterias

formadoras de nódulos en leguminosas

189

REQUERIMIENTO DE MATERIALES PARA TRABAJO DE CAMPO Y LABORATORIO Trabajo de campo: para muestrear suelo: alcohol al 95%, agua para eliminar el suelo del equipo de muestreo antes de la esterilización con alcohol, caja refrigeradora, bolsas de plástico esterilizadas (300 ml), espátula, bolsas grandes de plástico (5 l) y un pequeño sacabocados. Para muestrear nódulos: tijera pequeña, cuchara, azada y azadón, pinzas, pala, tubos de tapón de rosca, sílica gel o CaCl2 anhidro. Para resguardo de plantas: alcohol, prensa y periódico. Trabajo de laboratorio para aislar y enumerar BFNFNL: pipetas de 1 ml y 5 ml, solución para dilución, matraces Erlenmeyer de 1 L y 125 ml, agitador orbital, bolsas esterilizadas de plástico (125 ml) para crecimiento, tubos de ensayo (150 x 20 ml ó 200 x 30 mm), o botellas de cerveza recicladas, rejillas para bolsas de crecimiento o tubos, solución de nutrientes, semillas de plantas leguminosas hospederas promiscuas o nativas, temperatura ambiente controlada de luz y humedad. Trabajo de laboratorio para aislamiento de BFNFNL y caracterización de cultivos: cajas Petri, alcohol al 95%, HgCl2 al 0.1% (acidificado con HCl concentrado a 5ml/L) (Hipoclorito de Na o Ca; puede usarse H2O2 para sustituir al HgCl2), agua esterilizada, pinzas, medio de cultivo que contiene levaduras, manitol y sales minerales (hipoclorito de sodio o calcio, o H2O2 (pueden sustituir al HgCl2), agua esterilizada, pinzas, medio de agar con sales, levadura-manitol-mineral, pH6.8. Para la actividad de nitrogenasa mediante reducción de acetileno: matraces Kitasato Erlenmeyer, globo de hule, jeringas de 1 ml a prueba de gas, tubos de vacío de 5 ml, frascos de 10 ml o de mayor capacidad con tapones de goma, carburo de calcio CaC2, cromatógrafo de gases equipado con un detector de ionización de flama (FID) y columna RN Poropak para determinaciones de acetileno/etileno. Nota: los ensayos de nitrogenasa pueden llevarse a cabo en campo. MÉTODOS DETALLADOS Muestreo del suelo. Se saca una muestra de suelo a una profundidad de 20 cm, en 12 puntos, distribuidos alrededor de cada parcela de muestreo (véase Capítulo 2, Figura 2.3). Se utiliza el mismo esquema de extracción del núcleo para el muestreo en todos los grupos microbianos, incluyendo el BFNFNL. Se junta cada juego de 12 muestras, para formar una muestra compuesta de alrededor de 300 g que, posteriormente, se introduce en una bolsa plástica esterilizada. De manera alter190
Manual de biología de suelos tropicales

nativa, cuando lo permitan los recursos, se pueden obtener tres o más muestras compuestas en cada punto. Todas las herramientas: sacabocados, espátulas, azadón, etc. deberán lavarse muy bien con agua para remover partículas de suelo y ser esterilizadas mediante alcohol y flama antes y después de cada muestreo, con el fin de evitar la introducción de BFNFNL exóticas. Se deben minimizar las pisadas cerca de los puntos de extracción y la hojarasca deberá ser removida justo antes de que se lleve a cabo el muestreo. Las muestras de suelo se trasladan al laboratorio lo antes posible, utilizando un envase con aislamiento (preferiblemente debe permanecer a 4° C). Una segunda muestra compuesta de alrededor de 200 g será recogida en una bolsa de plástico no estéril para su análisis físico-químico. Muestreo de nódulos. Se deberán identificar plantas leguminosas dentro de un radio de 8 m (lo mismo que para un inventario de vegetación) en el punto de muestreo y se recogerá el material vegetal resultante. Será de gran ayuda contar con información previa acerca de cuáles son las especies que pueden nodular, de manera que se confine el muestreo a estas especies en concreto; sin embargo, hay que aclarar que existe un enorme potencial para el descubrimiento de nuevas especies de leguminosas de este tipo. En el caso de plantas herbáceas, se puede extraer todo el sistema de raíces del suelo, utilizando una azada, un azadón o una pala, cuidando no romper nódulos de manera accidental. Los nódulos de plantas leñosas deberán descubrirse extrayendo las raíces y poniendo gran atención para no dañar las ramificaciones delgadas en donde éstos normalmente se encuentran. Se debe verificar, con extremo cuidado, que las raíces delgadas pertenezcan a la planta leguminosa identificada; por este motivo, se recomienda empezar la excavación junto al tallo; se extirpan los nódulos (dejando un pedazo de raíz para facilitar la manipulación) y se guardan en tubos de tapón de rosca con un desecador (Figura 6.2b). Antes del almacenaje, las partículas de suelo deberán removerse, bien por sacudido o bien mediante lavado, retirando el exceso de agua con una servilleta. Por lo menos se recogerán 50 nódulos por cada punto de muestreo y la muestra será representativa de todas las especies nodulantes existentes en la parcela de muestreo. En ocasiones, algunos nódulos pueden ser demasiado grandes para los tubos normales de rosca: deberán ser almacenados en un recipiente de mayor capacidad. Actividad nitrogenasa. La actividad de nitrogenasa puede medirse en el campo o a partir de cada nódulo, justo después del muestreo o en el laboratorio (Figura 6.2). Se introduce el nódulo en un frasco de tapa de goma de 10 ml o de mayor capacidad, en caso necesario. Se produce acetileno en un matraz Kitasato Erlenmeyer
B acterias
formadoras de nódulos en leguminosas

191

por la reacción de CaC2 con agua (Figura 6.3). Si se lleva a cabo el trabajo en laboratorio, se obtiene acetileno de cilindros de gas comerciales. Se inyecta 1 ml de este gas en el frasco que contiene el nódulo. Después de una hora aproximadamente, se remueve 1 ml de gas de la superficie y se transfiere a un tubo al vacío para su posterior análisis de etileno por cromatografía de gases (Figura 6.2a). Especímenes de resguardos de plantas. Los especímenes de resguardos de plantas nodulantes, deberán recogerse en el área que se encuentra alrededor del punto de muestreo (radio de 8 m). Se debe poner especial atención en el etiquetado (véase a continuación) y si es posible, incluya flores y frutas. Enseguida, los especímenes se mandan al herbario para su identificación junto con una tarjeta de identificación de las mismas: Proyecto: CSM-BGBD Colector: Fátima Moreira Fecha: 2 de abril de 2005 Localidad: Benjamin Constant Altitud: 500 m Nombre vulgar de la especie: faveira Nombre científico de la especie: ¿? Número de vale: 05 Características del nódulo: crecimiento medio, tamaño 0.5 a 1.5 cm Descripción del lugar: pastizales abiertos con ganado y troncos de madera Tipo de suelo: limo arenoso
Figura 6.3 Producción de acetileno en campo o laboratorio.
Agua Globo de hule CaH2

Tubo de goma

CaC2

CaC2 + H2O ⇒ C2H2 + Ca (OH)2 Sólido Gas Sólido

192

Manual de biología de suelos tropicales

Características de la planta: herbácea con frutos maduros Otros comentarios: se recogieron semillas; flores amarillas. El conteo de BFNFNL. Se someten muestras de suelo a una serie de diluciones antes de la inoculación de las plantas hospederas candidatas (Figura 6.4). La correlación de diluciones varía entre 2.0 (1:2) y 14.5 (1:14.5), según la concentración de células esperada en la muestra. Esto significa una mayor dilución para suelos con más BFNFNL; sin embargo, aún es necesario inocular plantas hospederas en todas sus diluciones (véase a continuación). Asimismo, en cada dilución se debe emplear una réplica del bioensayo (2 a 5 veces). Las plantas se cultivan en condiciones controladas (Vicent, 1970) y después de 15 días, se les examina para ver si han formado nódulos. Las poblaciones de BFNFNL se estiman por el método del Número más Probable (Cochran 1950; Woomer et al., 1988b, 1999). En el caso de inocular las plantas únicamente para capturar las BFNFNL, las muestras de suelo deberán resuspenderse en agua esterilizada o en una solución de nutrientes (la misma que se utiliza para un medio de cultivo o crecimiento de plantas) (véase anexo 6.1 y 6.2) en una correspondencia 1:1. Las plantas pueden cultivarse en bolsas de plástico, jarras de Leonard u otro tipo de frasco. Se deben utilizar tres tipos de controles sin inoculante de suelo: el primero comprueba la presencia de contaminación durante los procedimientos experimentales. Si no se mantienen de manera correcta las condiciones axénicas, este control resultará en nódulos y el experimento se invalidará (aún cuando nódulos ocurren en una sola réplica). Se recomienda que el número de réplicas dentro de este control sea mayor que las réplicas de tratamientos de inoculación y el control debe localizarse dentro de diferentes posiciones en el protocolo. Los otros dos controles permitirán comprobar la eficiencia de las comunidades de BFN. Las comunidades que nodulan la planta hospedera indican si las condiciones del experimento (temperatura, concentraciones de nutrientes) son adecuadas para que se lleven a cabo la nodulación y la fijación de nitrógeno en las plantas y su crecimiento. El primero de los controles se complementa con nitrógeno mineral (para jarras de Leonard, 70 mg N-NH4NO3) cada semana desde la tercera hasta la penúltima, pero no se inocula. Para bolsas de plástico o recipientes de pequeños volúmenes, se utiliza una sola aplicación de 70 mg N-NH4NO3). De esta manera el caupí, que alcanza su nivel de floración en dos meses, con el uso de jarras de Leonard recibirán un total de 350 mg N-NH4NO3, mientras que los frijoles con un periodo de crecimiento de mes y medio, en jarras de Leonard, recibirán 280 mg de N-NH4NO3. El otro control se inoculará con un inoculante recomendado para esta
B acterias
formadoras de nódulos en leguminosas

193

especie de planta; por ejemplo, CIAT 899 para Phaseolus vulgaris en Brasil, pero no se añade nitrógeno. Aislamiento y caracterización de BFNFNL. Las BFNFNL son aisladas de los nódulos recogidos en campo y por bioensayo en el laboratorio. En el último caso, los nódulos obtenidos en cada dilución sucesiva pueden indicar cuáles son las cepas menos frecuentes en la muestra de suelo y cuáles, las más comunes. El primer paso será esterilizar la superficie de los nódulos con una breve inmersión en 95% de alcohol, seguida de una inmersión más larga de tres a cuatro minutos en HgCl2 (hipoclorito de Na o Ca, o H2O2 pueden usarse como sustitutos) y lavado mediante varios enjuagues con agua estéril (Vicent, 1970). A continuación se aplasta el nódulo dentro de unas gotas de agua estéril, utilizando pinzas y esto se vierte sobre un medio de agar. En el caso de los nódulos disecados, éstos deben remojarse en una solución de agua esterilizada para mejorar la absorción de la solución desinfectante. Los tiempos de inmersión en HgCl2 u otros desinfectantes, deberían ajustarse al tamaño del nódulo (más corto para nódulos pequeños). En la composición del medio de agar: levadura-manitol-sales minerales (Fred y Waksman, 1928) (Anexo 6.1), especialmente el pH y la fuente de carbohidrato pueden variarse, tomando en cuenta las condiciones específicas del suelo (Date y Halliday, 1979; Souza et al., 1984; Elkan y Bunn, 1991). Puede incluirse azul de bromotimol como indicador porque los cambios en el pH, causados por la formación de BFNFNL, pueden resultar útiles en la identificación de género. Otros caracteres incluyen: la tasa de crecimiento (tiempo TAIC de aparición de colonias aisladas), la cantidad de polisacáridos celulares, forma y tamaño de colonia, diámetro y color según lo descrito por Moreira et al. (1993) y Jesús et al. (2005). Los principales descriptores de cada género son: Allorhizobium, Rhizobium y Sinorhizobium: colonias circulares, de 2 a 4 mm de diámetro, normalmente unidas debido a la copiosa producción de polisacáridos extracelulares, convexas, semitraslúcidas, elevadas y mucilaginosas, la mayoría con el centro de color amarillo (debido al indicador de pH), de crecimiento rápido (TAIC: de 2 a 3 días). Mesorhizobium: igual que Rhizobium, pero normalmente de crecimiento más lento (TAIC: de 4 a 5 días). Bradyhizobium: colonias circulares que no exceden de un milímetro de diámetro, producción extracelular de polisacáridos de abundante a escasa (esto último, generalmente en el caso de los tipos que toman más de diez días para su crecimiento), opacas, raramente traslúcidas, blancas y convexas, granulares en textura y que producen un cambio de pH a alcalino, de crecimiento lento o muy lento (TAIC: de 6 a más días).
194
Manual de biología de suelos tropicales

Figura 6.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.

Paso de dilución

Nivel de dilución

El porcentaje base de la dilución (Nd) puede variar de 1:2 hasta 1:14.5 y el numero de replicas por dilución (N) de 2 a 5. Fuente: adaptado de Woomer, 1993 y Vincent, 1970 por Moreira y Pereira, 2001.
B acterias
formadoras de nódulos en leguminosas

195

de crecimiento rápido a medio (TAIC: de 3 a 4 días). 1993). con la excepción de modificación de pH porque pueden producir una reacción ácida o alcalina (dependiendo de la edad). será necesario definir el nivel apropiado de diversidad que permita caracterizar géneros y especies específicos. se han descrito nuevas técnicas para la caracterización de los procariotes. 1988). crecimiento en diferentes fuentes de carbono (Dreyfus et al. 1989). sino también la capacidad de discriminación dentro de diferentes taxas: cada una tiene un nivel específico de resolución para la clasificación bacteriana. generalmente. en sus características simbióticas...Azorhizobium: colonias circulares. resistencia intrínseca a los antibióticos (RIA) (Kingsley y Bohlool. perfiles de plásmidos (Giller et al. bajo condiciones bacteriológicas controladas. lo que mejora no sólo la clasificación bacteriana. 1988). por ejemplo. de 0. por lo tanto. contienen gránulos refráctiles de poly-β-hidroxibutirato en microscopio de contraste de fases. de acuerdo con los postulados de Koch. 1988).. Graham et al. lipopolisacáridos celulares (De Maagd et al. (1991) aportaron estándares mínimos para la descripción de nuevos géneros y especies.1 se pueden observar referencias que ofrecen amplios detalles de las características de especies de NFNLB. de color cremoso. lo que puede ser muy útil para numerosos estudios. Recientemente. hibridación DNA:DNA.. morfológicas y fisiológicas.. secuencia de la subunidad pequeña del RNA ribosomal (Young y Haukka. patrones totales de proteína por SDS-PAGE (Dreyfus et al. mediante una demostración en la que formen nuevos nódulos en una planta hospedera de prueba. Estas técnicas. composición de bases de DNA (%C + G).. al mismo tiempo. Las BFNFNL son bastoncillos Gram negativos que no forman esporas y que. 1988. muy poca producción extracelular de polisacáridos (mucho menos que en el caso de Bradyhizobium). 1983). Cupriavidus: similar a Azorhizobium.5 mm de diámetro. donde incluyeron serología (Dudman y Belbin. por ejemplo Rhizobium. hibridación rRNA-DNA y polimorfismos en los tamaños de fragmentos de restricción del DNA. dentro de la especie puede ser genéticamente y fenotípicamente alta. 1986). también conocidas como huellas 196 Manual de biología de suelos tropicales . En la Tabla 6. Burkholderia: con características de crecimiento muy similares a las de crecimiento rápido. con un poco más de producción extracelular de polisacáridos. La diversidad de cepas. 1996).. producen un cambio de pH a alcalino. electroforesis de enzimas metabólicas (Selander et al. Las cepas aisladas deben reconfirmarse como BFNFNL. a veces. Moreira et al.

incluyen: la digestión de DNA genómico con endonucleasas que cortan sitios (de restricción) poco frecuentes seguido por PFGE (Electroforesis en Gel en Campos Pulsados) y otros métodos de RFLP. El número total de placas de 96 muestras cuesta alrededor de US $350 para la secuenciación. la secuenciación directa de 16S rARN u otros genes puede ofrecer ventajas económicas. normalmente. Por ejemplo. tales como ARDRA (Análisis de Restricción del rDNA Amplificado). Los métodos basados en la reacción de Polimerasa en Cadena (PCR).. Empresas privadas dan buenos servicios para productos PCR y su purificación y secuenciación. 23S rARN u otras secuencias de genes. Extracción de DNA: el DNA genómico es aislado de cultivos de fases log en 79/YMA durante diferentes periodos de incubación.) (Rademaker y Bruijn. Alternativamente. RAPD (DNA polimórfico amplificado al azar): AP-PCR (PCR Con Arimers Arbitrarios). Los costos y beneficios de una caracterización previa y secuenciación de representantes versus una secuenciación directa de un número mayor de aislados. en algunos casos. Se pueden utilizar el kit “Ultraclean” para el aislamiento de DNA de suelo de los laboratorios MOBIO o cualquier otro kit recomendado por el productor. Los análisis numéricos con un número adecuado de cepas y la comparación con las cepas de BFNFNL permiten la caracterización de grandes poblaciones. 1997. AFLP (Polimorfismo de Tamaño de Fragmentos Amplificados) para el análisis de todo el genoma. dependiendo de la tasa de crecimiento específica para cada cepa (de 2 a 10 días).genómicas. Se cuantifica el DNA a A260 nm con un espectrofotómetro o se estima por comparación con diferentes estándares de concentraciones de DNA en geles de agarosa. 1997). si se piden las placas completas de 96 muestras. La caracterización genética de DNA (secuencia del 16S. por otro lado. se restringe únicamente a representantes de grupos. Los costos de la secuenciación de DNA se han reducido notablemente durante los últimos años y. para cada tipo se suspende una azada con bacterias de una colonia aislada en 1 ml de agua B acterias formadoras de nódulos en leguminosas 197 . en la actualidad. la secuenciación de genes específicos puede aplicarse directamente a un número de cepas determinado por las curvas de rarefacción o acumulación. tRNA-PCR o ITS (Amplificación y Análisis del tRNA y de Regiones Intergénicas del 16S-23S rRNA). si existe disponibilidad de recursos. la purificación y secuenciación de un fragmento de genes (una muestra) ya amplificada por PCR. REP-PCR (Huellas Genómicas de Elementos Genómicos Repetidos de DNA. Bruijn et al. homología DNA:DNA) requiere de mucho tiempo y de equipo especializado y. puede costar alrededor de US $6. deben tomarse en cuenta.

se utiliza un volumen de esta suspensión como templado para el PCR.nih. Sin embargo. 1990). tales como la del National Center for Biotechnology Information (NCBI) (www. lo que produce una suspensión ligeramente turbia que posteriormente se hierve durante cinco minutos para lisar las células. Las concentraciones finales en las mezclas de reacción (100 ml) son: 1 x PCR Buffer. Otros oligonucleótidos pueden utilizarse si permiten la síntesis de un gen 16S rARN casi completo.5 mm MgCl2.ebi. del gen 16S del RNA ribosomal de Escherichia coli (Wilson et al.ac. o bien. los cultivos puros se mantienen en agar inclinado dentro de tubos de tapa rosca en el mismo medio de cultivo. por otras técnicas).ncbi. seguido por 30 ciclos de desnaturalización a 94°C durante 40 segundos. Análisis filogenético. Los genes casi completos del 16S rDNA se amplifican con un par de oligonucleótidos 27F (pA: 5`AGAGTTTGATCCTGGCTCAG) y 1492R (5´GGTTACCTTGTTACGACTT).edu/index. durante 40 segundos.esterilizada. similares a los presentados en la Figura 6.. Se comparan las secuencias con otras conocidas contenidas en las bases de datos.uk) y el Ribossomal Database Project (RDP) (http://rdp.2 μm de cada oligonucleótido y dos unidades de la enzima Taq polimerasa (DNA extraído o cultivos líquidos): 6 μl. 2. 0.msu. perfiles REP-PCR.cme.2 mm de cada dNTP. con extensión a 72°C durante 90 segundos. Un paso de secuenciación del PCR amplificado se obtiene con el primer 27F.2. pero también con el primer reverso 1492R. La extensión final se lleva a cabo a 72°C. respectivamente. durante 7 minutos. el European Bioinformatics Institute (EBI) secuenciación de base de datos (www. MANTENIMIENTO Y COLECCIÓN DE CULTIVOS PUROS Normalmente. usando los aislamientos representativos de diferentes grupos (obtenidos bien por caracterización de cultivo. 0. Secuenciación 16S rDNA.jsp).gov/).nlm. El programa para PCR incluye un paso inicial: desnaturalizar a 94°C durante 5 minutos. 198 Manual de biología de suelos tropicales . Cuando se requiere la secuencia de todo el gen se deben elegir otros primers internos y usarse para amplificar y secuenciar el fragmento del gen que falte después de utilizar 27F y 1492R. apareamiento a la temperatura de 55°C. la viabilidad de dichos cultivos no es larga: los métodos como liofilización y almacenaje en un congelador (–80°C) garantizan una larga conservación de las células viables. La purificación de los productos PCR se hace con filtros Microcon™ (Millipore) o mediante otros métodos de purificación. Estos pares de oligonucléotidos corresponden a posiciones 8-27 y 1507-1492.

V. T. F.. (2010) ´Devosia yakushimensis sp.. R. pp209–266. G. K. isoled from root nodules of Pueraria lobata (Willd. V. Elliot.: A bacterial predator of bacteria in soil’. vol 47. (1982) ‘Ensifer adhaerens gen. Monsalud. vol 32. M. S. Soil Biology and Biochemistry.. Brandelet. R. nov.. P. (1987) ‘Methods for quantification of nitrogen fixation associated with Graminae’. Chou. Murphy. Y. pp2174-2179. Amarger. Boddey. Esperanza Martínez. Chou...) Ohwi´ International Journal of Systematic and Evolutionary Microbiology vol 60. nov. Elliot. Sprent. I. Casida Jr.. M. Berge... (1999) ‘Burkholderia caribensis sp. nov. E. J. Springer-Verlag. (2007)´ Burkholderia nodosa sp. Bala.. J. J. Chen.787-749. and Rhizobium giardinii sp. James. Roncato. R. M. Bautista. Santealla. (1975) Nitrogen Fixation in Bacteria and Higher Plants..H.. New York.G. B acterias formadoras de nódulos en leguminosas 199 . an exopolysaccharide-producing bacterium isolated from vertisol microaggregates in Martinique‘. International Journal of Systematic and Evolutionary Microbiology vol 49. G.. nov. De Faria. W. an exopolysaccharide-producing species isolated from legume and non-legume rhizospheres´ International Journal of Systematic and Evolutionary Microbiology vol 59. I. International Journal of Systematic Bacteriology. International Journal of Systematic Bacteriology. M. M.. J.. pp627-632.. (2001) ‘Genetic diversity of rhizobia varies from natural populations with the soil dilution sampled’. nov. pp996–1006. y Heulint. S. Barakat. pp841–843. N. De Faria. N. y Hardy. . J. Giller. from Phaseolus vulgaris nodules’. O. M. Heulin. Cnockaert. E. T.. Young. G. G. K. C.. S. A.. pp339–345. David Odee y Nancy Karanja. W. REFERENCIAS Achouak.. W. Macheret. M.. vol 33. Y. nov. y Vandamme. Critical Reviews in Plant Sciences. N. A. (1997) ‘Rhizobium gallicum sp.P.. Lin. R.H. (2009) ´Rhizobium alamii sp. C... Sprent.. E. nov. W. Chen. J. James.. L. nov. Christien. isolated from root nodules of Mimosa caesalpiniifolia´ International Journal of Systematic and Evolutionary Microbiology vol 58. R. P.. M. Bontemps. (2008) ´Burkholderia sabiae sp. K. Sheu.. vol 16. Burns. K. M.. pp. sp. C. y Laguerre.. P..W y Vandamme.AGRADECIMIENTOS Agradecimientos especiales por sus comentarios y revisiones a los Drs. E.. y Yakta. y Achouak. A... R.. Christen. W. V. Lodhi.. Marlet.pp367-372.. nov.

T. L.. Young. pp1–275.K. X. M.G.M. Sprent. Chou.. X. (2001) ‘Ralstonia taiwanensis sp. a moderately and slowly growing root nodule bacterium isolated from an arid saline environment in Xinjiang. Laevens. James. Chen.. A. Li. E. People’s Republic of China’.. Y. H. Farruggia... D. S.. Y. nov. International Journal of Systematic Bacteriology. Botaniste (Paris). y Vandamme. T. y Vandamme. Y. W. Li. P.’. F. Andrews. Wang. X.. W. J.. vol 45. X. International Journal of Systematic and Evolutionary Microbiology vol 51. W. (1997) ‘Rhizobium hainanense sp. M. isolated from wild Alhagi sparsifolia in north-western China´. S. Bontemps. Barrios. Elliot. S. S. J.I. W. Chen. Moreira. isolated from tropical legumes’.S. pp1729–1735. International Journal of Systematic Bacteriology. Chen... vol 11. isolated from nodules of Mimosa species and sputum of a cystic fibrosis patient’. E. y Li. (1995) ‘Characteristics of Rhizobium tianshanense sp. M. nov. (1991) ‘Rhizobiumhuakuii sp.. N. Viniesa. pp153–159. nov. 6. nov. Cochran... S. K. Chen. Chen.T. 200 Manual de biología de suelos tropicales . Z.. isolated from the root nodules of Astragalus sinicus’. International Journal of Systematic Bacteriology. G.. S. M.W y Wei. (1950) Estimation of bacterial densities by names of the “most probable number”. Zhu. Coenye.. W. Shen.. E. Lee.. y Li. International Journal of Systematic and Evolutionary Microbiology. H... vol 57. y James. Y. P. M. J. F. y Li... L. (2006) ‘Burkholderia mimosarum sp.. W.. Wang.. Odee. Qi. pp870–873. Dangeard. L.. vol 41.. Gyaneshwar.. G.P. pp105-116. L. pp2510-2525. Tan. Young. Humphry. M.. Faria. P. L. vol 38.isolated from root nodules of the woody Brazilian legumes Mimosa bimucronata and Mimosa scabrella´ International Journal of Systematic Bacteriology. T. T. vol 16.M. J. P.. Vos. (2009) ´Nodulation of Sebania species by Rhizobium (Agrobacterium) strain IRBG74 and other rhizobia´Environmental Microbiology. G. Yuan. P. I. Cummings. Sprent. vol 56. J. Y. W. Chen. Li. M. pp1847–1851.. Wang.P. P. E. Biometrics. W. (1988) ‘Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned to Sinorhizobium gen. International Journal of Systematic and Evolutionary Microbiology vol 60 pp958962. T. vol 47. J. C. G. y Wang. nov.F. pp392–397.. J. W. International Journal of Systematic Bacteriology. Chen. Yan. Chen. nov.. isolated from nodules of Mimosa spp.W. Mergeay. (1926) ‘Recherches sur les tubercles radicaux des légumineuses’. vol. pp10551059.. pp275–280.. J.P. from Taiwan and South America’. nov.. X. D... E. E. Gao. (2010) ´Mesorhizobium alhagi sp. Coenye.

. J. R.. Rademaker. Dreyfus. Hoste. Ragatz. P. (1988) ‘Numerical taxonomic analysis of some strains of Rhizobium spp. C. Collins.. R.. Molouba. Elkan. International Journal of Systematic Bacteriology. P. Truper (eds). M. International Journal of Systematic Bacteriology. Applied and Environmental Microbiology. y Gilles. A. K. pp3782–3785.. U.. vol 277.. A. vol 127. M. y Stoltzfus. Neyra. in A. Marcel Dekker Inc. Struffi.. y Gillis.. Berlin. pp89–98. De Maagd. C. nov. D. (1994) ‘Polyphasic taxonomy of rhizobia: Emendation of the genus Sinorhizobium and description of Sinorhizobium meliloti com.. Torck. Pot. Dudman.. vol 170. R.. Dilworth.’. infertile soils of the tropics’.. nov. Millcamps. M. B. 2nd Edition. Laurent-Fulele. pp715–733. van Rossum. y Belbin. (1988) ‘Characterization of Azorhizobium caulinodans gen. M. E. (1991) ‘The Rhizobia’. (1998b) ‘Characterization of tropical tree rhizobia and description of Mesorhizobium plurifarium sp. Willems. M. and Sinorhizobium teranga sp. J... Springer-Verlag. nov.. F.. Elmerich.. y Lugtenberg. y Gillis.’. sp. Dreyfus. A. Sinorhizobium saheli sp. B. (1988) ‘Recognition of individual strains of fast-growing rhizobia by using profiles of membrane proteins and lipopolysaccharides’. R. A.. Biochemica et Bioophysica Acta. Lindstrom. Collins. y Bunn. G.. K. G. pp369–382. H. L. Dreyfus. M. B acterias formadoras de nódulos en leguminosas 201 . nov.. U. F. D. De Bruijn. vol 44. P. M. Neyra.. Date. F. Kluwer Academic Publishers. H. A. (1997) ‘Molecular approaches in microbial ecology to assess genomic diversity and stress-induced gene expression in plantassociated diazotrophs’. y Halliday. McSpadden-Gardener. Dordrecht. De Lajudie. L. Nature. International Journal of Systematic Bacteriology.. M. nov. A.. Torck. Davey.. B. J.. J. R. D. Collins. B. in G. (1966) ‘Acetylene reduction by nitrogen fixing preparations of Clostridium pasteurianum’. M. Coopman. J. Moreira. M. M. isolation. nitrogenfixing bacteria that efficiently nodulate Neptunia natans in Senegal’. K. Dewettinck. nov. G. (1979) ‘Selecting Rhizobium for acid.. y Halliday. G. New York. The Prokaryotes. pp285–294. that uses a qualitative coding of immunodiffusion reactions’. Nick. De Lajudie. De Lajudie. pp1277–1290. nov. sp. P. Journal of Bacteriology. nov. H. Kersters. A. Kersters. E. vol 48. B... Newton (eds) Biological Nitrogen Fixation for the 21st Century.. M. (1998a) ‘Allorhizobium undicola gen. B. W. (1987) ‘Collection... F. D. Willems. Schultz. Maestrojuan.. W. J. Schlegel and H. a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata’. B. A. pp62–64. vol 48... J. E.. vol 54.. pp1825–1830. M.. Balows. vol 38. Willems. y Gillis. in C. D. Dreyfus.Date. Garcia. International Journal of Systematic Bacteriology. Elkan (ed) Symbiotic Nitrogen Fixation Technology. Kondorosi and W. J.. L. L. Dworkin. cultivation and maintenance of rhizobia’ .

vol 37.. J. Graham. Wang. Rigottier-Gois. vol 19. J. Ghosh. Gao. vol 111.nov. B. J. Han. Roslycky. Lindstrom. S. nov. R. Cooper. I. Chen. nov. P. pp91-97. S. Barnet. vol 41. Turner. Jarvis. 394–399. Mateos.. P. W. D. (1928) Laboratory Manual of General Microbiology. Qiu.F. P. K. E. Strijdom. R.. pp332–346... A. E. Y. H. R. isolated from sawdust of Populus alba’... García-Fraile.. G. International Journal of Systematic and Evolutionary Microbiology.M. (2007) Rhizobium cellulosilyticum sp. E. Tian. M.P. P. E.and stem-nodulating bacteria’.. R. E. Young... Soil Biology and Biochemistry..F. P. A. J. Sadowsky. vol 56. Botanik Zeitung.T. Bradley.. M.. y Chen. L. pp 582–587.X. S. B. isolated from Astragalus adsurgens growing in the northernregions of China’. vol 21. Martínez-Molina. T. J. a novel sulfur-oxidizing chemolithoautotroph from rhizosphere soil of an Indian tropical leguminous plant´. K. X. P. X.. pp 607–619. Lloyd-Macgilp. (1991) ‘Proposed minimum styards for the description of new genera and species of root. (2008) Rhizobium miluonense sp. L. J. F.. pp2037–2048.. vol 51. (1987) ‘Use and abuse of the acetylene reduction assay for measurement of “associative” nitrogen fixation’.. y Chen. E. Giller. nov. McGraw-Hill Book Company. A. W. y Young.Faria. K. P.. C. Gaunt. H. nov. pp 841–848. Lewis. International Journal of Systematicand Evolutionary Microbiology. Z. E. H. (2004) ‘Mesorhizobium septentrionale sp. Berichte der Deutschen Botanischem Gesellschaft. Turner. Frank.X.. pp 844-848. New York and London. vol 57... Willems. W. Y. pp783–784. J. W.. Inc. Frank. A. pp376–387. T. W.. W. S. M. Giller. B.. Wang. B. S. New Phytologist. vol5. y Hirsch. Sprent. Fred. pp2003–2012. (2006) ´Mesorhizobium thiogangeticum sp. International Journal of Systematic and Evolutionary Microbiology. a symbiotic bacterium isolated from Lespedeza root 202 Manual de biología de suelos tropicales . W. International Journal of Systematic Bacteriology. W... J.. P.. Kan.. L. Rivas.. McGrath. Peix. vol 7. W. Z. Gu. E. y Young. (2001) ‘Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia’. M. B. L. Martens.. and Mesorhizobium temperatum sp.. Terefework.F. International Journal of Systematic and Evolutionary Microbiology. H. J. y Sutherly. Keyser. Sui. y Waksman. (1879) ‘Ueber die Parasiten in den Wurzelan-schwillungen der Papilionaceen’. C.. L. Y. Soil Biology and Biochemistry.T. M. B. W..... S. y Velázquez.H. (1889) ‘Ueber die Pilzsymbiose der Leguminosen’. (1989) ‘Occurrence of nodulation in the Leguminosae’. Tan. E. y Roy. de Ley. S. (1989) ‘Absence of nitrogen fixation in clover grown on soil subject to long-term contamination with heavy metals is due to survival of only ineffective Rhizobium’.

L. M. R. International Journal of Systematic Bacteriology. vol58. y Chen.X. pp1693-1699.) Vassilcz´. e Seky.vol 59. Wu. W.. B. M.K. W. nov.T. nov.. Kawasaki. y Chen. W... W. Chen. S. E. Zhang. L.(2008) ‘Rhizobium multihospitium sp. T... (1997) ‘Transfer of Rhizobium loti. E. J. Han. y Chen. y Moreira. Yan.. pp2610-2618. nov. J. Li.L. W. Y. W. Jarvis. Lu. L.. International Journal of Systematic and Evolutionary Microbiology. nov. Hou. D. Isolated from a Tumor-Like Root of the Legume Entada koshunensis from Iriomote Island in Japan‘. in China ‘. a symbiotic bacterium isolated from Trigonella archiducis-nicolai (irj. Biotechnol.. Wang. nov. (2008) ‘Bradyrhizobium iriomotense sp. Y. A.1553. Wang. Islam. China‘.. (2007) ´ Rhizobium selenireducens so..X. T. Kuykendall. C.. D. Rhizobuim huakuii. X. W.J. Rhizobium mediterraneum and Rhizobium tianshanense to Mesorhizobium gen.International Journal of Systematic and Evolutionary Microbiology. F... W. nov. van Berkum. Rodrigues. isolated from nodules of Cicer arietinum´. E. a novel rhizobial species nodulated with Caragana spp. Y. nov. P. Gu.. X. Cleyet-Marel. vol 47. F. vol 58. Chen. L. and Mesorhizobium tarimense sp. Jesus. Imran.. Malik. L. (2008). T. y Stackebrandt.T. S.C. pp1416-1429. B.. vol 58.. C..F. E. a new species of legume root nodule bacteria’.. Wu. A. Mesorhizobium caraganae sp. nov. (2008) Mesorhizobium gobiense sp. M. Sui. M. S. 895–898. Jia..T.F. Schumann. nov.H.X. Jarvis. (2010)´Ochrobactrum ciceri sp. J. M. Guan. Dong. Chen. vol58.. D. Gao.. Biochem vol 72. Y. A. Florentino.. A. C.. E. Tian C. Han. J. y Chen.’. Y. pp1364-1368. y Patel. Han. Gu.. Oliveira. P.nodules‘..F. E... Hafeez.. y Gillis. K.. X.X.. M. Wang. Nakagaka.J. Hunter. y Manter D..X.H. H.: a selenite-reducing (alpha)-Protobacteria isolated from a bioreactor´Current Microbiology.T....F. vol 32. vol 60: 1548 .G.J.X.s. International Journal of Systematic and Evolutionary Microbiology.F. Gu. International Journal of Systematic and Evolutionary Microbiology. International Journal of Systematic and Evolutionary Microbiology. pp2646-2653. E. vol 55.. P. Frühling. W. Pankhurst. Rhizobium ciceri. International Journal of Systematic and Evolutionary Microbiology.I. (2009) ´Rhizobium tibeticum sp.. pp378–380. Chen. C.. B. W. Biosci. Muramatsu. M. Y. isolated from wild legumes growing in desert soils of Xinjiang. Fernyez. China‘.. isolated from multiple legume species native of Xinjiang.pp3051-3057. (1982) ‘Rhizobium loti. International Journal of Systematic Bacteriology.. I.. Wang.T.. pp455-460. (2005) ‘Leguminosae nodulating bacteria diversity from three different land use B acterias formadoras de nódulos en leguminosas 203 .G.J.R.. X. Chen.Z. J. W. Nour. R.X... W.B.

X. Chen. nov. Dénarie. isolated from root nodules of three different legume´. D. (2004) ‘Methylobacterium nodulans sp. vol 59. Li. y Chen. M.X..X.H. International Journal of Systematic and Evolutionary Microbiology. vol 29..X. W. E. W.. Chen. vol 59: 1919 . B. Jourand. Sui.Y. International Journal of Systematic and Evolutionary Microbiology. Hu. W. y Chen. X. D. W. W.. (2009)´Rhizobium mesosinicum sp.. Holt (eds) Bergey’s Manual of Systematic Bacteriology. Gillis. B. L. Canadian Journal of Microbiology. vol 59.X.. Williams and Wilkins. (2005) Legumes of the world. Canadian Journal of Microbiology. G. W..T. pp447–459. E. y Chen. nov. J. Royal Botanic Gardens. Wang. Wang E. F. W. W. Willems. isolated from root nodules of Caragana species ‘. Y. (2009)´Rhizobium alkalisoli sp.Q. Dowling.’. Manen. D.R. Stanley. B.. vol 58..X. pp3006-3011. Schrire. Wang.systems in Brazilian Western Amazon’. Dreyfus. A...L. vol 54. Han. Krieg and J... E. A.L. vol 8.. Lin. He. B. (1984) ‘Rhizobiaceae Conn 1938’. H. pp2269–2273.T.T. y Chen. X. A. isolated from Caragana intermedia growing in saline-alkaline soils in the north of China´. a symbiotic bacterium isolated from root nodules of the herbal legume Kummerowia stipulacea ‘. legume root-nodule-forming and nitrogen fixing bacteria’.. Wong. 204 Manual de biología de suelos tropicales . Hu.. Lewin. T. H.. for a group of aerobic facultatively methylotrophic. NGR234 selected using the widely compatible legume Vigna unguiculata’. G.. (1983) ‘Characterization of Rhizobium sp. immunodiffusion and intrinsic antibiotic resistance’. nov. Chen... y de Lajudie.1923. Tang.. pp1409-1413. y Bohlool. T. D. C. C. Sui. H. Sy. Plant Molecular Biology. (2008) ´ Shinella kummerowiae sp. L.. J.. M. International Journal of Systematic and Evolutionary Microbiology. Wang.. Rosenberg.) by immunofluorescence. (2009) ´ Mesorhizobium shangrilense sp. Li. Bena. Pesquisa agropecuária Brasileira. Guan. Kingsley.Q. International Journal of Systematic and Evolutionary Microbiology... D.H... D.H. D.X. pp501–505.. Nelson. L. R. Lin. nov. N.. C. T. B.. Kuykendall.F. vol 38.Y. pp518–526. y Lock. P. vol 40. F.. (1987) ‘Multiple host-specificity loci of the broad host-range Rhizobium sp.nov.. y Udell. in N.. L. Mackinder. London. Meyer. Devine.. F. P. y Broughton. Lewis. Wang E. M. Giraud. D. pp30123018. Kew. Han. S. Saxena.T... International Journal of Systematic and Evolutionary Microbiology. pp769–776. (Cicer arietinum L. B.. Jordan.. S... Wang E.F.F. nov. J. (1992) ‘Genetic diversity in Bradyrhizobium japonicum and a proposal for Bradyrhizobium elkanii sp. J.

Nóbrega. (2009) ´Nitrogen-fixing bacteria communities occurring in soils under different uses in the Western Amazon Region as indicated by nodulation of siratro (Macroptilium atropurpureum)´ Plant and Soil.. E. International Journal of Systematic and Evolutionary Microbiology. M. PhD Thesis.M. vol 319. PP. Bekki. vol 39. D.. Franco. de Lajudie. nov. F.M. A. L. Domergue.A. Ferreira...S. a new species of legume root nodule bacteria’. Le Roux..´. Segovia. Barberi.. R.Lima.M. A. (2007)´Ensifer mexicanus sp. Mars. S. Lima. Mantelin. A. Lotus creticus.. Graham.A. G. y Moreira.. Jeder.. Zakhia. (2010) Multilocus sequence analysis of root nodule isolates from Lotus arabicus (Senegal). International Journal of Systematic and Evolutionary Microbiology...F. M.R. vol 30.. F. M. Rogel-Hernández.... y Martínez-Romero. M. (2004) ‘Methodology for the inventory of nitrogen-fixing Leguminosae nodulating bacteria’. Phyllobacterium leguminum sp. O. Béna. y de Lajudie. J. Silva. Llorente. pp509-514. beans and Leucaena trees’. L. Nairobi. Ormeno-Orrillo. y Pardo. Willems. Minas Gerais. A. S. P. Fischer-Le Saux. H. B acterias formadoras de nódulos en leguminosas 205 .A. Mahdhi. Moreira. L. Rincon. Martens. a new specie nodulating Acacia angustissima (Mill. F. pp280-290. R.. Argyrolobium uniflorum and Medicago sativa (Tunisia) and description of Ensifer numidicus sp. L.. C. Martínez-Romero. pp417– 426. International Journal of Systematic Bacteriology. F. nov. C. Systematic and Applied Microbiology. K. (1991) ‘Rhizobium tropici. Oliveira. vol 56.. eficiência e diversidade de bactérias fixadoras de N2 que nodulam o siratro (Macroptilium atropurpureum) de solos sob diferentes usos na Amazônia Ocidental’. Magalhães. pp365–367. F. J. Phyllobacterium ifriqiyense sp. S. Mercante. Merabet. F. A. B. nov´. M.. A. (1982) ´Ocurrência de nodulacão en leguminosas florestais notivas de terra firme da região de ManausAM´. Sy. Martínez-Romero. and Ensifer garamanticus sp. nov.. J. Lindström. vol 12. E.674.C. a new species nodulating Phaseolus vulgaris L. Conservation and Sustainable Management of Below-ground Biodiversity CSM-BGBD. P. Bonneau. Universidade Federal de Lavras.) Kuntze in Mexico. and Phyllobacterium brassicacearum sp. nov. S. nov.. A.127-145. (1989) ‘Rhizobium galegae. (2007) ‘Densidade..... pp827-839.M. vol 41.S.S.. y Cleyet-Marel. E. A. K. Coopman.. Zakhia. Acta Amazônica. (2006) ´Emended description of the genus Phyllobacterium and description of four novel species associated with plant roots: Phyllobacterium bourgognense sp. vol 60: 664 . M. y Döbereiner.. Kenya. Annual meeting report 4. A. P..S. Brasil.. International Journal of Systematic Bacteriology. Magalhães.. M. nov.

Suomalainen. O.. New Phytologist. S. 280pp. S. Zhang. S. Moreira. Moreira. Eardly.. M. A. Moreira. M. F. L. (1999) ‘Sinorhizobium arboris sp. International Journal of Systematic and Evolutionary Microbiology. Willems. de Lajudie. Siqueira and L. L. (1993) ‘Characterization of rhizobia isolated from different divergence groups of tropical Leguminosae by comparative polyacrylamide gel electrophoresis of their total proteins. L. Canadian Journal of Microbiology. y Franco. Tiedje. S. CAB International. A. P. X. O’Hara. E. pp948–950. Nour. Indonesia (available at http://fao. vol 29.G. y Fernandez. C. Pedrosa. in F. Wallingford. México. Effosse. nov. Nature. Moreira. Kersters.. Silva.)’. pp563–570. y Young.. Faria.. Gillis. (2009) Mesorhizobium australicum sp. vol 40... S. (2002) ‘Burkholderia spp. Brussaard (eds) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. J. S. pp345–354.. F.Moreira. Lavras. W. Bogor. Moulin.. vol 16.. O. M. vol 121. M. S. C. M. Nandasena. (1992) ‘Occurrence of nodulation in legume species in the Amazon region of Brazil’.G. T. Moreira. L. are among fast growing symbiotic diazotrophs isolated from diverse land use systems in Amazônia and from Brazilian Leguminosae forest species’. Bignell (eds) Standard Methods for Assessment of Soil Biodiversity and Land Use Practice. F.. J. y Bolvin-Masson.. nov. Cocoyoacan. and Sinorhizobium kostiense sp.. B. Brussaard (eds) Biodiversidade do solo em ecossistemas brasileiros. Moreira.. G.. Siqueira and L. A. M. (2001) ‘Microsymbionts: rhizobia’. (1994) ‘Genotypic y phenotypic diversity of Rhizobium isolated from chickpea (Cicer arietnum L. J. K. K. Marsh. vol 59. in F. A. pp135–146.) Pers. y Pereira. G. S. Swift and D. pp197–206.. 206 Manual de biología de suelos tropicales .. R. Cruz. (2006) ‘Nitrogen-fixing Leguminosae nodulating bacteria’. F. isolated from leguminous trees in Sudan and Kenya’. M. and Mesorhizobium opportunistum sp.. isolated from Biserrula pelecinus L. UFLA. nov.. microsymbiont of Sesbania virgata (Caz. S. F. y Marsh. M. A. Editora.. (2008) ‘Bactérias fixadoras de nitrogênio que nodulam Leguminosae’.org/AG/agl/agll/soilbiod/docs/manual-soil%2). E. vol 411. S.. D. F. J. M. Memorias da XXI Reunión Latinoamericana de rhizobiologia... Cleyet-Marel. vol 49. F. O. pp2140-2147. M. S. M.P. in M. pp1359–1368. S. P. Systematic and Applied Microbiology. Moreira. y Faria. y Howieson. Dreyfus.. B. J. Beck. Martínez-Romero.. Gillis. nov. Tiwari. P. G. M. K. D. M. T. International Journal of Systematic Microbiology. B. Pitard. M.W. J. Munive. R. in Australia´... Nick. Paulin. M. (2006) ‘Azorhizobium doebereinerae sp. Moreira. Systematic and Applied Microbiology. F. M. y Lidstrom. M.nov.. S. F.’. 768pp. International Centre for Research in Agroforestry. Pot. (2001) ‘Nodulation of legumes by members of the b sub-class of Proteobacteri’.

nov. J. E. Makatiani. trifolii is a later synonym of R. Ramírez-Bahena. J. M. Yuan. R.M. J. y Tan. H. E. Z. Peix. J.) and description of Rhizobium mediterraneum sp. International Journal of Systematic and Evolutionary Microbiology. (1995) ‘Natural rhizobial populations and nodulation status of woody legumes growing in diverse Kenyan conditions’. M. (2008)´Revision of the taxonomic status of the species Rhizobium leguminosarum (Frank 1879) Frank 1889AL.. Willems. New York.F. Baek. vol 27. Igual.. Universidade Federal de Lavras. (1997) ‘Characterization and classification of microbes by rep-PCR genomic fingerprinting and computer-assisted pattern analysis’. vol 188. E.. in G. T. pp334–342. S. G. y de Bruijn. W.. isolated from effective nodules B acterias formadoras de nódulos en leguminosas 207 . Martínez-Molina... (1997) ‘Phenotypic characteristics and composition of rhizobia associated with woody legumes growing in diverse Kenyan conditions’. García-Fraile. nov. W. W. isolated from a cyanide treatment bioreactor’. D. S. D. vol 58. y Lee. Odee. A. PhD Thesis. y Fernandez. I. Rivas.. vol 58. Systematic and Applied Microbiology. Mateos. Bae. (2004) ‘rRNA and dnaK relationships of Bradyrhizobium sp. Gresshoff (eds) DNA Markers: Protocols.. M. Reclassification of the strain R. J. McInroy. (2008) ´Rhizobium oryzae sp. vol 173. S. pp2158-2163. International Journal of Systematic and Evolutionary Microbiology. nodule bacteria from four Papilionoid legume trees in Costa Rica’.. y Velázquez. J. Rademaker. Kimiti.. Zhang.. Odee.. E. R.. Plant and Soil. G. G. J. Sutherland. and Overviews. P. vol 55. Plant and Soil.’. leguminosarum.. Valverde. Parker.H.H.Nour... W.. Mateos. International Journal of Systematic Bacteriology. A. Normy.. J.. leguminosarum DSM 30132 (=NCIMB 11478) as Rhizobium pisi sp. nov.. Z. International Journal of Systematic and Evolutionary Microbiology.. A. pp65–75. Rodríguez-Navarro. nov. L. Li. D. Rivas.. Sutherland. A. E. and P. pp2484-2490. Chen.. J. (1995) ‘Genomic heterogeneity of strains nodulating chickpea (Cicer arietnum L. pp211–224. P. John Wiley and Sons Inc. (2000) ‘Diversity of rhizobia isolated from different land use systems in Amazon region’. Ramírez-Bahena. (2009)´ Bradyrhizobium pachyrhizi sp. y Velázquez.. Peix.. Quan. vol 45.F. P.. y Sprent.. nov. y Sprent. R. W. Cleyet-Marel. Brazil. pp2543–2549. I. and Bradyrhizobium jicamae sp. M. H. Caetano-Anollés.N. Peng. C. Lavras. M. M. Im.. isolated from the wild rice Oryza alta´. M. Rhizobium phaseoli Dangeard 1926AL and Rhizobium trifolii Dangeard 1926AL. M. pp640–648. Martínez-Molina. Pereira. P. A.. Camacho. F. W. E. (2005) ‘Rhizobium daejeonense sp.. Applications. Q.. M. P. M. nov. D.

G.. pp374–377. pp5217–5222. Willems. R. isolated from roots of Beta vulgaris affected by tumour-like deformations´ International Journal of Systematic and Evolutionary Microbiology. Subba-Rao. Systematic and Applied Microbiology. A.. Brunel. M. nov. E. pp972–980. vol 54. Martínez-Molina. E. R. A. 208 Manual de biología de suelos tropicales . Applied and Environmental Microbiology. pp5217-5222. A.. isolated from annual Medicago spp. Martinez-Molina. y Chen. P. C. Ponce.L. W. Gillis. International Journal of Systematic Bacteriology.. M. Rome. y Vizcaíno. P. Mateos. Normy. Willems. J. P.. F. E. Musser.. E. M. vol 34. Gilmour. vol 61. K. (2002) ‘A new species of Devosia that forms a unique nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (L. Rivas. y Burris. A.) Druce’. Sui. International Journal of Systematic Bacteriology. Ren. vol 24. nov. (1996) ‘Sinorhizobium medicae sp.. y Elkan. H. E. Caugant.. P. y Martínez-Romero.. J. E. (1966) ‘Study of intermediates in nitrogen fixation’. Willems. Palomo.. E. pp580-586. R. Dazzo. R.’. y Martinez-Molina. pp1271-1275.. M. F. E.F.. D. N.F. Rivas. Young. pp873–884. Mateos. M.. D.nov.. nov.. which has common symbiotic genes with Sinorhizobium mexicanum´.’. H. vol 68. pp484–486.. L.. Selyer. vol 59. D.. B. N.. International Journal of Systematic and Evolutionary Microbiology... an aquatic legume from India’. International Journal of Systematic and Evolutionary Microbiology. (2009)´ Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico. Ochman.. Proceedings of the Federation of American Societies for Experimental Biology. R. D. H.. W. vol 26. Gillis.f... Vizcaíno. S. y Velázquez.W.. N.. R. (1986) ‘Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics’. Rivas. P.of Pachyrhizus erosus’.. vol 43. including Sinorhizobium chiapanecum sp.. N. M. International Journal of Systematic Bacteriology. F. R.. N. Llorente. Wang. (2011)´Rhizobium vignae sp. S. FEMS Microbiology Ecology Vol 68. F. W. vol 51. M. nov. H. Subba-Rao. (1984) ‘Rhizobium fredii sp. a symbiotic bacterium isolated from multiple legume species´.T. Fernadez.. pp47–53. (1993) ‘Reclassification of American Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp. García-Benavides. Rincón-Rosales. Applied and Environmental Microbiology. Scholla. Dazzo. J. P. L. a fast-growing species that effectively nodulates soybeans’.. R.. p710 Segovia. Velázquez. J. M. Gillis. vol 46.H. Schollhorn.X. that nodulates and fix nitrogen in symbiosis with Neptunia natans.. P. pp255. y Cleyet-Marel. y Martínez-Romero. X. nov. E. T. Mateos. (2003) ‘Description of Devosia neptuniae sp. nov. Chen. (2004) Bradyrhizobium betae sp. y Whittam.. Kroppenstedt..

Tola.. Pesquisa Agropecuária Brasileira – Ediçao Especial 19. M. Kan. J. de Lajudie.. T. s/n. A.. vol 52.. W. G. E. E. Tian.. B.. D. B. P. a new Sinorhizobium species nodulating Acacia spp.G. vol 183.. pp1985– 1989. A. Applied and Environmental Microbiology. M.J. y Nuti.. Wang. S. A. Z. (2005) ‘Phylobacterium trifolii sp.X.. E. E.. Trujíllo... Joury. International Journal of Systematic and Evolutionary Microbiology‘. Valverde. Peix. Toledo. Reinhold-Hurek. a bacterium that nodulates Vicia faba. F. H. Gu. pp1267–1276.. Van Berkum. y Chen. Journal of Bacteriology. vol 55. Fernández-Santos.. Valverde. P. (2008) ‘Rhizobium favae sp. X. E. y Martínez-Molina. Struffi.Souza. nov. Y. (2002) ‘Rhizobium sullae sp.M. I. W. F. Giraud. N.. International Journal of Systematic Bacteriology. Planchuelo. L. (2006) ‘Rhizobium lusitanum sp. Ludeña.. 58: pp 2871-2875. Bao. (2001) ‘Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes’. International Journal of Systematic and Evolutionary Microbiology. nov. M. vol 56. (2003) ‘Sinorhizobium americanum sp. A... Garcia. Prin. X. y Dreyfus. Campbell. Sy. A. Velázquez. A. T. A. pp214–220. nov. pp. isolated from arid and semi-arid regions in China’. vol 26.. D. vol 51... Cervantes.G. P.. nov.. P. E. Lloret. a bacterium that nodules Phaseolus vulgaris´. E. Abril. Igual. Y. Velázquez. y Eardly. E. y Martínez-Romero. Casella. Van Berkum. vol 71. A. Dazzo. Mateos. B.. Rivas.. Selnska-Pobell.... Systematic and Applied Microbiology. P.. y Chen. F. G. A..’.. Applied and Environmental Microbiology. Wu. Vizcaíno.. (1984) ‘Avaliaçao do crescimento de rhizobium de leguminosas florestais tropicais em diferentes meios do culura’..T. (2001) ‘Rhizobium yanglingense sp. (2005) ‘Nodulation of Lupinus albus by strains of Ochrobactrum lupine sp. (formely ‘Rhizobium hedysari’). Wang. in Mexico’.F. A. L.. (2002) ‘The aquatic budding bacterium Blastobacter denitrificans is a nitrogen-fixing symbiont of Aeschinomene indica’.X. E.. F. International Journal of Systematic Bacteriology.. International Journal of Systematic and Evolutionary Microbiology. Gu. is one of three rhizobial genotypes identified which nodulate and form B acterias formadoras de nódulos en leguminosas 209 . Willens.nov.F. pp1132–1136.. P. E. y Oliveira.. Vendramin. L. D. Chen. Rivas. y Eardly. F. Squartini.. A. 2631-2637. nov..’. R. the root-nodule microsymbiont of Hedysarum coronarium L.nov. Matínez-Molina. M. Beyene. G. A. Willems. S.. pp1318–1327. N. pp54–64..T. A. Gillis. nodulating Trifolium and Lupinus in Spanish soils’. P. P. P. y Velazquez. (1998) ‘Rhizobium mongolense sp. Boivin-Masson. Tan. nov. M. C. L. R. J. E. C. vol 68. B. F. Döring.... E.. B. C. Han. Neyra.. W. pp901–914. Mateos. M.. Giacomini. Magalhaes. y Mateos. E.

T. Toro..C. P. Blackwell Scientific Publications. N..’. Kamfer.. nov.. and Burkholderia phymatum sp. Cervantes.. Willems. (2005a) ‘Bradyrhizobium canariense sp.. E.-M. Goris. (2009)´Mesorhizobium metallidurans sp. Escarré. Velazquez. nov. Werner. D... Igual. E. Vermis. P... (2006) ‘Proposal for combining Bradyrhizobium spp. vol 48. International Journal of Systematic and Evolutionary Microbiology. Van Berkum.. Fernyez. y Willems. M. Mauré. Nelis. C. Léon-Barrios.. G. P. y Conye. pp2285–2289. Oxford. P.. A. pp207–215. Vincent. nov. nov... Chen. J. Systematic and Applied Microbiology. E. 1985) to the genus Bradyrhizobium as Bradyrhizobium denitrificans (comb. de Baere. M. B. y Eardly. P. A. 1990) comb.. and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al. Vidal. B. y Martínez-Romero. Systematic and Applied Microbiology. de Vos. J. P.J.J. G. E. F. Jarabo-Lorenzo. M. T.. Pérez-Galdona. (2002) ‘Burkholderia tuberum sp. M.. International Journal of Systematic and Evolutionary Microbiology. Willems. (Aeschynomene indica) with Blastobacter denitricans and to transfer Blastobacter denitrificans (Hirsh and Muller.. Vandamme. International Journal of Systematic and Evolutionary Microbiology. P. LiPuma. a new genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species. Falsen. y Martinez-Molina.. nov. Chantreuil. an acid tolerant endosymbiont that nodulates endemic genistoid legumes 210 Manual de biología de suelos tropicales . nov. Berge. (2004) ‘Taxonomy of the genus Cupriavidus: A tale of lost and found’. Normy.. T. y Vandamme. Mateos.. Mahenthiralingam. Béna. J. C. C. L. (2001) ‘Mesorhizobium chacoense sp. (1970) A Manual for the Practical Study of Root-Nodule Bacteria. A. (2004) ‘Wautersia gen. a novel species that nodulates Prosopis alba in the Chaco Arido region (Argentina)’. J. Vandamme.. A.nitrogen fixing symbioses with Medicago ruthenica [(L. Coenye. J. M. y Verschraegen. International Journal of Systematic Bacteriology. vol 59. Munoz. Abril. P. H.. nodulate the roots of tropical legumes’. nov... pp1011–1021. Vaneechoutte. D. Gillis. M. vol 54.. nov. International Journal of Systematic and Evolutionary Microbiology. pp689691. (2004) Proposal to accommodate Burkholderia cepacia genomovar VI as Burkholderia dolosa sp.. Brunel.. pp507–512.) Ledebour]’. vol 29. P. France´. sp. pp850-855. nov.. vol 54. P.. pp13–22. J. R.. Leibold. E. K.. A.. pp317–327. M. M.. J. E. Vinuesa.. Silva.. a metal-resistant symbiont of Anthyllis vulneraria growing on metallicolous soil in Languedoc. vol 25.)’. y CleyetMarel. nov. International Journal of Systematic Bacteriology vol 54.. W. vol 51. O.

M. vol 34. Tan. E.(Papilionoideae:Genisteae) from Canary Islands.. Tan. (2007)´Mesorhizobium albiziae sp.. X. nov... (2002) ‘Rhizobium indigoferae sp. pp569–575. M.. E. X.. van Berkum. D.Q.... Fernández-López. Chen.. pp2231–2239. H. International Journal of Systematic and Evolutionary Microbiology. Wang. M. E. Wang.. Wang.. International Journal of Systematic Bacteriology. E.T. Z. International Journal of Systematic Microbiology. (1999a) ‘Rhizobium etli bv. P.. X.. Beyene. E. Rinhold-Hurek. Wei. A. Vinuesa. T. E. Dorado... Rogel-Hernández. pp1192-1199. X. Wang. International Journal of Systematic and Evolutionary Microbiology. vol 52.F. Q. pp1575–1583 B acterias formadoras de nódulos en leguminosas 211 . X. Silva. E.H. Wang. y Chen. van Berkum. Z. E. J. B. International Journal of Systematic and Evolutionary Microbiology.. Chen. nov. W. y MartínezRomero. (2003) ‘Characterization of rhizobia isolated from legume species within the genera Astragalus and Lespedeza grown in Loess Plateau region of China and description of Rhizobium loessense sp. G.. vol 49. E. T. E.X... P... Sui. and Sinorhizobium kummerowieae sp. A. W. C. International Journal of Systematic Bacteriology. W. y Martínez-Romero. (2005b) ‘Population genetics and phylogentic inference in bacterial molecular systematics: The roles of migration and recombination in Bradyrhizobium species cohesion and delineation’. M. International Journal of Systematic Bacteriology. Zhu. mimosae. Y. T. A. vol 57. M. P.. T. E. Sui. J. a novel bacterium that nodulates Albizia kalkora in a subtropical region of China´.. Chen. T. nov. and Kummerowia stipulacea’. Liu. y Chen. O. vol 55. Werner. G. a symbiont of Sesbania herbacea that has a close phylogenetic relationship with Rhizobium galegae’. T. Willems. vol 49.’.. Molecular Phylogenetics and Evolution. E. a Leucena leucocephala-associated bacterium that is highly resistant to multiple antibiotics’.. pp1479–1491. D. Sui. genistearum. y Chen. Wang. S. respectively isolated from Indigofera spp. E. vol 52.. International Journal of Systematic and Evolutionary Microbiology.. (2002) ‘Sinorhizobium morelense sp. Han. nov’. Chen. Cevallos. pp687–699.. Beyene. Bradyrhizobium genospecies a and Bradyrhizobium genospecies b’. D. H.. Wei. X. T. y MartínezRomero. H. (1999b) ‘Diversity of rhizobia associated with Amorpha fruticosa isolated from Chinese soils and description of Mesorhizobium amorphae sp. Wang. along with Bradyrhizobium japonicum bv. G. pp51–65.. A. nov. (1998) ‘Rhizobium huautlense sp. E. W. F. X.. Martínez-Romero. W. y Martínez-Romero. nov. H. Wang. a novel biovar isolated from Mimosa affinis’. pp1687–1693.. vol 48. pp29–54. Zhu.. E.. W. E. Wang.. y Martínez-Romero. Santos. nov. vol 53.

y Gillis.. Agronomy Journal. Woomer. A. Goris. J. Ge. P. Vos. J.´ International Journal of Systematic Evolutionary Microbiology. y Yost. MartínezRomero. vol 54 pp149.. vol 54... pp1494–1497. y Bohlool. M. Is the combination “Sinorhizobium adhaerens” (Casida 1982) Willems et al 2002 legitimate? Request for an opinion’.. Fernández-Lopez. Applied and Environmental Microbiology. Ingram (eds) Tropical Soil Biology and Fertility: A Handbook of Methods. M. Wallingford. Y. vol 53.’. Z. W. K. Journal of Clinical Microbiology.. isolated from the root nodules of soybeans’. N. B. pp349–353. Yao. (2004) Renaming of Agrobacterium larrymoorei Bouzar and Jones 2001 as Rhizobium larrymoorei (Bouzar and Jones 2001) comb. E. C. vol 54. Singleton. (2003) ‘Description of new Ensifer strains from nodules and proposal transfer Ensifer adhaerens Cassida 1982 to Sinorhizobium as Sinorhizobium adhaerens comb. P. Wilson. W. pp1942–1946. 212 Manual de biología de suelos tropicales . T. Cui. Singleton. (1993) ‘Most Probable Number Counts of Rhizobia in Soils’. B. pp2219–2230. I. nov. vol 82. X. pp2107–2110. E. H. y Fan. B. Kan. H. (1988a) ‘Ecological indicators of native rhizobia in tropical soils’. Blitchngton. (2003) ‘The genus name Ensifer Casida 1982 takes priority over Sinorhizobium Chen et al 1988 and Sinorhizobium morelense Wang et al 2002 is a junior synonym of Ensifer adhaerens Casida 1982. E.. International Journal of Systematic and Evolutionary Microbiology. nov. Woomer. M. Woomer. (1995) ‘Bradyrhizobium liaoningense sp. (1988b) ‘Reliability of the most-probable technique for enumerating rhizobia in tropical soils’. Xu. P. Z. B. pp706–711.... y Chen.. R. M.. M. J. vol 28. Young. J. in J. International Journal of Systematic Bacteriology. International Journal of Systematic Bacteriology. B. vol 53. y Bohlool. R. Toro. y Green. Wang. Woomer. Applied and Environmental Microbiology. Muñoz-Adelantado. S.Willems. Young. pp172–178. L. pp1207–1217. R. J. pp1112– 1116. (2002) ‘Characterization of rhizobia that nodulate legume species within the genus Lespedeza and description of Bradyrhizobium yuanmigense sp.. C. P. International Journal of Systematic and Evolutionary Microbiology.. (1990) ‘Agroclimatology and modeling – overcoming the inflexibility of most-probable-number procedures’. P. CAB International.. Li. M. (1990) ‘Amplification of bacterial 16S ribossomal DNA with polymerase chain reaction’. L.. nov. Request for an opinion’. nov. vol 52. P. Bennet. Yerson and J. F. vol 45. P. W.

E. Zurdo-Piñeiro. B.Young..T.A.L. pp512-517.. (1996) ‘Diversity and phylogeny of rhizobia’. Palomares. M... with an emended description of the genus.. H.E. vitis’. pp784-788.. y Sawada.. B acterias formadoras de nódulos en leguminosas 213 . E. 1998 as new combinations: Rhizobium radiobacter. Vizcaíno. M. Carrasco. (2001) ‘A revision of Rhizobium Frank 1889. Martínez-Romero. Kuykendall. vol 57.. nov. D. isolated from nodules of Cytisus scoparius in Spain´ International Journal of Systematic Evolutionary Microbiology. Li. J. E. (2007)´Ochrobactrum cytisi sp. .. Rivas.F. rubi.X... Young J. International Journal of Systematic Evolutionary Microbiology. Wang. Trujillo..J. undicola and R. R.X. J. W. K. y Velázquez. Chamber.. J. Martínez-Molina. R. W. pp89–103.. Zhang. R. N.. vol 61. Hou. R. E. P. R. y Haukka..vol 133. X. nov. pp87–94. Kerr. vol 51. and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. Zhang. rhizogenes. M. L. A. Mateos. (2011)´Rhizobium tubonense sp.C. Y. P. isolated from root nodules of Oxytropis glabra´International Journal of Systematic Evolutionary Microbiology. E. y Chen. A.. New Phytologist.

1928) (similar a medio YMA – Vincent. Cuando pH <5.2 gl–1) 1ml sol. 0.4 gl–1) 5ml sol.4 gl–1) 2ml sol. 7H2O (10%) (o 0. para hacer 1000 ml con agua destilada pH 6.75g Agar Autoclave a 120°C durante 15 minutos. K2HPO4 (10%) (o 0.8–7.5% azul de bromotimol en 0. 1970): 10g manitol o sacarosa 1ml sol. KH2PO4 (10%) (o 0. 214 Manual de biología de suelos tropicales .APÉNDICE 6.1 gl–1) 4ml sol. Medio sólido: 15g Agar Medio semisólido: 1.0.1 Composición de medio 79 para el crecimiento de Bfn Medio 79 (Fred y Waksman.1 gl–1) 100ml extracto de levadura (o polvo 0. NaCl (10%) (o 0. MgSO4.0 se reemplaza azul por Azul de Bromotimol por Verde de Bromocresol y se aumenta agar hasta 20 gl–1.2 N KOH.

2.. Control Se proveen los controles con nitrógeno a una concentración final de aproximadamente 70 ppm N (0.. sin inoculación del suelo B acterias formadoras de nódulos en leguminosas 215 .05% KN03 o NH4 NO3)..... H3BO3 .08 g Na2MoO4... pues las dosis elevadas inhiben la nodulacíon. Normalmente.. o entre 7 a 10 días después de plantar.... es decir... Vicent (1970) recomienda la mezcla para una solución de nutrientes.6H2O 1.APÉNDICE 6... ajustar con KOH. por lo tanto..86 g MnSO4..5H2O ..03 g ZnSO4........ Si al final del experimento esto resulta insuficiente para el crecimiento sostenido y el color verde de las plantas control.... Esto puede añadirse a la solución de nutrientes al principio del experimento.... 0.09 g El mismo protocolo que para agar con semillitas.... También después se usa la solución con sirato en bolsas de plástico..7H2O (2%) NaCl (2%) CaHPO4(10%) FeCl3. los controles absolutos..... entonces la concentración puede aumentar o hacer una suplementación dividida... los controles nitrogenados no presentan nódulos.4H2O .7.7 % o FeCl3 1% Solución de micronutrientes* Agua destilada (completar a) Volumen 10 ml 10 ml 10 ml 10 ml 10 ml 1 ml 1.... 0.........2 Solución de nutrientes Jensen’s para el crecimiento de espe- cies de leguminosas en bolsas de plástico y jarras de Leonard Componentes K2HPO4 (2%) MgSO4. las concentraciones más altas (>0..... Sin embargo. diluida de la misma manera.000 ml pH = 6... * Solución de micronutrientes (para 1 l de agua).....H2O ....22 g CuSO4........ 0.... 2.....7H2O ..7% KNO3) pueden ser tóxicas. Diluir solución a 1:4..

no mencionado por Vincent.son necesarios para comprobar las condiciones asépticas del experimento. Otro control importante. éstas deberán utilizarse. 216 Manual de biología de suelos tropicales . es el uso de una cepa eficiente como un control positivo para la nodulación y la fijación de nitrógeno. Si existe la disponibilidad de las cepas recomendadas.

hortícola y forestal. Bagyaraj y Sidney L. producción de cultivos redituables o plantaciones forestales industriales provoca cambios en las características quí217 .. se encuentra bien documentado que los hongos micorrizógenos arbusculares (HMA) mejoran la salud y el crecimiento de las plantas de importancia agrícola. 1995). aumenta significativamente la captación de iones relativamente inmóviles. huertos y cultivos agrícolas (Brundrett. cobre y zinc. dunas de arena. Bagyaraj and Varma. selvas tropicales. En la mayoría de los suelos tropicales. la agricultura se practica en áreas previamente ocupadas por dos principales ecosistemas naturales ricos en especies vegetales: bosques tropicales y sabanas. Bagyaraj. salinidad. Stürmer INTRODUCCIÓN Actualmente. el fósforo disponible es muy bajo. esto limita el desarrollo de las plantas. por lo tanto. patógenos de la raíz. La conversión de estos dos ecosistemas en agro-ecosistemas ya sea para agricultura de subsistencia. pH desfavorable del suelo y al choque por trasplante que sufren las plantas no micorrizadas (Mosse et al. Los HMA han sido registrados en ecosistemas naturales como desiertos.Capítulo 7 Hongos micorrizógenos arbusculares (HMA) Joseph D. sequía. provee una mayor superficie de absorción que los pelos radiculares y. Además. tales como fosfato. La red de hifas producidas por los HMA en el suelo durante su asociación con la planta huésped. En los trópicos. 1981. salinas y sistemas manejados como praderas. 1990. 1991). altas temperaturas. se ha demostrado que las plantas micorrizadas tienen mayor tolerancia a metales tóxicos.

(1992) encontraron que el número de esporas de HMA en una plantación de Terminalia ivoriensis en Camerún disminuyó notablemente después de tres meses de una desforestación. Mason et al. En estos sitios. usualmente. como los hongos dominantes. por lo general.micas. Jasper et al. La conversión de los ecosistemas naturales para distintos usos de suelo influye en la abundancia de esporas y composición de especies de HMA. 1989) son también adecuadas.. La medición del porcentaje de colonización (PC) (Moorman y Reeves. pastizales (Bever et al. 1979) y la determinación de las unidades de colonización (UC) (Franson y Benthlenfalvay. No obstante. sin embargo. (1987) observaron un descenso en el número de esporas y un cambio en la composición de especies después del disturbio en algunos lugares de Australia. La infectividad micorrízica se determina fácilmente por el método del número más probable (NMP) y puede servir para propósitos comparativos (Porter. a través de una cuenta directa y de la identificación de esporas recuperadas del campo. encontraron una riqueza similar de especies en la selva tropical seca y en praderas con dominio de una especie. generalmente. estas determinaciones no detectan a las especies crípticas de HMA que no están esporulando en el momento del muestreo (pero que están asociadas con las plantas hospederas) e impiden la adecuada identificación de algunas especies. 1979). 1996) y también en desiertos (Stutz and Morton. Picone (2000) demostró que la densidad de esporas y la comunidad fúngica disponible para la formación de micorrizas eran relativamente similares entre praderas y bosque tropical lluvioso. 1985). Las macetas trampa preparadas con suelo de campo han sido usadas exitosamente para detectar y recobrar especies crípticas durante estudios de diversidad en huertos de manzano en regiones templadas (Miller et al. Asimismo.. se eliminan muchas especies vegetales de todas las edades y. También notaron un cambio en la composición de especies. De igual forma. 218 Manual de biología de suelos tropicales . Johnson y Wedin (1997). La medición de la diversidad taxonómica de HMA se ha hecho. especialmente de los géneros Glomus y Gigaspora. Aunque comúnmente no es reportado. las medidas de diversidad taxonómica deberían estar acompañadas de algunas evaluaciones de la actividad de la comunidad micorrízica. en donde se detectaron 28 morfotipos de HMA con Glomus aggregatum y dos especies de Glomus no descritas. se siembran con una sola especie de la misma edad. 1996). físicas y biológicas del ambiente edáfico.

. El método del Número Más Probable se ha utilizado para estimar el número de propágulos infectivos de HMA en varios suelos. (2001) (Tabla 7. 1990. Datos moleculares y morfológicos fueron usados para transferir a los miembros del género Sclerocystis a Glomus (Almeida y Schenck. la identificación de especies está basada principalmente en las características morfológicas de las esporas.TAXONOMÍA Y CLASIFICACIÓN DE HMA Debe establecerse un esquema taxonómico antes de cualquier estudio de diversidad. (2001). MÉTODOS PARA EVALUAR PROPÁGULOS INFECTIVOS DE HMA Y COLONIZACIÓN MICORRÍZICA Número más probable (NMP) El protocolo propuesto para estimar la diversidad de HMA (descrito en el Capítulo 2) es el mismo que se sigue para todos los microorganismos y no será discutido aquí. colocando a este grupo de hongos en el mismo nivel que Basidiomycota y Ascomycota. También incluyeron en el Nuevo esquema de clasificación tres nuevos órdenes y varias familias. 2000) y para erigir dos nuevos géneros en dos familias distintas (Morton and Redecker. Morton y Benny (1990) transfirieron todas las especies de HMA al orden Glomerales (División Zygomycota) con tres familias y seis géneros. cuando se requieren comparaciones entre los sistemas de uso de suelo. (2001) transfirieron todas las especies de HMA a una nueva división monofilética: Glomeromycota.. Recientemente. Schüßler et al. Este género es incluido en el orden Diversisporales en la filogenia molecular propuesta por Schüßler et al. Por lo tanto. La taxonomía y clasificación de los hongos micorrizógenos han cambiado radicalmente en los últimos años. especialmente. Gerdemann y Trappe (1974) incluyeron todas las especies de HMA dentro del orden Endogonales en la familia Endogonaceae (División Zygomycota). con aquellos de Morton y Redecker (2001) y Schüßler et al.1). se propone un esquema de clasificación para estudios de diversidad que surge de los esquemas de Morton y Benny (1990).. Aunque se han aplicado técnicas moleculares para aclarar la clasificación filogenética entre las especies de HMA. 2001). un género nuevo llamado Pacispora fue propuesto por Oehl y Sieverding (2004). Se basa en una serie de diluciones decimales H ongos micorrizógenos arbusculares 219 . La formación de esporas en este género es similar a la de Glomus pero éste diferencia paredes germinales internas. Redecker et al.

La micorriza se tiñe muy obscuro. plana. Germinación a través de una estructura de germinación esférica. hifas intrarradicales y micorriza se tiñen como en Acaulospora. División Glomeromycota Schüßler. La pared germinal más interna tiene una superficie con excrecencias. Familia Acaulosporaceae Morton y Benny Acaulospora Gerd.1 Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales. conectada a una hifa ramificada. La pared de la espora esta formada por tres o cuatro capas y no se forma una verdadera bicapa germina. Las vesículas y células auxiliares no están diferenciadas. Los arbúsculos e hifas intrarradicales se tiñen débilmente. Familia Archaeosporaceae Morton y Redecker Archaeospora Morton y Redecker (una especie) Esporas formadas terminalmente de una hifa de sostén o como una ramificación de una estructura que semeja un sáculo esporífero. Entrophospora Ames y Schneider (cinco especies) Esporas formadas dentro de un cuello de un sáculo esporífero el cual deja dos cicatrices sobre la superficie de la espora. Germinación a través del lumen de la hifa de sostén o a través de la pared de la espora. Vesículas de pared delgada y elipsoides. solitarias. Vesículas. Las vesículas varían en forma con protuberancias y concavidades. Esporas con la pared esporal formada por dos capas. flexible. Hifas intrarradicales rectas o enrolladas cerca de los puntos de entrada. Otras estructuras subcelulares de la espora y germinación idéntica a la de Acaulospora.Tabla 7. Esporas con la pared esporal formada por un número variable de capas todas originadas a partir de la hifa de sostén. Hifas intrarradicales raramente enrolladas. en agregados laxos o en esporocarpos. No se observan paredes germinales diferenciadas. y Trappe emend. 220 Manual de biología de suelos tropicales . Berch (31 especies) Esporas formadas a los lados del cuello de un sáculo esporífero el cual deja una cicatriz en la superficie de la espora. La micorriza se tiñe débilmente. Se presentan especies dimórficas formando esporas acaulosporoides y glomoides. Scharzott y Walker Orden Glomerales Morton y Benny Suborden Glomineae Morton y Benny Familia Glomeraceae Pirozysnki y Dalpé Glomus Tulasne y Tulasne (85 especies) Esporas formadas blásticamente sobre una hifa de sostén. arbúsculos. Arbúsculos con troncos aplanados o cilindricos adelgazándose sucesivamente en las ramificaciones.

se diferencia una capa delgada con verrugas esparcidas y crece un tubo germinativo a través de la pared esporal. Las vesículas y células auxiliares no están diferenciadas. especialmente. Hifas intrarradicales frecuentemente enrolladas. Suborden Gigasporineae Morton y Benny Familia Gigasporaceae Morton y Benny Gigaspora Gerd. Las paredes de la hifa de sostén son continuas con la primera y segunda capa de la pared esporal. Esporos glomoides de forma aislada en el suelo o agregados en racimos. Esporas con la pared esporal formada por dos capas permanentes. a menudo nodosas o con proyecciones.Tabla 7. No se forman vesículas. La segunda capa de la pared germinal generalmente reacciona con el reactivo de Melzer. Esporos acaulosporoide formado un apéndice hifal emergiendo lateralmente del cuello de un sáculo esporífero. Scutellospora Walker y Sanders (30 especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. cerca de los puntos de entrada. Familia Paraglomeraceae Morton and Redecker Paraglomus Morton y Redecker (dos especies) Esporas formadas terminalmente de una hifa de sostén como en Glomus. Las estructuras subcelulares de la espora y la germinación como en Glomus. no se diferencian paredes germinales. y germinan atreves de hifa suspensora. células auxiliares finamente papiladas o equinuladas. Pared de la espora generalmente formada por tres capas distintas y la pared germinal compuesta también por tres capas. Arbúsculos e hifas intrarradicales similares en morfología a las de H ongos micorrizógenos arbusculares 221 . No se forman vesículas. Vestberg & Schüßler Ambispora Walter. Familia Pacisporaceae Walker. Germinación de la espora directamente de la pared germinal a través de la pared de la espora. Al germinar. Schüßler y Schwarzott Pacispora Sieverding y Oehl (siete species) Esporas formadas terminalmente de una hifa de sostén (como en Glomus). Vesículas y arbúsculos las raíces teñidas en azul franco con azul tripano. Vestberg & Schüßler (ocho especies) Especies generalmente dimórficas con asociaciones micorrizicas produciendo morfotipos acaulosporoide y glomoides. células auxiliaries que van de casi lisas a nodosas.1 Continúa Familia Ambisporaceae Walter. Arbúsculos con troncos hinchados angostándose abruptamente en las ramificaciones. Los arbúsculos y las hifas intrarradicales se tiñen débilmente. Blaszkowski. y Trappe (cinco especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa.

2004. Oehl y Sieverding. y puede llevarse a cabo por cualquiera que esté familiarizado con la morfología de la micorriza. de suelo en donde la presencia o ausencia de colonización micorrízica se registra y da como resultado el número más probable de propágulos infectivos. se puede utilizar cualquier otro hospedero. Fuente: compilado de Morton y Benny.wvu. Sin embargo. que se diferencia sobre la superficie de la última pared germinal. Como el resultado es un solo número.. el análisis de las raíces de las plantas trampa para comprobar la colonización es fácil y rápido. El tubo de germinación crece a partir de un escudo flexible plano. La planta hospedera recomendada para el ensayo del NMP es la cebolla. Si no contamos con semillas de cebolla. si tiene cierta dependencia micorrízica. 2006 y http://invam. ya que es dependiente de la micorriza y las raíces son fáciles de teñir. Esporas con una pared formada por dos capas permanentes y de una a tres paredes germinales internas. como el sorgo y el Paspalum. Spain et al. basándose en una tabla estadística. 1990. Una de las desventajas de esta prueba es que se requiere mucho tiempo para la preparación del bioensayo.edu. 222 Manual de biología de suelos tropicales .5 cm) y gradillas bolsas de plástico (30 X 20 cm) diluyente esterilizado (arena: mezcla de suelo 1:1) semillas de cebolla. cada una con dos capas.caf. el método es apropiado para comparaciones entre sistemas con diferente uso del suelo si los ensayos del NMP se establecen de forma simultánea. La ventaja es que.1 Continúa Gigaspora. se pueden utilizar gramíneas C4. pero el número calculado tiene hasta un 95 por ciento del nivel de confianza (Adelman y Morton.Tabla 7. Materiales necesarios • • • • tubetes para plantas (150 X 2. 1986).

hacer más diluciones decimales hasta la dilución 10-4 (o más. 6. H ongos micorrizógenos arbusculares 223 . Para el cálculo del NMP. hacer cinco replicas por cada dilución. Sembrar las semillas de cebolla en cada tubete. Agitar bien para obtener una dilución 10-1. Distribuir el suelo de cada dilución en los tubetes para plantas. Al cosechar. Después de emerger. Agitar bien para obtener una dilución decimal. 10-3 y 10-4). si es necesario). 3. si el número de tubetes positivos es el mismo en diluciones posteriores). El primer número (N1) corresponde al número de tubetes positivos para la colonización micorrízica en la dilución que muestra el mayor número de tubetes positivos (se toma la serie menos concentrada. la combinación sería: N1 = 5. 3. El procedimiento para el cálculo del NMP. 4. determinar la presencia o ausencia de colonización micorrízica en cada réplica. 2. Los otros dos números (N2 y N3) son los correspondientes a las próximas dos diluciones. si no se dispone de las semillas de cebolla puede utilizar cualquier otro hospedero (ver arriba).Procedimiento 1. 5. N2 = 3 y N3 = 2. de Fisher y Yates (1963) o Alexander (1965). Utilice las tablas de Cochran (1950). dejar una sola planta por tubete y dejarlas crecer en un invernadero o en una cámara de crecimiento durante seis semanas. En este ejemplo. Bajo un microscopio de disección. lavar el suelo de las raíces y teñirlas con azul de tripán (véase más abajo). Esto significa que las cinco réplicas fueron positivas para la colonización micorrízica en las diluciones 10-1 y 10-2. 7. 2. Pesar 30 g de suelo de campo en una bolsa de plástico y añadirle 270 g del diluyente esterilizado. considerando las cinco réplicas (tubetes) para cada una de los cuatro diluciones (10-1. sólo tres números de una secuencia dada son necesarios. Supongamos que. Retirar 30 g de la dilución anterior y colocarlo en otra bolsa que contiene 270 g del diluyente estéril. 10-2. tres réplicas fueron positivas en la dilución 10-3 y dos réplicas fueron positivas en la dilución 10-4. El número de tubetes positivos (los que contienen colonización) en diluciones diferentes se utilizan para calcular los valores de NMP. 5. se ilustra con el siguiente ejemplo. se obtiene la siguiente secuencia de números de tubetes positivos: 5.

este valor debe de ser multiplicado por la dilución media. El método más ampliamente utilizado es el descrito por Philips y Hayman (1970). 450 ml de H2O. en contraste con las asociaciones ectomicorrízicas. 50 ml de de HCl al 1%) • azul de tripano 0. para detectar y medir la colonización micorrízica. 30 ml de H2O2 al 3%. las raíces son sometidas a un procedimiento de clareo y tinción. Sumergir las raíces en KOH a 90°C por una hora o a 120°C por 15 minutos en autoclave. el suelo tiene 1. Lavar las raíces para eliminar residuos de suelo y enjuagar con varios cambios de agua. Teniendo en cuenta el costo de los productos químicos y el ahorro al reducir el número de productos químicos sin interferir con la calidad de la tinción. 224 Manual de biología de suelos tropicales .4. Kormanik y McGraw (1982) eliminan el fenol en las soluciones para tinción y decoloración. mientras que Koske y Gemma (1989) modificaron el procedimiento mediante la eliminación de ácido láctico de estas soluciones sin interferir con la intensidad de la tinción.4 X 10-3 propágulos infectivos g–1.5 g/l) • H2O2 alcalinizada (3 ml NH4OH al 20%.05 % en solución de glicerol (0. Procedimiento 1.Usando la tabla del NMP el valor dado para esta combinación de tubetes positivos es 1. Tinción de raíces para observar la colonización micorrízica La colonización de las células corticales de la raíz por HMA. 567ml de agua). (en este caso 10-3). se propone para la tinción de raíces el método de Philips y Hayman (1970) modificado por Koske y Gemma (1989). 2. Por lo tanto. (500 ml de glicerol. Para obtener el NMP de propágulos infectivos de HMA en la muestra. Por lo tanto. no altera la morfología de la raíz. Materiales necesarios • solución de KOH al 10% (hidróxido de potasio) • solución de HCl al 1% (ácido clorhídrico) • solución acidificada de glicerol.

8.1 cm. H ongos micorrizógenos arbusculares 225 . 7. 40ml de glicerol y 40 ml de agua destilada). 4. Material necesario • Cajas de Petri cuadriculadas en la base con cuadrados de 1. Si las raíces están demasiado pigmentadas se deben sumergir en agua oxigenada alcalinizada durante 10-30 minutos. No enjuague las raíces en esta paso ya que éstas deben estar acidificadas para una tinción adecuada. crecidas bajo condiciones del invernadero. Comentarios: si lo desea. • Agujas de disección.01%. es usado comúnmente para medir la longitud de la raíz y el porcentaje de la colonización micorrízica.3. un baño de agua a 90°C es apropiado para mantener las muestras. 1980) que se presenta a continuación. 5. 6. Para almacenar por un tiempo largo. Tiña las raíces en una solución de glicerol ácido con azul de tripano a 90°C por una hora o a 120 °C por cinco minutos. la solución de glicerol acidificada puede ser reemplazada por una solución de lactoglicerol (20 ml de ácido láctico. Para los pasos 2 y 7. la solución de agua oxigenada alcalinizada debe de prepararse justo antes de su uso.1 x 1. Enjuagar nuevamente las raíces con agua. Esta medida estima el crecimiento de un aislamiento de un hongo o de una comunidad fúngica dentro de la corteza de la raíz. las raíces pueden guardarse en agua adicionada con unas gotas de azida de sodio al 0. Descargue la solución colorante y mantenga las raíces en glicerol acidificado (sin azul de tripano) o agua a temperatura ambiente o 4°C. Eliminar el KOH y enjuagar las raíces con agua (dos o tres veces) para quitar el exceso de KOH. El paso 4 puede ser omitido si las raíces no están muy pigmentadas. Medición de la colonización micorrízica La determinación de la colonización micorrízica de la raíz. El método de intersección de cuadrante (Giovannetti y Mosse. Elimine el HCl. se realiza con frecuencia en raíces colectadas de campo (sacadas directamente del suelo o de plantas individuales) o en plantas experimentales. Sumerga las raíces en HCL al 1% por cinco minutos.

seguido por centrifugación en un gradiente de sacarosa. De esta manera. 3. Por lo tanto. el número total de raíces que interceptan las líneas de la cuadricula. las estructuras subcelulares de las esporas están altamente conservadas y son fenotípicamente estables independientemente del ambiente y la planta huésped (Morton et al. también se pueden utilizar para determinar las longitudes tanto de la raíz completa como de la raíz micorrizada. Comentarios: los datos obtenidos en el paso 3. 2.caf.. 1963). 226 Manual de biología de suelos tropicales . Bajo el microscopio de disección explore las líneas horizontales y verticales de la cuadrícula. En contraste. La morfología del micelio interno y externo durante la asociación micorrízica es prácticamente indistinguible entre las especies del mismo género y entre géneros. Registre: a) el número total de intersecciones de las raíces y las líneas de la cuadricula y b) el número de intersecciones con raíces micorrizadas.wvu. con estructuras micorrízicas. En una caja de Petri extienda al azar las raíces teñidas. 1995). las esporas son la única parte del organismo del hongo que puede utilizarse para delimitar las especies. Métodos para evaluar la diversidad de HMA Extracción de esporas del campo La Identificación de las especies de HMA está basada en el análisis de estructuras subcelulares de las esporas asexuales. Si se toma una muestra pequeña de toda la raíz.Procedimiento 1. se teñirá y se medirá en el microscopio con este método. Calcule el porcentaje de colonización micorrízica (% CM) utilizando la siguiente fórmula: % CM = (Número total de intersecciones con raíces micorrizadas/ Número total de intersecciones entre la raíz y las líneas de la cuadrícula) X 100. Es posible calcular la longitud total de la raíz y la longitud de la raíz micorrízada de la planta completa. 4. el total de la longitud de la raíz micorrizada será el número de intersecciones.edu/ methods/mycorrhizae/rootlengths. Para más detalles ver http://invam.1 cm. Si toda la raíz se extiende en la caja de Petri. representan la longitud total de la raíz en cm. usando la relación entre el peso seco de la planta y la submuestra. Las esporas se extraen del suelo mediante un tamizado húmedo (Gerdemann y Nicolson.htm. con las líneas de la cuadricula separadas en 1.

Figura 7. H ongos micorrizógenos arbusculares 227 . • Vasos de precipitados. • Cubeta de plástico o un vaso de precipitados grande.9%. Materiales necesarios • Un juego de tamices anidados que tengan al menos 710 µm y 45 µm de abertura de malla. Ejemplo. el largo de la raíz = 43 cm (25 + 18) y el largo de la raíz micorrizada=12 cm (Seis intersecciones positivas sobre líneas horizontales y seis intersecciones positivas sobre líneas verticales). En el diagrama las infecciones de micorrizas son representadas con puntos negros. Nota. • Tubos para centrífuga y centrífuga. • Por lo tanto. vidrio de reloj.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. Figura 7. • Soluciones de sacarosa (20 % y 60%). después de expander las raíces. cajas de Petri. el numero de intersecciones entre una raíz y las líneas horizontales y verticales tendríamos: • 25 intersecciones (Línea horizontal) • 18 intersecciones (Línea vertical) y • 12 intersecciones (Puntos negros) presentando colonización micorrizica.1 provee una ilustración del método de intersección de línea. • El porcentaje de colonización micorrízica= (12/43) x 100=27.

En este momento. agregue 15 ml de la solución de sacarosa al 20% en un tubo de centrífuga de 50 ml y después. Sin embargo. Centrifugue a 2. Los tamices recomendados (con mallas de 710 µm y 45 µm) son adecuados para recuperar la mayoría de especies. 1979) para dispersar las partículas de arcilla y liberar las aberturas del tamiz. 3.1M (Fogel y Hunt. Esto separa a las esporas por tamaños pero incrementa la cantidad de trabajo ya que el material retenido en cada tamiz debe centrifugarse por separado. en el fondo. ya que el tamaño de las esporas de HMA para la mayoría de las especies está en un intervalo de 40 a 600 μm. 4. Pasar la suspensión repetidamente a través de dos tamices anidados con abertura de malla de 710 µm y 45 µm. comprada en el supermercado. Transferir las esporas y el material retenido en el tamiz 45 µm a una caja de Petri y bajo el microscopio colecte las esporas en un vidrio de reloj limpio. 5. las esporas se pueden separar por morfotipos de acuerdo con su color y tamaño y si las esporas están en buen estado se pueden identificar hasta género y especie. 6. Coloque el material retenido en el tamiz de 710 µm en una caja de Petri grande y observe bajo el microscopio de disección para observar esporas grandes (esporas de Gigaspora y Scutellospora) y esporocarpos. Colocar 100 g de la muestra de suelo en la cubeta /vaso de precipitados y suspender en. Agitar hasta que las esporas queden suspendidas y dejar reposar 30 segundos . al menos. Los suelos con alto contenido de arcilla pueden obstruir los tamices. 7. Para preparar el gradiente de la sacarosa. es preferible vaciar la suspensión de suelo a través de un tamiz de 1 mm antes de pasar por el tamiz de 710 μm.000 rpm durante 60 segundos. Vacíe el sobrenadante en el tamiz de 45 µm y lave con agua corriente para quitar el exceso de sacarosa. Las esporas pueden separarse de los residuos orgánicos y recogerse de la caja de Petri usando unas pinzas finas o una pipeta Pasteur adelgazada en la punta. se pueden anidar otros tamices entre los dos recomendados. 228 Manual de biología de suelos tropicales . 500 ml de agua. 2. 8. si hay demasiados pedazos de raíz y otros desechos. Comentarios: en el paso 3. se puede agregar una pequeña cantidad de pirofosfato de sodio a 0.Procedimiento 1. agregue otros 15 ml de la solución al 60% . después transfiera este material a un tubo de centrífuga que contenga un gradiente de sacarosa de 20–60%. Coloque el material retenido en el tamiz de 45 µm en una vaso de precipitados con una pequeña cantidad de agua. La solución de sacarosa se hace con azúcar comercial.

West Virginia University. 1990) y comparando con las descripciones e ilustraciones de las especies proporcionadas por el Dr.wvu.ar. g.V. Por otro lado. b) espora de Scutellospora scutata con la hifa de sostén bulbosa (note el escudo de germinación redondo. Janusz Blaszkowski (Department of Plant Pathology of the Agricultural University of Szczecin. contrastando con el color hialino de las esporas). 2. y por consiguiente. el tamaño de las esporas y una descripción estandarizada de las especies de HMA. a la vez que Bentivenga y Morton (1995) proponen una clave para identificar las cinco especies de Gigaspora. La fotografia a) muestran una espora de Gigaspora albida con la hifa de sostén bulbosa típica de esta familia. b.pl/~jblaszkowski. la INVAM y el sitio de Blaszkowski poseen excelentes fotografías con detalles de la estructura subcelular de las esporas. f.agro. 3 y 4 se proporcionan los nombres de las especies y los autores. El manual de Schenck y Pérez es una copia de las descripciones originales de las especies y por lo tanto.Identificación de especies y montaje de preparaciones En la mayoría de los casos. Joseph Morton en la INVAM (Colección Internacional de hongos micorrizógenos arbusculares. 1979. La ilustración 4 muestra las esporas y las estructuras producidas por las especies de la familia Gigasporaceae (fotografías a. usando como referencia al Manual para la identificación de HMA (Schenck y Pérez. Sin embargo.caf. de 160 especies de HMA descritas en total. este manual incorpora en un solo volumen toda la descripción de las especies hasta 1990. W. Trappe. Poland) en http://www. En los anexos 1. c y d) y Acaulosporaceae (e.szczecin. y h). Koske y Walker (1985) proponen una clave para algunas especies de Scutellospora con esporas con paredes ornamentadas. Algunas claves de identificación para HMA (por ejemplo Hall y Fish. Fotografías de esporas de especies representativas de diferentes géneros se muestran en las ilustraciones 4 y 5.edu) y por Dr. deben ser montadas en portaobjetos y observadas en un microscopio compuesto. La identificación de especies de HMA se puede hacer por comparación con la descripción original de la especie. USA) sitio web (http://invam. c) un detalle de la ornamentación de H ongos micorrizógenos arbusculares 229 .. las esporas extraídas del campo no son identificables bajo el microscopio de disección. café. alberga todos los problemas inherentes a esas descripciones (falta de estandarización de las estructuras subcelulares de las esporas. en estos sitios web se describen 79 y 55 especies respectivamente. 1982) se publicaron antes de algunas revisiones de taxonomía recientes e importantes. falta de buenas fotografías para las comparaciones y las descripciones están hechas con esporas extraídas del suelo de campo por lo cual pueden no incluir características taxonómicas importantes).

Las características taxonómicas importantes que pueden observarse bajo el microscopio de disección son tamaño de las esporas. Archaeosporaceae (e y f) y Paraglomeraceae (g y h). en la foto d). esporas de Acaulospora sp. Foto a): espora de Glomus clarum indicando la hifa de sostén (note que la capa más interna de la pared de la espora se desprende y se ve parecida a la pared germinal. y d) células auxiliares nodosas que diferencian a los miembros de Scutellospora. c. En la foto e) se muestra una espora de Entrophospora colombiana (familia Acaulosporaceae) con la pared de la espora. forma. de células suspensoras y del sáculo esporífero (raramente observado en esporas recolectadas directamente del campo). se observan.la pared de las esporas (verrugas) de Scutellospora coralloidea. La foto b) muestra la pared de la hifa de sostén continua con la pared de la espora de un Glomus sp. también con la pared formada por tres capas (L1. L2 y L3) (la capa L2 está ornamentada con pequeñas crestas). b. d). número de paredes germinales y grosor de la pared de la espora. mostrando algunos sáculos esporíferos adheridos a las esporas. reacción al Melzer. En el microscopio compuesto pueden observarse algunas características taxonómicas importantes como son la presencia y tipo de ornamentación sobre la pared de la espora. la foto g) ejemplifica la estructura de la pared formada por tres capas (L1. Una espora de Entrophospora colombiana mostrando las dos cicatrices características se ve en la foto f). en la foto h). Materiales necesarios • Portaobjetos. La ilustración 6 muestra a las esporas y estructuras producidas por especies de la familia Glomeraceae (a. La foto e) muestra un espora de Archaeospora leptoticha con el sáculo esporífero. Un esporocarpo de Glomus clavispora se observa en la foto c) y un esporocarpo de Glomus sp. la pared germinal 1 (gw1) y la pared germinal 2 (gw2) con su capa más interna reaccionando al reactivo de Melzer. La fotografía g) representa una espora de Acaulospora scrobiculata que muestra la cicatriz que queda en la espora después de que el sáculo esporifero se desprende. L2 y L3) de Paraglomus occultum y en la foto h) se muestra una espora de Paraglomus brasilianum. cubreobjetos y etiquetas • Agujas de disección 230 Manual de biología de suelos tropicales . Las esporas necesitan montarse en líquidos de montar permanentes como son el PVLG (alcohol polivínilico lactoglicerol) y PVLG mezclado con reactivo de Melzer. la foto f) muestra un detalle de Archaeospora leptoticha en donde se observan protuberancias y depresiones de las capas 2 y 3 de la pared esporal (indicada con flechas). presencia de hifa de sostén. color. finalmente.

Procedimiento 1.5 g Iodo. Además. Coloque suavemente un cubre objeto sobre la gota de PVLG y otro cubreobjetos sobre la gota de PVLG + Solución de Melzer. en el momento del muestreo. 5. 7. 10 ml de glicerol. las esporas se deslizan hasta los bordes cuando se coloca el cubreobjetos en la parte superior de cada gota. Mezclar el reactivo de Melzer con el PVLG (1:1) para preparar la solución de PVLG + Melzer. 5 g de yoduro de potasio. durante dos días para endurecer el medio de montaje. Etiquetar las preparaciones incluyendo número de muestra. Usando una aguja de disección. mezcle las esporas en la solución de PVLG y de PVLG + Solución de Melzer y deje secar la superficie de la gota por lo menos cinco minutos. género y especie (si se conoce). Este paso es importante para exponer las paredes germinales y sus capas. El método propuesto se basa en los protocolos de Stutz y Morton (1996). 4. 100 ml de ácido láctico.6 g de alcohol polivínilico (PVA) • Reactivo de Melzer (100 g de hidrato de cloral. En un porta objetos. 6. 1. Comentarios: el paso 2 es crucial para el montaje de las esporas sobre el portaobjetos. H ongos micorrizógenos arbusculares 231 . ofrecen esporas nuevas y saludables que pueden ser utilizadas para establecer cultivos puros de HMA. tenga cuidado de no agregar demasiada agua). 3. Guardar las preparaciones a temperatura ambiente durante cinco días y luego incubar a 40-60ºC. colocar una gota de PVLG y una gota de la solución de PVLG + Melzer.• Solución de PVLG (100 ml de agua destilada. y fecha. Establecimiento de cultivos trampa Los cultivos trampa se utilizan con más frecuencia en estudios de diversidad de HMA porque revelan las especies que no están esporulando en el campo. rompa cada espora individualmente bajo el microscopio de disección. 100 ml de agua destilada. Con una aguja de disección. si se agrega demasiada agua. 2. Colocar las esporas al centro de cada gota usando un pinza fina o una micropipeta (en este caso. 16.

T. in A. Wisconsin. y Schenck. y Morton. 82. Cubrir las semillas con la mezcla de suelo y arena. Se recomienda cualquier gramínea C4 y/o leguminosa como hospederas. homogeneizar el suelo de campo con arena estéril (50% de suelo de campo y 50% de arena). llamado “cultivos trampa de trasplante”. R. 1467–1472. 232 Manual de biología de suelos tropicales .5 kg y sembrar abundantemente con una mezcla de semillas de sorgo y frijol (40-50 semillas por maceta). J.5 kg Bandejas o bolsas de plástico Semillas de Sorghum sudanense (Sorgo) y Vigna unguiculata (Frijol) Procedimiento 1 En una bandeja de plástico (o en una bolsa de plástico). Glomales)’. En el paso 2. Alexander.Soil Biology and Biochemistry. extraer las esporas e identificarlas. (1986) ‘Infectivity of vesicular-arbuscular mycorrhizal fungi: Influence of host-soil diluent combinations on MPN estimates and percentage colonization’. N. Part 2: Chemical and Microbiological Methods. 2 Colocar esta mezcla en macetas de plástico de 1. T. durante el muestreo de suelo de campo. se incluyan las raíces de las plantas ya que también sirven como propágulos para iniciar los cultivos trampa. Almeida. B. M. vol. Soil ScienceSociety of America. 3. según lo explicado arriba. pp. pp. Klute (ed) Methods of Soil Analysis. Bever et al. J. 703–714. vol. donde las plantas intactas colectadas del campo se trasplantan a una maceta con un sustrato libre de HMA y se evalúa la esporulación después de tres a cuatro meses.Materiales necesarios • • • • Arena estéril Macetas de plástico de 1. REFERENCIAS Adelman. Después de tres a cuatro meses. otras plantas hospederas pueden utilizarse. Mycologia. colecte uno o dos núcleos de suelo de 50 ml de cada maceta. si el sorgo y frijol no están disponibles. 7–13. Madison. pp . (1990) ‘A Revision of the Genus Sclerocystis (Glomaceae. (1965) ‘Most-Probable-Number Method for Microbial Populations’. bajo condiciones del invernadero. (1996) utilizan un procedimiento diferente para establecer cultivos trampa. Comentarios: es importante que. M. 18.

A. (1980) ‘An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots’. J. Arora. M. 1–76. H ongos micorrizógenos arbusculares 233 . 46. pp. J. y Yates. pp. Cochran. Journal of Ecology. Agricultural and Medical Research. (1979) ‘A key to the Endogonaceae’. G. 87. 53. vol. Robson. 235–244. Advances in Ecological Research. y Hunt. L. D. Transactions of the British mycological Society. pp. W. (1991) ‘Mycorrhizas in natural ecosystems’. J. incorporating developmental patterns of morphological characters’. vol. K. (1996) ‘Host-dependent sporulation and species diversity of arbuscular mycorrhizal fungi in a mown grassland’. T. (1990) ‘Ecology of vesicular-arbuscular mycorrhizae’. Hall. Franson. Oliver and Boyd. G.... R. 119–142. Jasper. (eds) (1963) Statistical Tables for Biological. pp. pp. 21. D. 641–652. Knudsen (eds) Handbook of Applied Mycology: Soil and Plants. 84. 489– 500. 261–270. 9. H. (1995) ‘Interaction between arbuscular mycorrhizal fungi and plants: Their importance in sustainable agriculture and in arid and semiarid tropics’. in D. Fisher. vol. B. vol. P. L. 171–213. vol. G. B. Mukerjii and G. 75–78. (1987) ‘The effect of surface mining on the infectivity of vesicular-arbuscular mycorrhizal fungi’. P. Bagyaraj. S. Morton J. Advances in Microbial Ecology. Rai. Mycologia Memoir. (1979) ‘Fungal and arboreal biomass in a Western Oregon Douglas-fir ecosystem: Distribution pattern and turnover’. pp. pp. I. pp. Mycol ogi a. J. 14. y Trappe. R. K. J. y Schultz. B. W. 71–82. 35. pp . G. Marcel Dekker Inc. R. vol. A. Soil Science Society of America Journal. pp. (1995) ‘A monograph of the genus Gigaspora. Australian Journal of Botany. 5. R. pp. 754–756. vol. New Phytologist. C. y Fish. J. R. Transactions of the British Mycological Society. Canadian Journal of Forest Research. (1989) ‘Infection unit method of vesicular-arbuscular mycorrhizal propagule determination’. J. J. A. vol. vol. Biometrics. Gerdemann. J. y Nicolson. M. y Varma. 73. A. Gerdemann. D.. W. J. B. Antonovics. vol. pp. y Bethlenfalvay. y Abbott. y Mosse. y Morton. New York. M.Bagyaraj. D. 6. 720–732. Edinburgh. F. 245–256. vol. Brundrett. Bever. Bentivenga. A. D. vol. (1950) ‘Present status of biometry’. (1974) ‘Endogonaceae in the Pacific Northwest’. Giovannetti. (1963) ‘Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting’. Fogel. K. 84.

Morton. R. J. vol. vol.. Alexander (eds) Mycorrhizas in Ecosystems. J. vol. C. pp. J. pp. pp. (2004) ‘Pacispora. (1985) ‘Mycorrhizal fungi at eighteen apple rootstocks plantings in the United States’. II: A bioassay to determine the effect of land disturbance on endomycorrhizal populations’. 78. Morton. Mosse. American Journal of Botany. (1970) ‘Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection’. 72–82. O. P. Zygomycetes)’. Mycologia. 471–491. pp. (1979) ‘The role of endomycorrhizae in revegetation practices in the semi-arid West. 37. C. N. New Phytologist. C. R. 1). vol. (2001) ‘Two new families of Glomales. D. Glomales. A. 158–161. Paul. C. B. P. Philips. T. (1982) ‘Quantification of vesicular-arbuscular mycorrhizae in plant roots’. y Gemma. D. J. Miller. A. y Reeves. y McGraw. pp. pp. J. Mycologia. Schenck (ed) Methods and Principles of Mycorrhizal Research. 702–720. vol. B. N. St. y Le Tacon. Journal of Applied Botany. E.. 379–391. Read. (1992) ‘Short-term changes in vesicular-arbuscular mycorrhizal spore populations in Terminalia plantations in Cameroon’. L. 93. P. Bentivenga. vol. nutrients and mycorrhizae during conversion of dry tropical forest to grassland’. y Last. Stribley. 73 (suppl. Acaulosporaceae and Gigasporaceae. 486–505. 5. American Phytopathological Society. D. 92. D. Kormanik. Glomineae and Gigasporineae. in N. T.. pp. y Hayman. G. 234 Manual de biología de suelos tropicales . CAB International Wallingford. Koske. vol. P. 55. Mycotaxon. 100. with an emendation of Glomaceae’. B. based on concordant molecular and morphological characters’. Oehl. P. Moorman. D. y Benny.. M. y Walker. pp. B. vol. Canadian Journal of Botany. measurement. (1989) ‘A modified procedure for staining roots to detect VA mycorrhizas’. pp. F. E. y Redecker. y Sieverding E. 7. a new vesicular-arbuscular mycorrhizal fungal genus in the Glomeromycetes’. vol. Domoto. Transactions of the British mycological Society. H. 181–195 Morton. D. A. vol. Fitter and I. Ecological Applications. Archaeosporaceae and Paraglomaceae. pp. F. B. H. C. Mycological Research. 261–267. pp. 14–18. y Walker. S. 137–210. (1990) ‘Revised classification of arbuscular mycorrhizal fungi (Zygomycetes): A new order. y Wedin. A. Mason. (1981) ‘Ecology of mycorrhizae and mycorrhizal fungi’. vol. J. M. (1997) ‘Soil carbon. Lewis. D. with two new genera Archaeospora and Paraglomus. S. in D. pp. 66. two new suborders. E. and two new families. y Bever. P. and interpretation of diversity in arbuscular endomycorrhizal fungi (Glomales. 77. A. F. J. (1995) ‘Discovery. Advances in Microbial Ecology. J. D. Koske. S25–S32. (1985) ‘Species of Gigaspora (Endogonaceae) with roughened outer walls’. Musoko. 171–182.Johnson.

Appendicispora: a new genius in the arbuscular micorrhiza-forming Glomeromycetes. 734–750.Picone. 1413–1421. 1102–1108. Schübler.. (1996) ‘Successive pot cultures reveal high species richness of arbuscular endomycorrhizal fungi in arid ecosystems’. Y. with a discussion of the genus Archaeospora. H ongos micorrizógenos arbusculares 235 . vol. D. y Oehl. J. C. Spain. T. W. 3rd Edition. (1990) Manual for Identification of VA Mycorrhizal Fungi. Synergistic Publications. vol. (1979) ‘Most Probable Number method for enumerating infective propagules of vesicular arbuscular mycorrhizal fungi in soil’. y Bruns. Redecker. Canadian Journal of Botany. pp. C. Mycological Research. (2001) ‘A new fungal phylum. (2000) ‘Diversity and abundance of arbuscular-mycorrhizal fungus spores in tropical forest and pasture’.L. 32. D. vol. 1883–1889. pp. pp515–519. USA. B. 92. 72. the Glomeromycota: Phylogeny and evolution’. N. Mycotaxon vol 97. vol. F. B. Porter. E. J. (2000) ‘Molecular phylogeny of the arbuscular mycorrhizal fungi Glomus sinuosum and Sclerocystis coremioides’. Phytopathology. C. J. J. pp. Mycologia. C. Trappe. Morton. vol. y Pérez. y Morton. Stutz.. Schwarzott. M.. D. (1982) ‘Synoptic key to the genera and species of Zygomycetous mycorrhizal fungi’. pp. y Walker. 2006. Sieverding. 163-182. Gainesville. pp. 105. Schenck. 282–285. 74. vol. Australian Journal of Soil Research. A. 17. J. pp. M. Biotropica.

delhiense Mukerji. australe (Berkeley) Berch G. callosum Sieverding G. y Ellis) Trappe y Gerdemann 236 Manual de biología de suelos tropicales .. macrocarpum Tulasne y Tulasne G. manihotis Howeler. ambisporum Smith y Schenck G. maculosum Miller y Walker G. lacteum Rose y Trappe G. clarum Nicol. y Trappe G. convolutum Gerd. Sieverding y Schenck G. przelewicensis Blaszkowski G. laccatum Blaszkowski G. y Broome) Redecker y Morton G. Renker y Buscot G.1. mosseae (Nicol. y Gerd. coremioides (Berk. melanosporum Gerd. Gemma y Olexia G. minutum Blaszk. G. multisubstensum Mukerji. liquidambaris (Wu y Chen) Almeida y Schenck G. constrictum Trappe G. invermaium Hall G. Bhattacharjee y Tewari G. boreale (Thaxter) Trappe y Gerd. botryoides Rothwell y Victor G. nanolumen Koske y Gemma G.) Trappe y Gerd. arborense McGee G. género Glomus Género/Especies Glomus G. caledonium (Nicol. proliferum Dalpe y Declerck G. y Gerd. cerebriforme McGee G. aurantium Blaszkowski. clavisporum (Trappe) Almeida y Schenck G.Apéndice 7. Tadych y Madej G. pubescens (Sacc. antarticum Cabello G. monosporum Gerdemann y Trappe G. canadense (Thaxter) Trappe y Gerd. multicaule Gerd. microaggregatum Koske. y Schenck G. Bhattacharjee y Tewari G. G. claroideum Schenck y Smith G. magnicaule Hall G. Especies de HMA de la familia Glomeraceae. corymbiforme Blaszkowski G. y Trappe G. mortonii Bentivenga y Hetrick G. Blanke. citricola Tang y Zang G. y Trappe G. G. y Bakshi G. pallidum Hall G. aggregatum Schenck y Smith G. microcarpum Tulasne y Tulasne G.) Gerd. albidum Walker y Rhodes G. pansihalos Berch y Koske G. coronatum Giovannetti G.

fragile (Berk. glomerulatum Sieverding G.1. dominikii Blaszkowski G. G. Blanke. formosanum Wu y Chen G. y Trappe emend. Friese. tenebrosum (Thaxter) Berch G. xanthium Blaszk. y Trappe) Almeida y Schenck G. Bloss y Menge G.) Trappe y Gerdemann G. tenue (Greenhall) Hall G. radiatum (Thaxter) Trappe y Gerd.wvu. vesiculiferum (Thaxter) Gerd. halonatum Rose y Trappe G. geosporum (Nicol. fragilistratum Skou y Jakobsen G. Renker y Buscot G. y Broome) Trappe y Gerd. y Bakshi) Almeida y Schenck G.. McGee G.Apéndice 7. tortuosum Schenck y Smith G. deserticola Trappe. G. y Gerd. segmentatum Trappe. dimorphicum Boyetchko y Tewari G. hoi Berch y Trappe G. pulvinatum (Henn. fulvum (Berk. diaphanum Morton y Walker G. y Broome) Trappe y Gerd. sinuosum (Gerd. fasciculatum (Thaxter) Gerd. viscosum Nicol. G. versiforme (Karsten) Berch G.) Walker G. fuegianum (Spegazzini) Trappe y Gerdemann G. warcupii McGee H ongos micorrizógenos arbusculares 237 . G. G. trimurales Koske y Halvorson G. tenerum Tandy emend. y Trappe G. Continúa Género/Especies G. rubiforme (Gerd. pustulatum Koske.edu. sterilum Mehrotra y Baijal G. Spooner y Ivory G. taiwananse (Wu y Chen) Almeida y Schenck G. Walker y Dalpe G. globiferum Koske y Walker G. reticulatum Bhattacharjee y Mukerji G.caf. insculptum Blaszkowski G. flavisporum (Lange y Lund) Trappe y Gerd. tubiforme Tandy G. heterosporum Smith y Schenck G. intraradices Schenck y Smith Fuente: tomado de http://invam. G. etunicatum Becker y Gerdemann G. Walker y Koske G.

paulineae Blaszkowski Fuente: tomado de http://invam. baltica Blaszkowski E. rehmii Sieverding y Toro A. tuberculata Janos y Trappe A. scrobiculata Trappe A. Reed y Sanders A. thomii Blaszkowski A. Chaverri y Rojas A. elegans Trappe y Gerdemann A. excavata Ingleby y Walker A. myriocarpa Spain. delicata Walker.Apéndice 7. géneros Acaulospora y Entrophospora Género /Especies Acaulospora A. Especies de HMA de la familia Acaulosporaceae.edu. lacunosa Morton A. undulata Sieverding A. nicolsonii Walker. walkeri Kramadibrata y Hedger Entrophospora E. schenckii Sieverding y Toro 238 Manual de biología de suelos tropicales . rugosa Morton A. denticulata Sieverding y Toro A.2.caf.wvu. kentinensis Wu y Liu E. cavernata Blaszkowski A. infrequens (Hall) Ames y Schneider4 E. colombiana Spain y Schenck E. morrowiae Spain y Schenck A. bireticulata Rothwell y Trappe A. gedanensis Blaszkowski A. capsicula Blaszkowski A. koskei Blaszkowski A. Sieverding y Schenck A. dilatata Morton A. foveata Trappe y Janos A. Pfeiffer y Bloss A. laevis Gerdemann y Trappe A. longula Spain y Schenck A. mellea Spain y Schenck A. taiwania Hu A. A. polonica Blaszkowski A. spinosa Walker y Trappe A. splendida Sieverding. sporocarpia Berch A.

Daniels y Trappe) Morton y Redecker Ar. leptoticha (Schenck y Smith) Morton y Redecker Paraglomus P. trappei (Ames y Linderman) Morton y Redecker Ar.wvu. y Oehl P. chimonobambusae Blaszk. 2004 y http://invam. Sieverd. dominikii Sieverd. coralloidea Sieverd.Apéndice 7.edu. y Oehl P. Especies de HMA de las familias Archaeosporaceae(Género Archaeospora). y Oehl P. scintillans Rose y Trappe emend. y Oehl P. boliviana Sieverd. brasilianum (Spain y Miranda) Morton y Redecker P. robigina Sieverd. y Oehl P. occultum (Walker) Morton y Redecker Pacispora P.3. y Oehl P. y Oehl Fuente: tomado de Oehl y Sieverding. gerdemannii (Rose. Sieverd.caf. emend. Paraglomeraceae (Género Paraglomus) y Pacisporaceae (Género Pacispora) Género /Especies Archaeospora Ar. H ongos micorrizógenos arbusculares 239 . franciscana Sieverd.

y Schenck Scutellospora S. géneros Gigaspora y Scutellospora Género /Especies Gigaspora Gi. y Trappe Gi. cerradensis Spain y Miranda S. y Ho) Walker y Sanders S.) Walker y Sanders S. gilmorei (Trappe y Herd. y Gerdemann) Walker y Sanders S. calospora (Nicol. arenicola Koske y Halvorson S. nigra (Redhead) Walker y Sanders S. y Herr.) Walker y Sanders S.4.) Gerd. rosea Nicol. albida Schenck y Smith Gi.Apéndice 7. y Gerd. pellucida (Nicol. heterogama (Nicol. y Schenck) Walker y Sanders S.) Walker y Sanders 240 Manual de biología de suelos tropicales .) Walker y Sanders S.) Walker y Sanders S. nodosa Blaszkowski S. aurigloba (Hall) Walker y Sanders S. biornata Spain. gregaria (Schenck y Nicol. gigantea (Nicol. hawaiiensis Koske y Gemma S. minuta (Ferr. margarita Becker y Hall Gi. castanea Walker S. Miller y Walker) Walker y Sanders S. armeniaca Blaszkowski S. reticulata (Koske. coralloidea (Trappe.) Walker y Sanders S. dipurpurascens Morton y Koske S. persica (Koske y Walker) Walker y Sanders S. y Gerd. Especies de HMA de la familia Gigasporaceae. Sieverding y Toro S. alborosea (Ferr. dipapillosa (Walker y Koske) Walker y Sanders S. erythropa (Koske y Walker) Walker y Sanders S. y Herr. Gerd. y Herr. fulgida Koske y Walker S. decipiens Hall y Abbott Gi. savannicola (Ferr.

scutata Walker y Diederichs S. Continúa Género /Especies S. H ongos micorrizógenos arbusculares 241 . y Ferr.caf.) Walker y Sanders S. spinosissima Walker. tricalypta (Herr. Cuenca y Sanchez S.Apéndice 7.4. verrucosa (Koske y Walker) Walker y Sanders S. weresubiae Koske y Walker Fuente: tomado de http://invam.wvu.edu.

.

Para poder obtener una evaluación confiable de la diversidad de los hongos del suelo. actinomicetos (actinobacterias) y pequeños invertebrados.Capítulo 8 Hongos del suelo saprófitos y patógenos de plantas Ludwig H. (Wainwright. Las investigaciones deben ser diseñadas en forma de estudios a largo plazo donde intervengan especialistas en taxonomía y micología. los patógenos de plantas actúan en el suelo y en la rizósfera. debido al tiempo y la limitación de los recursos. grupos específicos o un conjunto de predictores. Lodge. principalmente para la mesofauna que habita en el suelo (Bonkowski et al. En el suelo. Cuando un estudio de largo plazo involucra varios especialistas no resulta viable. podrían ser una alternativa (Hyde. La evaluación de la diversidad de hongos en suelos tropicales bajo diferentes usos de suelo es. junto con una metodología precisa. Los hongos son una parte importante de la cadena alimenticia en el suelo. los cuales juegan un importante papel en el reciclaje de nutrientes o son mediadores del equilibrio entre los patógenos y sus antagonistas.. El uso de organismos indicadores. 1988. Pfenning y Lucas Magalhães de Abreu INTRODUCCIÓN Los hongos del suelo juegan un papel clave en los procesos de descomposición que mineralizan y reciclan nutrientes de plantas. En los ecosistemas agrícolas. 1993). causando una notable reducción en las cosechas y afectando su calidad. 1997a y b). Las actividades agrícolas pueden afectar la diversidad de organismos presentes en el suelo. existen dos condiciones básicas. 2000). los hongos interactúan con una compleja comunidad microbiana que incluye: bacterias. por lo 243 .

(1992). Bills et al. y su crecimiento en un medio de cultivo axénico para su posterior identificación y cuantificación. un objetivo del proyecto CSM-BGBD. medios de cultivo parcialmente selectivos y adictivos que reducen el crecimiento de ciertos grupos de hongos. Se ha progresado considerablemente utilizando técnicas de lavado. un grupo monofilético de organismos de hongos obligados asociados a las raíces de las plantas (véase Capítulo 7). aún no están disponibles. la mayoría de los hongos que habitan en el suelo pueden ser considerados saprotróficos. deben ser capaces de crecer en cultivos axénicos. Sin embargo. 1996. puede no ser representativo de la dinámica de las comunidades del suelo. 1990. que cubran las diferentes idiosincrasias de la diversidad taxonómica y grupos fisiológicos de hongos presentes en los ecosistemas del suelo. No obstante. 1992.. Muyzer et al.. 1997). debido a que los medios de cultivo imponen nuevas condiciones selectivas y pueden introducir un sesgo en los análisis (Liu et al.. 244 Manual de biología de suelos tropicales . 1983. Los procedimientos clásicos microbiológicos para estudiar los hongos del suelo se basan en cultivos que implican el aislamiento de propágulos microbianos o hifas activas que crecen en el suelo.tanto. tales como suelos que muestran limitaciones inherentes debido a la naturaleza de las especies y la inhabilidad de los medios de cultivo para copiar con exactitud los hábitats del suelo (Tsao et al. afirmaciones genéricas de que únicamente el 1% de los “microorganismos” del suelo son cultivables aumentan la dificultad y no tienen en cuenta la inmensa diversidad biológica que realmente representan dichos microorganismos (Rondon et al. 1990. Gray.. rizósfera y hongos rizoplanos. Los métodos utilizados para el aislamiento del suelo. 1993.. Dentro de este grupo se encuentran grupos filogenéticamente diversos. Bridge y Spooner. tales como fila de Eubacterias. 1992. 2000). Las metodologías para aislar y cultivar hongos de ecosistemas complejos. Incluso el análisis de abundancia relativa de especies cultivables recuperadas del suelo... Singleton et al. con diferentes medios de cultivos y estrategias de aislamiento. 2001). 2004). Los métodos estándares aceptados para inventariar la diversidad de hongos o para evaluar su impacto en varias prácticas agrícolas u otras actividades humanas. junto con muchos grupos homogéneos como el filum Glomeromycota. Gams. Davet y Rouxel. Cannon.. Una visión global de los métodos para estudiar hongos patógenos de plantas en el suelo fue descrita por Singleton et al. por lo tanto. Una medida confiable de las comunidades de hongos en el suelo sin prejuicios requiere del seguimiento de un laborioso programa de aislamientos sistemáticos. han sido revisados por varios autores (Frankland et al. 2000.

. Aunque este enfoque no es exhaustivo. estos métodos proporcionan. microorganismos. pequeños invertebrados y contenidos intestinales. por sí solos. se deberá tomar en cuenta que el suelo no es un sustrato.. respiración del suelo. el suelo alberga una parte considerable de la biodiversidad total de hongos.Otras metodologías que han sido desarrolladas se enfocan en el análisis de la actividad de los hongos y su papel en los procesos biogeoquímicos que ocurren en el suelo. Malosso et al. El objetivo principal es contribuir al establecimiento de una serie de métodos estándares. También son tomados en cuenta los principios y aplicaciones de herramientas moleculares en los estudios de comunidades de hongos del suelo. raíces vivas. En este capítulo se hace referencia a algunos de los métodos más comunes y también a algunas técnicas menos conocidas para la evaluación y monitoreo de comunidades de hongos del suelo. sino un ecosistema compuesto por una mezcla de sustratos más diversos que incluyen partes de las plantas vivas y muertas. Houston et al. porque el suelo representa una mezcla compleja de fracciones orgánicas e inorgánicas con agua y organismos vivos. Las fracciones orgánicas se componen de material de plantas en diferentes fases de descomposición. No obstante. En general. además. 2003. 2006). Brodie et al. 2003). Por esta razón. animales y otros microorganismos. Con estos fines. y no existe ninguna estimaHongos del suelo saprófitos y patógenos de plantas 245 . intenta ofrecer una visión global de los procedimientos disponibles. por lo tanto. junto con minerales y agua. LA IMPORTANCIA ECOLÓGICA DE LOS HONGOS DEL SUELO El suelo es un hábitat o ecosistema. y no un sustrato. poca información acerca de las especies de hongos involucrados en dichos procesos. es necesario adoptar métodos similares dentro de los proyectos cooperativos o multidisciplinarios para garantizar la comparación de los datos en un futuro. para un mejor entendimiento de la estructura y función de las comunidades de hongos del suelo. de los métodos utilizados. 1998. se requieren los procesos de aislamiento e identificación tradicionales (Brodie et al. cada método presenta ciertas preferencias a ciertos grupos específicos de hongos. exudados. reciclaje de nitrógeno y contenido de ácidos grasos del hongo o de observaciones directas del crecimiento del micelio en partículas de suelo (Widden y Parkinson. generalmente aceptados.. esta característica complica las definiciones y la metodología. se han aplicado métodos que dependen del análisis de la biomasa microbiana del suelo. 1973. Los resultados obtenidos de un estudio de hongos del suelo dependen.. Por ello. principalmente.

Barratt et al.. 1984. Lodge. Los hongos del suelo juegan un papel clave en los procesos de descomposición. 2003). 1991. plantas utilizadas como cubierta vegetal y la diversificación de cultivos. 246 Manual de biología de suelos tropicales . 2002. Los saprófitos tienen una especificidad limitada por sustratos. especialmente en el caso de la mesofauna (Bonkowski et al. 1993.. mineralizando y reciclando los nutrientes de las plantas (Wainwright. Lodge. Beare et al. o Coniothyrium minitans pueden reducir la incidencia de una variedad de enfermedades en el suelo (Whipps et al. El mantenimiento de la diversidad de hongos del suelo debería. 1980. 1997. provocan grandes pérdidas. pero también es posible que se mantenga o incremente con algunas prácticas agrícolas específicas. 1988. 1997). La supresión de patógenos de plantas puede resultar intrínseca en los suelos. Silva et al. 2001).. Schneider. Con relación al papel de los organismos descomponedores. mediante el suministro de nutrientes. mientras los ascomycetes descomponen principalmente celulosa y hemicelulosa (Domsch et al. los patógenos de plantas y sus antagonistas son particularmente importantes. los zygomycetes usan carbohidratos simples. 2000). Hawksworth y Rossman.ción fidedigna del número de especies de hongos del suelo (Hawksworth. Rodrigues-Guzman. 1997).. 2001. 1996. tales como la incorporación de materia orgánica.. en la rizósfera o infectan tallos.. Éstos pueden ser específicos. por ende. Zak y Visser. 2007. beneficiar directamente la agricultura sustentable. 1997).. por tanto. 2003. aunque la mayoría ataca una amplia gama de plantas hospederas. Los patógenos de plantas actúan en el suelo. Existen evidencias de que las prácticas agrícolas causan más alteraciones cuantitativas que cualitativas en la comunidad de microhongos del suelo (Pfenning. Mazzola. Los hongos también constituyen una parte importante de la cadena alimenticia dentro del suelo. Algunos elementos biológicos han sido identificados como los principales factores de la supresión de enfermedades (Chet y Baker. cabe mencionar que los hongos son responsables de la degradación de xenobióticos y contaminantes orgánicos introducidos en el suelo (Bordjiba et al. por ejemplo. causando que las plántulas se marchiten y. una mejor estructura física del suelo y el control de antagonistas de los patógenos de las plantas en el suelo. 1993). 2004). En sistemas agrícolas. Se ha demostrado experimentalmente que la introducción de antagonistas específicos como Trichoderma spp.

como se discutió en el Capítulo 7. Glomeromycota Los hongos clasificados en el reino Fungi se caracterizan por tener quitina como el mayor componente en su pared celular. La detección de estos organismos requiere de bioensayos o cebos. Moreira y Siqueira. Dentro de este reino se reconocen cinco fila: los géneros que pertenecen al filum Glomeromycota forman micorrizas arbusculares y no crecen en ausencia de su planta hospedera (Schußler et al.. otros habitan en el suelo. su hábitat e importancia ecológica son variables. Dentro del grupo de los Oomycetes del suelo es posible encontrar saprófitos. 2002). con un sistema de clasificación filogenético (Kirk et al.. Kirk et al.habitan en restos de plantas. Hongos del suelo saprófitos y patógenos de plantas 247 . Por sus características biológicas requieren de técnicas específicas para su aislamiento y caracterización. aunque también pueden encontrarse en el suelo. aunque algunos de ellos son importantes patógenos de las plantas del suelo. 2001). Trabajar con este grupo de simbiontes biotróficos obligados requiere del uso de diferentes técnicas específicas. 2001. Plasmodiophora brassicae o Polymyxa graminis. Los hongos del reino Protozoa no son numerosos. Chromista Los hongos que son derivados de algas y que contienen celulosa como el mayor componente en su pared celular pertenecen al reino Chromista Filum Oomycota (Dick. Los hongos llamados mohos mucosos -un grupo de organismos heterogéneos y polifilético. Mientras que algunos son verdaderos hongos acuáticos asociados con restos de plantas en agua o con patógenos de otros organismos acuáticos.. las cuales se presentan en la sesión “Procedimientos basados en cultivos”. 2001). 2001. A pesar de que estos hongos representan un grupo delimitado de acuerdo con sus características y filogenia. así como otros géneros patógenos de plantas.ASPECTOS DE SISTEMÁTICA MODERNA Protozoa Los organismos conocidos como hongos actualmente se agrupan en tres reinos. tales como Spongospora subterranea. Estas especies se clasifican en la clase Plasmodiophoromycetes.

algunos de estos hongos habitan en el suelo. 2008).. 1998) que no son consideradas en este manual. Los patógenos de plantas importantes en el suelo son especies de Rhizoctonia y Sclerotium. Mortierella o Rhizopus son muy comunes en el suelo y se encuentran en casi todos los estudios de hongos de suelo. La fase asexual de los ascomycetes se llama anamórfica y es la fase más comúnmente encontrada. La evaluación de la diversidad de estos hongos y el monitoreo de su impacto en la comunidad requieren de técnicas específicas (Rossman et al. Ascomycota El filum Ascomycota representa el grupo más abundante de hongos. Varias de estas especies se conocen como trasmisores de virus patógenos de plantas (Krik et al. Para fines prácticos. Cunninghamella. Muchos de ellos forman ectomicorrizas en asociación con el sistema de raíces de árboles forestales. distinguir los grupos más importantes. La filogenia de este grupo aún es objeto de discusión y de revisión.Chytridiomycota El único grupo dentro del reino de los hongos que forma esporas flageladas es el filum Chytridiomycota. por lo general. Mucor. El micelio vegetativo se desarrolla. tales 248 Manual de biología de suelos tropicales .. Especies de los géneros Absidia. un meiosporangio en el que generalmente se forman cuatro esporas sexuales (Bauer et al. insectos. una estructura formada durante la fase sexual de su ciclo de vida. 2006) y en la mayoría de los casos por la formación de un cuerpo fructífero. Gongronella. pero normalmente son acuáticos y viven como saprófitos o parásitos de otros organismos como nematodos. Basidiomycota El filum Basidiomycota se caracteriza por el basidium. plantas u otros hongos. Zygomycota Representan el filum Zygomycota y se consideran como hongos de azúcar por su preferencia por carbohidratos simples y por su crecimiento vigoroso en un cultivo axénico. en el suelo y en restos de plantas. Se caracterizan por la formación de las ascas..

Algunos de los ascomycetes como Aspergillus y Penicillium que habitan en el suelo. debido a que la micobiota de la rizósfera es altamente influenciada por las especies de plantas. tres o más muestras compuestas podrán colectarse en cada punto de muestreo. MUESTREO DE SUELO Utilizando un nucleador se extraen pequeñas cantidades de suelo. espátula. 2008). pertenecen a los plectomycetes. si los recursos lo permiten. Para la extracción del DNA.como plectomycetes. las muestras del suelo deberán trasladarse al laboratorio utilizando un recipiente con aislamiento.. pyrenomycetes y loculoascomycetes puede ser útil. Probablemente. azadón.) deberán lavarse antes y después de tomar las muestras. el grupo más grande de hongos encontrados en el suelo son los pyrenomycetes anamorfos (Krik et al. discomycetes. utilizando plantas altamente susceptibles. Cada juego de 12 muestras se homogenizan para formar una muestra compuesta de alrededor de 500 g que se coloca en una bolsa de plástico. Todos los materiales de muestreo (nucleador. preferentemente a 4°C y congelarse lo más pronto posible para su futuro procesamiento. También se recogerá una segunda muestra compuesta de alrededor de 200 g. en caso de que se haya previsto realizar otros análisis físicos y químicos del suelo. la detección y el monitoreo de los hongos de organismos protistas como Spongospora y Plasmodiophora puede llevarse a cabo mediante bioensayos. con el fin de evitar la contaminación entre puntos de muestreo. De manera alternativa. Debido a su pequeño tamaño y estructura poco diferenciada. a pesar del uso de antibióticos en los medios de cultivo. etc. La hojarasca deberá ser removida justo antes de extraer la muestra. EVALUACIÓN DE LOS HONGOS DEL SUELO: PROCEDIMIENTOS BASADOS EN CULTIVOS Todos los métodos propuestos dependen de muestras del suelo y no contemplan el uso de raíces para aislar hongos del suelo. a una profundidad de 20 cm en 12 puntos distribuidos en cada parcela de muestreo de acuerdo con el esquema mostrado en el Capítulo 2. pueden resultar contraproducentes para la recuperación de especies de hongos. ascomycetes que forman un asca en un cuerpo fructífero cleistotecal. La rizósfera también contiene una alta concentración de bacterias que. Hongos del suelo saprófitos y patógenos de plantas 249 .

en la sección de color de este manual. 1998. Se añaden granos de sorgo como cebo y se incuban por cinco días. El aislamiento de hongos zoospóricos (Oomycetes. las porciones de agar que contengan micelio serán transferidas a placas con agua estéril destilada y con dos mitades de semillas de sorgo. la C) muestra un cultivo puro en el cebo y en la D) se observa el esporangio de Phytophthora. finalmente. en la última ilustración F). Pueden llevarse a cabo ensayos cuantitativos utilizando la frecuencia de la colonización relativa de los tejidos del cebo entre las réplicas de cada muestra de suelo. agar dextrosa y papa (ADP) o agar de papa y zanahoria (en el caso de Pythiaceae) (véase Apéndice 8. tomate o papa. Especies de Pythium y Phytophthora pueden causar serios daños a plantas cultivadas. mientras que el oogonio y anteridio de Pythium se ilustran en E)”. 2000). 1983.5 g colocadas en tubos de ensayo de vidrio esterilizado con 3 ml de agua estéril. Alícuotas de 2 g de suelo se traspasan a cajas Petri que contienen agua estéril destilada. 1970. Al final de dicho procedimiento se deberá observar que se obtiene únicamente un aislamiento para cada placa. después se comprueba la presencia de micelio en el cebo. la B) una muestra de agua con cebo. El micelio del hongo formado en el sustrato deberá traspasarse a charolas con el medio MP5 (en el caso de Saprolegniaceae) y agar con harina de maíz (AHM). Las hojas de zacate como cebo pueden ser sustituidas por pedazos de frutas o verduras como pepino. Tsao et al.Oomycota: uso de cebos para el aislamiento de Pythium y Phytophthora Para poder recuperar del suelo los oomicetes es aconsejable el uso de plantas susceptibles o tejidos vegetales. La ilustración A) representa una muestra de suelo con cebo. Este procedimiento deberá continuarse durante varias semanas. El micelio en crecimiento se verifica directamente mediante montajes con agua en un microscopio o se transfiere del cebo al medio de aislamiento (AHM) que contiene cloranfenicol (50 mg L-¹) y benomil (10 mg L-¹) (Marks y Mitchell. Después de incubar durante tres a cinco días.1 para la composición del medio). Edena et al. Otra técnica con sustrato susceptible utiliza muestras de suelo húmedo de 0.. Los tejidos infectados deben transferirse en agua estéril con el antibiótico cloranfenicol durante unas horas. Chytridiomycetes) de muestras ambientales aparece en la ilustración 6. 250 Manual de biología de suelos tropicales .. Las muestras son incubadas durante tres a cinco días a 25°C en la oscuridad. Se esterilizan en autoclave fragmentos de hojas de zacate y se añaden a los tubos como tejidos para recuperar el Pythium spp. se observa la liberación de zoosporas de Pythium.. Gams et al.

se recuperan las semillas con un tamiz de 1. la caracterización e identificación se hace directamente en el cebo.5 mm. se verifica el crecimiento típico de Rhizoctonia. después decantada usando un tamiz de 0.. posteriormente. se describen varios métodos. A continuación. compilados por Sneh et al. Después de un periodo de incubación de 48 horas a 25°C. los cebos pueden transferirse a viales. Técnica de cebo Se mezcla 1 g de semillas de betabel con 100 g de suelo húmedo en cajas Petri.. y pedazos de frutas y verduras (Gams et al. alas de insectos. se lavan con agua destilada durante Hongos del suelo saprófitos y patógenos de plantas 251 . Las partículas de suelo retenidas se secan con papel absorbente estéril y se transfieren a una caja Petri de 15 cm de diámetro que contenga un medio de agar con agua acidificada (al 2%) con 250 mg L-¹ de cloranfenicol. en suelos de jardines de eucaliptus clonados fue descrito recientemente por Sanfuentes et al. Los cebos más apropiados incluyen cáscara de camarón.5 mm. Para su preservación. Un método para evaluar la densidad de inóculo de Rhizoctonia spp. a 25°C. piel de serpiente. 1998). Después de un periodo de incubación de 24 a 48 horas. Como el aislamiento de colonias individuales en un medio de cultivo axénico es difícil. se evalúa la frecuencia de la colonización en las partículas del suelo y el micelio se transfiere a ADP para su eventual caracterización (Sneh et al. (1991). se presentan dos métodos de aislamiento útiles. (2002). El suelo retenido se resuspende y se pasa varias veces por el tamiz. Basidiomycota – Rhizoctonia: técnica de cebo y aislamiento directo de partículas de suelo Para evaluar este género de basidiomicetes anamórficos del suelo. Método de partículas de suelo Una suspensión de 10 g de muestra de suelo y agua de la llave es agitada. 1991).Uso de cebos para el aislamiento de Chytridiomycota Para evaluar los Chytridiomycota se usan las mismas técnicas empleadas para los oomicetos.

Después de la sedimentación de las partículas del suelo durante 2 minutos.20 minutos. 2002). utilizando un juego de tamices de 1. su aplicación en el estudio de suelos bajo vegetación natural. el empleo de técnicas de cultivo independiente.5 mm y 0.. que contenga 100 mg L-¹ de cloranfenicol.21 mm usando agua destilada (alrededor de 2 litros) por 2 minutos. 1975). La técnica de lavado de suelo es un método adecuado para el aislamiento de estas especies. Todas estas especies exhiben una fase saprotrófica en el suelo y pueden ser aisladas utilizando una metodología con placas de suelo. De esta manera. el sobrenadante se desecha y se repite el procedimiento dos veces.. en estos suelos. Cuando se emplea ciclosporina se logra una supresión casi completa 252 Manual de biología de suelos tropicales . El crecimiento de Rhizoctonia se verifica y se transfiere micelio a ADP para su aislamiento y caracterización (Papavizas et al. fitopatógenas y sus antagonistas.7 mm. Las partículas de suelo prelavadas son filtradas. entomopatógenas. 0. La frecuencia de colonización de partículas de suelo para cada especie de hongos es utilizada en ensayos cuantitativos. por el grupo de investigadores involucrados en el proyecto. se secan con papel absorbente estéril para ser transferidas a un medio de agar con agua al 2%. como la amplificación de DNA ribosomal de Rhizoctonia con iniciadores (en inglés. secados con papel absorbente esterilizado y transferidos (7 partículas por placa) a 5 cajas Petri (90 mm) que contienen el medio de aislamiento AHM (30 g L-¹). ha mostrado severas limitaciones debido a la continua presencia de Trichoderma spp.0 mm. Técnica de lavado Una muestra de 10 g de suelo mineral se agita con 200 ml de agua destilada en una centrífuga a 180 rpm durante 10 minutos. para la inhibición de hongos de rápido crecimiento. Los coloidales de suelo y granos de arena son removidos del último tamiz. más estreptomicina plus (50 mg L-¹) para la inhibición de bacterias y ciclosporina (10 mg L-¹) o rosa de Bengala (70 mg L-¹). A pesar del uso común de varios métodos para el aislamiento de Rhizoctonia de muestras de suelo agrícola. 0. primers) específicos y su análisis cualitativo e incluso cuantitativo puede resultar idóneo bajo circunstancias específicas (Lees et al. Ascomycota: técnica de lavado del suelo y filtración de partículas Éste es el mayor grupo de hongos del suelo que incluye especies saprófitas.

modificado con antibióticos como cloranfenicol. 2003).. éstos pueden contener fuentes de carbono preferiblemente metabolizados por algunos grupos fisiológicos de hongos o pueden modificarse con químicos que inhiben el crecimiento de organismos no deseados. por el factor de dilución empleado. Gams. la diversidad de hongos que normalmente existen en forma de micelio que crece activamente en el suelo. estreptomicina o penicilina para inhibir el crecimiento de bacterias. 1988. Este método se puede observar en la ilustración 7. 1985. Por lo tanto. 1986. y que tienen poca habilidad de competir con especies de rápido crecimiento en medios axénicos son subestimados por esta técnica (Bååth. hasta lograr la dilución final. Se pueden lograr medidas cuantitativas multiplicando el promedio de las unidades formadoras de colonias (UFC) en las placas. una cantidad conocida de suelo es suspendida en agua estéril. Bååth. 1992. 1985). Un factor final de dilución de 10-4 ó 10-5 se considera adecuado para el aislamiento de hongos (Dhingra y Sinclair. Ascomycota: medios selectivos y técnica con cebo Para un aislamiento selectivo de grupos blanco o especies de hongos del suelo.de zygomycetes saprotróficos. Por lo tanto. se toma 10% de la suspensión. Las alícuotas de la dilución final son distribuidas en cajas Petri que contienen un medio de agar generalmente.. rutinariamente se utilizan medios selectivos. 1998. Bills y Polishook. cuando se trata de estudiar este último grupo de hongos. se debe evitar el uso de ciclosporina (Dhingra y Sinclair. 1983). el resultado es una estimación del número de propágulos de hongos por gramo de suelo (Bills et al. 1988. Lang y Jagnow. 2004). Un gran número de medios selectivos ha sido desarrollado para el aislaHongos del suelo saprófitos y patógenos de plantas 253 . Tsao et al. la cual se mantiene en agitación durante unos momentos. La técnica es muy simple y se han descrito varias modificaciones. De esta suspensión se prepara una serie de 10 diluciones. Kacprzak y Stanczyk-Mazanek.. Gams et al. El método de dilución del suelo en placa Este es el método de uso más común para el aislamiento y estimación cuantitativa de bacterias y hongos. Básicamente. 1994. Existe una preocupación generalizada porque el método de dilución en placas muestra un sesgo hacia los hongos que son capaces de producir grandes cantidades de esporas y que crecen muy rápido en un medio de cultivo rico.

El aislamiento selectivo de los hongos del suelo también puede llevarse a cabo con cebos que son colonizados por grupos fisiológicos específicos de hongos. 1991.miento de varios géneros de ascomycetes. deberán aislarse selectivamente usando cebos. cuyo protocolo se describe a continuación. 1977. 1975. aquéllos que contienen especies patógenas de plantas. varios materiales de plantas adecuados para su aislamiento fueron descritos en una monografía reciente (Crous.. Hojas jóvenes y frescas se recogen y se lavan bajo agua de la llave para posteriormente ser sometidas a una desinfección con etanol al 70% durante un minuto... 1983. 1970. 2002. Wellington et al. Procedimiento para el aislamiento para el aislamiento de Cylindrocladium y géneros afines del suelo. cabello para las especies queratinofílicas. el tejido cebo es incubado con una muestra de suelo durante unos días. 1996. Edel et al.. Gams et al. mientras que para Fusarium spp. en particular.. Ejemplos de cebos utilizados para el aislamiento selectivo de hongos del suelo son tejidos de plantas para el caso de patógenos de plantas. En el laboratorio se utilizan hojas de ricino (Ricinus communis) como cebo para el aislamiento de hongos del complejo Cylindrocladium de manera rutinaria. Barratt et al. 2003).. para el aislamiento de Rhizoctonia solani se utiliza agua-agar acidificada. Pettitt et al. larvas de insectos para los entomopatogénos y nematodos para los hongos nematófagos (Marks y Mitchell. 1985. En la mayoría de los casos.. Thorn et al. 1998). por ejemplo.... Como el Cylindrocladium y probablemente otros géneros son sensibles a la ciclosporina. Papavizas et al. Sneh et al. 2000. Edena et al. después se transfiere a un medio selectivo de agar para su posterior aislamiento de los hongos deseados... especies de Cylindrocladium y de las especies relacionadas Cylindrocladiella y Gliocladiospsis raramente son reportadas en muestras de suelo que emplean el método de dilución del suelo por placas. Gonçalves et al. Dhingra y Sinclair. 2002b). La colonización del cebo por un hongo clave también puede llevarse a cabo mediante la observación directa al microscopio (Gams et al. el medio usado es Komada (Masago et al.. 2003. 1998. quitina para los productores de quitinasa. 254 Manual de biología de suelos tropicales .1987. Dackman et al. Sneh et al. utilizando como cebo hojas de Ricinus communis Cylindrocladium es un género conformado por especies saprotrófitas y patógenas de plantas comúnmente encontradas en el suelo.. basidiomycetes y oomycetes del suelo.. Tsao et al. 2001). 2001. A pesar de ello. 1991.

Hongos del suelo saprófitos y patógenos de plantas 255 . Técnica de cebo para el aislamiento de patógenos fúngicos de plántulas Una amplia gama de hongos patógenos de plantas en el suelo puede causar la muerte prematura de las plántulas. tal como ADP y AM (agar extracto de malta) que contiene cloranfenicol (250 mg L-¹). Después de más de 20 años. El aislamiento del hongo se logra con la transferencia de esporas a un medio de cultivo. después de tres días de incubación se lavan las hojas cuidadosamente con agua destilada y se transfieren a una cámara húmeda. síntomas de podredumbre. Los tejidos de plántulas infectadas se esterilizan con hipoclorito de sodio (al 2%. 2001. incluyendo hongos del suelo. es recomendable para su aislamiento el uso de plántulas de tomate como cebo. 1998.seguida de hipoclorito de sodio al 3%. Gonçalves et al. este compendio contiene claves para especies de varios géneros importantes y una recopilación de la literatura. IDENTIFICACIÓN DE HONGOS DE SUELO La identificación de hongos que habitan el suelo puede causar problemas para aquéllos que no tengan suficientes conocimientos de micología.. Las dificultades de identificar a nivel de especie se ilustran con el género Fusarium. Cylindrocladiella. enseguida se lavan con agua destilada y se secan en papel absorbente esterilizado para ser transferidas a un medio de aislamiento. Además de las claves y monografías de alrededor de 250 géneros. que es un grupo heterogéneo que incluye saprófitos. bajo un microscopio estereoscópico (Gams et al. Las hojas utilizadas sin desinfección previa tienden a ser degradadas con mayor rapidez y a ser colonizadas por bacterias. durante 30 segundos). Las hojas enteras se colocan un una caja Petri de 15 cm y se cubren con una capa de suelo húmedo. El trabajo de Barnett y Hunter (1998) es usado para unos pocos de los muchos saprófitos. donde diariamente se verifica la esporulación típica de Cylindrocladium.. utilizando agujas finas de cristal. por lo tanto. Gliocladiospsis y otros géneros relacionados. Crous. el amplio trabajo de Domsch et al. durante dos minutos. 2002b). (2007) aún sigue siendo una fuente importante para todos los involucrados en el estudio de hongos del suelo. Las semillas de tomate se germinan en 100 g de suelo y se verifica si las plántulas manifiestan o no. endófitos y patógenos de plantas.

. algunos tipos de hongos como Basidiomycota son difíciles de aislar y pueden no esporular en un medio axénico (Thorn et al. EVALUACIÓN DE HONGOS DEL SUELO: TÉCNICAS ESPECÍFICAS DE DNA Una medida confiable de las comunidades de hongos del suelo. (1998). 1971. (1991) resulta útil para trabajar con Rhizoctonia. 1967. 1996).. Fusarium (Leslie et al. 1993). Las herramientas moleculares basadas en el análisis del DNA han sido aplicadas con éxito en el estudio de complejos bacterianos y. 2004). las monografías y claves de Hanlin (1990. Nag Raj. 1996). Existen monografías disponibles para chyrids (Karling 1977) y también para el género Pythium (Waterhouse. 2001. 2001)... Samuels et al. 1984. Erwin y Ribeiro. (2000) o el manual de Gams et al. requiere de un laborioso programa de aislamientos sistemáticos con diferentes medios de cultivos y estrategias de aislamiento que reflejen la inmensa diversidad taxonómica y fisiológica de grupos de hongos que habitan en el suelo (Tsao et al.. hifas anamórficas pigmentadas (Ellis. Bridge y Spooner. recientemente. Las secuencias de DNA son amplificadas directamente desde el suelo por medio de la reacción en cadena de 256 Manual de biología de suelos tropicales . 1991a. Muyzer et al. c. 2006). Trichoderma (Bissett. Samson et al.. Una lista de referencias de guías y manuales para la identificación de grupos de hongos de suelo puede consultarse al final de este capítulo.. en ensambles de hongos a partir de muestras ambientales. Bills et al. 2000). 1976) y coelomycetes anamórficos (Sutton. sí. 1970. Penicillium (Pitt. 1968. Cylindrocladium (Crous. (página web). 1983. 1980. sin embargo. La monografía de Sheh et al. Tsao et al. No son específicas para el caso de hongos del suelo. Para más instrucciones acerca de cómo identificar hongos o grupos específicos de hongos. éstos incluyen técnicas específicas de DNA. 1983.Monografías y páginas web se encuentran disponibles para identificar las especies de Aspergillus. se puede consultar el Dictionary of the Fungi (Kirk et al.. Se pueden utilizar otras metodologías para complementar los enfoques tradicionales usados para un mejor entendimiento de la diversidad y dinámica de los hongos del suelo. No obstante. de mucha utilidad para este tema otras recopilaciones y monografías como la de Ellis y Ellis (1985). 1998a.. van der Plaats-Niterink. 1993. b. (Klich y Pitt 1988). Si se trata de identificar ascomycetes. 2002b). b) pueden ser un buen punto de partida. 1981) y para Phytophthora (Waterhouse..

El rDNA también contiene espaciadores entre las regiones codificantes conocidos como espaciadores internos de transcripción (ITS) que presentan secuencias de bases menos conservadas y que pueden utilizarse para la diferenciación entre especies relacionadas o para evaluar Hongos del suelo saprófitos y patógenos de plantas 257 . tienen que estar correctamente lisadas. Varias copias del DNA ribosomal (rDNA) se encuentran en el genoma eurocariota. 1997. incluso como micelio o esporas. Viaud et al. El total de DNA obtenido debe estar completamente purificado para eliminar sustancias húmicas y fenólicas que interfieren con el PCR.. La identificación de secuencias de DNA desconocidas también puede realizarse comparándolas con bases de datos de secuencias de nucleótidos de taxones conocidos. Bridge y Spooner. facilitando la amplificación de pequeñas muestras de DNA. 2000. 2001). debido a una variabilidad más alta dentro de la muestra (Ranjard et al. El polimorfismo en la longitud del DNA y la variación en la secuencia de las bases pueden utilizarse para agrupar organismos de acuerdo con su origen y relación evolutiva. es la extracción del DNA directamente del suelo. 2001). Extracción de DNA Un paso crucial antes del PCR. este paso se logra mediante separaciones a través de columnas de separación o con el uso de kits comerciales de purificación de DNA (Liu et al. principalmente.8S y 28S se considera que son altamente conservados entre los organismos eucarióticos y normalmente se emplean como marcadores moleculares. Las células de los hongos presentes en la muestra del suelo. 5. Los protocolos de extracción se basan. en los procesos físicos de macerado asociado con calor y lisis química. 2001).la polimerasa (PCR) y posteriormente caracterizadas utilizando varios enfoques (Bridge y Spooner.. Las muestras muy pequeñas (menores a un gramo) deben usarse con precaución porque tienen mayor probabilidad de error. Reacción en cadena de la polimerasa. Los kits para la extracción de DNA del suelo están comercialmente disponibles. Uso de Primers específicos para “hongos” El grupo de genes para las moléculas de RNA Ribosomales 18S.. La heterogeneidad encontrada a nivel de micro-escala en el suelo debe ser considerada cuando se selecciona el tamaño de la muestra de suelo sometida a la extracción total de DNA.

. no son adecuados para la evaluación de muestras ambientales complejas. Sin embargo. Baayen et al. El DNA clonado es secuenciado y comparado con las bases de datos que contienen secuencias oligonucleotídicas del rDNA fúngico mediante análisis de software. 2000.. Anderson et al. consumen tiempo y.. extraídos de matrices de gel. algunos de estos Primers específicos han mostrado que amplifican DNA no fúngico o muestran preferencia hacia la amplificación de grupos taxonómicos específicos dentro del reino de los hongos (Smit et al.. La detección y/o cuantificación de pocas especies específicas de hongos es requerida generalmente en el campo de la fitopatología. En el caso de estos hongos. 2003). Los Primers permiten la amplificación de una amplia gama de especies de hongos sin perder la especificidad de este grupo clave. Lees et al. purificados. Borneman y Hartin. 2000.. 2002. ya que el PCR tiende a amplificar moléculas del DNA que son dominantes en el extracto del DNA total.. Filion et al. 2003). Down. 2002. Para este tipo de investigación se han desarrollado varios iniciadores especie-específicos para una detección directa y el monitoreo de patógenos de estas plantas a partir de muestras del suelo (Cullen et al. utilizando Primers específicos para Géneros y/o especies de interés (Nechwatal et al.. 2001). los amplicones de tamaño correcto pueden separarse en geles de agarosa. Por 258 Manual de biología de suelos tropicales . Algunos hongos que están presentes en muy bajas densidades en suelos naturales. además. 2002). tales como especies de Phytophthora. han sido desarrollados y compilados por Anderson y Cairney (2004). el obtener Primers o iniciadores de rDNA de hongos específicos constituye un paso fundamental en la amplificación del PCR. Secuenciación del DNA Para poder conocer las identidades del DNA de los hongos amplificados por PCR. 2000.. conectados a vectores plásmidos y clonados en células bacterianas. Basándose en las secuencias de genes de RNA ribosomal disponibles en bancos de datos especializados para varias especies de hongos. 1999. la detección molecular de muestras de suelo puede ser mejorada mediante el uso de técnicas de cebo en conjunto con PCR. los Primers que son específicos para amplificar PCR del DNA de hongos de muestras complejas de suelo.divergencias genéticas intraespecíficas (Viaud et al. Como el suelo contiene un gran número de organismos. Estos procedimientos son caros. son difíciles de detectar por métodos moleculares.

el DNA se extiende a la misma longitud (como resultado del PCR). 2003. moléculas de DNA con diferentes secuencias en sus pares de bases. Varias combinaciones de Primers han sido propuestas para amplificar DNA de distintos grupos de hongos como Ascomycota. pero con diferentes secuencias de pares de bases.. Gomes et al. lo que determina el modo de desnaturalización y la movilidad electroforética al migrar en el gel desnaturalizante. parcialmente desnaturalizadas debido a las diferencias de la desnaturalización de los dominios menos estables en las moléculas.. las moléculas 18S DNA amplificadas por PCR son sometidas a una electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) o con un gradiente desnaturalizante (DGGE).. 2000.. Basidiomycota. 1999. Las restricciones y limitaciones están representadas en la selección de Primers utilizados en el primer paso de amplificación después de la extracción total del DNA de las muestras. y se llaman dominios de fusión. Milling et al.. generalmente.. Vandenkoornhuyse et al. 2000.ello. se han desarrollado técnicas moleculares de huella o rastreo molecular (en inglés fingerprint) para estudiar la diversidad a nivel de comunidad (Borneman y Hartin. En esta técnica. Método de huella molecular TGGE y DGGE La electroforesis en gel con gradiente de desnaturalización fue introducida en estudios sobre ecología microbiana por Muyzer y Smalla (1998). Viaud et al.. En varios estudios se ha usado esta técnica para evaluar la estructura de la comunidad de hongos y otros microorganismos. Hongos del suelo saprófitos y patógenos de plantas 259 . pero difieren en su contenido de Guanina-Citosina (GC). al igual que para monitorear modificaciones o impactos debidos a prácticas agrícolas o actividades industriales (Smit et al. Elsas et al. 2000. 2002. 2003). 1993). El gradiente de desnaturalización en DGGE puede variar con el uso de diferentes cantidades de urea y de formamida en la matriz del gel. contienen un DNA con bases repetitivas de GC que resultan menos propensas a la desnaturalización debido a su alta estabilidad química. Los iniciadores usados en el PCR.. presentan diferentes comportamientos de desnaturalización y migran hacia diferentes puntos en el gel (Muyzer et al. 2004). Los amplicones tienen exactamente el mismo número de nucleótidos. Los patrones de bandeo generados son utilizados para analizar complejas comunidades de hongos del suelo. Por lo tanto. Anderson et al. Bajo estas condiciones de desnaturalización.

Zygomycota y Oomycota (Nikolcheva y Bärlocher. la comigración de diferentes moléculas de DNA hacia un mismo punto en el gel.. El uso de un PCR anidado puede arrojar aún mejores resultados e incrementar la resolución en la separación de los productos del PCR (Oros-Sichler et al. la técnica puede proporcionar un estándar altamente reproducible de un gran número de muestras ambientales durante un periodo de tiempo relativamente corto. el DNA es amplificado por PCR con uno de los dos Primers marcados con fluorescencia. No obstante. T-RFLP Liu et al. tales como TGGE y DGGE. Se puede construir una base de datos de TRFs a partir de especies de hongos conocidos y utilizarla en corre260 Manual de biología de suelos tropicales . Recientemente.Chytridiomycota. 2001). 2004). los enfoques polifásicos que incluyen la construcción de bibliotecas de fragmentos clonados. los análisis bioquímicos y las técnicas de aislamiento. 2006). 2003). 2006. por ejemplo. la restricción enzimática del DNA antes de la electroforesis puede utilizarse en una técnica conocida como polimorfismo de longitud de fragmentos de restricción (RFLP) del DNA amplificado por PCR (Viaud et al. el método de huella molecular. (1997) desarrollaron una versión complementaria del PCR-RFLP. Singh et a. 2000). Otra limitante es que el DNA obtenido de organismos filogenéticamente distantes puede producir productos de PCR con una movilidad electroforética idéntica (Gomes et al. el DNA es tratado con enzimas de restricción y los fragmentos de restricción separados en un gel de acuerdo con su tamaño. Para incrementar el polimorfismo de la banda y mejorar la resolución..l. Los fragmentos de restricción terminal (TRFs) se marcan con fluorescencia y pueden ser detectados y cuantificados en un secuenciador automático. llamada polimorfismo de longitud de fragmentos de restricción terminal para el análisis (T-RFLP) de comunidades bacterianas de muestras ambientales. Después de la amplificación. 2006). después de la amplificación del DNA por PCR directamente extraídos del suelo utilizando Primers género-específicos (Nechwatal et al... Las especies de hongos relacionadas pueden identificarse de acuerdo con sus patrones típicos de RFLP. son la mejor opción (Malosso et al. En el T-RFLP.. Técnica PCR-RFLP La escasa variabilidad de rDNA de hongos puede resultar desventajoso en la técnica de huella molecular.

. Edel-Hermann et al. Kennedy et al. están enfocados en una o en pocas especies de hongos presentes en el suelo.. el polimorfismo intra-específico del ITS puede presentar problemas en la separación de distintas especies filogenéticas (O’Donnell y Cigelnik.. los diferentes fragmentos de ITS son separados en un gel y posteriormente detectados y cuantificados en un secuenciador automático (Ranjard et al. especialmente con hongos patógenos de plantas.. 1997. El ARISA de hongos es una técnica altamente sensible. 2005). 2006). PCR cuantitativo Algunos estudios. En el polimorfismo de conformación de cadena sencilla (SSCP). La Tabla 8. el DNA amplificado es completamente desnaturalizado antes de ser sometido a una corrida de electroforesis. 2001). los fragmentos de DNA del mismo largo. 1996. Lowell y Klein 2001. 2004. Después de la amplificación. En el análisis automatizado del espaciador intergénico ribosomal (ARISA). 2005). el DNA fúngico es extraído del suelo y amplificado por PCR utilizando Primers específicos para la región ITS con uno de los Primers marcados con fluorescencia.. Las moléculas de una sola hebra de DNA adquieren estructuras con dobleces únicos dictados por sus secuencias nucleotídicas y migran hacia puntos específicos en el gel. pero disímiles en su secuencia de pares de bases pueden ser fácilmente separados en SSCP por su diferencial de migración en el gel cuando existe la conformación de una sola hebra (Lee et al.. 2005. SSCP Otro estudio de huella molecular utiliza la migración diferencial de moléculas de una hebra de DNA en un gel para poder estudiar a las comunidades microbianas más complejas.laciones taxonómicas con los haplotipos detectados en el análisis T-RFLP (Brodie et al. En estos esHongos del suelo saprófitos y patógenos de plantas 261 . sin embargo.. Viaud et al. Como consecuencia. Kennedy et al. 2000. 2003. Singh et al. He et al. ARISA El polimorfismo natural de la región ITS del rDNA entre especies de hongos puede utilizarse para la evaluación de comunidades de hongos de suelo...1 muestra algunos ejemplos de técnicas moleculares empleadas para el estudio de comunidades de hongos del suelo publicadas en años recientes.

Baek y Kenerley. 2003. Sondas fluorogénicas o colorantes adicionados al PCRs permiten el monitoreo correcto de los productos obtenidos durante la amplificación.. Las sondas fluorescentes son capaces de emitir fluorescencia en la presencia de DNA de dos hebras.. Lees et al. Además de la detección molecular. Otro método empleado en aproximaciones cuantitativas es el de PCR en tiempo real.. 1992. Li y Hartman.tudios. se deben diseñar Primers de PCR específicos para obtener la amplificación correcta del DNA de la especie clave y otros marcadores moleculares pueden ser empleados como secuencia del gen β-tubulina o el factor de elongación de traducción del gen EF 1-α (Baayen et al. Esta técnica es más rápida y más sencilla que cPCR porque no existe la necesidad de construir un competidor de DNA y no se requiere de ningún análisis post-PCR (Cullen et al.. Después de esta amplificación. 2003). lo cual puede calibrarse y medirse con precisión. Mauchline et al. Una curva estándar puede construirse con cantidades conocidas de DNA e intensidades de fluorescentes. por lo tanto. 2002. 262 Manual de biología de suelos tropicales . 2003). la cuantificación del DNA de hongos en el suelo es requerida frecuentemente para estudios epidemiológicos y ecológicos. 2002. La cantidad de DNA en la muestra puede calcularse con la adición de diferentes cantidades de DNA competitivos. 1998. 2002.. No obstante. Después de un número definido de ciclos de PCR éstos se usan para cuantificar el DNA directamente de muestras de suelo. fragmentos de DNA que contienen los mismos sitios iniciadores que la muestra de DNA son añadidos en cantidades conocidas a las reacciones del PCR y coamplificados con el DNA específico. los distintos productos de PCR son cuantificados por separado de acuerdo con sus intensidades de bandeo relativas en geles de agarosa. En el cPCR. han sido desarrolladas modificaciones del PCR convencional como PCR competitivo (cPCR) y PCR en tiempo real.. 2000. el incremento de moléculas de DNA durante la amplificación conlleva un incremento en la intensidad de la emisión fluorescente. Filion et al. 2002). En el caso de ensayos cuantitativos. Mauchline et al. el PCR convencional es inapropiado para enfoques cuantitativos porque cualquier pequeña variación durante la fase exponencial en la reacción de amplificación puede alterar drásticamente las cantidades de los productos del PCR.. a una cantidad estándar de una muestra de DNA en una serie de PCRs y con el monitoreo de productos PCRs competitivos producidos en cada reacción (Siebert y Larrick. Filion et al.

Tres diferentes suelos cultivados con Lolium perenne.. 2003 Gomes et al. seguido por DGGE.. Diferentes horizontes de un suelo de selva. 2004 Milling et al... 2004 Edel-Hermann et al. Rizósfera de dos cultivos de maíz durante el periodo de ciclo de vida de la planta.. 1999 Viaud et al.1 Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes. Suelos de bosque natural y plantaciones de pino hoop.. Suelos con diferentes propiedades fisicoquímicas.Tabla 8. 2003 Brodie et al.. 2000 Lowel y Klein. 2003 Agnelli et al. Pastizales bajo diferentes tipos de vegetación. Suelo estepario con pasto corto con o sin presencia de nitrógeno. 2006 Hongos del suelo saprófitos y patógenos de plantas 263 .. Campos de espárragos. los efectos de cambiar el suelo al añadir composta o excremento.. Análisis de la dinámica de comunidades de hongos del suelo vía PCR hongoespecíficos del DNA del suelo. Técnica* TGGE PCR-RFLP SSCP ARISA DGGE Evaluación de comunidades de hongos en Rizósfera y suelo compuesto con trigo. análisis de detección y diversidad de especies de Fusarium. 2000 DGGE DGGE y TRFLP DGGE y restricción de DNA amplificado DGGE T-RFLP Anderson et al.. 2005 Yergeau et al.2005 DGGE SSCP y TGGE ARISA y T-RFLP DGGE con iniciadores específicos para Fusarium DGGE y T-RFLP Singh et al. 2001 Elsas et al. 2004 He et al.... 2005 Kennedy et al. amplificados del DNA total. Suelos bajo cultivos de papa transgénica y no transgénica. Referencias Smit et al. Suelos con diferentes propiedades fisicoquímicas. Gradiente de suelo desde llanuras hasta bosques de pino escocés. Gradiente de pastizales semi-naturales a suelos agrícolas mejorados. Una muestra de suelo por métodos de cultivo y molecular. 2001 Ranjard et al..

como hongos micorrízicos arbusculares. 2004b). contienen las mismas limitaciones que las técnicas de cultivos para hongos (Selenska y Klingmüller. Otra limitación del enfoque molecular basada en la amplificación del DNA es la falta de conocimientos acerca de la actividad de crecimiento o grupos funcionales 264 Manual de biología de suelos tropicales . los métodos de lavado del suelo y la filtración de partículas. tal y como ha sido discutido. 1992. en la secuenciación de quimeras (Crous. no se aplica en el caso de hongos saprófitos. este método no se describe para cada ejemplo. O’Donnell et al. exagerado. por lo tanto. Sin embargo. CONCLUSIONES Las herramientas moleculares para ensayos de comunidades de hongos del suelo fueron extraídas. Las técnicas de huella molecular en comunidades puede monitorear composiciones complejas de hongos de suelo. sin duda.Tabla 8. Incluso la mayoría de los hongos patógenos de plantas no son parásitos obligados. por ejemplo. 1994). en el caso de los hongos el número de especies no cultivables es.. de estudios sobre la diversidad bacteriana y. huella molecular y técnicas de clonación. pero una mejor caracterización y análisis filogénico de taxas dominantes. Hawksworth. Tsai y Olson. amplificación y secuenciación de contaminantes de hongos e incluso. 1992. los enfoques taxonómicos de hongos basados únicamente en datos moleculares. Bridge et al.1 Continúa. pueden presentar algunos problemas debido a que los bancos de datos pueden estar incompletos y puede que las secuencias de DNA se encuentren mal identificadas. Lo que puede ser verdad para organismos estrictamente simbióticos. principalmente. Muchos obstáculos para la identificación basada en cultivos han sido superados con la llegada de técnicas de aislamiento más sofisticadas como. requieren de una secuenciación y comparación utilizando bancos de datos de DNA al alcance del público.. lo que origina errores en identificaciones morfológicas. No obstante. Técnica* DGGE y ARDRA Evaluación de comunidades de hongos en Diversidad de hongos en suelos antárticos que combinan cultivo de aislamiento. 2006 Nota: * la clonación del DNA y la secuenciación fueron usadas por todos los autores para la identificación de haplotipos dominantes amplificados del DNA total. invariablemente. 2002a.. generalmente. 2003. Referencias Malosso et al.

2004). 2006. Se verifica el número de cepas de cada muestra y este dato puede ser usado para comparar entre sitios. constituye el primer conjunto de datos. fechas de colecta o diferentes tratamientos de suelo. Cuando están disponibles datos sobre variaciones cuantitativas entre las repeticiones dentro de las muestras. otros factores. 2006). el análisis de Kruskall-Wallis (Rodrigues. Para solucionar ese problema. Por medio del ANOVA es posible derivar variaciones entre diferentes muestras y dentro de las muestras (error). El conjunto de datos preliminares usualmente no es adecuado para hacer los análisis de ANOVA. ANÁLISIS DE DATOS Una lista de especies o agregados de especies aisladas y su abundancia relativa en cada muestra. Adicionalmente. dado que algunos de los datos no tienen una distribución normal. 1994. 1995). La prueba de independencia de Chi cuadrada puede usarse para este análisis. los protocolos de extracción del DNA son capaces de lisar y extraer ácidos nucleicos ya sea de micelio en crecimiento activo o de esporas latentes.. Por el momento. La forma de las curvas indica si el número Hongos del suelo saprófitos y patógenos de plantas 265 . Singh et al. Como se ha discutido. generalmente. y también dan información sobre el esfuerzo de muestreo empleado en la investigación. por lo tanto. La pendiente de las curvas muestra cuáles son las muestras con mayor riqueza de especies. Otra opción consiste en llevar a cabo un análisis de varianza no paramétrico. de acuerdo con la acumulación de las cepas muestreadas. además del número de cepas.. las transformaciones de datos. por ejemplo. por ejemplo. Las curvas de acumulación de especies o curvas de rarefacción pueden proporcionar comparaciones gráficas de la riqueza de especies entre muestras. Sokal y Rohlf. haciendo difícil la diferencia del crecimiento activo o grupos funcionales basados únicamente en el producto del análisis del PCR. pueden añadirse al ANOVA para evaluar sus efectos y sus interacciones con otros datos cuantitativos (Setälä y McLean. 1995). un entendimiento más completo sobre las comunidades de hongos del suelo deberá centrarse en enfoques polifásicos con ensayos basados en cultivos y taxonomía molecular en asociación con el estudio de los procesos biogeoquímicos que ocurren en el suelo (Malosso et al. 1998). donde el número total de cepas de cada muestra se usa en comparaciones pareadas.. tales como logaritmo o raíz cuadrada pueden aplicarse antes del análisis (Houston et al. como parámetros físicos y químicos del suelo bajo análisis. un enfoque más confiable es realizar un análisis de varianza (ANOVA). las curvas que se forman con más facilidad.de hongos del DNA total extraído del suelo. resulta ser un análisis robusto y confiable (Sokal y Rolf.

Curvas que no tienden a una asíntota indican que el número de especies podría aumentar si se aumenta el esfuerzo de muestreo (Bills y Polishook. y existen casos en donde dos comunidades distintas pueden tener el mismo índice de diversidad. 1982. Grishkan et al. análisis de correspondencia sin tendencia.).. se elige un límite (por ejem266 Manual de biología de suelos tropicales . 2003). 1994).. Howard y Robinson. común o rara y a la complejidad de los modelos matemáticos que se basan en la distribución de las especies. El análisis de correspondencia (AC) y su versión modificada. 1993. Muchos índices se han obtenido para evaluar y comparar la diversidad de especies.. El porcentaje de la varianza total explicada por el primer eje del AC y la contribución de las especies y muestras a la varianza (inercia) de cada eje apoya la designación de especies que ocurren en la comunidad como clave y “casual” (Howard y Robinson. explican la mayoría de la variabilidad de datos. En el caso de AC. datos generados de conteos. 1995). Los índices de diversidad son puramente numéricos y no proporcionan información sobre la estructura de la comunidad. 1998. La información sobre la estructura de la comunidad es mejor si se usa un análisis multivariado. si las curvas tienden a llegar a una asíntota. Los índices de similitud (disimilitud) de diversidad para realizar comparaciones pareadas entre diferentes muestras también son usados con frecuencia (Magurran.de especies es estable después de la acumulación de todas las cepas. 1995). por ejemplo. las relaciones multidimensionales entre muestras y especies se reducen a un número reducido de ejes que. De manera general. por ejemplo. De esta manera. basándose en su riqueza o equitatividad o tomando ambas variables y éstos cambian en función de la importancia relativa que se da a la especie dominante. matrices de datos de gran tamaño (llenas de ceros) y datos de distribución no paramétricos. El índice Shannon-Wiener se basa en la riqueza y equitatividad de la diversidad de las especies y se encuentra frecuentemente en la literatura (Dighton. 1995). Bettucci et al. Persiani et al. idealmente. La diversidad de especies de cualquier sistema está compuesta por dos componentes: la riqueza de especies (el número de especies) y la equitatividad o equidad de la frecuencia de especies (Kennedy y Smith. 1994. al igual que en otras técnicas de ordenación. 1988. el análisis multivariado no se lleva a cabo en el total de comunidad debido a la naturaleza “ruidosa” de la frecuencia y a la distribución de especies raras. son métodos de ordenación adecuados para la clase de datos generados de hongos y de otras comunidades. Los resultados se muestran gráficamente y permiten el análisis de tendencias generales de la estructura de la comunidad (Gauch. tales como los métodos de ordenación.

en donde las matrices son construidas con datos de presencia o ausencia de bandas distintivas (de manera ideal para especies diferentes) en los geles y la estructura de la comunidad es analizada posteriormente (Fromin et al. para la preservación a largo plazo de especímenes de resguardo será fundamental validar las entradas de secuencia y bases de datos genómicas. Las colecciones de referencia deberían ser apoyadas por países con una política fuerte en ciencia y tecnología dado que contienen información acerca de la distribución geográfica y de los hospederos. 0. por lo tanto. Ryan y Smith. 2002. como en el caso de la publicación de nuevos nombres (Agerer et al. 1995. 2003). 2004).. Bettucci y Alonso. 2006). Kirsop. 1% ó 5% del número total de aislamientos) y únicamente aquellas especies con una frecuencia de aislamientos igual o superior a este límite son incluidas en el análisis (Gauch. Agradecimientos Al profesor Richard Mibey y a la Dr. En el futuro.plo. 1992. El estatus actual de las colecciones de recursos genéticos de hongos y los retos para apoyar la necesidad de la genómica de hongos. con el objetivo de la preservar las especies ex situ y de suministrar a instituciones de investigación e industrias de este material.. 1996. son normalmente empleados para derivar resultados procedentes de los métodos de huella molecular. Sheila Okoth por sus comentarios y discusiones durante la preparación del capítulo. Hawksworth. al igual que las aplicaciones prácticas y económicas de las especies (Smith y Waller. es necesario que sean recopilados. 1996). Hongos del suelo saprófitos y patógenos de plantas 267 . así como el análisis de conglomerados (cluster).. PRESERVACIÓN Y COLECCIÓN DE RECURSOS GENÉTICOS Los inventarios de biodiversidad proporcionan argumentos y algunas bases científicas para la preservación de hábitats y el uso sustentable de suelos. por lo que proveen material de trabajo básico para quienes estudian las características y la variación. Bettucci et al. 1982. Oros-Sichler et al. 2004a.5%. Los métodos de ordenación de análisis de componentes principales y análisis de correspondencia.. 2002). 1993. Las colecciones de recursos genéticos hoy en día son solicitadas en todo el mundo. la biología molecular y la conservación de hongos han sido revisados recientemente (Hawksworth.

C. R. W. vol. G. pp. Dejardin. D. pp. M. 78–85. G. Canadian Journal of Botany.. 5. Pedobiologia. Cortia. G. y Oberwinkler. Cigelnik. C. Bettucci... pp. Mueller. J. Vikram Reddy. W. Halling. A... S.. vol. vol. S. y Prosser.. Bååth. S. 39. P. FEMS Microbiology Ecology. 769–779. y Cairney. Environmental Microbiology. vol. vol. vol. E. Ascher. J. R. pp. C. D. Weiss. R. 419–428. 41–66. R. Summerbell. Roebroeck. Campbell. F. Begerow. (2006) ‘The simpleseptate basidiomycetes: A synopsis’. Bonants. R.. Environmental Microbiology.. pp. L. vol. (1988) “A critical examination of the soil washing technique with special reference to the effect of the size of the soil particles’. 6. 87–108. y Pietramellar. E.. pp. Baayen. 642-644. Robson. T. Hallenberg. P. soil biodiversity and agroecosystem function in the tropics.. J. I. J... J.. O’Donnell.. Ceccherini. Applied Soil Ecology. Beare. pp. forest’. P. Nannipieri. 1566–1569. Agnelli... the role of decomposer organisms’. D. G. (1995) ‘The effect of wildfire on the opportunistic decomposer fungal community of Uruguayan Eucalyptus spp. (2000) ‘Gene genealogies and AFLP analyses in the Fusarium oxysporum complex identify monophyletic and nonmonophyletic formae speciales causing wilt and rot disease’. R. vol. Sampaio. C. y Handley. I.. L. Greenhalgh. pp. Rambold. M. M. 36. vol. A. Horak. 859–868. Triebel. 891–900. D. 268 Manual de biología de suelos tropicales . G. 66. D. y Watling. pp.. K. pp. 6. Ennos. R. Anderson. Journal of Applied Microbiology. E. Gams. P. Korf. N. Oberwinkler. R. (2003) ‘Potential bias of fungal 18S rDNA and internal transcribed spacer polymerase chain reaction primers for estimating fungal biodiversity in soil’. Tian. 470–480.. R. Anderson. pp.. P. P. Bauer. 36–47.P. R.. P. J. E. Kroon. y Kenerley. F. C. 95. y Alonso. vol.. M.. L. y Srivastava. (2003) ‘Always deposit vouchers’ Mycological Research. Blanz. Soil Biology and Biochemistry.E. soil respiration’... 90. M. Baek. N. (2003) ‘Fungi are the predominant micro-organisms responsible for degradation of soil-buried polyester polyurethane over a range of soil water holding capacities’. G. (1998) ‘Detection and enumeration of a genetically modified fungus in soil environments by quantitative competitive polymerase chain reaction’. 25.. (2004) ‘Distribution of microbial communities in a forest soil profile investigated by microbial biomass. (1997) ‘Agricultural intensification. Phytopathology. Courtecuisse. 5. (2004) ‘Diversity and ecology of soil fungal communities: Increased understanding through the application of molecular techniques’. I. M. Hawksworth.. Barratt. Mycological Progress. 104. J.. C.. G.. J. y Waalwijk. A. C. M.REFERENCIAS Agerer. D. H.. Ammirati.. M. vol. R.

y Hartin. D. 4356–4360. (2001) ‘Removal of herbicides from liquid media by fungi isolated from a contaminated soil’. K. pp994–998.. MN. (2003) ‘On the unreliability of published DNA sequences’. (2000) ‘PCR primers that amplify fungal rRNA genes from environmental samples’. y Guiraud.. ppv147–154. H. P. L. 105–114. Plant Pathology. vol. y Duncan. Elsevier. Plant and Soil. J. Rodriguez. CAB International. I. St Paul.. P. P. S. Cannon. 46. P. 51. B. pp. F. 89–93. M. y Thorn. I. J. (1994) ‘Abundance and diversity of microfungi in leaf litter of a lowland rain forest in Costa Rica’. K. (2002b) Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. J.. M. vol. R. y Roquebert. pp. G. Lees. B. F. 45. Jansson.. FEMS Microbiology Ecology. y Ritz. pp. B. vol. Dupont. F. pp. 281–292. S. Bills. vol. y Clipson. R. Christensen. M. (1980) ‘Induction of suppressiveness to Rhizoctonia solani in soil’. D. C. vol. vol. 30. M.. Chet. G. Edwards. y Panchal. A. 160. J. APS Press. P. L. (1993) ‘Fungal communities of two grazing-land soils in Uruguay’.. (2002) ‘Detection of Colletotrichum coccodes from soil and potato tubers by conventional and quantitative real-time PCR’. Wallingford.. vol. Pedobiologia. pp. Roberts. Applied and Environmental Microbiology. M. Pedobiologia. y Nordbring-Hertz... Toth. (1996) ‘Filamentous fungi’. M. K. y Polishook. Pedobiologia. Powell. New Phytologist. Dackman. Foster (eds) Biodiversity of Fungi: Inventory and Monitoring Methods. in G. A.Bettucci. 37. C. Olsson. in G. (2003) ‘Soil fungal community structure in a temperate upland grassland soil’. 86. 43–48. Bury. (2002a) ‘Adhering to good cultural practice’.. 606–623. D. (2004) ‘Saprobic soil fungi’. diversity and detection’. 44. M.. E. O. y Indarte. J. Semadi. 271–302. Malvarez. Mycologia. y Spooner. vol. Griffith. B. 666–676. 70...W. (1987) ‘Quantification of predatory and endoparasitic nematophagous fungi in soil’. W. I. Bridge. Phytopathology. 187–198. M. Bills y M. R. F. Amsterdam. pp. Crous. P. G. Microbial Ecology. vol. 232.. pp.. (2001) ‘Soil fungi. pp. Lundgren. Mueller. Hall (ed) Methods for the Examination of Organismal Diversity in Soils and Sediments. W. Cullen. S. Steiman. pp. Bettucci. D. 127–145. Journal of Environmental Quality. (2002) “Paraná river delta wetlands soil microfungi’. Bridge.. 13. Mycological Research. M. Kadri. 66.. K. E. F. G. (2000) ‘Food preference of earthworms for soil fungi’. y Baker. P. G. vol. 72–82. Hongos del suelo saprófitos y patógenos de plantas 269 . Brodie. S. 106. vol. vol. F. pp. N. Bills. B. Borneman. pp. pp1378–1379. 418–426. Crous. Bonkowski. J. vol. Spooner. pp. Bordjiba.

W. M. M. in R. 133–151. (2002) ‘Fungal family trees: Finding relationships from molecular data’. 270 Manual de biología de suelos tropicales . vol. (2000) Detection and Isolation of Soil Fungi. Elsas. R. Edel-Hermann. Hamelin. O. (2004) ‘Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils’. S. 53. (2001) ‘Genetic diversity of Fusarium oxysporum populations isolated from different soils in France’. Dhingra. Science Publishers. y Sinclair.. G. N. 2nd edition. K. Plant Pathology. Norris (eds) Methods in Microbiology.. (1985) Basic Plant Pathology Methods. Enfield.. Duarte. C. V. vol. Eching. Tarnawski. (2000) ‘Analysis of the dynamics of fungal communities in soil via fungal-specific PCR of soil DNA followed by denaturing gradient gel electrophoresis’. Gautheron. M. (1990) ‘Methods for studying fungi in soil and forest litter’. 11. Hillb. vol. P. Dighton. (1994) ‘Analysis of micromycete communities in soil: A critique of methods’. Dick. W. Aragno. Down. J. y Rossi. Journal of Microbiological Methods. S. Fromin. Academic Press. vol. Kluwer Academic Publishers. A.. pp. Filion. 61–71. S. St-Arnaud. y Galpoththage. A. L.. J. y Jabaji-Hare. 51–58. M.Davet. G. Recorbet.. 36.. Edel.. Jourdain-Miserez. F.. pp. 796–798. pp.. D.. Keijzer-Wolters. T. y Steinberg. G. (2003) ‘Direct quantification of fungal DNA from soil substrate using real-time PCR’. B. (2002) ‘Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns’. Edena. J. N. Teyssier. Pérez-Piqueres. pp. Dordrecht. Boca Raton. pp67–76.. London. pp. C. (2000) ‘An efficient baiting assay for quantification of Phytophthora cinnamomi in soil’. F. y Boddy. J. 343–404. 16.. G. Frankland. (2007) Compendium of Soil Fungi. 49. Steinberg. 515–522. pp. (2001) Straminipilous Fungi. Mycological Research.Cuvelle.. C. M. Environmental Microbiology. Domsch. 634–643. vol. IHW Verlag. D. CRC Press Inc. FEMS Microbiology Ecology. A. Roesti. F. M.. 22.. M. y Smit. FEMS Microbiology Ecology. E. 397– 404. H. vol.. The Netherlands. vol. y Alabouvette. Grigorova y J. A. Mycologist. R. Gams. vol. Dighton. N. y Anderson. J. K. pp. H. 98. Journal Microbiological Methods. V. 47. vol. Dreumont.. 43. pp. Forestier. D. G.. J. y Rouxel. Gillet.

L. W. Maffia. G. Phytopathology. G. pp. 69. and prognosis’. New York. pp. L.. Lower Nahal Keziv. 183–223. Alfenas. H. Studies in Mycology. 641–655. J. vol. W. (2005) ‘Analyses of soil fungal communities in adjacent natural forest and hoop pine plantation ecosystems of subtropical Australia using molecular approaches based on 18S rRNA genes’. L. significance and conservation’. Hawksworth. R. A. 78. Jr (1982) Multivariate Analysis in Community Ecology. vol. Kluwer Academic Publishers.. Hawksworth. G. C. magnitude. S. R. Samson. C. Frankland. Watling y A. Mycological Research. pp. M.. A. (1991) ‘The fungal dimension of biodiversity. L. Grigorova y J. (2004a) ‘Fungal diversity and its implications for genetic resource collections’. Hawksworth.. I. Nevo. FEMS Microbiology Letters. The Netherlands. Wasser. Dordrecht.. London. pp. D. T. in R. 261–264. Gams. (1993) ‘The tropical fungal biota. Biological Journal of the Linnean Society. y Crous. Whalley (eds) Aspects of Tropical Mycology. D. 4th edition. R. Xu. vol. 3758–3766. prophylaxis.. 247. Cambridge University Press. y Aptroot. y Smalla. A. Costa. Rumjanek. Buchner. pp. Stouthamer (eds) Culture Collections to Improve Quality of Life. C. D. Grishkan. Fagbola. L. Z. Hawksworth. Cambridge University Press. 95. vol. y Rossman. R. pp. D. Cambridge. E. L.Gams. 26–35. Norris (eds) Methods in Microbiology. in R. Hongos del suelo saprófitos y patógenos de plantas 271 . 41. Stalpers. pp. D. van der Mei y A. N.. 310–342. P. 50. A. Hawksworth. western Upper Galilee. (1996) ‘Microbial collections as a tool in biodiversity and biosystematic research’. Israel’. (1997) ‘Where are all the undescribed fungi?’.. 527–539. S. A. Proceedings of the International Congress for Culture Collections. (1998) CBS Course of Mycology. C. vol. H. Academic Press. K. L. 91–100. J. D. W. J. A. in S. Baarn. Isaac. P. (1992) ‘The analysis of communities of saprophytic microfungi with special reference to soil fungi’. New Phytologist. (2001) ‘Evaluation of bioassays to quantify Cylindrocladium inocula soil’. (2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. census. pertinence. Gomes. O. Hawksworth. J. vol. Baarn. vol. S. pp. 9–18. Gray. L. y Hughes. G. in W. N. Gauch. Hoekstra. (2003) ‘Adaptive spatiotemporal distribution of soil microfungi in ‘Evolution Canyon’ II. 22. Mycoscience. pp. 87.. Winterhoff (ed) Fungi in Vegetation Science. 161. y Beharav. 888–891. D. Applied and Environmental Microbiology. J. Y. He. E. A.. A. R. CBS. pp. vol.. vol. pp13–15. (2004b) ‘“Misidentifications” in fungal DNA sequence databanks’. Mendonça-Hagler.. (1990) ‘Methods for studying the microbial ecology of soil’. Gonçalves. CBS.

74–83. vol. H. J. vol. Y. 38... J. Hong Kong. S. L. G. 39. R. pp. (1998) ‘Microbial processes and fungal community structure in soils from clear-cut and unharvested areas of two mixed wood forests’. D. pp293–302. y Stanczyk-Mazanek. Lang. sp. Wallingford. Cambridge University Press. L. 89–95. A. D. C. Kennedy. A. M. vol. Applied and Environmental Microbiology. y Smith. 170. 75–86. 11. 4516–4522. J. 9th edition. vol. (1995) ‘The use of correspondence analysis in studies of successions of soil organisms’. A. C. Applied and Environmental Microbiology. y Stalpers. 51. H. (1995) ‘Soil microbial diversity and the sustainability of agricultural soils’. Kacprzak. vol. David. Li. (1997b) ‘Can we rapidly measure fungal diversity?’. W. Isaac. L. y Forney.. Hyde. T. WFCC. vol. D. 52. A. Frankland. pp. E. A. glycines in soybean roots and soil’. 518–527. Liu.. C. L.. 62.. Pedobiologia.Houston. D. Plant Pathology. B. (2003) ‘Molecular detection of Fusarium solani f. 37–58. pp. 630–640. Plant and Soil. Marsh. Hong Kong University Press. Cambridge. Mycologist. (1997) ‘Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16s rRNA’. 3112 –3120. pp. FEMS Microbiology Ecology. y Clipson. (1996) ‘Nonradioactive method to study genetic profiles of natural bacterial communities by PCR single-strand-conformation polymorphism’. 50. Watling y A. (2001) Dictionary of the Fungi. (2005) ‘Soil bacterial and fungal community structure across a range of unimproved and semi-improved upland grasslands’. (2002) ‘Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil’. W. S. Whalley (eds) Aspects of Tropical Mycology. P. S. G. (2003) ‘Changes in the structure of fungal communities of soil treated with sewage sludge’. Kirk. Hyde. N. pp. K. P. 63. y Hartman. M. L. (1993) ‘Nutrient cycling by fungi in wet tropical forests’. Edwards. K. P.. pp. Canadian Journal of Botany. Lodge. C. E. (ed) (1996) Access to Ex-situ microbial genetic resources within the framework to the convention on Biological Diversity. y Lautenschlager. vol. vol. (ed) (1997a) Biodiversity of Tropical Microfungi. pp. Cannon. S. R. Zo. Microbial Ecology. J. World Federation of Culture Collections. y Jagnow. J.. pp. Cheng. F.. 257–265. y Kim. in S. N. 38. Kennedy. y Robinson. vol. C. P. pp. M. 463–473. Lees. 176–178. K. 76. Howard. K. Kirsop. (1986) ‘Fungi of a forest soil nitrifying at low pH values’. Sullivan. D. Visser. CAB International. vol. pp. y Nicholson. Biology and Fertility of Soils. Plant Pathology. J. vol. pp. A. 272 Manual de biología de suelos tropicales . S. Lee. Cullen. J.

M. K. y Smalla. Waite. J. 68. Muyzer. C.. from soils and plants’. y Klein. (2002) ‘Mechanisms of natural soil suppressiveness to soilborne diseases’. 73 pp. vol. (2004) ‘Effects of transgenic potatoes with an altered starch composition on the diversity of soil and rhizosphere bacteria and fungi’. (1988) Ecological Diversity and its Measurement. (2006) “Fungal diversity in maritime Antarctic soils determined using a combination of culture isolation. D. A. Masago. M. Princeton. O. S. J. 1687–1690. y Uitterlinden. B. D. (1993) ‘Profiling of complex microbial populations by denaturing gradient electrophoresis analysis of polymerase chain reacHongos del suelo saprófitos y patógenos de plantas 273 . Milling. vol. (1970) ‘Detection. pp.. y Siqueira. Kerry. G. 36. 85–92. pp. W. Antonie van Leeuwenhoek. 425–428. R. 67.. 552–561. Lavras. (2004) ‘Assessment and management of soil microbial community structure for disease suppression’. (1977) ‘Selective inhibition of Pythium spp. de Waal. 1846–1853. G. Fukada. Editora UFLA. K. Applied and Environmental Microbiology. E.. pp. vol. pp.Lodge. vol. A. 557–564. G. Yoshikawa. Mazzola. 23–39. vol. G. y Nakanishi. English. X. Princeton University Press. pp. Moreira. vol. (2002) Microbiologia e bioquímica do solo. Mauchline. Phytopathology. L. P. Brazil. Malosso. y Mitchell. E. Annual Review of Plant Pathology. D. Muyzer. Phytopathology. M. A. Smalla. vol. 266. Mazzola. F... R. M. pp.. 60. on a medium for direct isolation of Phytophtora spp.. T. vol. Marks. N.. S. Hopkins. (2001) ‘Comparative single-strand conformation polymorphism (SSCP) and microscopy-based analysis of nitrogen cultivation interactive effects on the fungal community of a semiarid steppe soil’. A. F. Schloter. Magurran. y O´Donnell. isolation and pathogenicity of Phytophthora megasperma from soils and estimation of inoculum levels’. Antonie van Leeuwenhoek. H. 127–141.. molecular fingerprinting and cloning techniques’. L. C. M. FEMS Microbiology Ecology. 681–688 Lowell. A. vol. 29. Biodiversity and Conservation. J. H. I. y Hirsch. vol. 81. (2002) ‘Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating’. C. J. E. 6. G. pp. J (1997) ‘Factors related to diversity of decomposer fungi in tropical forests’. M. Polar Biology. 42. pp. Maidl. 35–59. E. pp. Plant and Soil. y Munch. (1998) ‘Application of denaturing gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology’.

Mycologia. (2001) ‘A combination of baiting and PCR techniques for the detection of Phytophthora quercina and P.. y White. (1975) ‘Ecology and epidemiology of Rhizoctonia solani in field soil’. R. A. y Nazaret... Gomes. P. Jung. Forest Pathology. vol. B. F. pp. S. A. Plant Pathology... Casado. (1994) ‘The foliar fungal endophytes of the Amazonian palm Euterpe oleraceae’. (2006) ‘A new seminested PCR protocol to amplify large 18S rRNA gene fragments for PCR-DGGE analysis of soil fungal communities’. G. J. Applied and Environmental Microbiology. Pettitt. and Bärlocher. vol. D. pp. 871–877. pp. Pfenning. pp. M. Cooke. 274 Manual de biología de suelos tropicales . pp. J. J.. J. 85–97. O. 59.. W. J. (2004) “Taxon-specific fungal primers reveal unexpectedly high diversity during leaf decomposition in a stream’. J. Dow. Neuber. M. vol. 86. in K. Hong Kong. y Kantzer. Nechwatal. J. (1998) ‘Diversity and variability in soil fungi from a disturbed tropical rain forest’. 4479–4487. 720–727. vol. Hyde (ed) Biodiversity of Tropical Microfungi. culture. Wakeham. F. Poly. L. (2001) ‘Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints. O’Donnell. y Smalla. A. pp. vol. D. Oros-Sichler. K. pp. (1997) ‘Soil and rhizosphere microfungi from Brazilian tropical forest ecosystems’. 65–73. 65. Schlenzig. F. Applied and Environmental Microbiology. R. 7. vol. N.. C. pp. pp. Wainwright. y Hawksworth. G. Mouguel. Duncan. G. biological and methodological variability’... 206–214.. Mycologia. vol. D. K.. E. vol.. Ranjard. F. 90. Ayers. 6. L. L. pp. D. 67. vol.tion-amplified genes coding for 16S rRNA’.. Rodrigues. Philosophical Transactions Royal Society London. y Cigelnik. G. 3.. M. R. C. Thioulouse. L. Papavizas. Mycological Progress.. 63–75. y Pineda. L. (2002) ‘Comparison of serological. Hong Kong University Press. Maggi.. Persiani.. (1994) ‘Theoretical and practical aspects of the quantification of biodiversity among microorganisms’. Molecular Phylogenetics and Evolution. M. pp. Adams. A. Nikolcheva. D. 103–116. 376–385.. C. E. H. Lomsden. Phytopathology. 31. Biological Sciences. vol. Journal of Microbiological Methods. citricola in soil samples from oak stands’. K. 341–365. Lata. 51. pp. vol. G. A. y Osswald.. A. F. (1997) ‘Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous’. C. B. 695–700. F. J. T. O´Donnell. W. A. G. 41–49. 345. L. T. and bait methods for detection of Pythium and Phytophthora zoospores in water’. Goodfellow. M. M. M. Lews.

O´Dell. vol. pp. (1999) ‘Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes enconding 18S rRNA and temperature gradient gel electrophoresis’. vol. Schuessler. Ryan. y Thorn. y Larrick. Boone. D. Burpee. J. J. Canhos. European Journal of Soil Science. R. (1992) Methods for Research on Soilborne Phytopathogenic Fungi. pp. R. D.. 57. Paul. MN. W. Smith.. St Paul. vol.. 31. (2004) ‘Decomposition rate of organic substrates in relation to the species diversity of soil saprophytic fungi’. St. 17. S. 53–78. Fitopatologia Brasileira. (1992) ‘Culture collections of microorganisms. D. vol. T. B. Glandorf. S. Schneider. E. M. A. APS Press. APS Press. Paterson.Rodrigues-Guzman. B. y Ogoshi. y Waller. E (2003) ‘Filamentous fungi isolated from estuarine sediments contaminated with industrial discharges’. 1. y Esposito. E. (1995) Biometry: The Principles and Practice of Statistics in Biological Research. A. 1351–1362. R. pp.. their importance in tropical plant pathology’. (2001) ‘A new fungal phylum. y Smith. L. y Silveira. Parkway Publishers. (1984) Suppressive Soils and Plant Disease. F. 12. (1991) Identification of Rhizoctonia Species... (2002) ‘Comparison of baits to quantify inoculum density of Rhizoctonia spp. pp.. G. B. y Rohlf. J. Mycological Research. Mihail. y Millard. 359. Mycological Research. MN. K. 3rd edition. L. Singh.. E. vol.. Freeman. J.. pp. Reid.. Rossman. 105. vol. S. Nature. (2004) ‘Fungal genetic resource centres and the genomic challenge’. 98–107.. A. vol. R.. vol. (1992) ‘Competitive PCR’. y McLean. V. NC. Australasian Plant Pathology. D. 5–12. A. 1413–1421 Selenska. pp. 177–183. W. 345-356. Ord. W. 66. vol.. J. Microbial Releases. pp. Umbuzeiro. Pfenning. M. M. D. E. pp. Alfenas. y Rush. St.. Silva. P. (2001) “Biodiversidad de los hongos fitopatógenos del suelo de Mexico’. H... A. Applied and Environmental Microbiology. J. E. E. M. Singleton. Paul. special issue no 1. Munro. APS Press. A. Y. Smit. New York. pp. in Eucalyptus clonal garden soils’. H. Setälä. 2614–2621. 41–46. W. biochemical and molecular fingerprinting methods’. L. L. F. G. J. 108. 139. Siebert. y Walker C. the Glomeromycota: Phylogeny and evolution’. (2006) ‘Investigating microbial community structure in soils by physiological. P. pp. H. y van Elsas. C. Schwarzott. Maffia. Hongos del suelo saprófitos y patógenos de plantas 275 . Sneh B. Soil and Sediment contamination. P. P. pp. Potts. R. A. vol. D. Sokal. C. (1992) “Direct recovery and molecular analysis of DNA and RNA from soil’. Acta Zoológica Mexicana. 557–558. M. 72–82. Tulloss. Oecologia. L. Sanfuentes. MN. Leeflang. M. y Klingmüller. P. M. (1998) Protocols for an All Taxa Biodiversity Inventory of Fungi in a Costa Rican Conservation Area.

. 2051. 37. pp. Applied Environmental Microbiology. (1996) ‘Isolation of saprophytic basidiomycetes from soil’. 4288–4292. Berry. vol. G. 62. 159–170. vol. H. S. P. 1070–1074. APS Press.. J. B. Bissett.. 295. Journal of Microbiological Methods.. 58. Biodiversity and Conservation. vol. Reddy. (1984) ‘A revision of the genus Trichoderma. vol. pp. 60. Y. I. C. Leyval. Canadian Journal of Botany. E. Viaud. 143– 154. J. Vandenkoornhuyse. y Krsek. vol. D. (2002) ‘Extensive fungal diversity in plant roots’. Canadian Journal of Botany.. 276 Manual de biología de suelos tropicales . Ecology and Pathology. M. 69. P. 62. Whipps. 2357–2372. 295–301. pp. B. Tsai. M. (2005) ‘A PCR-denaturing gradient gel electrophoresis approach to assess Fusarium diversity in asparagus’. J.. II. 2275–2290. (1983) Phytophthora. its Biology. vol. vol. E. (2000) ‘Diversity of soil fungi studied by PCR-RFLP of ITS’. L. C. vol. pp. Vujanovic. Tsao. Current Opinion in Microbiology. MN. Mycological Research. Science. Y. Widden. D. (1996) ‘An appraisal of soil fungal diversity: The crossroads between taxonomic and functional biodiversity’. pp. Canadian Journal of Botany. Manuales para identificación Barnett. p. 4th edition.. y Young. V. y Olson. Infrageneric classification’. vol. Erwin. 309– 317. Wainwright. Baldauf.. J. D. M. pp. M. Applied Environmental Microbiology. McQuilken. St Paul. vol. H. pp. S. (1973) ‘Fungi from Canadian coniferous forest soils’. Section Longibrachiatum sect. 51. y St-Arnaud. Harris. MN. exploiting genomics and stable isotope probing’.. 169–183. Transactions of the British Mycological Society. A. nov. M. E. M. 6. A. S. H. J. 1027–1032. P. S. Yergeau. (2003) ‘Resolving functional diversity in relation to microbial community structure in soil. pp. y Bartnicki-Garcia. A. vol. Wellington. Pasquier. Taxonomy. 924–931. y Brygoo. APS Press. M. Bissett. W. P. Straczek. P. A. 90. Pesticide Science. (1998) Illustrated genera of imperfect fungi. St. y Visser. Filion. (1993) ‘Use of fungal antagonists for biocontrol of damping-off and Sclerotinia disease’. Zak. C. pp. (1992) ‘Rapid method for direct extraction of DNA from soil and sediments’. E. M. (1988) ‘Metabolic diversity of fungi in relation to growth and mineral cycling in soil: A review’. R. Paul. P. 5. y Paul. pp.Thorn. C..’. 104. H. vol. y Hunter. J.. L. y Parkinson. pp. (1991a) ‘A revision of the genus Trichoderma. y Budge.

Hanlin.. C. J. M. Baarn. Additional notes on section Longibrachiatum’. R. T. Australia. A. Lynch. J. APS Press. y Goodman. St Paul. J. vols I and II. M. Blackwell Publishers. 69. S. B. vol. Domsch. y Bullock. Hoekstra. M. M. (2002b) Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. P.. (1976) More Dematiaceous Hyphomycetes.. MN. J. M. David. L. St Paul. R. A. Minor.. J. B. American Phytopathological Society. IHW Verlag. J. S. London. Karling. I. Bissett. M. Waterloo. ‘A revision of the genus Trichoderma... Nag Raj. C. y Stalpers. C. Hanlin. Betterman. (2000) ‘Cloning the soil meHongos del suelo saprófitos y patógenos de plantas 277 . Malden. P. London. pp. Vaduz. S. expanded reprint (Richmond Publ. Pitt. CSIRO. Liechtenstein Kirk. CBS. vol. R. W. Rondon. Canadian Journal of Botany. A. M. L. B. North Ryde. American Phytopathological Society. Gilman. K.. MA. Kew. Osburne. (1971) Dematiaceous Hyphomycetes.Bissett. Leslie. S. R. Kew. (1988) A Laboratory Guide to Common Aspergillus Species and Their Teleomorphs. I. B. CAB International. F. 2373–2417. Ellis. M. St Paul. R. 2nd edition. 69. Handelsman.. II. Australia. A. R. D. E. MN. P. (1996) Phytophthora diseases worldwide. Liles. K. (2007) Compendium of Soil Fungi. H. J. J. London. J. (2000) A Laboratory Guide to Common Penicillium Species. (2001) Dictionary of the Fungi. MacNeil.. Erwin. (1977) Chytridiomycetarum Iconographia. (1998) CBS Course of Mycology. CMI. W. J. T. A. 9th edition. y Anderson. H. Loiacono. P. Ellis. y Aptroot. y Ellis. Grossman.. Canadian Journal of Botany. Summerell. M. 2418–2420. (1991c). D. T. (1985) Microfungi on Land Plants: An Identification Handbook. M. I. Mycologue Publications. vol.. North Ryde. Cramer. Ellis. y Pitt. A. 3rd edition. August. Cannon. Eching. Section Pachybasium’.T. I. P. St Paul MN. MN. Co. S.. III. F.. T. (2006) The Fusarium Laboratory Manual. Hanlin. (1991b) ‘A revision of the genus Trichoderma. O... MN. Clardy. Brady. R. W. The Netherlands. B. Klich. Illustrated genera of Ascomycetes. A. CMI. K. CSIRO. Crous. (1993) Coelomycetous Anamorphs with Appendage-bearing Conidia.. y Ribeiro. APS Press.. Gams. C. (1998a) Illustrated Genera of Ascomycetes.. (1998b) Combined Keys to Illustrated Genera of Ascomycetes. pp. IV.. Tiong. St Paul. 1997). American Phytopathological Society. A. R.. Gams. Croom Helm. T. 1990. J. F. Wallingford. vol. J. 4th edition.

W.tagenome: A strategy for accessing the genetic and functional diversity of uncultured microorganisms’. F. Seymour. ecology and pathology. Kew. J. Hoekstra. Waterhouse.cfm. vol. APS Press.. CMI. B. vol. The Netherlands.ars-gring. C. 6th edition. Sutton. Jr. A. y Filtenborg. (1980) The Coelomycetes. Mycological Papers. P. Sneh. accessed November 2002. pp. Samson. C. Sitios web Johnson. G. L. Tsao. (1983) Phytophthora: Its biology. L. G. T. London. Mycological Papers.edu/people/padgett/book. pp. D. y Padgett. Erwin. MN. Systematic Botany & Mycology Laboratory. E. St Paul. P. C. 122. (1967) ‘A key to Pythium Pringsheim’. M. J. St Paul. E. http://nt. CBS. M. pp. G. 66. vol. Mycological Papers. M. 110.. Chaverri. D. E. S. Burpee. Applied Environmental Microbiology. Farr. R. APS Press. 1–59. taxonomy. (1970) ‘The genus Phytophthora de Bary: Diagnoses or descriptions and figures from the original papers’. (2000) Introduction to Food and Air-borne Fungi. 278 Manual de biología de suelos tropicales . MN. R. A. (undated) ‘Trichoderma Online’. O.gov/ taxadesciptions/keys/Trichodermalndex. 2541–2547.. D. (1991) Identification of Rhizoctonia species. www.. y Bartnicki-Garcia. B....uncw. ARS. Waterhouse. G. Baarn. H. B. Samuels. USDA. Frisvad. y McCray. 1–50. S. (2002) ‘Biology and systematics of Saprolegniaceae’. vol. Waterhouse. (1968) ‘The genus Pythium Pringsheim: Diagnoses or descriptions and figures from the original papers’. y Ogoshi. pp1–15. 109.

s. cubitos 200g dextrosa 20g agar 18g PCA. molida 100g agar 18g penicilina 0. MA2% .5g glucosa 0.Apéndice 8.agar extracto de malta extracto de malta 20g agar 18g SNA – agar sintético pobre en nutrientes KH2PO4 1.2g agar 18g OA – agar harina de avena Copos de avena 30g Agar 15g ADP – agar dextrosa y papa papa.p.0g agar 18g Antibióticos. basados en Gams et al.2g sacarosa 0.1g V8 agar V8 100 Ml CaCO3 2.0g peptona 1.1g Hongos del suelo saprófitos y patógenos de plantas 279 .p.02g estreptomicina 0.1 Medios de cultivo y aditivos: cebos Las recetas son para un litro.1g agar 18g MP5.2g pimaricina 0.0g agar 18g agua destilada 900 ml PARP harina de maíz 17g pimaricina 10mg ampicilina 250mg rifampicilina 10mg pentacloronitrobenceno 100mg himexazol 50mg AHM + p. (1998) y Erwin y Ribeiro (1996).0g penicilina 0.2g pimaricina 0.02g estreptomicina 0.2g pimaricina 0. –agar con harina de maíz harina de maíz 8.agar maltosa peptona maltosa 4.02g estreptomicina 0.0g KNO3 1.s zanahoria. molida 100g agar 18g CA + p.agar papa zanahoria papa 20g zanahoria 20g agar 18g CA – agar zanahoria zanahoria.0g MgSO4 x 7H2O 0. si es necesario penicilina 0.5g KCL 0.

Sustratos queratinosos: cabellos de niños rubios. Dependiendo del tipo de hongo pueden ser utilizados cebos específicos. granos de polen de Pinus. alas de insectos. Los cebos de vegetales pueden ser lavados. epidermis de cebolla. zanahoria o pepino. papa. 280 Manual de biología de suelos tropicales . exoesqueleto de camarones. Sustratos quitinosos: piel de serpiente. papel celofán. los de origen animal son esterilizados usando luz UV por una hora. Sustratos celulósicos: semillas de Sorghum. trozos de manzana. hojas secas de maíz.Cebos El uso de cebos es imprescindible para la recuperación de zoosporas formadas por hongos de sustratos complejos como el suelo.

1988). excepto en la Antártida (White y ElsonHarris.Capítulo 9 Muestreo. al final del abdomen. y su sexo es fácilmente distinguible debido a que las hembras tienen un prominente ovopositor. y a la familia Tephritidae.. Se trata de insectos multivoltinos con un potencial biótico relativamente alto y una gran capacidad para infestar diferentes especies de frutos nativos y exóticos. éstas pertenecen al orden Díptera. Algunos estudios han acentuado aspectos ecológicos y etológicos de las moscas de la fruta. el periodo durante el cual la larva destruye la pulpa de la fruta. Bactrocera. volviéndola 281 . en su mayor parte. Steck y Wharton. 1996). debido al gran impacto económico que causan. las moscas de la fruta son consideradas una de las más preocupantes. 1992). ya que representan plagas primarias para la mayoría de los cultivos frutales. Los daños que producen las moscas de la fruta se dan durante la fase inmadura. preservación e identificación de moscas de la fruta Neliton Marques da Silva INTRODUCCIÓN Entre las plagas de la fruta de América tropical. 1996. enfocados a las fases de pupa y larva (Silva et al. 1972. con una punta larga y delgada. Rhagoletis y Dacus. Las moscas de la fruta muestran un comportamiento y una taxonomía complejos (Bateman. 2000). Las características taxonómicas que permitan distinguir sexos entre pupas y larvas aún no se han determinado (Salles. Su clasificación se basa exclusivamente en los caracteres morfológicos del adulto.. Zucchi et al. Se distinguen cinco géneros importantes de esta plaga: Anastrepha. que se extienden globalmente. Ceratitis.

por ello. hongos y nematodos. ramas o semillas en donde las larvas de la mosca residían previamente. El desarrollo de la pupa ocurre en el suelo. junto con el suelo. los procedimientos para muestrear varían de acuerdo con la fase y el propósito. 200 ml de proteína hidrolizada de maíz (5% en agua preservada con tetraborato de sodio con un pH entre 8. Debido a que el ciclo de vida involucra las partes aéreas de la planta hospedera. normalmente. sobre todo. las larvas se mueven sobre la superficie del suelo buscando condiciones adecuadas para su desarrollo y penetran hasta una profundidad aproximada de 10 cm para entrar en la fase de pupa. el parasitoide adulto puede emerger en el suelo. 282 Manual de biología de suelos tropicales . Esta profundidad varía dependiendo de las condiciones físicas del suelo. removidos. La fase pupal dura de 8 a 10 días. azúcar al 10% o jarabe de caña de azúcar al 10%. puesto que ésta sólo se puede establecer usando frutos infectados. se puede utilizar jugo de fruta al 10%. que es diurna y responde a estímulos visuales y olfativos.inservible para cosecha o consumo.5 y 9). el uso de trampas con cebos alimenticios es lo más recomendable. las larvas migran de la fruta para pupar en el suelo (Ilustración 8a). Después de que la fruta infestada cae. la mosca de la fruta es un habitante temporal del suelo. y constituye una de las fases más vulnerables al estrés abiótico y a muchos enemigos naturales. que también forman parte de la biota del suelo (véase Capítulo 10). dependiendo de la temperatura y de la humedad. Aun cuando las larvas son parasitadas dentro de los frutos. Estos antagonistas juegan un papel importante en el control biológico de las moscas de la fruta. en su mayor parte depredadores y entomopatógenos como bacterias. por lo tanto. esta técnica representa una relación ambigua entre la mosca y su hospedero. la mosca de la fruta se puede considerar un organismo del suelo. pues sólo permanece ahí durante una etapa de su vida. la humedad y la textura. de ahí que. Antes de llegar al estado adulto. Los cebos deberán reemplazarse cada semana y los especímenes capturados. De manera alternativa. MUESTREO DE LA MOSCA DE LA FRUTA El muestreo de adultos de moscas de la fruta se lleva a cabo utilizando trampas McPhail (Ilustración 8b) con atrayente alimenticio. en función de la temperatura. resulta de suma importancia que en el diseño de la estrategia del manejo integrado de plagas se tome en cuenta la biodiversidad del suelo como un factor fundamental que influye en la mortalidad de larvas y pupas. En el caso de la mosca adulta. sin embargo. durante una parte de su ciclo de vida.

mientras que. M. o bien. El número de trampas por unidad de superficie puede variar de acuerdo con los objetivos del proyecto. el contenido de la trampa deberá pasarse por una malla de nylon de 1. esto se puede llevar a cabo en el campo o en el laboratorio. si lo hay. es decir. una trampa cada cuatro hectáreas resulta suficiente. COLECCIONANDO LOS ADULTOS CAPTURADOS Debido a la probabilidad de que distintos grupos taxonómicos de insectos sean capturados. Se anota el sexo y se colocan en frascos de vidrio (de alrededor de 50 ml) etiquetados. En el caso de plantas herbáceas. Por ejemplo: Manaus-AM Brasil 04° 05`S. preservación e identificación de moscas de la fruta 283 . Cuando los cebos son reemplazados. la densidad deberá ser de tres a cinco trampas por hectárea o estar de acuerdo con el tipo de uso de suelo existente en el predio. hasta tres por hectárea son las recomendadas para plantaciones herbáceas.5 mm para remover las moscas y separarlas de otros grupos taxonómicos utilizando unas pinzas curvas. con alcohol al 70% para su identificación posterior.Las trampas se instalan en el centro del dosel de los árboles y su localización será tomada con GPS. Muestreo. la trampa puede utilizar como soporte tres palitos. cada tipo de uso de suelo existente debe ser monitoreado con la misma densidad de trampas. Cuando el objetivo es el manejo integrado. Las trampas deberán ser colocadas de manera equidistante. Si el objetivo es monitorear plagas. Hasta cinco trampas por hectárea pueden ser instaladas en áreas con arbustos o árboles (jardines caseros). La etiqueta deberá incluir la información básica de muestreo y el número de la trampa. 60° 04´W 23/Marzo/2006 Silva. N. Trampa No 5 • • • • • También deberá ser registrada la identidad de individuos de otros grupos taxonómicos capturados en las trampas. dispuestos en forma de trípode. primero será necesario separar las moscas de la fruta de otros especimenes. colocarse sobre un árbol adyacente.

Posteriormente. se recogen frutos al azar en diferentes agroecosistemas y en diferente estado de de maduración. con sus respectivas etiquetas de identificación. Finalmente. las charolas se cubren con una tela de gasa y se aseguran con ligas de plástico para prevenir que se escapen las moscas adultas al emerger. Estas jaulas deberán ser examinadas diariamente. Las fechas de emergencia. se pesan.MUESTREO DE LA FRUTA Para poder establecer la relación entre las especies Anastrepha con sus plantas hospederas. el aculeo de la hembra bajo un microscopio estereoscó284 Manual de biología de suelos tropicales . de 1. Los adultos emergidos serán retenidos. Los frutos muestreados se separan por especie. Los frutos deberán ser colectados directamente de los árboles o inmediatamente después de caer al suelo. se protegen con bolsas de tela y se transportan en cajas térmicas hasta el laboratorio. para permitir la salida de las moscas adultas y/o parasitoides. los especimenes recuperados son fijados en una solución de alcohol al 70%. para separar las pupas que posteriormente serán colocadas en jaulas.5 mm. se cuentan y se separan para cada sitio de muestreo. durante 48 horas para permitir el endurecimiento cuticular y la pigmentación completa de los patrones alares (Ilustración 8c): características de gran importancia para la identificación taxonómica. Después de emergidas. Finalmente. las moscas adultas son alimentadas con una solución de miel disuelta en agua al 10% que será cambiada cada día. La determinación de la relación de sexos hembra-macho (SR) para moscas adultas y parasitoides se hace de acuerdo con Silveira-Neto (1976) en función de la siguiente ecuación: Número de hembras SR= Número de hembras + Número de machos IDENTIFICACIÓN DE ESPECIES La identificación taxonómica de especies de Tephritidae se basa en un examen ventral de la región apical. OBTENCIÓN DE LAS PUPAS La vermiculita o arena fina deberá pasarse por una malla galvanizada. el número y el sexo deberán quedar registrados con relación a las moscas o parasitoides. se depositan en charolas de plástico con una capa de vermiculita o arena fina como substrato de pupación.

(1934) “Moscas-de-frutas do gênero Anastrepha Schiner. L. C. robusta and schausi species groups of Anastrepha Schiner (Diptera: Tephritidae)’. Brazil. como las de Lima (1934). Foote. Departamento de Zoologia. N. como lo describe Zucchi (1988). Steyskal (1977). (2000) ‘Biologia e ciclo de vida de Anastrepha fraterculus (Wied. Memórias do Instituto Oswaldo Cruz (Rio de Janeiro). comparando el patrón alar. Pennsylvania. PhD Thesis. University of São Paulo. mesonoto. A. Ronchi-Teles (2002). L. Ribeirão Preto. São Paulo. A. PhD Thesis. The Pennsylvania State University. São Paulo. R. no. pp. pp. Muestreo. (1972) ’The ecology of fruit flies’. 17. (1985) ‘Phylogenetic analysis and taxonomy of the cryptostrepha. utilizando un microscopio de transmisión (100X). Silva (1993). Vanzolini (ed) A Catalogue of the Diptera of the Americas South of the United States. Zucchi (1978 y 2000) y Norrbom (1985). Malavasi and R. 28. Annual Review Entomology.)’. Lima. daciformis. En primer lugar. in M. Silva. Manaus. A. (1993) “Levantamento e análise faunística de moscas-das-frutas (Diptera: Tephritidae) em quatro locais do Estado do Amazonas’. Zucchi (eds) Moscas-das-frutas de importância econômica no Brasil: Conhecimento básico e aplicado. M. Brazil. especialmente. Foote (1967). 4. tergito medio. M. REFERENCIAS Bateman. in A. A. Holos. vol. coloración de cuerpo. Stone (1942). A. 493–518. Secretaria da Agricultura. PhD thesis. Salles. B. Ronchi-Teles. La identificación de especies del género Anastrepha se logra para las hembras adultas. o que éstas sean incorporadas a la colección institucional del laboratorio. (1967) ‘Family Tephritidae’. Federal University of the Amazon (UFAM) and National Institute for Agricultural Research (INPA). Escola Superior de Agricultura “Luiz de Queiroz”. preservación e identificación de moscas de la fruta 285 .pico (40X) o mediante el montaje sobre laminillas para examinar estas estructuras. vol. 487–575. 1868 (Diptera: Trypetidae)’. es necesario extraer completamente el aculeo de la funda del ovipositor con ayuda de agujas o pinzas (Ilustración 8d). Norrbom. H. las características morfológicas del aculeo (Ilustración 8e) con especímenes de museo o usando claves taxonómicas. Es recomendable que se depositen ejemplares de referencia en colecciones de museo. (2002) “Ocorrência e flutuação populacional de espécies de moscasdas-frutas eparasitóides com ênfase para o Gênero Anastrepha (Diptera: Tephritidae) na Amazônia Brasileira’. abdomen y.

Malavasi and R. (1992) Fruit Flies of Economic Significance: Their Identifications and Bionomics. R. y Silveira Neto. Annals of the Entomological Society of America. vol. S. grandis (Diptera: Tephritidae)’. y Elson-Harris. (1996) ‘The natural hosts plants of Anastrepha (Diptera: Tephritidae) in the State of Amazonas. N. Escola Superior de Agricultura ‘Luiz de Queiroz’. G. Silva. Zucchi. 1–112. D. Campinas. J. United States Department of Agriculture Miscellaneous Publications.. M. (1988) “Moscas-das-frutas (Dip. Brazil’. (1988) ‘Description of immature stages of Anastrepha interrupta. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. vol. C. M. Ceres. Stone. Barbin. A. in A. S. distribuição geográfica e hospedeiros”. 81. J. (1996) ‘Anastrepha species (Diptera: Tephritidae) from the Brazilian Amazon: Distribution.. de Souza (ed) Moscas-das-frutas no Brasil. A. Steck. Holos Zucchi. 6. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management.. R. S. (eds) (1976) Manual de Ecologia dos Insetos. A.Silva. Steck and B. and Silveira Neto. A. Nakano. Entomological Society of Washington. M. A. Fundação Cargill. and A. CRC Press. São Paulo. São Paulo. J. pp. y Nova. no. N. R. V. Boca Raton. A. I. Zucchi. (1942) ‘The fruit flies of the genus Anastrepha’. Zucchi. A. (1977) Pictorial Key to Species of the Genus Anastrepha (Diptera: Tephritidae). N. Ribeirão Preto. Washington DC. CAB International. Zucchi. R. y Wharton.. (2000) ‘Taxonomia’. O. in H. M. A. Boca Raton. A. R. Tephritidae) no Brasil: taxonomia. White. M. R. hosts and lectotype designations’. in G. Zucchi (eds) Moscas-dasfrutas de importância econômica no Brasil: Conhecimento básico e aplicado. CRC Press.. pp. A. 994–1003. University of São Paulo. Steyskal. Silveira Neto. PhD Thesis. L. Steck and B. limae. A. in G. Wallingford. M. 439. (1978) “Taxonomia das espécies de Anastrepha Schiner 1868 (Diptera: Tephritidae) assinaladas no Brasil’. 286 Manual de biología de suelos tropicales . A.

El control microbiano es una forma de control biológico cuyo principio es el uso racional de entomopatógenos sin que necesariamente se eliminen las poblaciones de plagas. sin intervención humana. La patología de insectos es la ciencia que estudia las enfermedades de insectos. o bien. para resistir la enfermedad. De éstas. Los principales microorganismos utilizados. 1992). frecuentemente hospedante-específico. Si se asume que cada especie de insectos es susceptible a por lo menos un microorganismo patogénico. Las enfermedades son procesos dinámicos en donde el patógeno (microorganismo) y el hospedante (insecto) están adaptados morfológica y fisiológicamente. pero sí manteniéndolas en niveles por debajo del umbral de daño económico.Capítulo 10 Hongos y nematodos entomopatógenos Alcides Moino. aproximadamente. y que han demostrado su 287 . el primero para llevar a cabo el proceso de infección y el segundo. el 10% pueden considerarse plagas agrícolas forestales o urbanas. aunque la cifra verdadera de diversidad puede ser mucho mayor (Groombridge. Jr y Ricardo Sousa Cavalcanti INTRODUCCIÓN Existe alrededor de medio millón de especies de insectos descritas en la tierra. con el fin de utilizarlas como mecanismos de control de especies que son plaga. Esto es similar a la dinámica natural que sucede en el campo entre el patógeno y su hospedante. ello da la idea de la potencial importancia del estudio de estos patógenos de insectos en el contexto de control de plagas y de biodiversidad. prevenir su ocurrencia en insectos benéficos.

Un pequeño número de especies generalistas con capacidad para ser cultivadas y producidas de manera masiva.. los nematodos y los protozoarios. 1995). penetrando directamente la cutícula o a través de las aperturas naturales como los espiráculos. a pesar de ello. 1997. los basados en toxinas). Los estadios juveniles parasitan a sus hospedantes. causar la muerte rápida del hospedante y provocar grandes niveles de mortandad en las poblaciones de éste) y causar epizoóticas periódicas (Chandler et al.5 mm de largo. Se conocen cientos de especies de hongos entomopatógenos que atacan una amplia gama de insectos y ácaros. y convirtiéndose posteriormente en adultos. 1995): los organismos producen fases infectivas que son liberadas al ambiente cuando muere el hospedante 288 Manual de biología de suelos tropicales . las bacterias que se introducen junto con el parásito se multiplican rápidamente y matan al hospedante. 1994. debido a su alto costo. invadiendo su cuerpo y matándolo de cuatro a diez días posteriores a la infección. Después de una a dos semanas posteriores a la invasión del hospedante. ambos presentan desventajas debido a su alto costo. 1993). se han utilizado como biopesticidas para su uso contra poblaciones de plagas. la Sterneinematidae y la Heterorhabditidae que son parásitos obligados de insectos y que son la base de varios plaguicidas biológicos diseñados específicamente para su uso en contra de plagas del suelo como los gorgojos y las larvas de mosca. La mayoría de los patógenos poseen una estrategia de transmisión de “sentar y esperar” (sensu Ewald. baja persistencia e inactividad a bajas temperaturas (en el caso de los nematodos).potencial en el control microbiano de insectos son: los hongos. 2006). aunque esta tecnología no se ha adoptado por completo en la práctica. Myers y Rothaman. Una vez muertos los insectos. se producen miles de nuevas esporas que se dispersan y continúan su ciclo de vida en nuevos hospedantes. Roy et al. las bacterias. éstos aparentemente son componentes diversos y universales de las biotas del suelo. pobre persistencia (especialmente bajo condiciones tropicales) y su baja eficacia cuando se compara con los insecticidas químicos (por ejemplo.. Leger. como es el caso de Lecanicillium logisporum. A pesar del éxito limitado de hongos y nematodos entomopatógenos como productos biocidas. aparece una nueva generación de estadios infectivos (Kaya y Gaugler. Existen dos familias. con varios grados de especificidad con su hospedante (Hajek y St. Los hongos producen esporas que germinan al contacto con el hospedante. los virus. permitiendo que los nematodos crezcan y maduren sobre el tejido en descomposición. Los nematodos entomopatógenos miden alrededor de 0. en donde pueden ser excepcionalmente virulentos (o decir.

Estas estructuras vegetativas son llamadas hifas. que constan de células alargadas provistas de una pared que contiene celulosa y quitina. H ongos y nematodos entomopatógenos 289 . Aschersonia aleyrodis. Cordyceps spp. Neozygites). Entomophaga. Aunque los artrópodos que viven por encima del suelo. además de otros carbohidratos y proteínas. sugiriendo de nuevo que los patógenos se distribuyen ampliamente en el suelo.. Las fases de diapausa y latencia reducen la dependencia en la movilidad de su hospedante y pueden complementarse con la capacidad para vivir saprotróficamente en suelo. Lecanicillium lecanii. son susceptibles a hongos y nematodos. Esta capacidad es una adaptación a sus hospedantes artrópodos que son más grandes y con patrones de distribución en parches. flavoviride. Los hongos de mayor interés por su potencial como patógenos de insectos son: Beauveria bassiana. el reservorio de las fases infectivas. Con frecuencia no hay correlación entre la densidad del hospedante y la ocurrencia de la enfermedad. En el caso de los hongos entomopatógenos esto se apoya en evidencia molecular que muestra que poblaciones en suelo no son totalmente clonales. Los hongos poseen una gran variabilidad genética y un amplio rango de hospedantes. BIOLOGÍA DE HONGOS Y NEMATODOS ENTOMOPATÓGENOS Hongos Los hongos son microorganismos unicelulares (levaduras) o multicelulares (especies filamentosas). M. debido a que ofrece un microambiente estable con una estructura de poros favorable para nematodos y recursos orgánicos para hongos.y tienen la capacidad de entrar en un estado de letargo o diapausa y permanecer latentes hasta que haya nuevos hospedantes disponibles. sin duda. se producen asexualmente estructuras reproductivas conocidas como esporas o conidias que ayudan a la diseminación del patógeno. Después de la infección exitosa de un hospedante. Hirsutella thompsonii. lo que les permite mayor distribución geográfica de la población y alta movilidad. Entomophthora. el suelo es. Nomuraea rileyi. y hongos del orden Entomophthorales (Zoophthora. ello a pesar de la ausencia de fases sexuales manifiestas y que el significativo flujo de genes ocurre localmente (Bidochka et al. como los que habitan debajo de éste. 2001). aunque su eficiencia competitiva en comparación con otros saprótrofos de vida libre puede ser baja... Paecilomyces spp. Metarhizium anisopliae.

De igual manera. también pueden obtenerse resultados semejantes y se requerirá de medidas adicionales para identificar patógenos con potencial. en el caso de los hongos. METODOLOGÍA PARA EL AISLAMIENTO DE HONGOS ENTOMOPATÓGENOS (Chase et al. cuando el objetivo del muestreo es evaluar la biodiversidad (por ejemplo. en el suelo).. se basa en caracteres morfológicos del organismo en cultivo y en la estructura de los conidióforos y conidias. Los principales grupos de nematodos de interés pertenecen al orden Rhabditida. 1998A) Las muestras de suelo se colectan a una profundidad de 0 a 20 cm y se colocan en bolsas de plástico debidamente etiquetadas. Los nematodos transportan internamente bacterias específicas que son liberadas en el interior del cuerpo del insecto después de que el nematodo penetra a través de aberturas naturales como boca. parasitismo obligado y parasitismo facultativo.. para lograr una buena identificación es necesario aislar el microorganismo en cultivos puros o al menos. Por lo general. es muy común encontrar también hongos. A continuación se describen dos técnicas básicas para el aislamiento de hongos y nematodos entomopatógenos a partir de muestras del suelo. En cada sitio de muestreo. La identificación correcta de un agente entomopatógeno. Alves et al. cuando un insecto muerto es recogido para el cultivo de inóculo infectivo.. espiráculos y ano. en el caso de los nematodos. La población microbiana en cualquier ambiente natural es muy grande y por lo tanto.Nematodos Los nematodos entomopatógenos son organismos pseudocelomados vermiformes muy similares a los que parasitan plantas y que pueden asociarse con los insectos de tres formas: forecia (adherencia pasiva y transporte). 290 Manual de biología de suelos tropicales . bacterias y otros microorganismos saprotróficos que no tienen potencial como agentes específicos para el control de plagas. 1986. 1993. Estas bacterias se multiplican dentro del insecto y lo matan al causarle septicemia (infección generalizada). Liud et al. Sin embargo. los nematodos entomopatógenos presentan una estrecha asociación (simbiosis) con bacterias específicas. y dentro de éste a las familias Steinernematidae y Heterorhabditidae. las cuales son los agentes primarios que inician la infección en el hospedante. la identificación se fundamenta en medidas hechas a partir de estructuras presentes en los estadios juveniles infectivos. aislar poblaciones.

) puede llevarse a cabo usando un microscopio compuesto y claves de identificación basadas en caracteres morfológicos de las estructuras reproductivas. A partir de estas alícuotas se preparan diluciones 10-1 sucesivamente.1). la identificación de los cultivos de interés (principalmente Metarhizium anisopliae.1 ml de la última dilución y se colocan sobre la superficie del medio de cultivo contenido en una caja Petri. Estas muestras pueden tomarse mediante el método de extracción de núcleos (véase Capítulo 4: Mesofauna). aunque puede prescindirse de él. el volumen añadido se reparte sobre la superficie utilizando una asa de Drigalski (ya sea de acero inoxidable o vidrio). Beauveria bassiana y Paecilomyces spp. 200 g infusión de papa (preparada a partir de papas rebanadas y hervidas para extraer el almidón). 1998). 550 mg de dodina (N-dodecilguanidina acetato). se añade agua destilada hasta alcanzar el volumen original de 1 litro y posteriormente se añaden 20 g de agar. H ongos y nematodos entomopatógenos 291 . con la subsecuente purificación de los cultivos (Figura 10. El fungicida dodina se añade en pequeñas concentraciones (cerca de 10 mg ml-¹) al medio selectivo con el fin de aislar hongos entomopatógenos a partir del suelo y preservar los aislamientos menos susceptibles al fungicida.se toma una muestra compuesta a partir de seis submuestras tomadas en puntos localizados alrededor de un monolito central (véase Capítulo 2). El medio selectivo de dodina se prepara de la siguiente manera: 20 g de harina de avena + 1 litro de agua destilada. conidias y fiálides (Alves et al.. El medio ADP se prepara de la siguiente manera: 15 g de agar. 20 g de dextrosa..0 mg de tetraciclina y 10 mg de cristal violeta. Después de este paso se toman 0. y agua destilada hasta completar el volumen total de un litro.1ml y se colocan en medio de cultivo selectivo (el cual contiene el fungicida dodina) y en medio ADP (Agar-Dextrosa-Papa). 5. utilizando agua destilada esterilizada hasta alcanzar una dilución 10-4. En el laboratorio se debe mezclar muy bien la muestra compuesta y tomarse alícuotas de 1g de suelo. 1998b. El crecimiento de los hongos y su esporulación se evalúan de 7 a 15 días posteriores a la inoculación. se esteriliza durante 20 minutos a 120°C y se filtra. De las diluciones 10-3 y 10-4 se toman 0. Después de la incubación. Samson et al. Esto suele ser efectivo especialmente con Metarhizium anisopliae. Las cajas se incuban a 27°C (Figura 10.2) y almacenaje de conidios en condiciones de congelación utilizando tubos Eppendorf para tal fin. tales como conidióforos.

Figura 10. d) almacenaje de conidios en tubos Eppendorf. creciendo en medio ADP. Nota: la separación de contaminantes se logra recogiendo una pequeña porción de cualquiera de las colonias del hongo de interés con una aguja. b) inoculación de la suspensión (alícuota de 0. y transfiriéndola a una caja Petri nueva con medio de cultivo ADP (tres puntos de inoculación por caja).1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) dilución seriada de la suspensión acuosa que contiene al hongo.1 ml) en una caja petri con medio de cultivo. bajo condiciones de congelación.2 Cultivos purificados de Beauveria bassiana.Figura 10. c) incubación bajo condiciones controladas en una cámara DBO. 292 Manual de biología de suelos tropicales .

la suspensión se lava adicionando una solución de formaldehído (1%) o solución de Ringer para obtener una concentración final de 10. FeSO4.3) para colectar los estadios juveniles infectivos a partir de los cuerpos muertos. CaCl2 0. si se encuentran estados infectivos en el líquido. La mortandad de las larvas se evalúa después de cinco a siete días. pH 6. Los nematodos se almacenan en envases cerrados de 50 ml a 11°C o cercano a esa temperatura. Las larvas de este lepidóptero son conocidas como mealworms (o gusanos de la harina).7H2O 0.6mM. 1998b.3mM. Posteriormente. utilizando la técnica de trampas de insectos con cinco larvas de Galleria mellonela (L. 1μM colesterol) a la que se le añaden 26 ml de una solución nutritiva fresca que contiene citrato de K 0. Las larvas muertas se colocan en una trampa White (Chen et al. Na EDTA 0.) (Lepidoptera: Pyralidae). Los ejemplares de nuevas especies pueden someterse a un análisis molecular para así comparar los patrones de DNA. Adams y Nguyen. que contienen las muestras de suelo y se mantienen cerradas a 23°C en oscuridad. 2004. La identificación se lleva a cabo con base en las claves específicas de identificación para cada familia de nematodos (Steinernematidae y Heterorhabditidae) (Alves et al. el cual cae hasta tocar el líquido en el borde de la caja inferior. La detección de nematodos se lleva a cabo mediante bioensayos.7H2O 0.0. Después de dos días. Figura 10..1M NaCl.4M. 0.METODOLOGÍA PARA EL AISLAMIENTO DE NEMATODOS ENTOMOPATÓGENOS (Bedding y Arkhurst. ZnSO4. éstos deben colectarse y colocarse en agua destilada dentro de un frasco Becker. CuSO4 0 1μM. Las larvas se colocan en cajas de plástico de 500 ml. 1974) Se recogen las muestras de la misma forma que fue descrita anteriormente.05M KH2PO4. y pueden adquirirse comercialmente. Las larvas de insectos infectadas se colocan en el centro del papel filtro.. MgSO4 0.4M. Una trampa de White se puede construir utilizando dos cajas Petri: una caja de 5 cm de diámetro se coloca invertida dentro de una caja de 9 cm que contiene agua esterilizada o medio “S” esterilizado y cubierta con un círculo de papel filtro de 9 cm.3M. El medio “S” consiste en un litro de solución madre (0. H ongos y nematodos entomopatógenos 293 . 2002).000 estados infectivos ml-¹.1mM. La suspensión se deja reposar para permitir que los nematodos queden en el fondo.

(1974) ‘A simple technique for the detection of insect parasitic nematodes in soil’. J. N. in S. R. pp. (1998b) “Chaves para identificação de patógenos de insetos”. (2002) ‘Taxonomy and Systematics’. Alves (ed) Controle Microbiano de Insetos. Gaugler (ed) Entomopathogenic Nematology. M. R. J. S.. A. A. T. Alves (ed) Controle Microbiano de Insetos. B. 109–110. M.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). y Akhurst. Kamp. Deckoning. Bidochka. Ferraz. S. y Castello Branco Jr. y Alves. (1998a) “Técnicas de laboratório”. L. Piracicaba Brazil. A. FEALQ. Fotos: R. L. J. Alves.. C. M. J. d) emergencia de juveniles infectivos en la trampa White. Almeida. E. B. Gaugler. Alves.. REFERENCIAS Adams.. B. B. Bedding. Nematologica. B. J. Piracicaba Brazil. 21.Figura 10. y De Croos. (2001) ‘Habitat association in two genetic groups of the insect-pathogenic fungus Metarhi294 Manual de biología de suelos tropicales . vol. A. A. Moino Junior. in S. Wallingford. M. J. B.. A. FEALQ. C. F. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. y Nguyen. 2nd edition. in R. c) larvas que muestran la patología típica de infección por nematodos. CAB International. K. B. Lavender.. 2nd edition.

Roy. H. 67. (1994) ‘Interactions between fungal pathogens and insect hosts’. pp. X. pp. B. 285–292. New York. 331–357. P. Chen. D. World Conservation Monitoring Centre. Leger. 51. (1993) ‘Entomopathogenic nematodes’.. A. Milner. A. Journal of Parasitology. E. 194–198. W. D.. Hajek... Journal of Invertebrate Pathology. R. y Ferguson. pp. J.. Springer-Verlag. London. A. S. pp. Groombridge. 81. R. vol. K. C. F. y Rothaman. H ongos y nematodos entomopatógenos 295 . H. Ewald. (1986) ‘Selective isolation of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium’. vol. 133-141. P. Osborne. vol. 1335–1342. 69. 10. Hay. D. (1988) Atlas for Entomopathogenic Fungi. (2006) ‘Bizarre interactions and endgames: Entomopathogenic fungi and their arthropod hosts’. J. pp. Eilenberg. (1995) ‘Virulence and transmission of infectious diseases in humans and insects: Evolutionary and demographic patterns’. S. H. Samson. Kaya. 659–669. G. y Latgé.P. R. y Read. Chen. Y. vol. 248–251. vol. y St. Chapman and Hall. K. vol. Applied Soil Ecology. y Lutton. 181–206. y Gaugler. Liu. Steinkraus. Evans. Y. A. Chase. J. C. L. (1995) ‘The evolution of virulence: A unifying link between parasitology and ecology’.. Trends in Ecology and Evolution. E. J. from soil’. Annual Review of Entomology. Z. Meyers.. y Pell. R. D. E.. 62. pp. vol. (2004) Nematology. Hajek. Annual Review of Entomology. A. 5. C. L. pp. pp. E. Florida Entomologist. vol.zium anisopilae: Uncovering cryptic species’. 293–322.. J. G. Applied and Environmental Microbiology. McRae. R. Chandler. CAB International. (1997) ‘Sampling and occurrence of enomopathogenic fungi and nematodes in UK soils’. Advances and Perspectives. vol. pp. V. J. M. 39. Annual Review of Entomology. (ed) (1992) Global Biodiversity: Status of the Earth’s Living Resources. W. 38. y Dickson. (1993) ‘The use of Dodine in selective media for the isolation of Metarhizium spp. Wallingford. H. Z.

.

los dominios de los valores de los atributos se especifican. en los puntos de muestreo. La clasificación de uso de suelo se facilita por una estructura jerárquica donde se ordenan los atributos. dependiendo de los datos disponibles. Solamente en algunos casos. Jeroen Huising RESUMEN DE LA METODOLOGÍA PARA LA DESCRIPCIÓN DE USO DE SUELO Este capítulo muestra una lista estructurada de atributos de uso de suelo que sirve como guía para la observación de características de uso de suelo en el campo. Cuántas clases de uso de suelo pueden ser definidas con respecto a la intensidad de usos de suelo se ilustra a continuación. cuando se precise un alto nivel de detalle. pero las clases finales de uso de suelo dependerán de la selección de dichos atributos a considerar para la clasificación. Este método ofrece varios niveles de detalle que describen las características.Capítulo 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo E. se necesitarán mediciones reales. 297 . Esto se lleva a cabo mediante la observación directa. lo cual requiere solamente el valor adecuado por evaluar en el campo. entrevistas o preguntas. En la mayoría de los casos. en función del propósito y del contexto de la clasificación misma.

se considera uno de los factores determinantes de la abundancia y riqueza de poblaciones de organismos del suelo. pero dependen de los clasificadores o atributos seleccionados para la asignación de la clase de usos de suelo a cualquier observación particular. Este capítulo presenta una estructura que provee el registro sistemático de las características de uso de suelo. y al mismo tiempo. En lugar de utilizar clases predefinidas de uso de suelo. Los procesos dominantes que determinan la presencia e incidencia de la biota del suelo y la escala espacial donde éstos se manifiestan no se conocen completamente.. de modo que se puedan reflejar las diferencias en la intensidad de uso de suelo. a través de puntos de referencia de los países tropicales involucrados.ANTECEDENTES Y PRINCIPIOS DE DISEÑO Propósito de la clasificación del uso de suelo y de su cobertura vegetal El uso de suelo. en cuanto al uso de varios recursos como fotos aéreas o imágenes satelitales para el propósito de la clasificación. la historia de uso de suelo y las prácticas de manejo de los mismos. el enfoque que se describe a continuación se aleja de la idea de que las clases de uso de suelo sean definidas de acuerdo con la identificación de las características relevantes de uso de suelo (atributos) que permiten una 298 Manual de biología de suelos tropicales . Para comprobar esta hipótesis. de manera que se puedan definir las clases de uso de suelo. basadas en un común denominador en todas las áreas bajo estudio. lo que facilita el análisis de los factores determinantes actuales y una clasificación a posteriori. proporciona una estructura para la clasificación de usos de suelo. Lo último. y en particular la intensidad de su uso. se requiere de un sistema que permita el registro de las características de uso de suelo en las parcelas de muestreo y su clasificación posterior. 1975). Las clases de uso de suelo predefinidas no son necesariamente aplicables o relevantes para todas las áreas involucradas porque será muy difícil definir un grupo estándar de clases de usos de suelo. razón por la cual fue adoptado un sistema regular en cuadrícula para muestrear la biodiversidad del suelo con un inventario detallado de su uso y cobertura en los lugares de muestreo. dada la variación en los cultivos y sus posibles combinaciones. Dicha estructura necesita ser flexible. La idea general es que el contenido de un estudio depende de la naturaleza de la región (Vink. implica que las clases de uso de suelo no están definidas a priori. 2005). especialmente en las regiones tropicales. y es por lo tanto. la hipótesis central del proyecto CSM-BGBD (Giller et al.

. para el propósito actual. La descripción detallada de uso y la cobertura de suelo deberán formar parte del inventario. forma del paisaje. etc. Un segundo objetivo para los inventarios de uso de suelo es proveer información básica para definir los usos de suelo alternativos y las prácticas de manejo que mejoran la sustentabilidad de la producción agrícola y conservan la biodiversidad del suelo.discriminación entre clases de usos de suelo. sistemas acuáticos y principalmente áreas sin vegetación. El método que se presenta pretende ser de utilidad para la descripción de uso de suelo a nivel parcela. Asimismo. 1975). Lo anterior. El sistema de clasificación de uso y cobertura del suelo ayuda a la armonización de los procedimientos para la recolección de datos y al manejo de los mismos. áreas cultivadas y manejadas) mientras que el marco del LCCS incluye sistemas terrestres vegetales (semi) naturales. especialmente en su intensidad. que desarrollaron el Sistema de Clasificación de Cobertura de Suelo (LCCS) por Di Gregorio y Jansen (2000). No obstante. El objetivo del inventario para proveer datos que permitan evaluar cambios en la biodiversidad del suelo en relación con el uso del suelo. ej. sin incluir elementos relacionados con el manejo de ganaD escripción y clasificación de uso de suelo en puntos de muestreo 299 . los métodos descritos en este capítulo se aplican únicamente en paisajes agrícolas terrestres (p. Para la clasificación y descripción de las áreas de vegetación (semi) natural se puede seguir el LCCS. aunque contiene elementos añadidos relacionados con el manejo de suelo y cultivos. los fenómenos relacionados con la forma en que se está utilizando el suelo (p. el manejo de los cultivos y del suelo) son de particular importancia porque impactarán notablemente sobre la distribución de los organismos del suelo. como clima. Las clases de usos de suelo obtenidas de esta manera pueden ser utilizadas para la extrapolación de los resultados más allá de los lugares de estudio. ej. El enfoque del inventario de uso de suelo aquí descrito se apoya principalmente en ese sistema de clasificación. La estructura de las descripciones del uso de suelo actual no ha sido hecha para registrar el uso de suelo histórico. Los objetivos mencionados arriba fueron también citados en el programa Africover. generalmente se traduce en el registro de la ocurrencia de cultivos. El método no incluye una estructura para la descripción de los atributos ambientales. es diferente al monitoreo usado con frecuencia que incluye en la descripción de uso de suelo y el estudio de las condiciones naturales y socioeconómicas del suelo como un primer objetivo (Vink. aunque atributos relacionados con la historia del uso de suelo o condiciones ambientales podrían ser adicionados o modificados del sistema de clasificación.

el sistema de clasificación de uso de suelo y de su cobertura del US Geological Survey. aunque se reconoce que para los estudios a una escala mayor o para considerar opciones alternativas de uso de suelo. porque esto no está particularmente relacionado a nivel de parcela. a no ser la cobertura del suelo per se. no resulta apropiado para la descripción y mapeo de áreas más grandes. ni incluye elementos relacionados con el sistema de cultivo. Nivel 5: Características de uso de suelo del área directamente circundante a Manual de biología de suelos tropicales 300 . Cuantos más clasificadores se añaden. donde cada jerarquía se relaciona con diferentes niveles de detalle temático y espacial. no son exhaustivos (es decir. resultarían de gran utilidad. Estos “sistemas” de clasificación básicamente representan leyendas. Muchos sistemas de clasificación utilizan a priori definiciones descriptivas de uso de suelo y clases de cobertura del suelo. dispuestos en un sistema jerárquico. más detallado queda el nivel de clasificación. son rígidos y de capacidad limitada para incorporar nuevas clases. por lo tanto. por lo tanto. Obsérvese. Dicho sistema a menudo carece de una definición clara de los límites de clases.do. La jerarquía de clases es construida sobre un conjunto de clasificadores. El método que se describe a continuación. utilizados para definir una clase. Concepto y principios de diseño Los conceptos y principios de diseño del LCCS adoptados utilizan criterios diagnósticos ordenados de manera jerárquica para permitir un sistema de clasificación consistente con límites claros para las clases. El principio básico se apoya en el uso de clasificadores que refieren a criterios de diagnósticos o atributos independientes. basada en la interpretación de fotografías aéreas con el propósito de elaborar mapas de uso y cobertura del suelo. son limitados cuando se les compara con otros sistemas. representan un subconjunto de un rango de posibles usos y coberturas de suelo) y debido a que no existe un sistema de clasificación de referencia. por ejemplo. Nivel 3: Características relacionadas con aspectos culturales como irrigación y cultivo de temporada. Existen cinco niveles en la jerarquía de clasificación: Nivel 1: Características relacionadas principalmente con el cultivo y el campo Nivel 2: Características relacionadas con la combinación de cultivos. descrita por Lillesand y Kiefer (1987). Nivel 4: Características relacionadas con el manejo de prácticas del suelo.

que muchas veces es referencia de la clase social y del tipo de manejo (Huising. el deshierbe y la fertilización del mismo. o basados en los datos proporcionados por el agricultor. patrones de campo) y los cultivos asociados. El quinto nivel en los sistemas de clasificación se relaciona con elementos de vegetación leñosa (semi) permanentes dentro de la parcela y en los campos aledaños. Este último determina si el campo forma parte de un sistema de cultivo migratorio. Estos tres primeros niveles forman la base para la clasificación de uso de suelo y la colecta de datos en relación con dichas características se sugiere representan los datos mínimos requeridos. como setos. pero con algunos antecedentes de uso de suelo y de los sistemas de cultivo habituales. En el siguiente nivel de la clasificación jerárquica se consideran las prácticas culturales relacionadas con el suministro de agua y factores de cultivos de temporada. Asimismo. el manejo de los campos agrícolas (es decir. Las subclases pueden definirse basándose en otros cultivos que forman parte del sistema del cultivo general. ej. barreras de viento y otras estructuras semipermanentes. Las características de rotación de cultivos se consideran en otros estudios. cercas vivas. “cultivo de árboles” para un sistema basado en árboles). la clase mayor es definida por el tipo de cultivo principal (p. se han añadido clasificadores que relacionan el manejo del suelo y cultivos que permiten la determinación del nivel de intensidad de uso.la parcela de muestreo. pero que se consideran importantes en relación a la intensidad del uso y pueden tener un impacto directo sobre la biodiversidad del suelo. Las características no siempre son fácilmente observables. Dichos clasificadores. Otros aspectos que se deben considerar son la distribución. Por ejemplo. Estos elementos de vegetación se relacionan con características permanentes en el paisaje. Esta información puede ayudar a determinar si la parcela bajo consideración representa una característica (o patrones) del uso de suelo o tipo de cobertura. junto con el tamaño de las áreas de los campos. incluyendo arreglos espaciales de los campos agrícolas. se refieren a las operaciones realizadas en una parcela en particular. normalmente. Esto puede ser señal de cultivos simultáneos o. especialmente en relación con elementos leñosos de la vegetación que no se reconocen como cultivo y en relación con cultivos en campos adyacentes. en secuencia. 1993). El tamaño del campo generalmente es indicador del tamaño de la finca. un sistema de barbecho o un sistema de cultivo permanente. lo que sirve para D escripción y clasificación de uso de suelo en puntos de muestreo 301 . éstos pueden ser evaluados. tales como la preparación del suelo. son características que no se evalúan en los primeros niveles de clasificación.

Los atributos técnicos específicos permiten una definición más precisa de clases de uso de suelo asociados. pueden añadirse sin mayores consecuencias para el sistema de clasificación.identificar posibles asociaciones de usos de suelo que. el valor de clase a un nivel más detallado de generalización puede ser inferido. Estos atributos técnicos específicos. 1998) y Huising (1993). Los principios de las clasificaciones jerárquicas son explicados por Molenaar (1991. por ejemplo. a su vez. Además. Estos nuevos atributos ofrecen información más específica sobre el objeto de observación. el patrón del campo ofrece información sobre la fragmentación del suelo y constituye otro aspecto de la intensidad de uso de suelo que puede impactar directamente sobre la biodiversidad del suelo. En el caso de algunos de estos atributos. la descripción cuantitativa de la intensidad del uso del suelo. Si se conoce el valor de clase a un nivel más específico. sirven para trazar la cartografía del uso de suelo (mediante la interpolación de puntos de observación que complementan un mapa). Los atributos. el cultivo principal puede describirse a un nivel más general (de género) como Zea o a un nivel de familia como Gramineae (pastos). como los refiere el LCCS. que pueden incluir. Por otro lado. los dominios de valor no son específicos para permitir la definición de 302 Manual de biología de suelos tropicales . Éstas sirven para guiar las observaciones en el campo en los puntos de muestreo y sus áreas circundantes. no son independientes y pueden involucrar algún tipo de medición con un nivel más alto de detalle. Los niveles de clasificación definen un eje de la clasificación jerárquica en donde atributos adicionales (conjuntos de ellos) en cada nivel subsecuente definen las subclases (que representan un mayor nivel de detalle). Los valores de datos posibles (dominios de valor) para la mayoría de los atributos son dados para proporcionar una descripción estándar de las características de uso de suelo. por lo tanto. Además de este eje existe uno más en la clasificación jerárquica que hace referencia al nivel de precisión con que se describen las características de uso o añade información específica (detalles técnicos) de las características de uso de suelo descritas. por ejemplo. información más específica se remite a variedades y esto representaría un mayor nivel de detalle (especificidad). el cultivo principal se puede describir como maíz (Zea mays). Registro de datos en campo y observaciones adicionales En las siguientes secciones se presenta la lista de atributos para la descripción de usos de suelo. La transformación de las listas de atributos a formatos para registrar los datos en el campo resulta fácil. por lo tanto. son consideradas observaciones a nivel de parcela.

clases de tamaño estándar definidas en campo con límites fijos no podrán ser significativas por esa razón. o bien. A priori. Sin embargo. La situación contraria sería con el conocimiento de la práctica común en el área. una tasa particular de aplicación (baja. basados en la definición de la clase adoptada (ver Tabla 11. utilizando otros recursos. La información en el cuarto nivel. basada en observaciones secundarias. no se obtiene a través de observaciones directas en el campo. La información de estas fuentes de datos puede resultar incorrecta. relacionada con el manejo. Los atributos pueden agregarse para facilitar la descripción de características específicas de un área en particular. media o alta) puede ser asumida. A menudo. junto con la información relacionada con el tercer nivel (es decir. es aceptable clasificar la tasa de aplicación como baja. Sin embargo. esto no es prescriptivo en el sentido de que los datos necesitan ser colectados en todos los niveles de detalle.6b). como documentos). sino que requiere del acceso a fuentes adicionales de información (a través de entrevistas a los agricultores. a partir de la observación directa en el campo. El sistema para describir el uso de suelo muestra varios niveles de detalle. Las observaciones para los tres primeros niveles del sistema de clasificación se pueden hacer directamente en el campo. Si éste no es el caso. Las clases de datos deben indicar una discriminación relevante (significativa) de objetos y el subconjunto de clases debe ser extensivo (no exclusivo). Por ejemplo. a personas externas. si la información sobre la tasa de aplicación de un fertilizante inorgánico en particular no se considera confiable o correcta. simplemente. la información puede generalizarse para la clase de “fertilizante aplicado” (implicando el uso de fertilizante inorgánico). los datos relacionados con niveles muy detallados de observación son muy difíciles de obtener. con los conocimientos de un sistema habitual de cultivo y las prácticas de manejo en el área. pero éstos deberán añadirse a los niveles más bajos de la clasificación jerárquica para evitar que interfieran con la estructura de la misma.valores de datos en los rangos de observación y distribución de los valores de datos. características culturales) obtenida de un informante o derivada de la información general de las prácticas culturales en el área. El nivel de detalle al cual la información es reunida depende del propósito del inventario de uso de suelo y de la posibilidad de obtener D escripción y clasificación de uso de suelo en puntos de muestreo 303 . se debería poder inferir información sobre el manejo de la parcela en particular. media o alta. sus fuentes no son totalmente confiables. pero ello se compensa con la aplicación de la jerarquía en la precisión de los datos (referidos anteriormente como el segundo eje en el sistema de clasificación). o bien.

pueden ser incorporadas fácilmente a las libretas de campo en caso necesario. Estas observaciones no se consideran como clasificadores y. Si bien estas observaciones no se incluyen en la clasificación del uso de suelo. sin embargo. Estas observaciones secundarias sirven.la información requerida. al mismo tiempo. para la selección entre un cultivo de árboles y un cultivo anual en el mismo campo. por lo tanto. además de los datos administrativos como hora. Este tipo de información deberá registrarse en la libreta de campo. nombre del encargado del proyecto y nombre de la persona que toma los datos. la explicación de posibles datos atípicos). como un mecanismo para la validación de los datos en atributos y clasificadores e incluso para los resultados de clasificación finales. fecha. El uso de una cuadrícula regular para el muestreo permite que se tomen puntos de muestreo en cualquier lugar dentro de la parcela y posibles efectos de borde deben tomarse en cuenta. Se deberá registrar la localización específica del punto de muestreo dentro del campo (por ejemplo. Para este propósito. El hecho de que el encargado del proyecto se encuentre familiarizado con el uso de suelo y con las prácticas de manejo en el área. Se recomienda revisar el trabajo de Stocking y Murnaghan (2001) para los indicadores relevantes de observaciones en el campo. sí pueden aportar información para el análisis de datos. ya que puede tener un efecto en la distribución de la biodiversidad del suelo. Si la selección se realiza entre dos 304 Manual de biología de suelos tropicales . no se incluyen en las listas de atributos que se detallan a continuación. OBSERVACIONES DE USO DE SUELO: CLASIFICADORES Y ATRIBUTOS Observaciones respecto del cultivo principal y tamaño del campo El primer nivel del sistema de clasificación se reserva para las observaciones del cultivo principal. (por ejemplo. donde el cultivo de árboles se considera como el principal. siempre y cuando la cobertura del suelo no se clasifique como escasa. será siempre una ventaja. El sistema para la descripción de uso de suelo requiere de una estructura que pueda implementarse a detalle y que se considere viable bajo las condiciones reales. dependiendo de la experiencia del encargado del proyecto. Observaciones secundarias pueden relacionarse con el estatus del cultivo o con la presencia de maleza. la información sobre el tipo de lindero se debe registrar. el centro o los linderos). la cobertura del dosel deberá clasificarse como “abierta” o “cerrada”. como el elemento de vegetación más dominante. el segundo.

árboles de sombra] Duración del cultivo [Estación (parte del año). 1 año. ej. cosecha de frutas. porque su apariencia (características de vegetación) puede ser muy distinta. La categoría de cultivo herbáceo representa un nivel adicional en la clasificación jerárquica (nivel de especificación) y. Se prevé para una descripción de un segundo y tercer cultivo. de la edad de la plantación. ancha] Propósito [vivero. es conocido el tipo de cultivo. “forrajes o fibras”. dependiendo. “leguminosas o vegetales”.o más cultivos de la misma forma de vida. deciduo] Tipo de hoja [aguda. el propósito) y duración del cultivo. nueces y otros. por ejemplo. arbusto. o gramíneas] Atributo técnico 1 Atributo técnico 2 Cultivo de árboles o arbusto Tipo de cultivo (especies y Fenología de la hoja [siem. una especificación con más detalle indica si el cultivo pertenece a la categoría de “raíces o tubérculos”. El valor de dominio no se especifica aquí. La información más concreta sería entonces el tipo específico de cultivo. cosecha de toda la planta (p.1 Clasificadores y atributos técnicos para el cultivo principal Nivel 1a – Clasificador Forma de vida [árbol. para madera o leña). entre 1 y 3 años. hierba. La clasificación se basa en la forma de vida del cultivo.1. es mejor definir una lista de Tabla 11. Los atributos técnicos son específicos para cada una de las diferentes formas de vida. entre 3 – 10 años.1 los valores posibles (clasificadores o atributos) se enlistan entre corchetes. el cultivo con el mayor porcentaje de cobertura califica como el cultivo principal. En la Tabla 11. En el caso de un cultivo de árboles o arbustos se puede añadir información sobre el aspecto (es decir. más de 10 años] 305 D escripción y clasificación de uso de suelo en puntos de muestreo . pero en lugar de dejarlo abierto. En el caso de cultivos herbáceos. proporcionando una mayor especificación de la forma de vida a nivel de detalle. por lo tanto. Cuando se considera relevante.variedades) pre verde. se puede añadir un cuarto nivel que ofrezca información sobre la variedad específica del cultivo. Generalmente. no se enlista bajo el título “Atributos técnicos 1” en la Tabla 11.

arroz. sirve como indicador del grado de organización y mecanización de las prácticas de manejo. 2000).1 Continúa Nivel 1a – Clasificador Atributo técnico 1 Gramíneas Tipo [bambú. a manera de ejemplo. La definición de clases de tamaño de campo “pequeña”. con las características de campo. fibras] (si se conoce. es mejor definir clases significativas basadas en un estudio piloto del rango de tamaño de campo presentes en el área de estudio (Huising. legumbres y vegetales.2). mediano y grande.lúpulo y otras enredaderas perennes] Herbáceas Categoría de cultivos [raíces y tubérculos. aunque está más relacionada con las características del cultivo que con las características del campo. ésta queda fuera del marco de este capítulo. cereales. pero manteniendo la distinción conceptual entre pequeño. III-cultivos de cobertura. forrajes. El siguiente nivel en la clasificación jerárquica se determina por las características espaciales de la parcela en observación (Tabla 11. véase la lista LCCS (Di Gregorio y Janssen. además. puesto que ello dependerá del contexto de estudio. con el propósito de evitar cualquier confusión. “mediana” o “grande” no aparece.herbáceas. aunque esto se relaciona más con las características del cultivo que. Aquí se incluye la “cobertura de los cultivos”. La forma del campo se añade principalmente como una preocupación respecto a posibles efectos de borde y. La cobertura del cultivo se anexa aquí. La cobertura del cultivo se usa generalmente como un parámetro para la interpretación de 306 Manual de biología de suelos tropicales . II. IV. no obstante. pastos] Si no son gramíneas Categoría del cultivo [I. especificar el tipo de cultivo) Atributo técnico 2 Tipo de cultivo (especies o variedades) Tipo de cultivo Tipo de cultivo nombres permitidos para los tipos de cultivo.plátanos y otras plantas herbáceas arbóreas. caña.Tabla 11. 1993) con la opción de utilizar diferentes definiciones para cada una de las distintas regiones en donde se esté llevando a cabo el estudio.

la distribución espacial en el campo puede especificarse. baja (30 -15%)] Cobertura permanente: [cerrada (> 70-60%). mediana.Forma [cuadrada. se refiere a que se produce un empalme entre las copas. los límites de clases son ligeramente diferentes (ver Di Gregorio y Janssen. rectangula [chica. El segundo y tercer cultivo pueden describirse por los mismos D escripción y clasificación de uso de suelo en puntos de muestreo 307 . proporciona información acerca de la densidad del cultivo y es un indicador útil de la intensidad del uso de suelo. grande] lar. esto se refiere a que en una misma parcela y durante una sola temporada se realizan uno o varios cultivos. En el caso de formas de vida permanentes. circular. su densidad puede medirse directamente en términos del número de plantas por unidad de medida (m² o ha) o en términos de espacio entre plantas (el espacio entre surcos y la distancia entre las plantas). Por lo tanto. en tira o irregular] Tamaño del campo (metros cuadrados) Atributo técnico 2 Cobertura del cultivo Cobertura no permanente: [alta (> 60%). en los casos donde un clasificador de segundo nivel “combinación de cultivos” indica que existe un segundo o tercer cultivo creciendo en el campo. la cobertura del cultivo puede resultar difícil de interpretar debido a la variación en la arquitectura de las plantas.2 Tamaño del campo y características de la cobertura del cultivo. Nivel 1b -Clasificador Atributo técnico 1 Tamaño de campo o parce. En el caso de cultivos anuales. multiangular. Tabla 11. Esto puede servir para entender la importancia relativa del cultivo en sistemas de cultivos múltiples. Se pueden hacer distinciones de acuerdo con el número de cultivos y con su secuencia. el tipo de cobertura “cerrada”. Para coberturas no permanentes. generalmente. Una cubierta “abierta” significa que la distancia entre los perímetros de las copas puede ser hasta dos veces mayor que el diámetro medio del dosel. a las diferencias en las etapas de crecimiento y otros factores. y especialmente en el caso de los cultivos anuales. Además. 2000). mediana (60 – 30%). En el caso de un segundo o tercer cultivos. pero dependería mucho del tipo de cultivo.imágenes de percepción remota. Las clases de densidad podrían especificarse. abierta (70-60 – 20-10%). escasa (20-10%)] Observaciones relacionadas a combinación de cultivos y prácticas culturales Las combinaciones de cultivos se consideran el segundo nivel.

serían suficientes. La descripción para las características del suministro de agua es muy sencilla (ver Tabla 11. relacionadas con el “factor de tiempo del cultivo” para especificar esta información. múltiple (intercalado)] Atributo técnico 1 Cultivos múltiples No. 2 o más] Secuencia [simultáneo. los cultivos de árboles (hule) en un campo grande (plantación). en donde la especificación de la forma de vida.4 Características del suministro de agua Nivel 3a – Clasificador Suministro de agua [lluvia. Un segundo tipo de cultivo puede referirse a un cultivo de sotobosque como el cardamomo. aspersión o goteo] Atributo técnico 2 Demanda de agua por irrigación [mm de agua suministrada por temporada de crecimiento o cultivo] 308 Manual de biología de suelos tropicales . definidas como características de suministro de agua y características relacionadas con el barbecho. como por ejemplo.4). el porcentaje de cobertura del cultivo adicional o añadido) puede alcanzar fácilmente el 100%. Nivel 2 – Clasificador Combinación de cultivos [simple (monocultivo).3 Atributos de cultivos combiandos. de cultivos adicionales [1.atributos. Se realizan previsiones al tercer nivel de clasificación. la totalidad de su cobertura (es decir. no habría un arreglo especial. por ejemplo. en cuyo caso. igual que para el cultivo principal. secuencial] Atributo técnico 2 (Segundo tipo de cultivo) Simultáneo o traslapado Arreglo espacial [una o dos filas intercaladas. también en estos casos. fragmentadas o dispersas] Tabla 11. La vegetación del sotobosque también puede referirse a vegetación (semi) natural. traslapar. Es necesario registrar cuando se practica una rotación de cultivo en particular. plantaciones. en los varios niveles de especificación. El segundo (o tercer) cultivo o elemento de la vegetación puede incorporarse en la descripción de clase del sistema de uso de suelo como elemento descriptivo o como atributo. El segundo tipo de cultivo se añade como un segundo atributo técnico. El nivel tres en el sistema de clasificación se refiere a las prácticas culturales. junto con la fenología y tipo de hoja. irrigación] Atributo técnico 1 Irrigación Tipo de irrigación [superficial. postinundaciones. Tabla 11. con un sotobosque herbáceo cerrado. franjas alternas.

en principio. mediano.5. de cultivos en dos años D escripción y clasificación de uso de suelo en puntos de muestreo 309 . El cultivo migratorio se define como suelo cultivado durante menos del 33% del tiempo (Ruthemberg et al. El barbecho se refiere al periodo (estación de crecimiento) durante el cual se deja descansar el suelo. El factor de tiempo del cultivo indica la fracción de tiempo durante la cual el suelo es usado para el cultivo. aunque no lo mismo.. la lluvia infiltrada en el suelo se usa intencionalmente como reserva para los cultivos”.El cultivo post inundación se define. Esto es similar. en términos prácticos. Nivel 3b . permanente] Atributo técnico 1 Cultivo migratorio Período de barbecho [corto. Se hace una distinción entre cultivos migratorios. se debe hacer la distinción entre si esto se hace con el objetivo de restaurar la fertilidad del suelo o debido a que las condiciones no permiten cultivar (bajas temperaturas o disponibilidad de agua limitada). al empleo de técnicas de cosecha de agua (tratado por separado en la sección relacionada con el manejo de suelos y cultivos). esta distinción no se mantiene. de la siguiente forma: “después de que un campo ha sido inundado con agua de lluvia. de acuerdo con el LCCS. largo] Permanente Permanente [continuo o intermitente] Atributo técnico 2 Índice de cultivo (valor del índice de cultivo Ruthenberg) Si es mejorado: Tipo de cobertura (ej. el suelo está cultivado por más de 66% del tiempo. Los atributos técnicos se especifican en la Tabla 11. Leguminosas. y debido a que no trae consecuencias en la intensidad del uso de suelo.Clasificador Factor tiempo de cultivo [cultivo migratorio. barbechos y cultivos permanentes. barbecho. Los cultivos migratorios típicamente se refieren a situaciones donde los agricultores abren nuevas parcelas para el cultivo. mejorado] Duración del barbecho[corto.5 Factor tiempo de cultivo. Los sistemas de barbecho se definen como suelo cultivado entre el 33% y el 66% del tiempo y en los cultivos permanentes. 1980). o largo plazo] Barbecho Tipo de barbecho[suelo desnudo. natural. mediano. mientras que en el sistema de barbecho Tabla 11. u otro tipo) Índice de cultivo (valor del índice de cultivo Ruthenberg) Intermitente No. sin embargo.

resulta relevante anotar la duración de dicho periodo. por lo tanto.cultivan la misma parcela o área de suelo. la clasificación del periodo de barbecho es la siguiente: Periodo corto: < 4–5 meses. pero eso no resulta lo suficientemente largo para clasificarlo como cultivo migratorio. La definición de estos límites de clases se basa en la experiencia en el campo. Los barbechos se consideran como “mejorados” en el momento en que se planta o se siembra para cambiar la composición de la vegetación de barbecho o para mejorar su calidad. Para sistemas de barbecho. pero < 8–9 meses. Barbecho largo. pero necesita confirmarse y puede ajustarse con base en los datos reales sobre la duración de los periodos de barbecho en el área en cuestión. por ejemplo. lo cual es muy común en algunos lugares donde uno o dos cultivos “cortos” ocurren durante un año o donde el agricultor deja un periodo de barbecho más largo. éstos se pue310 Manual de biología de suelos tropicales . El barbecho medio refleja la situación donde el suelo descansa durante seis a siete meses. por ello. durante el segundo año. con un periodo de < 1–2 años. Estas son evaluaciones parcialmente cualitativas y. Barbecho medio. se hace una distinción entre la duración del periodo de barbecho: Barbecho corto. se sobreponen los límites de clases y se especifican para cubrir la variación específica de un periodo de barbecho para cualquier área que probablemente sea dependiente de las condiciones socioeconómicas y biofísicas habituales. con un periodo de > 8–10 años. Si se requiere de datos más precisos. Periodo medio: 4–5 meses. El periodo largo de barbecho es la situación típica en donde el suelo se deja en barbecho durante un año o más. forrajes. Periodo largo: > 8–9 meses El barbecho de periodo corto se refiere a situaciones donde normalmente existen dos temporadas de cultivo en un año y el suelo se deja descansar durante el resto del periodo. En el caso de cultivos migratorios. dejándola descansar durante diferentes periodos de tiempo para restaurar la fertilidad del suelo. el periodo de barbecho típicamente tiende a reducirse. Bajo la presión de una población en aumento. No se hace ninguna distinción referida al tipo de cultivo o propósito. pero < 8–10 años. con un periodo de > 1–2 años.

plagas y enfermedades. se podría prever. Se añade la “preparación del suelo” por su relevancia en los márgenes de la selva en los trópicos. el manejo del suelo y de los cultivos se consideran representativos de un nivel separado en el sistema de clasificación (Tabla 11. Los mayores componentes de las prácticas de manejo discutidas se refieren a técnicas para la preparación del suelo o su cultivo.. Si se practica una rotación de cultivos.6a). tal y como se observa en la Tabla 11. el principal aspecto que se debe considerar sería si esto se realiza por medios mecánicos o no. el manejo de las malas hierbas. Los datos deberán especificar el número de años del ciclo de rotación de cultivos y la secuencia de los cultivos en el ciclo. tal y como se muestra en la siguiente fórmula (Ruthenberg et al.5. Características de manejo del suelo y de cultivos Las prácticas culturales mencionadas incluyen: “manejo de agua” como una operación de manejo. el mejor momento para incluir una descripción de las secuencias de los cultivos sería en el segundo nivel de la clasificación jerárquica donde “la combinación de cultivos” puede describirse como “secuencial”. como un clasificador podría ser excluida de la clasificación porque la preparación del suelo es generalmente la D escripción y clasificación de uso de suelo en puntos de muestreo 311 . el “factor tiempo de cultivo”. una opción para combinar ambos clasificadores dentro de uno que describa el grado de mecanización. En cuanto a la preparación del suelo y la cosecha. 1980): CIr = Tc/(Tc + Tf) En donde: Tc = duración del cultivo (tiempo). sin embargo. Tf = duración del barbecho o duración del tiempo en el que no se cultiva el suelo. puesto que el barbecho a menudo forma parte de un sistema de rotación de un cultivo en particular. donde potencialmente existe un alto impacto en la biodiversidad del suelo.den calcular utilizando el índice de cultivos de Ruthenberg. por lo que no han sido incluidas en el sistema de clasificación. Esto es. la cosecha. Alternativamente. Hasta este momento no se han considerado las rotaciones de cultivo. es un factor que deberá tomarse en cuenta en relación con la biodiversidad del suelo. fertilización y cosecha. por lo tanto. De manera alternativa.

arado de disco. por ejemplo. La principal preocupación relacionada con el control de las malezas. Se añade un atributo técnico que describe el tipo de arado usado. donde la labranza del suelo se restringe a hacer agujeros para sembrar. Por lo tanto. se podría considerar combinar ambos (mecánica y química) dentro de un clasificador que describa el uso de agroquímicos (excluyendo fertilizantes orgánicos). Una distinción más detallada de acuerdo con los requerimientos reales de poder o capacidad en términos de caballos de fuerza no se considera relevante. se basa en el tipo de tracción utilizada: animal o mecánica. tales como la unidad de sembrado directo (ripper-planter) utilizada en la agricultura de conservación (de Freitas.primera operación para ser mecanizada y tiene un profundo efecto en la biodiversidad del suelo. tales como tipo de suelo. pero al contrario. La eficiencia se refiere más a lo económico que a lo ambiental. el suelo (y otras condiciones ambientales) afectarán la eficiencia de la operación. estos arados se presentan desde el menos eficiente en remover el suelo y dejará más estructura intacta en el suelo. sería más sencillo 312 Manual de biología de suelos tropicales . De acuerdo con el orden mencionado. plagas y enfermedades es el uso de agroquímicos. El tipo de animal o el tipo de maquinaria empleada es indicado en el siguiente nivel de detalle. o arado de cincel. el uso de combustibles debería añadirse como atributo en el siguiente nivel más alto de especificación. la profundidad del arado. sin embargo. 2000). aquí se incluye su compatibilidad con los métodos que incorporan el uso de combustibles fósiles en los cálculos de la intensidad del uso de suelo. en caso afirmativo. porque esto dependerá de las condiciones locales. tipo de equipo y tipo de tracción. La “eficiencia” en términos de horas por hectárea requerida para la operación se añade como un atributo opcional. ya que no resultará un indicador directo del grado de perturbación del suelo. La labranza mínima se refiere a aquellos sistemas donde el arado y la siembra son típicamente una combinación de una sola operación. en lugar de labrar el campo entero o donde el grado de perturbación se minimiza con el uso de equipos especializados. refiriendo su capacidad. El uso de combustibles puede fácilmente estimarse si se conoce su eficiencia. Se hace una distinción basada en si el suelo ha sido labrado o no. Opcionalmente. las opciones son: arado de vertedera. comparado con animales “ligeros” o maquinaria de igual consideración. tomando en cuenta el impacto directo del peso del animal o la maquinaria y el impacto generado por los diferentes tipos de equipo operados por maquinaria o animales de diferentes capacidades. Se presume que animales “pesados” o maquinaria pesada causan un mayor impacto en el suelo. en el sentido de que una mayor o menor eficiencia no causará mayor o menor impacto en el suelo y los organismos que se encuentran en él. Se debe mencionar aquí si se practica la labranza mínima.

directo (ripper-planter)] vaca. tracción animal.y práctico manejarlas por separado. “No quitar malezas” puede atender a situaciones donde no existe la extracción real de las malezas.[vertedera. Tracción animal Tipo (y número) de anima. labranza y deshierbe. no se incluyen en el valor de dominio. químico] Tipo de deshierbe [con azadón. buey. Respecto al deshierbe manual se hace una distinción Tabla 11. estas han sido registradas de las prácticas de uso de suelo en los niveles previos del sistema de clasificación y. química] Atributo técnico 1 Manual Modo [desmontar y quemar. mula/burro] Eficiencia (horas/ha) Mecánico Tipo de arado Clase de maquinaria [dos ruedas (ligera). etc. Nivel 4 – Clasificador Limpieza [Sin limpiar. mecánica. cuatro rue. mecánico. caballo. por ello. intermedia e intensa] Manual Atributo técnico 2 Labranza [Sin labranza. mecánica] Alcance de la labranza [labranza completa. manual (azadón). a Deshierbe a mano Eficiencia (horas/ha) mano. sea por el método de herbicidas. labranza mínima/unidad de sembrado les usados [búfalo.. manual. biológico o cultural.disco.6a Clasificadores y atributos relacionados con la limpieza de la parcela. reducida o mínima] Eficiencia (horas/ha) Tipo de arado [vertedera. con la mano] D escripción y clasificación de uso de suelo en puntos de muestreo 313 . por ejemplo. desmontar y cubrir con abono verde] Mecánica Grado [limpieza moderada. cincel.disco. la rotación de cultivos. el barbecho. labranza mínima/unidad de das (pesada)] sembrado directo (ripperplanter)] Eficiencia (horas/ha) Deshierbe [Sin deshierbe. cincel. El clasificador para el control de malezas especifica el modo de mecanismos de control. En el caso de medidas de control culturales (y biológicas). mecánico.

si se considera el gran número de herbicidas que se encuentran disponibles en el mercado. dado que el Roundup es.Tabla 11. se recomienda implementar un sistema de clasificación para la aplicación de volumen de herbicidas que sea relevante para el área en cuestión. se debería especificar el ingrediente activo (ia). por lo 314 Manual de biología de suelos tropicales . En cuanto al uso de químicos en el control de malezas. Las especificaciones de manejo de malezas no cubren todas las medidas de control de malezas. los cuales se convierten de libras por acre a gramos por hectárea (weeds. 2005).edu/pnw/weeds). basadas en recomendaciones generales para su aplicación en diferentes cultivos. junto con la cantidad en gramos del ingrediente activo por hectárea. weeds. o cualquier otro tipo de herbicida. otros mecanismos] (entre 850 y 2500 g ia/ ha). la distinción se hace acorde con su aplicación: el uso de aspersor de mochila es el más común. Si se considera de vital importancia. los diferentes tipos de ingredientes activos y las fórmulas que existen (Oregon State University.iastate. Una diferencia más.edu/mgmt/2004) por la cantidad de aplicaciones especificada en gramos equivalentes de ácido (ea) por hectárea de glifosato. se basa en el volumen de la aplicación que resulta no viable. VA (> 2500 g ia/ha)] Herbicida. Sin embargo. el herbicida más usado en los trópicos (www.ippc. por mucho.6a Continúa. ingrediente activo y tasa de aplicación entre si esto se lleva a la práctica con el uso del azadón o mediante la extracción totalmente manual. se considera un volumen alto (VA). si se requiere información más detallada acerca del Roundup. Las especificaciones son asignadas de manera arbitraria. mientras que una aplicación (ea) de más de 2500 gha-1. que es la sustancia activa del Roundup. VI mochila. azadón de presión. Una tasa de aplicación de (ea) menos de 850 gha-1 se considera un volumen bajo (VB) de aplicación. Nivel 4 – Clasificador Atributo técnico 1 Mecánico Tipo de deshierbe [labranza frecuente. cultivo para el control de malezas] Atributo técnico 2 Eficiencia (horas/ha) Tipo de equipo (ej. azadón rotatorio) Eficiencia (horas/ha) Químico Volumen de aplicación Tipo de equipo [aspersor de [VB (< 850 g ia/ha). orst.

Eso se hace para poder acomodar los diferentes grados de fertilizantes. Cuando se utilicen fertilizantes de bajo grado. estos se basan en asumir un contenido de materia orgánica del 30%. los rangos de tasas de aplicación se especifican para los límites superiores e inferiores de las clases. se hace una distinción basada en si éstos son ampliamente aplicados en todo el campo o si la aplicación se restringe a puntos específicos y también al tipo de equipo utilizado. control biológico o mecanismos de control químico (Tabla 11. se definen clases similares: control natural o medidas culturales. La frecuencia de la aplicación puede variar y en la tabla que se observa a continuación. P2O5 para el fósforo y K2O para el potasio) El índice toma D escripción y clasificación de uso de suelo en puntos de muestreo 315 . sin considerar las disoluciones hechas antes de la aplicación. las cifras se convierten en tasas de aplicación por año. se prevén especificaciones para la tasa de aplicación.que la libreta de campo es un buen complemento para la observación relacionada con cualquier medida específica de control de malezas. Para abonos. Las clases de volúmenes para aplicar pesticidas se obtienen de Craig et al. estas cantidades se suministran una vez cada cuatro a seis años (ILACO. Con relación a las medidas de control de plagas y enfermedades. se podrían especificar cantidades reales de aplicación. Generalmente. (2002) y son usadas en caso de aspersión aérea. mientras que los fertilizantes de alto grado contienen hasta el 50% de elementos nutritivos. Dos toneladas por hectárea por año se consideran suficientes para todo tipo de cultivo. Los volúmenes especificados se refieren a la forma líquida en la cual el pesticida o el fungicida se obtienen. En cuanto a los fertilizantes orgánicos e inorgánicos.6b). fungicidas u otros químicos. se deberán tomar en cuenta los valores más altos. Respecto al uso de pesticidas. Los fertilizantes de bajo grado tienen menos del 25% de nutrientes para las plantas. En este punto. 1985). y las mismas clases de volumen se consideran relevantes. Los elementos nutritivos pueden referirse a un solo elemento (por ejemplo N) en los fertilizantes simples o la combinación de elementos en mezclas incompletas o mezclas completas (el porcentaje de peso se relaciona al N para el nitrógeno. Se presume que el modo de aplicación no traerá muchas consecuencias para la tasa de aplicación. dentro del rango especificado. en lugar de usar un valor en particular. se presume que se requieren entre 5 y 10 toneladas por hectárea para poder mantener los niveles de humus en el suelo. Con respecto a la aplicación de fertilizantes inorgánicos. Tasas de aplicación bajas de menos de una tonelada por hectárea por año se consideran insuficientes para mantener los niveles de humus y de materia orgánica en el suelo. en caso de considerarse relevante. sin tomar en cuenta su modo de empleo.

se incluye como clasificador separado. Una aplicación de 75 kg ha-1 de N requerirá 150 kg ha-1 de un fertilizante con N de alto grado y alrededor de 350 kg ha-1 de un fertilizante de bajo grado. Actualmente. o si las tasas de aplicación altas son de particular interés. Esto sería la aplicación recomendada para un suelo moderadamente fértil que produce alrededor de cuatro toneladas de maíz (grano). La manera en que se prepara la parcela puede tener un profundo impacto en la biodiversidad del suelo. En todos los sistemas es importante registrar si la quema se lleva a cabo para eliminar la vegetación muerta o si esta vegetación se queda como abono orgánico. Sin embargo. “Sin limpieza” (ver Tabla 11. estos valores se toman como el límite superior de la clase de “tasa de aplicación de fertilizante medio”. “La limpieza moderada” está indicada cuando se utilizan medios manuales y mecánicos. Otra distinción se hace basada en el tipo de equipo usado. La conversión puede incluir operaciones para nivelar el suelo. lo que ha ocurrido en algunos márgenes de selvas en donde opera el proyecto CSMBGBD. Las otras clases se derivan de estas cifras. La “limpieza intensa” significa que la tierra se limpia completamente con el uso de tractores oruga y otra maquinaria pesada. en donde los árboles se cortan a mano o con sierra de cadena y los troncos se remueven utilizando tractores u otra maquinaria más ligera.75 kg ha-1 de N como punto de referencia para la aplicación de N. cualquier incidencia de fue316 Manual de biología de suelos tropicales . cuando incluyen quemas. de un fertilizante de alto grado y de 700 kg ha-1 o más de un fertilizante de bajo grado. Si las tasas de aplicación son generalmente altas. por lo tanto. se podría considerar añadir una clase para las tasas muy altas que serían aplicaciones de 300 kg ha-1 o más. para alrededor de tres toneladas de trigo en suelos relativamente fértiles y 25 toneladas de mandioca en suelos moderadamente fértiles. especialmente. será relevante en el caso de tasas bajas o muy bajas de aplicación. en donde una tasa muy baja de aplicación representa alrededor de 10 a 15% de esta cantidad de referencia. ya sea en o alrededor del hoyo de plantación. por lo tanto. La limpieza también es importante en sistemas de barbecho. se hace una distinción entre sistemas de “desmontar y quema” y “desmontar y cubrir con abonos verdes”. 6a) se enlista cuando el campo ha sido convertido a partir de bosque o vegetación secundaria desde hace más de 20 años. Esto sería particularmente relevante donde se practican cultivos migratorios o donde las selvas han sido convertidas recientemente en suelo agrícola. La aplicación del fertilizante. lo cual coincide más o menos con la duración máxima de barbecho bajo sistemas de cultivos migratorios.

control químico y biológico] Atributo técnico 1 Control químico Aspersión [aspersión focalizada. media (entre 1–2 t/ha/año). Tabla 11. Nivel 4 – Clasificador Manejo de plagas y enfermedades [medidas preventivas y control natural. mezclas completas] Tasa de aplicación [muy baja (<20 – 60 kg/ha). alta (>2 t/ha/año)] Fertilizantes [sin fertilizante. mecánica] Eficiencia (Horas/ha) D escripción y clasificación de uso de suelo en puntos de muestreo 317 . baja (entre 25–60 y 75–175 kg/ha). vehículos. aspersor de motor. VI (entre 100 y 200L/ha). fertilizantes y cosecha.6b Clasificadores y atributos para el manejo de plagas y enfermedades. franjas. mezclas incompletas. VB (entre 10-100L/ha).go como parte de las prácticas de manejo deberá registrarse en esta sección como fenómeno importante. aspersión en toda la parcela] Atributo técnico 2 Volumen de aplicación [UVB (<10L/ha). estiércol de corral] Aplicación [hoyos. aviones] Fertilizantes orgánicos Tipo de fertilizantes [residuos de cultivos. franjas. (VA >200L/ha)] Tipo de químico y tasa de aplicación Tasa de aplicación [baja (<1t/ha/año). combinación de fertilizantes químicos y orgánicos] Equipo usado [aspersor de mochila. alta (>150–350 kg/ha) Aplicación [hoyos. o de manera homogénea en la parcela] Inorgánico Clases de fertilizantes [simple. abonos. media (entre 75– 175 y 150–350 kg/ha). o de manera homogénea en la parcela] Cosecha [manual. fertilizantes químicos. composta. abono verde.

lo que aumenta la capacidad de retención y reduce la pérdida de suelo. por lo que es difícil obtener cifras confiables y del todo correctas.Otras observaciones sobre el manejo de suelo y cultivos Aparte de registrar las características del manejo de suelo y de cultivos como se describió en las tablas anteriores. si se conoce la técnica con un nombre en particular (por ejemplo “Zai”. cuando se relacionan con su manejo. que se practica en el Níger). etc. Las evaluaciones del rendimiento basadas en campo deberán incluir lo siguiente: población de plantas por metro cuadrado. especialmente. número de macollos por planta de cereal. sean incluidas. entre otras.). esta información deberá adjuntarse. Las técnicas de recolección de agua como cavar zanjas. 2001). corta vientos y otros) o medidas estructurales que incluyen terrazas. cuando se compara con un cultivo de 318 Manual de biología de suelos tropicales . provee una visión general en su página web de muchas técnicas existentes (www. hondonadas y otras. De manera alternativa. La información sobre el rendimiento de la cosecha es igual de útil. muros de contención. acolchonado. El rendimiento del cultivo como indicador integra muchos factores. bancos. cultivos en curvas de nivel. Estos datos proporcionan información adicional sobre el cultivo principal tal y como se especifica en el primer nivel del sistema de clasificación. La información de las medidas de conservación no se captura directamente en el registro de los atributos enlistados arriba. Probablemente. altura y diámetro relativos del cultivo en crecimiento (ver Stocking y Murnaghan. las características del crecimiento del cultivo pueden utilizarse como una medida representativa del rendimiento. pero no como base de clasificación. el uso de elementos de vegetación (referido a tiras de pastizales. incluyendo las relacionadas con técnicas de recolección de agua. Las medidas de conservación de suelo y agua afectarán las poblaciones de organismos del suelo indirectamente por el almacenamiento de agua mejorada. De manera general. se incluyen como medidas estructurales. en donde se observa que la altura del cultivo es menor. el crecimiento puede clasificarse como: crecimiento retardado. al igual que las del estatus del cultivo. El registro debe contener la descripción de las medidas de conservación del suelo y el agua.net). se recomienda que las observaciones de las prácticas de conservación de suelo y agua. Las observaciones del estatus de los cultivos podrían ser útiles para corroborar los resultados anteriores (o resultados de clasificación). La World Overview of Conservation Approaches and Technologies (WOCAT). construcciones y empalizadas. wocat. barreras de setos. la mejor manera de categorizarlas es determinar si incluyen medidas agronómicas (como cultivos mixtos.

Esto permite la inclusión de elementos de vegetación leñosa en la descripción que no están capturados en el sistema de descripción de uso de suelo. dentro del contexto del uso de suelo en las áreas de los alrededores (esto ayuda a establecer si el uso de suelo en la parcela en observación es representativo o no). están disD escripción y clasificación de uso de suelo en puntos de muestreo 319 . deberá enlistarse su nombre. lo cual puede ocurrir cuando los árboles están dispersos dentro de la parcela. Además. Las observaciones del estatus del cultivo deberán acompañarse de observaciones acerca de la incidencia de plagas y enfermedades e incluir el porcentaje del cultivo afectado. se esperaría encontrar barbecho como parte del patrón de uso de suelo. con un diámetro del cultivo menor y una decoloración generalizada en sus hojas. y finalmente. todos a nivel parcela o paisaje. y cultivo de crecimiento vigoroso. el factor Ruthenberg se establece. por sí misma.crecimiento vigoroso. cercas vivas y otros elementos de vegetación importantes. la primera distinción se hace en función de si éstos son continuos. un importante aspecto de la intensidad del uso del suelo. frijol y col. plantas de menor vigor. Patrones de distribución en el campo y árboles en la finca Las observaciones relacionadas con el tipo de campo y con los elementos de vegetación leñosa dentro de la parcela bajo observación y sus alrededores están incluidas. permite una evaluación del uso del suelo en un punto de muestreo particular. Existen guías disponibles para registrar deficiencias específicas de nutrientes en cultivos (ver Stocking y Murnaghan. La fragmentación del uso de suelo que puede ser evaluada a partir de estas observaciones resulta ser. permite la validación y la verificación de las observaciones en el lugar del muestreo. lo que resulta importante para un mapeo del uso de suelo. 2001) por signos de déficit de nutrientes en maíz. dentro de una proporción espacial entre barbecho y el suelo cultivado en el uso de suelo actual. por ejemplo. Respecto a la distribución de los campos (evaluación del patrón de distribución). Este es el caso cuando la cobertura de árboles es escasa (menos de 10 a 20%). en el caso de cultivos migratorios o sistemas de barbecho. y la severidad de la infección en términos del grado en el cual la planta es afectada. Queda fuera del marco de este capítulo proporcionar información más detallada sobre plagas. en principio. Si se conoce la plaga o enfermedad específica. enfermedades y sus clasificaciones. El uso de suelo en el área circundante del punto de muestreo tendrá una notable influencia sobre la biodiversidad del suelo de la parcela en observación.

forma y patrón de los campos y finalmente. El patrón del campo se relaciona a la forma del lugar y al arreglo espacial del mismo.) 320 Manual de biología de suelos tropicales . grande] Cultivo principal (lista de los cultivos de cuatro parcelas vecinas ) Cultivo principal (lista de cultivos de cuatro parcelas vecinas) Cobertura del suelo (cobertura dominante de áreas no cultivadas) Tipo de cultivo o actividad Tipo de área acuática Tipo de área urbanizada (ej. áreas terrestres seminaturales. superficies artificiales. utilizando las clases mayores de cobertura de suelo del LCCS.tribuidos en forma de racimos o dispersos (ver Tabla 11. áreas acuáticas cultivadas o de inundación regular. dispersa] Atributo técnico 1 Continuo Distribución del tamaño de la parcela [uniforme. La segunda distinción se refiere al tamaño.7). lo que parece relevante especialmente en el caso de áreas cultivadas terrestres.7 Características de la parcela y distribución del uso de suelo. etc. queda una opción para especificar los porcentajes del área usando varias categorías: tierras cultivadas y áreas manejadas. áreas vacías o cuerpos de agua artificiales y cuerpos de agua naturales (hielo y nieve). en donde se especifican los cultivos principales. Residencial. Los distintos componentes de uso del suelo pueden describirse con mayor detalle. industrial. son las características del suministro de agua y la permanencia del cultivo. vegetación acuática (semi) natural. irregular] No continuo Parte de las tierras cultivadas [% de cultivo y área de manejo] Parte de la cobertura vegetal [% de área (semi) natual] Parte del área acuática cultivada [% de área acuática cultivada] Parte acuática no cultivada [% de área acuática no cultivada] Área urbanizada [% de superficie artificial] Atributo técnico 2 Uniforme clases de tamaño (mayoría del campo) [pequeña. agrupada. mediana. Clasificador espacial Distribución espacial de la parcela [continua. irregular] Patrón de la parcela [regular. Tabla 11.

8 especifica los atributos utilizados para describir los TROF. En el caso de porcentajes bajos de cobertura de árboles y árboles dispersos dentro del campo o alineados en forma de cerca viva. es importante registrar la localización del punto de muestreo respecto al lindero del campo. para leña o material de construcción). Se hace referencia a éstos como árboles en una finca (TROF). Las “zonas verdes” se refieren a árboles espaciados en filas dispuestas como empalizadas. Es importante derivar las clases de manera sistemática. La información sobre los árboles pertenecientes a la familia leguminosa es útil en relación con la ocurrencia de las bacterias formadoras de nódulos. a partir de los claD escripción y clasificación de uso de suelo en puntos de muestreo 321 . si es posible)] El último elemento que debe ser registrado es la presencia de elementos permanentes de vegetación leñosa en el paisaje. pantanos. nueces.Tabla 11. presas. especificado en términos del número de árboles por hectárea o longitud de los elementos lineales de la vegetación leñosa. este podría no ser el caso. natural (especificar tipo. aunque estos elementos pueden ser característicos del uso y cobertura del suelo y tener mayor influencia sobre la presencia de la biota específica del suelo. para cosechar frutas. como estanques. Se entiende que los tramos de bosque y otra vegetación leñosa fueron ya cubiertos por el método de clasificación para uso de suelo. Más información trata de la cobertura o densidad del componente árbol.7 Continúa. La Tabla 11. Clasificador espacial Atributo técnico 1 Atributo técnico 2 Suelo desnudo [% de áreas desnudas] Cuerpos de agua [% de Tipo de cuerpos de agua [arcuerpos de agua] tificial. para madera. El primer atributo describe la distribución espacial de los árboles. DESCRIPCIÓN Y CLASIFICACIÓN DE USO DE SUELO Definición y descripción de clases de uso de suelo No es el propósito de este capítulo describir cómo las clases de uso de suelo se definen. Los atributos técnicos permiten una descripción del tipo de árbol (ya sea por especie u otro nivel taxonómico) y el propósito de tener árboles (por ejemplo. Como se ha mencionado.

relacionados con observaciones de campo. principalmente madera. “parcela de tamaño grande”. barreras contra el viento u otros elementos leñosos. Esto se traduce en “plantación de árboles”. por ejemplo. distintos grados de cobertura de árboles pueden observarse dentro de la clase “plantación de árboles” (o aun dentro de las plantaciones de teca). una clase de uso de suelo podría ser definida en función de los siguientes valores de atributos: “cultivo de árboles”. zonas verdes] Atributo técnico 1 Cercas vivas: especies de árboles Árboles dispersos dentro de la parcela Propósito [principalmente frutas y nueces. “cultivo único”. pero esto pue322 Manual de biología de suelos tropicales . el diseño de la clasificación jerárquica y el atributo de los valores de clase. No todos los atributos o clasificadores tendrán que tomarse en cuenta. es posible distinguir entre una plantación de teca y otra de hule. “cultivo de temporada” y “cultivo permanente”. Si únicamente se consideran los primeros tres niveles en la clasificación jerárquica. otros] Barreras contra el viento u otros arreglos lineales: especies de árboles Empalizadas: tipo o especie dominante Atributo técnico 2 Cobertura (% de linderos que constituyen cercas vivas) Densidad (número de árboles por ha) Longitud total por ha (m/ha) sificadores y atributos presentados aquí. lo que determina el nivel de detalle con que se definen las clases. Si se contemplan atributos adicionales del cultivo principal (por ejemplo.Tabla 11. principalmente árboles de sombra.8 Características de los árboles en la finca (TROF). Las clases se definen por la combinación particular de clasificadores y atributos (determinados por el valor de los mismos). cuando se toman en cuenta atributos técnicos adicionales. Los principios de la definición de usos de clase de suelo. no necesariamente tienen que implicar una definición de un conjunto adicional de clases en el siguiente nivel de la clasificación jerárquica. utilizando reglas de decisión. Nivel 5 Clasificador Tipo de TROF [sin TROF. tipo de cultivo). árboles dispersos dentro de la parcela. Por otra parte. son explicados a continuación. de manera que un conjunto de clases definido para un área en particular puede ser fácilmente mapeado en el conjunto de clases utilizados para otra área y viceversa. cercas vivas.

9 proporciona una lista generalizada de los clasificadores y atributos de clases de acuerdo con el nivel la clasificación jerárquica. sin embargo. Y. Para una explicación de clasificación y jerarquías agregadas. decidiendo la presencia de un clasificador sobre otro. como han sido presentados arriba. Los clasificadores especifican un “cultivo de árboles”. Para ilustrar la definición y descripción de la clase. Una clasificación jerárquica se establece de manera similar. no todos los atributos pueden ser fácilmente organizados en una tabla.de no ser relevante para definir clases separadas de plantaciones de árboles. se retiene la información sobre el porcentaje de cobertura como un valor de atributo en particular para cada observación individual (instancia u ocurrencia) del objeto clase (es decir.9 contiene una vista global de la estructura de la clasificación principal.10. La Tabla 11. y “un cultivo permanente”. Más bien. Las reglas de decisión generalmente toman la forma de un conjunto de condiciones SI – ENTONCES que aplica los atributos. el factor “tiempo de cultivo” puede tener prioridad sobre el cultivo principal como la característica dominante. Esto se refiere a los niveles de la clasificación jerárquica. un “campo grande”. tal y como se observa en la Tabla 11. Las clases se asignan de acuerdo con las reglas de decisión y al mismo tiempo las clases se definen. No obstante. esta característica es general en áreas grandes y no en parcelas. combinados a través de operadores Booleanos (es decir. y por ello podría usarse para realizar ejercicios de mapeo a pequeña escala. en donde el factor “tiempo de cultivo” sería el parámetro en la jerarquía agregada y no. en áreas donde los cultivos migratorios o permanentes se practican uno al lado del otro. Por ejemplo: SI (<forma de vida> igual a ‘árbol’ y <tamaño de parcela> igual a ‘grande’ y <combinación de cultivos> igual a ‘único’ y <factor tiempo de cultivo> igual a ‘permanente’) ENTONCES <clase> = ‘plantación de árboles’. XO y NO). Debido a que el sistema que se presenta trata de áreas cultivadas y manejadas. Debido a la estructura anidada. hay que tomar en cuenta los valores especificados para los diferentes clasificadores y atributos técnicos. lo que D escripción y clasificación de uso de suelo en puntos de muestreo 323 . y no a los niveles de generalización (el segundo eje en el sistema de clasificación). en la jerarquía de clasificación para observaciones en parcela. Para información precisa habrá que referirse a las Tablas 11. ver Huising (1993). “sin irrigación”.1 a la 11. O. plantación de árboles). La Tabla 11.8. la jerarquía considera el cultivo principal como la puerta de entrada.

frecuentemente no son relevantes para cultivos de plantación. se pueden distinguir plantaciones de frutales. una plantación de más de 10 años de teca (que forma un dosel cerrado). que la parcela es cultivada de manera permanente con un pequeño periodo de barbecho cada dos años. El primer nivel especifica que se trata de una pequeña parcela cuyo cultivo principal es el maíz. La principal categoría de uso de suelo a la que esta parcela en particular pertenecerá puede definirse como “cultivos permanentes a pequeña escala con maíz como cultivo principal”. el manejo de plagas. enfermedades y la fertilización del suelo no tienen lugar. La Tabla 11. podría basarse en la clase de atributo nivel 1 “densidad de árboles” o en el atributo nivel 2 “combinación de cultivo de árboles”. se clasificará como “extensivo”. es importante informar sobre el uso del suelo circundante. si la información es correcta y se considera importante en el contexto de la clasifica324 Manual de biología de suelos tropicales . por ejemplo. Esto. el tercer nivel. con relación a la variedad de plantaciones. El manejo de estas plantaciones.significa una plantación grande de árboles. porque la preparación del campo. con 100 árboles por hectárea y que recibe 1. permitirá una distinción entre hule de “jungla”. Se pueden tomar en cuenta medidas para el control de malezas mediante corte o también el uso de químicos. Si se utiliza la información sobre la especie de árbol. Posteriormente. En cuanto a los clasificadores del nivel 5. a un sistema agroforestal en donde los árboles de hule (Hervea brasiliensis) crecen dentro de la selva (Joshi et al.200 mm de lluvia por año.11 muestra los datos para una parcela imaginaria de maíz.000 m² por tamaño de la parcela). 2002) o en lugares donde se cultivan únicamente árboles de hule. Tomando en cuenta la información del cultivo principal (clasificadores del nivel 1) se describirá la parcela como grande (con 10. el segundo nivel indica que entre el maíz se encuentran otros cultivos y. por ejemplo. De manera alternativa. por lo tanto. Algunos de los clasificadores de suelo y atributos de suelo y cultivos. Las diferencias entre la intensidad de uso de suelo. si la plantación de árboles bajo estudio es un pequeño bosque aislado dentro de un ambiente dominado por cultivos anuales.. de cacao y otras. lo cual únicamente tendrá sentido si existe una gran variación de dichas características dentro del área y si éstas reflejan diferentes regímenes de manejo. se podría definir una subclase añadiendo la descripción “intercalada con un cultivo de leguminosas” para distinguirla del maíz como único cultivo. o si forma parte de un paisaje dominado por plantaciones de cultivos de árboles. se pueden distinguir plantaciones de árboles destinadas a la producción de madera para tablas o para otros fines y si se utiliza la información sobre el propósito.

) Nivel 4 manejo Modo de cosecha y clasificación de uso de suelo en puntos de muestreo Clasificador Medios de limpieza Atributos Nivel de especie 1 Grado de limpieza Modo de limpieza 325 . Nivel 2 cultivo combinado Cultivos simples o múltiples Suministro de agua Factor tiempo de cultivo Nivel 3 prácticas culturales Cobertura del cultivo Nivel 1 características del cultivo y el campo Clasificador Forma de vida del cultivo principal Tamaño del campo Segundo Densidad o espacio entre tipo de cultivo plantas Tercer tipo de cultivo Cantidad de agua suministrada Número de Clase de cobertura del cultivos cultivo Tiempo de secuencia Arreglo espacial Tipo de irrigación Duración del período de barbecho Índice Ruthenberg Clase de tamaño del campo D escripción Modo de preparación del campo Tipo de tracción Frecuencia Tipo de operación Alcance de la operación Frecuencia Modo de deshierbe Manejo de plagas y enfermedades Prácticas de fertilización Tipo de fertilizante Volumen aplicado Atributos Nivel de especie 1 Tipo de cultivo (categoría) Forma del campo Tipo de barbecho Tipo especifico de barbecho Atributos Nivel de especie 2 Cultivo especifico (categoría o especies) Atributos Nivel de especie 3 Cultivo variedad (especie o variedad.9 Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo.Tabla 11.

Tabla 11.9 Continúa. Modo de equipamiento Aplicación Nivel 3 prácticas culturales Tipo de arado Alcance de la operación Eficiencia Clasificación de la aplicación Tipo de fertilizante Tipo de químicos Tipo de herbicida Volumen Volumen aplicado Volumen aplicado aplicado Patrones de distribución del campo Cobertura de árboles (copa) Densidad de árboles o longitud de barreras Patrones de distribución del tamaño del campo Partes del área terrestre cultivadas y manejadas Partes terrestres no cultivadas Arreglo espacial del campo Forma de vida del cultivo principal Otros tipos de uso o cobertura Clasificación de la aplicación Clasificafión de la aplicación Tipo de equipo 326 Eficiencia Nivel 1 características del cultivo y el campo Atributos Nivel de especie 2 Manual de biología de suelos tropicales Atributos Nivel de especie. 3 Atributos Nivel de especie 4 Nivel 5 Configuración espacial del campo y árboles en la finca Clasificador Configuración espacial de los árboles en la finca Atributos nivel 1 Propósito de los árboles en la finca Atributos nivel 2 Tipo de especies de árboles dominantes . Nivel 2 cultivo combinado Tipo de equipo Ubicación.

Tamaño o clases de tamaño del campo Tipo de cultivo principal % cobertura Nivel 5 Configuración espacial del campo y árboles en la finca Atributos nivel 3 Especies de árboles D escripción y clasificación de uso de suelo en puntos de muestreo 327 .Tabla 11.9 Continúa.

se puede describir las plantas debajo de los árboles y estas plantas pertenecerán a la categoría de vegetación (semi) natural. ** En el caso de sistemas de temporada de ser posible debe especificarse la cantidad de lluvia. para lo cual se utilizan otros parametros.200 mm** n/a n/a Nivel 1 Características del cultivo y el campo Clasificador Árboles Atributos técnicos Nivel 1 Perenes.Tectona grandis nico nivel 3 * En este caso.000 m2 100 árboles/ ha n/a n/a 1.Teca nico nivel 2 Atributo téc.Tabla 11. si es relevante. aunque no se discuten en este capítulo. Nivel 2 Combinación de cultivos Único 328 Nivel 3 Prácticas culturales De temporada n/a n/a n/a n/a Permanente n/a Grande Regular Cerrado Vegetación natural* 10. . de hoja ancha leñoso >10 años Manual de biología de suelos tropicales Atributo téc.10 Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca. aunque esto por lo general se describe en las características del sitio.

maíz 10% n/a n/a n/a n/a Ninguno Fertilizante químico Directamente hoyos Manual VMB (muy bajo) 50 kg CAN/ha n/a Atributos nivel de especie 2 Maíz Mucuna (abono verde) Atributos nivel de especie 3 Nivel de manejo 4 n/a Tracción animal n/a 2 bueyes n/a Arado de vertedera n/a Nivel 5 Configuración espacial del campo y árboles en la finca No TROF y clasificación de uso de suelo en puntos de muestreo n/a n/a Caminos .Tabla 11.16 1 cultivo adicional Simultaneo 2 filas alternadas NA Intermitente De temporada Permanente Mejorado Nivel 1 Características del cultivo y el campo Nivel 3 Prácticas culturales Clasificador Gramíneas Pequeño Atributos nivel de especie 1 Cereales Cuadrada D escripción Mecánica y química Labranza frecuente (2x) y fumigación una vez (1x) Aspersor de mochila VB (Roundup) Continuo n/a n/a Pequeño Uniforme 90% Regular Hierbas y gramíneas Chícharos. habas. Nivel 2 Combinación de cultivos Múltiple 2.infraestructura 329 n/a .11 Ejemplo de clasificadores y valores de atributos para parcelas de maíz.000 m2 Mediano a grande 75 x 25 cm Frijoles NA 0.

con escasa o sin presencia de árboles. el criterio para mejorar el barbecho podría considerarse en la definición de las subclases. insumos de ener330 Manual de biología de suelos tropicales . Esto podría traducirse. (1997) definieron un índice de intensidad de uso de suelo que considera la frecuencia de la ocupación de suelo (según lo expresado en el índice Ruthenberg). El grado de interferencia con (perturbación o alteración) el ecosistema natural sería una buena medida de la intensidad del uso de suelo. La norma general es que los sistemas culturales y manejados son más intensivos que los naturales (cuanto más insumos de manejo se requieran para mantener los sistemas. Giller et al. que indica patrones de uso de suelo fragmentados y un uso intensivo del suelo. principalmente. sin que esto quede reflejado en la definición de las clases. La información específica se refiere a la densidad de la planta. Parece que existe un consenso sobre los factores que determinan la intensidad del uso de suelo. Esta sección pretende demostrar cómo un conjunto de clases podrá definirse y organizarse en una estructura jerárquica y que el sistema es bastante flexible en cuanto a la selección de clasificadores y atributos considerados para su clasificación. uso de nutrientes. dependiendo de las reglas de clasificación. con cultivos anuales. manejo de plagas. al arreglo específico de la combinación del cultivo y a qué especie es utilizada para mejorar el barbecho. Ordenamiento de las clases de uso de suelo respecto a la intensidad de su uso En sistemas agrícolas. con un bajo volumen de herbicidas. más intenso será su uso). Manejo y nivel de insumos: la información en el manejo del cultivo y el suelo habla de que el nivel de perturbación del suelo se considera intermedio (habiendo sido arado dos veces con el uso de tracción animal) y que el insumo de químicos ha sido bajo. Un esquema de clasificación estándar no funcionará porque la definición de un conjunto de clases depende del contexto y del propósito específico de la clasificación. en “un manejo caracterizado por el uso de tracción animal y bajo insumos agroquímicos”. el manejo tiene por objetivo modificar o establecer condiciones que propicien la producción de un cultivo. pero una definición de un índice o medida de la intensidad de uso de suelo no es fácil..ción. Los clasificadores de nivel 5 y los atributos describen que el suelo es cultivado de manera continua. que las parcelas son generalmente pequeñas. sin el uso de fungicidas o pesticidas y únicamente con muy baja cantidad de fertilizantes.

de la misma manera como lo ilustran Kuechler y Zoonneveld (1988). El segundo gradiente D escripción y clasificación de uso de suelo en puntos de muestreo 331 . se refiere a la permanencia (o frecuencia) de operaciones y el segundo. puesto que es difícil asignar un peso adecuado a las variables explicativas. El primer gradiente representa la presencia (proporción en el espacio o tiempo) de vegetación seminatural. el componente de la cobertura de la vegetación (semi) permanente es un indicador útil. que en el entorno de márgenes de selva se traduce en elementos de vegetación leñosa. También. Además. la proporción del tiempo durante el cual la vegetación del suelo se restablece de manera semipermanente. Han existido varios intentos por definir una medida de intensidad de uso de suelo. Es decir. La presencia de vegetación permanente en el sistema de cultivo limitará las posibilidades para cultivar el suelo o la proporción del suelo que puede ser cultivado. los esfuerzos para crear un índice universal o una medida de la intensidad de uso de suelo serán inútiles. puesto que cada índice es una expresión particular de la intensidad del uso de suelo. pero éstos no han sido del todo exitosos. con la relevancia de que un índice en particular dependiente del contexto o propósito para el cual se está desarrollando. la presencia de vegetación permanente disminuirá la influencia de la variación climática en el ecosistema del suelo.gía y manejo de agua. reflejando el grado en el que estos factores tienen un efecto en los ecosistemas (el grado en el que se altera o perturba el ecosistema natural) y debido a que algunas veces los datos requeridos para una evaluación cuantitativa de la intensidad del uso de suelo no son accesibles. se requieren categorías de clases de uso de suelo en términos de la intensidad de uso de suelo (o alternativamente una definición de clases de uso de suelo que reflejen diferentes niveles de la intensidad de uso de suelo). se traduce directamente en la frecuencia del cultivo. en el caso de cultivos migratorios. Para los propósitos de investigar tendencias en la pérdida de la diversidad del suelo en relación con un incremento en la intensidad de su uso. En ambos casos. aunque no directamente relacionado con la influencia de la operación del manejo. indicando que el sistema con una proporción mayor de vegetación permanente (ya sea como elementos de vegetación natural o cultivada) representa una intensidad menor de uso o un grado menor de perturbación. Existen dos principales ejes a lo largo de los cuales se mide la intensidad del uso: el primero. como factores relevantes. Esto se hace considerando aquellos atributos (y clasificadores) que expresen un aspecto en particular de la intensidad de uso de suelo. Lo anterior permite un arreglo de los componentes de la vegetación (objetos) a lo largo de dos gradientes. a la intensidad (o amplitud) de las operaciones.

los objetos de uso de suelo son ordenados a lo largo del segundo gradiente de intensidad de uso de suelo. lo que resulta relevante en el caso de sistemas particulares de uso de suelo. cultivos anuales y pastizales) en el caso de elementos de vegetación cultivados. Cultivos anuales-campo Componente de le vegetación leñosa y semileñosa (natural) Componente de la vegetación leñosa cultivada Componente de la vegetación leñosa no cultivada Componente árbol Selva Tiempo de cultivo-permanencia Plantación 332 Manual de biología de suelos tropicales . se determina basándose en los clasificadores y atributos del sistema de clasificación. de acuerdo con el componente Figura 11. y presencia o ausencia del componente arbóreo. Se puede hacer una subdivisión adicional basándose en la duración del periodo de barbecho. En segundo lugar. Además de servir como una partición en el tiempo. dentro del sistema de cultivo. Los objetos se refieren a árboles que existen en la naturaleza (en el caso de vegetación natural). en el siguiente nivel de especificación.5). selva). de acuerdo con el incremento en la intensidad: “sin cultivar”. La localización a lo largo de los dos ejes. sólo de árboles plantados (plantación) o sólo de cultivos anuales o pastizales. como se ha especificado en el atributo técnico 1. la permanencia se expresa con el factor “tiempo de cultivo” y el sistema de clasificación permite un arreglo de clases de uso de suelo. El continuo puede representarse gráficamente con un triángulo en donde los tres ángulos representan los valores extremos de la cobertura del suelo que solo pueden estar constituidos por árboles naturales (es decir.“cultivos migratorios”. En primer lugar. dentro de cada una de las clases definidas. pero sobre todo.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. para el sistema de cultivo permanente. a árboles plantados o cultivados (árboles cultivados) o elementos de vegetación no leñosos (por ejemplo.representa la cobertura de vegetación leñosa. como en el sistema de “hule de la selva” mencionado arriba.“sistemas de barbecho”-“cultivos permanentes” (véase Tabla 11. este eje también expresa una partición en el espacio entre los elementos de vegetación natural y cultivada.

2. Por ejemplo. operación de cultivo) y con el grado de uso de agroquímicos (para el control de malezas y manejo de plagas y enfermedades) tal y como se indica en la Figura 11. Una diferenciación adicional para cultivos que no son árboles se basa en la permanencia o duración del cultivo.árbol o arbusto en el sistema de cultivo (referido a las proporciones en el espacio o en el tiempo).1). sin cultivo.3). “plátano y otras plantas herbáceas similares”. dentro de las clases resultado de los dos pasos explicados arriba. manual. se deberá considerar la intensidad de las operaciones. También se podrían considerar operaciones de deshierbe con “deshierbe mecánico”. Una asignación de la intensidad de clases se basa en el valor del clasificador en las operaciones de cultivo (es decir. Si la cobertura de los árboles es escasa. Tabla 11. como se ve reflejado en la información sobre la categoría del cultivo (ver atributo técnico 1. tracción animal o medios mecánicos). porcentaje de la cobertura del cultivo. el orden de intensidad de uso sería el siguiente: “cultivo herbáceo”. Una vez más. los cultivos de árboles se consideran menos intensivos cuando se comparan con cultivos de arbustos. Respecto al tipo de cultivo de gramíneas. A un nivel más general.1). Las clases se ordenan de acuerdo con este gradiente utilizando las características del cultivo principal (Tabla 11. tiene que considerarse la información relacionada con los árboles en la finca (Tabla 11. deshierbe y de manejo de plagas y enfermedades) son utilizados para definir las clases de intensidad.5). la clase “bambú” aparece antes que las clases de “pastos”. Existen dos aspectos que deben ser considerados en relación al manejo: uno se relaciona con el grado de perturbación física debida a las operaciones de manejo y el otro se relaciona con el grado de interferencia química con el sistema (uso de agroquímicos). En el caso de cultivos de árboles (sistema basado en árboles) se puede considerar el número de estratos de la vegetación y el porcentaje de cobertura del suelo para una categoría posterior. Tabla 11. las cuatro clases de intensidad se definen de acuerdo con el grado de mecanización (es decir. Si únicamente se toma en cuenta la forma de vida del cultivo principal.1) junto con las características de la cobertura del cultivo (es decir. Respecto a los cultivos sin gramíneas. las plantaciones de árboles se consideran menos intensivas que cuando se trata de arbustos pequeños como el del café o té. En el tercer paso. como un nivel más de intensidad. el rango se lleva a cabo basado en las características de manejo (el cuarto nivel en el sistema de clasificación). D escripción y clasificación de uso de suelo en puntos de muestreo 333 . “lúpulo y otras enredaderas perenes herbáceas” y “cultivo de cobertura”. “cereales” y “arroz” (ver Tabla 11. Los clasificadores y atributos del nivel 4 (especialmente relacionados con las operaciones de cultivo. de gramíneas y con formas de vida herbáceas.2) y combinaciones de cultivo (Tabla 11.

el arado de cincel y. la clase de uso de suelo más intensiva pertenece a “cultivos migra334 Manual de biología de suelos tropicales . estas clases tienen que relacionarse entre sí. El arado de vertedera tiene un efecto más profundo en el suelo (remoción completa). BAJO NIVEL DE INSUMOS QUIMICOS Otra diferencia podría establecerse en función del tipo de animales o maquinaria usada (de acuerdo con los caballos de fuerza) y el tipo de arado empleado. son considerados de manera conjunta. El procedimiento jerárquico descrito arriba producirá ramificaciones claramente separadas en la clasificación del árbol.3. en el primer paso de la clasificación. los clasificadores para el control de malezas y manejo de plagas y enfermedades. el arado escarificado. únicamente se considera el “uso” o el “no uso” de agroquímicos. que representa el nivel más bajo de perturbación. En cuanto al orden de categoría respecto del uso de agroquímicos. INTENSIDAD MEDIA: BAJO GRADO DE MECANIZACIÓN. ver Tabla 11. tipo de equipo o maquinaria usada en el caso de plagas y enfermedades y el volumen de aplicación. A nivel más general. Al final. pero una diferencia más.3. Como se ilustra en la figura 11. una evaluación por pares de clases de uso de suelo individuales en la región de superposición dará la clasificación final en términos de la intensidad de uso de suelo.2.6b). Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. y no reconoce que puede haber una superposición considerable en términos de intensidad de uso de suelo entre las clases. BAJO NIVEL DE INSUMOS QUIMICOS INTENSIDAD MEDIA: ALTO GRADO DE MECANIZACIÓN. podría basarse en el volumen de aplicación (aplicación selectiva o localizada. Esto se puede observar en la figura 11. ALTO NIVEL DE INSUMOS QUIMICOS Grado de disturbio físico INTENSIDAD BAJA: BAJO GRADO DE MECANIZACIÓN. La superposición será considerable entre las clases de sistemas de barbecho y sistemas de cultivos permanentes. Para poder llegar a una clasificación final de clases de uso de suelo en términos de intensidad de uso. por último. ALTO NIVEL DE INSUMOS QUIMICOS Uso de agroquimicos INTENSIDAD ALTA: ALTO GRADO DE MECANIZACIÓN. considerando una plantación de árboles (cultivo permanente bajo manejo extensivo) representará un sistema menos intensivo que un cultivo manejado intensivamente bajo un sistema de barbecho corto.Figura 11. seguido por el arado de disco.

considerando que la cobertura de árboles en plantaciones puede ser entre el 60% al 70% de la intensidad de uso. cultivo permanente Pchi: cultivo intensivo.3 Clasificación del uso del suelo en términos de la intensidad de uso. cultivo permanente Pge: pastizales extensivos. lo que se toma como el límite superior para la clase “cultivos migratorios”. cultivo permanente Pti: cultivo de árboles intensivo. se aplican los mismos criterios que en el segundo y tercer pasos de la clasificación. Para establecer una comparación de clases de uso de suelo individual. en las regiones superpuestas entre la categoría mayor de uso de suelo. cultivo permanente Pgi: pastizales intensivos. sistema de barbecho (4-5 meses < barbecho < 8-9 meses) Fsci: cultivo intensivo. cultivo migratorio (barbecho < 1–2 años) Flce: cultivo extensivo. este pasto se considera el tipo de vegeD escripción y clasificación de uso de suelo en puntos de muestreo 335 . sin distinguir. si el suelo está en barbecho el 60% del tiempo y la vegetación de ese suelo es pasto. Donde: Fn: selva natural Fl: selva explorada Slce: cultivo extensivo. bajo cultivo migratorio (periodo de barbecho > 8-10 años) Smce: cultivo extensivo. Esto quiere decir. en primera instancia. donde se determina el orden a lo largo del gradiente de intensidad de uso de suelo descrito anteriormente. bajo cultivo migratorio (1-2 años < barbecho < 8-10 años) Ssce: cultivo extensivo. cultivo permanente torios” y es seguida por el de menos intensidad de uso “cultivo permanente”. si proviene de orígenes culturales o (semi) naturales (por ejemplo. que corresponde al 66% del tiempo que la tierra no es cultivada. cultivo permanente Pcmi: cultivo de intensidad media. sistema de barbecho (barbecho > 8-9 meses) Fmcm: cultivo de intensidad media. sistema de barbecho (barbecho 4-5 meses) Pte: cultivo de árboles extensivo. que se considera la forma de vida de la vegetación dominante o cultivo.Figura 11. en esta fase.

Sanchez and P. FAO. y Swift. S. Marcel Dekker Inc. Pimentel (ed) Encyclopaedia of Pest Management. es decir. M. Woods. D. J.New York. P. G... A. Moreira.-X. H. 336 Manual de biología de suelos tropicales . J. A. selva manejada y selva explotada.. y Dorr. Techniques and Equipment.. Respecto a la selva. N. más que al barbecho en sí) para permitir a la clase bajo consideración subir una o dos posiciones en el orden de clasificación. Craig. Di Gregorio. FAO Soils Bulletin 77. Huang. De esta manera. “sistemas de barbecho” refiriéndose al componente de cultivo. Nwaga. de acuerdo con los sistemas de uso de suelo en el trópico húmedo a diferencia del proyecto ASB (Bignell et al. Igualmente. se hace una distinción entre selva natural. L. P. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. si se compara con un cultivo anual con un sistema de barbecho corto (Fsc).. Dibog. F. D. F.tación dominante). y Jansen.. Pashanasi. J. Management and Conservation Service. GCP/RA/287/ITA Africover – East Africa Project and Soil Resources. (2002) ‘Aerial application’. si se compara con un área de cultivo permanente bajo manejo intermedio o bajo (Pcmi). I. Columbia University Press. P. E. Vosti. un cultivo con un manejo intensivo bajo un sistema de barbecho corto (Fsci) puede subir una posición. (2002) Soil Management and Conservation for Small Farms.. Rome. Strategies and Methods of Introduction. aun en el caso de que sean manejados intensivamente (Pgi) tendrán una clasificación más baja en términos de intensidad de uso de suelo. B. FAO. los pastizales permanentes. in D. A.. M. in C. L. V. con la introducción de una noción de que la extracción de productos de la selva sirve como un indicador para la intensidad de uso. Susilo. Peter Okoth por las discusiones en la preparación de este capítulo. (2000) Land Cover Classification System (LCCS): Classification Concepts and User Manual. 2005). De Freitas. Rome. En el segundo ejemplo se considera la intensidad de manejo (en relación con el cultivo más demandante del sistema. J. Agradecimientos Al profesor Ken Giller por sus comentarios y al Dr. REFERENCIAS Bignell. (2005) ‘Belowground diversity assessment: Developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. A. Palm. S. New York.. Tondoh.

Manurung. Zandstra. F. Bignell. Barrios. D. Wibawa. Dordrecht.. (2001) Handbook for the Field Assessment of Land Degradation.. London. E. Ruthenberg. vol. R. T.org/swcmeas. M. Iowa State University (2004) ‘Weed Science’. N.. (eds) (1988) Vegetation Mapping. I. Kuechler. M. A. Earthscan Publications Ltd. (1991) ‘Formal data structures.. J. (1975) Land Use in Advancing Agriculture. y Kiefer. (1997) ‘Agricultural intensification. M.. A. J. B.edu/mgmt/2004/ world. G. (2005) ‘Soil biodiversity in rapidly changing tropical landscapes: Scaling down and scaling up’.. Swift. A pattern recognition approach to land use inventory at the sub-regional scale using remote sensing and GIS applying an object oriented and data-driven approach’..shtml. Wageningen Agricultural University. Ph. W.orst. Kluwer Academic. www. J. G... Oregon State University (2005) Pacific Northwest Weed Management Handbook. y Collinsons. M. D escripción y clasificación de uso de suelo en puntos de muestreo 337 . Molenaar. D. www. Barois. y Williams.iastate. R. New York. I. P.. Wichman Verlag. Izac. 6. Cambridge. 3–16. Oxford. M. pp. D. Amsterdam. Handbook of Vegetation Science. ILACO (1985) Compendium for Agricultural Development in the Tropics and Sub-Tropics. (2002) Jungle Rubber: A Traditional Agroforestry System Under Pressure. L. Berlin WOCAT. Vink. object dynamics and consistency rules’. Cambridge University Press.. Clarendon Press.. Karanja. H.. J. H.wocat. Bardgett and D. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica.. Baere. Bogor. S... The Netherlands. www. Applied Soil Ecology. The Netherlands. and Murnaghan. ippc. Fritsch and C. D. in H. M. van Noordwijk.asp. P. M. M. Joshi. y Swift. R.. A. H. Lavelle. Lillesand. E.. Huising. Elsevier Science Publishers B. Boutin. N. Thesis. J. The Netherlands. E. Karlsruhe. Molenaar. Indonesia. (1987) Remote Sensing and Image Interpretation. W.. P. Hopkins (eds) Biological Diversity and Function in Soils. Taylor & Francis Ltd. K. G. John Wiley & Sons. in M. A. Springer Verlag. Heipke (eds) Digital Photogrammetric Systems. (1980) Farming Systems in the Tropics. W. World Overview of Conservation Approaches and Techniques.. MacArthur. D. (1998) An introduction to the Theory of Spatial Object Modelling for GIS. M.weeds.D. N. London. Stocking. Giller. K.V. E.edu/pnw/weeds. Vincent.-M. y Zonneveld. Lavelle. Ebner. E. 3rd edition. S. y Huising. ICRAF-Southeast Asia Regional Research Programme. M. P. Usher. Moreira. vol. van Noordwijk.Giller. Akiefnawati.. soil biodiversity and ecosystem function’. 10.

.

Brasilia. 13.904-979. D. constant@unb. Bignell. Departamento de Zoología. Kenya.hu. Coe. Brazil. Franklin. Csuzdi. Systematic Zoology Research Group of Hungarian Academy of Sciences and Hungarian Natural History Museum.ac. DF. GKVK Campus. P. CEP 69011-970. Universidade de Brasilia (UNB).com.br. M. DF. United Nation Avenue. India. Sabah. cares@unb. Universidade de Brasilia (UNB).uk. Institute for Tropical Biology and Conservation. Brazil.904-970. DF. Cares. Cx Postal 478. dbagyaraj@vsnl. Coordenação de pesquisas em Entomologia. csuzdi-alef@nhmus. D. R. CEP 70910-900 Brasilia. J. Belo Horizonte MG.org.coe@ criar. University of Agricultural Sciences. Departamento de Fitopatología. E. Brazil. Instituto Nacional de Pesquisas da Amazõnia (National Institute for Amazonian Research-INPA). d. Departamento de Fitopatología. Universidade de Brasilia. lmabreu@gmail. E. Cx Postal 4457. Campus Universitario Darcy Ribeiro. Instituto de Ciências Biológicas. CEP 70. PO Box 30677-00100. Constantino. Brazil. Manaus.br. Instituto de Ciencias Biológicas.gov. World Agroforestry Centre (ICRAF). (finado). Huang. J. Abreu. Brasilia. 339 .com. Departament of Agricultural Microbiology. Gigiri. H-1088 Budapest. Cx Postal 4457. r. E. S. beth@inpa. AM.Colaboradores L. Universidade Federal de Minas Gerais. Nairobi. Instituto de Química. CEP 70. 88999 Kota Kinabalu. Malaysia. Barross str. Brazil. R.br. Universiti Malaysia Sabah.bignell@qmul. Hungary. Bangalore. C. Bagyaraj.

Jr. CEP 37200-000. Tondoh. CEP 89010-971. Skonate2@yahoo. A. c/o ICRAF. Faculty of Agriculture. Indonesia. Departamento de Ciências Naturais. Lavras . Departamento de Biología (Biology Department).id. Instituto Nacional de Pesquisas da Amazônia (Nationale Institute for Amazonian Research-INPA).br. morais@inpa. AM. S. C.com. N. UFR des Sciences et de la Nature. PO Box 161. Brazil. CEP. Indonesia. Stürmer. Departamento de Fitopatologia. Manaus.huising@cgiar. Bogor. 46. Universidade Federal doAmazonas. X. J. Jalan Sumantri Brojonegoro nº 1. tondohj@ yahoo. Faculdade de Ciências Agrárias. World Agroforestry Centre SE Asia.br. Cx Postal 3037. asgknila@yahoo. Brazil.com. A. Huising.com. Departamento de Entomología. L. Morais. F. E. N. M. jlouzada@gmail. MG. Blumenau. Departamento de Ciência do Solo (Soil Science Department). Karyanto. M. 801. fmoreira@ufla. CEP 69070-000 Manaus. Lavras. L.gov.br. Silva. University of Lampung. Universidade Federal de Lavras. Gigiri.go. H.org. Universidade Federal de Lavras. swiftmj2003@ yahoo. ludwig@ufla. 340 Manual de biología de suelos tropicales . Moino.br. j.P. Bandar Lampung 35145. PO Box 30677-00100 Nairobi. Tropical Soil Biology and Fertility Institute of CIAT.com. Department of Plant Protection. Côte d’Ivoire. F. Konaté. Université d’Abobo-Adjamé. S. Universitas Lampung. AM Brazil. Tropical Soil Biology and Fertillity (FSBF) Institute of CIAT. Brazil. Gigiri. Cx Postal 3037. Susilo. nmarques@ufam. Cibinong. Rahmadi. m. Abidjan 02. Zoology Division. Universidade Federal de Lavras. Swift. Cx Postal 1507.com. cahyo. C. Raya Jakarta-Bogor Km. W. PO Box 30677-00100. MG. RC Biology.rahmadi@lipi. J.br.. CEP 37200-000 Lavras MG. Indonesia. B. SC. Abidjan. Moreira. Brazil. fxsusilo@tlkom. 16001 Indonesia.net. M. Kenya. United Nations Avenue. Bandar Lampung 35145. J. Faculty of Agriculture.edu. Coordenação de Pesquisas en Entomnologia. Brazil. Brazil. Cx Postal 478. United Nations Avenue. Cx Postal 3037.van-noordwijk@cgiar. Jalan Suantri Brojonegoro nº1. Louzada. Côte d’Ivoire. Lavras. alcmoino@ufla. S. Cx Postal 3037. 02 BP 801. 69011-970. van Noordwijk. Nairobi. J.fr. LIPI JI. Universidade Federal de Lavras. Pfenning. Kenya. sturmer@furb. Universidade Regional de Blumenau. CEP 37200-000.E. M. Université d’Abobo-Adjamé. Centre de Recherche en Ecologie. J.br. c/o ICRAF. CEP 37200-000.

zanetti@ufla. Zanetti.br. C olaboradores 341 . Departamento de Entomologia (Enthomology Department).R. Lavras. CEP 37200-000. Brazil. MG. Universidade Federal de Lavras. Cx Postal 37.

.

243. 126. 247–248 arado 311.314. 251-252 bienes y servicios. 334 aislamiento 190. 263 análisis de conglomerados (cluster) 267 análisis de correspondencia (AC) 266 análisis de varianza (ANOVA) 265 análisis filogenéticos198. 99. 217. Véase análisis de correspondencia ácaros oribátidos 150 ácaros 149-159 acceso a puntos de muestreo 84. 132 mesofauna 159. de uso de suelo 302 B bacteria 39.85 ácido láctico 156 aditivos 279. 290 bacterias fijadoras de nitrógeno (BFNFNL) 177-213 Basidiomycota 248. 291 análisis automatizado del espaciador intergénico ribosomal (ARISA) 261. 132 343 . Véase atributos atributos técnicos específicos. 151.Índice analítico A abundancia macrofauna 98. 288. 290-294 alimentación especializada o incidental 111 almacenamiento de las muestras 78.127. 177-214. 252-153 Asia 140–141 atributos 297. 40. 191. 93. 334 Ascomycota 248.160 nematodos 171-172 AC.164. Véase servicios ecosistémicos biomasa 127. 246 agroquímicos 313. 280 África 141–142 agroecosistemas 43. 194-197. 302-329 atributos de tamaño de unidades de muestreo campo o parcela 304-307 cuadrícula 81-82 atributos técnico.

325-329 colecciones de recursos genéticos 267 Collembola 123. conservación y manejo sostenible de la biodiversidad del suelo 344 Manual de biología de suelos tropicales cuadrícula estratificada 84-85 cultivo post inundación 308 cultivos de sotobosque 308 cultivos migratorios 309. 300. 101. 149-162 colonización 219-224 colonizadores (c) 172-174 combinación de cultivos 308-311. 96. 303 DGGE. 125-132. 129. 265-267. 226-232 hongos 244. 188. 304307. 302. 302. 334335 clasificación de procesos 93. 319-320. 298. 58 . Véase taxonómica clasificación. 102 clasificación. 245. 325-329 caracterización cultural 189. Véase PCR competitivo CSM-BGBD. 301. 194 HMA 219-222. 310. 317 cPCR. Véase disturbio datos requeridos y análisis 49-50. uso de suelo 81 categorías tróficas 110-112. 164 descomposición 29-35. 94. 304-324. 158-160. 243. 265-267 macrofauna 98-100. 251 ciclo de nutrientes 34 clasificación de uso de suelo 332. jerarquía 323 clasificadores 297. Véase electroforesis en gel con gradiente de desnaturalización diapausa 289 disección 157 diseños multiescala 64 diversidad BFNFNL 178-182. 246 descriptores genéricos 194 desmonte de la tierra 311. 307 características del cultivo 301. 124. 190 caracterización de sitios 87-88 caracterización genética 197 cartografía.biopesticidas 288 bioturbación 34 C C. 37-38. cultivo 305-307 depredadores 37. 265 curvas de rarefacción 265 Cylindrocladium spp. 313-315 determinación a priori 65. 316 cultivos puros 198 cultivos secundarios 307 cultivos trampa 231-232 curvas de acumulación de especies 113. 58. 110 nematodos 171-172 uso de suelo 42-43. Véase colonizadores cálculo. 197. 302-304 densidad. 171-172 cercas vivas y otros elementos de vegetación 319-321. Véase enumeración cobertura. cultivo 305. 331-332 Chromista 247 Chytridiomycota 248. 254-255 D D. Véase Proyecto. 325-329 conjunto mínimo de datos 129-132 contaminación 78 control microbiano 287 cosecha 311. 97.

128 especies epigeas 78. Véase ensayo de reducción de acetileno escala 62 escalas espaciales de muestreo 42-50. 70. 128 especies trampa 185-186 esporas 88. 99. 319 enfoque sesgado 65 enfoques transversales 57 ensamble de especies 110 ensayo de reducción de acetileno (ERA) 185. 110-111. 128 especies clave 129 especies endógenas 99.99-100. 71 etiqueta 97. 94-100 esquemas de puntos de muestreo 72-75 estacionalidad 88. 317 fertilizantes inorgánicos 315 fijación de nematodos 165-169 G glomerales 220 Glomeromycota 247 gradientes. 288 esquemas de muestreo alternativos 5789. 317.6567. 163-165 grupos funcionales de la biota del suelo 38-41 H herbívoros 37 hidróxido de potasio (KOH) 156 hipótesis de CSM-BGBD 57 Í ndice analítico 345 . 190. 85-86 escarabajos 100-113. 36. 191 enumeración 168.E eficiencia en la labranza 312-314 electroforesis en gel con gradiente de desnaturalización (DGGE) 259-260. 226-228. 287. 257 esporas de HMA 226-228 método de Berlese 152-154 método de extracción Winkler 92. 312. 152-155 enfermedad 35. 112125. 132 nematodos 165-166 extracciones núcleo por núcleo 154 F factor tiempo de cultivo 309. 116-125. 193 equidad 266 ERA. 283 extracción DNA 197. 263 embudo de extracción 149. 104. 98 estándares para BFNFNL descripción de especies 194-196 estatus de los cultivos 318 estratificación en el muestreo 55-57. 130. 113. 229-231. 115-117. 322-323. 128 fertilizantes 314-316. 218. muestreo 80-81 gremios 114-115 grupos funcionales 29-41. 189. 140 especies anécicas 100. 315. 330-333 familia Acaulosporaceae 238 familia Archaeosporaceae 239 familia Gigasporaceae 240 familia Glomeraceae 236 familia Pacisporaceae 239 familia Paraglomeraceae 239 fase de pupa 284 fauna de la hojarasca 37. 162. 114-118. 192 .

64. 243-280 hongos fitopatógenos 41 hongos micorrizógenos 217-241 hongos micorrizógenos arbusculares (HMA) 41.HMA. 330-336 inventarios 41-50. 302-304 manejo de la biota del suelo 47-49 muestreo 79-80 replicación y tamaño de muestra 60–65 I identificación grupos funcionales en macrofauna 112-113 HMA 226-228. 140 hospederos promiscuos 178-185. 100–113 . patógenos de plantas 41. 217-241 hormigas 40. 129 inoculación 47. 114-118. 41 HMA 217–241 patógenos de plantas y saprofitos 41. 193 insectos 287-294 intensidad de uso de suelo agrícola 42. 87-88. Véase hongos micorrizógenos arbusculares hongos entomopatógenos 287-294 esquema de medición por puntos 74 grupos funcionales 39. 301. 91-92. 317 J jarras de Leonard 186. 305-306. 187. Véase también taxonomía IM. 304. 243-280 hongos saprofitos 41.173 índice de riqueza de género 171 índice de Shannon–Wiener 266 infiltración de glicerina 168 ingenieros del ecosistema 34. 100-113. 44. 313. 297-336 investigaciones piloto 60 irrigación308. 306 índice de diversidad de Shannon 171 346 Manual de biología de suelos tropicales L labranza 312. Véase índice de madurez imágenes satelitales 67. 46 datos requeridos 48-50 descripción y clasificación 299. 193 jerarquía clasificación 323 clasificación de uso de suelo 300-302. 293. 263-264 índice fitoparasítico (IFP) 172-174 índice de madurez (IM) 172. 166-168 organismos entomopatógenos 290. muestreo de 63. 259-260. 91. 185–187 huella molecular 196-198. Véase Sistema de clasificación de cobertura de suelo límites.93–100. 217. 140-144 mesofauna 156-159 moscas de la fruta 284-285 nematodos 163-165. 91. 310 limpieza de malezas 313-315 listas de especies 107-109 lombrices de tierra 40. 243-280 hongos antagonistas 41 hongos del suelo. 37. 229-230 hongos 255-256 lombrices de tierra 98-100 macrofauna 105-110. 53. 334 labranza mínima 312 LCCS.

75-77. 287–295 nematodos bacteriófagos 164 nematodos omnívoros 164 Í ndice analítico 347 . 91-148 manejo 311-319. 56. para hongos 252-255 mesofauna 39. 197. 263 método de Seinhorst 168 método de Seinhorst modificado 169 método Winkler 92.118125.84–85 paisajes 61-63 aleatorio y sistemático 67-68 muestreo en transectos monolitos para lombrices de tierra 97 macrofauna 75. 114-118. 130 métodos de extrapolación 105 métodos de montaje 157–158. 98-100.149-160 método de Berlese 149-160 método de Berlese modificado 154-155 método de centrifugación en azúcar 166 método de de extracción 190.256–259. 73. 214 muestreo dentro de una parcela 65 muestreo animales 39 BFNFNL185–189. 82–83.114–118.84–85 nematodos 165 punto de muestreo 62-63 muestreo aleatorio 55–56 muestreo en cuadrícula clasificación de uso de suelo 304 CSM-BGBD 79–80. 73. 263-264 método de la cuadrícula de intersección 227-228 método de partículas de suelo251–253 método de reacción en cadena de la polimerasa (PCR) 196. 131 número de muestras 81–83 esquema de puntos de muestreo 72–75 muestreo estratificado 67. 40.M macrofauna 39. 321-330 materia orgánica 29-35 materia orgánica del suelo (MSO) 34. 40. 193 muestras control 193. 73 microhabitat 47. 54. 131 monolitos complementarios para lombrices de tierra 97 moscas de la fruta 281-286 muestras compuestas 61–65. 229–230 métodos TSBF 93–94 microfauna 37-38. 260. 67-68 muestreo sistemático 67-68 N nematodos 163–176. 40. 334 media poblacional 25 medidas de conservación 318 “medio 79” 214 medio “S” 293 medio selectivo. 126. 58 mecanismos de control 313-315 mecanización 311. 48-49 monolitos 94–100. 249. 118. 193–195 clasificación de usos de suelo 297-336 diseño y estrategias 53-90 hongos 249 inventarios de biodiversidad 42-47 macrofauna 91-148 mesofauna 149-162 moscas de la fruta 282-285 muestreo adaptativo 64. 39. 97 muestreo no aleatorio 67 muestreo secuencial 64 muestreo simple aleatorio (MSA) 55. 290 método de filtración de partículas 252– 254. 261.

250 . 126 número más probable (NMP) 218. 48. 165. 307–311. muestreo 81. 315. 48-49.79–89. 78.147–148 nivel regional 44. Conservación y manejo sostenible de la biodiversidad del suelo (CSMBGBD) 45–47. 314 Phytophthora spp. 49. Véase Método de reacción en cadena de la polimerasa permanencia de la vegetación 330–332 persistencia (p) 172.nematodos parásitos de plantas 164 nematos micofagos 164 nicho. 7980. 63 prueba piloto 60 pseudo-replicas 62 puntos de medición 53 puntos de muestreo 74 puntos de muestreo.185–198. Véase persistencia paisajes 44–47. 219224 O observación directa 302 observaciones secundarias 303 Oomycota 250 organismos entomopatógenos 287–295 organismos mutualistas 39 P p. 319 plantaciones 322–324 348 Manual de biología de suelos tropicales plantaciones de teca 328 plantas hospederas 178–182. 328. 219 población. 174 pesticidas 286. muestreo 60-62 polimorfismo de conformación de cadena única (SSCP) 261.218. 263 polimorfismo de longitud de fragmentos de restricción (RFLP) 260 polimorfismo de longitud de fragmentos de restricción terminal (T-RFLP) 260. 38. 249–255 proceso de aclarado 156-157 procesos de degradación 44 procesos de rehabilitación 44 productores primarios 37 programa Africover 299 propágulos infectivos 219-224 protozoa 247 proyecto. 300–336 patógenos fúngicos de plántulas 255 perturbación (P) 56. 126. 330 PCR competitivo (cPCR) 262 PCR cuantitativo 261-262 PCR. 132 Pythium spp. 64-65. 244. 263 prácticas culturales 301. 325. 83–84. 41 procedimientos basados en cultura 333–245. 317. separación de 85-86 puntos. 85–86. 298 prueba de hipótesis 55–57. 57. 102 nivel de parche 46–47. subparcela o microhabitat 47. 81. 329 preparación de la tierra 311-312 primers específicos para “hongos” 257258 principales grupos funcionales 35-38. 184–186.61-62 parcelas de muestreo y clasificación de uso de suelo 46–47. 191 nivel de nicho 47. 145. 49 nivel neotropical 142. 49 nitrogenasa 184.140–144 nomenclatura 106. 250 plagas 35.

329 sitios de muestreo 60-63. 149 trampa 118-125. 229-230 macrofauna 105 mesofauna 158-159 moscas de la fruta 281. 256–265 termitas 40. 82. 103105. 126. 145. 103. 188189 técnicas de cebo 119. 251 Ricinius communis 254–255 riqueza de especies 265–267. 227 tipos de anidación 112-113 trampa de especies múltiples 185.279–280 técnicas de lavado para partículas del suelo 252. 140.249–252. 317 taxonomía BFNFNL 177–182 HMA 219-222. 149 trampa White 293 Í ndice analítico S secuencia de cultivos 107 secuenciación 16S rDNA 196 selección subjetiva 67 servicios ecosistémicos 29–36. 300–302. Véase Polimorfismo de conformación de cadena única sustancias químicas 156-158 349 .R reactivo de Melzer 230-231 reglas de decisión para la clasificación de usos del suelo 323 rendimiento.267 técnicas de procesamiento de muestras 78. 123. 147 termitas que se alimentan de madera 111 termitas que se alimentan del suelo 110 TGGE. 263 técnicas de preservación 267 técnicas de preservación 93-94. 284 neotropical 145 Véase también identificación visión general 29. 325. 297–299 rizosfera 249 rotación. 328. 36-41 técnica de infección de plantas 178. 155158 técnicas específicas de DNA 197. 30–33. 285 respuestas multivariadas de interés 63-64 RFLP ver polimorfismo de longitud de fragmentos de restricción rhizobia 177-183 Rhizoctonia spp. 314–316.124. 334. 93-95. medición del estatus de los cultivos 318-319 resguardo de especímenes 192-193. 79 solución de nutrientes Jensen’s 215 solución Nesbitt 158 SSCP. 100–113. 263 tinción de raíces 224–226.187 trampas McPhail 282 BFNFNL 190 pitfall 118-125. 304–319. 163 sistema de clasificación de cobertura de suelo (LCCS) 299 sistemas de barbecho 309–310. 130-132. 130-132. 335–336 sistemas de cultivo 42. 41. 124. 91. Véase electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) 259–260. 253-255. cultivos 310-311 roundup 314 T tasas de aplicación 303.

70–72. 58 hongos 243 inventarios 87-88 muestreo 65-67.trampas sin cebo 118 transecto de entrenamiento 102 transformación de datos 126. 132 U uso de suelo a priori definición de clases descriptivas 65. efectos de mitigación 301. 159-160 transformadores procariotas 38 T-RFLP. 48 W WOCAT World Overview of Conservation Approaches and Technologies 318 Z Zygomycota 248 350 Manual de biología de suelos tropicales . 61–62. 300. 83. 331–333 ventanas para muestreo 60. 83-84 Véase también intensidad de uso de suelo área de uso de suelo 46. 303 BFNFNL 186 cartografía 81 definición de clases 321–324 descripción y clasificación 297–336 diversidad 42. 298.7981. 320–322 vegetación semi-permanente 331 vegetación. Véase polimorfismo de longitud de fragmentos de restricción terminal trituradores 260 V valores cp 171-174 variabilidad 70-72 variabilidad de datos 44. 64. 87 variabilidad intragrupo 51 vegetación leñosa 319.

20 de Noviembre No 649. Xalapa.Manual de biología de suelos tropicales. C. Tel/FAX (228) 890 6204/815 1876 www. Bignell se terminó de imprimir durante el mes de mayo de 2012 en los talleres gráficos PROAGRAF.com. editado por Fátima M. S.mx Se tiraron 1.proagraf.A. P. México. Badillo. S. Jeroen Huising y David E.000 ejemplares . Av. de C.V. Veracruz. E. 91190. Col. Moreira. Muestreo y caracterización de la biodiversidad bajo suelo .

Sign up to vote on this title
UsefulNot useful