P. 1
667

667

|Views: 184|Likes:

More info:

Published by: Ricardo Daniel Medrano on Jul 02, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

11/16/2015

pdf

text

original

Manual de biología
de suelos tropicales

Esta publicación presenta parte de los resultados del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity”, implementado en siete países tropicales: México, Brasil, Costa de Marfil, Kenia, Uganda, India e Indonesia. El proyecto es coordinado por el Tropical Soil Biology and Fertility Institute del CIAT (TSBF-CIAT) con co-financiamiento del Global Environment Facility (GEF), y con apoyo para su implementación del Programa de Naciones Unidas para el Medio Ambiente (PNUMA-UNEP). Las opiniones expresadas en esta publicación pertenecen a los autores del libro y no necesariamente concuerdan con las de PNUMA-UNEP o GEF. La traducción y publicación de este libro en español fue posible gracias al apoyo financiero del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity” y al Instituto Nacional de Ecología (INE). También queremos agradecer todas las facilidades proporcionadas por Tiberious Brian Etyang del Tropical Soil Biology and Fertility Research Area of CIAT (TSBFCIAT) Nairobi, Kenia, a Teotonio Soares de Carvalho de la Universidade Federal de Lavras, Brazil, al Dr. José Antonio García Pérez por sus valiosos consejos y sugerencias, y a Caridad González Lerma por cuidar los últimos detalles.

Manual de biología de suelos tropicales
Muestreo y caracterización de la biodiversidad bajo suelo
Fátima M. S. Moreira, E. Jeroen Huising y David E. Bignell (editores )

Secretaría de Medio Ambiente y Recursos Naturales (S emarnat) Instituto Nacional de Ecología (INE)

Título original de la obra: A Handbook of Tropical Soil Biology Sampling and Characterization of Below-Ground Biodiversity © Earthscan en el Reino Unido y Estados Unidos en 2008 Hardcover ISBN: 978-1-84407-621-5 Paperback ISBN: 978-1-84407-593-5

Revisión de capítulos por especialistas en el tema: Dra. Isabelle Barois Boullard, Instituto de Ecología, A.C. Dra. Simoneta Negrete Yankelevich, Instituto de Ecología, A.C. Dra. Rocío Vega Frutis , Instituto de Ecología, A.C. M.C. José Antonio Gómez Anaya , Instituto de Ecología, A.C. M.C. Francisco Franco Navarro, Colegio de Posgraduados Dra. Esperanza Martínez-Romero, Centro de Ciencias Genómicas, UNAM Dra. Lucia Varela Fregoso, Hongos y Derivados, S.A. de C.V. Dr. Juan Rull Gabayet, Instituto de Ecología A.C. Dra. Dora Trejo Aguilar, Universidad Veracruzana

Primera edición: 2012
D.R. © Instituto Nacional de Ecología

Periférico Sur 5000. Col. Insurgentes Cuicuilco, Deleg. Coyoacán, 04530, México, D.F. www.ine.gob.mx

Coordinación General de la Publicación en Español: Isabelle Barois Boullard Coordinación editorial y formación: Raúl Marcó del Pont Lalli Corrección de estilo: Adriana Victoria Arcos Méndez Revisión y preparación de originales: Martín De Los Santos Bailón Colaboradora en la traducción al español: Judy Shirley Adaptación del texto: Mariluz Pérez Lorenzo Diseño portada: Álvaro Figueroa Foto de la portada: Claudio Contreras Edición para internet: Susana Escobar Maravillas Forma sugerida de citar el libro: Moreira, F., E. J. Huising y D. E. Bignell. 2012. Manual de biología de suelos tropicales. Muestreo y caracterización de la biodiversidad bajo suelo. Instituto Nacional de Ecología, México, 337 pp., México.
Ninguna parte de esta publicación, incluyendo el diseño de la portada, puede ser reproducida, traducida, almacenada o transmitida de forma alguna ni por ningún medio, ya sea electrónico, químico, mecánico, óptico, de grabación o de fotocopia sin permiso previo de los editores. Pequeños párrafos, tablas o figuras, pueden reproducirse dentro de lo estipulado en la Ley Federal de Derecho de Autor y el Convenio de Berna, o previa autorización por escrito de la editorial. ISBN: 978-607-7908-31-9 Impreso y hecho en México

Índice

1 2 3 4

Listado de tablas Listado de figuras Prólogo a la edición en español Prólogo Prefacio Lista de acrónimos y abreviaturas El inventario de la biodiversidad biológica del suelo: conceptos y guía general Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo Macrofauna Collembola, acari y otra mesofauna del suelo: el método Berlese

9 10 13 17 21 25 29 53 91 149

preservación e identificación de moscas de la fruta 163 177 217 243 281 287 10 Hongos y nematodos entomopatógenos 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo Colaboradores Índice analítico 297 339 343 .5 6 7 8 9 Nematodos del suelo Bacterias formadoras de nódulos en leguminosas Hongos micorrizógenos arbusculares (HMA) Hongos del suelo saprófitos y patógenos de plantas Muestreo.

1 5.7 11. a través de una gradiente de perturbación de la selva.1 3.3 11. Especie de bacterias formadoras de nódulos en leguminosas Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes. unidades de referencia. Familia.2 1. labranza y deshierbe Clasificadores y atributos para el manejo de plagas y enfermedades.1 3.Listado de tablas 1. biota del suelo y principales grupos funcionales a los que pertenecen Principales grupos funcionales de la biota del suelo Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. Género. en la provincia de Jambi del centro de Sumatra Composición química para aclarar y montar especímenes Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina Familias y valores cp utilizados para el índice de madurez Familias y valores cp utilizados para el índice fitoparasítico Filum/Orden.3 6.2 5.4 11.1 11.6a 11.10 11.1 11.2 4.9 11.2 11.1 7.11 Número de especies descritas en las principales categorías taxonómicas de plantas. amplificados del DNA total Clasificadores y atributos técnicos para el cultivo principal Tamaño del campo y características de la cobertura del cultivo Atributos de cultivos combiandos Características del suministro de agua Factor tiempo de cultivo Clasificadores y atributos relacionados con la limpieza de la parcela.1 8.5 11. procesos asociados de cambio y componentes relevantes de la biodiversidad Grupos de organismos del suelo colectados utilizando diferentes métodos de captura Ejemplo de lista de especies Densidad numérica (individuos m-2) de termitas en siete localidades.8 11.6b 11. fertilizantes y cosecha Características de la parcela y distribución del uso de suelo Características de los árboles en la finca (TROF) Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca Ejemplo de clasificadores y valores de atributos para parcelas de maíz 26 33 44 72 103 122 154 167 168 169 174 210 253 295 297 298 298 299 303 307 310 312 315 318 319 .1 1.3 2.1 5.

a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. esto aumentará la precisión de la estimación de la pendiente. 59 Esquema de muestreo por puntos para toda la biota. clasificados de acuerdo con dominios y reinos. 109 Esquema de una trampa pitfall con cebo.2 3.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. utilizando un transecto de 50 m. utilizando una pequeña cuchara o cuchillo de campo. 116 Sacabocados de metal. utilizando permutaciones de datos al azar. tamaños y procesos de ecosistemas relacionados. hormigas. d) reconociendo los límites como otra categoría. arañas y otros artrópodos. 94 Extracción de termitas de una muestra de suelo en una charola de aluminio. 148 . 70 Esquema alternativo para muestrear macrofauna.4 2.2 2. 77 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. 81 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). cuatro palitos pequeños y una cubierta de celofán. por estratificación. 32 Principales grupos funcionales. 35 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. 115 Trampa pitfall improvisada. 71 Ejemplos de diferentes configuraciones de ventanas de muestreo. 91 Esquema de alineación de monolitos complementarios de lombrices de tierra.1 2. dando un estimado pobre de la pendiente. según se requiera.3 2. estudiados en el proyecto CSM-BGBD.1 1. hecha con un vaso.3 3. b) ilustración de la división de una cuadrícula entre seis.1 3. tres y dos ventanas. dispuestas a lo largo del gradiente. 54 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo.Listado de figuras 1. b) tres cuadrículas que muestrean tres diferentes parches de selva.6 3.7 4. para muestrear la mesofauna en la hojarasca y en el suelo mineral. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. El muestreo se puede ampliar si se usa uno o dos transectos para termitas. 93 Separación a mano de lombrices de tierra en charolas de plástico. b) se utilizan guantes como precaución contra enredaderas. c) incrementando la replicación.4 3. b) si se incluyen de manera deliberada valores de MOS más extremos. mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra. a) cuadrícula completa.6 3. 99 Ejemplo de curva de acumulación de especies con una desviación estándar.2 2. con puntos de muestreo adicionales.5 2.5 3. hormigas y escarabajos.

La rejilla que contiene a los tubos se sumerge en un recipiente con agua. 149 4. 151 4. juego de tamices de metal (de malla de 45 arriba y de 400 abajo). Las cajas Petri no deben contener más de una tercera parte de líquido. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. y a la derecha. b) sistema Berlese– Tullgren en operación.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos.1 Evaluación de bacterias formadoras de nódulos en leguminosas. 284 . bajo condiciones de congelación.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos. 152 5. b) inoculación de la suspensión (alícuota de 0.2 a) contenedor de apoyo para embudos Berlese–Tullgren. d) emergencia de juveniles infectivos en la trampa White.3 a) Nematodos recuperados mediante el lavado de malla de 400.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos 165 5.5 Equipo básico requerido para extracciones núcleo por núcleo Berlese-Tullgren.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) disolución seriada de la suspensión acuosa que contiene al hongo.1 A la izquierda. 189 7.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca).1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. suspensión de suelo en reposo.2 Cultivos purificados de Beauveria bassiana.1 ml) en una caja Petri con medio de cultivo. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa. b) muerte de nematodos en agua caliente. 180 6. fijadoras de nitrógeno en diversos sistemas de uso de suelo.3 Embudos Berlese llenos de suelo y hojarasca.4 Embudo Berlese modificado. c) incubación bajo condiciones controladas en una cámara DBO.4. con embudo superior de 40 cm de diámetro. 282 10. 163 5. 165 5. 166 5.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas. resumida en seis pasos. 216 10. 187 6. 162 5. d) almacenaje de conidios en tubos Eppendorf.3 Producción de acetileno en campo o laboratorio. 151 4.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. de 50cm de altura. hecho de aluminio. 184 6. creciendo en medio ADP. 166 6. 163 5.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. c) larvas que muestran la patología típica de infección por nematodos. 282 10.7 Charola con montajes permanentes de especímenes de nematodos.

y presencia o ausencia del componente arbóreo.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural.3 Clasificación del uso del suelo en términos de la intensidad de uso.2. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. 11.11. 11. 322 324 325 .

es decir. que son las lombrices de tierra. escarabajos y pequeños mamíferos. la sostenibilidad y el desarrollo de sus comunidades rurales. hormigas. Cabe mencionar que un tipo de organismo puede participar en varios grupos funcionales. la fijación de nitrógeno. José Sarukhán. fundador de la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad de México. El conocimiento de esta biodiversidad se ha dejado de lado durante mucho tiempo por la dificultad para abordarla. la captura de carbono y la reducción de emisiones de gases traza (CO2. que pueden incorporar y asimilar estos conocimientos en beneficio de la biodiversidad del suelo. N2O. hongos y protozoarios y los reguladores biológicos como los ácaros. Por otra parte. “¡Se sabe más de las estrellas que de los organismos del suelo!”.Prólogo a la edición en español Este prólogo es el segundo elaborado para esta misma obra y se presenta para su versión en español. las bacterias. por la importancia que reviste su divulgación en un idioma que puede ser leído por un amplio grupo de países de América Latina. 13 . La biodiversidad del suelo alberga más del 25 % de la que existe en todo el planeta y. la regulación de la dinámica de la materia orgánica del suelo. en términos generales. pero ahora sabemos que interviene y participa ampliamente en los servicios ambientales que brinda el suelo: por una parte. termitas. CH4) son realizados principalmente por el grupo funcional de los ingenieros químicos del ecosistema. el ciclaje de nutrientes. Como lo afirmó el Dr. la elaboración de la estructura del suelo y el mantenimiento del régimen hídrico la desarrollan los ingenieros del ecosistema. es la que menos se conoce. colémbolos y nematodos.

que han sido desarrolladas y probadas en siete países y tres continentes. el equilibrio y la funcionalidad de los suelos modificados por las prácticas agrícolas. son grandes pero se desconocen en buena medida los mecanismos y procesos que se afectan. que se encuentran entre los más afectados por la deforestación y el 14 Manual de biología de suelos tropicales . se reconoce la necesidad de estimular la formación de profesionales en taxonomía y sistemática de la biodiversidad del suelo. combinada con las necesidades alimenticias de una población humana en continuo crecimiento. esta biodiversidad le da estabilidad al paisaje. Y aunque es difícil cuantificar el valor económico de estos servicios. fibra y combustible. su biodiversidad. que se estiman en miles de millones de euros anuales. Ante este panorama. el uso de fertilizantes. reduciendo la materia orgánica contenida y alterando gravemente sus redes biológicas y funcionales. y se dejó de lado el estudio de la biología del suelo y. Mientras leemos estas líneas. pues permitirán diseñar y establecer estrategias para mantener la sustentabilidad. generan y provocan el avance de la frontera agrícola y la intensificación productiva. conservación y equilibrio del ecosistema. silvícolas y ganaderas en el mundo. contribuye a nuestro alimento. las condiciones de la biota del suelo continúan alterándose aceleradamente en todo el mundo debido a las actividades humanas. conocer y aprender a manejar dicha biodiversidad resulta fundamental para conservar o restaurar la fertilidad del suelo. así como preservar y restaurar la fertilidad natural de los suelos. permite el control de plagas y fomenta la producción de las plantas y de los animales. con repercusiones a nivel global. pesticidas y técnicas mecánicas de cultivo modifican fuertemente las condiciones originales del suelo. más aun. son fundamentales. actualizada y rápida. Este manual reúne técnicas de muestreo en campo. particularmente en las regiones tropicales. En este sentido. particularmente en los ecosistemas tropicales. entendidas ahora bajo el concepto de calentamiento global. La pérdida de la fertilidad. Durante años los estudios del suelo fueron enfocados al conocimiento de la física y química del suelo.De manera global. se requieren muchos años más de investigación taxonómica y funcional para comprender y manejar los procesos edáficos. lo que visto desde el punto de vista antropogénico. pero su impacto y repercusiones sobre los procesos de funcionamiento. tanto del punto de vista morfométrico como molecular para lograrlo. las técnicas de muestreo y estudio de la materia orgánica y los organismos del suelo que permitan obtener información veraz. Y si bien se ha avanzado mucho al respecto. sobre el verdadero impacto que están teniendo las prácticas de manejo.

implementado por el PNUMA y ejecutado por el TSBF a nivel internacional y por el Instituto de Ecología A.BGBD. pues en este caso fueron probados. La información de este manual se ha organizado de acuerdo con la funcionalidad de los grupos del suelo. permitiendo llevar a cabo evaluaciones sobre la diversidad y salud del ecosistema que sirvan como base para el diseño de prácticas de manejo sustentables. portugués y español. financiado por el GEF. Estas técnicas de muestreo básicas han demostrado ser poderosas herramientas para llevar a cabo investigación básica y aplicada. inglés. Cabe mencionar que la mayoría de los autores que colaboraron para desarrollar este manual residen justamente en países tropicales. para que su alcance e impacto sea más amplio. sino constituir un apoyo en el camino hacia la sustentabilidad y la relación armónica entre el hombre y la naturaleza. mientras que al final se encuentra un capítulo integrador que permite relacionar los inventarios de los organismos del suelo con una clasificación del uso de suelo para estimar el impacto del manejo del suelo sobre su biodiversidad. Su elaboración tiene como finalidad no sólo ser una herramienta de utilidad en el trabajo técnico. Las técnicas y métodos de muestreo presentados en este manual no constituyen sólo una recopilación de los procedimientos originales ya conocidos. por sus siglas en inglés) . lo que demuestra la mayor presencia y formación de especialistas nacionales preocupados por sus recursos naturales. Con esta versión en español. profesores y profesionales involucrados en el manejo productivo de los suelos y también en su conservación. Esto es así porque. Al inicio del manual se incluyen dos capítulos que ofrecen una guía para establecer un método de muestreo representativo que permita evaluar y comparar la biodiversidad del suelo en diferentes sitios. incluso en plantaciones agrícolas con manejo de bajo insumos. estudiantes. en México. mejorados y actualizados durante el desarrollo del proyecto Conservación y manejo sostenible de la biodiversidad debajo del suelo (CMS. La información contenida en este manual es útil para investigadores. Agradecemos a todos los especialistas que revisaron la traducción de los textos que correspondían a su especialidad y competencia. ahora este manual se encuentra disponible en tres idiomas. las consecuencias de un mal manejo de suelos pueden provocar consecuencias dramáticas.C. Fondo para el medio ambiente. De manera especial queremos P rólogo a la edición en español 15 . generando información útil no sólo para investigadores o especialistas sino para toda persona interesada en el estudio de la conservación y la productividad del suelo.cambio en el uso del suelo.

y en particular a Raúl Marcó del Pont y su equipo. Isabelle Barois Boullard Coordinadora de la traducción y del proyecto CSM-BGBD en México 16 Manual de biología de suelos tropicales .agradecer al Instituto Nacional de Ecología. por su trabajo editorial y su paciencia ejemplar.

Una línea de investigación surgida a partir de entonces es la de cómo evaluar y manejar diversidad bajo suelo en sistemas de agricultura que faciliten la productividad agrícola y sustentabilidad de suelo a largo plazo. Este manual es. sólo en tiempos recientes se ha planteado que los suelos contienen un componente biológicamente activo. Dicha intensificación es necesaria para asegurar el suministro global de alimentos. tiene como consecuencia 17 . a su vez. Esto. sin embargo. en la medida que esto ocurra. celebrada en el año 2006. surge la gran necesidad de aplicar los conocimientos referentes al papel que desempeña la biodiversidad bajo suelo para su sustentabilidad. Ante esta situación. Un aspecto a destacar del cambio global en las regiones tropicales. sin lugar a dudas. Mediante la aprobación de la Iniciativa Internacional para la Conservación y el Uso Sustentable de la Biodiversidad del suelo en la Convención sobre Biodiversidad Biológica.Prólogo Durante mucho tiempo la sociedad ha reconocido su dependencia respecto del suelo. la regulación biológica del suelo se verá afectada e incluso sustituida por fertilizantes y cultivos mecánicos. los suelos en todo el mundo enfrentan una grave crisis. se enfatizó la importancia de la diversidad bajo suelo y se exhortó a abrir nuevas líneas de investigación multidisciplinaria. la mejor muestra –y la más actual– para poder evaluar la biodiversidad del suelo en ecosistemas que están siendo rápidamente alterados como consecuencia de los cambios en el uso del suelo. es el cambio de uso de suelo asociado a la intensificación agrícola. Sea como fuere. sin embargo.

pero constituye uno de los principales objetos de investigación en todos los niveles. La biodiversidad tropical ha sido subestimada y es posible que las verdaderas densidades de especies sean mayores que en otras latitudes.una reducción de la biodiversidad del suelo. entonces. las relaciones entre la biodiversidad del suelo y la ocurrencia y magnitud de los procesos ecológicos son inciertas. la capacidad de retención de agua del mismo. tanto en el laboratorio como en el campo. manejar la biodiversidad del suelo para poder incrementar la productividad agrícola en regiones que están siendo degradadas? La respuesta a esta pregunta atañe a toda la humanidad porque la tierra está siendo degradada. problema cuya solución implica un gran reto: ¿es posible. Un metro cuadrado de bosque templado puede contener hasta mil especies de invertebrados y. Dichos conocimientos son. En última instancia. Durante mucho tiempo los ecologistas han debatido sobre la importancia de la diversidad biótica del suelo: el secuestro de carbono en suelos. quizás. desde luego. además. únicamente. la provisión de nutrientes en las plantas y el control de patógenos en plantas como contribuciones específicas de los organismos del suelo a la fertilidad de éste. cubre casi la totalidad de la gama de biodiversidad biológica. por lo que representa el resultado publicado de más de una década de intensa discusión y un amplio trabajo de campo por parte de un gran número de expertos investigadores de muchos países. sino también en países de primer mundo. vitales para poder alcanzar la meta: productividad agrícola sustentable. un número mayor de diferentes tipos de microorganismos. El propósito de este manual es proveer de métodos estándares internacionales para el inventario de comunidades bajo suelo y la caracterización del uso de suelo en el trópico húmedo. así como la conservación de la biodiversidad en todo el mundo y no. estas herramientas pueden ser utilizadas para aprovechar los organismos del suelo en el manejo de los ecosistemas. la reducción de las emisiones de gas invernadero. asociada a la deforestación y al proceso de Intensificación agrícola en los márgenes de los bosques. Del mismo modo. desde los invertebrados más grandes hasta las bacterias. La relación entre la diversidad de especies y la diversidad funcional de la biota del suelo sigue siendo incierta. en los trópicos. no solamente en regiones en vías de desarrollo. en bioprospección y para promover mejoras sustentables en la pro18 Manual de biología de suelos tropicales . El objeto explícito en este caso es práctico: proveer de una herramienta definitiva para establecer una línea de base y luego documentar la pérdida de biodiversidad de suelo. el mantenimiento de la estructura física del suelo.

Muchas de las técnicas asociadas con una evaluación de diversidad dentro de grupos específicos microbianos han surgido a partir de P rólogo 19 . por lo tanto. porque la verdadera biodiversidad es tan amplia que queda fuera del marco de cualquier sistema científico para que se pueda documentar totalmente. sino también para biólogos en general. representan a instituciones académicas y gubernamentales en las que se requiere poner en práctica nuevas políticas para el manejo del suelo que han de ser validadas. tanto nacionales como extranjeros. considerado importante o esencial en la función del suelo y. con cierta frecuencia. por lo que algunos taxa han sido excluidos. sin embargo. El proceso responde a una necesidad selectiva. Durante los últimos cincuenta años se han publicado. pero que también corresponde a un grupo funcional mayor. si es que aún estamos a tiempo de parar la pérdida de la biodiversidad tropical. consecuentemente. Una de las más importantes es que la mayoría de los colaboradores pertenece a los países que se encuentran más afectados por la deforestación y el cambio en el uso de suelo. también donde es necesario. Otro aspecto notable de este manual es que la biota del suelo está agrupada en ocho categorías. especialmente en el caso de los pueblos más pobres del mundo. Inevitablemente. distribuidos en siete países y tres continentes. se aconseja referir los especímenes a especialistas. los métodos han sido desarrollados y monitoreados en condiciones de campo. dentro del alcance de la población que se encuentra relacionada con su productividad. los objetivos nacionales de desarrollo y calidad de nuestro ambiente. esto implica la reconciliación de los intereses y preocupaciones de los agricultores pobres. no obstante. el presente manual contiene notables diferencias respecto de los anteriores. Finalmente. son de interés no sólo para expertos en taxonomía. manuales metodológicos de muestreo para organismos del suelo. Tal selección es inevitable cuando se trata del suelo. los autores han incluido la revolución en metodología molecular que ha incursionado en las ciencias biológicas durante los últimos diez años. cada una con amplia identidad taxonómica. en doce localidades como puntos de referencia. En segundo lugar.ducción agrícola. especialistas en agricultura y empleados técnicos de todos los niveles. a muchos servicios ambientales que los suelos proveen. no obstante. En la medida de lo posible esto aplica a la identificación: las claves recomendadas son los más funcionales. los métodos presentados en este manual contemplan también los ecosistemas terrestres en general. ofrece la ventaja de traer consigo los medios para poder hacer una evaluación aproximada de la salud del suelo.

discusiones entre colaboradores y durante talleres específicamente pensados para la publicación del presente manual. Diana H. Wall Natural Resource Ecology Laboratory Colorado State University Mayo de 2008 20 Manual de biología de suelos tropicales .

constituye una actualización de los métodos y protocolos que fueron inicialmente propuestos por investigadores afiliados al Instituto de Biología y Fertilidad del Suelo Tropical del CIAT. al (TIGER). asimismo. y. institución que pertenece al Centro Internacional de Agricultura Tropical (CIAT). al NERC por el Reino Unido (UK). al PNUD/ 21 . Uganda. India e Indonesia.Prefacio Este manual es uno de los resultados del proyecto PNUMA/GEF “Conservación y Manejo Sostenible de Biodiversidad Bajo Suelo” (CSM-BGBD) que surge como respuesta a la necesidad de crear métodos estándares e instrucción práctica para el inventario de la biodiversidad bajo suelo. El proyecto se lleva a cabo en México. sobre todo. El manual describe métodos de muestreo y laboratorio para evaluar la biodiversidad de una gama de grupos funcionales básicos de biota de suelo. para mantener la productividad agrícola y reducir la extensión de la agricultura en paisajes naturales. y para su puesta en marcha. Kenia. Costa de Marfil. del Programa de Naciones para el Medio Ambiente (PNUMA/UNEP). recibe apoyo para su financiamiento del Fondo Global del Medio Ambiente (GEF por sus siglas en inglés). a la Red de Macrofauna financiada por la Unión Europea (EU). que permitan la comparación de resultados de inventario en áreas específicas de países tropicales con validez científica y estadística. El proyecto se inició en 2002 con el objeto de generar información y conocimientos que puedan ser utilizados para un mejor manejo y conservación de la BGBD en espacios de agricultura tropical. Este proyecto es ejecutado por el Instituto de Biología y Fertilidad del Suelo Tropical (TSBF). Brasil.

dentro del trópico húmedo. Kenia). Dado que muchas especies aún son desconocidas o no se han descrito. Un manual formal de técnicas para organismos de suelo y organismos que viven en agua dulce y sedimentos marinos fue publicado en 1996. La definición de métodos estándares aprovecha la experiencia obtenida con la implementación de los métodos utilizados en los siete países participantes en el proyecto. ampliamente. por parte de la UNESCO. Cali. en especial. diciembre 2004. termitas. Bangalore. Nairobi. S. octubre 2003). al programa DIVERSITAS. elaborado por Anderson e Ingram (1993). saprófitos y patógenos y una amplia gama de artrópodos mayores. en el de 2004 (Embu. Los métodos que se describen en este manual reflejan una amplia gama de actividades del proyecto CSM-BGBD. como es el caso de aquéllos que se refieren a la mesofauna. agosto 2004. tales como el registro de huellas genéticas del BFNFNL. Indonesia) y. Los métodos fueron discutidos y posteriormente perfeccionados en reuniones anuales celebradas entre los años 2002 y 2005. y en varios talleres llevados a cabo desde el inicio del proyecto. editado por Swift y Bignell (2001). en su caso. la gama completa -geográfica y biogeográfica. También cubre. Ésta fue la contribución. Los métodos para algunos de los grupos funcionales de organismos de suelo fueron incluidos en un manual pionero. Países Bajos). lombrices de tierra. Brasil mayo/2004 y Nairobi. Hall. provee detalles adicionales en el caso de grupos funcionales específicos: como el uso de trampas Winkler para hormigas y trampas Pitfalls para escarabajos en muestras de hojarasca. en donde también se habla del principio de grupos funcionales del inventario de organismos de suelo. Brasil. termitas y hormigas. en términos de grupos funcionales. editado por G. o la actualización de métodos para evaluar la diversidad de nematodos. Los métodos para una evaluación de biodiversidad de suelo fueron descritos en el ASB (Nota de Lectura 6B). Londrina. Kenia. Manaus. al igual que métodos que no han sido considerados en las publicaciones mencionadas. HMA y Ectomycorrhiza.UNDP-GEF con el apoyo financiero destinado al Proyecto Alternativas de RozaTumba-Quema (ASB). una evaluación de la diversidad de especies resulta un proceso poco práctico. Colombia. India 2005. dentro del alcance de laboratorios nacionales. al igual que en varios talleres temáticos de taxonomía específica (técnicas moleculares con énfasis en T-RFLP. además. febrero 2005. Una 22 Manual de biología de suelos tropicales . Los métodos estándares propuestos contienen avances tecnológicos recientes en genética molecular. hongos entomopatógenos. 2003 (Sumberjaya. cuya evolución se muestra en los reportes de 2002 (Wageningen. bacterias formadoras de nódulos en leguminosas (BFNFNL) y sus plantas hospederas.

generalmente. Aun si se pudiera regresar a sus condiciones originales. La mayoría de los organismos del suelo se encuentran en los primeros 20 centímetros de su perfil. la erosión puede llegar a nulificar todos los demás procesos degenerativos. como consecuencia del labrado o del creciente uso directo de agroquímicos. de manera que causará un impacto inmediato en la BGBD que fácilmente se antepondrá al efecto combinado de todos los factores mencionados. Para responder a algunas de las preguntas mencionadas se requiere: P refacio 23 . esto se traduce en una alteración del suelo como hábitat. llega a influir sobre la abundancia y diversidad de dichos organismos. por lo tanto. La conversión de uso de suelo y la intensificación de su uso. interpretar esos procesos en el contexto ecológico. Al mismo tiempo. por lo tanto. hay otros asociados con un incremento en la intensidad del uso de suelo. estos cambios de uso de suelo. la erosión del suelo significa la más catastrófica de las alteraciones. Los efectos en BGBD son condiciones compuestas por el medio ambiente y por características físicas y químicas del suelo (por ejemplo: pH. provoca una pérdida de servicios del ecosistema. sin embargo. frecuentemente provocan una reducción de materia orgánica del suelo que forma el sustrato básico para la mayoría de los organismos que en él habitan y. Quedan muchas interrogantes en cuanto al manejo de BGBD. poco se sabe de las relaciones entre ambos factores o sobre los mecanismos por los cuales ocurren cambios en la BGBD. que se espera. así. en contra de una productividad sustentable. Es por esto que el control de la erosión y la rehabilitación de suelos fuertemente erosionados deberá considerarse parte de las estrategias para conservar y sustentar un buen manejo de la BGBD. La hipótesis actual es que una intensificación en el uso de suelo trae consigo una reducción de la biodiversidad del suelo y a su vez. La premisa es que la diversificación agrícola (en varios niveles) genera biodiversidad en el suelo y que la producción agrícola sustentable (en los márgenes de la selva tropical) se mejora significativamente. van acompañadas por reducciones drásticas en la diversidad de plantas. Además de estos efectos. Además. dejándolo como estaba antes de ser alterado. tenga implicaciones en la BGBD. así se podrían entender las consecuencias de una pérdida en el BGBD y.mejor opción sería investigar la pérdida de grupos funcionales básicos dentro de la BGBD que muestran un cambio en el uso de suelo o una intensidad del mismo. nivel de nutrientes y densidad). no necesariamente se lograría restaurar la BGBD. restablecer la BGBD no implica precisamente devolver los servicios del ecosistema.

E.fao.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. desde bosque natural hasta agricultura de monocultivo. E. desde una parcela (agrícola.• Una caracterización de la biodiversidad del suelo en un amplio rango de uso de suelo de varias intensidades. Se espera que los métodos descritos en este manual sean útiles para el diseño y la ejecución de estudios para inventario y monitoreo de la BGBD en todos los niveles. G. S. Moreira. D. 2nd edition. caracterizada por un cultivo continuo y un elevado uso de químicos y mecanización. • Establecer una relación entre la biodiversidad de la superficie y bajo del suelo en los actuales y alternativos sistemas de uso de suelo. experimental o de muestreo) hasta un paisaje natural. (ed) (1996) Methods for the Examination of Organismal Diversity in Soils and Sediments. S. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. Fátima M. J. e Ingram. Bignell ReFERENCIAS Anderson. South East Asian Regional Research Programme. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. • Identificar “puntos de entrada” para mejorar el manejo de la tierra.pdf. Wallingford. www. Hall. Bogor. ASB Lecture Note 6B. Indonesia. mediante la introducción y/o manejo de biota de suelo (se experimenta con varios manejos alternativos). y Bignell. un conocimiento más amplio de prácticas existentes y un uso más efectivo de tecnologías disponibles que no requieran altos insumos. Swift. CAB International. International Centre for Research in Agroforestry. Estos “puntos de entrada” pueden incluir un mejor entendimiento del uso de prácticas indígenas. J. M. 24 Manual de biología de suelos tropicales . Wallingford. I. y observar cómo esta relación se modifica y se altera por las condiciones prevalecientes en el medio ambiente (incluyendo condiciones de suelo). CAB International. Jeroen Huising y David. M. S.

Lista de acrónimos y abreviaturas AC ADP AFLP AHM AM ANOVA ARISA B BFNFNL cPCR CSM-BGBD BGBD DGGE ea EBI ERA FID FURB GEF Análisis de correspondencia Agar dextrosa y papa Polimorfismo en el tamaño de fragmentos amplificados Agar con harina de maíz Agar extracto de malta Análisis de varianza Análisis automatizado del espaciador intergénico ribosomal Bacteriófagos Bacterias fijadoras de nitrógeno. formadoras de nódulos en leguminosas Reacción en cadena de la polimerasa competitiva Conservación y Manejo Sustentable de Biodiversidad Bajo Suelo Biodiversidad Bajo Suelo Electroforesis en gel con gradiente de desnaturalización Equivalente de ácido European Bioinformatics Institute Ensayo de reducción de acetileno Detector de ionización de flama Universidade Regional de Blumenau Global Environment Facililty 25 .

GF HMA ia ICRAF IFP IM INPA ITS KOH LCCS M MAS MOS NCBI Nd NMP P Pc PCA PCR PFGE PNUMA PP RAPD Rep-PCR RFLP RIA SR SSCP TGGE TRF T-RFLP TROF TSBF-CIAT 26 Grupo funcional Hongos micorrizógenos arbusculares Ingrediente activo World Agroforestry Centre Índice fitoparasítico Índice de madurez National Institute for Amazonian Research (Instituto Nacional de Pesquisas da Amazônia) Espaciadores de trascripción interna Hidróxido de potasio Sistema de clasificación de cobertura de suelo Micófagos Muestreo aleatorio simple Materia orgánica del suelo National Center for Biotechnology Information Nivel de dilución Número más probable Perturbación Porcentaje de colonización Análisis de componentes principales Reacción en cadena de la polímerasa Electrofóresis en campos pulsados Programa de las Naciones Unidas para el Medio Ambiente Parásitos de plantas DNA polimórfico amplificado al azar De fragmentos repetidos palindrómicos-éxtragenicos Polimorfismo de longitud de fragmentos de restricción Resistencia intrínseca a los antibióticos Sensores remotos (imagen) Polimorfismo de conformación de cadena sencilla Electroforesis en gel con gradiente de temperatura Fragmentos de restricción terminal Polimorfismo terminal de la longitud del fragmento de la restricción Árboles en finca Tropical Soil Biology and Fertility Institute of the International- Manual de biología de suelos tropicales .

UC UFAM UFC UFLA UFMG UnB VA VB Center for Tropical Agriculture Unidad de colonización Universidad Federal de Amazonas Unidades formadoras de colonias Universidad Federal de Lavras Universidad Federal de Minas Gerais Universidad de Brasilia Volumen alto Volumen bajo A crónimos y abreviaturas 27 .

.

cuando se hace una evaluación biológica de la salud de los suelos (Lawton et al. 2004. Bardgett. 2004).5 millones de especies de eucariontes y con una riqueza de especies estimada muy por encima de 10. Moreira y E.2004).Capítulo 1 El inventario de la biodiversidad biológica del suelo: conceptos y guía general Mike J. Lavelle. 1997. Sin embargo. cualquiera que sea el sistema de clasificación utilizado. 1996. Bignell. contri29 .. 1998. Wall. la biota (relativa a agentes no bióticos y entre ellos mismos) será evaluada por su contribución relativa a los procesos del ecosistema (sensu Daily.1 se enlistan los principales fila de organismos eucariontes y procariontes que son o pueden ser representativos en la comunidad del suelo..000 en el caso de procariontes. Cavalier-Smith. 2006). 1979.Estos procesos apoyan a los servicios del ecosistema. La clasificación taxonómica de organismos vivos aún se encuentra en una situación polémica (Margulis y Schwartz. la diversidad de la biota del suelo es elevada en todos los niveles de análisis (véase Swift et al.. Wall. S. 1990) y muchos fila. 1998)... Jeroen Huising Organismos y servicios del ecosistema del suelo El suelo es un hábitat que alberga una amplia gama de organismos dentro de los tres dominios taxonómicos (sensu Woese et al. Fátima M. Brussaard et al. Swift. con más de 1. Moreira et al. Ya que no es ni práctico ni coherente tomar en cuenta todos los organismos presentes. 1998. David E. En la Tabla 1. 1997. especialmente cuando se trata de los taxa a ser creados en altos niveles y los números de tales categorías altas (como reinos) a ser consideradas. 2005.

4 4 común localmente 5 - 30 Manual de biología de suelos tropicales .000 Dicotiledoneas 130.1 Número de especies descritas en las principales categorías taxonómicas de plantas.000 Reino Plantae [12 fila] Filum Bryophyta (musgos) 10.4 muy raro en el suelo 3.000 Filum Mollusca 35. biota del suelo y principales grupos funcionales a los que pertenecen.000 Filum Annelidad (lombrices segmentadas) Clase Polychaeta 9.000 Monocotiledoneas 65.800 y Enchytraeidae) Clase Hirudinea (sanguijuelas) 500 45.000 Clase Oligochaeta(lombrices de tierra 8.000 >10 millones Reino Animalia [37 fila] 750 Filum Tardigradad (osos de agua) d 99.000 cochinillas) Filum Mandibulata (Artropoda) Grupo funcionalb 1 1 1 1 1 1 1 1 1 2.000 Filum Crustacead [>6 clases] 25.000 Filum Cycadophyta (gimnospermas) 185 Filum Coniferophyta (gimnospermas) 550 Filum Gnetophyta 70 Filum Anthophyta (angiospermas) 235.000 Clase Malacostracad (incluye orden Decapoda con un esqueleto externo calcificado) Orden Isopoda (ácaros de la madera y >11. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Dominio Eucarionte 255.000–40.000 hepáticas) Filum Filicinophyta (helechos) 12.000 Clase Gastropodad (incluye babosas y caracoles) 18.4 2.000 Filum Hepatophyta (plantas 6.Tabla 1.

3. 23.500 Clase Symphyla 200 Clase Pauropoda 700 El Grupo funcionalb 4 4.800 Orden Hemiptera (chinches) >80.000 Suborden Homoptera (cigarras. escamas) Suborden Heteroptera 25.000 Orden Isoptera (termitas) 2. 4. 6 2.826 Orden Lepidoptera (mariposas. 4. afidos.000 gegenes.000 Orden Archaeognatha (pececillos de 350 cobre ó bristetails) Orden Thysanura 700 Orden Blattoptera (cucarachas) 4.800 Orden Orthoptera (saltamontes.000 Orden Dermaptera (tijerillas) 1. >125. 4. 9 3. 7 4.) Orden Trichoptera 12. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Subfilum Hexapoda (Insectos) >900. 9 2. mosquitos.000 etc. 9 2. 6 4. peri55. mosquitos pequeños) Orden Hymenoptera (hormigas. 6.Tabla 1.000 quitos. 7 31 inventario de la biodiversidad biológica del suelo .500 Orden Diplura (doble cola) 659 Orden Protura 500 Subfilum Myriapoda (milpiés y 15. grillos. 4 2.1 Continúa. 7 2. 6 2. polillas. 9 2.162 ciempiés) Clase Diplopoda (milpiés) 10. pulgones. 7.6 4 2.000 abejas. 9 2.000 langostas) Orden Thysanoptera (trips) 6. 115. avispas. 9 2. 9 6 2.9 Sólo en la rivera 4. abejorros) Familia Formicidae (hormigas) 11. 9 4. 9 2.000 Orden Collembola (colémbolos) 7. 6. 180.000 Orden Diptera (moscas.000 Clase Chilopoda (ciempiés) 2.000 Orden Coleoptera (escarabajos) >350.

6. garrapatas) 45.1 Continúa.000 Filum Discomitochondria (flagelados 800 y zooflagelados) 10. lombrices enterobius. 7 Muy raros en suelo 2. 6.455 Orden Palpigradi (micro-escorpiones) 80 Orden Acari (ácaros. alfilerillos) 25.000 Filum Plathyheminthesd (Helmintos.6 7 1. lom15.Tabla 1.000 Orden Pseudoscorpionida 3. 7.000 briz redonda.7 7 1. incluidas planarias) Número sin Reino Protoctistac [30 fila] determinar Filum Rhizopoda (amibas) Número sin determinar 4000 Filum Dinomastigotad (dinoflagelados) Filum Ciliophora (ciliados) 10.000 Clase Arachnida [11 órdenes] 93. 7.000 Order Scorpionida (escorpiones) 2000 400 Filum Gastrotrichad (gastrotricha) d 1000 Filum Acanthocephala (lombrices con cabeza espinuda) 2000 Filum Rotiferad (animales de ruedas) 900 Filum Nemertinad (gusanos planos) Filum Nematoda (nematodos. 7 1 5.100 Grupo funcionalb 6 2.235 (Pseudoescorpiones) Orden Araneae (arañas) 40. 9 2. 9 1 32 Manual de biología de suelos tropicales .000 Filum Diatomacead (diátomos) Filum Oomycota (Oomycetes) Cientos Filum Rhodophyta (alga roja) 4. 9 6 6 6 7 Parásitos artrópodos 4. 4. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos critas en el taxón (todos de organismos de suelo/nombre los hábitats) común Subfilum Cheliceratad [3 clases] >100.

de acuerdo con Woese et al.398f 1 sólo parásitos 5. Reinos de Eucariotas clasificadas de acuerdo con Margulis y Schwartz. Clasificación.9 5 5.ncbi. desde el más bajo hasta el más alto nivel: dominio.2 (de este capítulo). 2006. (2006). de acuerdo con la Tabla 1. 8. d) Incluye organismos acuáticos y del suelo. Fuente: Moreira et al... 8 10 1.Grupo funcionalb critas en el taxón (todos los hábitats) 16. (1990). respectivamente. 1998.. 2008). 9. reino. clase. cuando éstos se incluyen.000 >70.nih.000 >344f >8.1 Continúa. Categorías taxonómicasa (número total de fila existentes) ejemplos de organismos de suelo/nombre común Filum Chlorophyta (alga verde) Reino Fungi [6 fila] Filum Microsporídia Filum Chytridiomycota (Hongos quitridios) Filum Zygomycota (mohos) Filum Glomeromycota (hongos micorrízicos arbusculares) Filum Basidiomycota (incluidos hongos y algunas levaduras) Filum Ascomycota (incluidas levaduras) Dominio Archaead [4 fila] Dominio Bacteriad [52 fila]e Número de especies des.250 >30. 8 5. Procariotas (Dominio Archaea y Bacteria). 1997. buyendo al mantenimiento y a la productividad de los mismos. excluyendo organismos no clasificados. consultado el 13 de mayo de 2007). filum. b) Grupos funcionales.100 204 >22. e) Rappé y Giovannoni (2003). 5. 10 Nota: a) Considerando las categorías taxonómicas. por su influencia en la calidad y salud del suelo (Hoavelle.500 1.000 1.nlm. género y especies. familia. Hongos de acuerdo con James et al. sin cultivo y no especificados.000 1. c) Considerados por algunos autores como Protistas o Protozoos y Chromistas.gov.Tabla 1. Dichos procesos pueden ser agrupados de acuerdo a cuatro funciones agregadas del ecosistema: El inventario de la biodiversidad biológica del suelo 33 . Brussard et al.. f) National Center for Biotechnology Information: (www. Kibblewhite et al. la riqueza correspondiente arrojará 3090 y 79. orden. 8 5.342. 1996.

Algunos grupos de bacterias del suelo están involucrados en transformaciones elementales autotróficas. por la biota del suelo. se mantienen físicamente activos dentro del suelo formando canales. agregados y montículos. Aquí también los microorganismos son mediadores de la mayor parte de las transformaciones. el carbono orgánico es liberado en la atmósfera. Así. porosidad y contenido de carbono. La descomposición de materia orgánica. tales como protoctistas. Ciclo de nutrientes. drenaje. sin embargo. lombrices de tierra. Animales más grandes mejoran algunos procesos porque proveen nichos para un crecimiento microbiano dentro de sus intestinos o excremento. Las raíces de plantas. Microorganismos específicos del suelo también incrementan la cantidad y eficiencia de absorción de nutrientes por la vegetación. El ciclo de nutrientes. es esencial para todo tipo de agricultura y silvicultura. los cuales trituran los residuos de plantas y animales. sin embargo. en gran parte realizada por animales del suelo como ácaros. estabilidad del suelo. estabilidad de agregados 34 Manual de biología de suelos tropicales . lombrices de tierra y termitas. nematodos. lo que controla el resto de la biota. y dispersan los propágulos microbianos. los microorganismos y los animales involucrados se llaman “descomponedores”. Estas fracciones de MOS varían en su estabilidad y longevidad. Bioturbación.1. y moviendo partículas de un horizonte a otro. colémbolos y ácaros. hormigas y algunos otros de la macrofauna del suelo. poros. estrechamente asociado con la descomposición orgánica. crean y modifican microhábitats para otros organismos más pequeños y determinan propiedades del suelo como aireación. 2. Juntos. pero también es incorporado en diferentes reservorios en forma de materia orgánica (MOS). el paso que marca la operación del proceso se determina mediante micropredadores. siempre que no se incluya a los ingenieros del ecosistema (véase más abajo). Estos procesos de “bioturbación” influyen y determinan la estructura física del suelo y la distribución de materia orgánica del suelo. milpiés. aunque en un tipo de suelo y medioambiente determinados existe un equilibrio entre el contenido del MOS y las entradas y salidas de carbono en el sistema. termitas. estos grupos son afectados indirectamente por factores como el contenido de agua. es decir. Como resultado de la descomposición. mediante la formación de asociaciones simbióticas como las micorrizas y la fijación de N2 en nódulos de raíces. principalmente como CO2 o CH4. que no dependen directamente de la materia orgánica como fuente de alimento. que ocurre principalmente por actividad enzimática de bacterias y hongos. 3. aunque el atributo “transformadores de hojarasca” es el más utilizado hoy en día para describirlos.

bacterias. las actividades de plagas potenciales y patógenas son reguladas por interacciones con otros miembros de la biota del suelo. todos los organismos enlistados.. se le ha denominado “ingenieros del ecosistema del suelo” (Stork y Eggleton. CH4. La bioturbación juega un importante papel en la regulación del equilibrio del agua en el suelo (infiltración. Lavelle et al. Especialmente.. 1997). por tanto. N2O). NOX. y de causar enfermedades y muerte. Enfermedades y control de plagas. como miembros de la comunidad del suelo. Para poder interrelacionar El inventario de la biodiversidad biológica del suelo 35 . 1994. En los agroecosistemas. brotes intensivos de enfermedades en el suelo y plagas. La biota del suelo incluye un amplio rango de virus. En suelos saludables.1 muestra la contribución de la biota del suelo a servicios ambientales. este rango de interacciones puede encontrarse reducido. tales como los causados por un contenido de MOS más bajo. 1997). son relativamente raros.y capacidad de retención de agua. en el cambio climático. pueden ser asignados dentro de una o más de las cuatro categorías funcionales genéricas descritas. por lo tanto. debido a una diversidad biológica disminuida y/o en cambios ambientales del suelo. y hasta humanos. hongos y animales invertebrados capaces de invadir plantas y animales. 1992. La estructura y las propiedades del suelo también están influenciadas por la producción de excretas de animales. Grupos funcionales de la biota del suelo En principio. Los organismos del suelo juegan un papel importante en la regulación de la composición atmosférica y. como resultado de los procesos anteriores.. incluyendo complejos organominerales estables durante meses o periodos más largos (Lavelle et al. Jones et al. respectivamente. capacidad de almacenaje y drenaje) y tiene una fuerte influencia sobre la susceptibilidad a la erosión. 4. y también una amplia variedad de interacciones antagonistas microbianas. A este conjunto de organismos. basándose en la función particular que desempeñan o en el proceso específico del suelo del que son mediadores. debe hacerse notar que la interacción entre la descomposición de materia orgánica. La Figura 1. pero tales epidemias sí son comunes en la agricultura. En ecosistemas naturales. que incluyen microbívoros y micropredadores que se alimentan de las plagas microbianas y de animales. bioturbación y ciclo de nutrientes determinará el equilibrio entre la cantidad de carbono secuestrado en el suelo (véase arriba) y entre las emisiones de gases invernadero (principalmente CO2.

Ciclaje de nutrientes Transformadores de nutrientes: Descomponedores Transformadores de elementos Fijadores de nitrógeno Micorrizas Ingenieros del ecosistema: Megafauna Macrofauna Hongos Bacteria Biocontroladores: Predadores Microherbívoros Hiperparásitos Figura 1. Fuente: Kibblewhite et al. Regulación de la población biológica 3. 2008 Servicios agrícolas Procesos de entrega basados en el suelo Alimentos y fibras Captura y ciclaje de nutrientes Descomposición de la MO adicionada Dinámica de MOS Mantenimiento de la estructura del suelo Regulación de la población biológica Manual de biología de suelos tropicales Servicios no agrícolas Calidad y suministro de agua Control de erosión Regulación de la composición atmosférica y del clima Degradación y disminución de contaminantes Control de enfermedades y plagas no agrícolas Conservación de la biodiversidad ..36 Funciones agregadas del ecosistema 1. Mantenimiento de estructura del suelo 2.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. Transformaciones C Ensamblaje funcional Descomponedores: Hongos Bacterias Microherbívoros Detrívoros Procesos de entrega basados en el suelo Mantenimiento de la estructura del suelo Ciclaje de nutrientes Mantenimiento de la estructura del suelo Dinámica de la MOS Descomposición Ciclaje de nutrientes Regulación de población biológica Provisión de hábitat Regulación de población biológica 4.

y que son los responsables de la mayor parte del flujo de energía en la red alimenticia de los descomponedores. también de acuerdo con sus características taxonómicas. por lo tanto. 1998) es necesario tomar en cuenta el concepto de grupos funcionales básicos. Transformadoras de hojarasca (mucha macrofauna y mesofauna. Microrreguladores (microfauna como nemátodos): animales que regulan ciclos de nutrientes mediante forrajeo y otras interacciones con los microorganismos descomponedores. 6. 1. translocando compuestos orgánicos sintetizados arriba del suelo. que incluyen minadores de hojas y de tallos. morfológica. en última instancia. Esta actividad puede ocurrir a varias escalas espaciales. de alguna manera.2 Principales grupos funcionales de la biota del suelo. alguna microfauna): invertebrados que se alimentan de desechos orgánicos originados por microbios y por trituradores de este material. Descomponedores (hongos o bacterias degradadores de la celulosa): microorganismos que poseen las enzimas polímero-degradadoras. ni de cuántos de estos grupos deberán definirse dentro de un ambiente de suelo típico. normalmente definido por criterio trófico (Brussaard. descomponedores y microrreguladores por depredación. construcción de estructuras agregadas y formación de poros. 3. ingenieros del ecosistema. el Tabla 1. Predadores (mucha macrofauna y mesofauna): animales que regulan a los herbívoros. Pueden incluir predadores. haciéndolo más accesible para los descomponedores o favoreciendo el crecimiento microbiano de excretas en forma de gránulos. incluyendo el ciclaje de nutrientes. transformadores de hojarasca. Herbívoros: animales que consumen y parcialmente digieren tejidos vivientes de plantas. Ingenieros del ecosistema (macrofauna como termitas y lombrices de tierra): organismos que causan un impacto físico mayor en el suelo mediante su transporte. Microsimbiontes (hongos micorrícicos. y chupadores de sabia. con los servicios del ecosistema (Setäla et al.. 5.organismos específicos del suelo (biodiversidad colectiva) con las categorías genéricas funcionales y. 1998) pero también calificado en función de la respuesta fisiológica. El inventario de la biodiversidad biológica del suelo 37 . Productores primarios (plantas superiores e inferiores): organismos fotosintéticos que asimilan bióxido de carbono del aire y penetran en el suelo mediante sistemas de raíces. de comportamiento bioquímico o ambiental y. rizobia): microorganismos asociados con raíces que facilitan la absorción de nutrientes. muchas hormigas. 4. 8. por ejemplo. 7. No existe acuerdo preciso en la definición de grupos funcionales. 2.

1. parasitoides e hiperparásitos de plagas y enfermedades). concepto es heurístico y puede modificarse en función del propósito analítico necesario. Por esta razón y porque muchos componentes de biota de suelo son taxonómicamente difíciles de identificar. enlistadas en la Tabla 1. no relacionados. invertebrados.2). mientras que otros son muy específicos en cuanto a su taxonomía. 1994) y especies clave (sensu Davic.Tabla 1. plagas) especies de control biológico también pueden incluirse (ej. 38 Manual de biología de suelos tropicales . Véase que algunos grupos funcionales incluyen una amplia gama de taxa relacionados y. cuyos métodos de inventario y caracterización se describen en los siguientes capítulos. a veces. 2003). Éstos son grupos taxonómicos que fueron tomados en cuenta en el proyecto Conservation and Sustainable Management of Below-Ground Biodiversity (CSM-BGBD). La importancia funcional de cualquier especie o de grupos de especies. Éstas están representadas formalmente en la Tabla 1. también es importante buscar dentro de los grupos funcionales para descubrir los taxa que alcancen el criterio de ser considerados como ingenieros del ecosistema (sensu Jones et al.: depredadores. aislado e identificado (Figura 1. Los grupos taxonómicos propuestos a continuación son seleccionados de acuerdo con su significado funcional diverso. 9.. existe un argumento válido que establece por lo menos diez categorías. incluya todos los grupos funcionales considerados como importantes.. al mismo tiempo. Plagas y enfermedades del suelo (hongos patógenos. existen pocos estudios sobre la salud del suelo agrícola. Transformadores procariontes: Archaea y bacterias que transforman de manera específica el carbono (metanotrofa) o elementos nutricionales como N. 10. probablemente se relaciona con su abundancia relativa y con la biomasa. (razón por la cual se emplea el término “taxa seleccionado”) y por su facilidad relativa a ser muestreado. no obstante. uno de los principales desafíos es seleccionar un subgrupo de la biota del suelo que refleje adecuadamente el espectro taxonómico anticipado y que.2 Continúa. en cuanto a la fertilidad y calidad del suelo.2 y se usan para anotar las categorías taxonómicas. S o P (nitrificación y fijación de nitrógeno). no obstante. 2005). Grupos selectivos de biota de suelo En el diseño de trabajo de campo. en donde el espectro taxonómico completo ha sido objeto de un muestreo representativo en el mismo lugar y al mismo tiempo (Bignell et al.

transformadores procarióticos. clasificados de acuerdo con dominios y reinos.1-2.1 mm. especialmente protoctistas Archaea y Bacteria El inventario de la biodiversidad biológica del suelo 39 . promotores de crecimiento Nota: la fauna se clasifica de acuerdo con el ancho de cuerpo: macrofauna >2. un grupo que incluye muchos organismos con papeles especiales y una diversidad de descomponedores genéricos MICROBIOTA GENERAL Microfauna.0 mm.Figura 1. y microfauna <0.MACROFAUNA Lombrices de tierra I Escarabajos Otros Hormigas Termitas Diversidad y biomasa alta Diversidad alta Ingenieros del ecosistema. patogénos y antagonistas IV Omnipresentes con diversidad alta indeterminada Descomponedores. tamaños y procesos de ecosistemas ANIMALES.2 Principales grupos funcionales.0 mm. patógenos. trituradores de hojarasca. macropredadores ANIMALES. transformadores de hojarasca. antagonistas. Por su parte.transformadores de hojarasca plantas HONGOS Y BACTERIAS MUTUALISTAS Hongos micorrizógenos Bacterias formadoras de nódulos en leguminosas Omnipresentes con especificaciones típicas de variedad de hospederos (a varios grados) III Omnipresentes Microsimbiontes mejoran la absorción por la raíz y la fijación de nitrógeno Hongos saprotróficos. nematodos y protoctistas pueden considerarse como componentes de la microbiota general. trituradores de hojarasca. estudiados en el proyecto CSM-BGBD. mesofauna 0.MICROFAUNA Y MESOFAUNA Nematodos Ácaros Colémbolos Otros Biomasa alta II Alta diversidad y biomasa Micropredadores. parásitos de Micropredadores.

la distribución geográfica. e) 40 Manual de biología de suelos tropicales . lombrices de tierra. En este contexto.1). 5 Microfauna: nematodos y protoctistas que. de esta manera contribuyen en procesos orgánicos de trituración a pequeña escala y ejercen un importante papel regulatorio dentro de la biota del suelo. de la mesofauna. todos ellos conforman un gran número de especies. en los que viven dependientes de películas de agua. Algunas especies de ácaros y formas de larvas de muchos artrópodos de suelo son lo suficientemente pequeñas como para clasificarse dentro de la microfauna. omnívoros y depredadores. microfauna y microsimbiontes. probablemente. micófagos. 4 Mesofauna: colémbolos y ácaros que actúan como transformadores de hojarasca y micropredadores (forrajeros de hongos. Algunas especies también resultan perjudiciales porque se convierten en plaga. 2 Macrofauna: termitas. varios de estos grupos taxonómicos son muy importantes por sí mismos como contribuidores a la diversidad biótica en general. al compararse con otros grupos taxonómicos superiores (Tabla 1. la introducción de especies exóticas e invasivas. bacterias y depredadores de otros animales del suelo). c) normalmente representan una riqueza genérica y de especies muy alta d) juegan un papel importante en la regulación de abundancia y actividad microbiana. la trituración y digestión de materia orgánica. nematodos y.Además. arácnidos grandes y otros tipos de insectos). b) el ciclo de nutrientes. escarabajos. 3 Otra macrofauna: cochinillas (Isópoda). protoctistas. ácaros. y la pérdida de especies endémicas. al cavar sus túneles y mediante la ingestión de materia mineral y orgánica. a) influyen en la tasa de recambio por su papel como forrajeros de raíces (parásitos de plantas). hormigas y escarabajos que intervienen en: a) la porosidad y la textura del suelo. Los grupos incluidos en la selección son: 1 Macrofauna: lombrices de tierra. a escala pequeña. milpiés (Diplópoda) y otros tipos de larvas de insectos que actúan como transformadores de hojarasca con una importante acción trituradora sobre el tejido de plantas muertas y sus depredadores (ciempiés. arañas. al construir galerías y al cavar túneles e ingerir suelo. hormigas. c) el control biológico como depredadores. bacteriófagos. también representan factores de interés y preocupación. que intervienen en la porosidad del suelo y en sus nutrientes. también actúan como reguladores de las poblaciones de biota del suelo. Enchytraeidae. b) ocupan espacios que existen en pequeños poros. por ejemplo. mediante el transporte. por ejemplo.

utilizando el concepto de grupos funcionales clave como los descritos anteriormente. y contribuyen al potencial control biológico de plagas y enfermedades. aunados a la inmensa escala de diversidad encontrada en el suelo. Los métodos empleados para la extracción de diferentes grupos de organismos del suelo también son muy diferentes de un grupo a otro. otros fijadores de nitrógeno microsimbiontes que transforman el nitrógeno atmosférico N2. Métodos para inventario de la biodiversidad bajo suelo: principios generales La metodología actual no permite la identificación de todas las especies en el suelo. bacterias involucradas con el compuesto El inventario de la biodiversidad biológica del suelo 41 . hongos y animales invertebrados. por ejemplo. requieren de un enfoque selectivo para llevar a cabo un inventario de la biodiversidad bajo suelo. sean los más vulnerables ante situaciones de estrés y perturbación que afectan a dichos grupos funcionales. En muchos Fila. saprotróficos y antagonistas: que determinan o median (en diferentes casos) la viabilidad de cultivos. En los casos de Archaea y bacteria. 6 Hongos micorrizógenos arbusculares: se asocian con las raíces de las plantas y mejoran la disponibilidad de nutrientes. que dependen de grupos funcionales. que es asimilable para las plantas. en ocasiones. la mayoría de las especies aún son desconocidas. diversidad funcional (el número de grupos funcionales). lo anterior aplica para los trituradores de materia orgánica (véase transformadores de hojarasca en Tabla 1. En la biota del suelo. Se espera que los servicios de ecosistema. 8 Hongos fitopatógenos. Aún sigue siendo una pregunta sin respuesta la relación existente entre diversidad de especies. Hasta donde se conoce. de esta manera. entre bacterias.2). Estos factores. la caracterización molecular y bioquímica reemplaza al enfoque de identificación tradicional. y enfermedades de las plantas. rotación de carbono orgánico en descomposición. composición funcional (la naturaleza de los grupos funcionales) y ocurrencia e intensidad de los procesos ecológicos. reducen ataques patógenos en plantas y mejoran la tolerancia al estrés del medio ambiente.como insectos patógenos. el concepto de especies también es muy variable. compuestos por relativamente pocas especies y/o especies altamente especializadas. 7 Bacterias formadoras de nódulos en leguminosas y. representan un importante control biológico. bacterias que nitrifican y denitrifican (como parte de los transformadores procariotas). en NH3.

que para algunos grupos y en algunos países es un desafío importante. centrándose en los grupos funcionales que permitan la evaluación de la diversidad. escogidos y modificados. por ejemplo. Por lo tanto. La evaluación de la composición de la comunidad biótica depende de la identificación de los especímenes recolectados. la fragmentación de hábitat y el manejo de cultivos en la diversidad biológica del suelo. aunque se dan referencias de claves para la identificación de especies de varios grupos funcionales. preguntas como las anteriores deberían ser consideradas en la definición del propósito del objetivo de la investigación de la biodiversidad bajo suelo. especialmente. para el cual se han desarrollado y probado los métodos. en términos de una dis42 Manual de biología de suelos tropicales . las consecuencias pueden ser negativas. y en relación con que “especies clave (si existen) en los grupos funcionales?. Inventario de biodiversidad bajo suelo en escalas de espacio y tiempo Cambio de uso de suelo como la causa principal del cambio de diversidad biológica del suelo Un inventario puede demostrar si la biota del suelo responde a intervenciones humanas como prácticas agrícolas. hierro. hongos micorrizogenos (entre los microsimbiontes) y bioturbadores (ingenieros del ecosistema). esto conlleva a una serie de interrogantes como ¿cuál es el número mínimo de especies dentro de los grupos funcionales que garanticen la resistencia del suelo contra el estrés del ecosistema natural y antropogénico. cobre y azufre quimiolitotrofos. para su aplicación en paisajes con diferentes usos de suelo. Si éste es el caso. cuando se adopta el concepto de los grupos funcionales principales. el impacto que provoca la intensificación agrícola. Este manual aborda métodos para el inventario y caracterización de la biodiversidad del suelo. Esto debería servir como respuesta a un gran número de preguntas en contextos similares. Los métodos estándar son necesarios para describir los ecosistemas de manera consistente. lo que exige un alto nivel de conocimientos taxonómicos.C1 y en las transformaciones de hidrógeno (metanogénicas y metilotróficas). de manera que sea posible evaluar. Los métodos han sido desarrollados. En este manual no se abordan problemas taxonómicos. deforestación. puesto que se reflejarán en los métodos a utilizarse. contaminación y cambio climático. abundancia y composición de las especies. En el prefacio se plantea una breve descripción del proyecto.

Se presume que de esa forma se reducirá la diversidad bajo suelo y que. muchas veces enlazadas entre sí. Sin embargo. además. los procesos de disturbio -y recuperación. la complejidad de los agroecosistemas ha sido drásticamente reducida. especialmente en suelos degradados. pérdida del potencial para la limpieza de los residuos y contaminantes. también se manifiestan en diferentes escalas espaciales y temporales (por ejemplo. 2008). dónde y cuándo Aunque éste es un manual de instrucción práctica. incluso puede producirse la pérdida de la productividad primaria. En los trópicos. fertilizantes químicos y pesticidas (Kibblewite et al. interrupción de los ciclos elementales globales y respuesta ante los efectos de los gases invernadero y de la erosión. El mantenimiento de una variedad de cultivos y otras plantas es aceptado como una práctica que protege al agricultor contra los riesgos a corto plazo. escalas que determinan la predicción de servicios ecosistémicos. tales como cultivo mecánico. retener una buena cantidad de diversidad sobre el suelo. la regulación biológica de los servicios de ecosistema basados en el suelo. la biodiversidad y complejidad arriba del suelo favorecen el restablecimiento o protección de la diversidad de organismos bajo suelo. lo cual implica una reducción de la biodiversidad bajo suelo y. debería reflejar un consenso de la teoría ecológica y del pensamiento actual sobre estructuras de la comunidad en diferentes escalas espaciales y temporales. debido a cambios en la fertilidad del suelo y/o incrementos de enfermedades en el mismo. al mismo tiempo. Dichas funciones regulatorias frecuentemente se describen como “sustitutos” por insumos. El suministro global de alimentos depende de la agricultura intensiva. a pesar de que la producción se ha intensificado. un gran número de agricultores tienen acceso limitado a insumos. para mejorar la complejidad estructural y diversidad funcional. de los que puedan realizar las funciones biológicas esenciales. en la medida que proceda la intensificación. Una solución alternativa sería intensificar y. varias frecuencias). si se acompaña de la extinción de especies individuales.minución de los servicios del ecosistema. puede causar pérdidas de función y reducir la habilidad de los sistemas agrícolas para soportar periodos inesperados de estrés. produciendo efectos indeseables. por ende. especialmente. la biodiversidad arriba del suelo se verá reducida. en la medida de lo posible. Este hecho puede considerarse tanto a nivel de campo como de paisaje.que afectan la biodiversidad bajo suelo. El principio central es que el significado funcional de la diversidad biológica cambia de acuerdo con las escalas de El inventario de la biodiversidad biológica del suelo 43 . Para qué muestrear..

pero en el caso de dos campos colindantes. o bien. o bien. los materiales parentales y los suelos serán los principales determinantes de todos los servicios del ecosistema a nivel paisaje. se pensaría que el material parental y el clima fueran los factores determinantes en el proceso de formación del suelo. la diferencia que puede ocurrir en la descomposición o la fijación de nitrógeno simbiótico entre dos paladas de suelo del mismo campo.. con el propósito de lograr lo anterior. El objetivo debería ser reducir la variabilidad intragrupo y maximizar la variabilidad entre grupos. El mayor reto. el inventario de especies de lombrices de tierra. La formación del suelo. a los servicios del ecosistema en diferentes tipos de comparaciones. por ejemplo. en número y diversidad de lombrices de tierra al moverse de un lugar a otro. 2004). si uno o más grupos funcionales importantes estuvieran ausentes o permanecieran en baja presencia en una de las localidades o si el ecosistema original de bosque se hubiera reducido a una presencia mínima en uno de los lugares. Lavelle et al. mientras se mantuviera en un paisaje mixto. puede haber una influencia biótica significativa. puede quedarse corto en relación con el propósito de evaluación de la diversidad de toda el área. dónde y cuándo se mide. es cómo definir estos “grupos” en relación con niveles de escala. si el objetivo del inventario es conservar la biodiversidad bajo suelo. al punto de llegar a hacerla ser irrecuperable. la pérdida progresiva de macroporos.. en otro lugar. probablemente es cuestión de saber cuáles microorganismos existen en cada una. tomando en cuenta los aspectos de la biodiversidad que puedan afectar. a escala regional. Esto quiere decir que. la erosión de finas partículas de suelo y la reducción al mínimo de materia orgánica compleja que. se puede esperar una variación grande. mientras que en el caso de la zona de uso de suelo. espaciales y temporales. 2002. en un lugar específico. Entre dos paisajes o dos regiones. en caso de rehabilitación. a la existencia de termitas o cualquier otro ingeniero del ecosistema que haya presentado mayor actividad en un lugar que en otro. De la misma manera. esto quiere decir qué se mide. del campo hacia setos que delimitan el terreno. como se podría esperar. puede que se deba al drenaje o manejo previo del lugar. Por ejemplo. incluso. El clima. destruir la capacidad productiva. los números o diversidad pueden mantenerse estables. no obstante. Asimismo. de manera general. entonces. En términos generales. Las escalas temporales son importantes en los procesos de degradación. los ciclos de vida de diferentes 44 Manual de biología de suelos tropicales . en última instancia podría. en un mismo paisaje.espacio y tiempo (Swift et al. que combina estos elementos dentro de un sistema de uso de suelo. constituye uno de los servicios del ecosistema que integra procesos en todas las escalas.

cada proyecto necesitará determinar su propia escala en función de sus objetivos. Los cuatro niveles de escala espacial en muestreo. en este caso. (2006). también será diferente de un organismo a otro. al igual que en los protocolos de medición. como calidad y suministro de agua o control de erosión y no parece que éste juegue un papel importante. la distribución espacial de la biodiversidad bajo suelo estará fuertemente influenciada por los gradientes de altitud y temperatura. El impacto en el diseño de muestreo. como se indica más adelante. deberá capturar la distribución. más útil como indicador de la respuesta del suelo al manejo. mientras que las fecundidades también varían y. para explicar las posibles variaciones en la biodiversidad bajo suelo. En el nivel más alto. No obstante. incluyendo el descubrimiento de especies invasivas exóticas es. será un determinante más de dicho nivel. a escala de paisaje. se enfatiza en el capítulo 2 de este manual. geología. El inventario de biodiversidad bajo suelo. como puede ser dentro de los bosques). 1. El patrón de uso de suelo superpuesto en función de dichos efectos de clima. por lo tanto. Paisaje. que afectan a la biodiversidad bajo suelo (y servicios ambientales asociados) y el componente de la biodiversidad bajo suelo. 2004).taxa de biota varían de horas a años y pueden incorporar estados obligados de inactividad. derivados de la base mineral y vegetal. al igual que los procesos de cambio relacionados. La Tabla 1.3 muestra un resumen de niveles jerárquicos modificados a partir de los propuestos por Lavelle et al. tamaño y forma de estos gradientes y fragmentaciones. Los principales conceptos teóricos que corresponden a estos criterios son: apertura y conectividad. el tiempo requerido para que una población creciente alcance un tamaño crítico mínimo donde es autosuficiente. La biodiversidad bajo suelo. La protección y conservación de los principales agroecosistemas y hábitats representa la mejor El inventario de la biodiversidad biológica del suelo 45 . de gran relevancia en ese nivel. son usados en el proyecto CSM-BGBD (véase prefacio) y están considerados como ejemplo. Las características espaciales de la distribución de uso de suelo (“parches” de uso de suelo. en el caso del ecosistema de suelo y sedimentos (Wall. por los gradientes o transiciones de las condiciones de humedad o por los gradientes de las propiedades del suelo. ampliamente discutidos. comparado con los efectos que produce la vegetación misma. A nivel paisaje es difícil evaluar el efecto de la biodiversidad bajo suelo sobre algunos servicios del ecosistema. vegetación y tipo de suelo. también tendrán una importante influencia en la biodiversidad.

2007. Cambios en la arquitectura del suelo. 2006 y Tittonell et al. cercos vivos. también lo es la abundancia de especies relativas. incluso. la composición y actividades funcionales de la biota son de gran interés y.. cuando se trata de agrosilvicultura. tal es el caso de un área con plantaciones comerciales de té o la caracterizada por la agricultura de autoconsumo. por lo tanto. En este nivel. en el caso del inventario de biodiversidad bajo suelo. incluyendo a las raíces de suelo. respecto al cambio de uso de suelo. A nivel de parcela. es en este nivel donde la biodiversidad bajo suelo debería estudiarse de manera minuciosa. 2. La escala de tiempo de estos procesos (cambio de la composición de uso de suelo y configuración de paisaje) para ser observable necesitaría de varios o. de cientos de años. sobre todo. queda dentro de los dominios funcionales de los ingenieros del ecosistema. 1993).. pertenecientes a varios niveles tróficos y grupos funcionales que gobiernan la estabilidad de redes alimenticias y la provisión de funciones de apoyo. Estas áreas muestran. una combinación específica de tipos de cobertura. Área de uso de suelo. describen los gradientes de la fertilidad del suelo en función de los recursos destinados al terreno. de manera que la relación entre el patrón de distribución espacial de la biota sobre el suelo con la de bajo suelo son particularmente interesantes. aunque sean provocados por cambios en la composición funcional y actividad de los ingenieros del ecosistema o del arado del suelo. Parcela o parche. La intensificación de uso de suelo. Las interacciones laterales son componentes muy importantes para la biodiversidad bajo suelo. rompevientos. La biodiversidad sobre el suelo se determina por la variedad de cultivos encontrados en el área y por los elementos vegetales asociados con barbechos.opción para dicha intervención. por ejemplo. Vanlauwe et al. 2006). los cambios relacionados con el uso y cobertura del suelo. se asocia con la extracción de elementos vegetales como árboles. El terreno o parche. Las áreas de uso de suelo se definen en función de su uso y régimen de manejo (Huising. tramos de bosque y otros elementos de manejo de paisajes. típicamente. que implican una pérdida de sus aportes e impactos. normalmente. A este nivel. Los gradientes de las propiedades de suelo sí ocurren en este nivel.. 3. éste es el caso de algunos árboles donde ciertos organismos de suelo hacen uso de sus nichos. si no es demasiado grande. y para la manera en cómo funciona el sistema. pero son asociados con el manejo. tendrán un 46 Manual de biología de suelos tropicales . son visibles en escalas de tiempo más cortas que pueden abarcar desde pocos años hasta varias décadas. la estructura comunitaria y sus interacciones son reguladas por la arquitectura del suelo del lugar en específico (Lavelle et al.

Las “intervenciones” enlistadas en la Tabla 1. 4. La redundancia funcional entre los transformadores primarios (especies o familias diferentes que cumplen una misma función). El manejo de materia orgánica y el uso de agroquímicos causarán un mayor impacto en la estructura de la red alimenticia. en relación con esto. Tal intervención debería apoyarse en el inventario y la abundancia relativa de especies.. termitósferas. también despiertan gran interés.efecto sobre las interacciones tróficas y. principalmente. pertenecientes a grupos funcionales definidos o a niveles tróficos dentro de la cadena alimenticia. La lista de intervenciones y mediciones correspondiente a la biodiversidad bajo suelo. A nivel parcela. composición funcional) pueden necesitar de varios años. según lo describe Swift (1998). el grado de diversidad genética. Este nivel se refiere a los microhábitats que alojan a los microbios y a los componentes de la microfauna del sistema de suelo que los regulan. por ende. la inoculación con especies microbianas.3 son parcialmente derivadas del concepto “el manejo jerárquico de la biota del suelo”. reflejándose la dependencia de los organismos más pequeños en los ingenieros del suelo para el suministro de sus sustratos (véase Lavelle y Spain. los procesos involucrados. dado que ésta es la unidad fundamental de la función del suelo. son segregados en los dominios funcionales: rizósferas. 2001. subparcela o microhabitat. en la estructura de la red alimenticia. sino más bien ilustrativa. Cambios estructurales en la comunidad biótica (conexiones en la cadena alimenticia. drilósferas. Cualquier tipo de inoculación causará un impacto directo sobre la diversidad bajo suelo y. pero un entendimiento de los procesos e interacciones es vital. no es necesariamente exhaustiva. como en la cadena alimenticia. dentro de los microorganismos. por lo tanto. la introducción de depredadores para el control de una enfermedad en particular. del agregado individual y de la partícula individual. para mayores detalles y terminología). Nicho. Éstos existen en la escala de los horizontes de suelo. condicionados por los organismos de suelo en la producción de servicios de apoyo tales como mantenimiento de la estructura de suelo y la descomposición de materia orgánica introducida. etc. la competencia y la eficiencia son de particular relevancia y. El inventario de la biodiversidad biológica del suelo 47 . puede servir para corregir desequilibrios en la composición funcional o para mejorar algunas funciones en particular. Las opciones para intervenciones de manejo en una escala de subparcela son actualmente limitadas. tienen escalas de tiempo relativamente cortas y mostrarán variaciones estacionales.

unidades de referencia. parches de selva. manejo ecosistemas: integrado de patrón de distrirecursos naturales bución espacial. Capa de nivel de agregación Paisaje Tipo de unidad Medida/ parámetro de biodiversidad Área caracterizada Sin especificar: Cambio de uso de Diversidad biopor un mosaico de tal vez.3 Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. dentro de degradación diversidad y tico y patrón de composición cobertura de suelo un paisaje espe. saje. Tabla 1.cas e invasoras. funcional.relacionada con diversidad arriba ingenieros de clasificación).Proceso/ ses o unidades intervención Área de uso de suelo 48 Manual de biología de suelos tropicales . corredores biológicos. varias suelo: protección lógica de suelo: uso de suelo y de por bioma o por de usos de suelo y especies exótiecosistemas como región dentro elementos de pai. de relevancia específica para la biodiversidad y mantenimiento de la provisión de servicios de ecosistema. cuenca mayor. 3–20 tipos de Intensificación Diversidad Área con uso de áreas de uso de de uso de suelo.de suelo. de detalle de la biológicas y bio. mancífico (depentenimiento de de especies y régimen de especialmente diente del nivel áreas de refugio manejo. y prácticas de conservación del suelo. procesos asociados de cambio y componentes relevantes de la biodiversidad. por ejemplo. de un país. del suelo.existiendo una superposición entre niveles de escala dentro de los parámetros a medir. Número de cla. suelo caracteríssuelo.

Proceso/ ses o unidades intervención Medida/ parámetro de biodiversidad Intensificación de Abundancia manejo de suelo y relativa de cultivos. microhábitat horizontes de suelo. 10 a 100 por Área con un uso particular y mane. de agentes de control biológico. Por regla general. funcional. ejemplo. • Proporciones relativas de GF. dentro mejoramiento de y entre grupos funcionales y sistemas de cultivo y manejo de niveles tróficos.Tabla 1. campo agrícola. • Abundancia (total) y biomasa (en el caso de animales) de taxa. parcelas de vegetación. Capa de nivel de agregación Parcela. etc. diversidad introducción genética. na. por suelo. El inventario de la biodiversidad biológica del suelo 49 . proveen un gran número de parámetros para la evaluación de la biodiversidad bajo suelo. Datos requeridos Los métodos expuestos en este manual. Biomasa y actiManejo de vidad microbiabiota clave. inoculación con microsimbiontes.3 Continúa. • Abundancia y biomasa de los grupos funcionales (GF). parche Tipo de unidad Número de cla. dependiendo del tipo de análisis realizado: En cuanto a la biodiversidad: • Riqueza taxonómica a nivel de especie. utilizando los métodos previstos en este manual. materia orgánica. drilósfera. composición labranza mínima. inoculación. Nicho Por ejemplo. erosión. rizósfera. selva. el inventario bajo suelo de la biodiversidad. especies. o a nivel más alto o más bajo (por ejemplo. provee los siguientes datos e información. que consisten en el uso oportuno de tiempo y recursos. Sin tomar en cuenta los objetivos específicos y el diseño experimental de cualquier estudio.área de uso de jo particular. cepas para microsimbiontes). etc. para lo cual se indican en los capítulos 3 y 9 los mejores métodos. los datos tendrán que ser acumulados en cada punto de muestreo.

. Daily. Referencias Bardgett... D. Hattori. T.. Soderstrøm. D. pp. Oxford University Press. y Swift. Bignell. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. V. T. guilds. Moreira.• Índices cuantitativos generales de riqueza y equitatividad.Ecology. F. A. B. (2005) The Biology of Soil. X. Freckman. Malloch. Tiedje. pp.Rusek. Washington DC. J. G. pp.. New York. Brussaard. P. (1998) ‘Soil fauna. V. Proceedings of the Royal Society of London Series B. Bignell. Promedio de datos climáticos y precipitación real hasta la fecha de muestra. J. Tondoh. R. En cuanto al suelo. D. Huising. A. Davic.. Conservation Ecology. uso del suelo... (1981) ‘Effects of animals on soil’. 123–135. Biological Reviews. (ed) (1997) Nature’s Services. J. C. response 11. vol 7. M. V. P. Dibog. Geoderma. D.. D. vol 73. 563–570. Klopatek.. Huang. Behan-Pelletier. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. J. D.. vol 271. Nwaga. F. y Virginia. Hole. Brussaard. J. Historia precisa del uso de suelo desde su estado de selva no perturbada hasta otro tipo de vegetación pre-cultural. Applied Soil. pp. Didden.. Brown. 75–112. Hawksworth.. vol 9. Island Press. functional groups and ecosystem processes’. C. L.. (2003) ‘Linking keystone species and functional groups: A new operational definition of the keystone species concept’.. pp. T. A. Gupta. (1998) ‘A revised six-kingdom system of life’... L. C. in C. L. (2004) ‘Only six kingdoms of life’. Sanchez. 203–266. intensidad de uso y cobertura de suelo: • • • • • • Cultivo aparente o uso de barbecho. Lavelle. Propiedades físicas y químicas básicas: pendiente y aspecto del suelo. S. Ambio. E. Cavalier-Smith. (2005) ‘Belowground diversity assessment: developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. E.. Características de vegetación. F. vol 5. P. issue 1. P. W. Vosti.. R.. 1251–1262. Cavalier-Smith. (1997) ‘Biodiversity and ecosystem functioning in soil’. D.. Folgarait.. A pattern recognition approach to land use inventory at the sub-regional scale 50 Manual de biología de suelos tropicales . Fragoso. vol 26. B. D. Pashanasi. S. Palm.. Prácticas actuales de manejo de suelo y cultivos.. Oxford. Columbia University Press. Susilo. D. P. R.

Kluwer Academic Publishers. Stork. vol 391. H. J.. M... y Watt... (1994) ‘Organisms as ecosystem engineers’. Moreira. Blouin. E. (2008) ‘Soil health in agricultural systems’. H. C. J.. M. Austen. D. Hawkins. R. (1996) ‘The role of species in ecosystems: Aspects of ecological complexity and biological diversity’. (1997) ‘Soil function in a changing world: The role of invertebrate ecosystem engineers’. vol 42..using remote sensing and GIS applying an object oriented and data-driven approach’. Bureau. M. 685–701.. W. N. Lawton. M. S. H. Philosophical Transactions of the Royal Society Series B.. y Shachak. P. P. P. Nature (Lond). P. Washington..vol 69.... 3rd edition. A.J.. 3–16. Lawton.. 72–76. J. C. European Journal of Soil Biology. Mycologia. pp. Hodda. W. Y. an Ecological Perspective. pp. M. pp. Lawton. in T.. in D. D. M. Oikos. Letcher. B. S. P. A. E. Wageningen Agricultural University. y Rossi. Barot. indicator taxa and effects of habitat modification in tropical forest’. The Netherlands. V. Freeman. St John. J. 860–871. 159–193. pp. Wallingford. S. J. B. G. J. A.. H. vol 33..Griffith... Powell.. Lavelle. M. (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. M. Behan-Pelletier.. P.. G. J. M. Decaëns. Spain. (2006) ‘Soil invertebrates and ecosystems services’. Higashi (eds) Biodiversity. (1998) ‘Biodiversity inventories. James.. y Vilgalys. O. The Inventory of Soil Biological Diversity 15ES_HTSB_11-6 13/6/08 18:14 Page 15 European Journal of Soil Biology.S. V.. K. Aubert. Garey. y Paul. K. pp. Lepage. (1996) ‘Diversity of soil fauna and ecosystem function’.. Lavelle. Springer. P. E. Heal. R. Margerie. Eggleton. F. E. CAB International. Porter. Biology International.. P. Siqueira. Roger. L. M. vol 33. A. Jones. N. S3–S15. (2001) Soil Ecology. El inventario de la biodiversidad biológica del suelo 51 . Giller.. 373–386. W. Bignell. R. Levin y M. Holt. G. Brown... W.. Srivastava.. y Swift. Berlin. H. K. (1998) Five Kingdoms – An Illustrated Guide to the Phyla of Life on Earth. Kibblewhite. D. D. Brown. E.. Margulis.. Ritz. L. P. Island Press. P. y Dillion. D. Volters. Abe. Bignell. M. J-P. Mawdsley... T. y Brussaard. T.D. F. Mora. S... M. H. Dordrecht Lavelle. y Schwartz. S. P. Ineson. E. G. Hunt. S.. Longcore. D. Ph. Thesis. G. P. A. Larsen. V..pp.. Mozley-Standridge. T. Bloemers. Hammond. J. (2006) ‘A molecular phylogeny of the flagellated fungi (Chytridiomycota) and a proposal for a new phylum (Blastocladiomycota)’. F. G. P. V. M. E. D. (2004) ‘Connecting soil and sediment biodiversity: The role of scale and implications for management’.. New York. Bignell. S. Wall (ed) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. DC Lavelle. V.. Boulton. vol 98. pp. vol 363. Lavelle.

Bacteria. 23–32 Swift. Proceedings of the National Academy of Sciences USA. G. (1998) ‘Functional diversity of decomposer organisms in relation to primary production’. Vanlauwe B. y Huhta. (ed) (2004) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. E. vol 104. R.. Washington. K. vol 7. G. W. pp. N. Faquin. C. Stork.. R.. J. 11–24. vol 76.. Mikola. 113–134. (2002) ‘Biodiversity and ecosystem services in agricultural landscapes – are we asking the right questions?’ Agriculture. O. Tittonell. M. A. Blackwell. (1990) ‘Towards a natural system of organisms: Proposal for the domains Archaea.. vol 94. M. L. Soil Biology and Plant Nutrition interrelationships. Furtini Neto y J. J. pp. pp. vol 9. P. SBCS/UFLA/DCS. y Eggleton. V. (1992) ‘Invertebrates as determinants and indicators of soil quality’. Swift. Applied Soil Ecology. (1979) Decomposition in Terrestrial Ecosystems. A. M. 4576–4579. de Ridder. H. J. (2003) ‘The uncultured microbial majority’. pp. M. J. Moreira. Laakso. D. y Giller. S. inJ. y Giovannoni. M. (1998) ‘Towards the second paradigm: Integrated biological management of soil’. Tittonell. pp. y Van Noorwidjk. 376–390. E. 369–394. M. Lopes. y Wheelis. S. E. pp. Oxford. pp. B. Swift. pp. J. and Eucarya’. Carvalho (eds) Soil Fertility. American Journal of Alternative Agriculture. M. Island Press. S. A. J. N. y Anderson. Nutrient Cycling and Agroecosystems. vol 87.Rappé. N. Setäla. y Mukalama. (2007) ‘Heterogeneity of crop productivity and resource use efficiency within smallholder Kenyan farms: Soil fertility gradients or management intensity gradients’. vol 57. V. J. M. Kandler. H. J. O. 52 Manual de biología de suelos tropicales .. (2006) ‘Within-farm soil fertility gradients affect response of maize to fertilizer application in western Kenya’. F. Guilherme... Wall. S. Agricultural systems. 25–31. Ecosystems and Environment. Lavras. N. Brazil. Siqueira. Annual Review of Microbiology. L. P. Heal. P. O. Woese. 171–182. Vanlauwe. M. Izac.

Southwood y Henderson. también incluye cómo determinar la localización de estos sitios de muestreo: lo que se discutirá más abajo. S. en otra. Huang (†) INTRODUCCIÓN Gran parte de este manual contiene instrucciones de cómo tomar mediciones una vez que se tiene un sitio de muestreo. En algún punto entre estos dos. En cuanto al argumento es más complicado que una mera elección al azar. el problema gira en torno a cómo escoger el número y localización de los puntos de muestreo en el paisaje en cuestión. Julio N. en los cuales se llevarán a cabo los protocolos de medición. Juvenil E. se cuenta con una teoría de muestreo bien establecida. Fátima M. Richard Coe. se encuentra el problema de la elección de los sitios. Souleymane Konaté. Cares. Gregoire y Valentine. Existe una larga tradición de muestreo en la ecología de campo y. 1977). 2007). se necesita determinar en dónde va a estar localizado todo el estudio. Susilo. En una primera escala. Louzada. por tanto. Además.Capítulo 2 Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo E. una gran experiencia al respecto. en un punto predeterminado del paisaje. que aplica en todos los casos (Cochran. Hay numerosos textos que describen la teoría y su aplicación (ej. La base del problema radica en el muestreo. Moreira. Jeroen Huising. Meine van Noordwijk y Shiou P. es necesario escoger el lugar dónde se tomarán las muestras de suelo para los análisis químicos. 2000. Francis-X. mismos que se describirán en los siguientes capítulos. Entonces ¿para qué se necesita otro capítulo que discuta las técnicas de muestreo de la biodiversidad del suelo? A pesar de los conocimientos y experiencias en rela53 . El problema de localizar los puntos de muestreo se presenta a diferentes escalas. Ronald Zanetti.

54 Manual de biología de suelos tropicales . entonces tratan de entenderlo” y aquéllos que “empiezan con una hipótesis y tratan de probarla”. Sin embargo. Ford (2000) hace referencia a una amplia discusión de los objetivos de investigación en ecología. en cualquier proyecto habrá desacuerdos y discusiones en cuanto a las estrategias de muestreo. Son varias las razones para ello: 1 La aplicación de una teoría completa o de métodos tan extensivos como los utilizados en otros estudios. 5 Los investigadores toman diferentes posturas filosóficas relacionadas con el enfoque de muestreo. Comúnmente hay malos entendidos de algunos de los principios básicos. se presenta un ejemplo del enfoque utilizado en el proyecto CSM-BGBD. 2 La aplicación de una teoría de muestreo puede requerir de información con la que no se cuenta hasta que los datos han sido colectados. Muchos de los debates sobre los métodos apropiados de muestreo se deben a diferencias de opinión en cuanto a los objetivos exactos del estudio. A continuación. debido al tiempo y al costo. OBJETIVOS DEL ESTUDIO Y BASES DEL MUESTREO La mayoría de los autores que escriben sobre diseños de investigación puntualizan que el diseño se determina en función de los objetivos. pueden discrepar en lo referente al carácter práctico del estudio que está siendo diseñado. 4 Los objetivos del estudio determinan el diseño. el tamaño de muestra requerido depende de la variación entre las muestras. entonces esta variación es desconocida. están los que “Ven lo que está ahí. estos podrían no estar completamente desarrollados o los objetivos múltiples podrían sugerir diferentes enfoques para el muestreo. Kenkel et al. En este capítulo se describen algunas opciones para muestrear la biodiversidad del suelo y las ventajas o desventajas de los diferentes enfoques. tales como por qué el trabajo de muestreo debe ser de manera aleatoria. (1989) lo explican con detalle en el contexto de muestreo ecológico. el acceso a sitios de muestreo ideales puede ser restrictivo. Si datos similares no han sido colectados antes.ción con el tema. o qué es una réplica. Por ejemplo. 3 Puede haber límites en cuanto a la teoría. es posible que no sea fácil tomar tantas muestras como se desearía. o bien. Por ejemplo.

Intuitivamente. pero si el propósito es realizar un inventario de especies. Un ejemplo de un objetivo que requiere diferentes enfoques de muestreo son los inventarios. Piense en un nicho raro en el paisaje (por ejemplo.El muestreo aleatorio simple (MAS) constituye el punto de partida para la discusión sobre cómo muestrear. existen pocos estudios ecológicos cuyo objetivo sea estimar la media poblacional. Cuando el objetivo es identificar todas las especies de un grupo dado en el área de estudio entonces el MAS resulta inapropiado. La teoría. existe una estimación del error de muestreo basada en el diseño). dividir la población en sub-poblaciones o estratos. Otra alternativa es formular algunas hipótesis predictivas para explicar los patrones en la biodiversidad. en ecología. existirá solamente una pequeña porción del área de estudio ocupada por este tipo de nichos. indica cómo la precisión de la estimación puede ser controlada mediante la elección de la muestra. a través de la estratificación (es decir. lo que se discutirá en la sección de muestreo aleatorio y sistemático. por lo que prefieren mantener la mente abierta y partir de la observación. La media de la muestra es una estimación imparcial de la media poblacional. La mayoría de los estudios. Un enfoque de muestreo consiste en colectar datos usando el método de MAS o mediante una cuadrícula. Los seguidores del primer enfoque pueden argumentar que no quieren ser prejuiciados por hipótesis previas. situado en el lindero entre el bosque y la pradera. esto es atractivo. argumentando que si se empieza partiendo de un objetivo limitado. y la precisión aumenta con un tamaño de muestra fijo. o el número promedio de especies de hongos en 1 cm3) el MAS adquiere propiedades relevantes. y luego diseñar un estudio cuyo objetivo específico sea probar estas hipótesis. No obstante. y su error estándar puede ser estimado sin hacer supuestos acerca de la variación dentro de la población (técnicamente. se han hecho imD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 55 . Si el objetivo es estimar la media poblacional (la biomasa media de escarabajos por m2 dentro del área de estudio. encontrando correlaciones con variables ambientales). Otra alternativa al MAS consiste en usar un muestreo sistemático usando una cuadrícula. y en cada estrato tomar una muestra aleatoria). el caso de las orillas de un estanque. intentan entender los patrones en la biodiversidad. no importará si los nichos raros son omitidos o no. su imaginación y descubrimientos potenciales podrían estar restringidos. Si el objetivo del estudio es estimar la biomasa media de escarabajos en general. Por supuesto. intentando describir patrones (por ejemplo. entonces los nichos raros deben ser incluidos. análisis de conglomerados y ordenación) y luego explicarlos (por ejemplo. incluyendo los del proyecto CSM-BGBD. entonces.

aunque ésta sea implícita. no obstante.portantes descubrimientos por casualidad. separar los efectos de las dos variables. 3 Si se parte de hipótesis específicas. Se requiere de estudios minuciosamente planeados para poder probar dichas explicaciones. • La MOS y la P pueden estar correlacionadas. tienen valores bajos de MOS. si se trata de entender la relación entre la biodiversidad del suelo y la MOS o la P. haciéndolo más eficiente. parcelas con un valor alto de P. deberían ser medidos en los sitios de muestreo. 56 Manual de biología de suelos tropicales . sin alguna noción de los factores ambientales que puedan controlar la biodiversidad. entre un número infinito de factores. por ejemplo. existen tres razones para tratar de diseñar un estudio con objetivos específicos que incluyan hipótesis comprobables: 1 Los descubrimientos inesperados usualmente tienen la naturaleza de formulación de hipótesis observacionales que sugieren explicaciones. está determinada por el nivel de Perturbación (P) y el nivel de Materia Orgánica del Suelo (MOS) y se colectan los datos por medio del MAS o por muestreo de cuadrícula. Por ejemplo. entonces es probable que: • La mayoría de los sitios de muestreo tengan valores de P y MOS alrededor de la media con. Si las hipótesis implícitas se hacen explícitas el diseño de los estudios pueden ser mejorado. relativamente.1). frecuentemente. además. es imposible elegir cuáles. es posible mejorar el diseño del estudio. los que proponen el enfoque “no hipotético” en realidad parten de alguna forma de hipótesis. Entonces es difícil y hasta imposible. frecuentemente. pocos puntos con valores altos o bajos. sin seguir estudios planeados. Este último punto subraya o enfatiza gran parte de lo que sigue en este capítulo. Si suponemos la hipótesis de que la biodiversidad del suelo en parcelas agrícolas. cada investigador debería estar abierto a la posibilidad de observaciones no anticipadas y explicaciones verdaderamente nuevas. 2 De hecho. son los puntos más extremos los que proporcionan más información (Figura 2. el estudio podría ser diseñado para incluir específicamente algunas muestras con valores altos de P y de MOS y otras muestras con valores bajos de P y de MOS. No obstante. Sin embargo. La estratificación puede usarse para incrementar el número de puntos con MOS más extremos y mejorar la estimación de la relación sin incrementar el número de muestras.

D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 57 . en lugar del experimental. Se espera que las correlaciones entre la intensidad de usos de suelo y la biodiversidad del suelo reflejen alguna conexión causal. es hacer justamente el cambio y esto precisamente constituye la base de un enfoque experimental. dicha investigación iría acompañada de un experimento. como el que se observa en la Figura 2. En el presente estudio. El objetivo global del proyecto CSM-BGBD fue comprobar la hipótesis de que un incremento en la intensidad del uso del suelo cambia la biodiversidad del suelo (más específicamente. En términos ideales. generalmente. entonces se abren nuevos debates con una probabilidad de mejorar el diseño del estudio.1 y las relaciones pueden ser más complejas que el caso de dos líneas rectas. Si tenemos que utilizar un diseño de estudio observacional. Este planteamiento es muy amplio. tampoco es viable en un proyecto de duración fija y corta. se aplican los mismos principios de diseño. que indiquen lo que pasaría con la biodiversidad del suelo si los usos de suelo cambian en el futuro. sin embargo. considerando un rango de usos de suelo en un momento específico de tiempo. Si éstas se seleccionan explícitamente. como en muchos otros. lo ideal sería llevar a cabo un estudio longitudinal. en donde las parcelas sean monitoreadas a través del tiempo para observar si los cambios en la biodiversidad del suelo pueden ser correlacionados con cambios en el uso del suelo.Entonces. Otro ejemplo de una hipótesis implícita en muchos de los estudios es la escala espacial en la que ocurren los patrones interesantes. sin embargo. y sus efectos combinados pueden ser estimados. puede que sea imposible o inútil producir un solo índice de biodiversidad del suelo. muchas veces es la única opción disponible. señala una pérdida de biodiversidad del suelo). no siempre resulta viable. La única manera cierta para determinar el efecto de un cambio. Aunque la validez de este enfoque puede ser cuestionable. En la práctica. el investigador hace una selección de las escalas importantes para su estudio. Lo anterior. se utiliza una aproximación transversal. los efectos de ambas variables. Cuando se determina la distancia entre los sitios de muestreo y el tamaño total del área de estudio. pero aún puede resultar útil cuando se enfoca con un diseño de muestreo. Las discusiones en este capítulo sólo consideran esquemas alternativos de muestreo para datos colectados por el método transversal. puesto que se desconoce el tiempo necesario para el monitoreo.

esto aumentará la precisión de la estimación de la pendiente. por lo tanto. b) si se incluyen de manera deliberada valores de MOS más extremos. el acceso limitado a localidades deseadas para muestrear. tiempos y disponibilidad de expertos. Asimismo. no obstante. Paso 1: Defina objetivos Como se indicó en la sección de objetivos del estudio y bases de muestreo. ENFOQUES PRÁCTICOS El diseño de un esquema de muestreo exitoso y práctico es todo un arte. Sin embargo.Figura 2. serán diferentes para cada estudio y darán a cada investigación un aspecto único. por ejemplo. o bien. dando un estimado pobre de la pendiente. con base científica y de las propiedades que ofrecen los diversos métodos. es posible que se especifiquen algunos pasos del proceso en general que se deben seguir en cualquier estudio. por estratificación. Los detalles de cómo dichos factores prácticos y teóricos pueden mezclarse. desde un principio deberán ser expresados de manera clara y precisa. probablemente arrojará la mayoría de los valores de MOS cercanos a la media.1 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. es necesario que se combine con las restricciones prácticas impuestas por costos. Escríbalos y compártalos con otros para 58 Manual de biología de suelos tropicales . la necesidad de transportar con rapidez las muestras desde el campo hasta el laboratorio. Requiere de un entendimiento profundo. los objetivos determinan todos los aspectos del diseño. podría surgir una serie de restricciones adicionales.

Estos expertos pueden ser investigadores que trabajan sobre temas similares en otros lugares. datos meteorológicos (ej. mapas de uso de suelo (ej. o bien. La Figura 2. Escriba el diseño con tantos detalles como sea posible. Paso 4: Elabore un diseño Elabore un diseño tentativo utilizando una combinación de principios generales. Después deberá comprobar con cuidado que: a) los resultados realmente logren los objetivos y b) que el diseño de muestreo simulado realmente pueda mostrar estos resultados. otros que han trabajado en el mismo sitio. Si bien puede haber aspectos sobre los cuales tenga poca idea. ¿Cuáles cumplen con sus objetivos y proveen evidencia para su hipótesis?.que pueda discutir algunas sugerencias. Imagínese que ha finalizado el estudio y ha obtenido resultados ¿Qué tablas y gráficas le gustaría presentar?. indican la estratificación por altitud o nos permiten entender los problemas de acceso). otros que tienen experiencia en los métodos que va a utilizar. anótelas y numérelas. Paso 3: Reúna datos relacionados Reúna información o antecedentes que serán necesarios para diseñar los detalles del muestreo. Cada estudio cuenta con aspectos únicos y siempre habrá estudios previos de los cuales puede aprender: ésto le permitirá entender qué aspectos de los métodos utilizados han tenido éxito y cuáles limitan la eficiencia y calidad de los resultados. Consiga el mayor número de comentarios y sugerencias de los expertos en la materia. mapas de cobertura del terreno). para identificar los principales usos del suelo que se incluirán en el estudio).... su propia experiencia. Paso 2: Consulte otros estudios Consulte los estudios relacionados con su investigación. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 59 . Una herramienta que ayuda a refinar los objetivos es la presentación de resultados simulados. Anote específicamente el tamaño de las muestras utilizadas y la variación de los resultados. diseños utilizados en otros estudios y su imaginación. para ayudar a decidir cuáles son las temporadas idóneas para el muestreo de campo). imágenes de detección remota (ej.. siempre deberá plantear un proyecto realista.1 es un ejemplo simple. Estos incluyen: mapas topográficos (ej.

procedimientos de manejo de datos. que expresan su opinión acerca de su tema. un error común es obtener información que sugiere que los objetivos son inalcanzables. Una investigación piloto abre la posibilidad de evaluar el aspecto práctico del esquema de muestreo. REPLICACIÓN Y TAMAÑO DE MUESTRA La mayoría de los diseños de estudio son jerárquicos y el problema de muestreo no sólo consiste en seleccionar el sitio de muestreo dentro del área de estudio. En particular. que han usado métodos similares o que han trabajado en la localidad o simplemente. fueron seleccionadas una o más áreas de estudio. considerará algunos aspectos que pueden pasar desapercibidos por el ecólogo. De nuevo. pero deberás seguir adelante. Paso 6: Realice una prueba piloto Pruebe su enfoque. puesto que involucra varios países. procese algunos datos hasta llegar a un análisis estadístico. etc. Dentro de cada país. El proyecto CSM-BGBD es un buen ejemplo. permita probar y refinar los protocolos de medición. también permita estimar el tiempo del muestreo y el procesamiento de las muestras. Dentro de cada sitio de estudio alrededor de 100 puntos de muestreo fue60 Manual de biología de suelos tropicales . puede ser que tenga que retroceder a un paso anterior para volver a intentar. De ser posible. uno o más sitios de estudio (etiquetadas como “ventanas”) fueron seleccionados.. éstos pueden ser personas que han trabajado con temas similares. Asimismo. Paso 7: Revise los pasos En cualquier paso. En cada área. esto dará una indicación de la variabilidad. Trate de incluir un estadista con experiencia en investigación en ecología.Paso 5: Revise su diseño Comparta su diseño con otros investigadores para que expresen su punto de vista y sus comentarios. Un buen estadista. probablemente. lo que puede ser útil para ayudar a decidir el tamaño final de la muestra. JERARQUÍA. revise los objetivos a la luz de nueva información.

Los patrones de interés son los que mantienen una consistencia a través de un número de casos. La selección de algunos países puede estar basada en función de su política o de los intereses de algunas agencias financiadoras e investigadores que dirigen el proyecto. sólo podemos hacer afirmaciones sobre el monte Kenia con base en los datos obtenidos y no es posible extrapolarlos a otros lugares. En cada capa jerárquica. es necesario repetir observaciones con el fin de determinar si los patrones son realmente consistentes. La intención es saber a qué se refieren sus resultados. se plantean las mismas preguntas: ¿cuántas unidades deberían de ser seleccionadas?.ron seleccionados y en cada punto se tomaron muestras (el protocolo de medición determina más capas en la jerarquía. Si se desean resultados que apliquen a los límites del bosque de África del Este en general. Como ejemplo. Suponga que cuenta con diez muestras tomadas de un bosque y diez en las cercanías de campos cultivados y que las muestras de bosque tienen consistentemente una alta biodiversidad del suelo ¿qué podría concluir? Si las muestras fueron seleccionadas de manera apropiada. dicha selección se deberá basar en los objetivos del estudio y en la aplicación de algunos principios. estrictaD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 61 . se podría estudiar la biodiversidad del suelo en fincas alrededor de los límites del bosque en el monte Kenia. en algún nivel. La terminología es confusa y no tiene nada que ver con una población biológica. entonces también se necesitará una muestra de otros bosques. como consecuencia de la extracción de cuatro muestras tomadas para la caracterización del suelo y sub-muestras de éstas para los análisis químicos). pero. La segunda idea es la de replicación. puede concluir (con un grado conocido de incertidumbre. ¿cuáles son? En los niveles más altos. Por lo tanto. lo que requerirá de una muestra de fincas pertenecientes a esta localidad. que trata de mantener la consistencia de patrones y relaciones. relacionados con los usos de suelo. las respuestas no necesariamente estarán basadas en la ciencia. tales como los patrones de la diversidad del suelo. evaluada mediante un análisis estadístico) que las muestras de bosque contienen mayor diversidad que las de los campos cultivados. ya que estos patrones pueden utilizarse para hacer predicciones y pueden reflejar algunas reglas o procesos. El objetivo de la investigación es encontrar algunos patrones. El muestreo implica que el conjunto sobre el que nosotros queremos hacer inferencias (“la población”) necesita ser delimitado antes de que un esquema de muestreo pueda ser planteado. aunque. Sin eso. Lo primero es centrarse en la idea de una teoría de muestreo de una “población”.

2b se pueden observar tres ventanas más pequeñas para muestrear tres diferentes parches de bosque y no uno solo. puesto que representan “pseudo-réplicas”. Sin embargo.2d). los bosques en general. Si este proceso de reducir el tamaño de las ventanas mientras se incrementa su número se continúa. Dicha cuadrícula es una “ventana” con 77 puntos de muestreo (intersecciones) definidos. representan una “regla” aplicable ampliamente. las unidades de nivel más alto. etiquetados como: “bosque” y “agricultura”. Si busca una conclusión válida para los bosques. Nótese que no es necesario muestrear todos los usos de suelo en cada ventana. El que muestras repetidas dentro de un bosque sirvan para ser interpretadas de igual manera que las muestras de diferentes bosques depende de las propiedades de los datos y no. Por ejemplo.2a. por lo tanto.2c). ha sido construida una cuadrícula de tal manera que incluya los dos usos de suelo. Algunas de las implicaciones de estas ideas en el muestreo de cuadrícula son ilustradas a través de un ejemplo simplificado que se muestra en la Figura 2. Un enfoque más certero es asegurar una replicación válida y algunos resultados genéricos. La replicación puede aumentarse y abarcar más área total observada. determina el nivel jerárquico donde se requiere tener réplicas. probablemente. Una respuesta a esto es definir una nueva categoría de “límites de bosque” y asegurar ventanas en los tres sitios de muestreo (Figura 2. muestras múltiples de un mismo bosque no sirven al mismo propósito. la 62 Manual de biología de suelos tropicales .mente hablando. por lo que no pueden ser considerados representativos del uso de suelo. como los sitios de estudio pueden proveer un nivel de replicación. sólo podrá concluir que ese bosque en particular es más diverso y no. patrones consistentes entre sitios. pero queda claro que la escala en que se anticipan o hipotetizan los patrones. a través de un diseño que replique bosques y otros elementos de uso de suelo. En la Figura 2. 1998). entonces en algún momento se perderán las ventajas posibles de muestrear por cuadrícula y se terminará con un diseño que podría parecer un muestreo aleatorio de sitios individuales. varios bosques son muestreados. deberá buscar una consistencia en varias de ellos. En la Figura 2. Dentro de un estudio jerárquico.2. Dentro de cada sitio de estudio se podrán establecer conclusiones más contundentes si por ejemplo. utilizando más ventanas y más pequeñas (Figura 2. La palabra “escala” es confusa y controversial en la ecología (Peterson y Parker. para poder examinar las diferencias en la biodiversidad del suelo. Una crítica a este tercer tipo de diseño es que todos los sitios de muestreo en tierras agrícolas quedan cerca de un límite de bosque. del diseño de muestreo. El objetivo es muestrear un paisaje con dos usos de suelo.

La réplica dentro de la unidad es importante para determinar la precisión con que la biodiversidad del suelo es medida para cada unidad. utiliza datos en el nivel de parcela y el otro. se basan en datos de diferentes niveles jerárquicos: uno. Entonces la hipótesis necesita una muestra de una unidad de 1 km². Ahora es la réplica quien determina la necesidad de varias áreas en cada nivel de cobertura de bosque. no queda claro el diseño de muestreo que se necesita. d) reconociendo los límites como otra categoría. suponiendo que fue definida como áreas de 1 km². se necesita definir el significado de “en el paisaje”. sin embargo. si se intenta hacer un “análisis en el nivel de paisaje”. b) tres cuadrículas que muestrean tres diferentes parches de selva. con varios niveles de cobertura de bosque. con la definición de algunos sitios dentro de cada unidad. Lo anterior. El mensaje es claro: “el nivel de paisaje” no está bien definido y. datos en el nivel de unidades de 1 km².Figura 2. Para poder evaluar la biodiversidad del suelo dentro de un 1 km². la escala espacial en que se evaluó la cobertura del bosque. por lo tanto. pero no es relevante para afirmar la consistencia del patrón a través de la unidad de 1 km² necesaria para examinar las hipótesis. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. Los dos ejemplos del párrafo anterior son análisis que utilizan factores del paisaje. factores del paisaje como la fragmentación del bosque. c) incrementando la replicación. Una hipótesis diferente sería “la biodiversidad del suelo en parcelas agrícolas decrece con la reducción de la cobertura del bosque en el paisaje”. puede ser investigado con parcelas (sitios de muestreo) en un intervalo de distancias. los objetivos de un proyecto de biodiversidad del suelo pueden incluir “análisis del paisaje”. hipótesis puede ser “la biodiversidad del suelo en parcelas agrícolas decrece con el aumento a la distancia del límite del bosque”. con réplicas en cada distancia. afectan los procesos. En otras áreas de la ecología. se requerirá de más muestras. En este caso.2 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 63 . es decir.

y la variabilidad entre réplicas del mismo uso de suelo. La idea de estos diseños es elegir posiciones de muestreo. El muestreo adaptativo (Thompson y Seber. el tamaño de muestra se ha basado en una combinación de información de métodos formales (lo que puede indicar los órdenes de magnitud requeridos). cuando el objetivo de la investigación es detectar y entender algunos procesos. Por lo tanto. requieren puntos más lejanos. sin embargo. Aunque sean teóricamente atractivos. Los métodos requieren conocimiento de dos cosas: de la magnitud de las diferencias (por ejemplo. es improbable su viabilidad. Los patrones a escala fina requieren puntos muy cercanos. Una variedad de diseños a multi-escala han sido utilizados en estudios ecológicos. al igual que el software para iniciar el análisis. Por lo tanto. Otra complicación surge a partir de las respuestas multivariadas de interés. se incluyen ambos 64 Manual de biología de suelos tropicales . a diferentes escalas. Cuando la investigación es dirigida a medir respuestas económicas para decisiones de manejo (por ejemplo. es improbable que sean prácticos para los estudios de biodiversidad del suelo porque el trabajo necesita planearse en distintas fases de campo y de laboratorio. No obstante. Los métodos estándares presumen que existe una respuesta medible de la biodiversidad del suelo que se puede utilizar para obtener el tamaño de muestra. 1996) permite que el diseño responda a patrones que se detecten. como la diversidad de diferentes grupos funcionales. Patrones a escala más grande. pero normalmente resulta difícil especificarlos. dada la necesidad de planear campañas de campo por adelantado. con muchas mediciones que sólo están disponibles después de un largo periodo de muestreo en campo. Queda claro que la decisión sobre el tamaño de muestra depende de esto. la diversidad del suelo entre dos usos de suelo) que es importante detectar. los métodos estándares están disponibles para ayudar a seleccionar el tamaño de muestra. de tal manera que los patrones. medida de diferente manera. puedan ser investigados. Una estimación aproximada de la varianza puede ser obtenida de estudios previos. en la práctica. Enfoques secuenciales (Pedigo y Buntin. Si bien existe cierta atracción por esta idea. etc. 1993) permiten continuar con el muestreo hasta que algunos criterios se cumplan. números. biomasas y proporciones de estos grupos funciones o especies. y estudios previos similares y pilotos. ningún estudio real ha multiplicado las respuestas de interés. la respuesta de un cultivo a un fertilizante) entonces es viable especificar la respuesta mínima que es importante detectar. pero saber qué relevancia tendrá en nuevos ambientes puede ser desconocida.Una vez que se sepa lo que hay que replicar. muchas veces no es posible especificar un tamaño de muestra que resulte importante.

sino de una parcela. Necesitará muestrear dentro de toda esta parcela. los estratos son áreas con diferentes usos de suelo y la idea es obtener. responde a la necesidad de contar con mediciones iguales de diferentes grupos funcionales del suelo. Algunas veces se piensa que este enfoque puede estar “sesgado” porque los tipos de uso de suelo para tomar las muestras se determinan a priori. todas las mediciones se realizan a nivel de parcela. Normalmente.. dentro de cada parcela se reúnen las muestras. No obstante. Si los datos se usan para hacer afirmaciones sobre el área de estudio en general (por ejemplo. Stein y Ettema. de manera deliberada. 2003). El objetivo de descubrir y entender los efectos del uso de suelo en la biodiversidad del suelo. podrá alterar otros grupos. esto significa que la variación y los patrones en la escala dentro de la parcela (por ejemplo. requieren establecer comparaciones en diferentes usos de suelo. muestras de cada uno de ellos. para cada uso de suelo. 2002. Cuando varios grupos de especies están siendo evaluados. y los diferentes usos de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 65 . la segunda. existen dos razones para ello: una. simplemente es práctica. En cada sitio de muestreo seleccionado. lo que quiere decir que se mezclan varias muestras de suelo. normalmente sólo resulta posible examinar un grupo en una muestra de suelo dada y la extracción de la muestra de un grupo. esto quiere decir que se tiene que medir en el mismo lugar. Piense en un lugar seleccionado. pero únicamente un volumen de suelo muy limitado puede ser examinado en la mayoría de las mediciones de biodiversidad del suelo y se toman varias muestras para poder representar toda la parcela. antes de cuantificar la biodiversidad del suelo. puesto que habría demasiadas muestras para procesar si no fuera así. lo que asegura que se obtengan muestras realmente representativas. se requiere tomar muestras (ver esquema de puntos de medición abajo). de tamaños adecuados. seguramente las relaciones entre ellos son importantes. el número promedio de escarabajos por m2) sin tomar en cuenta un diseño. Así. <10 m) no se han examinado. no en función de un punto. ENFOQUE DE OBJETIVOS: ESTRATIFICACIÓN En la introducción de este capítulo. se sugiere que un buen enfoque en los objetivos de un estudio mejorará la eficiencia en su diseño e incrementará la posibilidad de lograrlos.y los diseños eficientes tienen una estructura en forma de conglomerado (Urban et al. entonces los resultados pueden estar sesgados. En este sentido. Un buen enfoque para mejorar el diseño de muestreo es el uso de la “estratificación”. quizá en un área del orden de 100 m².

éstos deberán ser incluidos específicamente en el muestreo. Por ejemplo. En un enfoque estratificado. ni aquellas zonas de transición que puedan ser importantes. Si se emplea este enfoque. tiene sentido excluir tales sitios. las áreas ambiguas pueden ser excluidas del muestreo. podemos elegir un tamaño idóneo de muestra para cada uso de suelo. Si se cuenta con un total de N muestras para comparar dos usos de suelo entonces. 2 Las localizaciones de estos usos de suelo deben ser conocidas. Con un enfoque de muestreo estratificado. ¿dónde se encuentra el límite entre “pastizales con árboles” y “bosque secundario”?. el mejor diseño es tener N/2 en cada uno de los dos grupos. Por supuesto. por ejemplo. Sin embargo. no es deseable excluir algunos usos de suelo. es probable que la muestra incluya únicamente algunas observaciones de estas categorías. pero si el objetivo es investigar los efectos de uso de suelo. entonces probablemente muchos de los sitios de muestreo seleccionados terminarán siendo posiciones ambiguas en lo que se refiere a la definición de uso de suelo. Si un diseño de muestreo no toma en cuenta el uso de suelo. entonces existen dos prerrequisitos: 1 Se necesita saber cuáles son los usos de suelo a comparar y contar con definiciones precisas de ellos. El primer aspecto hace que algunos investigadores se sientan incómodos ante la idea de que una predefinición de uso de suelo para la investigación excluya el descubrimiento de patrones potencialmente importantes. Resulta más eficiente incluirlas en un número 66 Manual de biología de suelos tropicales . sin embargo. Si los objetivos incluyen investigación en límites entre áreas de diferentes usos de suelo o de nichos raros. tiene que considerarse en algún momento. si el objetivo es hacer un inventario del paisaje. de no ser así.suelo pueden no estar representados en las muestras. Se requiere de un mapa de uso de suelo del área bajo estudio. con frecuencias proporcionales a su ocurrencia en el área de estudio. puesto que no habrá certeza en cómo clasificarlas. en ausencia de alguna otra información. el diseño no es parcial para el objetivo de comparar los usos de suelo y además es eficiente. rasgos lineales. a partir de las cuales no se podrán establecer conclusiones. ¿cuándo se debe uno de mover a lo largo de un gradiente para incrementar la cobertura de árboles? Aquí tenemos otra ganancia potencial en la eficiencia del pensamiento a través de estos requerimientos en el diseño y no sólo en la etapa de análisis. al igual que la necesidad de definir con precisión. La predefinición.

El no contar con un mapa de usos de suelo. el que estos no tengan una resolución idónea. El muestreo aleatorio estratificado requiere hacer lo mismo en cada estrato. esto es equivalente a limitar el área de estudio.suficientemente grande. Nótese que muchos de estos argumentos también aplican cuando los factores hipotéticos que influyen sobre la biodiversidad del suelo. por lo tanto. resultan muy útiles en la práctica. puede ser útil hacer un monitoreo rápido de la MOS. entonces dicha área queda representada por esa ventana y el hecho de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 67 . y b) la selección de un punto no cambie la probabilidad de incluir cualquier otro punto. ya que existe la posibilidad de la interpretación de imágenes por sensores remotos (SR). Si se toma un tamaño de muestra subjetivo igual a 1. Sin embargo. Para la implementación del MAS es necesario delimitar el área de estudio. sino variables ambientales. de tal modo que: a) cada punto tenga las mismas posibilidades de ser seleccionado. o en imágenes de SR y utilizar esto para definir los estratos. algunas veces por una buena razón. no es una limitante. calibrarlo en un mapa de uso de suelo. MUESTREOS ALEATORIO Y SISTEMÁTICO Las razones esenciales para utilizar el muestreo aleatorio simple (MAS) fue descrito anteriormente y son detalladas en textos tales como Cochran (1977). los estudios ecológicos no siempre usan un muestreo aleatorio. si los objetivos no lo requieren. Un enfoque común no aleatorio es una selección subjetiva de los sitios de muestreo. cuando una “ventana” única se coloca en un área. Por ejemplo. de la propiedad inherente del diseño. y seleccionar los sitios de muestreo de manera aleatoria. si los objetivos lo requieren. El uso de un software para ayudar en la aleatorización y un GPS para localizar los puntos de muestreo en el campo. Cuando se usan variables como la MOS en la estratificación. abierto al debate cuando los resultados son presentados. tales como la MOS o la frecuencia de fuego. influenciadas por el uso de suelo. por ejemplo. la limitante de este enfoque es la posible falta de “representatividad” del área de muestreo (la medida en que los resultados pueden razonablemente ser asumidos para aplicarlos a una población más grade) porque ésta depende de la percepción del ejecutor y no. Aunque a veces es necesario. excluirlas (dándoles un equivalente de tamaño cero). no son usos de suelo per se. que frecuentemente sirven como base para seleccionar unidades de muestreo a niveles jerárquicos más altos. o bien. cuando se toman muestras en lugares considerados interesantes o importantes. Ello queda.

que esa área sea o no, representativa dependerá únicamente de la habilidad del ejecutor. El muestreo sistemático tiene muchas aplicaciones en la ecología, usando transectos de una dimensión o cuadrículas de dos dimensiones. En el caso de los transectos, las muestras son seleccionadas en puntos que se encuentran a una distancia fija entre sí, a lo largo de una línea predeterminada. Para un muestreo de cuadrícula, una cuadrícula rectangular (usualmente) es definida en el área y las muestras son tomadas en cada punto de intersección. Las ventajas potenciales de este tipo de muestreo sistemático se derivan de la teoría y de la práctica. Las ventajas de la práctica incluyen:
• La facilidad de localizar puntos de muestreo, describir su ubicación y los medios de llegar a los puntos de muestreo; por ejemplo, el protocolo puede ser algo tan simple como “desde el punto de partida, camino al norte y muestreo cada 50 m”. • La facilidad de planear el trabajo de campo; por ejemplo, de estimar el tiempo requerido para muestrear un número fijo de puntos. La razón estadística para utilizar muestreos sistemáticos es que pueden ser eficientes (Webster y Oliver, 1990). Si se considera un estudio con el propósito de calcular la media o el total de algún parámetro (por ejemplo, el carbono total en el suelo en el área de estudio o la media de escarabajos por m2). Si la cantidad medida no es constante, una muestra que utilice la cuadrícula dará una mejor estimación que una simple muestra al azar del mismo tamaño, lo que frecuentemente es el caso de variables ambientales y biológicas. La eficiencia se basa en el hecho de que puntos cercanos son similares, por tanto, no proporcionan mucha información nueva; mientras que en la cuadrícula las muestras están de manera uniforme en toda el área de estudio. Por razones similares, el enfoque de cuadrícula resultará útil para compilar el inventario de un área bajo estudio, salvo que puede excluir nichos raros (véase abajo). Sin embargo, hay aspectos negativos: • Algunos puntos de la cuadrícula tendrían que ser excluidos del estudio, tales como caminos o cuerpos de agua. • Las cuadrículas incluyen muestras de diferentes usos de suelo, con un tamaño más o menos proporcional en cada tipo de uso de suelo. En particular, tipos de uso de suelo raros pueden ser omitidos, lo que se puede compensar moviendo
68
Manual de biología de suelos tropicales

la ventana y añadiendo puntos, aunque el proceso podría llegar a ser arbitrario y subjetivo. • Algunas veces no es posible caracterizar el uso de suelo claramente en cada punto de muestreo. Estos puntos están relacionados con el problema discutido en la sección “enfoque de objetivos: estratificación”. Si el objetivo del estudio es comparar clases de uso de suelo, entonces el muestreo por cuadrícula, a veces, no los captura de forma óptima, de manera que las cuadrículas y los transectos probablemente son más apropiados para muestrear la biodiversidad del suelo, cuando a) no existe ningún objetivo explícito o hipótesis que involucre comparaciones o relaciones con variables ambientales, o b) la hipótesis se refiere a una unidad espacial de un nivel más alto que la escala en que el muestreo por cuadrícula o por transecto fue hecho. Por ejemplo, Swift y Bignell (2001) recomiendan transectos de 40 m de largo, pero éstos quedan dentro de cada clase de uso de suelo. Cuando se comparan usos de suelo, se hacen réplicas de los transectos y se asignan aleatoriamente los estratos definidos por diferentes usos de suelo. De esta forma, el muestreo sistemático por cuadrícula o transecto, normalmente, es combinado con un muestreo aleatorio. Por ejemplo, puede haber varias cuadrículas definidas como se aprecia en la Figura 2.2d, con una localización y orientación hecha al azar. De manera similar, el punto de inicio y la orientación de los transectos que se repiten pueden ser hechos aleatoriamente. Los transectos también pueden ser útiles cuando se alinean con gradientes ambientales considerados importantes; esto se conoce como “gradsectos” (Wessels et al., 1998). Con la aleatorización en algún nivel en la jerarquía, es posible hacer un análisis estadístico basado en las propiedades aleatorias del diseño; por ejemplo, si un número de cuadrículas pequeñas es colocado aleatoriamente en el área de estudio, entonces contamos con las réplicas necesarias para establecer una consistencia, a través de patrones encontrados. El análisis estadístico elegido para una muestra tomada en un diseño sistemático no puede estar basado en la aleatorización, porque los sitios no fueron seleccionados de manera independiente dentro de cada cuadrícula. Existen dos posibles enfoques para el análisis: el primero asume que los datos se comportan de forma aleatoria (por ejemplo, las propiedades estadísticas son las mismas, como si el punto hubiera sido localizado aleatoriamente); el segundo, es utilizar un modelo explícito de patrones espaciales. En la mayoría de los análisis que buscan relaciones entre variables ambientales y la biodiversidad del suelo se usa el primer análisis,
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

69

principalmente, porque las alternativas son complejas. Las consecuencias de suponer esto son raramente investigadas. Es claro que la distancia y el tamaño total de la cuadrícula determinan la escala de los patrones que pueden ser detectados. No es posible observar patrones (por ejemplo, agregación de la biodiversidad del suelo) a escalas espaciales menores que las distancias entre los puntos de la cuadrícula; de la misma manera, tampoco será posible detectar patrones más grandes que el tamaño total de la cuadrícula. Sólo se pueden reconocer los patrones cuando existen varias repeticiones dentro de la misma cuadrícula. Es este aspecto de escala de patrones, definido por los objetivos del estudio, el que debería determinar los espacios y el tamaño total de la cuadrícula. Algunas veces se sugiere que los espacios deben ser de tal manera que los puntos vecinos no estén correlacionados. Esta noción de correlación espacial es importante, pero también confusa. La correlación entre las mediciones de una determinada distancia, no es una cantidad absoluta, pero es una medida relativa a un promedio (técnicamente, el problema tiene que ver con el recambio). Para poder ver esto, piense en analizar datos de una sola ventana en Kenia, donde los puntos de una distancia de más de 200 m entre sí, pueden no indicar similitud en la biodiversidad del suelo, pero si juntamos los datos con otra base de datos global se esperaría encontrar similitud, no sólo en los puntos que pertenecen a una misma ventana, sino entre todos los puntos dentro de Kenia. HABLANDO DE VARIABILIDAD La experiencia de estudios pasados sugiere que se debería de esperar un alto nivel de variación en muchas de las mediciones principales de la biología del suelo. Aún cuando se trata de distancias cortas, se puede esperar una variación grande en número y diversidad de diferentes grupos funcionales. En paisajes agrícolas tropicales la variación dentro de una categoría de uso de suelo puede ser debida a las prácticas de manejo, la variación en las características de la vegetación, las diferencias históricas en el uso de suelo de la parcela, efectos de borde, posición topográfica y características biofísicas. Si los métodos formales para determinar los requerimientos del tamaño de muestra fueran seguidos, probablemente indicarían un tamaño de muestra mucho más grande de lo es viable o costeable, ¿Qué se debe hacer entonces? Primero, ¡no tiene sentido no hacer nada! Simplemente, si se sigue con un tamaño de muestreo preconcebido, no se alcanzarán los objetivos; si el plan original fue
70
Manual de biología de suelos tropicales

trabajar con diez muestras por cada uso de suelo dentro de un sitio de referencia, y las indicaciones son que se necesitan alrededor de 100 muestras por cada uso de suelo, no tiene sentido continuar, puesto que se terminarán obteniendo resultados vagos y no concluyentes, los cuales se traducirán en errores estándares altos y sin efectos significativos cuando se analizan los datos. Tres son las posibles opciones: 1. Incrementar el tamaño de muestra. 2. Utilizar métodos de muestreo para reducir la variabilidad. 3. Reducir la amplitud del estudio. La primera opción no resulta práctica en la mayoría de los casos, pues siempre hay limitaciones de tiempo, dinero, recursos y experiencia. Existen varios métodos para reducir la variabilidad de las muestras; los más útiles consisten en la estratificación y la congruencia. Nótese que el uso del término “estratificación” se usa para el muestreo, pero es diferente a cómo se aplica en “enfoque de objetivos: estratificación” (arriba). Si algunas fuentes de variabilidad pueden ser previstas, éstas pueden ser usadas para definir estratos y removerlas del análisis. Por ejemplo, si el sitio de estudio cubre un rango de altitudes, se puede esperar una variación en la biodiversidad del suelo dependiendo de la altitud. La estratificación, entonces, divide el sitio de estudio en zonas de altitud y los sitios de muestreo dentro de cada una de ellas. En esta fase del análisis de datos, la variación de los usos de suelo se compara dentro y entre estratos para no oscurecer los resultados. Este enfoque requiere que algunos (no todos) de los diferentes usos de suelo estén localizados dentro de zonas de altitud. Si el uso de suelo únicamente varía con la altitud, entonces los dos factores están confundidos y sus efectos en la biodiversidad del suelo no se distinguen. Dado que existe una variación ambiental, la variabilidad en la biodiversidad del suelo estará en respuesta a la variación ambiental. Consecuentemente, los estratos pueden ser útiles para definir puntos de muestro cercanos geográficamente. Las ventanas en la figura 2.2 pueden ser vistas de esta manera. Comparar conlleva la idea de la estratificación a un extremo. Imagine que si dos de los usos de suelo a comparar son bosque y campos de maíz, se puede esperar que la biodiversidad del suelo dependa de muchas variables ambientales, tales como el clima, topografía, y geología. Estas variables ambientales varían típicamente de manera irregular, con sitios cercanamente similares. De esta manera, si seleccionamos parcelas de bosque y maíz que están cercanas, las diferencias entre ellas, principalmente, se deberán al uso de suelo y no, a otros factores, lo que nos
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

71

permite eliminar las variables que “meten ruido” en el análisis. Entonces, el enfoque sería identificar y muestrear, por ejemplo, diez pares de sitios, donde cada par esté formado por parcelas de bosque y maíz cercanas, situadas a cada lado de un lindero de uso de suelo. Formalmente, cada par constituye un estrato de tamaño 2. Más de dos usos de suelo pueden incluirse en el diseño. Las ideas de diseño para experimentos de bloques incompletos son relevantes para seleccionar pares de usos de suelo similares. Controlar la variabilidad mediante la reducción del área de estudio, muchas veces es la mejor solución. El área podría ser reducida, si se reduce el tamaño del sitio de muestreo, reduciendo naturalmente la heterogeneidad, lo que puede ser insatisfactorio porque también reduce la generalidad de los resultados. Si únicamente tomamos muestras en un área pequeña, entonces no existe una base para asumir que se han encontrado patrones ampliamente aplicables. Otras maneras de reducir el ámbito del sitio de estudio son: No incluir todos los usos de suelo encontrados en el área de estudio, sino una selección que cubra un gradiente de intensidades de uso de suelo o que represente alguna transición típica en el uso de suelo. Ajustarse a la definición de una clase de uso de suelo. Por ejemplo, en lugar de tomar un “campo de maíz” como uso de suelo, se podrá limitar la atención a campos de maíz que han sido cultivados continuamente durante los últimos diez años, que no han sido fertilizados en los últimos tres años y que son trabajados con azadón. Evitar tomar muestras en sitios ambiguos, como aquellas que se encuentren cerca de linderos. Mientras esto ayudará a detectar y medir el efecto de la intensidad de uso de suelo en la biodiversidad del suelo, pueden ser inconsistentes con los objetivos del inventario de las especies. Un compromiso entre los dos objetivos puede ser necesario. Esto es común en el diseño de proyectos y, en resumidas cuentas, no se puede esperar encontrar todo en un tamaño limitado de muestra. ESQUEMA DE MEDICIÓN DE PUNTOS Una vez localizados los puntos de muestreo, tiene que ser definido un protocolo de medición, lo que implica la necesidad de un muestreo adicional. El esquema básico
72
Manual de biología de suelos tropicales

de muestreo por puntos adoptado por el CSM-BGBD se presenta en la Figura 2.3, que a la vez se complementa con la Tabla 2.1. Aunque el esquema de medición utilizado para el muestreo de grupos funcionales que son descritos por los procedimientos del proyecto alternativas de roza, tumba y quema (Swift y Bignell, 2001), es diferente de lo que fue propuesto por Swift y Bignell para adecuarse al enfoque basado en la cuadrícula. Por ejemplo, los pocos monolitos en cada punto de muestreo son compensados por el gran número de puntos de muestreo, que resulta en aproximadamente el mismo número de eventos de muestreo. No obstante, los resultados preliminares han indicado que con un pequeño monolito por punto de muestreo no todas las especies pueden ser capturadas. Si éste es el objetivo para llevar a cabo el muestreo, se prevén opciones adicionales para incluir monolitos más grandes. Macrofauna: un solo monolito, trampas de caída (pitfall) y, por lo menos un transecto de 20 m son colocados en cada sitio de muestreo. El muestreo por transectos se amplía para incluir hormigas y escarabajos, en adición a las termitas. En un esquema alternativo adicional los monolitos pueden ser excavados para mejorar el muestreo de lombrices de tierra y se puede introducir un sistema simple para tomar muestras de termitas. Nótese que en las parcelas pequeñas, los sistemas de cultivo pueden estar altamente disecados o los terrenos son difíciles, por lo tanto, no es necesario que el transecto sea lineal. Un transecto puede tener un ángulo de 90 grados, y muestrear parcelas de forma irregular o para evitar arroyos, fuertes pendientes o rocas. Los árboles caídos deben incluirse en el transecto si estos quedan sobre la línea (Swift y Bignell, 2001). Mesofauna: 12 extracciones de suelo tomadas en círculos concéntricos alrededor de un solo monolito a 3 y 6 metros de radio, y extraídas utilizando el método Berlese. Adicionalmente, las trampas pitfalls sin cebo abiertas durante un periodo de 24 horas sirven para colectar mesofauna y macrofauna que viven en la superficie. Las trampas pitfalls generalmente son apropiadas para hormigas, algunos escarabajos, algunos saltamontes, milpiés y arañas. Muestras de suelo extraídas con sacabocado por el método de Berlese contienen colémbolos, ácaros y en sitios húmedos enquitreidos. Microfauna: muestreos con sacabocado de manera similar en 12 extracciones de suelo de dos círculos concéntricos, a 3 y 6 metros de radio del monolito. La “microfauna”, principalmente se refiere a nematodos, aunque también a pequeños ácaros (y larvas de ácaros) extraídos de las muestras de suelo; por el método Berlese pueden cuantificarse.
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

73

Figura 2.3 Esquema de muestreo por puntos para toda la biota. El muestreo se puede ampliar si se usa uno o dos transectos para termitas, hormigas y escarabajos, mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.

Monolito Núcleo de suelo para mesofauna Núcleo de suelo para nemátodos y microbios Muestras para análisis físicoquimicos Transecto 1 m2 para muestra de hojarasca (Winkler) Trampa pitfall

Microsimbiontes y hongos del suelo: muestreos de manera similar mediante 12 extracciones de suelo con sacabocado, puestas en dos círculos concéntricos alrededor de un solo monolito, a 3 y 6 metros de radio. Parámetros físicos y químicos del suelo: cuatro extracciones de suelo con sacabocado puestas en un círculo de 6 metros de radio de un monolito. En el caso de estudios de co-ubicación, una extracción adicional de suelo puede tomarse de la pared exterior de la zanja del monolito (véase Capítulo 3, muestreo de macrofauna). En un esquema alternativo (Figura 2.4) los usos de suelo pueden ser muestreados por una combinación de monolitos principales y subsidiarios, transectos de 50 metros, cuadrantes de hojarasca espaciadas y trampas pitfalls. El muestreo casual alrededor de los transectos puede ser empleado y también trampas Malaise colocadas para capturar insectos voladores mayores. El protocolo difiere de la propuesta anterior, en lo concerniente a los puntos del transecto, cuadros de hojarasca, trampas pitfalls y monolitos subsidiarios colocados en líneas paralelas de 50 m, con una separación lateral de 10 m. Este protocolo debe ser tomado básicamente como una extensión del propuesto anteriormente y se considera aplicable en donde se le dé más importancia al muestreo de todas las especies que existen dentro del área y en los casos donde la frecuencia de muestreo es baja (número de parcelas muestreadas) por las razones explicadas anteriormente. Estas modificaciones
74
Manual de biología de suelos tropicales

resultan más adecuadas cuando se encuentran diferentes usos de suelo en todos los sitios. CONSIDERACIONES PRÁCTICAS EN LA ORGANIZACIÓN DEL TRABAJO DE CAMPO La colecta de muestras o la medición directa en el campo deberían, en la medida de lo posible, realizarse de forma secuencial y durante una sola salida. En el caso de parámetros físicos y químicos del suelo que permanecen estables en el tiempo, el muestreo puede hacerse en un momento diferente. Lo anterior, por supuesto, no se aplica en el caso de características dinámicas del suelo, por ejemplo, el contenido de agua en el suelo.
Figura 2.4 Esquema alternativo para muestrear macrofauna, utilizando un transecto de 50 m.
Extracción Winkler Transecto Mini-monolito

Trampa pitfall Monolito adicional
12 muestras de suelo (12 x 12 x 10 cm)
MS MS MS MS

Monolito principal 10 m

10 m 10 m 5m 50 m
MS MS MS

MS MS

Monolito adicional

MS MS MS

30 cm Hormigas de hojarasca Hormigas endogeas Termitas

2m

D iseño

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

75

Tabla 2.1 Grupos de organismos del suelo colectados utilizando diferentes métodos de captura.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Manual de biología de suelos tropicales
Suelo Mesofauna Descripción X X X X X X X X

76
Trampas pitfall con cebo* - 3 trampas por punto de muestreo. Las trampas se deben quitar después de 48 horas en campo. Transectos semi-cuantitativos 2 x 20 m uno por punto de muestreo, perpendicular a la pendiente Trampas Winkler para muestras pequeñas de hojarasca (1 x 1 m) a lo largo del transecto, 3 Winkler por punto de muestreo Núcleos de suelo con hojarasca (3.5 x 3.5 x 5 cm),12 submuestras por punto de muestreo (profundidad de 0-5 cm). Para mesofauna se hace una muestra compuesta (1er opción), o 4 muestras compuestas por 3 submuestras de cada cuadrante (segundo opción) o 3 muestras compuestas por 4 submuestras. Núcleos de suelo para microbios de 0-20 cm de profundidad sin hojarasca. En círculos a 3 y 6 m, del punto de muestro, una muestra compuesta de 12 submuestras por punto de muestreo.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

Trampa (pitfall)

X

X

X

Transecto

X

X

Trampa Winkler

X

X

X

Embudo de Berlese

X

X

X

Varios

Tabla 2.1 Continúa.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Monolito X

X

X

X

X

X

X

Mesofauna

D iseño
Suelo Descripción Monolito (25 x 25 x 30 cm), incluyendo hojarasca, una muestra por punto método TSBF. Muestra de suelo, una muestra compuesta de suelo por al menos 4 submuestras para análisis físicos y químicos, profundidad 0-10; 10-20; 20-30 cm.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

*Nota.- El cebo sugerido para las trampas pitfall es excremento de monos o de humanos, el cual es muy efectivo para extraer escarabajos coprófagos (Coleoptera) y, al mismo tiempo, no interfiere con la captura de escarabajos saprofíticos (Scarabaeidae, Aphodidae, Trogidae) y predadores (Sistiridae, Staphilinidae). El excremento de omnívoros, resulta más adecuado, en el caso de áreas de selva tropical porque los omnívoros predominan en estos ambientes

77

La colecta de muestras de los principales grupos funcionales de organismos del suelo, requiere de la colaboración de mucha gente en cada punto de muestreo, con el riesgo de lastimar el cultivo en pie, al igual que afectar el inventario, especialmente de aquellos organismos con alta motilidad o sensibles a la intromisión humana. Por ejemplo, las lombrices de tierra epígeas y algunos tipos de termitas comedoras de tierra son sensibles al disturbio, y especialmente a las pisadas, por lo que se alejarían rápidamente. Por lo tanto, es importante reducir el número de personas involucradas en la colecta de las muestras, aunque se necesita un número suficiente de manos para poder manejar y procesar las muestras. Durante el entrenamiento de técnicos y asistentes de campo, es necesario prestar atención a los riesgos que pudieran surgir en cada grupo específico de organismos de suelo. El riesgo de contaminación cuando se trata de microorganismos debe ser entendido y la importancia de utilizar procedimientos adecuados para evitar la contaminación debe ser enfatizada, especialmente en las personas inexpertas. El mismo principio rige cuando existe la posibilidad de que dichos organismos escapen de los sitios de muestreo, como consecuencia de una severa perturbación. Otra preocupación es el gran volumen de suelo que será colectado durante el muestreo y la necesidad de reducir dicho volumen para transportarlo. Desde este punto de vista, la extracción de especímenes de las muestras se hace mejor en, o cerca, del sitio de muestreo. También, en el sitio de muestreo se deben agrupar todas las muestras y extraer sub-muestras para su posterior análisis. El tiempo y la temperatura a la que se almacenan las muestras juegan un papel importante, dado que muchos organismos del suelo pueden morir a temperatura ambiente, en la superficie del suelo, o cuando son guardados en bolsas o contenedores durante unas cuantas horas. Para poder evitar dichos riesgos es importante identificar una instalación local adecuada antes de colectar las muestras o, hacer la extracción inmediata in situ de los especímenes. En algunas ocasiones, por ejemplo, el embudo de Berlese para la mesofauna y de Winkler para la extracción de hormigas y escarabajos de la hojarasca, pueden instalarse en el campo para su uso inmediato; en otros casos, cuando los organismos necesitan ser cultivados in vitro o cuando las propiedades del suelo necesitan ser determinadas, es necesario disponer de un transporte rápido para su traslado hacia el laboratorio. Bajo ninguna circunstancia las muestras deberán permanecer bajo el sol, ni aun cuando el protocolo de extracción requiera de un secado final de la materia. Otros detalles sobre las precauciones a tomar en cuenta y consejos
78
Manual de biología de suelos tropicales

sobre la logística general, se pueden encontrar en los capítulos que tratan grupos y métodos específicos.

MUESTREO EN EL PROYECTO CSM-BGBD
La jerarquía de muestreo
En el proyecto fueron seleccionadas áreas de siete países tropicales, con el propósito de evaluar la pérdida de biodiversidad del suelo con el incremento en la intensidad del uso de suelo. Los sitios se localizaron en las principales regiones biogeográficas de los trópicos, desde la selva tropical húmeda Amazónica hasta la selva montañosa del Himalaya, en la India; áreas que presentan una biodiversidad global importante. Cada sitio incluyó un intervalo de usos de suelo desde selvas prístinas relativamente no perturbadas, hasta tierras agrícolas sometidas a uso intensivo, para determinar tendencias comunes, que puedan ser observadas en el cambio de la biodiversidad del suelo en relación con la intensidad del uso del suelo. El uso de métodos estándares de muestreo en los países y sitios de estudio, permite hacer comparaciones entre los sitios. Se adoptó un enfoque para el muestreo dentro de los sitios que hace uso del muestreo por medio de ventanas. Una ventana es (usualmente un rectángulo) una parcela de tierra que incluye en el estudio varios usos de suelo locales y se consideran “representativos” de los sitios de estudio. Típicamente, las ventanas miden entre 2 y 5 km²; estas ventanas de muestreo varían en tamaño y número debido a la configuración del uso del suelo en cada sitio, y sólo se presentó un caso donde el acceso fue problemático. Por ejemplo, se utiliza una ventana más grande para incluir los usos de suelo relevantes en el área y hasta seis ventanas más pequeñas se distribuyen dentro del área para los diferentes usos de suelo requeridos. Una cuadrícula regular (con espacios variables, véase a continuación) se utiliza para identificar un conjunto de posibles puntos de muestreo dentro de cada ventana; los puntos corresponden a las intersecciones de las líneas en la cuadrícula. El muestreo de cuadrícula se usó por las razones descritas anteriormente, eficiencia estadística y para racionar el trabajo de campo. Además, el inventario es de naturaleza exploratoria, sin tomar en cuenta la hipótesis general formulada, pues quedan pendientes las siguientes preguntas: ¿cuáles de los factores que determinan las prácticas intensivas de uso de suelo influyen en la distribución y riqueza de la biota del suelo? y, ¿a qué escala los patrones de distribución espacial se manifiestan? Este
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

79

enfoque es similar al usado para el proyecto de BioAssess, financiado por la Unión Europea, cuyo objetivo, similar al de éste proyecto, fue evaluar la biodiversidad en función de la intensidad del uso del suelo en paisajes agrícolas (véase Ponge et al., 2003; Federoff et al., 2005). La biodiversidad del suelo se muestrea en el nivel de parcela (punto de muestreo o sitio). La cuadrícula define una serie de parcelas, con un objetivo de cerca de 100 a 200 parcelas por ventana. La parcela es un área de, por lo menos, 25 x 25 m determinada por el área mínima requerida para colectar todas las muestras necesarias y realizar su medición, tal y como se describió anteriormente. El principio de co-ubicación es adoptado para análisis de muestras físicas y químicas del suelo y para los inventarios de la biodiversidad del suelo. Al mismo tiempo las ventanas permiten comparar la biodiversidad del suelo entre los componentes del paisaje.

Localización y definición de las ventanas de muestreo y cuadrícula
La posición de las ventanas dentro del sitio de estudio se hace de tal modo que abarque los diferentes usos de suelo. Generalmente, una ventana no puede abarcar los diferentes usos del suelo, por lo que son necesarias otras ventanas más pequeñas. La Figura 2.5 describe las distintas configuraciones utilizadas. La Figura 2.5a ilustra el uso de una ventana de 9 x 11 puntos de muestreo (además de algunos puntos adicionales de muestreo). La figura 2.5b ilustra el uso de 6, 3 y 2 ventanas separadas. En el caso donde se usan seis ventanas separadas, una ventana medirá 1 km², dependiendo de la distancia entre los puntos de la cuadrícula. En sitios caracterizados por fuertes pendientes se esperaría que el gradiente del uso del suelo esté orientado en la misma dirección, y las ventanas estarán entonces localizadas a lo largo del gradiente (Figura 2.5b). En los linderos de la selva en los trópicos, frecuentemente se observa que el patrón de distribución de usos de suelo refleja un gradiente de intensidad de uso de suelo, con un uso más intensivo a mayor distancia de la selva. En tales casos, las ventanas de muestreo se localizan a lo largo de tal gradiente. Se necesita, por lo tanto, contar con suficientes conocimientos de la región antes de seleccionar los sitios de muestreo. Cuando algunos gradientes no son obvios, la selección de las ventanas deberá cubrir dos o tres de los usos de suelo más importantes y, por tanto, también las transiciones observadas con mayor frecuencia de un tipo a otro tipo de uso de suelo. Por ejemplo, en los márgenes del bosque puede darse la transición de bosque a pastizal, bosque a tierras de cultivo o bosque a grandes plantaciones, en donde
80
Manual de biología de suelos tropicales

b) ilustración de la división de una cuadrícula entre seis. tres y dos ventanas. a) cuadrícula completa. el área ocupada por cada uso de suelo. Cuando se encuentran disponibles mapas digitales de uso de suelo. variaciones topográficas o climáticas. Esto permitirá un análisis comparativo de transiciones de uso de suelo (por medidas relativas).una ventana cubre cada transición típica de uso de suelo. utilizando un papel traslúcido sobre la fotografía. Cuando únicamente están disponibles materiales análogos. según se requiera. Figura 2. Para la selección de las ventanas de muestreo se utilizaron fotos aéreas o imágenes de satélite de alta resolución.5 Ejemplos de diferentes configuraciones de ventanas de muestreo. se introduce un elemento de replicación. antes que un cambio de uso de suelo per se. Número de parcelas de muestreo y tamaño de la cuadrícula El número total de puntos de muestreo por área de referencia se mantiene fijo entre 100 y 120. lo que facilitará la selección de las ventanas. con puntos de muestreo adicionales. dentro de una ventana definida puede ser determinada utilizando software de Sistemas de Información Geográfica (SIG) estándar. mientras minimiza los cambios en la biodiversidad del suelo que surgen de los diferentes usos. se hace una selección manual por interpretación visual. Lo anterior se obtiene mediante varias configuraciones de ventana(s) D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 81 . Mapas detallados de uso de suelo y de vegetación también son adecuados para este propósito. dispuestas a lo largo del gradiente. De esta forma.

descritos anteriormente. Con 100 a 200 puntos por área de referencia generalmente se llega al punto donde la curva de acumulación de las especies para grupos de macrofauna es asintótica. En un muestreo basado en transectos la idea de replicación recomendada por Swift y Bignell (tres transectos por cada uso de suelo) casi nunca se logra. del cual un mínimo de cinco monolitos son cavados para muestrear la macrofauna y cinco muestras conjuntas para los microsimbiontes. suponiendo que existan entre seis y siete usos de suelo distintos por cada área de referencia (correspondientes a seis o siete clases de usos de suelo generalmente definidos en el sistema de clasificación de usos de suelo) donde cada uso de suelo es muestreado por tres transectos. termitas y hormigas). El número total de puntos de muestreo concuerda con otras estrategias de muestreo propuestas en ejercicios similares de evaluación de la biodiversidad. el proyecto BioAssess (Ponge et al. con un transecto extendido en el caso de algunos grupos (por ejemplo.. el diseño 82 Manual de biología de suelos tropicales . En este último. La captura adicional de especies requiere de un esfuerzo de muestreo considerable. Se añaden puntos de muestreo donde el uso de suelo es altamente variable. Eggleton et al. el número de puntos de muestreo deberá incrementarse de 5 a 8 por transecto (es decir. Por ejemplo.de muestreo y las dimensiones de las cuadrículas. cada uso de suelo es evaluado en.. por lo menos. dando un total de 90 a 105 monolitos muestreados (y el mismo número de muestras agrupadas para evaluar los microsimbiontes) aproximadamente igual al número de puntos en la cuadrícula. termitas). un transecto de 40 x 5 m. en el caso de por lo menos algunos de los grupos funcionales (ej. Davies et al. en parte por consideraciones logísticas. Mientras el tamaño de muestra sigue siendo más o menos igual en los transectos y cuadrículas. que para incrementar la confiabilidad de los datos del esquema basado en transectos.. otra opción es ensamblar de una manera sinóptica por combinación de transectos a lo largo de diferentes años o en proyectos no relacionados (ej. es que únicamente se toma un monolito y una muestra agrupada para los microsimbiontes por parcela. 2002. 2001) tendrá un esfuerzo de muestreo comparable. el esfuerzo de muestreo promedio probablemente varía. La principal diferencia con el enfoque de muestreo de cuadrícula. 2003). De esta manera. Los resultados del inventario del proyecto CSM-BGBD indican que es necesario un esfuerzo mínimo de muestreo de 100 a 120 puntos para poder capturar la mayoría de las especies dentro del sitio. y el procedimiento recomendado por el proyecto ASB (Swift y Bignell. 2003) recomienda un número similar de puntos de muestreo. En este sentido Swift y Bignell (2001) argumentan. más puntos en la misma parcela).

Se le da prioridad al tipo de agricultura de subsistencia a la hora de incrementar el número de muestras porque es precisamente en esta categoría dónde se espera que ocurra una mayor variación debido al manejo. basándose en otros datos o en un estudio piloto. Reducir el número de puntos de muestreo por categoría de uso de suelo mientras se mantiene el número de categorías de uso de uso de suelo investigado puede comprometer el objetivo de obtener resultados estadísticamente verificables. si esta prueba confirma alta variabilidad en la biodiversidad del suelo dentro de las D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 83 . La experiencia del proyecto CSM-BGBD indica que el procesamiento de 100 a 120 muestras es viable con los recursos generalmente disponibles. Con menos categorías de uso de suelo presentes. un promedio alrededor de 15 puntos por clase de cobertura de suelo resultan de muestrear la cuadrícula. identificación y catalogación de especímenes son los pasos que requieren mayor tiempo en el proceso (Lawton et al.. Número de puntos de muestreo por categoría de uso de suelo Con seis o siete tipos de uso de suelo en cada área determinada. pero aun así se requiere de una campaña organizada en el campo y de instalaciones establecidas para poder procesar y analizar las muestras. En números pequeños o en una distribución irregular de puntos de muestreo en los diferentes usos de suelo. el número de puntos por categoría de uso de suelo aumenta. La colecta de muestras rara vez es el paso que limita la evaluación de la biodiversidad porque la extracción. Si la capacidad para procesar y analizar esta cantidad de muestras no está disponible.de muestreo se ajusta a los objetivos del inventario del área de estudio. historia. Se aconseja hacer una prueba piloto para informar el diseño de muestreo. en lo que concierne a la evaluación de la diversidad de especies. el procedimiento correcto para reducir el número total de puntos de muestreo deberá ser estimado. normalmente no todas las especies son capturadas y hará más difícil demostrar las diferencias en biodiversidad del suelo entre los tipos de usos de suelo que normalmente se caracterizan por una alta variabilidad en la riqueza de especies. etc. restringir el número de usos de suelo de manera que el esfuerzo total sea compatible con la capacidad de procesamiento. 1998). es importante considerar el número mínimo de puntos requeridos para cada categoría de uso de suelo. El número de muestras requeridas por uso de suelo deben ser representativas de la biodiversidad del suelo presente y entonces. Dado el alto nivel de variación en las medidas de los componentes de la biodiversidad del suelo.

deberán hacerse algunos intentos para aleatorizar la selección de los puntos originales para ser divididos en dos. se puede partir de una cuadrícula vacía (que únicamente contenga posibles puntos de muestreo). Adaptación del enfoque de muestreo a condiciones de campo Hay dos estrategias disponibles para asegurar una representación de los usos de suelo y clases de cobertura en el muestreo.6. se aplica un procedimiento no-sesgado para restar un número de puntos que permitan contrarrestar el incremento en el número total de puntos de muestreo que resulta de ampliar la cuadrícula. Cuando éste no es el caso. con el propósito de seleccionar aleatoriamente puntos de muestreo para cada categoría de uso de suelo. Para este propósito. El enfoque de la cuadrícula asume un acceso libre al terreno o parcela donde se localizan los puntos de muestreo.5a. Una estrategia es usar una “cuadrícula estratificada” según lo ilustrado en la Figura 2. La segunda opción es seleccionar puntos adicionales dentro de las ventanas entre los puntos existentes de la cuadrícula para aquellas categorías de uso de suelo que están siendo muestreadas. se define una cuadrícula mayor (resaltando el número de intersecciones). mientras se cumplen los requerimientos para el número mínimo de puntos de muestreo para cada categoría de uso de suelo. Aunque la inserción de puntos adicionales es conveniente. entonces se hace un ajuste de la definición de clases de uso de suelo. La definición de un sistema de clasificación de uso de suelo se detalla en el Capítulo 11.categorías de uso de suelo. seleccionar las clases de uso de suelo que cubren un claro gradiente en intensidad de usos de suelo. Para poder seleccionar o eliminar sitios de muestreo (parcelas) es necesario conocer los usos de suelo en cada punto de la cuadrícula y se requiere de un inventario de uso de suelo previo al muestreo de la biodiversidad del suelo. De la misma manera. Este procedimiento permitirá eliminar los puntos que caigan en tipos de uso de suelo no especificados. de forma separada hasta que se cumpla con el requerimiento del número mínimo de puntos de muestreo. posteriormente. Posteriormente. Esto implica adoptar un nivel más alto de detalle en el sistema de clasificación de uso de suelo y. Esta opción se puede observar en la Figura 2. de tal manera que se cumpla el criterio para un mínimo número de puntos de muestreo en cada uno de los tipos de uso de suelo. donde la distancia mínima entre puntos necesita ser respetada. Esta estrategia implica incluir ventanas de muestreo irregulares. se necesita una 84 Manual de biología de suelos tropicales . de acuerdo con los principios detallados en “Hablando de variabilidad” (arriba).

Distancia entre los puntos de muestreo La distribución de los organismos del suelo puede reflejar gradientes. aquéllos de carbono orgánico y prácticas de cultivo. estrategia de muestreo alterna. por ejemplo. el acceso a las tierras de los agricultores estuvo restringida. En este caso las tierras seleccionadas fueron aquéllas que pertenecían a agricultores que sí permitieron el acceso y se adoptó un patrón específico para muestrear dentro de estas tierras. en lugar de utilizar una cuadrícula regular que cubriera un área mayor. de una a tres ventanas fueron colocadas en cada comunidad disponible. debido al aislamiento de las comunidades. Los patrones de distribución de los organismos del suelo puede correlacionarse con la topografía. con D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 85 .6 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. Por ejemplo: en un área determinada en México. En el área determinada en La Amazonia en Brasil. colocando una cuadrícula fija dentro de dichas ventanas.Figura 2.

En la literatura se pueden encontrar varios ejemplos de la estructura espacial de la biota de suelo sobre distancias de menos de un centímetro hasta de cientos de metros en el campo. en la Amazonia. Una distancia de 200 m parece aceptable porque permite un área relativamente mayor de muestreo a través de la cuadrícula y es probable que refleje los usos de suelos más dominantes en la muestra. los espacios en la cuadrícula fueron reducidos en el área determinada en Brasil. que las termitas siguen patrones espaciales en un intervalo de hasta 330 m y que la distribución de especies de nematodos muestra tamaños de parches entre 6 a 80 m. con muchos grupos diferentes de organismos del suelo estudiados. Ettema y Wardle (2002) mencionan que la biomasa microbiana y los colémbolos son espacialmente dependientes en intervalos de más de 200 m. reproducción y competencia (Lavelle y Spain. No obstante. con parcelas muy pequeñas (menos de 0. anidadas en estructuras más grandes.los parches de vegetación. si las parcelas individuales miden más de dos a cuatro hectáreas. En el caso del proyecto de la biodiversidad del suelo. dependiendo de los organismos implicados. Sin embargo. 2001). vegetación secundaria muy densa dentro de parcelas barbechadas). 86 Manual de biología de suelos tropicales . la distribución y agrupación de organismos de suelo también son gobernadas por fuerzas intrínsecas de procesos poblacionales tales como dispersión.5 ha) y donde no es posible atravesar (ej. la investigación de la distribución de patrones específicos no representa un objetivo deseado. Por estas razones. el muestreo en cuadrícula permite examinar patrones espaciales a escalas entre la distancia inter-muestra y el tamaño de la cuadrícula. tales como las lombrices de tierra. razón por la que no fueron considerados esquemas de muestreo adecuados para llevar a cabo un análisis de la distribución espacial. También se registra una distribución parchada en una escala miniatura de centímetros a metros. Por otro lado. con la ubicación de árboles individuales. en la mayoría de los casos. o bien. se debe considerar aumentar la distancia entre los puntos. Al mismo tiempo reduce la dependencia espacial de las observaciones para la mayoría de los principales grupos de organismos del suelo. Existen varias teorías para explicar la riqueza extremadamente alta de las comunidades del suelo y el bajo grado de especialización en recursos. se pueden reducir los espacios en la cuadrícula. con gradientes de recursos del suelo. atravesar de un punto a otro. en el caso de paisajes altamente fragmentados. a 100 m. al mismo tiempo permite.

junto con la altitud. etc. la información sobre la precipitación anual. así como las características de uso y manejo del suelo pueden variar considerablemente entre regiones. pH. descrita a nivel de las principales categorías de uso de suelo. con referencia especial al uso del suelo también es importante de conocer (aunque no siempre se cuenta con este dato). como parte del proceso del inventario. textura (la proporción arcilla/arena/limo). asumir que una categoría de uso del suelo está en una escala correcta para acomodar su variación puede ser incorrecto. Por lo tanto. a fin de permitir un análisis completo de los datos para identificar los parámetros que explican la variabilidad en la biodiversidad del suelo. pF (tensión de humedad del suelo). en términos de los factores que determinan la biodiversidad del suelo. Al mismo tiempo. las condiciones bióticas y abióticas.Inventario de uso del suelo y caracterización del sitio La hipótesis central plantea que la mayor variación en la biodiversidad del suelo está asociada con la diferencia en la intensidad de usos de suelo. C y N total. lo indicado será incluir una descripción detallada de uso y cobertura del suelo. materia orgánica del suelo) y características de manejo (tipo de labranza. diversidad de plantas. Existn un número de factores interrelacionados: bióticos y abióticos (ej. Sin embargo.) que afectan la distribución de organismos del suelo y se asume que las principales categorías de uso de suelo proporcionan una diferencia significativa. la diversidad del suelo es inventariada independientemente a lo largo de un gradiente de intensidades de usos de suelo para cada área seleccionada. La definición de clases de uso de suelo resulta importante y se discute en el Capítulo 11 de este manual. deberían registrarse para la ventana e incluso para el área seleccionada. especialmente en sistemas tan diversos como los representados en los trópicos. días de lluvia. y de las características del suelo. duración de secas y la precipitación acumulada hasta la fecha de muestreo. cationes D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 87 . y debido a que las características completas del sitio no pueden ser obtenidas solamente por la apariencia del uso del suelo. El conjunto básico de las propiedades físicas y químicas del suelo debería incluir densidad aparente. Es posible que la variabilidad en abundancia y diversidad de organismos del suelo dentro de una categoría de usos de suelo pueda ser mayor que la variabilidad entre categorías de uso de suelo. Debido a que se sabe muy poco sobre la importancia relativa de los factores antes mencionados. uso de químicos. temperatura y humedad media. pendiente y aspecto. La historia del sitio.

en el caso de cultivos anuales las esporas son más abundantes durante la época seca. P. Sin embargo. la época seca será la más apropiada para muestrear. por esta razón se hace el muestreo al final de la época de lluvias 88 Manual de biología de suelos tropicales . debido a la senescencia de las raíces. Épocas de muestreo Los organismos del suelo responden a cambios estacionales. en la práctica. lo que puede ser diferente. pero inmediatamente adyacentes a la zanja de cada monolito (la zanja exterior probablemente sea el mejor lugar). ayudan a elegir sitios a lo largo de un gradiente de diversidad botánica que tiene alguna relación con sus posiciones actuales en las cronosecuencias e intensidades de perturbaciones. en áreas de bosque. puesto que de esta manera surge la posibilidad de correlacionar las propiedades del suelo con la presencia o ausencia de un taxa en particular y grupos funcionales (véase Anderson e Ingram. la evolución de las estructuras y ciclos reproductivos (como la formación de esporocarpos) se sincronizan con los cambios estacionales que ocurren dentro del hospedero y son mejor observados durante y hacia finales de la época de lluvias. Además. Respecto de hongos micorrizógenos arbusculares. y los resultados del inventario de la riqueza de especies y abundancia (relativa) mostrarán marcadas diferencias entre las épocas. El Capítulo 11 proporciona más detalles sobre los requerimientos respecto de usos de suelo específicos. por ejemplo. características como la altura media del dosel. dependiendo de los métodos utilizados. Una descripción de los sitios puede ser completada por el tipo de vegetación. por ejemplo. no siempre suele ser factible.intercambiables. Para el muestreo de otras variables relacionadas con la caracterización del sitio. También. 2005). Al3+ y H+. CIC. En los casos de hongos fitopatogénos y hongos ectomicorrízicos. los inventarios deberían elaborarse durante la época de lluvias y también en la época de seca. acumulación y abundancia de hojarasca. Idealmente. área basal. ver Anderson e Ingram (1993). La diversidad y abundancia de especies de leguminosas son de particular importancia en relación con la presencia de las bacterias formadoras de nódulos en leguminosas. cobertura dominante/abundancia de flora en el nivel del suelo. la actividad de las lombrices de tierra es mayor al final de la época de lluvias (Tondoh y Lavelle. cuando el método depende del conteo e identificación de esporas. el porcentaje de cubierta vegetal. especies de plantas y la riqueza de géneros. 1993). La producción de esporas responde a la fenología de las plantas y. Muestras de suelo son tomados de suelos no perturbados.

D . pp. A. 195–207. Dubs. Hodda. D. E. S. L. (2000) Scientific Method for Ecological Research. Hauser. C. P. A. y Valentine.. M. G. Stork. T. Eggleton. (eds) (1993) Handbook of Sampling Methods for Arthropods in Agriculture. P. Norgrove. pp.. 89–202. Ponge. H. pp. Ford. Ecosystems and Environment. London. CRC... Federoff. pp177-183. Cambridge. Lavelle.. vol 83. J-F. Kenkel.. T. y Spain. Vegetatio. New York. Ecosystems and Environment.. D. Bignell. Lo último puede realizarse con el objetivo específico de investigar cambios temporales en la biodiversidad del suelo. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 89 . S. Larsen. A. Eggleton. vol 105. T.. D. (2005) “Small-scale response of plant species to land-use intensification”. N. (eds) (1998) Ecological Scale: Theory and Applications. 2nd edition. (1989) ‘On sampling procedures in population and community ecology’. P. G. Columbia University Press. e Ingram. Cambridge University Press. E. Wallingford. Hammond. T. Agriculture.. M. F. (1998) ‘Biodiversity inventories. y Parker. E. D. (1977) Sampling Techniques. J. Peterson. pp. L. Davies. y Watt. 283–290. H. F. P. Holt.. V. G. Jones. G. P. T.. New York. y Buntin. F.. (2007) Sampling Strategies for Natural Resources and the Environment. D.. Boulton. N. Chapman and Hall/CRC Press. Srivastava. vol 17. Mawdsley. G. J. 847–877. (2003) ‘Evolution of termite functional diversity: Analysis and synthesis of local ecological and regional influences on local species richness’. D. D. CAB International. Dordrecht Lawton. M. Wiley. P. R.con la opción de tomar muestras adicionales durante la época de secas. Gregoire. indicator taxa and effects of habitat modification in tropical forest’. (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. B.. vol 90.E. pp. Bloemers.. Ettema. D.. F. Cochran W.. A. y Madong. Dibog. vol 391. Agriculture. y Lavelle. y Podani. Bignell. J. Kluwer Academic Publishers. I. Gathorne-Hardy. (2001) Soil Ecology. Journal of Biogeography... Pedigo. REFERENCIAS Anderson. E. Fernández-González. Eggleton. 72–76. P. Nature (Lond). y Wardle. S. (2002) ‘Termite diversity across an anthropogenic disturbance gradient in the humid forest zone of West Africa’. New York. y Hernandez. B. N.. (2002) ‘Spatial soil ecology’. D. Trends in Ecology and Evolution. Juhfisz-Nagy. L. B. vol 30. P. C. R. J.. L.. L. 3rd edition.

Dubs. F. Haese. R.Ponge. Gillet.. Indonesia. K. M. K. S. D. D. Ecosystems and Environment. P. y Bignell. ASB-Lecture Note 6B . y Lookingbill.. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. E. (1996) Adaptive Sampling. T. S. Bogor. pp. y Lavelle. 200–202.. (eds) (2001) Standard Methods for the Assessment of Soil Biodiversity and Land-use Practice. (2003) ‘An overview of spatial sampling procedures and experimental design of spatial studies for ecosystem comparison’. J. G. Southwood. Eudrilidae) in Ivory Coast’. J. 813–826. M. 1093–1121. 493–500. pp. y Henderson. P. (2003) ‘Collembolan communities as bioindicators of land use intensity’. New York. Biodiversity Conservation. Swift. A. 90 Manual de biología de suelos tropicales . pp.. pp. P. Wessels. (1990) Statistical Methods in Soil and Land Resource Survey. F. van. y Oliver. M. y Lavelle. pp. Thompson. E. 3rd edition. Agriculture. y Seber. J. Journal of Tropical Ecology. vol 94. vol 21. vol 7. Pierce. P.. South East Asian Regional Research Programme. Oxford University Press. y Ettema. Oxford. Wiley. E. 31–47. vol 9.. J..worldagroforestrycentre. Sousa. R. E. A. J. www. (2002) ‘Extending community ecology to landscapes’. Federoff. T. S. Soil Biology & Biochemistry. L.. Ecoscience. Blackwell Science. A. Stein. (2000) Ecological Methods. Urban. J. S. vol 35. International Centre for Research in Agroforestry. A.org/SEA/Publications. Goslee. Jaarsveld. K. Oxford. D. F. A. Webster. y van der Linde. C. (1998) ‘An evaluation of the gradsect biological survey method’. Grimbeek. Tondoh.

por tanto. en la creación de macroporos y en la transformación y redistribución de materia orgánica. e influyen de manera notable en las propiedades físicas y químicas de los suelos. Bignell. termitas. como ingenieros del suelo. los grupos de macrofauna frecuentemente son utilizados o propuestos como indicadores de la calidad biológica del suelo. en ambientes tropicales. Las lombrices de tierra son. sobre todo. se consideran un componente determinante de la biota del suelo. los invertebrados más importantes en el suelo de regiones templadas. el grupo macrofauna incluye aquellos animales del suelo que miden más de un centímetro de largo. Julio Louzada. o que tienen una anchura o diámetro de más de 2 mm. que habitan especialmente en ambientes tropicales. Agus Karyanto.Capítulo 3 Macrofauna David E. Una diversidad de organismos de suelo se incluye en esta categoría (capítulo 1). aunque éste se concentra en los grupos más significativos: lombrices de tierra. Jérôme Ebagnerin Tondoh y Ronald Zanetti INTRODUCCIÓN Este capítulo describe los métodos para realizar el inventario de la macrofauna del suelo. predominan las termitas y las hormigas. indicativos de la biodiversidad de suelo y de los efectos del cambio de uso y prácticas de manejo del mismo. Debido a su importante papel en los procesos del ecosistema y a su sensibilidad ante condiciones ambientales. Susilo. Csaba Csuzdi. probablemente. Mucha macrofauna desempeña un importante papel en los ecosistemas del suelo. Otros son trituradores que deshacen la materia orgánica y un buen número de estos grupos son macropredadores. Reginaldo Constantino. hormigas y escarabajos. sin embargo. 91 . Francis-X. Además. debido a su biomasa. Souleymane Konaté.

utilizando cualquiera de los métodos enlistados en el capítulo 2. Nuevos esquemas son propuestos en el diseño de monolitos para mejorar el muestreo de lombrices de tierra. por lo tanto. abundancia y biomasa. Se entiende que los métodos propuestos son aplicados en ambientes tropicales. Generalmente. el hecho de que se pueda dedicar un capítulo entero al muestreo de macrofauna. algunos grupos representativos de macrofauna específica son capturados. los que generalmente se refieren como métodos “TSBF”. cuyo énfasis se concentra en un grupo específico de organismos asociados y. en el caso de termitas. Un avance mayor consiste en utilizar el principio de transecto para hormigas y escarabajos. Para poder contar con datos de diversidad y abundancia de lombrices de tierra. forman un importante componente de la red alimenticia en el suelo. se requiere de métodos estándares en el muestreo para diversidad. No obstante. demuestra cómo ha crecido durante los últimos años nuestra percepción de la importancia de estos organismos. tal y como fueron aplicados en el proyecto CSM-BGBD. 2000). sin embargo. este capítulo se estructura de acuerdo con el método utilizado y no tanto en función del grupo funcional. Éstos están basados en monolitos de suelo y. Como en el caso de otros grupos de biota de suelo. por ende. el punto de partida de desarrollo de los protocolos han sido los procedimientos de Anderson e Ingram (1989. que sirvan como indicadores para monitorear el cambio de efecto de uso de suelo. en un transecto corto (20-40 X 2m) al que ahora han sido añadidas trampas pitfall (principalmente para escarabajos) y otras guías para muestreo casual. y la extracción Winkler es el método más idóneo para la captura y extracción de hormigas de muestras de hojarasca. con la extracción de los insectos de los marcos de hojarasca por el método Winkler (Bestelmeyer et al. En este capítulo se describen métodos propuestos para realizar un inventario de macrofauna. 92 Manual de biología de suelos tropicales . cada uno de los métodos descritos es idóneo para un grupo en particular: los monolitos son especialmente escogidos para el inventario de lombrices de tierra.generalmente alta. y no simplemente tres páginas que fueron impresas en los métodos originales “TSBF”. el método de transecto es más adecuado para un inventario de termitas. podrán ser utilizados más ampliamente. 1993) consolidados y mejorados por Swift y Bignell (2001). en cada una de las siguientes secciones que describe un método en particular. mientras que las trampas pitfall con cebo son apropiadas para la captura de escarabajos. En el capítulo 2. al mismo tiempo. se explica que no existe un sólo método para llevar a cabo un inventario de un grupo específico de macrofauna. en la generalidad de la macrofauna.

con un reborde. son dictados por Anderson e Ingram (1993). sirve como un buen recipiente para la M acrofauna 93 . aunque es mejor si se muestrea la hojarasca delimitada por marcos dispuestos en una línea paralela. esto se puede hacer de manera sencilla.1d). 10-20 cm y 20-30 cm. Este transecto también puede ser utilizado para hormigas y escarabajos. La muestra de suelo en botes se debe guardar alejada del sol directo y deberá ser revisada antes de 24 horas. una charola de plástico grande de cocina. HOJARASCA Y LOMBRICES DE TIERRA EN PARTICULAR. Se divide el bloque del monolito en tres capas.1a y 3. En el caso de la hojarasca.. con dimensiones de 50 x 50 x 20 cm de profundidad para lombrices de tierra. todos los invertebrados mayores de 10cm de largo. Monolito TSBF Los procedimientos generales. En una variante del método. Se revisa manualmente la hojarasca y cada capa de monolito por separado. 2000). junto con monolitos extraídos del suelo. de manera que puedan trabajar varios asistentes en la misma muestra de suelo o en muestras diferentes. pero que representan una biomasa importante. excavados de la zanja y la hojarasca pueden ser colectados. utilizando un machete o parang tomado de forma horizontal y agarrado por ambos lados. 2001) y las extracciones con trampas Winkler (Bestelmeyer et al. preferentemente en el lugar y bajo sombra. Para la discusión del número y posicionamiento de monolitos. Para revisar el suelo es conveniente utilizar la superficie de una mesa grande de campo para llevar a cabo la extracción. de 0-10 cm. serán milpiés y lombrices de tierra con bajas densidades de población. la anchura aproximada del monolito más dos anchuras de zanja. UTILIZANDO MONOLITOS DE SUELO Macroartrópodos de hojarasca y de suelo. Primero se coloca un marco de 25 x 25 cm para marcar la posición del monolito y cualquier hojarasca o madera dentro de él es removida e introducida en una charola (Figura 3.1c y 3. Se utiliza un transecto adicional de 20 x 2 m para muestrear las termitas.INVENTARIO DE MACROARTRÓPODOS DE SUELO.50 m².1b). aislando el monolito como un pilar no perturbado (Figuras 3. véase el capítulo 2. éstos. con la adición de trampas pitfall (Swift y Bignell. Si no hay mucho tiempo o si la luz es insuficiente (colectar en selva cerrada es difícil porque la luz disminuye muy temprano). Su abundancia y biomasa podrán ser calculadas con base en las muestras de 0. en su mayor parte. es decir. Se aísla el monolito utilizando una pala a unos pocos centímetros fuera del marco y luego se cava una zanja a su alrededor de 25 cm de ancho y 30 cm de profundidad. hay que meter la muestra en un bote de 19 L y llevarla al laboratorio.

Se diseccionarán los pedacitos de madera en diferentes piezas para ver si hay termitas. Se añadirá una etiqueta dentro del alcohol o formaldehído. El tamiz retiene las hormigas que pueden ser aspiradas. • El microhábitat en cuestión (madera nueva. en la que se anotan los datos siguientes (con lápiz o tinta indeleble. sin embargo.revisión. etc. En otros casos. Las hormigas pueden ser extraídas tomando un puñado de suelo. en una charola. no usar bolígrafo o pluma): • Fecha y clave de identificación del lugar. Para evitar confusión en lugares ricos. madera podrida. Se deberá utilizar un tubo o frasco por cada especimen o población encontrada (o colonia aparente). cuando se hace la extracción durante un tiempo determinado. se incluirán soldados. pasándolo a través de un tamiz de malla grande.). montículo. las etiquetas se pueden hacer cuando se ha completado la extracción en cada sección del transecto. generalmente. • En el caso de transectos o monolitos alineados. 94 Manual de biología de suelos tropicales . madera seca. hojarasca. el número de la sección en el transecto en donde se encontró el espécimen (1. se conservan en formol (formaldeído) al 4% para evitar la supuración de la mucosa. de 5 mm. al igual que obreras. Las hormigas. hormigas o escarabajos. deberán preservarse en alcohol al 80%.3 ó 4). las etiquetas deberán escribirse en el momento en que los especímenes sean introducidos en los tubos o frascos.2. las pequeñas ramas deberán romperse y ser golpeadas en la charola para que se desprenda cualquier insecto que contengan. Las lombrices de tierra y moluscos. como en el caso de un transecto. el periodo destinado deberá incluir el tiempo para el llenado de la etiqueta. termitas y escarabajos colectados. suelo. suelo de raíz de árbol. La información es importante para establecer la naturaleza de los organismos encontrados (especialmente la diversidad de grupos funcionales) y para construir una curva de acumulación de especies. en el caso de las termitas. Protocolo de muestreo alternativo para evaluar la abundancia y diversidad de lombrices de tierra en ecosistemas tropicales Introducción Este protocolo alternativo combina el llamado monolito de suelo TSBF (25 x 25 x 30 cm) y tres grandes monolitos (50 x 50 x 20 cm) para evaluar la abundancia y diversidad de lombrices de tierra a nivel local y de paisaje en ecosistemas tropicales.

(1995). por lo menos. véase Gilot et al. A B C D Nota: las ilustraciones A y B muestran la colocación de un marco de madera para delimitar el monolito y la limpieza de hojarasca suelta. 2004). (2000) para Asia y Decaëns et al. Barrios et al. M acrofauna 95 . (2003). la mayoría de los estudios sobre lombrices de tierra han sido elaborados utilizando el método TSBF (Anderson e Ingram. satisface el requerimiento de rapidez y la necesidad de tomar en cuenta la heterogeneidad del suelo a nivel parcela. La ilustración C muestra un monolito grande (50 x 50 x 30 cm) y la D un monolito pequeño (25 x 25 x 30 cm) y la excavación de la zanja. Haymes et al. (2004). (2002) y Mathieu et al.Figura 3. 1993) para macroinvertebrados. Dlamini y Haynes (2004) para el muestreo de lombrices de tierra en África.1 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). véase Bhadauria et al. antes de muestrear el monolito. un monolito cuadrado de suelo de 25x25 cm y de 30 cm de profundidad. los monolitos se distribuyen a lo largo de un transecto corto (40 m) con. siendo la unidad de muestreo. para ejemplos de América del Sur. (1994. cinco monolitos por parcela bajo estudio. En todos los casos. Por más de una década.

A pesar del éxito relativo del método TSBF para estimar la abundancia y diversidad de los macroinvertebrados del suelo. 10-20 cm y 20-30 cm. ha sido reportada para monitorear la dinámica de población de la lombriz peregrina Hyperiodrilus africanus (Tondoh y Lavelle. se estudió la demografía de lombrices de tierra. 2005). el muestreo debería realizarse al final de la temporada de lluvias. 2002). 2005). 1997. 1998) porque las lombrices de tierra son reconocidas por presentar sensibilidad ante la perturbación antropogénica (Fragoso et al. Se seleccionan cinco puntos de muestreo al azar. el reto será desarrollar un protocolo de muestreo rápido para muestrear a nivel paisaje. bajo diferentes prácticas de manejo de suelo (Fragoso et al. Las lombrices de tierra son colectadas a mano. 1978). 1999.. Recientemente. permite tomar en cuenta la variación a 96 Manual de biología de suelos tropicales . por ejemplo. en cada tipo de uso de suelo. Burel et al. 2001. que combina pequeños y grandes monolitos. Decaëns y Jiménez. Protocolo de muestreo De manera ideal. una combinación más eficiente de 100 x 100 x 40 cm para grandes y de 25 x 25 x 30 cm para monolitos pequeños de suelo. Originalmente.. 2002). Lavelle. aunque pequeños monolitos han sido utilizados con éxito para identificar cambios importantes en la diversidad de lombrices de tierra a nivel parcela. Como las prácticas agrícolas contemporáneas muestran un mosaico de tipos de uso de suelo. Vincent. Se pueden usar argumentos similares para justificar un muestreo más extensivo de lombrices de tierra. en cada punto de muestreo se extrae un pequeño monolito de 25 x 25 x 30 cm que se rebana en tres capas: 0-10 cm. respectivamente. han propuesto protocolos de muestreo más exhaustivos para muestrear termitas y hormigas. Decaëns y Jiménez. debido a su especificidad de grupo funcional. cuando se sabe que las lombrices de tierra son más activas (Tondoh y Lavelle.. Tal avance será crucial para desarrollar indicadores de degradación de suelo (Moreno y Halffter. Eggleton et al. aunque pocas investigaciones se han enfocado a la evaluación de la abundancia y diversidad de lombrices de tierra en paisajes agrícolas. (2000). pero consumen mucho tiempo y resultan tediosos. 1969. cubriendo grandes áreas. Fragoso et al. 1997. la carencia relativa de centros de colonias y su distribución altamente parchada. Los monolitos de tamaño medio (50 x 50 x 40 cm) fueron utilizados por Ortiz-Ceballos y Fragoso (2004) para evaluar el impacto de una cobertera en poblaciones de lombrices de tierra. utilizando grandes monolitos de suelo de 1 m² x 40 cm de profundidad. (1999) y Agosti et al. Este esquema de muestreo estratificado.

Monolitos grandes (50x50x20 cm) Monolito pequeño (25x25x30 cm) nivel parcela de las poblaciones. con un punto de partida elegido al azar. Anderson e Ingram.3) y son almacenadas en una solución de formol al 4% para su posterior identificación. 1993). Cada monolito mayor se separa en dos capas (0-10 y 10-20cm) y no en tres.2 Esquema de alineación de monolitos complementarios de lombrices de tierra. 2005). porque la mayoría de los especímenes (57-99%) son localizados en los primeros 20cm durante la temporada de lluvias (Tondoh y Lavelle. como en los pequeños monolitos. 1993). En cada punto seleccionado. contados y pesados. mientras la variación a nivel paisaje se hace con un muestreo en los usos de suelo más representativos. De manera adicional. El transecto aparece representado esquemáticamente en la Figura 3. Las lombrices de tierra se colectan a mano (Figura 3. en intervalos de 5 m. Los individuos después son identificados. perpendicular a la pendiente.Figura 3. de acuerdo con el procedimiento de TSBF (Anderson e Ingram. cuando se considere apropiado (TSBF modificado. se extraen tres grandes monolitos de 50 x 50 cm y de 20cm de profundidad. Monolitos adicionales son extraídos para poder tomar en cuenta la heterogeneidad a nivel de la parcela. las lombrices de tierra son muestreadas. M acrofauna 97 .2. a lo largo de un transecto.

Figura 3. las especies nativas requieren de la pericia específica del país. cuando sea necesario.3 Separación a mano de lombrices de tierra en charolas de plástico. 2005) son los principales puntos de referencia. Identificación de lombrices de tierra y estimaciones de su abundancia Especímenes de lombrices de tierra. previamente agrupados como morfoespecies. La abundancia de lombrices de tierra se estima 98 Manual de biología de suelos tropicales . Las especies de lombrices de tierra peregrinas comunes. Fragoso y Rojas-Fernández. 2001. por lo tanto. se debe consultar la descripción original de especies. 1994. 1987) y Csuzdi (1996) y. Zicsi. Para las especies africanas de Eudrilidae y Acanthodrilidae (Benhamiinae) se pueden utilizar las revisiones de Sims (1980. que se encuentran distribuidas en toda la región tropical. utilizando las claves desarrolladas por Blakemore (2005). Desgraciadamente. son identificables a nivel especie utilizando las guías y descripciones dadas por Blakemore (2002). Easton (1979) y Julka (1988) son las apropiadas. 1995. las monografías de Gates (1972). pueden ser identificados a nivel de familia. 1971. Sims e Easton (1972). Para la identificación de lombrices de tierra de la India y del Sureste de Asia. la revisión de Eisen (1900) y estudios seleccionados de varios autores (Righi. sin embargo. debido a la carencia de guías comprensivas para su identificación. no existen a la fecha monografías disponibles para la identificación de lombrices de tierra de América Central y América del Sur.

. M acrofauna 99 . producen excretas dentro del perfil del suelo y sobre la superficie. Desde el punto de vista ecológico. 1977.como el número de individuos por m² y la biomasa como g de individuos por m². 1997). las comunidades de lombrices de tierra pueden dividirse en tres grupos (Bouché.. 2. La diversidad de lombrices de tierra se estudia en dos niveles complementarios: diversidad taxonómica y funcional (Bouché. 1977. El aspecto funcional de la diversidad resulta de gran interés para evaluar la relación entre diversidad y servicios del ecosistema. a nivel de la superficie del suelo. en casi todos los casos. 1997). en cada tipo de uso de suelo. con este enfoque. regional y continental. Fragoso et al. Se pueden utilizar tres categorías de expresión de la riqueza de especies: 1) el número de especies registrado en todos los monolitos. no pigmentadas y que viven dentro del suelo. mientras que las especies exóticas son. 1996). introducidas por interferencia humana. éstas han sido llamadas peregrinas para indicar su amplia distribución a niveles regionales y continentales (Lee. Fragoso et al. Los servicios que proveen las lombrices de tierra al ecosistema se relacionan con el impacto de su actividad en el sistema de suelo (Lavelle et al. La estructura de las comunidades de lombrices de tierra puede ser caracterizada por la densidad y biomasa de lombrices nativas y exóticas La importancia de la diversidad funcional en las lombrices de tierra ha sido ampliamente documentada (Lavelle.. 1997. se lleva a cabo mediante la identificación en cada tipo de uso de suelo de especies nativas y exóticas o peregrinas.. 1997 y Lavelle et al. Lavelle 1983. dos grupos de lombrices de tierra pueden ser distinguidos de acuerdo con su origen: especies nativas o exóticas.. Lombrices epígeas: de tamaño pequeño. 1977). Lavelle. Lombrices endógeas: de tamaño medio. 1983. El primer nivel de diversidad taxonómica trata del número y de la identidad de especies de lombrices de tierra. La relación nativas vs exóticas puede utilizarse como un índice para calcular la extinción de especies nativas o como un claro indicador de la invasión de especies exóticas o peregrinas. 1981): 1. 2) la diversidad promedio expresada en términos de la media de número de especies por cada tipo de uso de suelo y 3) el índice ShannonWiener de diversidad (Pielou. Como resultado de su actividad. Blanchart et al. Especies nativas son las caracterizadas por una distribución restringida a nivel local. El análisis de comunidades de lombrices de tierra. 1987). El segundo nivel de diversidad taxonómica trata de la biogeografía de lombrices de tierra (Fragoso et al.. con pigmentación y que viven en la hojarasca. 1997). Dentro de un ecosistema dado.

Swift y Bignell (2001). La mayoría de las lombrices de tierra que pertenecen a los tipos endógeos y anecicos son destacados ingenieros del ecosistema (Lavelle et al. 50 o 20 x 2m. sin pigmentación y viven en el suelo. cinta métrica de 30 m o preferiblemente cuerda de nylon o mecate. relativamente. aunque se considera que. aunque se ha acortado a 20 m en el protocolo estándar. El método. se basa en un transecto de 100 m. por lo que los transectos se tratan separados de los monolitos y de las trampas pitfall. Sus actividades forman una red densa de túneles dentro del suelo. pero comen en la superficie. 1997) porque son activas mezclando y cavando el suelo. ESCARABAJOS Y LOMBRICES de tierra Introducción Este método utiliza un transecto de 100. Equipo requerido Brújula. tumba y quema. tal y como se describe y desarrolla más adelante. modificando así las propiedades hídricas y químicas del mismo. marcada en secciones de 5 m.3. MÉTODOS DE TRANSECTO PARA TERMITAS. presentan una alta resolución. y sigue las descripciones formales de Jones e Eggleton (2000). para el proyecto CSM-BGBD y a 50 m en el esquema alternativo de muestreo (véase Capítulo 2). una 100 Manual de biología de suelos tropicales . Los datos obtenidos son cualitativos (identificación y número de especies) y/o semi-cuantitativos (abundancia relativa de especies y/o grupos funcionales específicos).. fue desarrollado para bosques o localizaciones recientemente derivadas como en la agricultura de roza. Cada persona lleva un machete o parang afilado. HORMIGAS. Este método se considera de bajo impacto y resulta idóneo para ser usado por aquellos que no son especialistas en termitas y puede ser completado en cada punto de muestreo por dos personas en un día (dos días para un transecto de 100 m). Lombrices anecicas: de tamaño grande. A las lombrices de tierra se les puede asignar una categoría ecológica o grupo funcional y posteriormente comparar dichos grupos con base en su densidad y biomasa. utilizando cinta naranja o amarilla fluorescente o a prueba de agua y un palo de 2 m.

Frecuentemente se necesita evaluar. acantilados o caminos en uso que no sean hábitats adecuados para termitas. cuando se trata de decidir sobre la línea ideal. sin embargo. por lo menos. a 15m de distancia. Se debe asegurar que las líneas de pitfall se mantengan sin perturbación en todo momento. para poder replicar un monolito) los transectos deberán posicionarse para evitar interferencia mutua y separarse. de alrededor de 8-10 cm. siempre que no se crucen con ellas mismas. Se coloca el transecto de manera que visualmente atraviese los alrededores de manera homogénea. para evitar pisadas excesivas en un solo lugar. un cuchillo de campo de hoja fija. ese tiempo podrá reducirse si se trabaja con varios equipos de dos personas. con alcohol al 80% (se necesitarán más para hábitats ricos en termitas). dos pares de pinzas. tales como pendientes. un transecto puede curvarse sucesivamente por dos ángulos de 90° para que corra hacia atrás hasta su punto de partida. No obstante. de manera simultánea. de modo subjetivo. el transecto se puede desviar hacia un lado. para evitar obstáculos naturales. el transecto puede incorporar otros fenómenos naturales del ambiente biótico que contribuyen a su heterogeneidad física. en diferentes secciones. a una distancia suficiente para evitar cualquier perturbación durante el muestreo. puede ser útil para picar madera o suelo. Las líneas de transecto no necesariamente tienen que ser rectas. pueden inclinarse para alcanzar ángulos de hasta 90°. siempre que por lo menos una parte del sistema de raíces quede dentro de la cinta de muestra de dos metros de ancho. El tiempo requerido para realizar transectos de 20 m es de 30 minutos de muestreo por dos personas. dirección del transecto con la brújula y cualquier cambio de dirección. Si la línea atraviesa un árbol. estrechas zanjas con arroyos o cortes en el dosel. en cada sección de 5m. de área basal muy grande. Procedimiento Se traza una línea de transecto de 20. En una parcela pequeña. alrededor de 40 frasquitos de aproximadamente 1 x 5 cm. Si se emplean otros transectos en la misma parcela (por ejemplo. Es necesario anotar el punto de partida. El muestreo se estratifica por M acrofauna 101 . evitando grandes arroyos. Un equipo de dos personas será capaz de muestrear entre 8 y 12 secciones por día (2 a 3 transectos). se pueden colocar dos transectos de 50m (o de 10 m) para que queden en paralelo. Alternativamente. especialmente en los casos de pequeñas parcelas. pero los dos “brazos” principales de la línea del transecto deberán encontrarse. 50 o 100 m junto al monolito. una charola de plástico o metal con reborde alto.cuchara de albañil.

la hojarasca y los restos de madera pueden diseccionarse rápidamente en charolas. frecuentemente contiene termitas. También resulta de ayuda descansar unos minutos entre secciones. El suelo. Idealmente. La madera podrida. nidos de termitas o pistas de tierra en troncos de árboles y otra vegetación. debería muestrearse la primera vez bajo la supervisión de un colector experimentado. de 50 ó 100 m. Otras especies pueden habitar montículos y nidos o podrán coexistir con los que están construyéndolos. sin olvidarse de las ramificaciones o de los helechos que pueden acumular suelo que contenga termitas. posiblemente. madera en todas sus etapas de descomposición. lombrices de tierra y. En la mayoría de las localizaciones no es necesario colectar cada termita y las especies más comunes podrán ser ignoradas después de muestrearse inicialmente para poder buscar las formas más raras o crípticas o para buscar soldados en especies que tengan una relación relativamente baja de soldado/obrero (tomando en cuenta que algunas especies no tienen soldados). Normalmente se requiere de un corto periodo de entrenamiento u orientación para que colectores sin experiencia puedan muestrear con la misma eficiencia que un experto. El tronco de un árbol vivo puede ser investigado para ver si contiene túneles de termitas a una altura accesible. o cubierta de pedazos de suelo. junto con sus cámaras centrales. escarabajos y lombrices de tierra en nichos crípticos o cuando escasea la luz. incorporada en el suelo de superficie. por ello se permite interrumpir la labor 102 Manual de biología de suelos tropicales .4). sin necesidad de usar una escalera o tener que trepar (alrededor de 2 m). Los pedazos más grandes de madera deberán cortarse tomando en cuenta que pueden estar infectados en alguna parte. Los colectores deberán trabajar de manera constante (no frenética) en cada uno de los periodos de muestra de 30 minutos y tratar de mantener el mismo nivel de eficiencia de muestreo en cada sección del transecto. Los siguientes micronichos son investigados con detalle: hojarasca y la superficie del suelo hasta una profundidad de alrededor de 5 cm. un transecto de entrenamiento. por esta razón y para poder minimizar la necesidad de tener que trabajar con escasa luz. es aconsejable comprobar la periferia y la base de la estructura. por lo tanto. se recomienda completar no más de 12 secciones en un día. Los palitos deberán romperse en pedazos y golpearse moderadamente en las charolas para desplazar cualquier termita u hormiga que contengan. Es imposible muestrear con lluvia fuerte.nichos. acumulaciones profundas de hojarasca y suelo entre grandes raíces que funcionan como retenedores. otros invertebrados. nidos subterráneos epígeos y arbóreos y montículos de una altura de hasta 2 m sobre la superficie del suelo (incluyendo nidos de bolsitas suspendidos en la vegetación). esto ayuda mucho a ver las termitas (Figura 3.

contener soldados y obreros. en el M acrofauna 103 . por ejemplo. por lo menos. hasta que mejoren las condiciones climatológicas.4 Extracción de termitas de una muestra de suelo en una charola de aluminio. el otro examina el suelo y las raíces de los árboles. Procesamiento de especímenes Los especímenes representativos de las termitas encontradas deberán ser preservadas en alcohol al 80% y. Esto dependerá de la naturaleza del lugar y de la topografía. en lados opuestos de la línea.5 x 2 m. se puede usar un pincel de artista humedecido con alcohol para depositar el espécimen en el frasco colector. a pesar de que se trate de una pequeña cosecha. En los transectos donde se encuentran pocas termitas. de manera que mientras uno muestrea la madera. para dividir cada sección en dos subsecciones de 2.Figura 3. El trabajo puede dividirse entre los colectores. en lo posible. previo acuerdo. Se recomienda que el suelo se extraiga en. es importante observar el protocolo de muestreo con precisión. cada persona trabaja en una cinta de un metro de ancho. Se debe destinar un tubo de especímenes para cada población (o colonia aparente). Alternativamente. una docena de lugares separados en cada sección del transecto. Nota: las pinzas finas son idóneas para atrapar insectos con cuidado. sección a sección. sin dañarlos. sin interrumpir el trabajo.

se añade alcohol fresco y se escriben las etiquetas nuevas). madera podrida. Se generan diez secuencias al azar de las secciones por 104 Manual de biología de suelos tropicales . La información referente al micronicho en donde se encuentra cada espécimen es importante para poder establecer la naturaleza de la comunidad de termitas (especialmente la diversidad funcional del grupo) y para construir una curva de acumulación de especies. montículo. por morfoespecies o especies nombradas.cual se introducirá una etiqueta. utilizando una impresora láser. como una muestra independiente. Alternativamente. que se cortarán y pegarán en una libreta de campo. con pluma o bolígrafo. sin embargo. los números de las etiquetas estarán relacionados. se deberán escribir las etiquetas (o las notas de campo) tan pronto como se hayan colocado las termitas en los tubos de especímenes. hojarasca.). el mismo día en que son colectados o tan pronto como sea posible. Las termitas deberán separarse en unidades taxonómicas reconocidas. por lo tanto. etc. los siguientes datos: • Fecha y clave del transecto. • El micro hábitat en cuestión (madera fresca. en el campo únicamente se añaden las etiquetas a los frasquitos y se toma nota en la libreta de campo de los números por sección y del transecto. al completar cada sección del transecto. se podrán escribir etiquetas o notas. Para evitar la confusión. Todas las notas de campo se guardan en la libreta y. lo que facilitará el trabajo. Los especímenes pueden resultar dañados o afectados en su color por el suelo o basura contenido en el frasquito. razón por la cual deben limpiarse lo antes posible (se separan las termitas del suelo o de la hojarasca. suelo a raíz de árbol). se podrán imprimir etiquetas numeradas. en lugares ricos en termitas. en orden secuencial. reduciendo así las posibilidades de cometer errores en la numeración. se podrá construir una curva de acumulación por especies basada en especímenes o simplemente por especies. 3. razón para destinar un mínimo de dos días a cada transecto de 100 m (proporcional para transectos más cortos). los treinta minutos para el trabajo deberían incluir el etiquetado. todas las etiquetas seguirán el mismo patrón. 2. Lo anterior hace que el procesamiento sea más eficiente. • Número de sección en el transecto donde se encontró el espécimen (1. madera seca. con lápiz o tinta indeleble y no. por lo que se podrán leer con mayor facilidad. Al tratar cada sección de 5 m. donde se anotan. En otros lados. suelo. para los taxónomos expertos.

en el lugar 1. Las muestras y los especímenes necesitan ser etiquetados y organizados cuidadosamente. el resto. normalmente requiere una pericia taxonómica alta. dependiendo del lugar y de la región biogeográfica. También es importante que las morfoespecies “A”. de manera permanente. 2004). Una manera más realista sería obtener la lista final. 2004) que son implementados por el software libre EstimateS (Colwell. pero esto muchas veces no es posible para algunos grupos de organismos de suelo. Una taxonomía pobre podría resultar en una baja o sobreestimación de diversidad y similitud de especies y hacernos llegar a establecer conclusiones erróneas. La identificación de organismos de suelo. La riqueza específica del lugar puede ser estimada utilizando métodos de extrapolación. M acrofauna 105 . finalmente.medio de un trazo (en cada secuencia) de 20 secciones al azar. entre otros (Magurran. Identificación El primer paso para compilar una lista de especies y organizar los datos del ensamble de las especies encontradas. en un museo. Una curva ideal debería ser asintótica. o bien. Lo ideal sería que todos los especímenes fueran identificados hasta especie. debería subir y posteriormente inclinarse. en el lugar 2. se separaran en morfoespecies. será identificar cuáles son las que están presentes en la muestra. sin reemplazo. indicando que se encontrarían pocas o nuevas especies con transectos adicionales en el área. parcialmente compuesta por especies identificadas y. Chao y ACE. la identificación consiste en la determinación de la posición de un espécimen en la clasificación existente. un subjuego en una colección de una institución nacional. tales como Jackknife de primer orden y Jackknife de segundo orden. se identificaría a nivel género y. es importante utilizar el mismo esfuerzo de identificación y métodos. El número de especies encontradas en cada sección se usa para calcular el número acumulativo de especies. para cada selección de las diez secuencias. Cuando se comparan datos de diferentes hábitats o localidades. Las especies y morfoespecies encontradas por transecto pueden ser desde sólo unas cuantas hasta más de 50. se calcula la media acumulativa de especies de los diez juegos de 20 secciones para cada sección y se construye una curva de acumulación de especies. a nivel especie. es decir. sean las mismas que “A”. trabajando desde niveles altos como órdenes hasta familia. género y especie. La colección entera deberá ser preservada durante un tiempo después de la identificación para su posterior confirmación y se debe de depositar. lo que resulta muy laborioso en términos de tiempo. 2000.

No obstante. corniger y N.1 presenta un ejemplo de una lista de especies. nunca se deben utilizar nombres manuscritos no publicados. c) comparaciones con colecciones de referencia y d) envío de especímenes a un experto taxónomo. será el Código Internacional de Nomenclatura Zoológica (Comisión Internacional de Nomenclatura Zoológica. La Tabla 3. similis. para plantas. técnicas moleculares para la identificación de microorganismos. El formato de los nombres deberá seguir el código respectivo de nomenclatura. aunque frecuentemente se recomienda. que deberán ser respetadas: los géneros y especies se imprimen en cursiva. 1992). a modo de rutina. B fueron identificadas únicamente a nivel género y morfoespecie. A y Termes sp. excluyendo animales. por ejemplo. ocasionalmente. pero no es obligatorio. Se trata de una lista organizada en orden alfabético. Se muestran tres niveles de identificación. fueron identificadas plenamente a nivel especie. En el caso de animales. compare). tienen un significado y su uso se determina de acuerdo con las reglas de nomenclatura. La abreviación “cf” en el caso de Coatitermes y Armitermes. Se utilizan. Consulta un catálogo taxonómico que te permita comprobar la validez y cómo se deletrean los nombres. 2000). y para bacterias. Los paréntesis. si existen. por lo tanto. lo cual generalmente resulta más práctico que un “orden taxonómico” subjetivo. se utilizan con la misma connotación o de manera similar. N. hormigas y escarabajos en el apéndice 1 y listas más especializadas en las publicaciones 106 Manual de biología de suelos tropicales . 1999).Los métodos comunes de identificación de la fauna del suelo incluyen: a) uso de claves de identificación publicadas. de manera particular. para grupos de organismos diversos o poco conocidos. Nota que las abreviaciones “sp” y “cf” no aparecen en cursivas. El paréntesis que abarca el nombre de los autores indica que la especie fue originalmente descrita en otro género y después se transfirió al género actual. Otras abreviaciones. los Códigos de Nomenclatura contemplan reglas muy estrictas de formato para nombrar autores. b) comparaciones con descripciones. (abreviación del latín confer. Tal abreviación se usa para indicar que la identificación es incierta. el Código Internacional de Nomenclatura Botánica (Greuter et al. El dato de autor y año de publicación no forma parte de un nombre de especies y su uso es opcional. el Código Internacional de Nomenclatura de Bacterias (Sneath. Lista de guías y catálogo de identificación Se puede consultar una lista integrada de claves de identificación para termitas. Termes sp.

4 Angularitermes sp. 19 Araujotermes nanus Armitermes holmgreni Armitermes minutus Armitermes teevani Atlantitermes osborni 1 1 1 13 9 13 46 2 2 1 15 7 1 1 1 1 1 2 2 6 1 7 3 4 1 3 1 2 1 1 5 1 1 1 1 1 4 14 1 6 1 6 25 8 1 1 2 19 20 3 1 9 4 10 71 47 3 10 1 2 16 7 1 3 Armitermes cf. 10 Angularitermes sp. 7 Angularitermes sp. No. 9 Angularitermes sp.Tabla 3. 17 Angularitermes sp. peruanus Caetetermes taquarussu Constrictotermes cavifrons M acrofauna 107 . 5 Angularitermes sp. 13 Angularitermes sp. 16 Angularitermes sp. 14 Angularitermes sp. 1 Angularitermes sp. 15 Angularitermes sp. 3 Angularitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Kalotermitidae Angularitermes nasutissimus Angularitermes sp. 18 Angularitermes sp. 11 Angularitermes sp. Angularitermes sp.1 Ejemplo de lista de especies. 8 Angularitermes sp. 2 Angularitermes sp. 6 Angularitermes sp. 12 Angularitermes sp.

I 5 1 10 9 10 1 22 4 1 1 1 3 85 1 6 29 1 35 6 1 89 4 2 8 3 2 7 4 1 10 7 1 18 2 2 3 15 1 12 17 21 1 56 29 6 2 11 1 9 1 5 29 1 1 2 16 1 1 1 37 19 1 Nasutitermes sp.Tabla 3. J Nasutitermes surinamensis Nasutitermes unduliceps 1 Nasutitermes wheeleri Neocapritermes pumilis Neocapritermes sp.1 Continúa. No. Neocapritermes talpa 1 2 6 1 1 1 108 Manual de biología de suelos tropicales . Curvitermes odontognathus Cylindrotermes flangiatus Cylindrotermes parvignathus Embiratermes parvirostris Heterotermes tenuis Labiotermes psilus Microcerotermes strunckii Nasutitermes callimorphus Nasutitermes corniger Nasutitermes gaigei Nasutitermes guayanae Nasutitermes octopilis Nasutitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 Coptotermes testaceus Cornicapritermes mucronatus Cornitermes pugnax Cornitermes sp. A Nasutitermes sp.

2 Ruptitermes sp.6 81.80 . 1 6 8 1 1 1 2 1 1 1 2 3 9 3 6 5 1 1 5 1 1 1 9 9 259 52 20 3.80 14.1 Continúa.2 18.41 0.1 25.4 3 2 1 229 35 18 2.90 25. Especie Selva Barbecho Cultivo Agroforestal Pastizales 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Neocapritermes taracua Neocapritermes villosus Obtusitermes sp.91 .3 25.Tabla 3. No.3 52.8 72. 3 Subulitermes baileyi Subulitermes microsoma Syntermes molestus Syntermes spinosus Syntermes territus Termes hispaniolae Termes medioculatus Triangularitermes sp.96 34.90 26.4 M acrofauna 109 . 3 Triangularitermes triangulariceps Velocitermes sp. Planicapritermes planiceps Rhinotermes hispidus Rhinotermes marginalis Rotunditermes bragantinus Rugitermes sp.1 3 119 15 10 2.3 17.4 1 5 2 2 1 3 8 7 471 50 39 2. 1 Ruptitermes sp.3 50.81 14.8 203 18 13 2. Ruptitermes sp.6 4 Muestras Especies Transectos Índice Shannon(H) Índice Simpson Rarefacción (100 muestras) Estimación de Chao 86.01 .04 .7 Estimación de Jackknife 1 74.

que se centran en una sola región. conferencias y documentos producidos por proyectos de desarrollo internacional sin una distribución global. Algunas veces se refieren a “comunidades de especies”. Casi siempre la muestra no contiene todas las especies presentes en el hábitat. es necesario extrapolar de la muestra y utilizar estimaciones comparables de la diversidad local. Una de las principales propiedades de un ensamble es “la diversidad de especies”. de un hábitat o área geográfica específica. Las termitas distribuidas en el perfil de suelo. en los apéndices 2 y 3. El mejor enfoque para identificación. esto se obtiene como resultado de la anotación del número de especies y morfoespecies. cuentan con sus propios manuales. aparentemente. por ende. varían entre el taxa y entre regiones. Interpretación de resultados Los ensambles de especies son grupos de especies relacionadas taxonómicamente. pueden consultarse en la lista de literatura. la capa de hojarasca orgánica y/o montículos epigeos se alimentan del suelo mineral. con un grado de selección de limos y fracciones de ar110 Manual de biología de suelos tropicales . desde muestreo en campo hasta identificación y análisis de datos. junto con su calidad. al final del presente capítulo. otra información puede ser obtenida del transecto. antes de tomar las muestras. Si los detalles bibliográficos no están incluidos en la tabla. Las termitas pueden colocarse dentro de las siguientes categorías tróficas: • Las que se alimentan del suelo.taxonómicas para termitas. Invariablemente. Aunque la información básica generada es la de riqueza especifica. será el entrenamiento o bien que el procesamiento de especímenes esté a cargo de un taxónomo con experiencia. Los ensambles de diferentes hábitats o localidades pueden compararse con varias estimaciones o índices y agruparse de acuerdo con sus similitudes. los cuales no están disponibles para el público en general. en relaciones ecológicas actuales. pues dichos ensambles son delimitados por una clasificación taxonómica basada en historia y filogenia y no. la cual se puede definir y estimar por varios métodos. por lo que muchos museos o instituciones científicas dedicadas a la taxonomía y conservación de la biodiversidad. Los ensambles pueden o no. Existe también una “literatura gris” extensiva de reportes de talleres. la disponibilidad de claves adecuadas publicadas. formar un grupo funcional (GF) uniforme y su composición también puede verse afectada por los métodos de muestreo utilizados. Lo más importante es la diversidad funcional del grupo. La caracterización de un ensamble de especies involucra varios pasos. pero este término no es correcto. por lo tanto.

algas. y menos tejidos de plantas reconocibles que en otros grupos (Sleaford et al. Las termitas que buscan hojas muertas. Este tipo de termita forrajera usualmente es más conspicua que otros tipos alimenticios. provenientes de pasajes subterráneos o la formación de columnas descubiertas de individuos. al igual que otros que se han caído y se conservan aún frescos. todavía unidas del árbol viviente y árboles muertos en pie.• • • • cilla. normalmente compuestas por obreros y soldados forrajeros. Hospitalitermes hospitalis en el sureste de Asia. quedan proporciones más altas de materia orgánica del suelo y sílica. Las que se alimentan del suelo y de madera. reconocida por Collins (1989). por razones de las numerosas galerías o placas de suelo que construye encima de la madera. incluye especies que se alimentan de hongos. Las que se alimentan de madera. pero no en la misma categoría de “alimentadores de madera podrida”. El término “madera” incluye ramas muertas.raíces. 1996). normalmente cortan el material antes de consumirlo o lo llevan a sus nidos. debajo de troncos o en suelo adherido a la superficie de troncos en estado de putrefacción. todos menos los que se encuentran en una fase de descomposición terminal. Las termitas que se alimentan de madera y que cavan túneles en piezas más grandes de madera. hojarasca y superficie del suelo y porque hace agujeros que se abren en la superficie. Las termitas que se alimentan de madera muy podrida. Las que forrajean la hojarasca (Termitas forrajeras). la cual se ha vuelto fácilmente desmenuzable y que se asemejan al mismo suelo o que predominan dentro del suelo. Ruptitermes y otras especies de Constrictotermes en América del sur que se M acrofauna 111 . o bien.. pero que se alimentan en otro lado y muchas Macrotermitinae que cultivan jardines de hongos. Este grupo incluye termitas con nidos arbóreos. Las termitas de alimentación especializada o incidental. subterráneos o epígeos. briofitas y líquenes en la corteza de los árboles (por ejemplo. Este grupo incluye algunos Macrotermitinae subterráneos y constructoras de montículos y otras Nasutiterminitinae y algunas otras que se alimentan en la superficie del suelo. Este grupo es sinónimo de “alimentadores medios” sensu DeSouza y Brown (1994). junto con por lo menos una termita inferior del sur de África Hodotermes mossambicus con un hábito similar. Esta categoría sigue la lista de alimentación de termitas de acuerdo con Wood (1978). o mezclada con hojas podridas en complejos de limo . Aunque el material digerido es altamente heterogéneo. pastos vivos o secos y pequeños pedazos de madera. que pueden volverse centros de colonias.

Algunas veces la madera muerta es gradualmente reemplazada por material acartonado o por panales de hongos. una aproximación útil se obtiene dividiendo las especies en “alimentadas de suelo” o geófagas (alimentadas de suelo. aunque ninguna especie es realmente fitófaga. es posible comparar ensambles de termitas en base a tipos de nidos. Las termitas cuyos centros de colonia normalmente se concentran en troncos muertos o árboles en pie. las comunidades de selva son frecuentemente dominadas por las que se alimentan de suelo. suelo. Si se dificulta la selección de un grupo funcional. incrementa las proporciones de otros grupos funcionales.). Eggleton y Bignell. las que se alimentan de excrementos o las carroñeras de cuerpos de vertebrados (probablemente consumidos oportunamente. etc. Inquilinitermes. La identificación del grupo funcional puede hacerse de acuerdo con el color abdominal en especímenes vivos (las alimentadas de suelo y suelomadera son más oscuras). Algunas termitas también se alimentan de tejido de planta viva. aunque el excremento se puede considerar como forma de basura descompuesta) y también ciertas habitantes secundarias de montículos de termitas que se alimentan de los forros hechos de rica materia orgánica. que habitan dentro de los nidos de Constrictotermes). otros aspectos biológicos como el lugar donde anidan (las que anidan en árboles normalmente no se alimentan de suelo). según las siguientes categorías: • Las que anidan en madera. de manera similar. y suelo y madera) como las definidas arriba. Los centros son pocos definidos y amorfos (especialmente en 112 Manual de biología de suelos tropicales . generalmente. Las categorías no son mutuamente excluyentes y muchas especies toman sus alimentos de por lo menos dos fuentes diferentes. pero la perturbación o un periodo de secas. las Macrotermitinae no se alimentan del suelo. Ophiotermes y Tuberculitermes. 1997. encontrada en las cámaras interiores como inquilinas obligadas (Por ejemplo: Ahamitermis y Incolitermis. el lugar de su descubrimiento (en madera. y “las que no se alimentan de suelo” (todas las demás).alimentan de líquenes). Termitas cuyos centros de colonia quedan bajo el suelo.Gay y Calaby. la ausencia de soldados (generalmente indica las que se alimentan del suelo) y la afiliación taxonómica (por ejemplo. • Las que anidan de manera hipogea. la mayoría de la Apicotermitinae se alimentan de suelo o de suelo y madera). especialmente bajo condiciones desfavorables. La forma de distribución de dichas categorías indica la estructura de la comunidad de termitas. en Australia. en África oeste y central. 1970.

hechas de acuerdo con especificaciones típicas de la especie. adiciones y ocupación por parte de habitantes secundarios. que se forman por sí solos o que se asocian con los contrafuertes de los árboles. pero con una tendencia a volverse más irregulares con el paso del tiempo por razones de erosión. Nidos que se sujetan a árboles y que se localizan en diferentes alturas. aunque algunas forman nidos subterráneos complejos (por ejemplo Marcotermitinae). Termitas cuyos centros de colonia se sitúan arriba del suelo. M acrofauna 113 . Estos montículos. utilizando permutaciones de datos al azar. pero excluyen montículos arbóreos. • Montículos arbóreos. • Montículos epigeos. estos nidos están conectados con el suelo mediante pistas cubiertas que pueden ayudar a distinguir algunos nidos de termitas arbóreas de los de hormigas. usualmente construidos con material de apariencia acartonada (cartón). En la mayoría de los casos. Figura 3. Este grupo incluye especies que son habitantes secundarias facultativas de montículos epigeos. normalmente están bien definidos y constituyen estructuras altamente complejas.los Apicoterminotenae que no tienen soldados). con estructura interna poco obvia.5 Ejemplo de curva de acumulación de especies con una desviación estándar.

en el caso de lombrices de tierra. producción de excretas por cada tipo de uso de suelo. tales como el de componentes principales (PCA). HORMIGAS. con desviaciones estándar. trampa. muestra.0b1 (Colwell. tiempo (o persona por tiempo). o área. El esfuerzo de muestreo puede ser medido por espécimen. número de especies y. hasta 500 veces. La forma más simple de estas curvas es conocida como la curva del colector. en la secuencia en que fueron anotadas en el campo. Aunque algunos autores consideran estos nombres como sinónimos.5) u otros métodos que normalmente requieren de programas computacionales especializados.Curvas de acumulación de especies Las curvas de acumulación de especies son gráficas que representan la relación entre el esfuerzo de muestreo y el descubrimiento de las especies en un hábitat o región. OTRA MACROFAUNA Y MESOFAUNA EN HOJARASCA. UTILIZANDO EL MÉTODO WINKLER Introducción Las hormigas pueden clasificarse en grupos funcionales o gremios. Otro método será normalizar la densidad y la biomasa de las lombrices de tierra antes de llevar a cabo el análisis paramétrico de varianza (ANOVA). la curva es asintótica y tiende a inclinarse. 1997). Para más análisis estadísticos. Las curvas más sofisticadas. mediante la prueba Fisher. La prueba Kruskal-Wallis ANOVA puede utilizarse para probar si existe un efecto significativo de los tipos de uso de suelo en relación con la abundancia de lombrices de tierra. La relación entre abundancia de lombrices de tierra y el índice de uso de suelo se comprueba utilizando regresiones. Los análisis de multivariados. Las curvas de acumulación de especies pueden ser obtenidas reiterativamente mediante remuestreo al azar de los monolitos de suelo o por secciones de transectos. el de correspondencia (AC) y el de co-inercia pueden ser útiles para determinar factores que afectan la densidad y la diversidad de lombrices de tierra. es únicamente una gráfica del número de especies acumuladas. en relación con el número de unidades de muestreo. con un 5% de nivel de probabilidad.. utilizando el software de EstimateS versión 6. tienen diferentes sig114 Manual de biología de suelos tropicales . se pueden obtener utilizando permutaciones (reiteraciones) de los datos al azar (Figura 3. En el caso de un esfuerzo de colecta grande. en todos los paisajes agrícolas (Thioulouse et al. se establece la comparación de la media del índice Shannon-Wiener. 2000).

. Paratrechina spp. en su mayoría. Meranoplus spp. y Notoncus spp. Aunque han sido varias las propuestas de esquemas de clasificación de grupos funcionales. no especialistas y altamente competitivas. de modo que minimizan el contacto con otras hormigas que no ocupan este hábitat (Brachyponera spp. • Especies oportunistas: escasamente competitivas. originalmente diseñado para hormigas australianas. Aphaenogaster spp.). morfológicas y de comportamiento que reducen su interacción con la dominante Iridomyrmex spp.. • Especies subordinadas asociadas: incluyen. mientras que los grupos funcionales se refieren a especies que utilizan estrategias similares para explotar el recurso y pueden estar formados por más de un gremio. son cosmopolitas. 2000). hormigas no especialistas que frecuentemente viven en ambientes perturbados (Rhytidoponera spp. Ejemplo: Iridomyrmex spp... Eurhopalothrix spp. • Especies especialistas en clima y suelo: estas especies (Melophorus spp. • Especies dominantes: especies muy abundantes y agresivas que influyen sobre la distribución y el comportamiento de otras especies de hormigas. • Especies crípticas: especies de hormigas forrajeras que normalmente anidan bajo el suelo (en la capa de suelo y hojarasca).) muestran adaptaciones fisiológicas. Bothroponera y Odontomachus).nificados: los gremios son un grupo de especies que utiliza el mismo tipo de recurso para su supervivencia (Terborgh y Robinson. • Especies forrajeras solitarias de tamaño relativamente grande: predadoras solitarias que manifiestan muy poca interacción con otras especies de hormigas (especies dentro de los géneros Myrmecia.. las pertenecientes al género Camponotus. se recomienda utilizar el de Andersen (1997). que pueden coexistir con la dominante Iridomyrmex spp. debido al tamaño relativamente grande de su cuerpo y a su comportamiento sumiso.). • Especies generalistas myrmicines: especies que pertenecen al género Monomorium. 1986). Los siguientes son ejemplos de gremios en la selva brasileña de la Costa Atlántica (Delabie et al. M acrofauna 115 . Crematogaster y Pheidole.. pues es la más usada en diferentes paises.

Labidus (predadoras generalistas) y Neivamyrmex y Normamyrmex. para trabajo de campo práctico. ejemplo: Azteca y Crematogaster. 1995). Apterostigma. se subdividen en dos grupos: a) predadoras generalistas grandes. probablemente comedoras de larvas de termitas del género Syntermes (Delabie. b) verdaderas omnívoras: Brachymyrmex. ejemplo: Acropyga. ejemplos: Gnamptogenys (hormigas y otros insectos depredadores). forrajean toda la vegetación arriba de la superficie y en la hojarasca. Pachycondyla y Centromyrmex (inquilinas de nidos de termitas). • Especies de hormigas arbóreas dominantes: especies omnívoras que anidan en árboles. donde son forrajeras. ejemplo: Amblyopone (predadoras de termitas) y Thaumatomyrmex (predadoras de miriápodos) y Strumigenys (predadoras de colémbolos).• Especies omnívoras: especies que se alimentan de varias fuentes. Solenopsis (especies grandes) y Wasmannia. predadoras especialistas que comen otras hormigas. ejemplo: Odontomachus y Ectatomma. • Especies predadoras de suelo: especies que se establecen en el suelo y en la hojarasca. Mycocepurus. la empleada en el taller CSM-BGBD (2005): 116 Manual de biología de suelos tropicales . Anochetus e Hypoponera. • Especies predadoras generalistas: especies que se alimentan de diferentes tipos de presas. Cyphormyrmex. Utilizan hojas frescas. • Especies cultivadoras de hongos: especies que utilizan hongos simbióticos. Atta. por ejemplo. También existen otras clasificaciones funcionales. son generalistas o especialistas dentro de las especies predadoras. Paratrechina. Sericomyrmes y Trachymyrmex. Campanotus. carroña y restos de plantas para cultivar sus hongos. normalmente miembros de Attini. • Especies de hormigas subterráneas: dependen de gotitas de aguamiel y comen secreciones de azúcar de otros insectos. • Especies de hormigas dominantes en suelo u hojarasca: hormigas forrajeras de hojarasca y suelo o de la superficie. • Especies de hormigas legionarias: también conocidas como “formigas da correição”. son altamente agresivas y presentan una influencia competitiva sobre otras especies. Myrmicocrypta. ejemplos: Eciton. ejemplos: Acromyrmex. es conveniente escoger las clasificaciones más cortas. incluyendo los restos de animales muertos. • Especies predadoras especialistas: especies que se alimentan de un solo tipo de presa. por ejemplo. ejemplo: Megalomyrmex. Pheidole y Solenopsis.

se puede pasar la hojarasca burda por una malla de 2 mm. La fracción fina queda en el fondo de la bolsa del tamiz. con un centro de colonia en las capas superficiales de hojarasca. de manera que se puedan separar los fragmentos más gruesos. tres cuadrantes de 1 m2. • Carnívoras (especialistas o generalistas). realizando movimientos laterales. Una vez en el laboratorio. junto a la coordenada GPS y al monolito (Ilustración 1. Se coloca un frasco con alcohol al 70% en la base de la trampa Winkler. hacia arriba. Procedimiento de muestreo El procedimiento completo se lleva a cabo en tres fases: a) tamizar en campo para separa la hojarasca fina (con hormigas) de la materia más gruesa.• Carnívoras (especialistas o generalistas). con un centro de colonia subterráneo. Se recoge primero la hojarasca. • Herbívoras. con un centro de colonia epigeo o arbóreo. de manera que no escape ningún insecto. 1999). • Carnívoras (especialistas o generalistas). c) extraer las hormigas dentro de la trampa Winkler. véase también el Capítulo 2). cuando los Winklers no se encuentren disponibles. que se encuentra en. con guantes de cuero. b) transportar al laboratorio dentro de una bolsa segura. estas redes se fijan dentro de la trampa Winkler. • Herbívoras. conforme se seque la hojarasca. con el fin de maximizar la recuperación de los especímenes (Delabie. en alcohol al 70%. Este procedimiento permite separar la macrofauna pequeña y alguna de la mesofauna M acrofauna 117 . sobre una sábana blanca. trabajando desde el borde hacia el centro. Se tamiza cada muestra de hojarasca para remover pedazos grandes. con el centro de colonia epigeo o arbóreo. cerrado pero ventilado. preferentemente colocados a lo largo de la línea de transecto. lentamente las hormigas y otros insectos migran hacia afuera y se caen en el alcohol. con un centro de colonia subterránea. el contenido de las bolsas de campo se transfiere a redes. como complemento o alternativa. posteriormente. por lo menos. Esto debe hacerse con suficiente habilidad. se mantiene la trampa durante por lo menos 72 horas. • Herbívoras. los cuales son colgados en un lugar cubierto. ventilado y bajo condiciones ambientales. Se utiliza un marco para delimitar un área de un 1 m2 y se remueve la hojarasca a mano. con el centro de su colonia en las capas superficiales de hojarasca. Se almacenan los especímenes en tubos cerrados y etiquetados. junto con las hormigas y se transfiere a bolsas en campo.

La hojarasca seca. de aproximadamente 34 cm de ancho x 55 cm de largo. de esta manera. se marca un límite de búsqueda de 30 minutos por cada metro cuadrado de hojarasca muestreada. • Redes. Como variación de este método. • La trampa Winkler consiste en una bolsa porosa de algodón o nylon. el cual contiene alcohol al 70%. que entre dentro de una bolsa resistente de nylon o tergal. la parte superior del envase puede situarse a 1 cm más arriba de 118 Manual de biología de suelos tropicales . tarros. por ejemplo. La lista completa de los materiales para la extracción con trampas Winkler (Bestelmeyer et al.del material orgánico y. deberá ser pesada al final de la extracción. las cuales se usarán en campo para transportar el material tamizado. las cuales serán llenadas holgadamente con la hojarasca trasportada en las bolsas del campo y se colocaran en el centro de la trampa Winkler para dar paso a los invertebrados. tazas. de aproximadamente 1. 25 cm de ancho y 20 cm de profundidad central.50 m de largo. se pueden recolectar los especímenes de la sábana. • Bolsas de nylon. después de limpiar la hojarasca suelta en el punto donde se va a colocar la trampa. una por cada trampa. utilizando un aspirador manual (pooter). hasta el lugar donde se encuentren las trampas Winkler. Se achica el fondo de la bolsa para que se pueda colocar un frasco de aproximadamente 200 ml de capacidad. ESCARABAJOS. 2000) es la siguiente: • Marco con una medida de 1 x 1 m de madera.5 m de largo. dichas trampas están hechas de envases profundos relativamente pequeños. en este caso. plástico o aluminio para delimitar el área de muestreo. • Tamiz de malla grande. a prueba de insectos y mide 1. contenida en la trampa Winkler. que se entierran de manera que la parte superior del envase quede exactamente al ras del suelo. de 25 cm de ancho y 37 cm de largo. OTRA MACROFAUNA Y MESOFAUNA QUE SE ENCUENTRAN EN LA HOJARASCA: TRAMPAS PITFALL CON Y SIN CEBO Introducción Las trampas pitfall o de caída constituyen un método efectivo de recolección de muestras de los invertebrados meso y macro que viven en la hojarasca. vasos. latas. botellas de plástico.. de alrededor de 5 mm.

por lo que se utilizan frecuentemente en los trabajos de inventario de la biodiversidad. al igual que a actos de vandalismo. miriápodos. se encuentran dispuestas de manera lineal (para facilitar la instalación y el retiro) sufren la misma desventaja que los transectos. de fácil instalación. Nota: frascos con diámetro de 10 a 20 cm generalmente son efectivos. Una típica trampa pitfall puede observarse en la Figura 3. éstas ofrecen ventajas adicionales: se puede muestrear.la superficie y se construye una rampa de suelo suelto a su alrededor. Además. se pueden utilizar específicamente para atrapar animales nocturnos. Las pitfall son baratas.6 Esquema de una trampa pitfall con cebo. No obstante. M acrofauna 119 . las pitfall son proclives a sufrir daños ocasionados por mamíferos y aves. Las trampas pitfall no son cuantitativas y dado que. mientras que los insectos alados se escapan). El diámetro más pequeño ofrece la ventaja de sufrir menos perturbación al momento de insertar la trampa. de manera simultánea. pero la trampa debe ser lo suficientemente amplia como para poder colectar un número razonable de especímenes y suficientemente profunda Figura 3. puesto que en ambas existe un alto grado de autocorrelación entre muestras adjuntas. presentan algunas desventajas: sobre todo que no muestrean todos los grupos taxonómicos con la misma eficiencia (escarabajos. Las trampas se colocan bajo cubierta para evitar que entre la lluvia y funcionan como colectores de artrópodos que viven en el suelo y que caen en el envase. ahogándose en agua contenida en el fondo de la trampa. Las trampas normalmente se limpian y se recolocan una vez al día. hormigas.6. las dimensiones no son fundamentales. la macrofauna y parte de la mesofauna (especialmente. arañas y otros arácnidos grandes tienden a dominar. normalmente. colémbolos). ortópteros juveniles.

hecha con un vaso. Un aditamento usual a las trampas es un techo inclinado para protegerlas de la lluvia. Entre 1 o 2 cm de agua en el fondo y un poquito de detergente serán suficientes para ahogar o inmovilizar a la mayoría de los animales y el detergente contrarrestará las propiedades hidrofóbicas de muchas cutículas de artrópodos. Los clavos galvanizados o de madera son la mejor opción para elevar el techo hasta dos Figura 3. una caja Petri de vidrio invertida. cuatro palitos pequeños y una cubierta de celofán. es lo ideal.para impedir la fuga. 120 Manual de biología de suelos tropicales . éstos pueden ser improvisados en el campo.7 Trampa pitfall improvisada. sin embargo. ésta descansará sobre palitos o clavos.

muestran que un nivel de captura aproximada puede obtenerse mediante la replicación de trampas pitfall. por lo que el techo se mantendrá más estable.7). Colocación de trampas Mientras las pitfall son estrictamente no cuantitativas. retardando así la descomposición.o tres centímetros. 2001). una solución de hidrato de cloruro al 5% o una mezcla de ácido láctico/ácido acético (10% de cada uno de ellos. dentro de un rango de unidades vegetales. combinados con un poco de glicerina) para mejorar su conservación. ajenos a la fauna del suelo. Pueden emplearse para muestrear artrópodos en madrigueras. El techo puede hacerse también de loseta de cerámica. de manera que permitan el acceso a las trampas. Se puede argumentar que cuando se trata de sol directo. al mismo tiempo que ayuda a mantener el contenido fresco. aunque su aplicación más común es en un sustrato de suelo para la fauna de artrópodos activa en la superficie del suelo (Figura 3. En otras palabras. el número de especies obtenidas por medio de las trampas pitfall se incrementa cuando éstas son colocadas en un máximo de unidades vegetales. madera podrida y turba. El vidrio pesa más que el plástico. el techo debería ser opaco para evitar un efecto invernadero dentro de la trampa. El número de réplicas puede basarse en curvas de acumulación de especies y ha de ser seleccionado para lograr un 85% o más de las especies buscadas. pueden ser útiles para la estimación de la diversidad alfa. éste deberá ser gris claro. ¿cuál sería el número apropiado de trampas pitfall requeridas para colectar el 85% o más de las especies capturables en una unidad vegetal dada? En el muestreo basado en transectos (Swift y Bignell. pero deberán evitarse siempre que se pueda. lo que resulta atractivo para los artrópodos diurnos activos en la superficie. En estudios referidos a riqueza de especies. plástico. de manera alternativa. con la excepción de agua y roca. Estudios que se enfocan a la abundancia. las pitfall normalmente se colocan en paralelo y M acrofauna 121 . En algunas variaciones de este procedimiento se añade sal como conservador. El uso de envases de color fuerte o con dibujos puede mejorar la captura de parasitoides u otros insectos voladores que serán atraídos por los colores. pero se puede utilizar. hojarasca. madera u otro material lo suficientemente pesado como para que no lo eleve el viento o que pueda ser afectado por la lluvia o el sol y que además no sea comestible para las termitas. también crea un microhábitat como si fuera una cueva. de manera que no atraiga insectos voladores. Las trampas pitfall pueden usarse en cualquier sustrato a nivel del suelo. con una respuesta negativa a la luz.

2 Se coloca la trampa pitfall en el hoyo y el borde externo se llena de tierra procedente de la excavación. es decir. ello depende del largo del transecto. extracciones de núcleos de mesofauna y de microsimbiontes y. especialmente a pisadas. colocados en la superficie del suelo. Un muestreo ocasional. donde se puede colocar una colección de pitfall de manera cercana (véase "cercas movibles”). Se usa el relleno para construir una rampa. de manera que los animales caminen sin obstáculos hacia el borde de la trampa. De esta manera. se sugiere que las pitfall sean colocadas a lo largo de la línea de transecto y a un lado de los cuadrantes de 1 m² del muestreo para hojarasca. fuera del área principal de actividad. se aplana con cuidado para mantener el mismo nivel que el borde de la trampa. No se especifica el número. Se muestrea. puede soplarse hacia afuera. que cae en la trampa durante su colocación. pero esto no trata de ser prescriptivo. cualquier microhábitat de interés podrá ser investigado. capítulo 2. en forma de “V” o de embudo. En el sistema de muestreo recomendado para el proyecto CSM-BGBD. de manera que se minimice al máximo la perturbación del microhábitat adjunto. deberán ser extraídas a mano. Instalaciones de las trampas pitfall Las trampas pitfall deben ser introducidas en el suelo con el borde superior del envase al ras del mismo o de la superficie de la hojarasca. 1 Se utiliza una cuchara de albañil para cortar y sacar las raíces y suelo. Cuando una parcela es botánicamente compleja y varias unidades vegetales pueden ser reconocidas. Se debe tener especial cuidado para evitar remover suelo y raíces. según el orden de vulnerabilidad decreciente: primero las pitfall (de un día para otro) seguidas por los transectos. una precaución sensata sería. podrá hacerse en cualquier momento. ordenar el lugar entero. La colecta de las pitfall es sensible a la perturbación. 3 El suelo fino. las partículas más grandes. sugerido por Southwood (1978) hace uso de tablas de madera o de algunos obstáculos similares de hasta 30 cm de alto. el monolito. las pitfall pueden ser distribuidas de la misma manera que en el muestreo casual para hormigas y termitas. finalmente. Un esquema variable de muestreo con pitfall. se canalizan los animales móviles hacia la base de la “V” o embudo. por lo tanto. con el fin de hacer un hoyo del tamaño del vaso a introducir. 122 Manual de biología de suelos tropicales . a una distancia de alrededor de 5 m. El número recomendado es de 3 a 5 trampas por cada punto de muestreo.a cada lado.

esta película es difícil o hasta imposible retirar una vez que los ejemplares quedan conservados. enjuagando el contenido de cada bolsa en la red. Cada trampa se debe procesar de manera separada y se coloca en la bolsa o frasco una etiqueta con la identificación del lugar. tales como hojas. se utiliza por separado un colador de 53 µm. 7 Se coloca un indicador con el número de lugar y trampa (en tinta indeleble o lápiz) cerca de la trampa. palitos. ver abajo).4 Se insertan tres soportes de techo en el suelo alrededor de la trampa. El detergente facilitará la inmovilización por ahogamiento de animales activos. dejando así 2. 6 Se coloca el techo sobre los soportes. Para poder retener los colémbolos. Se transfieren los especímenes en bolsas de plástico o frascos desde la red. El lavado de ejemplares en agua fresca es esencial porque el detergente y la suciedad forman una película sobre los insectos. un palito.5 cm de cada soporte visible. con el fin de remover la suciedad. lo que servirá para separar los últimos ejemplares. durante varios minutos. etc. Se retira cualquier basura grande restante y se trata de retirar al máximo la tierra u otra basura orgánica. colocado verticalmente con un pedazo de cinta o banderín amarillo o naranja. a no ser que la frecuencia de mantenimiento sea de 24 horas o menos. si se les introduce directamente en alcohol. El mantenimiento y el procesamiento de especímenes El mantenimiento de las trampas se lleva a cabo de la siguiente forma: se quita el techo y se levanta el vaso interior que contiene el cebo (en el caso de que lo contenga. resulta útil para identificar la localización de la trampa y para prevenir pisadas accidentales. utilizando un frasco para enjuague o pipeta de agua. Se añade un poquito de detergente como agente tensoactivo. que hayan caído en la trampa. utilizando un flujo suave de agua. situado en su parte superior. la sal y el detergente. Se extraen los elementos grandes. 5 Se llenan las trampas hasta alrededor de ¼ de su capacidad con agua y suficiente sal como para lograr una solución saturada (en caso de escoger una solución salina). siempre se necesitará sal u otro tipo de conservador en climas tropicales. Los especímenes deberán procesarse el mismo día en laboratorio o la base de campo. arriba del substrato. lo que dificulta que sean manipulables y visibles bajo M acrofauna 123 . animales más grandes. se agita suavemente el contenido restante del vaso para levantar los especímenes del fondo y se filtra con una red de acuario. trampa y fecha de recolección.

El uso de cebos resulta controversial porque el muestreo se sesga hacia los animales con un marcado olfato. o sustancias sintéticas atractivas (por ejemplo. rojo o azul) para atraer moscas o parasitoides. Una variante de este proceso es usar dos filtros para colémbolos (malla 53 µm y 38 µm) se utilizan para separar estos animales de la otra fauna (ver Capítulo 4). en espera de futuros procedimientos. lleno de alcohol. esto se lleva a cabo con la suspensión del cebo en un pequeño bote colocado en la boca del envase principal. y se introducen las etiquetas (escritas con tinta indeleble o con lápiz). Se recomiendan dos trampas de este tipo más tres de diseño convencional por cada punto de muestreo. Para el procesamiento de ejemplares de colémbolos véase Capítulo 4 (Mesofauna). cebos de color (amarillo. se usa alcohol al 95% en el caso de colémbolos y al 70% para otros especímenes. El cebo puede ser estiércol. El excremento humano fresco también es apetecible para una gran variedad de escarabajos y. Se pueden preparar trampas pitfall adicionales (opcional) con un contenido de 120 ml de etanol al 95% + glicerina (9:1) que se dejan en campo durante 72 horas. si es posible. Las muestras almacenadas deberán quedarse en una bolsa doble o frasco. por supuesto. Las trampas con cebo no podrán utilizarse en una evaluación semi-cuantitativa como medio de captura (por ejemplo. frutos caídos u hongos en descomposición que resultan indistintamente atractivos para los detritívoros y algunos otros tipos de artrópodos. se lava suavemente el contenido de la red y los lados de la bolsa o frasco con el fin de que los ejemplares caigan hasta el fondo. se refrigeran o se congelan las muestras. porque la capacidad de captura de las pitfall está en función del tamaño de su circunferencia. se invierte el contenido de la red en una bolsa de especímenes y con un atomizador o piseta. El cebo deberá separarse del líquido conservador. Para mejorar la capacidad de captura con trampas pitfall Es posible mejorar la capacidad de captura con las trampas pitfall haciendo varios cambios en el diseño de la trampa o usando cebo atractivo para artrópodos. Después de este lavado. feromonas). Se cubre con alcohol la muestra hasta la altura de los ejemplares que se encuentran dentro de la muestra. se encuentra fácilmente disponible. el porcentaje de todas las trampas estará ocupado por una sola especie) porque no se puede determinar 124 Manual de biología de suelos tropicales . Después de siete días se debe cambiar el alcohol y.microscopio. carroña. La principal modificación en el diseño consiste en agrandar su diámetro. El hecho de usar cebos atractivos implica un mejoramiento general para la captura de una gran variedad de artrópodos.

• Detergente puro: detergente líquido no perfumado para platos. por lo menos. hasta el nivel de determinación taxonómica y funcional más alta posible. • Sal. • Alcohol al 70 al 90%. utilizando el nombre genérico y por orden alfabético. • Lápiz de grafito (ej. transectos. se combinan los resultados de los monolitos. • Cubeta o envase para agua. • Bolsas de plástico para muestreo con sello (tipo ziplock son las más convenientes para el almacenamiento de especímenes de campo) o frascos. 2 o 6B) • Etiquetas tipo tarjeta. se puede estimar el peso fresco para ejemplares conservados. • Soportes del techo: clavos de madera o galvanizados de 152 mm (seis pulgadas). • Agua: agua de la llave o de una fuente natural. La presencia y el peso de hongos cultivados por las termitas (si los hay) también deberán anotarse. pesados después de un secado con papel absorbente. siempre que sea posible agruparlas en familias o subfamilias. trampas Winkler. • Red de acuario o similar (de malla fina). se hace una lista de especies. Para completar la lista. esto es aplicable para las lista de especies de la localidad. trampas pitfall junto con un muestreo casual.el área en donde se llevó a cabo el muestreo y la captura no sólo depende de la abundancia de animales. sin embargo. Lista de materiales requeridos • Trampas pitfall: vasos de plástico de 1000 ml (con dimensiones de 180 mm de diámetro superior x 120 mm de profundidad). sino también de la movilidad relativa. • Indicadores de plástico o de madera. no. • Techo de 200 x 200 mm (uno por trampa). Si no se cuenta con una balanza disponible en el campo. REGUISTRO E INTERPRETACIÓN DE DATOS Parámetros Registre el número y peso fresco de todos los organismos e identifique. M acrofauna 125 . loseta de color gris claro.

2003. Selva de hule 211 BS12. con la excepción de las lombrices de tierra y milpiés.2 Densidad numérica (individuos m2) de termitas en siete localidades. de cada monolito y de cada estrato. Las morfoespecies deberán enlistarse por letra: Ejemplo Crematogaster sp. y Crematogaster sp. Fuente: datos de especies de Jones et al. Es importante que la designación de letra sea consistente entre las localidades. Hule 128 BS10. se multiplica el número crudo de cada monolito x 16.827 22-977 5-16. Tabla 3. Cassava 26 Media aritmética Nivel del estrato (Promedio de todas individuos m-2 (n=5) las localidades) 46 0–10 cm 106 10–20 cm 55 20–30 cm 49 Media geométrica individuos m-2 (n=5)* 971 65 47 11 25 2 10 Media geométrica individuos m-2 (n=5)* 15 80 44 4 95% de confianza 347-12. Por ejemplo.772 0-20 2-534 95% de confianza 3-64 43-148 24-78 1-50 * Datos retrotransformados. Selva primaria 2. Sitio Media aritmética individuos m-2 (n=5) BS1. La abundancia se estima como número o individuos por m2..046 2-9. la especie A es la misma especie en toda el área de muestreo. Incorpore la lista de especies en una tabla que muestre las localidades donde fue encontrada cada una. Paraserianthes 512 BS8. B. en la provincia Jambi del centro de Sumatra. Árboles talados 163 BS6. deberán enlistarse sin letras: Ejemplo Colobobsis sp.892 BS3.Las especies plenamente identificadas deberán enlistarse con su nomenclatura binomial (género y especie) y la autoridad que las describió completas: Ejemplo Dorylus laevigatus Smith. A. Las especies identificadas únicamente a nivel género. a través de un gradiente de perturbación de la selva. los cuales se muestrean en el mo126 Manual de biología de suelos tropicales .445 2-1. Alang-alang 3 BS14.

se puede probar una transformación loglog. si es posible. etc. Este concepto no se puede aplicar de la misma manera para las pitfall. Se citan las medias para datos no transformados. Se evita el uso del peso seco debido a las diferentes temperaturas de los hornos que usan algunos investigadores y por el contenido variable de agua de los diferentes tipos de organismos.. se calculan las medias aritméticas.nolito y la zanja (véase monolitos arriba).). Para la información completa obtenida de transectos. (2005). existe un método alternativo que consiste en calibrar la biomasa viva con el ancho de cabeza. datos transformados y los límites de confianza para log10(x+1). finalmente. Jones e Eggleton (2000). Los datos transformados pueden usarse para histogramas y comparaciones de lugar a lugar (Eggleton et al. junto con las medias geométricas. también es posible que el número total de encuentros. se utiliza peso fresco o la masa de un espécimen parcialmente seco.2). En el caso de transformaciones a log de los datos. derivar en índices de diversidad de especies y de equitatividad. y prepare una tabla resumida. Donde se dispone de especímenes de insectos de varios tamaños. El peso de los desconocidos puede entonces estimarse desde la curva.m-2 de manera similar a como se calcula la abundancia. número de pitfall respecto al total. Woodcock (2005) y Jones et al. (1997). Algunos indicadores de la abundancia relativa se pueden obtener a partir de la frecuencia de encuentro de diferentes especies (número de secciones de un transecto en donde se localizó la especie con respecto al número total muestreado. tal y como se muestra en la tabla 3. Para poder estimar el 95% de límite de confianza. o sea. Se estima la biomasa en g. resulta más conveniente M acrofauna 127 . véanse las discusiones en Eggleton y Bignell (1995). es posible asignar dominancia y. Se aplican estadísticas descriptivas al juego de datos transformados. se determina la abundancia para cada taxón. por lo tanto. los datos primarios deberán transformarse en log10(x+1). En casos difíciles. también para cada grupo taxonómico superior y se combinan los datos de todas las especies. puedan ser parámetros útiles de población. o para otros grupos individuos separados a lo largo del transecto completo. 1996). Eggleton et al. en especímenes representativos que cubren todo el rango de tamaños. el número de veces que se descubren colonias separadas en el caso de hormigas o termitas. También partiendo de que un transecto completo representa una muestra única y grande. incluyendo el 95% de los límites de confianza y con los datos transformados se obtiene una media geométrica. Cuando no hay demasiados ceros (muestras sin organismos) este procedimiento debería normalizar los datos y producir varianzas homogéneas de grupo a grupo.

Para poder establecer una comparación. Este grupo incluye. una variedad de artrópodos (hormigas. Especies anécicas son las que retiran hojarasca de la superficie del suelo a través de su actividad alimenticia. puesto que no implica pesar especímenes individuales o hacer otras medidas para estimar la biomasa. Especies epigeas que viven y se alimentan en la superficie del suelo. menos informativa. de manera que monitorear datos sin estimaciones de biomasa proporciona información incompleta y. Los dos grupos principales son las lombrices de tierra y las termitas que se alimentan del suelo. Cantidades considerables de suelo. es decir. cochinillas y grillos). Especies endógeas que viven en el suelo y se alimentan de materia orgánica y de raíces muertas. definido por su hábito alimenticio y su distribución en el perfil del suelo. ciempiés. el efecto de estos invertebrados es fraccionar y despedazar la hojarasca. en su mayoría. pero también algunos arácnidos. Nota: determinar solamente la abundancia resulta fácil. por tanto. Se debe mostrar riqueza de especies/morfoespecies. muchas tasas de procesos en el ecosistema son proporcionales a la biomasa y no a la abundancia. como arriba. milpiés. Ensambles pueden ser comparados por la proporción relativa de especies o unidades taxonómicas (morfoespecies). cucarachas. elementos minerales y materia orgánica se redistribuyen con esta actividad y también se acompañan de efectos físicos sobre la estructura del suelo y las propiedades hídricas. escarabajos. Se prepara una tabla resumida. Análisis Los análisis se deben llevar a cabo por grupo funcional. la clasificación de lombrices de tierra (ya mencionada) puede aplicarse a todos los invertebrados del suelo. Las lombrices de tierra y las termitas que no se alimentan de suelo constituyen los principales grupos dentro de esta categoría. pero no redistribuyen activamente materiales de las plantas (aunque el material despedazado sea más fácilmente transportado por el viento o el agua que el material de donde deriva). caracoles y pequeñas lombrices de tierra completamente pigmentadas. La macrofauna activa en la superficie incluirá a los organismos muestreados en las trampas pitfall. ingiriendo grandes cantidades de materia mineral.trabajar en (mg+1) y luego se transforman y se expresa en gramos. las cuales pueden ser incluidas en una o más 128 Manual de biología de suelos tropicales . abundancia y biomasa en forma gráfica. sin embargo. y liberar nutrientes.

Las especies clave (termitas y posiblemente algunos transformadores de hojarasca) proveen oportunidades físicas de nichos para organismos de nivel más bajo y determinan la estructura de la comunidad de estos organismos.2 cm. 1978 y Krebs. termitas y lombrices anécicas y endógeas). Lista por familia de los otros escarabajos. Jacquard y Sorensen (véase Southwood. Macropredadores (especies predadoras >0. pero ocasionalmente más pequeños) ingieren una mezcla de materia orgánica y minerales.2 a 1cm). pero algunos animales más pequeños (varios ácaros) pueden tener funciones análogas. Este grupo incluye invertebrados grandes (> 1cm) y medianos (0. M acrofauna 129 . Simpson. Los índices de diversidad y de similaridad útiles incluyen: ShannonWiener. Los grandes invertebrados (> 1cm. Transformadores de hojarasca (normalmente artrópodos no sociales o semisociales. Se recomienda probar la clasificación de un grupo funcional (GF) adicional para la macrofauna. La riqueza de especies actual puede ser estimada por medio de Sob. por categoría de uso de suelo y por ventana de muestreo. como sinónimos. Conjunto mínimo de datos por punto muestreado De todo el muestreo Lista de especies/morfoespecies para hormigas. utilizando las siguientes categorías: Los ingenieros del ecosistema (normalmente hormigas. ICE y EstimateS. según se explica a continuación. Jackknife. que son complejos organominerales. de forma incorrecta.categorías funcionales. Nota: los términos “ingeniero de ecosistema y especies claves” con frecuencia son utilizados. termitas y escarabajos capturados con cebo. 1998). lombrices epigeas y ácaros grandes) ingieren una mezcla de materia orgánica y biomasa microbiana y forman heces holorgánicas de corta vida. ACE. y forman heces longevas y estables. normalmente procedentes de varios grupos de artrópodos). CONJUNTO mínimo DE DATOS El conjunto mínimo de datos puede ser expresado por cada punto de muestreo.

etc. Desde el transecto o los transectos Abundancia relativa de termitas. Todas las lombrices de tierra (además por GF 1. De las trampas Winkler Frecuencia de especies por muestra. por lo tanto. GF 2. En el caso de las hormigas. el número de encuentros. La abundancia relativa para cada GF está dada por el número de encuentros de divididos entre el número total de encuentros de todos los GFs. Datos de abundancia para hormigas y escarabajos (número de individuos m²). Abundancia total en número m2 de forma separada para: Todas las hormigas (y por grupo funcional GF1. Para cada taxón se indica el método de muestreo empleado: C = casual T = transecto W = Winkler P = pitfalls M= monolito (Para el monolito no observar estratificaciones de 3 x 10 cm. GF 2.. GF2. etc. etc. etc.).) también pueden estimarse.).Lista de los otros invertebrados en la resolución taxonómica la más alta posible. GF2. Se pueden juntar los datos obtenidos de diferentes transectos en puntos de muestreo separados. utilizando todas las secciones de transectos disponibles para el muestreo. números totales por cada grupo funcional (GF1. Todos los escarabajos Otros invertebrados Todos los invertebrados. Se hace un cálculo para cada GF. 130 Manual de biología de suelos tropicales . Todas las termitas (y por GF 1. Nótese que un encuentro es un evento en una sección de 5 m del transecto. varía de 0 a 4 para transectos de 20 m y de 0 a 20 para transectos de 100 m. con la excepción de lombrices de tierra). en su defecto las que se alimentan de madera o de suelo).

o en su defecto las que se alimentan de madera o de suelo). lombrices de tierra y escarabajos capturados con cebos. termitas. W= Winkler. utilizando las mismas claves que las especificadas anteriormente: C= Casual. separado para hormigas (y para grupos funcionales GF1. P= Pitfalls y M= Monolito De los monolitos Es necesario proveer la abundancia media como: a) Número de individuos m² ±SD b) Media geométrica ± 95% de intervalo de confianza c) Media aritmética ± 95% de intervalo de confianza donde n = número de puntos por uso de suelo. GF 2. De los transectos Abundancia relativa media de termitas GF 1. T = Transecto.De las trampas pitfall Se desglosa los taxa no muestreados por otros medios (únicamente). GF 2. todas las lombrices de tierra (y por grupos GF 1. etc. todas las termitas (y para los grupos GF 1.). donde n = número de puntos por uso de suelo. etc. Conjunto mínimo de datos por uso de suelo Las categorías de uso de suelo son anotadas y cuando esto no es posible se clasifican de acuerdo con la intensidad de uso de suelo. otros invertebrados y todos los invertebrados (igual a lo indicado para datos mínimos por punto de muestreo). etc..). De todo el muestreo Listas de especies/morfoespecies para hormigas. M acrofauna 131 . todos los escarabajos. etc. GF 2. Lista de familias para los demás escarabajos Lista de invertebrados en la resolución taxonómica la más alta posible Para cada taxón se indica el método de muestreo empleado. como % ± SD. GF 2.

Abundancia media de escarabajos como individuos m² ± SD. De manera similar. GF 2. cuando su abundancia o biomasa lo justifique. muestreo anidado y estratificado ejemplo Eggleton et al. en base de lugar a lugar.. no obstante. Para todas las abundancias medias totales y las abundancias medias relativas de los GF Correlación con parámetros individuales del gradiente. si el régimen de muestreo es suficientemente robusto (incluyendo réplicas adecuadas.) como individuos m² ± SD. la escala del esfuerzo requerida para poder evaluar la biomasa es enorme (véase Eggleton y Bignell. ejemplo Diversidad β.De las trampas Winkler Abundancia media de hormigas (y como GF 1. se dice que la abundancia de individuos no se debe usar en el caso de hormigas porque son insectos sociales que se organizan en colonias formadas por miles de individuos que se alimentan en grupos.. 1994). se argumenta que los organismos se deben asignar únicamente como ingenieros del ecosistema. etc. 132 Manual de biología de suelos tropicales . La frecuencia de especies por muestreo presenta un parámetro alternativo. Lawton et al. el cálculo retrospectivo hasta llegar a la densidad numérica. Conjunto mínimo de datos por ventana de muestreo De todos los métodos de muestreo Recambio de especies a lo largo del gradiente como la β de Whittaker. Por ejemplo. será sobreestimada (Colwell y Coddington. Desafortunadamente. existen contra argumentos de que los insectos sociales pueden evaluarse correctamente en cuanto a su abundancia y biomasa. si el muestreo se hace en una colonia. 1996) y que la biomasa es tan importante para la determinación del impacto ecológico que no se puede prescindir de ella o sustituirla. El uso de datos crudos de abundancia y de biomasa en la interpretación de la función del ecosistema resulta controversial. 1995. donde n = número de puntos por uso de suelo. incluyendo los resultados de intensificación de uso de suelo.

L.. S. 122–132. Japan. Smithsonian Institution. H. P. C. y Valentin. Environmental & Ecology. Halder. 431–439.. Lavelle. J. Alonso L. Blakemore. Agosti. (2000) ‘Diversity and distribution of endemic and exotic earthworms in natural and regenerating ecosystems in the central Himalayas.. Constantino. Kippax. COE Soil Ecology Research Group. C. R. E. Barrios. Standard Methods for Ground-living Ants. Pashanasi. 35. pp. Kaneko and M. Washington. M. A. 433–460. S. Bhattacharya. T. pp. e Ingram. Anderson. I. Ecological Bulletins. M. I. K. (2002) Cosmopolitan Earthworms – An Eco-Taxonomic Guide to the Peregrine Species of the World. 2nd edition.ynu. Andersen. D. R. (eds) (1989) Tropical Soil Biology and Fertility: A Handbook of Methods. 29. (1997) ‘Functional groups and patterns of organization in North American ant communities: A comparison with Australia’. E. Bhadauria T. S. (2005) ‘Introductory key to revised earthworm families of the world’. pp. 3. Biology and Fertility of Soils. M acrofauna 133 . vol.bio-eco. E. N. vol. J. Alonso. VermEcology. Wallingford. T. Blanchart. Delabie. J. CAB International. Yokohama National University. J. 24. (1997) ‘Regulation of soil structure by geophagous earthworm activities in humid savanna of Côte d’Ivoire’. (1977) ‘Stratégies lombriciennes’. D.. R. Bestelmeyer. Anderson.. Journal of Biogeography. M. Bouché. Ecology and Systematics from Various Regions of the World.eis. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. B. C. DC.. in U.. T. (eds) (2000) Measuring and Monitoring Biological Diversity. E. Brandão.. 2045–2054.T. Persson (eds) Soil Organisms as Components of Ecosystems.338–347. D.. P. vol.. Majer. K. M. pp.. P.htm. CAB International. Lohm and T. Lebissonnais. G. J. vol. J. N. y Lavelle.ac. pp. J. J. pp. Leeanne. Braudeau. Y. F.1998). India’. lo que compromete la caracterización de la heterogeneidad del paisaje porque restringe el número de puntos de muestreo que pueden ser utilizados. y Schultz T. B.. in N. R. vol. 143–147... Wallingford. REFERENCIAS Agosti. (2000) ‘Soil microarthropods of a rubber plantation and a natural forest’. Soil Biology and Biochemistry.jp/eng/index. Australia.. 1st edition. 25.. 32. Blakemore. Brown. T. www. y Srivastava. W. vol. Ito (eds) A Series of Searchable Texts on Earthworm Biodiversity. (2002) ‘Effects of land-use system on the soil macrofauna in western Brazilian Amazonia’. Soil Biology and Biochemistry. R. y Saha. e Ingram. Ramakrishnan.

T. G. T. CSM-BGBD (2005) Global workshop on ant and termite sampling and identification. Tropical Soil Biology and Fertility Institute of CIAT. Agosti. (1998) ‘Comparative biodiversity along a gradient of agricultural landscapes’. Mitteilungen aus dem Zoologischen Museum in Berlin. Delettre. (1994) ‘Impact of land management on soil macrofauna in the Oriental Llanos of Colombia’.0b1’. Butet. J. Delabie. 12. European Journal of Soil Biology. Baudry. Thenail.. C. 58–68. Alonso and T. Werger (eds) Tropical Rain Forest Ecosystems. (2005) ‘EstimateS. Colwell.. A. H.5: Statistical Estimation of Species Richness and Shared Species from Samples. Escobar. Blanchart.. Decaëns. uconn. Ecosystems and Environment. Version 6. Kenya.. 240. in D. G. Colwell. vol.. Majer. (1996) ‘Revision der Unterfamilie Benhamiinae MICHAELSEN. Collins. T..eeb. C. pp. Software and User’s Guide’. E. (2000) ‘Statistical Estimate of Species Richness and Shared Species from Samples. 39. J. K. vol. D. P.eeb. Fragoso. N. y Nascimento.edu/estimates. 101–118. vol. vol. E. Resumos Feira De Santana. J. Petit. A. T.. (1999) ‘Comunidades de formigas (Hymenoptera: Formicidae): Métodos de estudo e estudos de casos na Mata Atlântica’. Feira De Santana. D. (Isoptera. J. 30. R.. C. (2004)‚‘Soil macrofauna communities in permanent pastures derived from tropical forest or savannas’. Colwell. Termitidae.edu/EstimateS. Agosti. (1995) ‘Inquilismo simultâneo de duas eespécies de Centromyrmex (Hymenoptera. Philosophical Transactions of the Royal Society (Series B). 157–168. E.. Dubs.. y Lefeuvre. J. Amsterdam. J. pp. G. 72.. Sociedade Nordestina De Zoologia. H. Leith and M. F. C. A. Morvan. pp. J. Lavelle. A. 19. pp. pp.. C. Decaëns. J. pp. R. P. M. J. Brunel. Formicidae. Elsevier Science Publishers. Acta Oecologia. S. D. F.. Delabie. Jiménez... J. Version 7. P. y Lavelle. 47–60. K. Ponerinae) em cupinzeiros de Syntermes sp.-C. J. Agriculture. I. N. vol. São Paulo. Nasutermitinae)’. Y. (1989) ‘Termites’.. Encontro De Zoologia Do Nordeste. 301–312 Decaëns. 103. vol. J. H. 605–609. (2000) ‘Litter ant communities of the Brazilian Atlantic rain forest region’. Jiménez. Clergeau. (1994) ‘Estimating terrestrial biodiversity through extrapolation’.ucon. Revista Brasileira De Entomologia. Nairobi. vol. Delabie. (2002) ‘Earthworm communities under an agricultural intensification gradient in Colombia’. vol. J. pp133-143. K. Le Coeur. y Jiménez. S. 1897 (Oligochaeta: Acanthodrilidae)’. in H.Burel. Chauvel. L. Barros.. pp. Paillat.. and Rippstein. Csuzdi.. J.. http://viceroy. y Coddington. R. http://viceroy. C. Plant and Soil. C. 347–367. 345. Schultz 134 Manual de biología de suelos tropicales .

forest disturbance and greenhouse gas fluxes in Sabah. Jones. vol. Stork (eds) Insects in a Changing Environment. M acrofauna 135 . 111. Eggleton.. vol. in R. M. Homathevi. pp. Philosophical Transactions of the Royal Society of London. D. Eggleton. pp. Series B. 35. E. pp. Eggleton. Megadrilogica. P. D. 2.. R.. Washington. (1995) ‘Monitoring the response of tropical insects to changes in the environment: troubles with termites’. y Bignell. Academic Press. G. Applied Soil Ecology. 351. G. pp. P. C. Journal of Tropical Ecology... London. East Malaysia’. (1979) ‘A revision of the ‘acaecate’ earthworms of the Pheretima group (Megascolecidae: Oligochaeta): Archipheretima.. New Acanthodriline genera and species (Megascolecidae. (1996) ‘The diversity. N. R. G. (1997) ‘The species richness and composition of termites (Isoptera) in primary and regenerating lowland dipterocarp forest in Sabah. Jones.. pp. D. Easton. 1–12. 354. M. Davies. A. R.. 197–206. Oligochaeta)’. Metapheretima. Davies. C. Smithsonian Institution. F. Dlamini. pp. Bignell. vol. y Bignell. K. (2004) ‘Influence of agricultural land use on the size and composition of earthworm communities in northern KwaZulu-Natal. pp. Eggleton. T. Fragoso. J. y Maryati. 119–128. 1–128. y Rojas-Fernandez. Harrington and N. Wood. Journal of African Zoology. Bignell. DeSouza. N. A. Pleinogaster and Polypheretima’. 10. O. Eggleton. T. Homathevi. V. vol. E. 51–68. D.. P. T. E. J. Proceedings of the Californian Academy of Sciences. (1994) ‘Effects of habitat fragmentation on Amazonian termite communities’. MacDonald... Series B.. (1999) ‘Termite assemblages. y Brown. Eisen. R.(eds) Measuring and Monitoring Biological Diversity: Standard Methods For Groundliving Ants. W. abundance and biomass of termites under differing levels of disturbance in the Mbalmayo Forest Reserve. E. Philosophical Transactions of the Royal Society of London. DC. pp. E. G. Jeeva. D. 27. pp. 87–276. (1900) ‘Researches in American Oligochaeta with especial reference to those of the Pacific Coast and adjacent islands’. D. vol. East Malaysia’. 6. D. P. vol. G. 77–88. South Africa’. Lawton. y Bignell. J. (1994) ‘Earthworms from Southeastern Mexico. F. 3.. 1791–1802. Sands. H. P. Bulletin of the British Museum (Natural History) Zoology. R.. vol. Southern Cameroon. E. 489–498.. (1997) ‘The incidence of secondary occupation of epigeal termite (Isoptera) mounds by other termites in the Mbalmayo Forest Reserve. Jeeva. y Maryati. Mawdsley. A. vol. vol. Ecotropica.. C. Haynes. Planapheretima. and its biological significance’. D. Southern Cameroon’. P.

Indonesia’.. M. Brussard and P. C. D. pp.-M. Agriculture. Applied Soil Ecology. D. E. F. J. E. Kouassi.-X. (1995) ‘Biological activity of soil under rubber plantation in Côte d’Ivoire’. R. Senapati. Demoulin.. Calcutta. Verkerk. Jones. Koeltz Scientific Books. (2003) ‘Effect of agricultural land use on soil organic matter status and the composition of earthworm communities in KwaZuluNatal. y Hawksworth. (2005) ‘Methods for sampling termites’. Gates. International Trust for Zoological Nomenclature.... Filgueiras. 4th edition.. B. pp. 186–189.. P. vol. A. Journal of Applied Ecology. D.. vol. Nicolson. M. P. 95.. vol.. P. J. Senapati. (1972) ‘Burmese earthworms. y Graham.. 1–326. y Calaby. Oxford. P. pp. T. 196. Turland N. B.. C. pp. New York. J. F. P. G. Brown. Gay. Lavelle. J. C. 6. vol. Silva. soil biodiversity and agroecosystem function in the tropics: The role of earthworms’.. Keli. vol. F. E. in P. H. C. South Africa’. 136 Manual de biología de suelos tropicales . R. R. (1997) ‘Agricultural intensification. Blanchart. Jones. Decaëns. pp.. Blanchart. T. W... E. Haynes. 453–464 International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature. E. H.. Lavelle. Lavelle. y Kumar. Megadrile Oligochaeta (Earthworms) Family Octochaetidae. Julka. H. Journal of Applied Ecology. V. Greuter.. Acta Zoologica Fenica. J. Leather (ed) Insect Sampling in Forest Ecosystems. P. Blanchart. J. y Tondoh. Burdet. J. Bignell. J. Dominy. Gillison. Lavelle. Academic Press. S. Ecosystems and Environment. Weesner (eds) Biology of Termites. G. Skog. y Guillaume. M. L. McNeill.. F.. T. Jones. G.. D. Suryo. M. in S. E. CAB International.. (2000) International Code of Botanical Nomenclature (St Louis Code). J. (2000) ‘Sampling termite assemblages in tropical forests: Testing a rapid biodiversity assessment protocol’. y Eggleton. Barrie. Jiménez. vol.. A. D. Martinez. L. in K. P. 62. Susilo. Hendrix (eds) Earthworm Management in Tropical Agroecosystems. 37. Patron. H. (2003) ‘Termite assemblage collapses along a land-use intensification gradient in lowland central Sumatra. y Eggleton. G.. J. 380–391. Konigstein. W.. structure and influence of management pratices’. (1999) ‘Earthworm communities of tropical agroecosystems: Origin.Fragoso. Krishna and F. (1970) ‘Termites of the Australian region’. Trehane. Zoological Survey of India..... Wallingford.. 17–35. (1988) The Fauna of India and the Adjacent Countries. E. y Eggleton. pp. S. D. Pashanasi. T. London. B. P. H. Gilot. an introduction to the systematics and biology of Megadrile oligochaetes with special reference to South-East Asia’.. T. T. J. Transactions of the American Philosophical Society. C. P.. C. 191–203. J. K.. 40. Fragoso. Blackwell. J.

Heal. (1995) ‘Colombian earthworms’. E. vol.. Journal of Theoretical Biology. (1978) ‘Les vers de terres de la savane de Lamto (Côte d’Ivoire): Peuplements. Amsterdam. Righi. Unione Zoologica Italiana 2. vol. G.. (1998) Ecological Methodology. M acrofauna 137 . M. Oxford. (2004) ‘Earthworm populations under tropical maize cultivation: The effect of mulching with velvet bean’. 2.. F. K. populations et fonction dans l’écosystème’. pp. A. 2nd edition. and Fragoso. y Rouland-Lefèvre. G. C. vol. J. (1987) ‘Peregrine species of earthworms’. pp. Omodeo (eds) On Earthworms: Selected Symposia and Monographs. A. vol. 1–95. (1997) ‘Soil function in a changing world: The role of the invertebrate ecosystem engineers’. S. (2004) Measuring Biological Diversity. Eggleton. P. Moreno. O.. Mawdsley. pp. Bourlière (ed) Tropical Savannas. C. Lavelle. Hammond.. 72–76. 33. (2001) ‘Spatial and temporal analysis of. Righi. C. y Watt. J. II The earthworms’. Ecole Normale Supérieure 12. 20. (1971) ‘Sobre a familia Glossoscolecidae (Oligochaeta) no Brasil’. Bonvicini and P. y Halffter. Modena. (1981) ‘Strategies de reproduction chez les vers de terre’. indicator taxa and effects of habitat modification in tropical forest’. Nature (Lond). pp. 4. 159–193. Larsen. 391. 13. M. Rossi. Journal of Applied Ecology. I. B. (1996) ‘The measurement of diversity in different types of biological collections’. E. Laboratoire de Zoologie. Bloemers. 39. y Dhillion. Mucchi. D. M. Mora. N. A. 10. pp. vol. Elsevier Publishing Company. Stork. N. E. in A. V. E. vol. Pearson Education. Boulton.. vol. vol.Krebs. Hodda. Lavelle.. E. P. France. Lavelle. Blackwell Science.. B. G. J. Lee. European Journal of Soil Biology. Thèse de Doctorat. A. 117–133. 300–305.. P. Lawton. Lavelle. 213–226. vol.. vol. Wolters. P. Srivastava. pp. Holt. J. Pielou. G. M. P. C. Bignell. P. P. D. (1998) ‘Biodiversity inventories... P. 438–445. pp. D. S. E.. 485–607. Roger. C. Biology and Fertility of Soils. Acta Oecologia – Oecologia Generalis.. (2000) ‘Assessing the completeness of bat biodiversity inventories using species accumulation curves’. in F. R. 40. M. (1983) ‘The soil fauna of tropical savannas. Bignell. Biology and Fertility of Soils. Grimaldi. and diversities of bats in a fragmented landscape’. Biodiversity and Conservation.. Université Paris VI. T. H. Arquivos de Zoologia. D. P. G. Studies on Tropical Andean Ecosystems. (2004) ‘A multi-scale study of soil macrofauna biodiversity in Amazonia pastures’.. E. Mathieu. 37.-P... y Halffter... C. pp367–382 Ortiz-Ceballos. Lavelle. London. D. Lepage. pp. pp. Magurran. 149–158. Moreno.

vol. Blackwell. Omodeo (eds) ‘On earthworms. A. E. 103–124. (1978) Ecological Methods with Particular Reference to the Study of Insect Populations. pp. Chessel. J. www. 1995) (Oligochaeta: Glossoscolecidae). A. R. pp. Oxford. Cambridge University Press. E... Oxford. G. (1972) ‘A numerical revision of the earthworm genus Pheretima auct. Université Paris VI. Ecological Entomology. 7. 493–500. P. Kikkawa and D. pp. 279–288. Swift. Indonesia. R. M. y Easton. Thioulouse. (1997) ‘ADE: A multivariate analysis and graphical display software’.. Bogor. pp. France. Sims. Herndon. Vincent. suborder Lumbricina (Haplotaxida: Oligochaeta)’. D.Sims. 75–83. W. Blackwell Science. 113–131. vol. pp. vol. G. M. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition’. E. R. A. vol. Zicsi. P. Leather (ed) Insect Sampling in Forest Ecosystems. ASB Lecture Note 6B. Anderson (eds) Community Ecology. R. E.. J. Terborgh. y Bignell.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. vol. selected symposia and monographs’. Sneath. ASM Press. Opuscula Zoologica Budapest. y Robinson. Tondoh. Modena. W. Thèse de 3e cycle. F. Chapman and Hall. Regenwürmer aus Südamerika’. (1992) International Code of Nomenclature of Bacteria: Bacteriological Code. Sims. in M. J. Cambridge. y Lavelle. (1986) ‘Guilds and their utility in ecology’. Mucchi. Bignell. 4. (2001) ‘Revision der Untergattung Martiodrilus (Maipure Righi. International Centre for Research in Agroforestry. Cameroon’. Brian (ed) Production Ecology of Ants and Termites. R. Pattern and Process. vol. D. (2005) ‘Pitfall sampling in ecological studies’. J. Southwood. South East Asian Regional Research Programme. Bulletin of the British Museum (Natural History) Zoology. pp. E. D. VA. Eudrilidae) in Ivory Coast’. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. 21. Journal of Tropical Ecology. (1996) ‘A pilot analysis of gut contents in termites from the Mbalmayo Forest Reserve. (1978) ‘Food and feeding habits of termites’.pdf. y Eggleton. W. (1980) ‘A classification and the distribution of earthworms. S. in J. P. 21. in S. 1990 Revision. Sleaford. V.fao. London. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. Dolédec. M. B. (1987) ‘A review of the Central African earthworm family Eudrilidae (Oligochaeta)’. 138 Manual de biología de suelos tropicales . S. (1969) ‘Recherche sur le peuplement en Oligochète de la savane de Lamto (Côte d’Ivoire)’. Woodcock. P. 169–268. H. Biological Journal of the Linnean Society. in A. 2nd edition. Statistics and Computing. T. 39. y Olivier. Pagliani and P. T. Unione Zoologica Italiana 2. 33. Wood.

Regenwürmer aus Südamerika 39. 92. (2005) ‘Über den heutigen Stand der Regenwurmfauna (Oligochaeta) Ekuadors mit einem Bestimmungsschlüssel der Glossoscoleciden-Arten’. 95–130. A. vol. Berichte des Naturwissenschaftlicher-Medizinischer Vereins in Innsbruck.Zicsi. M acrofauna 139 . pp.

M. Kirton (ed) Malaysian Forest Records. pp 95162. útil para Sumatra. pp1-244. Clave moderna y de fácil interpretación. E. Alexander von Humboldt. Colombia. Y. de fácil manejo. dentro del clado Termes. ‘Introducción a las hormigas de la región Neotropical’ Instituto de Investigaciones de Recursos Biológicos.E. 65-87. Fácil de usar. de Asia. (1992) ‘Termites of peninsular Malaysia’ en L. (1984). vol. S. pp. vol. (1984) Collins. Disponible y económica. F. XXVI. F. ‘Termites of Sabah’ Forest Record 12. taxonomía y la importancia económica de las hormigas. Publicación clave para géneros de la región Neotropical. Incluye una revisión de la biología ecología. Tho.E. pero no cubre toda la diversidad de animales que se alimentan del suelo. with descriptions of one new genus and new species and including a key to genera’ Journal of Natural History. (2 003). incluyendo Indonesia).R. de Asia Thapa. 1-398. Claves de identificación de termitas. 30. Clave un poco obsoleta de géneros de termitas del Norte de Borneo. Sarawak Museum Journal. P. (2001). Región y autor Hormigas del S. pp. (2003) Termitas del S. vol. ‘A review of the South-east Asian Nasutitermitinae (Isoptera Temitidae). Notas Clave de géneros de hormigas de Borneo (útil en el S. Borneo Java y Sulawesi. protocolos de muestreo por región. pp. Forest Research Institute of Malaysia. 1-374. Bien ilustrada clave de fácil identificación para los soldados. 1485-1506. de Asia Hashimoto. Hormigas Neotropicales Fernández. y Homathevi. Universidad Malasis Sabah. Preparado por “Tools for Monitoring Soil Biodiversity in the ASEAN Region”. Bogota. Bien ilustrada con sinopsis genérica. Gathorne-Hardy. Kepong. ‘The termites (Isoptera) of Gunung Mulu National Park with a key to the genera know from Sarawak’. 140 Manual de biología de suelos tropicales . Título y referencias ‘Manual for Bornean Ant (Formicidae) Identification’. R. 12-26 octubre.Apéndice 1.G. N. escarabajos y hormigas. 2003. Trabajo estándar. 35 pp. Y. 36.

‘Manual for Bornean beetle (Coleoptera) family identification’. Trabajo estándar. pp. Sabah Forest Record 12 pp. 18-22 Septiembre. Supplement 4.Apéndice 1. Clave moderna. A. incluyendo Indonesia. 2006.Cox. fácil de usar. 36 p. C. Training course on Arthropod preservation. G. tanto para imagos como soldados. (1990). International Institute of Entomology (and Institute of escarabajos. R. Thapa. (2003) Título y referencias ‘Manual for Bornean Termites (Isoptera)’ preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Webb. Un poco anticuado. La autoridad estándar del momento para este genero. The Natural History Museum. M acrofauna 141 .. Región y autor Homathevi. W. preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Escarabajos de Asia Chung. L. vol 8. Y. Termitidae) from the Ethiopian region’. M. Explicación detallada de la IIE Guides to insects of importance morfología y agrupaciones de to Man. Adaptación de Chung. (2006). (2003).E. 1-374. Lo que opera actualmente sobre esta subfamilia en África. pp. de Asia. CAB International). pp. 3. Coleoptera. B. 1–384. Notas Clave inédita de géneros de termitas en el S. Nigeria. Sands W. Ibadan University Press. Bien ilustrada. Coleoptera. y Madge R. (1961). Universiti Malasia Sabah. Universiti Malaysia Sabah. 1-28. pp. ‘A revision of the termite subfamily Nasutitermitinae (Isoptera. 12–26 Octubre 2003. S. 2003. R. Escarabajos en general. 129-156 Keys to the Genera of the African Termites. Hormathevi. Clave bien ilustrada a nivel género de soldados. R. Clave de géneros de imagos y soldados. Claves hasta especies. Bulletin of the British Museum (Natural History). Octubre 2003. de fácil manejo. A. curation and data management. G. 12–26. Bulletin of the British Museum (Natural History). Termitas africanas Sands. “Termites of Sabah”. 1–172. Universiti Malaysia Sabah. 2–38. con muchas referencias que incorporan descripciones taxonómicas recientes. R. A. C. Booth. (1965). corta y bien ilustrada de familias con una sinopsis diagnóstica de más de 100 familias y casi 50 subfamilias. Continúa. (1981). (1959). London pp. ‘A review of the termites of the genus' Antitermes the Ethiopian region.

Región y autor Bouillon. Higashi (eds) Termites: Evolution. incluye detalles del enrollamiento del intestino y de cómo está conformada la válvula entérica para identificar algunas Apicotermitinae. Clave completa muy ilustrada y detallada. Clave corta. ‘Report on a survey of the termites of Zimbabwe’. D. 24. V. Occasional Papers of the National Museums of Rhodesia. especialmente Apicotermitinae y todas las que se alimentan del suelo. 365–444. Clave de especies para imagos. Estudio prestigiado.. CAB International. ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’.Apéndice 1. L. pp. R. vol 67. utilizando imagos. (1970) A revision of the termites of the genus Macrotermes from the Ethiopean (Isoptera: Termitidae) Bulletin of the British Museum (Natural History) Entomology vol. Natural Science 6. más 32 referencias. Termitas neotropicales Constantino. E. pp. (1998). Mitchell B. (1971). E. 1–40. pero recomendada para formarse. Kambhampati. 1–115. Harris W. “The Identification of Worker Castes of Termite Genera from Soils of Africa and the Middle East”. Longman. Their Recognition and Control. Estudio comprensivo que incluye claves hasta géneros de soldados. Sociality. J. obreros y soldados. Wallingford. A. y Eggleton P. Lo que opera actualmente este género. Termites. soldados mayores y soldados menores. 500 pp. pp. Zootaxa. Notas Clave a nivel familia de imagos y soldados. de difícil manejo. pp 1–23. Incluye una sinopsis de familias y subfamilias en forma de clave con notas e identifica caracteres diagnósticos. Bignell and M. Abe. 187–323. 142 Manual de biología de suelos tropicales . únicamente para géneros principalmente en el contexto africano. Symbioses Ecology. Kluwer Academic Publishers. (2002). (1966). pero útil para confirmaciones. ‘Taxonomy and phylogeny of termites’. vol. muy útil para termitas subterráneas crípticas. anticuada. Sands. G. pp. S. en: T. London. y Mathot. Series B. A. W. 1. Continúa. no muy útil como clave. (1980). Clave hasta género para soldados y muchos géneros ilustrados de manera detallada a nivel de especies (en francés). (2000). Ruelle. Título y referencias Quel est ce termite Africain? Zooleo.

O. S. Los volúmenes I y II contienen claves hasta familias.Uganda. B. C. subfamilias. Excelente para entrenaPest Research. pero sí un listado Checklist of the Species of Termites que identifica la distribución entre (Isoptera) Recorded from East Africa. The Fauna of India and Adjacent Countries: Isoptera (Termites). Entomology department. E. Kenia. Tanzania y Zanzibar. Centre for Overseas Pest Research. Listas de material requerido para un muestreo de hormigas con precios en $US del 2001. reporte detallado con definiciones de características morfológicas. Chhotani. A. 672 pp. con una amplia bibliografía. vol. Título y referencias Notas No es una clave. Harvard University. (2001). Continúa. B. 'Guidelines for data collection for ants’. incluyenCountries: Isoptera (Termites). (2001). (2003). miento avanzado. Los volúmenes I y II cubren todo el The Fauna of India and Adjacent subcontinente de la India. Williams R. Harvard University. B. Región y autor Claves inéditas de termitas y listas de comprobación Wanyoni. Guías para caracterización del sitio y anotaciones relacionadas con el muestreo de hormigas. UC Davis. P. Ward. Fisher. O. No publicado. (sin fecha). géneros y especies para imagos y soldados. India. Sands W. I. C. Department of Entomology. K. (Family Termitidae) Zoological survey of do Sri Lanka. ed) International Centre of Insect Physiology and Ecology. Bibliografía completa.Apéndice 1. (1989). B. y Chhotani. Centre for Overseas para géneros de África del Oeste y Central. Zoological Survey of India. Calcutta. Clave detallada y de fácil manejo A Key to the Genera of the Termitinae by the Soldier Caste. M. (1983). II. L. C. incluye claves hasta familias y subfamilias. y Williams. 801 pp. Documentos variados Roowal. No publicado. utilizadas en taxonomía. Documento de base. Calcutta. ‘Equipment specifications’ Department of Entomology. ‘Taxonomy of Termites’. (sin fecha). (1997). Sinopsis ilustrada de subfamilias y su distribución. M acrofauna 143 . 'Ant subfamilies’. (J. Darlington. eje de muchas claves privadas de museos nacionales. imagos y soldados. R. Fisher. P. vol. M. M.

No publicado. Región y autor Jones. Universiti Malaysia Sabah. Bibliografía amplia y actual. Harvard University Entomology. Isópteros y arañas (Araneae). pero sin ilustraciones. Department of Entomology. Harvard University 144 Manual de biología de suelos tropicales . 12–26 October. T. 2003. escarabajos del suelo. “Glossary of morphological characters used in ant taxonomy”. lombrices de tierra diplópodos. termitas. pp. lectura obligatoria. (ed) 2003. sin fecha). Título y referencias ‘Tools for the Rapid Assessment of Soil Invertebrate Biodiversity in the ASEAN Region’. Completo. prepared for ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’.Apéndice 1. Notas Revisión moderna y completa de la naturaleza de la biodiversidad del suelo y métodos de evaluación rápidos para hormigas. (Anónimos. 1–39. D. Continúa.

M acrofauna 145 . Constantino (2001). Constantino (1990). Neocapritermes Parvitermes Krishna y Araujo (1968). únicamente Kalotermitidae). Nasutitermes Parvitermes Procornitermes Holmgren (1910). Snyder (1926). (2006). Claves de soldados de especies de Las Antillas (anticuado). Mill (1983) y Constantino (1999. Araujo (1954). Fontes (1985). Revisión y claves. Scheffrahn y Krecek (2001). Revisión de mapas de distribución de especies del Nuevo Mundo con clave de soldados y alados. Género KALOTERMITIDAE Cryptotermes Eucryptotermes Procryptotermes Bacchus (1987) Scheffrahn y Krecek (1999). Revisión y claves. Emerson y Banks (1965). Revisión y claves de soldados (en portugués).Apéndice 2. Clave de soldados de América del Sur. Las claves hasta género son dadas en Krishna (1961. Emerson (1952). Clave de soldados. Clave de soldados de Paracomitermes (anticuado). Scheffrahn y Krecek. Clave de soldados. con claves. Revisión y claves (anticuado). Revisión y claves. Emerson (1952). Constantino y DeSouza (1997). Revisión y claves (anticuado y en alemán). Cancello (1986). Trabajos taxonómicos con claves de especies de algunos géneros neotropicales. 2002). Scheffrahn and Krecek (1993). Constantino et al. Constantino (1997). Revisión de Labiotermes sensu stricto. Clave de alados (anticuado). Referencia Contenido RHINOTERMITIDAE Heterotermes TERMITIDAE Amitermes Anoplotermes Atlantitermes Cornitermes Cyranotermes Cyrilliotermes Labiotermes Light (1932). Revisión y claves. Clave de soldados. Claves de soldados de especies de Las Antillas (anticuado). Revisión mundial con revisión de claves de las especies antillanas con claves hasta la diagnosis de los soldados.

Apéndice 2. 146 Manual de biología de suelos tropicales . Revisión y claves. Rhynchotermes Rotunditermes Syntermes Fontes (1985). Continúa. Constantino (1995). Revisión y claves (anticuado). Género Procornitermes Referencia Emerson (1952). Contenido Revisión y claves. Emerson (1945) . Revisión y claves de soldados (en portugués). Claves de soldados (anticuado). Fontes y Bandeira (1979). Cancello (1986). Claves de soldados.

American Museum Novitates. Constantino. 36. Nasutitermitinae)’. Tropical Pest Bulletin. (1997) ‘Key to the soldiers of Atlantitermes Fontes 1979. Constantino. paper 67. Bulletin of the American Museum of Natural History. pp. pp. Emerson. A. pp. A. 1–33. pp. 427–472. 455–518. R. E. 463–472. distribution and ecology (Isoptera. Revista Brasileira de Entomologi. Zootaxa. vol. F. 7. E. Goeldiana Zoologi. Emerson. Termitidae. vol. 99. C. Constantino. 31. Cuezzo..Apéndice 3. vol. K. A. F. 83. Cancello. vol. pp. R. pp. 10. Papéis Avulsos de Zoologia (São Paulo). 30. (1986) ‘Revisão de Procornitermes Emerson (Isoptera. (2006) ‘A taxonomic revision of the Neotropical termite genera Labiotermes Holmgren and Paracornitermes Emerson (Isoptera: Termitidae: Nasutitermitinae)’. N. (1987) ‘A taxonomic and biometric study of the genus Cryptotermes (Isoptera: Kalotermitidae)’. pp. Termitidae)’. Termitidae. S. Bulletin of the American Museum of Natural History. R. 1–91.. 189–236. Constantino. y Banks. 1–44. pp. A. y Vasconcellos. pp. pp. E. A. Acioli. 125–131. (1997) ‘Notes on Eucryptotermes with a new species from central Amazonia (Isoptera: Kalotermitidae)’. A. 55. Zootaxa. University of Kansas Science Bulletin. Constantino. Insect Systematics and Evolution. L.. R. Tropical Zoology. M. 181–189. R.. 475– 540. Schmidt. O. (1952) ‘The Neotropical genera Procornitermes and Cornitermes (Isoptera. E. Constantino. 205–213. (2002) ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. M acrofauna 147 . 1–11. Carvalho. Nasutitermitinae)’. vol. 1–40. 1. R. (2001) ‘Key to the soldiers of South American Heterotermes with a new species from Brazil (Isoptera: Rhinotermitidae)’. vol. H. (1945) ‘The Neotropical genus Syntermes (Isoptera: Termitidae)’. pp. pp. Emerson. paper 1340. S. (1995) ‘Revision of the Neotropical termite genus Syntermes Holmgren (Isoptera: Termitidae)’. A. Bacchus. no 2208. F. vol. Constantino. Sociobiology. vol. (1965) ‘The Neotropical genus Labiotermes (Holmgren): Its phylogeny. R. Termitidae. with a new species from Brazil (Isoptera: Termitidae: Nasutitermitinae)’. 2. pp. vol. (1954) ‘Notes on the genus Paracornitermes Emerson 1949 with description of two new species (Isoptera. Literatura especializada en termitas neotropicales Araujo. Nasutitermitinae)’. Nasutitermitinae)’. R. (1990) ‘Notes on Cyranotermes Araujo with description of a new species (Isoptera. Termitidae. y DeSouza. vol.

Nasutitermitinae)’. pp. K. S. G. 68. Light. 603–607. L. 3. 13. Annals of the Entomological Society of America. y Bandeira. H. Snyder. vol. 7–25. (1961) ‘A generic revision and phylogenetic study of the family Kalotermitidae (Isoptera)’. J. 138. a new subterranean termite (Isoptera: Termitidae) from Cuba and the Dominican Republic’. R. y Araujo. vol. Bulletin of the American Museum of Natural History. pp. (1993) ‘Parvitermes subtilis. Scheffrahn. y Krecek. pp.Fontes. L. R. pp. Nasutitermitinae)’. 179–190. 23. vol. 111–171. 27. pp. 530–539. Revista Brasileira de Entomologia. A. 107–110. pp. N. L. vol. 76. J. Florida Entomologist. pp. vol. (1983) ‘Generic keys to the soldier caste of New World Termitidae (Isoptera: Insecta)’. 122. 9. 1–76. 171–325. Termitidae)’. pp. y Krecek. H. 335–414. vol. 303–408. Scheffrahn. (1910) ‘Versuch einer Monographie der amerikanische Eutermes – Arten’. R. R. pp. (1979) ‘Redescription and comments on the Neotropical genus Rotunditermes (Isoptera. Krishna. Systematic Entomology. Termitidae. R. vol. Bulletin of the American Museum of Natural History. Holmgren. Scheffrahn. 94. 84–138. vol. H. A. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten. (2001) ‘New world revision of the termite genus Procryptotermes (Isoptera : Kalotermitidae)’. E. y Krecek. 5. vol. pp. pp. (1985) ‘New genera and new species of Nasutitermitinae from the Neotropical region (Isoptera. Insecta Mundi. J. T. (1999) ‘Termites of the genus Cryptotermes Banks (Isoptera: Kalotermitidae) from the West Indies’. Termitidae. (1926) ‘Termites collected on the Mulford Biological Exploration to the Amazon Basin 1921–1922’. vol. (1932) ‘Contribution toward a revision of the American species of Amitermes Silvestri’. R. F. Fontes. Mill. Krishna. 148 Manual de biología de suelos tropicales . (1968) ‘A revision of the Neotropical genus Neocapritermes (Isoptera. K. Proceedings of the US National Museum. E. University of California Publications in Entomology. Revista Brasileira de Zoologia. vol.

y cuya abundancia no puede ser evaluada con exactitud por medio de la selección manual del suelo.Capítulo 4 Collembola. Protura. La mesofauna se colecta utilizando dos métodos de muestreo: a) una muestra compuesta que contiene varios núcleos de suelo y hojarasca extraída de la superficie. a 3 m y 6 m de radio del monolito. Cahyo Rahmadi. Acari (ácaros). 149 . Enchytraeidae. en principio. descrito en el Capítulo 2. bien por el método Berlese-Tullgren o por el de Berlese modificado. b) del contenido líquido de las trampas pitfall. Elizabeth Franklin. y se complementan con pitfall. Collembola (colémbolos).2 y 2. En cada punto de muestreo. Pauropoda y otros Nematodos son típicos representantes de la mesofauna. por debajo de la hojarasca de la superficie y en la hojarasca en sí. Francis-X. Susilo y Jose Wellington de Morais INTRODUCCIÓN La mesofauna está conformada por animales cuyo tamaño de cuerpo oscila entre 0. los núcleos de suelo se localizan en dos círculos concéntricos. sin embargo. Los núcleos de suelo.0 mm. sirven para colectar mesofauna que habita en el suelo mineral. localizadas a por lo menos 14 m del centro del monolito. formas de larvas de especies de macrofauna también caen dentro del rango de tamaño de mesofauna. El muestreo de la mesofauna (y otra biota del suelo) se encuentra integrado como parte de la estrategia global del inventario de la biodiversidad bajo del suelo. mientras las trampas pitfall se utilizan para colectar los que habitan en la superficie del suelo. acari y otra mesofauna del suelo: el método Berlese Agus Karyanto. respectivamente.

En este sistema circula agua caliente entre las paredes dobles de latón del embudo (o embudos). forrajean en hongos y algas. MÉTODOS DE MUESTREO Los protocolos aquí descritos abordan principalmente los de los ácaros y colémbolos presentes en los horizontes minerales y en la hojarasca. normalmente. y algunos son predadores. en contraste con los grupos más oportunistas como los colémbolos. se alimentan de nematodos vivos (Siepel. composición de especies y diversidad en un hábitat específico son buenos indicadores de un suelo “sano” (Minor. a finales del siglo XIX. con una diversidad de especies también muy alta y. son sedentarios (con la excepción de algunas familias como Galumnidae y Scheloribatidae). al igual que en la formación de la estructura de suelo. a su vez. Estos ácaros se alimentan de materia de plantas vivas o muertas y de carroña. en suelos no perturbados. después de muertos. su abundancia. Lo anterior es aplicable para los grupos mayores de microartrópodos del suelo o a partir de las proporciones de abundancia y diversidad entre los grupos de mesofauna del suelo.El método Berlese es un sistema de extracción por embudo para separar los pequeños artrópodos del suelo. Debido a su papel regulador en la descomposición y el reciclaje de nutrientes. Tullgren modificó el método Berlese. Los ácaros oribátidos (también conocidos como Cryptstigmata a los que se refieren como ácaros escarabajos o ácaros de caja) son artrópodos numéricamente dominantes en los horizontes orgánicos de la mayoría de los suelos. En 1918. constituyen un componente integral de la estructura del suelo. por ejemplo. 2004). sin embargo. se pueden encontrar entre 50 y 100 especies (Norton. fue desarrollado por Antonio Berlese. no resulta útil para colectar ácaros oribátidos (Acari: Oribatida) porque estos animales. se convierten en un importante desecho nitrogenado. Se sugiere que para un muestreo normal ambas extracciones de embudo y pitfall deben emplearse de manera conjunta. Sus heces fecales proporcionan una amplia superficie para la descomposición primaria por hongos y bacterias y. de manera que la muestra se seca lentamente.) es suficientemente eficaz como para poder capturar colémbolos que viven en la superficie del suelo (edáficos). El principio es colectar pequeños núcleos o bloques y combinarlos para hacer una sola muestra compues150 Manual de biología de suelos tropicales . 1990). 1990). El método pitfall (Capítulo 3. asimismo. reemplazando la envoltura de agua por un foco de luz eléctrica. su densidad puede alcanzar cientos de miles de individuos por m².

De manera alternativa. y toma muestras a una profundidad de hasta 5cm que posteriormente se transfieren a un recipiente de plástico de 300 ml de volumen (Figuras 4. Se ha observado que los costales de tela son muy eficientes para almacenar temporalmente y transportar las muestras durante largas distancias y tiempos. ésta deberá situarse en el asiento del pasajero.ta. acari y otra mesofauna del suelo 151 . Así. para evitar que la mesofauna muera. Una vez en el laboratorio. Ahora las muestras estarán listas para su traslado al laboratorio. Si se transporta la muestra sin aire acondicionado. también se deben proteger de la lluvia durante el traslado. De la misma manera.1a y b). con una capa de papel para mantener un ambiente de humedad estable dentro de la caja. donde serán identificadas. De manera alternativa. con un promedio de un kilo por bolsa.5 x 3.5 x 3. la fauna también puede morir. C ollembola . de acuerdo con su localidad de muestreo. No se debe usar un costal de plástico porque la temperatura del suelo puede aumentar sustancialmente. utilizando una pequeña cuchara que tome un volumen constante de aproximadamente 100 ml. las muestras del suelo pueden ser colectadas en muestras de 3. se utilizan tres o cuatro muestras compuestas y no sólo una. lo que provocaría la muerte de la mesofauna antes de su extracción. se colocan todos los costales de tela bajo techo. La muestra compuesta de suelo se divide en 10 bolsas de nylon.5 cm de ancho y 10 cm de alto. Dichas muestras deben permanecer alejadas del calor del motor del vehículo y de su sistema de escape. Este aparato mide 3. Al llegar al campo de base o laboratorio. porque si éstas se mojan o humedecen demasiado. con o sin hojarasca. el suelo deberá someterse de inmediato a su extracción. Enseguida se empacan las muestras en una caja de cartón. El siguiente paso es almacenar las muestras en cajas grandes para transportarlas hasta el laboratorio. evitando que la temperatura se eleve. se colectan en el campo. se debe evitar que la muestra se exponga a sol directo durante el encostalado en el campo. porque la tela permite que circule el aire. se etiquetan y se transfieren a un costal de tela de 30 x 35 cm de tamaño. son dañinos para los animales que se encuentran en la muestra.5 x 5 cm de profundidad. Las muestras de suelo. el suelo de 12 sub-muestras se coloca entonces en una bolsa de 5 kg como una muestra compuesta. para ello es recomendable utilizar un vehículo con aire acondicionado. utilizando un sacabocados. la cual es entonces sub-muestreada por extracción por el método de BerleseTullgren. tanto la luz solar como el calor del motor.

deberá contener cuatro agujeros de 4 mm de diámetro para permitir que animales mayores escapen hacia abajo.1 Sacabocados de metal para muestrear la mesofauna en la hojarasca y en el suelo mineral.2 a) al igual que puertas. Se calientan ligeramente los embudos. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. para evitar que otros insectos voladores pasen a formar parte de la muestra. dejando los focos encendidos cada vez 152 Manual de biología de suelos tropicales . cada compartimento contará con un marco para sostener los embudos de plástico (Figura 4. utilizando para ello focos eléctricos (los de 25 W son ideales). aunque también se podrían usar los de 40 W. El tamaño de malla del tamiz. se mantiene el aparato en el laboratorio del campo de base. arañas y otros artrópodos. se debe incrementar el calentamiento de manera gradual cada día.W. Morais y E. éstos se suspenderán a 14 cm por encima del tamiz.2) es utilizado para extraer la mesofauna activa que habita en las muestras de suelo y en la hojarasca. Cortesía de: J. b) se utilizan guantes como precaución contra enredaderas. La manera ideal es utilizar un contenedor de madera de alrededor de 160 x 50 cm. hormigas. Franklin.5 mm.Figura 4. dividido en compartimentos superiores e inferiores. A B EXTRACCIÓN Método Berlese-Tullgren El aparato Berlese-Tullgren (Figura 4. cerca del área de referencia. utilizando una pequeña cuchara o cuchillo de campo. de 1. Se coloca un tamiz (de 8 cm de diámetro y 5 cm de altura) con muestras de suelo y hojarascas encima del embudo.

para evitar que el material de la muestra se seque demasiado rápido. en una botella que los recibe hasta la base del embudo. por lo tanto. Típicamente. Las muestras se quedan en el aparato hasta que estén completamente secas. evitando así que las especies que se mueven con mayor lentitud queden atrapadas en las capas secas y duras del suelo. Se ajusta la posición de la lámpara para asegurar que la temperatura del suelo suba gradualmente. el embudo deberá presentar una superficie lisa y una fuerte pendiente. Figura 4. Franklin. si se dejan durante más tiempo nacen los C ollembola .W. hasta que mantengan un peso seco constante que generalmente tarda unos 8 días. por un periodo de hasta 8 días. Morais y E. El principio básico del aparato Berlese-Tullgren es que los organismos de suelo responden al incremento de temperatura o sequedad en el suelo migrando hacia abajo hasta que finalmente caen a través de la malla. esto inmovilizará a la mesofauna antes de que se escape. b) sistema Berlese–Tullgren en operación. para una mayor efectividad.durante mayor tiempo. la cual contiene un conservador. es decir. Cortesía de: J.2 a) contenedor de apoyo para embudos Berlese–Tullgren. la temperatura de la muestra se aumenta gradualmente de 27°C hasta aproximadamente 40-45°C. Nota: nótese que las patas están sumergidas en agua para evitar la invasión de hormigas y de otros insectos. acari y otra mesofauna del suelo 153 . de modo que los animales que caen por la malla lo hagan de manera rápida hasta llegar a la botella que los recibe.

arriba de las muestras de suelo. 154 Manual de biología de suelos tropicales . Asimismo. El envase receptor se llena con etanol al 96% para su conservación y durante intervalos de 4 a 5 días se cambia el envase receptor. El aparato Berlese sensu stricto puede transformarse en un modelo Berlese-Tullgren. aunque tomará más tiempo. en este caso. El método Berlese modificado Cuando no se cuenta con electricidad. En la presencia de luz. el tiempo de incubación (tiempo necesario para extraer la fauna del suelo) es aproximadamente de 4 a 5 días. Son baratos y sencillos. lo único que se requiere es un embudo más grande y un tiempo de secado más largo. que se muestra en la figura 4. en donde se coloca un tamiz con una malla de 2 x 2 mm (malla 13). el sistema Berlese-Tullgren y. dependiendo de las condiciones de humedad inicial del suelo. Como líquido conservador. 2006). aun en regiones remotas (Frankin y Morais. Para evitar lo anterior. al 96%. un embudo de aluminio modificado de Berlese. éste se cerrará con una tapa para prevenir la entrada de otros insectos. el embudo se coloca sin luz y el proceso de calentamiento-secado se lleva a cabo simplemente a temperatura ambiente. en cierta manera. el agujero de ventilación de la tapa deberá cerrarse durante la noche.. el tiempo de espera será de 7 a 14 días.3. especialmente si el embudo Berlese no está perfectamente cerrado.5). el de Berlese. es el adecuado para el secado sin electricidad. el equipo completo requerido es barato y puede ser fácilmente improvisado (Figura 4. 2002). Una ventaja de dichos sistemas es que se pueden operar a diferentes escalas. El uso de un foco puede atraer insectos nocturnos. generalmente. por lo que las muestras serán menos representativas. cuando se compara con otros métodos de muestreo. es uno de los más usuales para la extracción en la evaluación de la diversidad y densidad de microartrópodos del suelo (André et al. pueden moverse con facilidad desde el lugar del muestreo y ser ajustados para acomodar un gran número de muestras. al tiempo que utilizan el mismo principio para extraer un solo núcleo o una muestra conglomerada mayor.huevos y las formas inmaduras se vuelven adultos. se utiliza formol al 4% o etanol. con la colocación de una bombilla de 10 a 40W. Un sistema Berlese que opera sin luz muchas veces permite una mejor extracción. A pesar de una eficiencia menor.

Suhardjono LIPI Bogor. El proceso de montaje debe realizarse bajo un microsC ollembola . con embudo superior de 40 cm de diámetro.3 Embudos Berlese llenos de suelo y hojarasca. Figura 4. PROCESOS DE ACLARADO Y MONTAJE DE ESPECÍMENES Para su identificación.4 Embudo Berlese modificado. los especímenes de mesofauna son montados sobre laminillas. Y. acari y otra mesofauna del suelo 155 .Figura 4. después de su aclarado. Fuente: cortesía del Dr. hecho de aluminio. de 50cm de altura. R.

la observación de la morfología. Después de la inmersión en KOH. Cortesía de: M. durante unos minutos. aunque el hidróxido de potasio (KOH) y el ácido láctico son alternativas efectivas. Los especímenes pueden ser aclarados con un 15% de KOH.5 Equipo básico requerido para llevar a cabo extracciones Berlese-Tullgren núcleo por núcleo. dependiendo del pigmento y de la grasa del cuerpo del animal. Proceso de aclarado El aclarado consiste en volver más transparente el tejido de los especímenes. fácil y seguro. normalmente se usa una solución de Nesbitt (su composición se describe a continuación).Figura 4.. con o sin calentamiento. copio de disección.R. dependiendo del tamaño. Los taxa con cutículas delicadas.. hasta neutralizar la reacción. se transfieren los especímenes a una solución de cloral fenol. (2008) propusieron una solución de KOH 10% durante 1 a 5 minutos. Un método más simple de aclarado es utilizando ácido láctico. y da buenos resultados (Greenslade et al. requiere de un microscopio compuesto. mediante el lavado y removido de las grasas y pigmentos del cuerpo. en donde se sumergen y calientan durante los diferentes periodos de tiempo. aunque Greenslade et al. durante dos a cinco minutos. como algu156 Manual de biología de suelos tropicales . este método es más barato. Coelho. Para ello. normalmente. 2008).

sin calentamiento. patas. Los ácaros también pueden aclararse y conservarse trasladándolos del alcohol a un medio de Hoyer. en el C ollembola . fúrcula.nos Diplura. por lo menos. para que puedan ser bien identificados. utilizando el ejemplo de los colémbolos. Montaje No existen métodos totalmente satisfactorios para el montaje (Greenslade et al. con alcohol 70%. la posición indicada es látero-lateral. Después de su identificación. En el caso de especímenes mutilados. De nuevo. cristales de fenol y agua destilada. es aconsejable montar todas las partes del cuerpo en una sola preparación. el medio líquido Hoyer. mientras que las partes del cuerpo de los Symphypleona grandes se montarán de la siguiente manera: cabeza (dorsoventral). Para un almacenaje permanente. tales como cabeza. Normalmente. acari y otra mesofauna del suelo 157 . muchos ácaros oribátidos se guardan en viales etiquetados.. Las especímenes son montados en laminillas y secadas en el horno a 70°C durante. como característica clave. en proporciones 50:25:25) o simplemente con ácido láctico (frío o caliente). Algunos grupos necesitan ser disecados o disectados antes del montaje. al que se añade un 5% de glicerina. La disección se realiza en varias partes del cuerpo. 2008). tubo ventral y en los segmentos V y VI abdominales. Protura y Pauropoda no deben meterse en una solución concentrada de ácido. Los ácaros esclerotizados pueden ser aclarados con lactofenol (compuesto por ácido láctico.1). Otras soluciones. también pueden usarse para el proceso de montaje (Tabla 4. se recomienda la disección en el caso de Symphypleona y de las Paronellidae y Entomobrydae mayores (6 a 8mm). por ejemplo. si no se hace. Symphypleona y Neelipleona. abdomen pequeño y fúrcula (dorsoventral). los colémbolos Poduromorpha se deben colocar en posición dorso-ventral. La posición de los especímenes sobre el portaobjetos difiere entre los órdenes: por ejemplo. estos especímenes deberán sumergirse en una mezcla de 50% de ácido láctico/etanol durante unas horas. porque el ácido láctico continúa aclarándolos y ablandándolos. los especímenes deben transferirse a otro medio. Para dicho montaje se requiere de una solución Berlese. mientras que para los Entromobrymorpha. los especímenes pueden destruirse o desarticularse. En cada caso se debe regular y controlar el tiempo. Las partes diseccionadas del cuerpo de los Entromobrymorpha deberán colocarse de forma dorso-ventral sobre el portaobjetos. siete días. con el propósito de identificarlos viendo la quetotaxia de cada parte. abdomen grande (látero-lateral).

la pericia taxonómica quizás sea el factor determinante en la selección de una taxa para su estudio posterior. El espécimen puede rodarse suavemente hasta conseguir la orientación deseada. Se coloca de manera parcial un cubreobjetos sobre la depresión y se empuja el espécimen por debajo del recubrimiento. donde se indican las características distintivas de varios grupos de invertebrados. www.massey. 5 ml de glicerina. de donde se pueden obtener guías de ayuda para la identificación. ofrecen una buena discusión de fondo acerca de cómo aclarar y montar ácaros. se hace un montaje temporal. esta última dirección también concentra la literatura principal.ac. 50 g de hidrato de cloro. tales como los de Bachelier (1978) y Dindal (1990). 158 Manual de biología de suelos tropicales .php.edu/course/ent591k/kwikey1. IDENTIFICACIÓN DE ESPECÍMENES Y ANÁLISIS DE DATOS Identificación La mayoría de los invertebrados del suelo pueden identificarse hasta orden o familia con la ayuda de trabajos estándares de referencia. 30 g de goma arábiga. 50 ml de agua destilada. aunque también se puede usar para otros grupos de mesofauna. Tabla 4. 10 g de glucosa y 5 ml de ácido acético glacial. El medio líquido de Hoyer es un agente temporal y no se endurece con calentamiento. Krantz (1978) y Norton (1990).1 Composición química para aclarar y montar especímenes.nz/key. sin embargo. Para aclarar especimenes solución Nesbitt’s 10% KOH ó NaOH Montaje de especimenes : medio líquido de Berlese 25 ml de agua destilada. resulta difícil. El espécimen se traslada a unas gotas de ácido láctico o glicerina en un portaobjetos excavado. hacia el borde de la depresión.cals. 200 g de hidrato de cloro y 20ml de glicerina. en el caso de la mayoría de los grupos de artrópodos de suelo. Trave (1965).5 ml de ácido hidroclórico 20 ml de agua destilada. Montaje de especimenes: medio líquido de Hoyer Nota: montaje Berlese: calentar a 70°C durante 7 días. pero las preparaciones pueden hacerse semipermanentes sellando el recubrimiento con barniz de uñas transparente. A nivel de especies.ncsu. 40 g de hidrato de cloro y 2.caso de ácaros de suelo.htm o http://soilbugs. Se encuentran disponibles varias páginas en la web. Por ejemplo. 15 g de goma arábiga. una identificación más allá de este nivel.

una vez conocida su morfología y características básicas (Crossley y Coleman. Pauropoda. se encuentra disponible en Greenslade et al. Opiliones. es mostrado en Dindal (1999). es utilizado para estimar su abundancia. Scorpiones. Balogh (1972). por ejemplo.permitiendo así. El libro se escribió para un fácil manejo. Collembola. al igual que referencias de la taxonomía actual de estos grupos. Balogh y Balogh (1990) ofrecen una breve caracterización y claves de identificación para ácaros oribátidos que habitan en la región neotropical. C ollembola . Protura. son escasas las guías específicas para este grupo en los trópicos. la identificación de colémbolos. la identificación a nivel género y/o especies. Diptera y Hymenoptera. Los subórdenes de ácaros y muchas familias de colémbolos son de fácil identificación. Mites. Diplura. Enchytraeidae. 1999). al igual que una lista de comprobación y bibliografía de especies descritas en esta área. 2008. 1982a. La base de identificación y clasificación se encuentra resumida en las referencias que se citan a continuación. taxonomía y ecología de grupos de la biota del suelo. Desafortunadamente. Publicaciones de Yoshii (1981a. algunas veces. hasta nivel de familia y. a nivel genérico. 1981b. están disponibles en Kranz (1978) y Dindal (1990). Los recursos para la identificación de ácaros. Bachelier (1978) ofrece buena información de fondo dentro de las amplias unidades taxonómicas de artrópodos del suelo e incluye guías ilustradas para varios grupos. Asimismo. Un estudio completo de la biología. Isopoda. familias. Las muestras colectadas. ya que contiene guías de identificación ilustradas.1982b y 1983) pueden utilizarse para identificar colémbolos a nivel especies. Araneae. utilizando pequeños núcleos o bloques. Balogh y Mahunka (1983) y Balogh y Balogh (1992).. El libro contiene claves de identificación para todas las clases. a nivel familia. Adis (2002) ofrece guías ilustradas para principiantes y cualquier persona interesada en Arachnida y Myriapoda Neurotropicales. por lo que es recomendable tanto para principiantes como para profesionales. son combinadas para crear una muestra compuesta que se somete a extracción. en las familias Entomobryidae y Paronellidae. acari y otra mesofauna del suelo 159 . Coleoptera. algunos géneros y listas de especies terrestres conocidas. quienes ofrecen guías y figuras a nivel genérico para ácaros que pertenecen a la suborden Oribatida. por lo menos. de especies para algunos grupos como Nematoda. Isóptera. Symphyla. Chilopoda. Análisis de datos El número de individuos en cada orden y en cada lugar. órdenes. Pseudoscorpionida.

La comparación de la composición de taxa entre usos de suelo debería llevarse a cabo utilizando un análisis jerárquico de agrupación y la unión promedio de agrupaciones de los datos transformados. 2006). Se ha demostrado que datos a nivel género y familia. junto con otros índices de diversidad.. Este procedimiento mejora la eficiencia de la extracción porque maximiza las posibilidades de captura de grupos o especies representativos. Dado que los grupos de lugares similares ofrecen una fauna similar y que la mayoría de animales del suelo pueden distribuirse en los grupos funcionales básicos (Ruf et al. del paquete de metodología ecológica para Windows. por lo tanto. 1988). (1978) “La faune des sols. son écologie et son action“.utilizando el método Berlese-Tullgren. pueden ser calculados utilizando el programa EstimateS (Colwell.. con numerosas especies raras. Ph. Bachelier. Pensoft. 2006). André. incluir la riqueza de especies en el caso de los taxa seleccionada para la identificación a nivel especies. H. J. fitofagos. también pueden detectar los efectos de la perturbación con poca pérdida de información y llegar a ser una herramienta preliminar para describir patrones y sucesiones en ecosistemas del suelo perturbado por humanos (Caruso y Migliorini. pp. un nuevo estimador estadístico que toma en cuenta especies compartidas no detectadas. o bien. ácaros oribátidos y hormigas. ejemplo: ácaros oribátidos. X. (2002) “Soil biodiversity: Myth. no 38. También puede llevarse a cabo un análisis adicional como rarefacción y estadística multivariada. Paris. 2006. 2003). los taxa escasamente conocidos también se pueden clasificar a niveles taxonómicos más altos (orden o familia). 2005. basada en la correspondencia estadística entre combinaciones de singletons y de otras especies raras (estimador de abundancia Chao-SØrensen) fue desarrollada por Chao et al. y Lebrun. vol. (2002) Amazonian Arachnida and Myriapoda. predadores. Este estimador. El programa DIVERS. REFERENCIAS Adis. M. puede usarse para calcular los índices de riqueza de especies.). Initiations et Documents Techniques. Ducarme. tales como colémbolos. 160 Manual de biología de suelos tropicales . reality or conning?” Oikos.. etc. 3–24. G. Sofia-Moscow. ORSTOM. de acuerdo con su función ecológica mayor (detritivoros. 96. El número de individuos normalmente se transforma de forma logarítmica log: x’=log10 (x+1) para evitar dar mayor peso a las especies dominantes en el análisis de datos (Ludwig y Reynolds. Los datos obtenidos deben. Este índice resulta especialmente útil para eliminar invertebrados hiper-diversos.

T-J. W. Brill. (2008) Handbook to Collembola of Indonesia. R.eeb. J. (2006) ‘Abundance-based similarity indices and their estimation when there are unseen species in samples’. in D. y Migliorini. Sumner (ed) Handbook of Soil Science. Colwell. Chazdon. Budapest. M. in J. 30. acari y otra mesofauna del suelo 161 . no. y Mahunka. 148–159. pp. Crossley. A. 2.nz/~maminor/mites. Balogh.. John Wiley and Sons. (2005) ‘A new statistical approach for assessing compositional similarity based on incidence and abundance data’. F. y Reynolds. S. New York. Budapest. y Coleman. y Morais. vols 1 and 2.. Fauna Malesiana. (2006) ‘Soil Mesofauna in Central Amazon’. D. J. P. Dindal. L. Caruso. (1983) Primitive Oribatids of the Palaearctic Region. y Balogh. O. http://viceroy. Colwell. y Suhardjono. G. Elsevier.ac. Norton. S Moreira. 8. pp. T. Chao. Siqueira and L. Hungarian Natural History Museum Press. L. Bedos. Greenslade. M. vol. html. L. Brussaard (eds) Soil Biodiversity in Amazonian and Other Brazilian Ecosystems. in F. Y.Balogh. John Wiley & Sons. K.massey. P. John Wiley and Sons. K. K. y Shen. Amsterdam. pp. 779–803. CABI Publishing. (2006) ‘Micro-arthropod communities under human disturbance: Is taxonomic aggregation a valuable tool for detecting multivariate change? Evidence from Mediterranean soil oribatid coenoses’. y Balogh. T-J. Franklin. no 1. y Shen. L. Akadémiai Kiadó. Biometrics. E. Wallingford. no. (1978) A Manual of Acarology. Ludwig. (1988) Statistical Ecology: A Primer on Methods and Computing.edu/estimates. New York. J. R. C ollembola . CRC Press. A. M. Balogh. R.. E. 62. J.. Oregon. 361–371. J. pp. Amsterdam. Ecology Letters. D. Leiden (in press). A. P. (2006) ‘EstimateS: Statistical estimation of species richness and shared species from sample. Balogh. Boca Raton. vol. (1990) ‘Oribatid Mites of the Neotropical Region II’. A. L.. in M. R. J. Krantz. (1990) ‘Acarina: Oribatida’. Oregon State University Book Store Inc. J. 2. Version 8 User’s Guide and Application’. New York. 59–65. pp. pp. Dindal (ed) Soil Biology Guide. R. J. 142–162. (1972) The Oribatid Genera of the World. (1999) ‘Microarthropods’. uconn. A. Chazdon. www. accessed 10 January 2008. Chao.. Minor. (1992) The Oribatid Mite Genera of the World. R.. Mahunka (eds) The Soil Mites of the World. (1990) Soil Biology Guide. Deharveng. W. vol. Balogh and S. R. (2004) ‘Soil mites and other animals’. Elsevier. Acta Oecologica. Colwell. 46–53. D.

pp1–38.. Yoshii. Japan International Cooperation Agency. K. EX-1 JR. (1982a) ‘Lepidocyrtid Collembola of Sabah’. Hund-Rinke. 1–70. Travè.Ruf. Entomological Report from the Sabah Forest Research Centre No. J. de triage. 4. pp. Siepel. Agriculture. pp. vol. (1983) ‘Studies on Paronellid Collembola of East Asia’. 1–28. Beck. Camisiidae)’. R. Oribatida. R. 5. R. Entomological Report from the Sabah Forest Research Centre No. J. (1981b) ‘Neanurid Collembola of Sabah’. (1965) “Quelques techniques de récolte. 7. 6. 81-12. Fert. 3. 2. A. 23–47. (1982b) ‘Studies on the Collembolan Genera Callyntrura and Dicranocentroides’. Japan International Cooperation Agency.. Entomological Report from the Sabah Forest Research Centre No. d’observation et de conservation des Oribates (Acariens) et autres microathropodes”. Ecosystems and Environment. Nothridae) and Platynothrus peltifer (Koch) (Acari. pp. Oribatida. Soils. (1981a) ‘Paronellid Collembola of Sabah’. Yoshii. vol. R. (1990) ‘Niche relationships between two panphytophagous soil mites. L. Japan International Cooperation Agency. Yoshii. EX-1 JR. P. 98. Dreher. Entomological Report from the Sabah Forest Research Centre No. 263–271. 2. Japan International Cooperation Agency. Römbke. pp. no. pp. (2003) “A biological classification concept for the assessment of soil quality: “Biological soil classification scheme” (BBSK)’. vol. pp. R. Biol. y Spelda. 1–3. 162 Manual de biología de suelos tropicales . J. Nothrus silvestris Nicolet (Acari.. Japan International Cooperation Agency. Yoshii. Revue d’Écologie et de Biologie du Sol. Yoshii. pp. 8112. 1–38. no. 9. 1–70.. 139–144. H. Entomological Report from the Sabah Forest Research Centre No.

Petersen. los cuales se consideran uno de los grupos de animales más abundantes y más diversos en el planeta. en todas las latitudes del planeta y desde fondo del mar hasta la cima de las montañas. Cares y Shiou P. Huang (†) INTRODUCCIÓN Los nematodos del suelo son pequeños invertebrados dependientes del agua. mientras que las formas de vida libre se alimentan de microorganismos (bacterias y hongos). ya que poseen un cuerpo alargado y cilíndrico. los nematodos parásitos tienen la capacidad de colonizar y alimentarse de tejidos de plantas y animales. protozoarios. Aunque la biomasa de nematodos en el suelo es pequeña (10¹ a 104 mg peso seco m-2). Derivado de su evolución. 1980. ellos son responsables del 10 a 15% de la respiración de los animales del suelo (Sohlenius. otros nematodos y microinvertebrados. los nematodos están presentes en cualquier lugar donde exista carbono orgánico. además de estos bene163 .Capítulo 5 Nematodos del suelo Juvenil E. ellos juegan un papel importante como agentes de ciclado de nutrientes y como reguladores de la fertilidad del suelo mediante el flujo de energía y la movilización y utilización de nutrimentos (Procter. Debido a su gran capacidad de adaptación. De esta manera. sin embargo. animal y de plantas. Los nematodos en una primera aproximación. 1990). son conocidos como una amenaza para la salud humana. 1982). La palabra nematodo deriva del griego “nema” que significa “forma de un hilo”. los nematodos se adaptaron a la exploración de una amplia variedad de fuentes de alimento. algas.

Como típicos estrategas r. tal es el caso de los nematodos entomofílicos Deladenus siricidicola o los entomopatógenos Steinernema carpocapsae y Heterorhabditis bacteriophora. poseen un estilete que les permite alimentarse de otros nematodos. bajo condiciones de enriquecimiento de nutrimentos. una condición que puede interpretarse como indicador de la fertilidad del suelo (Ferris et al. Los nematodos del suelo viven en grupos o gremios. mientras otros ocupan áreas más restringidas. algunos nematodos micófagos son pueden comportarse como parásitos facultativos de plantas. Su omnipresencia y abundancia en todo tipo de suelos y hábitats acuáticos. patogénicos. Se distinguen también entre ellos mismos por su 164 Manual de biología de suelos tropicales . Por tal motivo.ficios para el ecosistema. por lo que pueden fungir como micófagos. pueden regular el nitrógeno y el fósforo disponible para las plantas. o en algunos casos. compuestos por lo general de cinco grupos funcionales principales: parásitos de plantas. también participan en importantes servicios del agroecosistema al fungir como agentes de control biológico de plagas de insectos. pueden alimentarse de bacterias y esporas de hongos. En el caso de nematodos parásitos de plantas. benéficos y micorrízicos. Los nematodos bacteriófagos. con la capacidad de alimentarse de cualquier fuente. en algunos casos. microinvertebrados y protozoarios. influir en la nodulación por parte de bacterias tipo Rhizobium. equipados en su mayoría con un estilete pequeño y delicado (Ilustración 2b). Aunque la identificación de estos organismos requiere de intenso entrenamiento. 2006). los nematodos están bien representados a lo largo de la red trófica del suelo. los califican como poderosos bioindicadores de condiciones ecológicas (Huang y Cares. bacteriófagos. mismos que carecen de estilete (Ilustración 2c). se alimentan de las hifas de hongos saprofíticos. los nematodos bacteriófagos pueden incrementar su población ante cualquier perturbación del suelo o bien. así como su ciclo de vida corto y sensibilidad ante alteraciones ambientales. Los nematodos depredadores tienen la cavidad bucal equipada con una o más estructuras en forma de dientes (Ilustración 2d). el aparato bucal incluye un estilete tipo aguja (lustración 2a). así como alimentarse y diseminar bacterias benéficas y fitopatógenas. mediante el cual puede causar pérdidas significativas en varios cultivos. 2001). son polífagos. Algunos nematodos viven en un amplio rango de ambientes. en la mayoría de los casos la identificación de los diferentes grupos funcionales puede lograrse en base a la morfología de su aparato bucal. depredadores y omnívoros (Ilustración 2). Los omnívoros tienen la cavidad bucal armada con un estilete hueco (Ilustración 2e). bacteriófagos. herbívoros y también como depredadores al alimentarse de otros nematodos. Los micófagos. micófagos.

lo cual deberá hacerse con la mayor rapidez posible. una ausencia de dauerlarva y sensibilidad ante contaminantes y otros factores de perturbación. por tal motivo. A esta última suspensión de nematodos se le pueden eliminar aún más partículas de N ematodos del suelo 165 . se trazan dos círculos concéntricos. los nematodos persistentes (similares a estrategas k) se caracterizan por necesitar un largo tiempo de generación. Según lo propuesto por Bongers (1990) y Bongers y Borgers (1998). abundancia y estructura de comunidad. Los doce núcleos de suelo se depositan en una bolsa de plástico que deberá sellarse para evitar su desecación y además protegerla de la luz solar. Por otra parte. Para colectar el suelo se utiliza un nucleador de acero y las muestras se toman en cuatro puntos equidistantes en el círculo pequeño. MUESTREO DE SUELO En cada punto de muestreo dentro de un sistema de cuadrícula (véase Capítulo 2).sensibilidad a la perturbación del suelo y a los contaminantes químicos. la cual se vacía a una cubeta con 2 litros de agua. los nematodos colonizadores (similares a los estrategas r) típicamente poseen un tiempo de generación corto. pero más grandes. un análisis apropiado de la comunidad de nematodos. y ocho puntos en el círculo grande. respectivamente. poseen una baja movilidad. producen muchos huevecillos pequeños.1). respectivamente). producen pocos huevillos. EXTRACCIÓN DE NEMATODOS La muestra de suelo se mezcla completamente y se toma una submuestra de 300 ml. Las muestras son transportadas al laboratorio en una caja aislada y almacenadas a 4° C hasta su extracción. se agita durante 30 segundos y se deja reposar otros 2 minutos para que las partículas del suelo se sedimenten. puede presentar un índice de sistemas de uso de suelo y cambios de uso de suelo y medir los niveles de perturbación provocados por contaminantes y otros factores. muestran la presencia de dauerlarva e incrementan sus poblaciones cuando existen condiciones ricas en alimentación. con un radio de 3 m y 6 m. Esta suspensión se pasa a través de tamices de 40 a 60 mallas (tamaño de malla de 250 a 350 µm. todos los núcleos de suelo se deben tomar a una profundidad de 20 cm. además son los más resistentes a la perturbación del suelo y a contaminantes químicos. y los nematodos se colectan directamente en un tamiz de 400 mallas (tamaño de malla de 37 µm) (Figura 5. tomando en cuenta su diversidad.

Una vez calentados los tubos. los nematodos se colectan a partir del sobrenadante utilizando un cernidor con tamaño de malla de 37 µm (Figura 5. dejando así una suspensión de nematodos de 10 a 20 ml.3b) y. suspensión de suelo en reposo. se añade un volumen igual de solución Golden Figura 5. contenida en el vaso.3a). 1970). y a la derecha. Los especímenes que se hallan sobre la malla se lavan y arrastran con agua. se distribuye en tubos de ensayo para su fijación.500 rpm durante 5 minutos y el sobrenadante se descarta. La suspensión. 1964).2b). para luego colectarse en un vaso de precipitados (Figura 5. juego de tamices de metal (de tamaño de malla 45 arriba y 400 abajo). En este procedimiento.suelo mediante un método modificado de centrifugación con flotación de azúcar (Jenkins. 166 Manual de biología de suelos tropicales . Posteriormente. el sedimento o botón dentro del tubo de centrífuga se resuspenden en solución de sacarosa (456g L-1) (Figura 5. Posteriormente. FIJACIÓN Y CONTEO DE NEMATODOS Los nematodos extraídos se matan con agua caliente a 50-60°C durante un máximo de un minuto (Figura 5.1 A la izquierda. la suspensión acuosa se centrifuga primero a 3. posteriormente se fijan con solución Golden 2X (Hooper.2a) y se centrifuga de nuevo a 1.000 rpm durante uno a dos minutos. éstos se dejan reposar durante 30 minutos y se remueve el exceso de sobrenadante utilizando una pipeta o por medio de succión al vacío (preferentemente).

Figura 5.3 a) Nematodos recuperados mediante el lavado de malla de 400. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. 2X. el número total se obtiene de multiplicar la media de tres conteos de manera que el número total representará el número medio de 3 conteos de submuestras x 15. N ematodos del suelo 167 . depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa. a b Figura 5. de alícuotas de 1 ml.2%. b) muerte de nematodos en agua caliente.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos. con lo que se obtiene una concentración final de formol 3. La suspensión resultante se ajusta a un volumen de 15 ml y se cuenta el total de nematodos en la población mediante la toma al azar.

1996. Hunt. Después de este proceso. 1984) (Figura 5. luego se añaden 7 ml de la solución Seinhorst I (Figura 5. aunque en la última ocasión no es necesario añadir solución Seinhorst II pero sí incubar a la misma temperatura durante otras 48 horas para evaporar todo el alcohol. May et al. 1991.4). Goseco et al.1974.. Jairajpuri y Ahmad. la caja se retira del desecador y se deja evaporar a la misma temperatura durante un mínimo de cuatro horas. Baldwin y Mundo-Ocampo. 1991.1. Fortuner. 2001). Loof. Geraert. 1991. Smart Jr y Nguyen. al final.. se tapa la caja y se deja nuevamente en el desecador durante la noche. Estos pasos se repiten tres veces. 1991. 1991. la preparación se sella utilizando bálsamo de Canadá (Huang et al. Nickle y Hooper. 168 Manual de biología de suelos tropicales . 1988. Bongers. Andrássy. Antes de colocar el cubreobjetos de vidrio sobre la gota. El procedimiento se ilustra en la Figura 5. 2000.6). La modificación consiste en reducir a 3 ml el volumen de la suspensión (Figura 5. El volumen de la caja se reestablece con solución Seinhorst II. 1991. los nematodos de la caja se montan en laminillas. 1994. en esas condiciones se retira la tapa de la caja para que se reduzca por lo menos a la mitad de su volumen. Al segundo día.7). La identificación de nematodos por caracteres morfológicos se basa en la literatura taxonómica especializada (Goodey. 1983. Maggenti.1) y el volumen resultante se vacía por completo en una caja Petri de 5 cm de diámetro.5.5. Anderson y Potter. 1988. se coloca una tira de cinta adhesiva para evitar que el cubreobjetos aplaste a las especímenes. utilizando un microscopio compuesto (se requiere un aumento de 400 a 1. utilizando una gota de glicerina deshidratada como medio de montaje. la caja se coloca en un desecador a 43°C durante la noche (Figura 5.000 x). 1991. Tabla 5. Thorne. 1959) suele modificarse para evitar la laboriosa tarea de pescar individualmente cada nematodo y elaborar numerosas preparaciones permanentes. 1993. 1961. Decraemer. Se hace una selección al azar de aproximadamente 100 nematodos montados para su identificación a nivel de género. 1991. mientras que la composición de las soluciones se puede observar en la Tabla 5. 1992. 1991. 1951. Cares y Huang. Smart Jr y Nguyen. Raski. 1991.INFILTRACIÓN CON GLICERINA Y OBSERVACIÓN DE NEMATODOS El método de Seinhorst (Seinhorst.

Nematodos en: Golden (3 ml) + Seinhorst I (7 ml) Evaporación a 43°C durante 4h para reducir el volumen a la mitad Completar volumen con Seinhorst II Desecador a 43°C durante la noche Desecador a 43°C durante la noche Desecador a 43°C durante la noche Evaporación a 43°C durante 48 horas. Evaporación a 43°C durante 4 hrs para reducir a la mitad del volumen Completar volumen con Seinhorst II Evaporación a 43°C durante 4h para reducir el volumen a la mitad Desecador a 43°C durante la noche N ematodos del suelo 169 . Las cajas Petri no deben contener más de una tercera parte de líquido.Figura 5.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos Figura 5.

Foto Francisco Franco.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. Teixeira.7 Charola con montajes permanentes de especímenes de nematodos.Figura 5. Nota: el fondo del contenedor se mantiene a 43°C. Foto: Marcella A. 170 Manual de biología de suelos tropicales . Figura 5.

todos ellos basados en los criterios de Yeates et al. Índice de Diversidad de Shannon [H’ = .Σpi log2 pi]. empleando las fórmulas que se mencionan líneas adelante. pueden utilizarse para calcular índices de diversidad y equitatividad. depredadores y omnívoros. cuando un nematodo tiene dos tipos de hábitos alimenticios. micófagos. Los datos de frecuencia y abundancia de los diferentes grupos tróficos se usan para calcular el Índice de Diversidad Trófica y varios cocientes que consideran la abundancia relativa de los grupos tróficos. bacteriófagos. donde pi = porcentaje de género ‘i’ en la abundancia total]. N ematodos del suelo 171 . donde S = número de géneros y N = número total de nematodos]. Los datos sobre frecuencia absoluta. Golden X Formol (+ 40% formaldehído) Glicerina Agua destilada Alcohol 96% Glicerina Agua destilada 8 partes 2 partes 90 partes Seinhorst I 20 partes 2 partes 78 partes Golden 2X 16 partes 4 partes 80 partes Seinhorst II 95 partes 5 partes ÍNDICES Y PARÁMETROS PARA LA CARACTERIZACIÓN DE POBLACIONES DE NEMATODOS Los nematodos identificados a nivel de género pueden dividirse en cinco grupos tróficos: parásitos de plantas. Índice de Diversidad de Simpson [Ds = 1 – Σ(pi)². Equitatividad del Índice de Diversidad de Simpson [Es = Ds/Ds max’ donde Dsmax = 1 – 1/S Equitatividad del Índice de Diversidad de Shannon (J’= H’/H’max’ donde H’max = Log2 S]. su número poblacional se divide entre dos para cada hábito.Tabla 5. abundancia total y abundancia relativa de cada uno de los géneros.1 Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina. (1993). Índice de Riqueza de Género [d = (S – 1)/log N. Si un nematodo posee dos tipos de hábito alimenticio.

producen muchos huevecillos pequeños. Por el contrario. los persistentes cp5 se distinguen por tiempos generacionales largos. Bongers (1990) dividió a los nematodos del suelo en una serie desde los colonizadores (c) hasta los persistentes (p) (similar a los estrategas r y k. presentan dauerlarvae o estadios de sobrevivencia y crecen bajo condiciones de riqueza de alimento. 1994]. y el cociente IFP /IM como un indicador de fertilidad del suelo. Los colonizadores cp1 se caracterizan por tener tiempos generacionales cortos. se han utilizado varios índices para la evaluación del suelo. Para medir el nivel de perturbación del suelo (Bongers. asignándoles un “valor cp” en una escala de 1 a 5. 1990). Índice de Diversidad Trófica [T = 1/ Σ(pi)². En base a estos conceptos. 1998). Bongers y Bongers (1998) propusieron IM2–5 (igual que IM. 1978. La relación micófagos/bacteriófagos (M/B) y (micófagos+bacteriófagos)/parásitos de plantas [(M+B)/PP].3). pero excluyendo a los nematodos cp1) para evaluar factores de estrés inducidos por contaminación. 1988. ausencia de dauerlavae y elevada sensibilidad ante la presencia de contaminantes y otros factores de perturbación (Bongers y Bongers. el Índice de Madurez (IM) (que incluye únicamente nematodos de vida libre) (Tabla 5. véase Norton. siempre están activos. y fi = frecuencia relativa del género ‘i’). baja movilidad.2) y el Índice Fitoparasítico (IFP) (que incluye únicamente parásitos de plantas) (Tabla 5. Tabla 5. Σ(vi x fi) (donde vi = valor c-p de 1 a 5 para el género ‘i’. Magurran. Krebs.2 Familias y valores cp utilizados para el índice de madurez* Familia Neotylenchidae Anguinidae Aphelenchidae Aphelenchoididae Rhabditidae 172 valor cp 2 2 2 2 1 Familia Achromadoridae Ethmolaimidae Cyatholaimidae Desmodoridae Microlaimidae valor cp 3 3 3 3 3 Manual de biología de suelos tropicales . Yeates (1994) amplió el Índice de Madurez para incluir a todos los nematodos del suelo (mIM). respectivamente). la producción de pocos huevecillos pero muy grandes. donde pi = abundancia relativa de un grupo trófico . Porcentajes de criconematidos y de dorylaimidos en la población.

Tabla 5. Tabla 5.3 Familias y valores cp utilizados para el índice fitoparasítico cp2 Tylenchidae Psilenchidae Tylodoridae cp3 Dolichodoridae Hoplolaimidae Pratylenchidae cp4 Trichodoridae cp5 Longidoridae N ematodos del suelo 173 Nota:*modificado de Bongers (1990).2 Familias y valores cp utilizados para el índice de madurez* Familia Alloionematidae Diploscapteridae Bunonematidae Cephalobidae Ostellidae Panagrolaimidae Myolaimidae Teratocephalidae Diplogasteridae Neodiplogasteridae Diplogasteroididae Tylopharyngidae Odontopharyngidae Monhysteridae Xyalidae Linhomoeidae Plectidae Leptolaimidae Halaphanolaimidae Diplopeltidae Rhabdolaimidae Chromadoridae Hypodontolaimidae Choanolaimidae valor cp 1 1 1 2 2 1 2 2 1 1 1 1 1 1 2 3 2 3 3 3 3 3 3 4 Familia Odontolaimidae Aulolaimidae Bastianiidae Prismatolaimidae Ironidae Tobrilidae Onchulidae Tripylidae Alaimidae Bathyodontidae Mononchidae Anatonchidae Nygolaimidae Dorylaimidae Chrysonematidae Thornenematidae Nordiidae Qudsianematidae Aporcelaimidae Belondiridae Actinolaimidae Discolaimidae Leptonchidae Diphtherophoridae valor cp 3 3 3 3 4 3 3 3 4 4 4 4 5 4 5 5 4 4 5 5 5 5 4 3 Nota: *Bongers (1990). .

L.and non-cyst-forming nematodes’. (1983) A taxonomic review of the suborder Rhabditina (Nematoda Secernentia). Pirola. REFERENCIAS Anderson. M. Schoorl. P. J.3 Continúa cp2 Ecphyadophoridae Paratylenchidae Anguinidae cp3 Heteroderidae Hemicycliophoridae cp4 cp5 Nota: * modificado de Bongers (1990). Revisão Anual de Patologia de Plantas. vol. O. M. R.Tabla 5. T. pp. pp. Koninklijke Nederlandse Natuurhistorische Vereniging. Andrássy. (1994) De Nematoden van Nederland. in W. 3. 275–362. Marcell Dekker. vol. y Bongers. 14–19. 9. Oecologia. Nickle (ed) Manual of Agricultural Nematology. S. (1991) ‘Heteroderinae cyst. Bongers. y Huang. (1991) ‘Stunt nematodes: Tylenchorhynchus. New York. (1998) ‘Functional diversity of nematodes’. V. y Mundo-Ocampo. J. Applied Soil Ecology. 163–183. The Netherlands. Bongers. Pirola. vol. 83. W. CABI Publishing. 174 Manual de biología de suelos tropicales . J. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian amazon and savanna vegetation’. London. Cares. vol. P. Bibliotheekuitgave no. pp. Siqueiera and Brussaard. Nickle (ed) Manual of Agricultural Nematology. Bibliotheekuitgave no 46. J. Budapest. 2nd edition. Moreira. Bongers. Cares. R. Merlinius. 239–251. in W. M. 177–235. (1988) De Nematoden van Nederland. P. New York. The Netherlands. y Huang. no. Koninklijke Nederlandse Natuurhistorische Vereniging. Marcel Dekker. (2000) “Taxonomia atual de fitonematóides. 46. (1990) ‘The maturity index: An ecological measure of environmental disturbance based on nematode species composition’. pp. 10. Revisão Anual de Patologia de Plantas. Chave sistemática simplificada para gêneros Parte II”. Bongers. S. and related genera’. pp. G. 8. 529–586. J. T. in F. T. Baldwin. I. R. pp. (eds) (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. Cares. T. E. E. 185–223. Chave sistemática simplificada para gêneros Parte I”. y Huang. J. E. S. Eötvös Lorand University. pp. y Potter. (2001) “Taxonomia de fitonematóides. Schoorl.

New York. F. (1974) Revision in Leptonchoidea (Nematoda: Dorylaimida). O. vol. C. Siqueira and L. Maggenti. S. T. (1951) Soil and freshwater nematodes. W. R. P. Southey (ed) Laboratory Methods for Work with Plant and Soil Nematodes. E. Goseco. Nickle (ed) Manual of Agricultural Nematology. pp. C. Jenkins. M. and Ahmad. R. CAB International. J. 662–665. 669–720. D. V. 18. in J. F. R. Paratrichodorus. pp. Marcel Dekker. New York. 16. London. 587–626. pp. R. no 1. 795–826. R. A. Goodey. New York. in W. W. y Cares. Nickle (ed) Manual of Agricultural Nematology. S. J. Predaceous and Plant Parasitic Nematodes. and Monotrichodorus’. staining and mounting nematodes’. Hooper. Fisheries and Food. T. pp. Ltd. Wallingford. y Ferris. pp. Huang.. S. (1970) ‘Handling. Huang. New York. (1991) ‘The family Pratylenchidae Thorne. M. Purdue Nematode Collection Department of Entomology. E. Fortuner. pp. 341–342. Marcel Dekker. Jairajpuri. Methuen and Co. J. Journal of Nematology. Marcel Dekker. Bittencourt. R. pp. in W. fixing. P. 363–422. R. 4th edition. Bongers. (1994) Ecology: The Experimental Analysis of Distribution and Abundance. Moreira. C. M. Ferris. in W. vol. in F. Purdue University. Brussaard (eds) Soil biodiversity in Amazonian and other Brazilian ecosystems. Loof. in W. Longidoridae. (1984) ‘Preparing nematode permanent mounts with adhesive tapes’. CAB International. New York. Wallingford. Brill. Applied Soil Ecology. (1991) ‘Nemata: Higher classification’. W. (1964) ‘A rapid centrifugal flotation technique for separating nematodes from soil’. E. (1992) Dorylaimida: Free-living. and Trichodoridae: Their systematics and bionomics. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian Amazon and savanna vegetation’. J. (1991) ‘Stubby root and virus vector nematodes: Trichodorus. Nickle (ed) Manual of Agricultural Nematology. N ematodos del suelo 175 .. 48. Marcell Dekker. pp. (1991) ‘The Hoplolaimidae’. Nickle (ed) Manual of Agricultural Nematology. Geraert. y Goede. C. J. New York. 147–190. Technical Bulletin No 2. M. F. 1st edition. S. R. no 9. Nickle (ed) Manual of Agricultural Nematology. G. M. Harper Collins College Publishers. Allotrichodorus. y Silva. 163–183. Ferris. Plant Disease Reporter. R. Marcel Dekker. 34–39. Ministry of Agriculture. no 3. Leiden. (1991) ‘Tylenchidae in agricultural soils’. Krebs. in W. (2001) ‘A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept’. J. West Lafayette. R. E. Hunt. pp. G. (1993) Aphelenchida. Indiana. 1949’.Decraemer. D. A. vol. 13–29. pp.. H.

K. pp. pp. Yeates. 627–668. pp. Thorne. W. pp. vol. vol. (1988) Illustrated Key for Identification of Common Nematodes in Florida. F. H. A. leaf. Raski. and Dolichodorus spp. pp. D. D. 306–329. (1982) ‘Structure and size of soil animal populations’. Procter. S. Cornell University Press. T. D. Cambridge. 4. Smart Jr. (1988) Ecological Diversity and its Measurement. Seinhorst. biomass and contribution to energy flow by soil nematodes in terrestrial ecosystems’. J. (1991) ‘Tylenchulidae in agricultural soils’. (1993) ‘Feeding habits in soil nematode families and genera . 38. no. 67–69. in W. L. 34. y Nguyen. vol. (1961) Principles of Nematology. P. G. J. R.. Smart Jr. G. D. K. University of Florida.. 39.. (1991) ‘The Aphelenchina: Bud. pp. Cambridge University Press. (1991) ‘Sting and awl nematodes: Belonolaimus spp. G. Nickle (ed) Manual of Agricultural Nematology. C. 5th edition. Journal of Nematology. y Georgieva. H. New York. Lyon. New York. W. J. Freckman. y Loeffer. Gainesville. vol. H. C. W. R.. (1978) Ecology of Plant Parasitic Nematodes. 22. pp. McGraw Hill Co. D. B. G. C. and insect nematodes’. R. Norton. 97–101. New York Petersen. W.an outline for soil ecologists’. (1990) ‘Global overview of the functional roles of soil-living nematodes in terrestrial communities and ecosystem’. G. B. in W. de Goede. (1959) ‘A rapid method for the transfer of nematodes from fixative to anhydrous glycerin’. New York. R. 25. Mullin. B. C. G. pp. Journal of Nematology. W. 1.. New York.Magurran. W. Sohlenius. Yeates. M. Marcel Dekker. 761–794. John Wiley and Sons. K. 2.’. y Hooper. 315–331. no. Bongers. Marcel Dekker. Nickle (ed) Manual of Agricultural Nematology. S. May.. 465–508. New York. R. E. Nickle (ed) Manual of Agricultural Nematology. Nickle. and Nguyen. no. pp. 3. 176 Manual de biología de suelos tropicales . (1994) ‘Modification and quantification of the nematode maturity index’. (1996) Pictorial Key to Genera of Plant Parasitic Nematodes. 186–194. Pedobiologia. vol. G. Oikos. Oikos. (1980) ‘Abundance. 1–7. in W. Marcell Dekker. Nematologica. vol.

d) Transferencia del material tamizado a bolsas de nylon en campo. que contiene alcohol al 70%. b) Colecta de la hojarasca utilizando guantes de cuero.Ilustración 1. por un marco. e) Cada muestra de hojarasca tamizada se transfiere a una red. desde el borde hacia el centro. f y g) Se fijan las redes al interior de la trampa Winkler previamente colgadas en un espacio bien aireado con un frasco colocado en el fondo. Sistema de extracción de hormigas y escarabajos con trampas Winkler a) Delimitación de un metro cuadrado de hojarasca. c) Introducción de la hojarasca en un tamiz para separar los fragmentos más gruesos. i .

B) micófago. Fotomicrografías de la región anterior en las que se muestra el aparato bucal (flechas) de nematodos de suelo pertenecientes a diferentes grupos funcionales: A) parásito de plantas. A y B: Estoma con estilete C: Estoma sin estilete D: Diente dorsal E: Odonto estilete ii Manual de biología de suelos tropicales . D) depredador.Ilustración 2. E) omnívoro. C) bacteriófago. Fotos: Juvenil Cares.

2009.Ilustración 3. Moreira excepto e) de Lima et al. en gel de poliacrilamida. b) Plantas de Prosopis juliflora en agar inclinado con solución de nutrientes. a) Siratro en bolsa de plástico con solución de nutrientes Pheseolus vulgaris c) Pruebas en plantas de Pheseolus vulgaris para ver la eficiencia de aislamientos en Jarras de Leonard. tropici (CR crecimiento rápido) creciendo en YMA f) Perfiles de Rep-PCR de e) Perfiles de proteínas totales obtenidos por electroforesis diferentes cepas. cr CL CL d) Características de dos aislamientos de Bradyrhizobium (CL de crecimiento lento) y de R. I lustraciones a color iii . Pasos de la metodología para caracterizar a las bacterias fijadoras de nitrógeno y formadoras de nódulos en leguminosas (BFNFNL) aplicada en el proyecto CSMBGBD. Fotos: F. PAB vol 319..

iv Manual de biología de suelos tropicales . pared germinal 1 (gw1) y pared germinal 2 (gw2) con su capa más interna en reacción con el reactivo Melzer. Esporas y estructuras producidas por especies de HMA de la familia Acaulosporaceae: e) espora de Entrophospora colombiana mostrando la pared de la espora. obsérvese el escudo redondo de germinación de color café que contrasta con el color hialino de la espora. Fotos: Sidney Stümer. h) esporas de Acaulospora sp. Esporas y estructuras producidas por especies de hongos micorrizógenos arbusculares de la familia Gigasporaceae: a) espora de Gigaspora albida mostrando la célula suspensora bulbosa (flecha). g) espora de Acaulospora scrobiculata mostrando la cicatriz (flecha) que queda en la espora después de que se suelta el sáculo esporífero. c) detalle de la ornamentación de la pared de la espora (verrugas) de Scutellospora coralloidea.Ilustración 4. b) espora de Scutellospora scutata con la célula suspensora bulbosa (flecha). mostrando algunos sáculos esporíferos todavía fijados a la espora (flecha). típica de la familia. d) células auxiliares nudosas diferencias por miembros del género Scutellospora. f) espora de Entrophospora colombiana mostrando las dos cicatrices (flecha).

Esporas y estructuras producidas por especies de HMA de la familia Glomeraceae: a) Espora de Glomus clarum mostrando la hifa de sostén. L2 y L3). c) Esporocarpo de Glomus clavispora. brasilianum que fueron tomadas de http:// invam.edu. mostrando la pared de la hifa de sostén de manera continua con la pared de la espora. excepto de Paraglomus occultum y P. L2 y L3) (obsérvese que la capa L2 está ornamentada con pequeñas crestas). g) Espora de Paraglomus occultum mostrando la estructura de la pared de la espora formada por tres capas (L1. f) Detalle de Archaeospora Leptoticha mostrando salientes y depresiones en las capas 2 y 3 de la pared de la espora (flecha).Ilustración 5. d) Esporocarpo de Glomus sp. I lustraciones a color v . obsérvese que la capa más profunda de la pared de la espora se separa y se asemeja a la pared germinal. Esporas y estructuras producidas por especies de HMA de la familia Archaeosporaceae (e y f) y Paraglomeraceae (g y h): e) espora de Archaeospora Leptoticha con sáculo esporífero. h) Espora de Paraglomus brasilianum mostrando la estructura de la pared de la espora formada por tres capas (L1.caf. Fotos: Sidney Stümer.wvu. b) Espora de Glomus sp.

Aislamientos de hongos zoospóricos de muestras del ambiente (Oomycota y Chytridiomycota): a) muestra de suelo con cebo. c) cultivo puro en cebo. b) muestra de agua con cebo. d) esporangio de Phytophthora. vi Manual de biología de suelos tropicales . f) Pythium liberando zooesporas.Ilustración 6. e) Oogonio y anteridio de Pythium.

I lustraciones a color vii . e) partículas de suelo lavado. Técnica de lavado del suelo para el aislamiento de microhongos del suelo: a) Pre-lavado. h) colonias de hongos en medio de cultivo para retardar el crecimiento.Ilustración 7. b) tamices con diferentes mallas. f) medio de cultivo en placas. Fotos: Lucas M. c) suelo pre-lavado. g) placa con partículas de suelo para su incubación. d) continuando con el procedimiento de lavado. Abreu.

A C Banda costal Banda “s” Banda “s” D B E Cabeza Punta del oviducto Mesonoto Aculeo Mediotergio Abdomen Terminalia viii Manual de biología de suelos tropicales .Ilustración 8. D) Extracción del aculeo. A) Larvas y pupas de la mosca de la fruta en el suelo. E) Adulto de mosca de la fruta y detalle del aculeo. C) Patrones alares típicos con bandas. B) Trampa MacPhail con cebo.

la biodiversidad del suelo puede afectar el comportamiento de la formación de nódulos de manera positiva o negativa. La inoculación con cepas de BFNFNL altamente eficientes y adaptadas a las condiciones ambientales dominantes. un conocimiento de la diversidad de BFNFNL en el suelo deberá ser el primer paso para el manejo y la conservación de este recurso genético de tanto valor. considerando un área de 21 millones de hectáreas. donde se cosecharon cerca de 57 millones de toneladas de soya. provienen de una diversidad que se encuentra en el suelo. se ahorraron alrededor de US$ 3. Moreira LA IMPORTANCIA ECONÓMICA Y ECOLÓGICA DE LA SIMBIOSIS DE BACTERIAS FORMADORAS DE NÓDULOS EN LEGUMINOSAS (BFNFNL) La fijación biológica de nitrógeno es uno de los procesos más importantes para mantener la vida en el planeta. pues proporciona alrededor del 70% de todo el nitrógeno requerido en los ecosistemas naturales y agroecosistemas (Burns y Hardy. usadas para la inoculación. Las cepas.3 billones de gastos en fertilizantes mediante la aplicación de esta biotecnología. al mismo tiempo.Capítulo 6 Bacterias formadoras de nódulos en leguminosas Fátima M. debido a las múltiples interacciones que se dan entre organismos del suelo y plantas. 1975). 177 . se utiliza en algunos países con un pequeño y selecto grupo de leguminosas con el propósito de reemplazar el uso de fertilizantes químicos de nitrógeno. en el caso de la soya. En Brasil. En el año 2006. S. manteniendo así la armonía con el medio ambiente. la inoculación con cepas de Bradyrhizobium reemplaza completamente la aplicación de fertilizantes sintéticos. por lo tanto.

1998 Wang et al.. leguminosarum biovars phaseoli. giardinii biovars phaseoli. 2004 Rivas et al. trifolii. galegae R.1 Filum/Orden. 1993 Amarger et al. 1997 Amarger et al. el nombre ”rhizobia” ya no resulta idóneo para describir bacterias formadoras de nódulos. mongolense R. (Ulmaceae). Una extensión reciente de conocimientos acerca de las bacterias formadoras de nódulos en leguminosas fue el descubrimiento que estableció que las bacterias pertenecientes al β-proteobacteria (género Burkholderia y Ralstonia/Cupriavidus) y a otras familias de la α. 1984 Lindström. por esta razón. tropici R.TAXONOMÍA ACTUAL DE BFNFNL Las bacterias fijadoras de nitrógeno. 1998 Wang et al. 1989 Martinez-Romero et al.1).. 2002. 1991 Segovia et al.. 2001. 2001. Methylobacterium Methylobacteriaceae y Dovosia Hyphomicrobiaceae) también pueden formar nódulos en leguminosas (Moulin et al. gallicum R. El término rhizobia se deriva de Rhizobiaceae (Conn.. aunque se continúa usando en alguna literatura. Género. giardinii R. 2003) (Tabla 6. Familia. etli biovar mimosae 178 Manual de biología de suelos tropicales Frank. Chen et al. etli R. viceae R. Jordan. huautlense R. Especie de bacterias formadoras de nódulos en leguminosas. conocidas anteriormente como rizobios. 1879. 2001. Sy et al. Las citas referidas describen a las especies y/o comprueban su capacidad de nodulación. 1997 van Berkun et al. 1997 Chen et al. Filum/Orden. Tabla 6. hainanense R.Familia/Género/Especie α-Proteobacteria-Orden Rhizobiales Referencia Rhizobiaceae Rhizobium R. 1889. 1938). 1999a .. una taxa a nivel familia de bacterias creada expresamente para acomodar organismos que pueden formar nódulos en leguminosas. Jourand et al.proteobacteria (por ejemplo. forman nódulos en las raíces (y algunas veces en los tallos) de algunas especies de leguminosas y en las raíces de Parasponia spp.

2008 Peng et al. 1999 Nick et al. 2008 Ren et al. 2003 Quan et al. 1988. 1988 de Lajudie et al. 2002 Wang et al. 1994.Familia/ Género/Especie R. 2009 Hou et al. 2008 Berge et al. 2009 Tian et al. 1994 de Lajudie et al. 2007 Gu et al. 2002 Wei et al. tubonense Ensifer (Sinorhizobium) E.1 Continúa. 1996 Nick et al. 1984. daejeonense R. 2003 B acterias formadoras de nódulos en leguminosas 179 . fredii E. miluonense R. loessense R. pisi R. kostiense E. 2002 Toledo et al. oryzae R. xinjiangense E. Chen et al. yanglingense R. 1984. 2009 Li et al. tibeticum R. teranga E. 1926. alkalisoli R. 2005 Valverde et al. Chen et al. 2006 Hunter et al. lusitanum R. saheli E. morelense E. 1999 Wei et al. medicae E. vignae R. Young. Filum/Orden. kummerowiae E. 2008 Ramirez-Bahena et al. 2001 Squartini et al. 2002 Wei et al. 1988. indigoferae R. de Lajudie et al. 1994 Rome et al. mesosinicum R. alamii R. selenireducens R. 2008 Han et al. 1994 Chen et al. de Lajudie et al. 2009 Lin et al. arboris E. meliloti E. americanum Referencia Tan et al. fabae R. 2011 Zhang et al. sullae R. 2003 Scholla & Elkan. 2011 Dangeard. Jordan et al. multihospitium R.Tabla 6.

kummerowieae Bradyrhizobiaceae Bradyrhizobium B. Jarvis et al.Familia/Género/ Especie E. 2002. 1997 Chen et al. yuanmingense B. 1991. 2007 Rincon-Rosales et al. 1997 Manual de biología de suelos tropicales . (2010) de Lajudie et al. 2003 Lloret et al. 2002 Vinuesa et al. japonicum B. 2009 Merabet et al. numidicus Allorhizobium* A. 1992 Xu et al. iriomotense Bradyrhizobium (Blastobacter) B. 2008 van Berkun & Eardly.canariense B. 2006 Jordan et al. 2006** Dreyfus et al. 2009 Islam et al. 1995 Yao et al. 2009 Lin et al. Willems et al. liaoningense B. jicamae B.1 Continúa. 2001 Cummings et al. 1982. 2005a Ramírez-Bahena et al. 1982.adiobacter/ tumefasciens Shinella S. doebereinerae Phyllobacteriaceae Mesorhizobium M. 1988 Moreira et al. Filum/Orden. 1998a. 1984 Kuykendall et al. Jarvis et al. Jarvis et al. loti M. 2008 Jordan. 1984. adhaerens E. huakuii 180 Referencia Casida. caulinodans A. elkanii B. mexicanus E. garamanticus E. Young et al. Young. van Berkun et al. chiapanecum E. denitrificans** Xanthobacteraceae Azorhizobium A.Tabla 6. (Rhizobium) undicola Agrobacterium* A (Rhizobium). (2010) Merabet et al. 2003. pachyrhizi B. 2009 Ramírez-Bahena et al.

1997 Chen et al. 1998b Wang et al. lupini O. leguminum*** Methylobacteriaceae Methylobacterium M. 2007 Gu et al.Tabla 6. temperatum M. 2004 Gao et al. 2008 Han et al. australicum M. 2001 Gao et al. 2006 Mantelin et al. 1995. 1997 Nour et al. Filum/Orden.1 Continúa. albiziae M. 2009 Vidal et al. 2010 Valverde et al. 1999b Velásquez et al. septentrionale M. nodulans Brucellaceae Ochrobactrum O. Jarvis et al. opportunistum M. 2009 Chen et al. 2003 B acterias formadoras de nódulos en leguminosas 181 . 1997 De Lajudie et al. Jarvis et al. tarimense M. mediterraneum M.Familia/Género/ Especie M. 2004 Trujillo et al. 2007 Imran et al. Jourand et al. 1994. 2005 Zurdo-Pineiro et al. amorphae M. 2001. 2002. metallidurans M. 1995. trifolii P. 2006 Sy et al. plurifarium M. ciceri M. 2008 Han et al. ciceri Hyphomicrobiaceae Devosia D. 2004 Wang et al. 2005 Mantelin et al. 2008 Li et al. 2009 Nandasena et al. neptuniea Referencia Nour et al. tianshanense M. shangrilense M.alhagi Phyllobacterium P. gobiense M. cytisi O. 2010 Rivas et al. chacoense M. caraganae M. Jarvis et al. ifriqiyense*** P. 2009 Nandasena et al.

1999. 2008 Chen et al. 2002 Achouak et al. 2004) fueron propuestos para acomodar dichas especies de Ralstonia. Las leguminosas contienen alrededor de 20 mil especies.Tabla 6. 2002 Vandamme et al. 2001) y A. 2004) y más tarde del género Cupriavidus (Vandamme y Conye. 2007 Chen et al. Vermis et al.Familia/Género/ Especie D. 2010 Moulin et al. 2006 Chen et al. nodosa B. 2002 Vandamme et al. distribuidas en las subfamilias Caesalpinoideae (2250 spp. ** Estos autores no describieron estas especies.800 spp. El alcance de la simbiosis con BFNFNL entre leguminosas queda todavía sujeta a investigación. 2001 Vandamme et al.1 Continúa. larrimoorei (Young 2004) en Rhizobium. *** Fueron aislados de nódulos. phymatum B. pero descubrieron que pueden formar nódulos en leguminosas y la propusieron para que se incluyera en el género Bradyrhizobium. en su mayoría plantas tropicales leñosas). en su mayoría herbáceas) (Lewis et al. del trópico. Arubi y A. 2001. rhizogenes. (Ralstonia) taiwanensis ***** Referencia Bautista et al.. Filum/Orden. caribensis B. 2002.. adiobacter).. dolosa (B.cepacia genomovar VI) B.. mimosarum B. pero su capacidad de nodular no fue comprobada. A. Mimosoideae (3270 spp. vitis y (Young et al.. **** Estos autores no describieron el género. Vandamme et al. A. plantas leñosas. únicamente el 57% del género y el 20% de las espe182 Manual de biología de suelos tropicales . Hasta 1989. Vandamme & Conye 2004 Notas: * Se propuso incluir a las especies Agrobacterium como A. tumetaciens (syn. 2004 Chen et al. sabie Cupriavidus (Ralstonia) C. yakushimensis β-Proteobacteria Orden Burkholderiales Burkolderiaceae Burkholderia **** B. 2005). subtrópico y zona templada) y Papilionoidae (13. pero descubrieron que pueden formar nódulos en leguminosas ***** El género Wautersia (Vaneechoutte et al. tuberum B.

1995). en ecosistemas naturales (por ejemplo. Mimosoideae y Papilionoidae. aunque este método puede resultar difícil en el caso de hospederas perennes o leñosas (Moreira et al.cies habían sido examinadas por la formación de nódulos y los porcentajes de las especies que sí podían formar nódulos se encontraron en porcentajes de 23. es posible que nuevas simbiosis se identifiquen en el futuro.. los nódulos pueden muestrearse en plantas cultivadas en el campo (colecciones in situ). 1989). Aunque se han llevado a cabo búsquedas extensivas para nuevos géneros y especies formadoras de nódulos.. Odee et al. 2007). De esta manera. de leguminosas hospederas. y se esperan más revisiones en un futuro. para poder estimar la población de BFNFNL en el suelo. en selvas tropicales). tradicionalmente.... se requiere de un método que separe claramente BFNFNL de otras especies bacterianas y que permita un muestreo fácil y sistemático de los nódulos.. Faria et al.. por ejemplo. y que han sido desarrolladas nuevas técnicas de genética molecular. 1992). puede proveer información sobre la composición taxonómica de poblaciones de BFNFNL y determinar el grado de especificidad entre cepas específicas y candidatos hospederos. la taxonomía del BFNFNL estaba basada en cepas aisladas de cultivos de zonas templadas. 2006) EVALUACIÓN DE DIVERSIDAD DE BFNFNL EN EL SUELO Los estudios sobre poblaciones y diversidad de BFNFNL dependen de un aislamiento exitoso de nódulos de raíces y ocasionalmente de tallos. Aunque algunas plantas hospederas se consideran muy promiscuas. Bradyrhizobium betae (Rivas et al. Moreira et al. 2004) y Mesorhizobium thiogangeticum (Ghosh et al. ha ocurrido una revolución en la taxonomía con 90 especies y 10 géneros adicionadas a las 4 especies y a los 2 géneros originales enlistados por Jordan. Sin embargo. 1992. 1982. Tres especies de los géneros descritos de BFNFNL no fueron incluidas en la tabla porque no fueron aisladas de nódulos ni la capacidad de nodulación se comprobó hasta el momento: Rhizobium cellulosilyticum (García-Fraile et al. en 1984 (véase Tabla 6.. Para poder aislar o enumerar BFNFNL en una población microbiana diversa. El cultivo posterior y caracterización de BFNFNL y de los nódulos. como la que surge en el suelo. 1989. El proceso de infección de la planta es el resultado de la formación de nódulos en sí. muestran una B acterias formadoras de nódulos en leguminosas 183 . se estima que hoy en día.1). especialmente en Brasil (Magalhães et al.. únicamente el 25% de las especies existentes han sido examinadas. 90 y 97% entre Caesalpinoideae. ahora que se encuentran disponibles las que han sido aisladas de otras especies y regiones. respectivamente (Faria et al.

1993. entre otras (Moreira et al. de crecimiento lento. se reporta que suele estar nodulado por la especie Bradyrhizobium (Woomer et al. en la mayoría de los casos. El bioensayo para BFNFNL puede hacer uso de hospederos promiscuos. Lima et al. de manera natural. La nitrogenasa es la enzima responsable de la reducción del gas nitrógeno a amoniaco. representa una comprobación útil de la exactitud del procedimiento en el laboratorio. debería incluirse una especie leguminosa nativa como trampa hospedera. acetileno a etileno (Dilworth.. 2000. Para poder evaluar la diversidad de BFNFNL en el suelo. Aunque algunas de las asociaciones mencionadas pueden ser relativamente específicas.. Antes de escoger las plantas hospederas para realizar un bioensayo. con los que se muestrea con el bioensayo. Las especies encontradas posteriormente deberían compararse con las especies que forman nódulos en el lugar.baja especificidad. Por lo anterior. Moreira.. más variedad resultará de cepas de BFNFNL. de hecho. 1987 demostraron que Vigna unguiculata. De manera similar. 1970). 184 Manual de biología de suelos tropicales ... no existe ninguna cepa de BFNFNL que sea lo suficientemente promiscua como para nodular a todas las especies leguminosas. de rápido crecimiento. tiene una especificidad muy baja y puede ser nodulada por Rhizobium spp. Lewin et al.. aisladas e identificadas. cultivados en muestras de suelo tomadas del campo o inoculadas con suspensiones del suelo (Moreira et al.. pero. la comparación de BFNFNL. se recomienda llevar a cabo experimentos preliminares para cada tipo de suelo. 2009). normalmente considerada como hospedero de Badyrhizobium. 2002. en Kenia. Pereira. es deseable hacer uso de una variedad de especies de plantas hospederas candidatas y cuantas más sean empleadas. 2007) y Burkholderia. atropurpureum fue nodulado. aisladas de nódulos formados de manera natural. únicamente. Resultados preliminares de Taita. ningún hospedero promiscuo puede ser nodulado por todas las especies o cepas existentes de BFNFNL y. de manera contraria. 1997. Odee et al. También reduce. atropurpureum y que el frijol Phaseolus vulgaris. por Bradyrhizobium spp.. y. 2009). también cabe la posibilidad de que sea nodulado por especies de rápido crecimiento como Rhizobium (Pereira. 2006 y 2008. en la mayoría de los casos. siratro (Macroptilium atropurpureum) atrapa BFNFNL en los 98 puntos de muestreo del proyecto CSM-BGBD (Lima et al. por ejemplo: Macroptilium atropurpureum es uno de los hospederos ampliamente conocido (Vicent. entre otros sustratos.. donde sea posible. punto de referencia CSM-BGBD. Lima. Resultados obtenidos en Brasil (Alto río Solimões) muestran que caupí (Vigna unguiculata) captura más especies que M. 2000). 1966. 1988a). indican que M.

. es barato y fácil de realizar aun en condiciones de campo. aplicados en el proyecto CSM-BGBD. resulta muy útil para la detección simple de fijadores de nitrógeno. el uso de especies múltiples no es viable con un gran número de puntos de referencia (por ejemplo 100). Es por ello que se emplea una única especie promiscua como trampa. La actividad de la nitrogenasa constituye una información invaluable porque en muchos casos es imposible verificar que los nódulos aún son efectivos y viables (color interior rojo). el personal que no posee la suficiente experiencia podrá confundirlos con estructuras no inducidas por BFNFNL. con esto se B acterias formadoras de nódulos en leguminosas 185 . Cuando se llevan a cabo varios experimentos. ya que posee pequeñas semillas y resulta fácil de manipular bajo condiciones controladas en bolsas de plástico y jarras de Leonard. METODOLOGÍA APLICADA EN EL PROYECTO CSM-BGBD: UNA REVISIÓN GENERAL Los pasos utilizados en la metodología para la caracterización de BFNFNL. la gran ventaja de un ensayo de reducción de acetileno (ERA). es que destaca por su gran sensibilidad y velocidad. sin embargo. se encuentran resumidos en la Figura 6. 1992). deben utilizarse semillas de la misma procedencia. cuyos seis pasos a seguir se muestran en la ilustración 3a hasta la 3f. 1966). tal y como se describe a continuación. Los nódulos sin actividad de la nitrogenasa pueden estar senescentes o ser inefectivos. Bajo estas circunstancias. dado lo afanoso del procedimiento.Schollhorn Burris. puesto que deben quedarse intactos para su aislamiento posterior o secarse cuando requieran ser almacenados durante un largo periodo. resulta idóneo Macroptilium atropurpureum (siratro). Paso 2A: para el proyecto se utiliza el método convencional de uso de especies promiscuas. como trampas para aislar las BFNFNL de las muestras del suelo. 1987. dado que la anatomía de los nódulos varía ampliamente en forma y en tamaño.1. Aunque el uso de ERA para obtener estimaciones cuantitativas de fijación de nitrógeno a la nutrición de la planta ha sido ampliamente discutido (Boddey. Esta reacción se utiliza como técnica para medir la actividad de la nitrogenasa. Giller. con una solución nutritiva. y estará limitado por el tiempo disponible y las facilidades que ofrezca el laboratorio. Una descripción previa fue hecha por Moreira en 2004. dentro de cámaras de crecimiento o invernadero. Paso 1A: recoger muestras de suelo del campo. Por ejemplo. 1987). El ensayo también puede usarse para confirmar una nueva simbiosis de BFNFNL o en el caso de nódulos no usuales (Moreira et al.

tales como dnaK. peso de materia seca y peso seco de planta (contenido N). (Ilustración 3. 6. a). agar inclinado (Ilustración 3. en caso necesario. Aislamiento de NLB de nódulos ** en YMA/79 con azul de bromotimol (Ilustración 3. peso seco de materia aérea de planta. 2A. Jarra de Leonard. Ensayo de reducción con acetileno (opcional) 3 B. 1A. 3A. más un control de una cepa conocida. Nota: 1A. otros genes. Siratro* 2. Doce muestras en cada punto de muestreo (véase esquema global CSM-BDBG. cuando se aprecian diferencias significativas entre tratamientos 4.55% 1. ** Algunos nódulos pueden guardarse en gel de sílice para su aislamiento. Caracterización de aislados verificados. tamizar según características de cultivo y REP-PCR o perfiles de proteína (Ilustración 3. La eficiencia de poblaciones nativas es evaluada con la floración. índices de diversidad. eficiente. f (ii). resumida en seis pasos. d) caracterización de cultivo 3 A. Bioensayos con aislados: verificación (postulados de Koch) y propiedades simbióticas (número de nódulos y peso seco de materia). representativos de grupos previos. Especies nativas (opcional) Bolsas de plástico (Ilustración 3. Caracterización de cultivos (son necesarios los experimentos preliminares con suelo de selvas y cultivos de leguminosas para determinar el número de aislamientos requeridos para caracterizar las comunidades de simbiontes en su conjunto. * Puede usarse para conteo NMP (opcional). c) 2 B. dos controles sin inoculación (con o sin mineral N). b). Origen del hospedero. utilizando la técnica de infección de planta. basados en una 186 Manual de biología de suelos tropicales . Eficiencia de poblaciones nativas: número de nódulos. capturadas con suspensiones de suelo 1:1. 2A. fijadoras de nitrógeno en diversos sistemas de uso de suelo. secuencia del gen (16S rRNA para todos los géneros. capturando BFN: técnica de infección de planta: inoculación de especies promiscuas. colectadas bajo condiciones asépticas Área de referencia /Uso del suelo/ Puntos de muestreo 1B. con la muestra de suelo. Dos controles sin inoculación (con o sin mineral N) más un control con un tipo eficiente (Ilustración 3. Frijol (opcional) 4. solución de nutriente de suelo o NaCl a 0. especialmente para Bradyrhizobium). Claves de identificación de plantas. Nódulos de especies de plantas locales 5. Almacenaje en frascos con gel de sílice o CaCl2 4.1 Evaluación de bacterias formadoras de nódulos en leguminosas. 2e) 1C. Caupí (opcional) 3. Capítulo 2).Figura 6. Captura de BFN. 12 muestras compuestas de suelo por punto. contenido de N por planta (opcional).

Las dos especies fueron escogidas por ser bastante promiscuas y porque se cultivan en muchos países. Se selecciona Phaseolus vulgaris con base en que en varios países existen datos. Bradyrhizobium. pueden cultivarse especiestrampas en bolsas de plástico. Representantes de racimos. aunque también se puede aplicar a otros géneros). deberán corregirse para los ensayos. ni forma parte de la metodología estándar. acidez y un alto contenido de Al. basados en características de cultivo (si este es el caso) y/u otro método deben ser secuenciados para 16SrRNA y otros genes como dnaK (por ejemplo. incluso puede indi- curva de extinción de especies). Las semillas que se encuentren disponibles en la localidad proveerán información útil para agricultores del lugar. Paso 3 A: aunque la eficiencia bajo condiciones controladas no refleja lo que está pasando in situ. El criterio para la selección debe basarse en que la especie-trampa sea ecológica y económicamente relevante para el país. Cuando un equipo puede manejar más de una trampa de especies. Para poder capturar BFNFNL. debido a diferentes relaciones simbióticas (diferentes especies de plantas) y condiciones ambientales. esto puede servir como un punto de referencia. incluyendo algunas especies nativas que. aún dispersos. pueden ser diferentes en cada país. Los suelos con un alto contenido de N deberán evitarse. jarras de Leonard o en macetas que contengan las muestras de suelo. es fácil de medir y proporciona información útil sobre la variabilidad y eficiencia de las poblaciones nativas. las cuales se describen a continuación. caupí y frijol) se pueden seleccionar otras. por supuesto. aunque sería imposible estandarizar esta selección. Incluye características de cultivos obtenidos en el paso número 4. Dada la complejidad del primer ejercicio. otros factores limitantes como deficiencias de macro y micronutrientes. B acterias formadoras de nódulos en leguminosas 187 . para trampas promiscuas adicionales se recomienda usar Vigna unguiculata (como segunda especie) y Phaseolus vulgaris (frijol) como tercera especie. Las muestras de suelo en macetas pueden usarse únicamente cuando haya disponibilidad en los laboratorios y se deben seguir todas las técnicas asépticas normales de la microbiología. éste no es obligatorio. Después de las tres especies mencionadas (siratro. Las especies-trampas pueden usarse para capturar y contar BFNFNL o simplemente para capturarlas. en el tamizado de la colección entera de aislamientos (para conseguir racimos) y elementos repetitivos extragénicos palindrómicos/secuencias de DNA (REP-PCR) (u otros métodos como perfiles de proteínas por electroforesis con SDS-PAFE/poliacrilamida gel puede ser complementario). sobre poblaciones de BFNFNL donde se utiliza el frijol común como especie-trampa.evita cualquier variación de NFNLB debida a las plantas.

Los nódulos se almacenan en sílica gel (Figura 6. 2001). en los diferentes sistemas de uso de suelo. se necesitarán más aislamientos para obtener una buena resolución. pertenecientes a los diferentes sistemas de uso de suelo en cuestión. las BFNFNL deben ser aisladas. Se necesitará aplicar las curvas de muestreo a todos los aislados. En la literatura se ha discutido que. por ejemplo. los aislados de estos nódulos. 3B: se recomienda también que las BFNFNL sean aisladas de especies leguminosas (nativas e introducidas) que nodulan naturalmente. por lo menos. 188 Manual de biología de suelos tropicales . Paso 4: después de la aparición y crecimiento de nódulos. en caso de no alcanzarlo. 2001). Paso 1C: las especies de leguminosas en un área específica. para una especie hospedera en particular.car la existencia de cepas eficientes en las poblaciones del suelo.2). deben ser inventariadas para que las relaciones con poblaciones naturales de BFNFNL puedan determinarse. junto con los de nódulos recogidos de plantas nativas que naturalmente forman nódulos. de ocho metros de radio alrededor de cada punto de muestreo. Paso 1B/2B. de esta forma estarán disponibles para futuros aislamientos. proporcionarán los datos de la diversidad. y quizá más de 100 por uso del suelo (Jesús et al. 2005). esto indica que no se han detectado todas las especies y que muestras adicionales (aisladas de nódulos) deberán ser analizadas. Una comparación de BFNFNL aisladas de nódulos del campo y de nódulos introducidos en una especie-trampa. y los de plantas. Este número se encuentra en el punto (asíntota) donde la curva alcanza su mayor nivel.. Considerando que estas curvas se obtienen con base en el número de diferentes cultivos que todavía pueden mostrar características genéticas variables. lo que permite la construcción de curvas de muestreo para evaluar si la diversidad en un lugar ya ha sido completamente caracterizada. Las curvas de muestreo (acumulación o escasez) pueden revelar el número de aislados requeridos para evaluar correctamente la diversidad. formados en el campo. es decir. con una inoculación de suspensiones de suelo. tal y como se explicó anteriormente. Cuando se usa la técnica de infección por planta. cultivadas en una serie de diluciones de suelo. los nódulos deberán muestrearse a partir de plantas que nodulen y representen niveles secuenciales de diluciones (Moreira y Pereira. Se sabe que la diversidad genética en poblaciones naturales de las NFNLB del mismo lugar puede presentar diferencias entre los aislados de nódulos.. en condiciones de laboratorio (Bala et al.. 2001) porque los tipos de BFNFNL capturadas pueden variar también con la dilución (Bala et al. a los del bioensayo y a los nódulos colectados en campo. hará posible la mejor evaluación de diversidad y de eficiencia de la especie-trampa. se necesitan entre 30 y 50 nódulos.

El aislamiento de BFNFNL de nódulos deberá hacerse en el medio 79 con azul de bromotimol (Fred y Waksman, 1928). El medio 79 se conoce también como YMA (Vincent, 1970) (anexo 6.1); esto permite la caracterización completa del cultivo (tasa de crecimiento, cambio de pH, producción de exo-polisacáridos, morfología de colonia, color, tamaño, etc.). Para obtener grupos a partir de estas características de cultivo. La diversidad genética de poblaciones de BFNFNL puede evaluarse al agrupar los perfiles que resultan de rep-PCR, utilizando un software como Gelcompar (Brujin et al., 1997) o mediante el uso de otra técnica: perfiles de proteínas por electroforesis con gel de SDS-Poliacrilamida; que dan una buena resolución a nivel cepa (Paso 6); sin embargo, esto puede ser opcional, de acuerdo con los recursos disponibles en cada país y debe llevarse a cabo después del paso 5 para evitar perder el tiempo con contaminantes. Finalmente, los representantes de cultivos de los clados generados mediante el agrupamiento por Rep-PCR u obtenidos mediante otros métodos se secuenciarán para obtener el gen 16SrRNA (Paso 6). Cuando existen recursos suficientes, dnaK u otros genes involucrados en el mantenimiento de la bacteria, tales como atpD, rpoB, recA, glnII (Parker, 2004; Vinuesa et al., 2005b; Gaunt et al., 2001), pueden ser probados para algunas cepas de género que no hayan sido bien discriminadas por 16 SrRNA, como en el caso de Bradyrhizobium.
Figura 6.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. Fuente: Moreira y Pereira, 2001.
1 ml de C2H2 Muestra de gas Tapón de goma (a) Vial (10 ml) 30 minutos a 1 hora Tapón de goma Tubo al vacío

Nódulo Nódulo efectivo Nase C2H2+2H++2e 2C2H4 Tubo de ensayo 8.5 ml (b)

Tapón de rosca Tapón de rosca, nódulo, algodón y sílica gel o CaCl2

B acterias

formadoras de nódulos en leguminosas

189

REQUERIMIENTO DE MATERIALES PARA TRABAJO DE CAMPO Y LABORATORIO Trabajo de campo: para muestrear suelo: alcohol al 95%, agua para eliminar el suelo del equipo de muestreo antes de la esterilización con alcohol, caja refrigeradora, bolsas de plástico esterilizadas (300 ml), espátula, bolsas grandes de plástico (5 l) y un pequeño sacabocados. Para muestrear nódulos: tijera pequeña, cuchara, azada y azadón, pinzas, pala, tubos de tapón de rosca, sílica gel o CaCl2 anhidro. Para resguardo de plantas: alcohol, prensa y periódico. Trabajo de laboratorio para aislar y enumerar BFNFNL: pipetas de 1 ml y 5 ml, solución para dilución, matraces Erlenmeyer de 1 L y 125 ml, agitador orbital, bolsas esterilizadas de plástico (125 ml) para crecimiento, tubos de ensayo (150 x 20 ml ó 200 x 30 mm), o botellas de cerveza recicladas, rejillas para bolsas de crecimiento o tubos, solución de nutrientes, semillas de plantas leguminosas hospederas promiscuas o nativas, temperatura ambiente controlada de luz y humedad. Trabajo de laboratorio para aislamiento de BFNFNL y caracterización de cultivos: cajas Petri, alcohol al 95%, HgCl2 al 0.1% (acidificado con HCl concentrado a 5ml/L) (Hipoclorito de Na o Ca; puede usarse H2O2 para sustituir al HgCl2), agua esterilizada, pinzas, medio de cultivo que contiene levaduras, manitol y sales minerales (hipoclorito de sodio o calcio, o H2O2 (pueden sustituir al HgCl2), agua esterilizada, pinzas, medio de agar con sales, levadura-manitol-mineral, pH6.8. Para la actividad de nitrogenasa mediante reducción de acetileno: matraces Kitasato Erlenmeyer, globo de hule, jeringas de 1 ml a prueba de gas, tubos de vacío de 5 ml, frascos de 10 ml o de mayor capacidad con tapones de goma, carburo de calcio CaC2, cromatógrafo de gases equipado con un detector de ionización de flama (FID) y columna RN Poropak para determinaciones de acetileno/etileno. Nota: los ensayos de nitrogenasa pueden llevarse a cabo en campo. MÉTODOS DETALLADOS Muestreo del suelo. Se saca una muestra de suelo a una profundidad de 20 cm, en 12 puntos, distribuidos alrededor de cada parcela de muestreo (véase Capítulo 2, Figura 2.3). Se utiliza el mismo esquema de extracción del núcleo para el muestreo en todos los grupos microbianos, incluyendo el BFNFNL. Se junta cada juego de 12 muestras, para formar una muestra compuesta de alrededor de 300 g que, posteriormente, se introduce en una bolsa plástica esterilizada. De manera alter190
Manual de biología de suelos tropicales

nativa, cuando lo permitan los recursos, se pueden obtener tres o más muestras compuestas en cada punto. Todas las herramientas: sacabocados, espátulas, azadón, etc. deberán lavarse muy bien con agua para remover partículas de suelo y ser esterilizadas mediante alcohol y flama antes y después de cada muestreo, con el fin de evitar la introducción de BFNFNL exóticas. Se deben minimizar las pisadas cerca de los puntos de extracción y la hojarasca deberá ser removida justo antes de que se lleve a cabo el muestreo. Las muestras de suelo se trasladan al laboratorio lo antes posible, utilizando un envase con aislamiento (preferiblemente debe permanecer a 4° C). Una segunda muestra compuesta de alrededor de 200 g será recogida en una bolsa de plástico no estéril para su análisis físico-químico. Muestreo de nódulos. Se deberán identificar plantas leguminosas dentro de un radio de 8 m (lo mismo que para un inventario de vegetación) en el punto de muestreo y se recogerá el material vegetal resultante. Será de gran ayuda contar con información previa acerca de cuáles son las especies que pueden nodular, de manera que se confine el muestreo a estas especies en concreto; sin embargo, hay que aclarar que existe un enorme potencial para el descubrimiento de nuevas especies de leguminosas de este tipo. En el caso de plantas herbáceas, se puede extraer todo el sistema de raíces del suelo, utilizando una azada, un azadón o una pala, cuidando no romper nódulos de manera accidental. Los nódulos de plantas leñosas deberán descubrirse extrayendo las raíces y poniendo gran atención para no dañar las ramificaciones delgadas en donde éstos normalmente se encuentran. Se debe verificar, con extremo cuidado, que las raíces delgadas pertenezcan a la planta leguminosa identificada; por este motivo, se recomienda empezar la excavación junto al tallo; se extirpan los nódulos (dejando un pedazo de raíz para facilitar la manipulación) y se guardan en tubos de tapón de rosca con un desecador (Figura 6.2b). Antes del almacenaje, las partículas de suelo deberán removerse, bien por sacudido o bien mediante lavado, retirando el exceso de agua con una servilleta. Por lo menos se recogerán 50 nódulos por cada punto de muestreo y la muestra será representativa de todas las especies nodulantes existentes en la parcela de muestreo. En ocasiones, algunos nódulos pueden ser demasiado grandes para los tubos normales de rosca: deberán ser almacenados en un recipiente de mayor capacidad. Actividad nitrogenasa. La actividad de nitrogenasa puede medirse en el campo o a partir de cada nódulo, justo después del muestreo o en el laboratorio (Figura 6.2). Se introduce el nódulo en un frasco de tapa de goma de 10 ml o de mayor capacidad, en caso necesario. Se produce acetileno en un matraz Kitasato Erlenmeyer
B acterias
formadoras de nódulos en leguminosas

191

por la reacción de CaC2 con agua (Figura 6.3). Si se lleva a cabo el trabajo en laboratorio, se obtiene acetileno de cilindros de gas comerciales. Se inyecta 1 ml de este gas en el frasco que contiene el nódulo. Después de una hora aproximadamente, se remueve 1 ml de gas de la superficie y se transfiere a un tubo al vacío para su posterior análisis de etileno por cromatografía de gases (Figura 6.2a). Especímenes de resguardos de plantas. Los especímenes de resguardos de plantas nodulantes, deberán recogerse en el área que se encuentra alrededor del punto de muestreo (radio de 8 m). Se debe poner especial atención en el etiquetado (véase a continuación) y si es posible, incluya flores y frutas. Enseguida, los especímenes se mandan al herbario para su identificación junto con una tarjeta de identificación de las mismas: Proyecto: CSM-BGBD Colector: Fátima Moreira Fecha: 2 de abril de 2005 Localidad: Benjamin Constant Altitud: 500 m Nombre vulgar de la especie: faveira Nombre científico de la especie: ¿? Número de vale: 05 Características del nódulo: crecimiento medio, tamaño 0.5 a 1.5 cm Descripción del lugar: pastizales abiertos con ganado y troncos de madera Tipo de suelo: limo arenoso
Figura 6.3 Producción de acetileno en campo o laboratorio.
Agua Globo de hule CaH2

Tubo de goma

CaC2

CaC2 + H2O ⇒ C2H2 + Ca (OH)2 Sólido Gas Sólido

192

Manual de biología de suelos tropicales

Características de la planta: herbácea con frutos maduros Otros comentarios: se recogieron semillas; flores amarillas. El conteo de BFNFNL. Se someten muestras de suelo a una serie de diluciones antes de la inoculación de las plantas hospederas candidatas (Figura 6.4). La correlación de diluciones varía entre 2.0 (1:2) y 14.5 (1:14.5), según la concentración de células esperada en la muestra. Esto significa una mayor dilución para suelos con más BFNFNL; sin embargo, aún es necesario inocular plantas hospederas en todas sus diluciones (véase a continuación). Asimismo, en cada dilución se debe emplear una réplica del bioensayo (2 a 5 veces). Las plantas se cultivan en condiciones controladas (Vicent, 1970) y después de 15 días, se les examina para ver si han formado nódulos. Las poblaciones de BFNFNL se estiman por el método del Número más Probable (Cochran 1950; Woomer et al., 1988b, 1999). En el caso de inocular las plantas únicamente para capturar las BFNFNL, las muestras de suelo deberán resuspenderse en agua esterilizada o en una solución de nutrientes (la misma que se utiliza para un medio de cultivo o crecimiento de plantas) (véase anexo 6.1 y 6.2) en una correspondencia 1:1. Las plantas pueden cultivarse en bolsas de plástico, jarras de Leonard u otro tipo de frasco. Se deben utilizar tres tipos de controles sin inoculante de suelo: el primero comprueba la presencia de contaminación durante los procedimientos experimentales. Si no se mantienen de manera correcta las condiciones axénicas, este control resultará en nódulos y el experimento se invalidará (aún cuando nódulos ocurren en una sola réplica). Se recomienda que el número de réplicas dentro de este control sea mayor que las réplicas de tratamientos de inoculación y el control debe localizarse dentro de diferentes posiciones en el protocolo. Los otros dos controles permitirán comprobar la eficiencia de las comunidades de BFN. Las comunidades que nodulan la planta hospedera indican si las condiciones del experimento (temperatura, concentraciones de nutrientes) son adecuadas para que se lleven a cabo la nodulación y la fijación de nitrógeno en las plantas y su crecimiento. El primero de los controles se complementa con nitrógeno mineral (para jarras de Leonard, 70 mg N-NH4NO3) cada semana desde la tercera hasta la penúltima, pero no se inocula. Para bolsas de plástico o recipientes de pequeños volúmenes, se utiliza una sola aplicación de 70 mg N-NH4NO3). De esta manera el caupí, que alcanza su nivel de floración en dos meses, con el uso de jarras de Leonard recibirán un total de 350 mg N-NH4NO3, mientras que los frijoles con un periodo de crecimiento de mes y medio, en jarras de Leonard, recibirán 280 mg de N-NH4NO3. El otro control se inoculará con un inoculante recomendado para esta
B acterias
formadoras de nódulos en leguminosas

193

especie de planta; por ejemplo, CIAT 899 para Phaseolus vulgaris en Brasil, pero no se añade nitrógeno. Aislamiento y caracterización de BFNFNL. Las BFNFNL son aisladas de los nódulos recogidos en campo y por bioensayo en el laboratorio. En el último caso, los nódulos obtenidos en cada dilución sucesiva pueden indicar cuáles son las cepas menos frecuentes en la muestra de suelo y cuáles, las más comunes. El primer paso será esterilizar la superficie de los nódulos con una breve inmersión en 95% de alcohol, seguida de una inmersión más larga de tres a cuatro minutos en HgCl2 (hipoclorito de Na o Ca, o H2O2 pueden usarse como sustitutos) y lavado mediante varios enjuagues con agua estéril (Vicent, 1970). A continuación se aplasta el nódulo dentro de unas gotas de agua estéril, utilizando pinzas y esto se vierte sobre un medio de agar. En el caso de los nódulos disecados, éstos deben remojarse en una solución de agua esterilizada para mejorar la absorción de la solución desinfectante. Los tiempos de inmersión en HgCl2 u otros desinfectantes, deberían ajustarse al tamaño del nódulo (más corto para nódulos pequeños). En la composición del medio de agar: levadura-manitol-sales minerales (Fred y Waksman, 1928) (Anexo 6.1), especialmente el pH y la fuente de carbohidrato pueden variarse, tomando en cuenta las condiciones específicas del suelo (Date y Halliday, 1979; Souza et al., 1984; Elkan y Bunn, 1991). Puede incluirse azul de bromotimol como indicador porque los cambios en el pH, causados por la formación de BFNFNL, pueden resultar útiles en la identificación de género. Otros caracteres incluyen: la tasa de crecimiento (tiempo TAIC de aparición de colonias aisladas), la cantidad de polisacáridos celulares, forma y tamaño de colonia, diámetro y color según lo descrito por Moreira et al. (1993) y Jesús et al. (2005). Los principales descriptores de cada género son: Allorhizobium, Rhizobium y Sinorhizobium: colonias circulares, de 2 a 4 mm de diámetro, normalmente unidas debido a la copiosa producción de polisacáridos extracelulares, convexas, semitraslúcidas, elevadas y mucilaginosas, la mayoría con el centro de color amarillo (debido al indicador de pH), de crecimiento rápido (TAIC: de 2 a 3 días). Mesorhizobium: igual que Rhizobium, pero normalmente de crecimiento más lento (TAIC: de 4 a 5 días). Bradyhizobium: colonias circulares que no exceden de un milímetro de diámetro, producción extracelular de polisacáridos de abundante a escasa (esto último, generalmente en el caso de los tipos que toman más de diez días para su crecimiento), opacas, raramente traslúcidas, blancas y convexas, granulares en textura y que producen un cambio de pH a alcalino, de crecimiento lento o muy lento (TAIC: de 6 a más días).
194
Manual de biología de suelos tropicales

Figura 6.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.

Paso de dilución

Nivel de dilución

El porcentaje base de la dilución (Nd) puede variar de 1:2 hasta 1:14.5 y el numero de replicas por dilución (N) de 2 a 5. Fuente: adaptado de Woomer, 1993 y Vincent, 1970 por Moreira y Pereira, 2001.
B acterias
formadoras de nódulos en leguminosas

195

contienen gránulos refráctiles de poly-β-hidroxibutirato en microscopio de contraste de fases. 1988). patrones totales de proteína por SDS-PAGE (Dreyfus et al.1 se pueden observar referencias que ofrecen amplios detalles de las características de especies de NFNLB. 1989). hibridación DNA:DNA. (1991) aportaron estándares mínimos para la descripción de nuevos géneros y especies. de acuerdo con los postulados de Koch. de color cremoso. Graham et al. hibridación rRNA-DNA y polimorfismos en los tamaños de fragmentos de restricción del DNA. lo que mejora no sólo la clasificación bacteriana. será necesario definir el nivel apropiado de diversidad que permita caracterizar géneros y especies específicos. Cupriavidus: similar a Azorhizobium. composición de bases de DNA (%C + G). Las cepas aisladas deben reconfirmarse como BFNFNL. bajo condiciones bacteriológicas controladas. generalmente. por ejemplo Rhizobium. Recientemente. en sus características simbióticas. La diversidad de cepas.. a veces. de 0.. 1988). Burkholderia: con características de crecimiento muy similares a las de crecimiento rápido.Azorhizobium: colonias circulares. Moreira et al. donde incluyeron serología (Dudman y Belbin. también conocidas como huellas 196 Manual de biología de suelos tropicales . resistencia intrínseca a los antibióticos (RIA) (Kingsley y Bohlool. perfiles de plásmidos (Giller et al. muy poca producción extracelular de polisacáridos (mucho menos que en el caso de Bradyhizobium). dentro de la especie puede ser genéticamente y fenotípicamente alta. lo que puede ser muy útil para numerosos estudios. 1996).. 1993).. 1988. 1988). crecimiento en diferentes fuentes de carbono (Dreyfus et al. En la Tabla 6.. sino también la capacidad de discriminación dentro de diferentes taxas: cada una tiene un nivel específico de resolución para la clasificación bacteriana. por lo tanto.. 1983). mediante una demostración en la que formen nuevos nódulos en una planta hospedera de prueba.5 mm de diámetro. producen un cambio de pH a alcalino. lipopolisacáridos celulares (De Maagd et al. con la excepción de modificación de pH porque pueden producir una reacción ácida o alcalina (dependiendo de la edad). con un poco más de producción extracelular de polisacáridos. Las BFNFNL son bastoncillos Gram negativos que no forman esporas y que. Estas técnicas. se han descrito nuevas técnicas para la caracterización de los procariotes. secuencia de la subunidad pequeña del RNA ribosomal (Young y Haukka. por ejemplo.. al mismo tiempo. morfológicas y fisiológicas. 1986). electroforesis de enzimas metabólicas (Selander et al. de crecimiento rápido a medio (TAIC: de 3 a 4 días).

Los análisis numéricos con un número adecuado de cepas y la comparación con las cepas de BFNFNL permiten la caracterización de grandes poblaciones. la secuenciación de genes específicos puede aplicarse directamente a un número de cepas determinado por las curvas de rarefacción o acumulación. Alternativamente. Los costos de la secuenciación de DNA se han reducido notablemente durante los últimos años y. si se piden las placas completas de 96 muestras. Los métodos basados en la reacción de Polimerasa en Cadena (PCR). Empresas privadas dan buenos servicios para productos PCR y su purificación y secuenciación. deben tomarse en cuenta. 1997). 1997. si existe disponibilidad de recursos. Extracción de DNA: el DNA genómico es aislado de cultivos de fases log en 79/YMA durante diferentes periodos de incubación.. se restringe únicamente a representantes de grupos. Se cuantifica el DNA a A260 nm con un espectrofotómetro o se estima por comparación con diferentes estándares de concentraciones de DNA en geles de agarosa. la secuenciación directa de 16S rARN u otros genes puede ofrecer ventajas económicas. Los costos y beneficios de una caracterización previa y secuenciación de representantes versus una secuenciación directa de un número mayor de aislados. AFLP (Polimorfismo de Tamaño de Fragmentos Amplificados) para el análisis de todo el genoma. Bruijn et al. Se pueden utilizar el kit “Ultraclean” para el aislamiento de DNA de suelo de los laboratorios MOBIO o cualquier otro kit recomendado por el productor. por otro lado. dependiendo de la tasa de crecimiento específica para cada cepa (de 2 a 10 días). normalmente. RAPD (DNA polimórfico amplificado al azar): AP-PCR (PCR Con Arimers Arbitrarios). la purificación y secuenciación de un fragmento de genes (una muestra) ya amplificada por PCR. incluyen: la digestión de DNA genómico con endonucleasas que cortan sitios (de restricción) poco frecuentes seguido por PFGE (Electroforesis en Gel en Campos Pulsados) y otros métodos de RFLP. tales como ARDRA (Análisis de Restricción del rDNA Amplificado). El número total de placas de 96 muestras cuesta alrededor de US $350 para la secuenciación.genómicas. homología DNA:DNA) requiere de mucho tiempo y de equipo especializado y. 23S rARN u otras secuencias de genes. en la actualidad. en algunos casos. tRNA-PCR o ITS (Amplificación y Análisis del tRNA y de Regiones Intergénicas del 16S-23S rRNA).) (Rademaker y Bruijn. La caracterización genética de DNA (secuencia del 16S. puede costar alrededor de US $6. REP-PCR (Huellas Genómicas de Elementos Genómicos Repetidos de DNA. para cada tipo se suspende una azada con bacterias de una colonia aislada en 1 ml de agua B acterias formadoras de nódulos en leguminosas 197 . Por ejemplo.

Análisis filogenético. Estos pares de oligonucléotidos corresponden a posiciones 8-27 y 1507-1492.jsp). Otros oligonucleótidos pueden utilizarse si permiten la síntesis de un gen 16S rARN casi completo. Los genes casi completos del 16S rDNA se amplifican con un par de oligonucleótidos 27F (pA: 5`AGAGTTTGATCCTGGCTCAG) y 1492R (5´GGTTACCTTGTTACGACTT). se utiliza un volumen de esta suspensión como templado para el PCR. durante 40 segundos. Cuando se requiere la secuencia de todo el gen se deben elegir otros primers internos y usarse para amplificar y secuenciar el fragmento del gen que falte después de utilizar 27F y 1492R.cme. 0. lo que produce una suspensión ligeramente turbia que posteriormente se hierve durante cinco minutos para lisar las células. seguido por 30 ciclos de desnaturalización a 94°C durante 40 segundos. el European Bioinformatics Institute (EBI) secuenciación de base de datos (www.ac.esterilizada. por otras técnicas). 198 Manual de biología de suelos tropicales . respectivamente.2 mm de cada dNTP.ncbi. usando los aislamientos representativos de diferentes grupos (obtenidos bien por caracterización de cultivo. MANTENIMIENTO Y COLECCIÓN DE CULTIVOS PUROS Normalmente. pero también con el primer reverso 1492R. perfiles REP-PCR. apareamiento a la temperatura de 55°C.nih. 1990). tales como la del National Center for Biotechnology Information (NCBI) (www.5 mm MgCl2. con extensión a 72°C durante 90 segundos. similares a los presentados en la Figura 6.nlm.gov/). del gen 16S del RNA ribosomal de Escherichia coli (Wilson et al.edu/index. Sin embargo. Las concentraciones finales en las mezclas de reacción (100 ml) son: 1 x PCR Buffer.msu. La extensión final se lleva a cabo a 72°C. 2.ebi.. La purificación de los productos PCR se hace con filtros Microcon™ (Millipore) o mediante otros métodos de purificación.uk) y el Ribossomal Database Project (RDP) (http://rdp.2. El programa para PCR incluye un paso inicial: desnaturalizar a 94°C durante 5 minutos. Secuenciación 16S rDNA. los cultivos puros se mantienen en agar inclinado dentro de tubos de tapa rosca en el mismo medio de cultivo. la viabilidad de dichos cultivos no es larga: los métodos como liofilización y almacenaje en un congelador (–80°C) garantizan una larga conservación de las células viables. Se comparan las secuencias con otras conocidas contenidas en las bases de datos. o bien. durante 7 minutos. Un paso de secuenciación del PCR amplificado se obtiene con el primer 27F. 0.2 μm de cada oligonucleótido y dos unidades de la enzima Taq polimerasa (DNA extraído o cultivos líquidos): 6 μl.

M. pp339–345.H.. O.. y Heulint. pp2174-2179. G. C. I. N. R.W y Vandamme. International Journal of Systematic and Evolutionary Microbiology vol 49.pp367-372. Christen. New York.. Monsalud. J. Berge. Barakat. y Laguerre. Lin. Amarger. M... G. J. vol 32. (2007)´ Burkholderia nodosa sp. James. N. W. K.. S.. Giller. V.. Soil Biology and Biochemistry. K. David Odee y Nancy Karanja. E. R.. I. an exopolysaccharide-producing bacterium isolated from vertisol microaggregates in Martinique‘. W. S. A. A. M.. y Vandamme. International Journal of Systematic Bacteriology. E. Sprent.. Esperanza Martínez. (2001) ‘Genetic diversity of rhizobia varies from natural populations with the soil dilution sampled’. (2009) ´Rhizobium alamii sp.. De Faria. nov. Y. vol 47... Bala. W.. Heulin.G. T.. E. Murphy. Cnockaert. F. nov. J. M.. y Hardy. Elliot. and Rhizobium giardinii sp.. REFERENCIAS Achouak. (2010) ´Devosia yakushimensis sp.. P. W. Marlet. P. Chou. C. Santealla. R. (2008) ´Burkholderia sabiae sp. Chou. isoled from root nodules of Pueraria lobata (Willd. M. M. R. (1987) ‘Methods for quantification of nitrogen fixation associated with Graminae’. S. Chen. K. (1982) ‘Ensifer adhaerens gen. L. M. Macheret.. A. Y.. International Journal of Systematic Bacteriology.. . nov. Critical Reviews in Plant Sciences.. E... nov.H. W. Young. G. B acterias formadoras de nódulos en leguminosas 199 .) Ohwi´ International Journal of Systematic and Evolutionary Microbiology vol 60. nov. P.. vol 16. Sheu. Elliot. M. Boddey. K. Chen. Bautista. pp996–1006. R. nov. J. nov. pp841–843... Brandelet. from Phaseolus vulgaris nodules’. y Achouak. T. V. an exopolysaccharide-producing species isolated from legume and non-legume rhizospheres´ International Journal of Systematic and Evolutionary Microbiology vol 59. M. Burns.. Springer-Verlag. pp209–266. nov. sp. R... pp. De Faria. pp627-632.P. N... G. vol 33. (1975) Nitrogen Fixation in Bacteria and Higher Plants.V. Roncato.787-749.AGRADECIMIENTOS Agradecimientos especiales por sus comentarios y revisiones a los Drs. J. Christien.... Bontemps. C. J. Sprent. Lodhi. y Yakta. Casida Jr. isolated from root nodules of Mimosa caesalpiniifolia´ International Journal of Systematic and Evolutionary Microbiology vol 58. nov. (1997) ‘Rhizobium gallicum sp. (1999) ‘Burkholderia caribensis sp.: A bacterial predator of bacteria in soil’.. James.

(1995) ‘Characteristics of Rhizobium tianshanense sp. X. Andrews. L. International Journal of Systematic and Evolutionary Microbiology. Yan.F... Wang. pp2510-2525. S. Yuan. from Taiwan and South America’. vol 56. Young. Elliot. Barrios. P. Li. y Vandamme. Chen. Wang. H. Y. Chen.. E. N... G. International Journal of Systematic Bacteriology. D. (1926) ‘Recherches sur les tubercles radicaux des légumineuses’. E. C. People’s Republic of China’. D.. Chou. pp275–280.. M. (1991) ‘Rhizobiumhuakuii sp. (2010) ´Mesorhizobium alhagi sp. Coenye. J. J. G. pp392–397... Chen. isolated from the root nodules of Astragalus sinicus’. S.. Mergeay. (2009) ´Nodulation of Sebania species by Rhizobium (Agrobacterium) strain IRBG74 and other rhizobia´Environmental Microbiology. J. nov.. nov. S. M.M. X. International Journal of Systematic and Evolutionary Microbiology vol 60 pp958962. pp1729–1735. Humphry. Lee. T. Shen. G. 200 Manual de biología de suelos tropicales . J. Odee. M. (1997) ‘Rhizobium hainanense sp. vol 45.. A. (2006) ‘Burkholderia mimosarum sp... a moderately and slowly growing root nodule bacterium isolated from an arid saline environment in Xinjiang.. E. Sprent. pp153–159. Z. J. L. L. Bontemps. nov. Chen. pp1–275.. y Wang. Chen.. (2001) ‘Ralstonia taiwanensis sp. isolated from tropical legumes’.. vol. Qi. vol 41. W. Sprent.. pp10551059..I. Zhu. L. X. Vos. vol 47.. International Journal of Systematic Bacteriology.. E... Farruggia. Moreira. Chen.. P.P. W. I. J. (1950) Estimation of bacterial densities by names of the “most probable number”. L.... M. J. James.’. (1988) ‘Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned to Sinorhizobium gen. International Journal of Systematic and Evolutionary Microbiology vol 51. Y.P. S. isolated from nodules of Mimosa spp... M. W. H. vol 38.T. Viniesa.S. Y. y Li. G. nov.K. Faria. isolated from wild Alhagi sparsifolia in north-western China´. y Li.G. W. Y. F. S. pp870–873.. W. X. vol 57. Coenye. y James.. y Li.W y Wei. Gyaneshwar. P. W. Botaniste (Paris). Tan..M. M. P. Chen.isolated from root nodules of the woody Brazilian legumes Mimosa bimucronata and Mimosa scabrella´ International Journal of Systematic Bacteriology. Young. isolated from nodules of Mimosa species and sputum of a cystic fibrosis patient’. Biometrics. nov.P.. Cummings. T. T.. W. E.W. M. Dangeard. Cochran. Li. Y. pp1847–1851. Chen. E. S. Wang. W. International Journal of Systematic Bacteriology. y Vandamme. P. Li. vol 11. T. vol 16. 6. pp105-116. nov. F. W. Laevens. International Journal of Systematic Bacteriology.. nov. Gao. J... T. X. K. P..

. Kersters. vol 48. (1988) ‘Characterization of Azorhizobium caulinodans gen. Struffi. P. nov. Pot. Springer-Verlag. Dworkin. Berlin. Molouba. Nature. G. Garcia.. Nick. Sinorhizobium saheli sp. De Lajudie. Dreyfus. Kondorosi and W. sp. Elkan. G. y Halliday.. P. nitrogenfixing bacteria that efficiently nodulate Neptunia natans in Senegal’. Dreyfus. B. New York. M. nov. infertile soils of the tropics’. D. W. M. y Lugtenberg. (1988) ‘Recognition of individual strains of fast-growing rhizobia by using profiles of membrane proteins and lipopolysaccharides’. vol 170. B. (1966) ‘Acetylene reduction by nitrogen fixing preparations of Clostridium pasteurianum’. (1998b) ‘Characterization of tropical tree rhizobia and description of Mesorhizobium plurifarium sp. De Lajudie. Journal of Bacteriology. vol 38. Neyra. J. M. Biochemica et Bioophysica Acta. J.... y Gillis. Marcel Dekker Inc. Dudman. Rademaker. M. B acterias formadoras de nódulos en leguminosas 201 . nov. A. Applied and Environmental Microbiology. in G. R. a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata’. B. Balows. Collins.. E. A. J. B. International Journal of Systematic Bacteriology. F. Ragatz... nov. E. A. pp1825–1830. Willems. Neyra. C. (1991) ‘The Rhizobia’. B. vol 127. y Halliday. H. (1998a) ‘Allorhizobium undicola gen.. Kersters.. cultivation and maintenance of rhizobia’ .. E. (1987) ‘Collection.. Collins. nov. International Journal of Systematic Bacteriology. D. A. J. that uses a qualitative coding of immunodiffusion reactions’. A. A. M. Maestrojuan. The Prokaryotes. Torck. (1988) ‘Numerical taxonomic analysis of some strains of Rhizobium spp. B. pp369–382. G. A. De Bruijn.. in C.. R.’. International Journal of Systematic Bacteriology. Dreyfus. J. Date. Willems. vol 44. pp3782–3785. pp1277–1290. A. y Gillis.. P. pp62–64.... van Rossum... isolation. 2nd Edition.. Schlegel and H. L. L. nov. G. vol 54. y Bunn. F. (1994) ‘Polyphasic taxonomy of rhizobia: Emendation of the genus Sinorhizobium and description of Sinorhizobium meliloti com... M. Willems. H. Hoste. Elmerich. in A. Dordrecht. W. U. Dreyfus. Dewettinck. y Stoltzfus. Schultz. Elkan (ed) Symbiotic Nitrogen Fixation Technology.. L. R. J.. pp89–98. and Sinorhizobium teranga sp. (1997) ‘Molecular approaches in microbial ecology to assess genomic diversity and stress-induced gene expression in plantassociated diazotrophs’. B... Lindstrom... M. y Gilles. vol 277. K.’. McSpadden-Gardener. F. pp285–294.. Laurent-Fulele.. Dilworth. M. R... nov. International Journal of Systematic Bacteriology. Moreira. M. sp. P. Torck.. Collins. Kluwer Academic Publishers. nov. Newton (eds) Biological Nitrogen Fixation for the 21st Century. Davey. vol 48. pp715–733. y Belbin. K. Millcamps. C. U. D. L. D. J. y Gillis. J. M. H.. M. De Lajudie. M. R. M. Coopman. Truper (eds).Date. F.. De Maagd. K. D.. (1979) ‘Selecting Rhizobium for acid..

Turner. W. Mateos. S. isolated from sawdust of Populus alba’. Kan. H. M. Barnet. W. A. L.... pp2003–2012. B. P. A. García-Fraile. (1989) ‘Absence of nitrogen fixation in clover grown on soil subject to long-term contamination with heavy metals is due to survival of only ineffective Rhizobium’... M. B. Young. (2001) ‘Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia’.. International Journal of Systematic Bacteriology. Peix.T. (1987) ‘Use and abuse of the acetylene reduction assay for measurement of “associative” nitrogen fixation’. Lewis. New Phytologist. (1989) ‘Occurrence of nodulation in the Leguminosae’. Lindstrom. M. G. pp 607–619.. pp2037–2048. S. nov.. F. y Chen. Soil Biology and Biochemistry.. (1889) ‘Ueber die Pilzsymbiose der Leguminosen’. M. P. vol 51. International Journal of Systematicand Evolutionary Microbiology. y Velázquez. y Waksman.X. McGraw-Hill Book Company. Martínez-Molina. H. Inc. H. W. E.P. nov. H. J. E. de Ley. Han. (2006) ´Mesorhizobium thiogangeticum sp.. J. Wang.M. Jarvis. W. W. (2004) ‘Mesorhizobium septentrionale sp. E. Sprent. Strijdom. P. vol 37. E. Berichte der Deutschen Botanischem Gesellschaft. Ghosh. K. Tian. pp376–387. Y.T. X. Graham. T. E.. New York and London. Y. y Chen. P.. Keyser. J. S. nov. y Young. Bradley. vol 57. L. J. P. S.. W.. International Journal of Systematic and Evolutionary Microbiology. Sui.and stem-nodulating bacteria’. W. (1928) Laboratory Manual of General Microbiology. Gaunt.Faria. Z. y Hirsch. pp332–346. Soil Biology and Biochemistry. vol 56. Tan.F. Frank.... Gao. Fred. P. I.X. vol 111. C.. M. Y.. Rivas. a symbiotic bacterium isolated from Lespedeza root 202 Manual de biología de suelos tropicales . McGrath.F. Martens.. K. B.. isolated from Astragalus adsurgens growing in the northernregions of China’. W. K. C. A. P. R. International Journal of Systematic and Evolutionary Microbiology. E. y Sutherly. Qiu. Sadowsky. P. D. J. L.F. S. E. and Mesorhizobium temperatum sp. Gu. W. E.. T. Z. Terefework. J. International Journal of Systematic and Evolutionary Microbiology. (2007) Rhizobium cellulosilyticum sp... Lloyd-Macgilp. nov. J. pp 582–587. B. R. R. Roslycky. vol 21. Chen. A. R.. pp91-97. L.. J. Rigottier-Gois.. L. vol 19. a novel sulfur-oxidizing chemolithoautotroph from rhizosphere soil of an Indian tropical leguminous plant´. Giller... (1879) ‘Ueber die Parasiten in den Wurzelan-schwillungen der Papilionaceen’. vol 41. pp783–784. J. Turner. B. E. vol5. pp 841–848. Wang. Willems.. Giller. X. (1991) ‘Proposed minimum styards for the description of new genera and species of root. Cooper..... (2008) Rhizobium miluonense sp. y Roy. W. pp 844-848. B.nov.H.. vol 7... S. Frank. S. 394–399. Botanik Zeitung.. y Young.

Rhizobium ciceri. Sui. Biotechnol. W.K. nov. pp1416-1429... W. isolated from multiple legume species native of Xinjiang.1553.. Yan..X. Nour. pp378–380. Kuykendall. E..I.Z. W.. vol 32. Y.G.. B. Wu. vol 58. Chen. Hunter.J. vol 55. isolated from wild legumes growing in desert soils of Xinjiang. W. C. J. E. S. nov. International Journal of Systematic Bacteriology. J. y Stackebrandt. nov.. Imran. Rhizobium mediterraneum and Rhizobium tianshanense to Mesorhizobium gen. Y. W. E.X. E. L. Chen.. Jarvis. F. a novel rhizobial species nodulated with Caragana spp. (2007) ´ Rhizobium selenireducens so. M. pp1693-1699. L.T. e Seky.. vol58. Malik. International Journal of Systematic and Evolutionary Microbiology.. W. Frühling. H.J. Dong. W. International Journal of Systematic and Evolutionary Microbiology. Florentino.F. D. y Manter D. Han.F. E. T.X. (2005) ‘Leguminosae nodulating bacteria diversity from three different land use B acterias formadoras de nódulos en leguminosas 203 . Wu. Li. y Gillis. D.F. Jesus.nodules‘. Rhizobuim huakuii. Wang. (2009) ´Rhizobium tibeticum sp.T.. E. E. pp2646-2653. P.. pp1364-1368. Kawasaki. Gu.C..X.. Chen. 895–898.s. P. Biochem vol 72. y Chen. B. Guan. P. Wang.J. y Chen. M. D. vol58..) Vassilcz´.T... M. C. Wang. Mesorhizobium caraganae sp. I. Biosci. Y.. T. B. M. Tian C. vol 58. a new species of legume root nodule bacteria’. L. in China ‘..J... Muramatsu. (2008) ‘Bradyrhizobium iriomotense sp. Jia.H.: a selenite-reducing (alpha)-Protobacteria isolated from a bioreactor´Current Microbiology. C. W. W.. International Journal of Systematic Bacteriology... F. China‘. X. A.. (2008). A. L.. Fernyez. and Mesorhizobium tarimense sp. International Journal of Systematic and Evolutionary Microbiology. nov. J. Schumann.(2008) ‘Rhizobium multihospitium sp. Gu. y Chen. isolated from nodules of Cicer arietinum´. J. X. Jarvis.. A.. Isolated from a Tumor-Like Root of the Legume Entada koshunensis from Iriomote Island in Japan‘. Han.X. Zhang. y Patel.B.’. Hou.. nov. Lu.. C..F. y Moreira.. T. Pankhurst.. (2008) Mesorhizobium gobiense sp.. nov.X. Gu. van Berkum. M. nov..X. Hafeez. Nakagaka. nov.L. A. Y. R. (2010)´Ochrobactrum ciceri sp. Y. pp455-460. vol 60: 1548 . Chen. Han. y Chen. S. W. International Journal of Systematic and Evolutionary Microbiology... W. R. nov. vol 47.F. L. Oliveira. (1982) ‘Rhizobium loti. S. a symbiotic bacterium isolated from Trigonella archiducis-nicolai (irj. Rodrigues.. Islam. K. X.. Cleyet-Marel. Y. (1997) ‘Transfer of Rhizobium loti. J..R.pp3051-3057.vol 59. pp2610-2618. W.T. X. M. Chen.H.International Journal of Systematic and Evolutionary Microbiology. International Journal of Systematic and Evolutionary Microbiology.G.. Wang... M. China‘.T... Gao.

D. (2009)´Rhizobium mesosinicum sp. Kuykendall. Devine. Pesquisa agropecuária Brasileira.. (2009)´Rhizobium alkalisoli sp. isolated from root nodules of three different legume´.L. Kew.R. y de Lajudie. E. He. isolated from Caragana intermedia growing in saline-alkaline soils in the north of China´.. y Bohlool. M. International Journal of Systematic and Evolutionary Microbiology.Y. vol 38.T.’. Mackinder. (1984) ‘Rhizobiaceae Conn 1938’..H.X. nov. L. D. F.. H. pp769–776. S. A... W.. Chen. R.Y.L.. Nelson..Q. Lewin. E. isolated from root nodules of Caragana species ‘.. vol 59. immunodiffusion and intrinsic antibiotic resistance’. (2005) Legumes of the world. Lin. Rosenberg. N. B. E. Canadian Journal of Microbiology. L. J.systems in Brazilian Western Amazon’. Williams and Wilkins. Han.H. D. (2008) ´ Shinella kummerowiae sp.F.T. T. nov. nov. vol 59.. Krieg and J. legume root-nodule-forming and nitrogen fixing bacteria’.nov.1923. J. B. a symbiotic bacterium isolated from root nodules of the herbal legume Kummerowia stipulacea ‘. X. (Cicer arietinum L. vol 59: 1919 . L. (2009) ´ Mesorhizobium shangrilense sp. pp518–526. B. S. International Journal of Systematic and Evolutionary Microbiology. J.. M.. 204 Manual de biología de suelos tropicales . pp447–459. Hu. Y. vol 58. P. W. Wang E.. y Chen..T. Royal Botanic Gardens. Schrire. D. Wang. vol 8. for a group of aerobic facultatively methylotrophic. y Broughton. T. Gillis. Wang E. Jordan. Sui. Bena... W.. (2004) ‘Methylobacterium nodulans sp. L. pp30123018. NGR234 selected using the widely compatible legume Vigna unguiculata’. Dénarie.X. Holt (eds) Bergey’s Manual of Systematic Bacteriology. Wong.. y Chen. C. vol 40. B. (1983) ‘Characterization of Rhizobium sp. Dreyfus... nov..X. Li. Wang. Lewis. H. Wang. D. pp3006-3011. (1992) ‘Genetic diversity in Bradyrhizobium japonicum and a proposal for Bradyrhizobium elkanii sp. B.X. Kingsley. W. X.. y Udell.. D.F. Li. Guan. W. London. Willems. y Chen. Wang E. Jourand. y Lock.H. T. W. pp1409-1413. B.. D.T. D. Canadian Journal of Microbiology.. pp501–505.. International Journal of Systematic and Evolutionary Microbiology. H. Dowling. Sui.... nov.. G. International Journal of Systematic and Evolutionary Microbiology.X. y Chen. (1987) ‘Multiple host-specificity loci of the broad host-range Rhizobium sp.Q. W.F. Meyer.. Lin.) by immunofluorescence. Chen. International Journal of Systematic and Evolutionary Microbiology. F.. vol 54. Han. Tang.. vol 29.. Hu. C. pp2269–2273..X. Saxena. Plant Molecular Biology. G.. A.. W. Chen. A. Stanley. Giraud. J. Manen.X. in N.. F.. Sy. C.. P. M.

A. Rincon. y Moreira. A.. M.. Merabet.M. S. F. M. y Pardo. Zakhia. B. L. F. PhD Thesis. F. Brasil.. Llorente. Lotus creticus. Mars..´. A.. y Döbereiner. pp827-839.. PP. Segovia. Magalhães. Nairobi. eficiência e diversidade de bactérias fixadoras de N2 que nodulam o siratro (Macroptilium atropurpureum) de solos sob diferentes usos na Amazônia Ocidental’. K. Annual meeting report 4. vol 39. Graham.Lima. (2007) ‘Densidade. Acta Amazônica. Béna. International Journal of Systematic Bacteriology. (2004) ‘Methodology for the inventory of nitrogen-fixing Leguminosae nodulating bacteria’.. Barberi. (2007)´Ensifer mexicanus sp. International Journal of Systematic and Evolutionary Microbiology.. Lindström.. pp417– 426. (2009) ´Nitrogen-fixing bacteria communities occurring in soils under different uses in the Western Amazon Region as indicated by nodulation of siratro (Macroptilium atropurpureum)´ Plant and Soil. Bonneau. O... Nóbrega. nov. M. vol 12.. C.. A.A. P... Martínez-Romero.. G..) Kuntze in Mexico.. M. J.C. y de Lajudie. nov. Ferreira. A. (1989) ‘Rhizobium galegae. R.. Moreira.S. vol 41. (2006) ´Emended description of the genus Phyllobacterium and description of four novel species associated with plant roots: Phyllobacterium bourgognense sp. Martens. nov´. nov. Bekki... Oliveira. Argyrolobium uniflorum and Medicago sativa (Tunisia) and description of Ensifer numidicus sp. K. Ormeno-Orrillo. Universidade Federal de Lavras. A. A. E. Martínez-Romero. Mahdhi. (1982) ´Ocurrência de nodulacão en leguminosas florestais notivas de terra firme da região de ManausAM´.674. vol 319.. C.M. M. y Cleyet-Marel. J.. A. a new specie nodulating Acacia angustissima (Mill. S. International Journal of Systematic and Evolutionary Microbiology. P. nov. P. Zakhia.M. Silva.S. B acterias formadoras de nódulos en leguminosas 205 . pp280-290. Domergue. Franco. H... S. M. a new species of legume root nodule bacteria’.F. L. Magalhães. (1991) ‘Rhizobium tropici. J. Lima.. Mantelin.. de Lajudie. E. pp509-514. Fischer-Le Saux.S. F. F.. Phyllobacterium leguminum sp. beans and Leucaena trees’.S. nov. a new species nodulating Phaseolus vulgaris L. and Ensifer garamanticus sp. International Journal of Systematic Bacteriology. pp365–367. S.R. L. Systematic and Applied Microbiology. Kenya. vol 30.A. R.. vol 60: 664 . M. Mercante.. A.M. A. L. Le Roux. Minas Gerais. y Martínez-Romero. vol 56.127-145. Phyllobacterium ifriqiyense sp. F. Jeder. Sy. E. Coopman. and Phyllobacterium brassicacearum sp. Conservation and Sustainable Management of Below-ground Biodiversity CSM-BGBD. Rogel-Hernández.. (2010) Multilocus sequence analysis of root nodule isolates from Lotus arabicus (Senegal). D. Willems. nov.

y Faria. M. K.Moreira. y Howieson... y Franco. vol 49. 280pp.W. pp135–146. Brussaard (eds) Biodiversidade do solo em ecossistemas brasileiros.) Pers. M. L. Systematic and Applied Microbiology. pp197–206. Bogor. Moreira. A. A. (2006) ‘Nitrogen-fixing Leguminosae nodulating bacteria’. M. M. K. Marsh. T. F.P. nov. A. Moreira. M. vol 411. Nick. M. S. M.. F. M. G. in M. Moulin.. F. (1999) ‘Sinorhizobium arboris sp. R. Brussaard (eds) Soil Biodiversity in Amazonian and other Brazilian Ecosystems.. Moreira.. vol 59.. J. S. Tiwari. Moreira. vol 121.’.. are among fast growing symbiotic diazotrophs isolated from diverse land use systems in Amazônia and from Brazilian Leguminosae forest species’. pp948–950. Paulin. International Journal of Systematic and Evolutionary Microbiology... pp2140-2147. (1994) ‘Genotypic y phenotypic diversity of Rhizobium isolated from chickpea (Cicer arietnum L. Zhang. Tiedje. y Young. (2009) Mesorhizobium australicum sp. J. Suomalainen. (2006) ‘Azorhizobium doebereinerae sp. 206 Manual de biología de suelos tropicales . Effosse. L. M.. New Phytologist. International Centre for Research in Agroforestry. y Bolvin-Masson. D. and Mesorhizobium opportunistum sp. Moreira. J. Siqueira and L. (1992) ‘Occurrence of nodulation in legume species in the Amazon region of Brazil’..)’.. microsymbiont of Sesbania virgata (Caz. isolated from leguminous trees in Sudan and Kenya’. X. B. S.nov.. M.. Martínez-Romero. O. J.. y Pereira. (2001) ‘Microsymbionts: rhizobia’. Eardly. nov. pp1359–1368. (2008) ‘Bactérias fixadoras de nitrogênio que nodulam Leguminosae’.. O. S. (1993) ‘Characterization of rhizobia isolated from different divergence groups of tropical Leguminosae by comparative polyacrylamide gel electrophoresis of their total proteins. nov. F. B. nov. P. Beck. M. Nandasena. S. M. Pot. S. P. F. Lavras. (2001) ‘Nodulation of legumes by members of the b sub-class of Proteobacteri’.. Bignell (eds) Standard Methods for Assessment of Soil Biodiversity and Land Use Practice. S. Canadian Journal of Microbiology. Munive. C. México. G. E. Moreira. Cleyet-Marel. Indonesia (available at http://fao. S. L. Pitard. Swift and D.. D. S. A. C. pp345–354. Wallingford. Editora. J. R. International Journal of Systematic Microbiology. O’Hara. Gillis. in Australia´. pp563–570. UFLA. y Fernandez. F. CAB International. M. Nature. Faria. S. M. E. and Sinorhizobium kostiense sp. Dreyfus. Memorias da XXI Reunión Latinoamericana de rhizobiologia. O. Pedrosa. de Lajudie. S. y Lidstrom. K. Willems.. M. S. F.G.G.org/AG/agl/agll/soilbiod/docs/manual-soil%2). J.. F. Cocoyoacan. W. L. Cruz. G. Kersters. Moreira. Systematic and Applied Microbiology. Nour. Silva. isolated from Biserrula pelecinus L.. Gillis. P. Siqueira and L... Moreira. vol 29. B. (2002) ‘Burkholderia spp. M... 768pp. vol 40. in F. F. T. y Marsh.. in F. A.. vol 16. S. M.

Peix. A... S. (2008)´Revision of the taxonomic status of the species Rhizobium leguminosarum (Frank 1879) Frank 1889AL. W. pp2543–2549.. W. H.. M. pp640–648. P. in G. J. vol 58. Bae. PhD Thesis. Odee. Kimiti.N. vol 188. International Journal of Systematic and Evolutionary Microbiology. E. pp211–224. Q. Rademaker. y Fernandez.. International Journal of Systematic and Evolutionary Microbiology. W.. isolated from the wild rice Oryza alta´.. Baek. A. J. Sutherland. E. Peix.. New York. Rodríguez-Navarro. Reclassification of the strain R. W. Yuan. P. Rhizobium phaseoli Dangeard 1926AL and Rhizobium trifolii Dangeard 1926AL. nov. D. I. G. M. Zhang. trifolii is a later synonym of R. Cleyet-Marel. J. R.Nour. McInroy. Gresshoff (eds) DNA Markers: Protocols. Plant and Soil.. nov. Mateos.. nov. E. nov.H. isolated from a cyanide treatment bioreactor’. Peng. J. pp2484-2490. C. E... y Tan. W. Systematic and Applied Microbiology. (1997) ‘Phenotypic characteristics and composition of rhizobia associated with woody legumes growing in diverse Kenyan conditions’. A. F. Brazil. M.. Lavras. Quan. Igual. H. and Overviews. R. Rivas.. J. leguminosarum.) and description of Rhizobium mediterraneum sp. vol 55. T.. pp65–75. Pereira. Valverde. S. Z. Makatiani. y Lee. and P. M.nov. y de Bruijn. R. J. (2009)´ Bradyrhizobium pachyrhizi sp.. nov. leguminosarum DSM 30132 (=NCIMB 11478) as Rhizobium pisi sp. García-Fraile. Im.. E. G. D. D. Odee. vol 45. M. (2008) ´Rhizobium oryzae sp...’. (2000) ‘Diversity of rhizobia isolated from different land use systems in Amazon region’.. Sutherland. Martínez-Molina.. (2004) ‘rRNA and dnaK relationships of Bradyrhizobium sp. Parker. (1995) ‘Genomic heterogeneity of strains nodulating chickpea (Cicer arietnum L.. y Sprent. vol 27. J. D. (1995) ‘Natural rhizobial populations and nodulation status of woody legumes growing in diverse Kenyan conditions’.. Normy.. Li. Caetano-Anollés. Z.F..M. John Wiley and Sons Inc. J. Camacho. G. I. Universidade Federal de Lavras. International Journal of Systematic Bacteriology. W. M. Chen. Ramírez-Bahena. Willems. y Sprent. Ramírez-Bahena. vol 58. pp2158-2163. A.. M. isolated from effective nodules B acterias formadoras de nódulos en leguminosas 207 . M. P... y Velázquez. vol 173. A. Martínez-Molina. P. M. (2005) ‘Rhizobium daejeonense sp. International Journal of Systematic and Evolutionary Microbiology. L. nodule bacteria from four Papilionoid legume trees in Costa Rica’. M. J. Plant and Soil.. y Velázquez.H. P. E. Applications. Mateos. pp334–342. S. (1997) ‘Characterization and classification of microbes by rep-PCR genomic fingerprinting and computer-assisted pattern analysis’.. Rivas.F. and Bradyrhizobium jicamae sp..

N. pp5217-5222. Willems. vol 51. isolated from annual Medicago spp.. pp255.F. M. N. B. International Journal of Systematic and Evolutionary Microbiology. nov.. R. C.. Ren..f. L. E.. Chen. E. H. y Martínez-Romero.. Fernadez. pp47–53.. D. Gillis.. N. p710 Segovia. R. Wang.. X. Rivas. H. Ochman.of Pachyrhizus erosus’.. nov. International Journal of Systematic Bacteriology. Velázquez. a symbiotic bacterium isolated from multiple legume species´. Willems. Sui. Willems.. Ponce. R. Proceedings of the Federation of American Societies for Experimental Biology. D. S.. vol 46. H. A. vol 61. Normy. F. P. nov. vol 43. P. (2003) ‘Description of Devosia neptuniae sp. W. P.’. Mateos. (2002) ‘A new species of Devosia that forms a unique nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (L. E. Brunel. that nodulates and fix nitrogen in symbiosis with Neptunia natans. y Vizcaíno.. Martinez-Molina. Applied and Environmental Microbiology. R. (1966) ‘Study of intermediates in nitrogen fixation’. Vizcaíno. E. (1996) ‘Sinorhizobium medicae sp. R. Systematic and Applied Microbiology. (2011)´Rhizobium vignae sp.) Druce’. pp580-586.. S. F. Dazzo. (2009)´ Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico. P. Martínez-Molina. vol 59. W. R.. y Velázquez. including Sinorhizobium chiapanecum sp.T. nov.. J. P. Mateos... International Journal of Systematic Bacteriology.... y Martínez-Romero. y Chen. G. nov. vol 34. E.X.. E...W. Rivas.. Subba-Rao. 208 Manual de biología de suelos tropicales . nov. y Martinez-Molina... (1984) ‘Rhizobium fredii sp.’... N.L. Gilmour. L. P. E. Rincón-Rosales. F. (1993) ‘Reclassification of American Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp. Musser.. García-Benavides. A. pp374–377. M. M. F. P. E. vol 26. W. y Burris.. M.F. Applied and Environmental Microbiology. Palomo. (1986) ‘Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics’. Rivas.. Schollhorn. isolated from roots of Beta vulgaris affected by tumour-like deformations´ International Journal of Systematic and Evolutionary Microbiology. M. E. T. K. Kroppenstedt. H. pp1271-1275. a fast-growing species that effectively nodulates soybeans’.. Selyer. A. Mateos. M. R. D. vol 24. Subba-Rao. Gillis. R. pp484–486. y Cleyet-Marel. M. an aquatic legume from India’. Rome. pp873–884. vol 68. y Whittam. pp972–980.H. Gillis. FEMS Microbiology Ecology Vol 68. which has common symbiotic genes with Sinorhizobium mexicanum´. M.nov. Scholla.. J.. D. y Elkan. International Journal of Systematic and Evolutionary Microbiology. N. Llorente. J. Caugant. Dazzo. vol 54. International Journal of Systematic Bacteriology. Young. (2004) Bradyrhizobium betae sp. A.. pp5217–5222. J.

M. (2005) ‘Phylobacterium trifolii sp. A. is one of three rhizobial genotypes identified which nodulate and form B acterias formadoras de nódulos en leguminosas 209 . the root-nodule microsymbiont of Hedysarum coronarium L. P.F.. pp54–64.. B. M. nov. (1998) ‘Rhizobium mongolense sp. Cervantes. vol 52. (formely ‘Rhizobium hedysari’). Ludeña. C... Van Berkum. G. in Mexico’. pp214–220. Systematic and Applied Microbiology. Giraud. I. A... P. pp901–914. (2006) ‘Rhizobium lusitanum sp. Dazzo.’.. Rivas.. Mateos. Z. Planchuelo. Rivas. A.X. E. nodulating Trifolium and Lupinus in Spanish soils’.X. Sy. Toledo. P. Wu.nov. Selnska-Pobell. International Journal of Systematic Bacteriology.J.. Boivin-Masson.’. Van Berkum. B. F. A. pp1132–1136. F. P... E.T. y Chen.. (2001) ‘Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes’.. R. vol 71. Valverde. y Martínez-Molina. W. y Dreyfus.. N. International Journal of Systematic and Evolutionary Microbiology. y Chen. M. E. y Eardly. E. B. J. E. (2002) ‘Rhizobium sullae sp... S.nov. Garcia. A. T. (1984) ‘Avaliaçao do crescimento de rhizobium de leguminosas florestais tropicais em diferentes meios do culura’. B. Tan.Souza. Neyra.. A.. D. Willems. Peix. Squartini.F. Vendramin. pp. E. W. Tola.. E... R. pp1985– 1989.. A. L. Gillis. Valverde. Trujíllo. C. E. vol 51. nov... H. L. D.. P. F. A. (2003) ‘Sinorhizobium americanum sp. G. Reinhold-Hurek. Beyene. vol 68.. de Lajudie.. Magalhaes. P. a new Sinorhizobium species nodulating Acacia spp.G. nov. W. E.. Igual.. vol 183. Campbell. Lloret. P.. Vizcaíno. Döring. International Journal of Systematic and Evolutionary Microbiology‘. a bacterium that nodulates Vicia faba.. M. X... X. Casella. G.T. Kan. M. y Oliveira. J. F. (2001) ‘Rhizobium yanglingense sp. (2002) ‘The aquatic budding bacterium Blastobacter denitrificans is a nitrogen-fixing symbiont of Aeschinomene indica’. nov. vol 26. Wang. Han. B.. Mateos.. Giacomini. pp1318–1327. y Eardly.. y Mateos. nov. Y. s/n. Tian. Velázquez. 2631-2637. Prin. Y. E. y Nuti.. y Velazquez. N.. 58: pp 2871-2875. Applied and Environmental Microbiology... D. A.. P. A. Struffi. Joury. A. Matínez-Molina.G. vol 55. isolated from arid and semi-arid regions in China’. Velázquez. Pesquisa Agropecuária Brasileira – Ediçao Especial 19. F. L. E. Chen. y Martínez-Romero. a bacterium that nodules Phaseolus vulgaris´. pp1267–1276. Gu. M. Bao.. nov.. Wang.. L.. S. International Journal of Systematic Bacteriology.. vol 56. C. Fernández-Santos. A. International Journal of Systematic and Evolutionary Microbiology. (2005) ‘Nodulation of Lupinus albus by strains of Ochrobactrum lupine sp. T. Journal of Bacteriology..M. E. Applied and Environmental Microbiology. P. Gu. E. (2008) ‘Rhizobium favae sp. Abril. Willens. A.. F.

pp1011–1021.. pp507–512. vol 48.. J. M. B. A. (2004) ‘Taxonomy of the genus Cupriavidus: A tale of lost and found’. vol 54. International Journal of Systematic Bacteriology vol 54. H... L. E.-M. nov. J. Kamfer.. T.. Berge. Vincent.. International Journal of Systematic Bacteriology. D. P. y Vandamme. M. J. (2002) ‘Burkholderia tuberum sp. Vidal. P. a metal-resistant symbiont of Anthyllis vulneraria growing on metallicolous soil in Languedoc. C.. C. P... Vaneechoutte.. Goris.. and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al.. K. A. y CleyetMarel... Falsen.. P. France´.’.. Abril. (2009)´Mesorhizobium metallidurans sp. (2004) ‘Wautersia gen. pp13–22. M. Cervantes. Willems. Velazquez. Escarré. P. (2004) Proposal to accommodate Burkholderia cepacia genomovar VI as Burkholderia dolosa sp. International Journal of Systematic and Evolutionary Microbiology. Mahenthiralingam.. Systematic and Applied Microbiology. G. y Willems. P. Igual. vol 25.. O. R. (2005a) ‘Bradyrhizobium canariense sp. vol 51. Jarabo-Lorenzo. T. Nelis. Vandamme.C.. F. nodulate the roots of tropical legumes’. M. nov. 1990) comb. E. nov.. E. Léon-Barrios. (Aeschynomene indica) with Blastobacter denitricans and to transfer Blastobacter denitrificans (Hirsh and Muller. Van Berkum. P. Silva. sp. Chen. Béna. Vandamme. pp689691. Werner.... J. Mauré. Chantreuil. Brunel. Leibold. W.. E.... International Journal of Systematic and Evolutionary Microbiology. (2006) ‘Proposal for combining Bradyrhizobium spp. vol 29. nov. B. M. P. pp2285–2289. T. 1985) to the genus Bradyrhizobium as Bradyrhizobium denitrificans (comb. Vinuesa. nov. M.nitrogen fixing symbioses with Medicago ruthenica [(L. N. J. Mateos.. Systematic and Applied Microbiology. y Eardly. Willems. International Journal of Systematic and Evolutionary Microbiology.. y Conye. nov. LiPuma.)’. vol 59. (2001) ‘Mesorhizobium chacoense sp.. and Burkholderia phymatum sp.. Blackwell Scientific Publications. Gillis. a new genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species. P. an acid tolerant endosymbiont that nodulates endemic genistoid legumes 210 Manual de biología de suelos tropicales . E. de Baere. de Vos. P. Toro. nov. pp850-855. Munoz.. nov. A. vol 54. y Martínez-Romero. pp317–327.) Ledebour]’. nov.... a novel species that nodulates Prosopis alba in the Chaco Arido region (Argentina)’. Pérez-Galdona.. Oxford.J. pp207–215. J. y Martinez-Molina. J. D. G.J. M. M. Coenye. Vermis. C. nov.. E. A. (1970) A Manual for the Practical Study of Root-Nodule Bacteria. Fernyez. International Journal of Systematic and Evolutionary Microbiology. Normy. y Verschraegen. A.

nov..’.. Beyene. Wang. Zhu. pp1479–1491...H. pp1575–1583 B acterias formadoras de nódulos en leguminosas 211 . W. Fernández-López. E. H. J. vol 48. Tan. E. X. T... Chen.. (1999a) ‘Rhizobium etli bv.. a symbiont of Sesbania herbacea that has a close phylogenetic relationship with Rhizobium galegae’. (1999b) ‘Diversity of rhizobia associated with Amorpha fruticosa isolated from Chinese soils and description of Mesorhizobium amorphae sp. D. E. (1998) ‘Rhizobium huautlense sp.. H. pp687–699. vol 57.. a Leucena leucocephala-associated bacterium that is highly resistant to multiple antibiotics’. Martínez-Romero. vol 52. International Journal of Systematic Bacteriology. Z. Molecular Phylogenetics and Evolution. E. Wang. Chen. pp569–575. Wang. E. W. y Martínez-Romero. P.. International Journal of Systematic and Evolutionary Microbiology. E. E. M. nov.. J.. y MartínezRomero. vol 49.. (2002) ‘Sinorhizobium morelense sp. (2002) ‘Rhizobium indigoferae sp. Sui. T. T..X. F. P. y Martínez-Romero. Sui. International Journal of Systematic and Evolutionary Microbiology.. W. Q. E. Zhu. vol 55. Chen. International Journal of Systematic Bacteriology. T. Santos. Beyene. Han. G... Sui. W. y Martínez-Romero. International Journal of Systematic Bacteriology. M.. nov. Wang. A. a novel bacterium that nodulates Albizia kalkora in a subtropical region of China´. E. G. nov’. Wang.. Dorado.. respectively isolated from Indigofera spp. pp51–65. T. E... nov.Q. nov. A. y MartínezRomero. (2007)´Mesorhizobium albiziae sp. a novel biovar isolated from Mimosa affinis’. X. vol 49. E. A. W. Willems. (2003) ‘Characterization of rhizobia isolated from legume species within the genera Astragalus and Lespedeza grown in Loess Plateau region of China and description of Rhizobium loessense sp. X. Tan. along with Bradyrhizobium japonicum bv. and Kummerowia stipulacea’. C.. Vinuesa. Wang. y Chen. E. nov. vol 34.. O. van Berkum.. X.. H. Liu. B. X. Rinhold-Hurek. A. M... International Journal of Systematic Microbiology. and Sinorhizobium kummerowieae sp.. Wang. Silva. Y. M. Wei. M.(Papilionoideae:Genisteae) from Canary Islands. G. genistearum...T. vol 52. Werner. y Chen. E. Bradyrhizobium genospecies a and Bradyrhizobium genospecies b’. X. T.. W. pp1192-1199.. Z. pp2231–2239. pp1687–1693.F. E. y Chen. International Journal of Systematic and Evolutionary Microbiology. mimosae. International Journal of Systematic and Evolutionary Microbiology. S. Cevallos.. H. D. X. Wei.. (2005b) ‘Population genetics and phylogentic inference in bacterial molecular systematics: The roles of migration and recombination in Bradyrhizobium species cohesion and delineation’. Chen. E. pp29–54. van Berkum. Wang. T. P. Wang. Rogel-Hernández. D. vol 53. E.

nov. 212 Manual de biología de suelos tropicales . T. Muñoz-Adelantado. P. vol 53.. W. Woomer. Woomer.. pp1112– 1116. Woomer. I. S. vol 54. nov. N. K. Wilson.. Woomer. pp2107–2110. Young. (1988b) ‘Reliability of the most-probable technique for enumerating rhizobia in tropical soils’. Applied and Environmental Microbiology. P.. Goris. L. J. Bennet. P. R.. Agronomy Journal. B. M.. Wallingford. y Green. M. vol 45. Z. Applied and Environmental Microbiology. C. vol 52. P. X. (2003) ‘Description of new Ensifer strains from nodules and proposal transfer Ensifer adhaerens Cassida 1982 to Sinorhizobium as Sinorhizobium adhaerens comb. Singleton. P. Y. J. Toro. (2002) ‘Characterization of rhizobia that nodulate legume species within the genus Lespedeza and description of Bradyrhizobium yuanmigense sp. nov. pp349–353. E. vol 53. Ge. vol 54 pp149.. A. Xu.. Vos. P. vol 54.. Li. M. P. y Chen. y Bohlool. F. y Fan.. Kan. pp1494–1497. Fernández-Lopez. R.. y Bohlool. B. y Yost.. isolated from the root nodules of soybeans’. Request for an opinion’. in J. E.’. (1993) ‘Most Probable Number Counts of Rhizobia in Soils’. vol 82. (2004) Renaming of Agrobacterium larrymoorei Bouzar and Jones 2001 as Rhizobium larrymoorei (Bouzar and Jones 2001) comb. B. L. Journal of Clinical Microbiology. (1995) ‘Bradyrhizobium liaoningense sp. Z. (1990) ‘Amplification of bacterial 16S ribossomal DNA with polymerase chain reaction’.. pp172–178. H. Blitchngton. MartínezRomero.. B. pp1942–1946.Willems. W. CAB International. (2003) ‘The genus name Ensifer Casida 1982 takes priority over Sinorhizobium Chen et al 1988 and Sinorhizobium morelense Wang et al 2002 is a junior synonym of Ensifer adhaerens Casida 1982. Yao. R. E. C. H. Ingram (eds) Tropical Soil Biology and Fertility: A Handbook of Methods. Young. y Gillis. Wang. Cui. pp706–711. International Journal of Systematic and Evolutionary Microbiology. International Journal of Systematic Bacteriology.. International Journal of Systematic and Evolutionary Microbiology. M. nov. International Journal of Systematic Bacteriology. pp2219–2230. J. pp1207–1217. (1988a) ‘Ecological indicators of native rhizobia in tropical soils’. W. J. vol 28. (1990) ‘Agroclimatology and modeling – overcoming the inflexibility of most-probable-number procedures’. B. J. Yerson and J. Is the combination “Sinorhizobium adhaerens” (Casida 1982) Willems et al 2002 legitimate? Request for an opinion’. M. M.. Singleton.´ International Journal of Systematic Evolutionary Microbiology.

F. E. M.. (2001) ‘A revision of Rhizobium Frank 1889. R. J.vol 133. vol 57. Li.. Chamber. rhizogenes. pp87–94. (1996) ‘Diversity and phylogeny of rhizobia’. E. vol 61.C. nov. nov. y Haukka.. E. pp784-788. R. M. A. Kerr. D. E. and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. y Chen. Carrasco. L. J.. Hou. with an emended description of the genus. Y. vol 51.. Mateos.. . Vizcaíno.J. W... P. Rivas. Zurdo-Piñeiro.T.E... pp512-517. R. (2007)´Ochrobactrum cytisi sp. Wang. Trujillo...L. rubi. pp89–103. Kuykendall. W. Palomares. A. B.... B acterias formadoras de nódulos en leguminosas 213 . isolated from nodules of Cytisus scoparius in Spain´ International Journal of Systematic Evolutionary Microbiology. Martínez-Romero.Young. Zhang..X. N. y Velázquez.X. H. Martínez-Molina. vitis’. isolated from root nodules of Oxytropis glabra´International Journal of Systematic Evolutionary Microbiology. International Journal of Systematic Evolutionary Microbiology. undicola and R. E. X. K. J. (2011)´Rhizobium tubonense sp. P. New Phytologist. Zhang.. R. 1998 as new combinations: Rhizobium radiobacter.A. y Sawada. Young J. M. R.

4 gl–1) 5ml sol. MgSO4. 7H2O (10%) (o 0. 1970): 10g manitol o sacarosa 1ml sol. K2HPO4 (10%) (o 0.4 gl–1) 2ml sol.1 gl–1) 100ml extracto de levadura (o polvo 0.0 se reemplaza azul por Azul de Bromotimol por Verde de Bromocresol y se aumenta agar hasta 20 gl–1.1 gl–1) 4ml sol. 214 Manual de biología de suelos tropicales .2 gl–1) 1ml sol. Medio sólido: 15g Agar Medio semisólido: 1.1 Composición de medio 79 para el crecimiento de Bfn Medio 79 (Fred y Waksman.75g Agar Autoclave a 120°C durante 15 minutos.5% azul de bromotimol en 0. 1928) (similar a medio YMA – Vincent. para hacer 1000 ml con agua destilada pH 6. 0.8–7. NaCl (10%) (o 0.2 N KOH. KH2PO4 (10%) (o 0. Cuando pH <5.0.APÉNDICE 6.

....05% KN03 o NH4 NO3)..2 Solución de nutrientes Jensen’s para el crecimiento de espe- cies de leguminosas en bolsas de plástico y jarras de Leonard Componentes K2HPO4 (2%) MgSO4..APÉNDICE 6. 0.. o entre 7 a 10 días después de plantar............. Control Se proveen los controles con nitrógeno a una concentración final de aproximadamente 70 ppm N (0... Sin embargo. pues las dosis elevadas inhiben la nodulacíon.08 g Na2MoO4... Si al final del experimento esto resulta insuficiente para el crecimiento sostenido y el color verde de las plantas control........ ajustar con KOH..... 0.. Vicent (1970) recomienda la mezcla para una solución de nutrientes.000 ml pH = 6.......5H2O . diluida de la misma manera.. H3BO3 .7 % o FeCl3 1% Solución de micronutrientes* Agua destilada (completar a) Volumen 10 ml 10 ml 10 ml 10 ml 10 ml 1 ml 1. es decir.. También después se usa la solución con sirato en bolsas de plástico. Normalmente..86 g MnSO4..4H2O . entonces la concentración puede aumentar o hacer una suplementación dividida..7H2O (2%) NaCl (2%) CaHPO4(10%) FeCl3.. 2. los controles nitrogenados no presentan nódulos.22 g CuSO4... sin inoculación del suelo B acterias formadoras de nódulos en leguminosas 215 ....7% KNO3) pueden ser tóxicas.. Diluir solución a 1:4.....6H2O 1..... los controles absolutos....03 g ZnSO4. por lo tanto. Esto puede añadirse a la solución de nutrientes al principio del experimento.7H2O ..7. 0... las concentraciones más altas (>0..H2O .......09 g El mismo protocolo que para agar con semillitas.... * Solución de micronutrientes (para 1 l de agua).. 2.....

son necesarios para comprobar las condiciones asépticas del experimento. no mencionado por Vincent. es el uso de una cepa eficiente como un control positivo para la nodulación y la fijación de nitrógeno. Si existe la disponibilidad de las cepas recomendadas. Otro control importante. éstas deberán utilizarse. 216 Manual de biología de suelos tropicales .

hortícola y forestal. se ha demostrado que las plantas micorrizadas tienen mayor tolerancia a metales tóxicos. 1990. se encuentra bien documentado que los hongos micorrizógenos arbusculares (HMA) mejoran la salud y el crecimiento de las plantas de importancia agrícola. el fósforo disponible es muy bajo. Además. cobre y zinc. Bagyaraj y Sidney L. 1981. Los HMA han sido registrados en ecosistemas naturales como desiertos.. la agricultura se practica en áreas previamente ocupadas por dos principales ecosistemas naturales ricos en especies vegetales: bosques tropicales y sabanas. dunas de arena. altas temperaturas. sequía. esto limita el desarrollo de las plantas. Bagyaraj and Varma. La conversión de estos dos ecosistemas en agro-ecosistemas ya sea para agricultura de subsistencia. selvas tropicales. pH desfavorable del suelo y al choque por trasplante que sufren las plantas no micorrizadas (Mosse et al. por lo tanto.Capítulo 7 Hongos micorrizógenos arbusculares (HMA) Joseph D. salinas y sistemas manejados como praderas. patógenos de la raíz. La red de hifas producidas por los HMA en el suelo durante su asociación con la planta huésped. huertos y cultivos agrícolas (Brundrett. aumenta significativamente la captación de iones relativamente inmóviles. En los trópicos. producción de cultivos redituables o plantaciones forestales industriales provoca cambios en las características quí217 . 1991). provee una mayor superficie de absorción que los pelos radiculares y. Bagyaraj. salinidad. En la mayoría de los suelos tropicales. Stürmer INTRODUCCIÓN Actualmente. tales como fosfato. 1995).

De igual forma. Aunque comúnmente no es reportado. (1987) observaron un descenso en el número de esporas y un cambio en la composición de especies después del disturbio en algunos lugares de Australia.micas. estas determinaciones no detectan a las especies crípticas de HMA que no están esporulando en el momento del muestreo (pero que están asociadas con las plantas hospederas) e impiden la adecuada identificación de algunas especies. físicas y biológicas del ambiente edáfico. por lo general. se eliminan muchas especies vegetales de todas las edades y. se siembran con una sola especie de la misma edad. No obstante. En estos sitios. pastizales (Bever et al. generalmente. Mason et al. 1979) y la determinación de las unidades de colonización (UC) (Franson y Benthlenfalvay. 1979). La medición de la diversidad taxonómica de HMA se ha hecho. en donde se detectaron 28 morfotipos de HMA con Glomus aggregatum y dos especies de Glomus no descritas. Las macetas trampa preparadas con suelo de campo han sido usadas exitosamente para detectar y recobrar especies crípticas durante estudios de diversidad en huertos de manzano en regiones templadas (Miller et al. 1996). Jasper et al. encontraron una riqueza similar de especies en la selva tropical seca y en praderas con dominio de una especie. (1992) encontraron que el número de esporas de HMA en una plantación de Terminalia ivoriensis en Camerún disminuyó notablemente después de tres meses de una desforestación. También notaron un cambio en la composición de especies. las medidas de diversidad taxonómica deberían estar acompañadas de algunas evaluaciones de la actividad de la comunidad micorrízica. La medición del porcentaje de colonización (PC) (Moorman y Reeves. 1989) son también adecuadas. como los hongos dominantes.. La conversión de los ecosistemas naturales para distintos usos de suelo influye en la abundancia de esporas y composición de especies de HMA. La infectividad micorrízica se determina fácilmente por el método del número más probable (NMP) y puede servir para propósitos comparativos (Porter. Asimismo. 1985). Johnson y Wedin (1997). 1996) y también en desiertos (Stutz and Morton. sin embargo. a través de una cuenta directa y de la identificación de esporas recuperadas del campo. Picone (2000) demostró que la densidad de esporas y la comunidad fúngica disponible para la formación de micorrizas eran relativamente similares entre praderas y bosque tropical lluvioso. especialmente de los géneros Glomus y Gigaspora. 218 Manual de biología de suelos tropicales .. usualmente.

2000) y para erigir dos nuevos géneros en dos familias distintas (Morton and Redecker. se propone un esquema de clasificación para estudios de diversidad que surge de los esquemas de Morton y Benny (1990). La taxonomía y clasificación de los hongos micorrizógenos han cambiado radicalmente en los últimos años.. La formación de esporas en este género es similar a la de Glomus pero éste diferencia paredes germinales internas. colocando a este grupo de hongos en el mismo nivel que Basidiomycota y Ascomycota.. Se basa en una serie de diluciones decimales H ongos micorrizógenos arbusculares 219 . Por lo tanto. Gerdemann y Trappe (1974) incluyeron todas las especies de HMA dentro del orden Endogonales en la familia Endogonaceae (División Zygomycota). Schüßler et al. 1990. El método del Número Más Probable se ha utilizado para estimar el número de propágulos infectivos de HMA en varios suelos. Morton y Benny (1990) transfirieron todas las especies de HMA al orden Glomerales (División Zygomycota) con tres familias y seis géneros.1). cuando se requieren comparaciones entre los sistemas de uso de suelo.TAXONOMÍA Y CLASIFICACIÓN DE HMA Debe establecerse un esquema taxonómico antes de cualquier estudio de diversidad. Recientemente. MÉTODOS PARA EVALUAR PROPÁGULOS INFECTIVOS DE HMA Y COLONIZACIÓN MICORRÍZICA Número más probable (NMP) El protocolo propuesto para estimar la diversidad de HMA (descrito en el Capítulo 2) es el mismo que se sigue para todos los microorganismos y no será discutido aquí. Datos moleculares y morfológicos fueron usados para transferir a los miembros del género Sclerocystis a Glomus (Almeida y Schenck. 2001). Aunque se han aplicado técnicas moleculares para aclarar la clasificación filogenética entre las especies de HMA. Este género es incluido en el orden Diversisporales en la filogenia molecular propuesta por Schüßler et al. También incluyeron en el Nuevo esquema de clasificación tres nuevos órdenes y varias familias.. especialmente. (2001). (2001) transfirieron todas las especies de HMA a una nueva división monofilética: Glomeromycota. (2001) (Tabla 7. un género nuevo llamado Pacispora fue propuesto por Oehl y Sieverding (2004). la identificación de especies está basada principalmente en las características morfológicas de las esporas. Redecker et al. con aquellos de Morton y Redecker (2001) y Schüßler et al.

1 Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales. arbúsculos. en agregados laxos o en esporocarpos. Vesículas. No se observan paredes germinales diferenciadas. Berch (31 especies) Esporas formadas a los lados del cuello de un sáculo esporífero el cual deja una cicatriz en la superficie de la espora. Hifas intrarradicales raramente enrolladas.Tabla 7. La micorriza se tiñe débilmente. La pared de la espora esta formada por tres o cuatro capas y no se forma una verdadera bicapa germina. conectada a una hifa ramificada. Las vesículas y células auxiliares no están diferenciadas. Se presentan especies dimórficas formando esporas acaulosporoides y glomoides. Los arbúsculos e hifas intrarradicales se tiñen débilmente. solitarias. Germinación a través del lumen de la hifa de sostén o a través de la pared de la espora. Scharzott y Walker Orden Glomerales Morton y Benny Suborden Glomineae Morton y Benny Familia Glomeraceae Pirozysnki y Dalpé Glomus Tulasne y Tulasne (85 especies) Esporas formadas blásticamente sobre una hifa de sostén. La micorriza se tiñe muy obscuro. plana. Arbúsculos con troncos aplanados o cilindricos adelgazándose sucesivamente en las ramificaciones. Familia Acaulosporaceae Morton y Benny Acaulospora Gerd. Esporas con la pared esporal formada por un número variable de capas todas originadas a partir de la hifa de sostén. División Glomeromycota Schüßler. flexible. La pared germinal más interna tiene una superficie con excrecencias. Esporas con la pared esporal formada por dos capas. 220 Manual de biología de suelos tropicales . hifas intrarradicales y micorriza se tiñen como en Acaulospora. Otras estructuras subcelulares de la espora y germinación idéntica a la de Acaulospora. Familia Archaeosporaceae Morton y Redecker Archaeospora Morton y Redecker (una especie) Esporas formadas terminalmente de una hifa de sostén o como una ramificación de una estructura que semeja un sáculo esporífero. Germinación a través de una estructura de germinación esférica. Las vesículas varían en forma con protuberancias y concavidades. Vesículas de pared delgada y elipsoides. Entrophospora Ames y Schneider (cinco especies) Esporas formadas dentro de un cuello de un sáculo esporífero el cual deja dos cicatrices sobre la superficie de la espora. y Trappe emend. Hifas intrarradicales rectas o enrolladas cerca de los puntos de entrada.

1 Continúa Familia Ambisporaceae Walter. Scutellospora Walker y Sanders (30 especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. Esporas con la pared esporal formada por dos capas permanentes. Blaszkowski. Las paredes de la hifa de sostén son continuas con la primera y segunda capa de la pared esporal.Tabla 7. Arbúsculos e hifas intrarradicales similares en morfología a las de H ongos micorrizógenos arbusculares 221 . y germinan atreves de hifa suspensora. Pared de la espora generalmente formada por tres capas distintas y la pared germinal compuesta también por tres capas. No se forman vesículas. Las vesículas y células auxiliares no están diferenciadas. no se diferencian paredes germinales. No se forman vesículas. Vestberg & Schüßler Ambispora Walter. especialmente. Schüßler y Schwarzott Pacispora Sieverding y Oehl (siete species) Esporas formadas terminalmente de una hifa de sostén (como en Glomus). Germinación de la espora directamente de la pared germinal a través de la pared de la espora. cerca de los puntos de entrada. Las estructuras subcelulares de la espora y la germinación como en Glomus. Vestberg & Schüßler (ocho especies) Especies generalmente dimórficas con asociaciones micorrizicas produciendo morfotipos acaulosporoide y glomoides. Arbúsculos con troncos hinchados angostándose abruptamente en las ramificaciones. células auxiliaries que van de casi lisas a nodosas. Suborden Gigasporineae Morton y Benny Familia Gigasporaceae Morton y Benny Gigaspora Gerd. Familia Paraglomeraceae Morton and Redecker Paraglomus Morton y Redecker (dos especies) Esporas formadas terminalmente de una hifa de sostén como en Glomus. Al germinar. Esporos glomoides de forma aislada en el suelo o agregados en racimos. y Trappe (cinco especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. células auxiliares finamente papiladas o equinuladas. Los arbúsculos y las hifas intrarradicales se tiñen débilmente. Esporos acaulosporoide formado un apéndice hifal emergiendo lateralmente del cuello de un sáculo esporífero. La segunda capa de la pared germinal generalmente reacciona con el reactivo de Melzer. Familia Pacisporaceae Walker. Vesículas y arbúsculos las raíces teñidas en azul franco con azul tripano. a menudo nodosas o con proyecciones. se diferencia una capa delgada con verrugas esparcidas y crece un tubo germinativo a través de la pared esporal. Hifas intrarradicales frecuentemente enrolladas.

La ventaja es que. que se diferencia sobre la superficie de la última pared germinal. La planta hospedera recomendada para el ensayo del NMP es la cebolla. Una de las desventajas de esta prueba es que se requiere mucho tiempo para la preparación del bioensayo.edu.caf. 2004. Como el resultado es un solo número. ya que es dependiente de la micorriza y las raíces son fáciles de teñir. y puede llevarse a cabo por cualquiera que esté familiarizado con la morfología de la micorriza. Si no contamos con semillas de cebolla. de suelo en donde la presencia o ausencia de colonización micorrízica se registra y da como resultado el número más probable de propágulos infectivos. Fuente: compilado de Morton y Benny. pero el número calculado tiene hasta un 95 por ciento del nivel de confianza (Adelman y Morton. 2006 y http://invam.wvu. 222 Manual de biología de suelos tropicales . si tiene cierta dependencia micorrízica. Esporas con una pared formada por dos capas permanentes y de una a tres paredes germinales internas. cada una con dos capas. se pueden utilizar gramíneas C4. Sin embargo. Oehl y Sieverding. Materiales necesarios • • • • tubetes para plantas (150 X 2.5 cm) y gradillas bolsas de plástico (30 X 20 cm) diluyente esterilizado (arena: mezcla de suelo 1:1) semillas de cebolla. El tubo de germinación crece a partir de un escudo flexible plano. basándose en una tabla estadística. como el sorgo y el Paspalum. se puede utilizar cualquier otro hospedero.. 1986). 1990.Tabla 7.1 Continúa Gigaspora. el análisis de las raíces de las plantas trampa para comprobar la colonización es fácil y rápido. el método es apropiado para comparaciones entre sistemas con diferente uso del suelo si los ensayos del NMP se establecen de forma simultánea. Spain et al.

considerando las cinco réplicas (tubetes) para cada una de los cuatro diluciones (10-1. Pesar 30 g de suelo de campo en una bolsa de plástico y añadirle 270 g del diluyente esterilizado. 5. tres réplicas fueron positivas en la dilución 10-3 y dos réplicas fueron positivas en la dilución 10-4. Utilice las tablas de Cochran (1950). El primer número (N1) corresponde al número de tubetes positivos para la colonización micorrízica en la dilución que muestra el mayor número de tubetes positivos (se toma la serie menos concentrada. Al cosechar. 6. En este ejemplo. Agitar bien para obtener una dilución 10-1. 3. Esto significa que las cinco réplicas fueron positivas para la colonización micorrízica en las diluciones 10-1 y 10-2. 10-2. lavar el suelo de las raíces y teñirlas con azul de tripán (véase más abajo). la combinación sería: N1 = 5. 2. El número de tubetes positivos (los que contienen colonización) en diluciones diferentes se utilizan para calcular los valores de NMP. N2 = 3 y N3 = 2. hacer cinco replicas por cada dilución. Sembrar las semillas de cebolla en cada tubete. Para el cálculo del NMP. 2. H ongos micorrizógenos arbusculares 223 . 10-3 y 10-4). 3. Los otros dos números (N2 y N3) son los correspondientes a las próximas dos diluciones. Retirar 30 g de la dilución anterior y colocarlo en otra bolsa que contiene 270 g del diluyente estéril. determinar la presencia o ausencia de colonización micorrízica en cada réplica. Agitar bien para obtener una dilución decimal. dejar una sola planta por tubete y dejarlas crecer en un invernadero o en una cámara de crecimiento durante seis semanas. 5. Supongamos que. 4.Procedimiento 1. sólo tres números de una secuencia dada son necesarios. hacer más diluciones decimales hasta la dilución 10-4 (o más. 7. de Fisher y Yates (1963) o Alexander (1965). se obtiene la siguiente secuencia de números de tubetes positivos: 5. Bajo un microscopio de disección. si es necesario). si no se dispone de las semillas de cebolla puede utilizar cualquier otro hospedero (ver arriba). Distribuir el suelo de cada dilución en los tubetes para plantas. El procedimiento para el cálculo del NMP. si el número de tubetes positivos es el mismo en diluciones posteriores). se ilustra con el siguiente ejemplo. Después de emerger.

50 ml de de HCl al 1%) • azul de tripano 0. Procedimiento 1. Sumergir las raíces en KOH a 90°C por una hora o a 120°C por 15 minutos en autoclave. 567ml de agua). 224 Manual de biología de suelos tropicales . El método más ampliamente utilizado es el descrito por Philips y Hayman (1970).4. mientras que Koske y Gemma (1989) modificaron el procedimiento mediante la eliminación de ácido láctico de estas soluciones sin interferir con la intensidad de la tinción. Por lo tanto.05 % en solución de glicerol (0. Para obtener el NMP de propágulos infectivos de HMA en la muestra. para detectar y medir la colonización micorrízica. 450 ml de H2O. Por lo tanto. Materiales necesarios • solución de KOH al 10% (hidróxido de potasio) • solución de HCl al 1% (ácido clorhídrico) • solución acidificada de glicerol. (en este caso 10-3). Kormanik y McGraw (1982) eliminan el fenol en las soluciones para tinción y decoloración. 30 ml de H2O2 al 3%. 2. este valor debe de ser multiplicado por la dilución media. las raíces son sometidas a un procedimiento de clareo y tinción.Usando la tabla del NMP el valor dado para esta combinación de tubetes positivos es 1. se propone para la tinción de raíces el método de Philips y Hayman (1970) modificado por Koske y Gemma (1989).4 X 10-3 propágulos infectivos g–1. Tinción de raíces para observar la colonización micorrízica La colonización de las células corticales de la raíz por HMA. el suelo tiene 1. Teniendo en cuenta el costo de los productos químicos y el ahorro al reducir el número de productos químicos sin interferir con la calidad de la tinción.5 g/l) • H2O2 alcalinizada (3 ml NH4OH al 20%. no altera la morfología de la raíz. Lavar las raíces para eliminar residuos de suelo y enjuagar con varios cambios de agua. en contraste con las asociaciones ectomicorrízicas. (500 ml de glicerol.

Eliminar el KOH y enjuagar las raíces con agua (dos o tres veces) para quitar el exceso de KOH. H ongos micorrizógenos arbusculares 225 . la solución de glicerol acidificada puede ser reemplazada por una solución de lactoglicerol (20 ml de ácido láctico.1 cm. Sumerga las raíces en HCL al 1% por cinco minutos. 7. la solución de agua oxigenada alcalinizada debe de prepararse justo antes de su uso. Si las raíces están demasiado pigmentadas se deben sumergir en agua oxigenada alcalinizada durante 10-30 minutos. Tiña las raíces en una solución de glicerol ácido con azul de tripano a 90°C por una hora o a 120 °C por cinco minutos. Elimine el HCl. Descargue la solución colorante y mantenga las raíces en glicerol acidificado (sin azul de tripano) o agua a temperatura ambiente o 4°C. El paso 4 puede ser omitido si las raíces no están muy pigmentadas. un baño de agua a 90°C es apropiado para mantener las muestras. Enjuagar nuevamente las raíces con agua. 8. es usado comúnmente para medir la longitud de la raíz y el porcentaje de la colonización micorrízica. 6. Esta medida estima el crecimiento de un aislamiento de un hongo o de una comunidad fúngica dentro de la corteza de la raíz. • Agujas de disección. 1980) que se presenta a continuación. Material necesario • Cajas de Petri cuadriculadas en la base con cuadrados de 1.1 x 1. las raíces pueden guardarse en agua adicionada con unas gotas de azida de sodio al 0. Para los pasos 2 y 7. 5. Para almacenar por un tiempo largo. No enjuague las raíces en esta paso ya que éstas deben estar acidificadas para una tinción adecuada. El método de intersección de cuadrante (Giovannetti y Mosse. 40ml de glicerol y 40 ml de agua destilada). se realiza con frecuencia en raíces colectadas de campo (sacadas directamente del suelo o de plantas individuales) o en plantas experimentales. 4.01%. crecidas bajo condiciones del invernadero. Medición de la colonización micorrízica La determinación de la colonización micorrízica de la raíz. Comentarios: si lo desea.3.

Comentarios: los datos obtenidos en el paso 3. Las esporas se extraen del suelo mediante un tamizado húmedo (Gerdemann y Nicolson. con estructuras micorrízicas. En una caja de Petri extienda al azar las raíces teñidas. 2.wvu. Calcule el porcentaje de colonización micorrízica (% CM) utilizando la siguiente fórmula: % CM = (Número total de intersecciones con raíces micorrizadas/ Número total de intersecciones entre la raíz y las líneas de la cuadrícula) X 100. Es posible calcular la longitud total de la raíz y la longitud de la raíz micorrízada de la planta completa. 3. 4. Para más detalles ver http://invam. Registre: a) el número total de intersecciones de las raíces y las líneas de la cuadricula y b) el número de intersecciones con raíces micorrizadas.. De esta manera. el total de la longitud de la raíz micorrizada será el número de intersecciones. Bajo el microscopio de disección explore las líneas horizontales y verticales de la cuadrícula. 1995). las esporas son la única parte del organismo del hongo que puede utilizarse para delimitar las especies. La morfología del micelio interno y externo durante la asociación micorrízica es prácticamente indistinguible entre las especies del mismo género y entre géneros. Si se toma una muestra pequeña de toda la raíz.edu/ methods/mycorrhizae/rootlengths. Métodos para evaluar la diversidad de HMA Extracción de esporas del campo La Identificación de las especies de HMA está basada en el análisis de estructuras subcelulares de las esporas asexuales. usando la relación entre el peso seco de la planta y la submuestra. Si toda la raíz se extiende en la caja de Petri. Por lo tanto. 1963). se teñirá y se medirá en el microscopio con este método.htm.1 cm. las estructuras subcelulares de las esporas están altamente conservadas y son fenotípicamente estables independientemente del ambiente y la planta huésped (Morton et al. seguido por centrifugación en un gradiente de sacarosa. En contraste. representan la longitud total de la raíz en cm.Procedimiento 1. 226 Manual de biología de suelos tropicales . con las líneas de la cuadricula separadas en 1.caf. el número total de raíces que interceptan las líneas de la cuadricula. también se pueden utilizar para determinar las longitudes tanto de la raíz completa como de la raíz micorrizada.

el numero de intersecciones entre una raíz y las líneas horizontales y verticales tendríamos: • 25 intersecciones (Línea horizontal) • 18 intersecciones (Línea vertical) y • 12 intersecciones (Puntos negros) presentando colonización micorrizica. Materiales necesarios • Un juego de tamices anidados que tengan al menos 710 µm y 45 µm de abertura de malla. • El porcentaje de colonización micorrízica= (12/43) x 100=27. cajas de Petri. Nota. • Por lo tanto. Ejemplo. Figura 7. • Vasos de precipitados.9%. vidrio de reloj. el largo de la raíz = 43 cm (25 + 18) y el largo de la raíz micorrizada=12 cm (Seis intersecciones positivas sobre líneas horizontales y seis intersecciones positivas sobre líneas verticales).1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. • Cubeta de plástico o un vaso de precipitados grande. • Tubos para centrífuga y centrífuga. • Soluciones de sacarosa (20 % y 60%).1 provee una ilustración del método de intersección de línea. H ongos micorrizógenos arbusculares 227 .Figura 7. En el diagrama las infecciones de micorrizas son representadas con puntos negros. después de expander las raíces.

ya que el tamaño de las esporas de HMA para la mayoría de las especies está en un intervalo de 40 a 600 μm. 228 Manual de biología de suelos tropicales . en el fondo. 2. Las esporas pueden separarse de los residuos orgánicos y recogerse de la caja de Petri usando unas pinzas finas o una pipeta Pasteur adelgazada en la punta. comprada en el supermercado. 1979) para dispersar las partículas de arcilla y liberar las aberturas del tamiz. Comentarios: en el paso 3. Colocar 100 g de la muestra de suelo en la cubeta /vaso de precipitados y suspender en. agregue otros 15 ml de la solución al 60% . 3. Esto separa a las esporas por tamaños pero incrementa la cantidad de trabajo ya que el material retenido en cada tamiz debe centrifugarse por separado. 4. Los tamices recomendados (con mallas de 710 µm y 45 µm) son adecuados para recuperar la mayoría de especies. Coloque el material retenido en el tamiz de 45 µm en una vaso de precipitados con una pequeña cantidad de agua. La solución de sacarosa se hace con azúcar comercial. Pasar la suspensión repetidamente a través de dos tamices anidados con abertura de malla de 710 µm y 45 µm. al menos. si hay demasiados pedazos de raíz y otros desechos. después transfiera este material a un tubo de centrífuga que contenga un gradiente de sacarosa de 20–60%. Agitar hasta que las esporas queden suspendidas y dejar reposar 30 segundos . 500 ml de agua. agregue 15 ml de la solución de sacarosa al 20% en un tubo de centrífuga de 50 ml y después. Sin embargo. En este momento. 6. Los suelos con alto contenido de arcilla pueden obstruir los tamices. 8.000 rpm durante 60 segundos. Transferir las esporas y el material retenido en el tamiz 45 µm a una caja de Petri y bajo el microscopio colecte las esporas en un vidrio de reloj limpio.Procedimiento 1. Coloque el material retenido en el tamiz de 710 µm en una caja de Petri grande y observe bajo el microscopio de disección para observar esporas grandes (esporas de Gigaspora y Scutellospora) y esporocarpos. se pueden anidar otros tamices entre los dos recomendados. Para preparar el gradiente de la sacarosa. Centrifugue a 2. es preferible vaciar la suspensión de suelo a través de un tamiz de 1 mm antes de pasar por el tamiz de 710 μm. 7. se puede agregar una pequeña cantidad de pirofosfato de sodio a 0. las esporas se pueden separar por morfotipos de acuerdo con su color y tamaño y si las esporas están en buen estado se pueden identificar hasta género y especie. 5. Vacíe el sobrenadante en el tamiz de 45 µm y lave con agua corriente para quitar el exceso de sacarosa.1M (Fogel y Hunt.

USA) sitio web (http://invam. café.Identificación de especies y montaje de preparaciones En la mayoría de los casos. falta de buenas fotografías para las comparaciones y las descripciones están hechas con esporas extraídas del suelo de campo por lo cual pueden no incluir características taxonómicas importantes).edu) y por Dr. En los anexos 1. y por consiguiente. La ilustración 4 muestra las esporas y las estructuras producidas por las especies de la familia Gigasporaceae (fotografías a. la INVAM y el sitio de Blaszkowski poseen excelentes fotografías con detalles de la estructura subcelular de las esporas. c) un detalle de la ornamentación de H ongos micorrizógenos arbusculares 229 . Algunas claves de identificación para HMA (por ejemplo Hall y Fish. g. y h). 1990) y comparando con las descripciones e ilustraciones de las especies proporcionadas por el Dr. West Virginia University. contrastando con el color hialino de las esporas). Poland) en http://www. Janusz Blaszkowski (Department of Plant Pathology of the Agricultural University of Szczecin. La identificación de especies de HMA se puede hacer por comparación con la descripción original de la especie.szczecin. 3 y 4 se proporcionan los nombres de las especies y los autores. Koske y Walker (1985) proponen una clave para algunas especies de Scutellospora con esporas con paredes ornamentadas. 2. Sin embargo. a la vez que Bentivenga y Morton (1995) proponen una clave para identificar las cinco especies de Gigaspora. El manual de Schenck y Pérez es una copia de las descripciones originales de las especies y por lo tanto. 1979. usando como referencia al Manual para la identificación de HMA (Schenck y Pérez. de 160 especies de HMA descritas en total. b) espora de Scutellospora scutata con la hifa de sostén bulbosa (note el escudo de germinación redondo.. las esporas extraídas del campo no son identificables bajo el microscopio de disección. el tamaño de las esporas y una descripción estandarizada de las especies de HMA.ar. W. 1982) se publicaron antes de algunas revisiones de taxonomía recientes e importantes. Por otro lado. deben ser montadas en portaobjetos y observadas en un microscopio compuesto. b. Joseph Morton en la INVAM (Colección Internacional de hongos micorrizógenos arbusculares.caf. este manual incorpora en un solo volumen toda la descripción de las especies hasta 1990. Trappe. c y d) y Acaulosporaceae (e. f. alberga todos los problemas inherentes a esas descripciones (falta de estandarización de las estructuras subcelulares de las esporas. Fotografías de esporas de especies representativas de diferentes géneros se muestran en las ilustraciones 4 y 5.pl/~jblaszkowski. en estos sitios web se describen 79 y 55 especies respectivamente.wvu.agro. La fotografia a) muestran una espora de Gigaspora albida con la hifa de sostén bulbosa típica de esta familia.V.

Archaeosporaceae (e y f) y Paraglomeraceae (g y h). en la foto d). Foto a): espora de Glomus clarum indicando la hifa de sostén (note que la capa más interna de la pared de la espora se desprende y se ve parecida a la pared germinal. esporas de Acaulospora sp. b. finalmente. y d) células auxiliares nodosas que diferencian a los miembros de Scutellospora. La fotografía g) representa una espora de Acaulospora scrobiculata que muestra la cicatriz que queda en la espora después de que el sáculo esporifero se desprende. número de paredes germinales y grosor de la pared de la espora. Un esporocarpo de Glomus clavispora se observa en la foto c) y un esporocarpo de Glomus sp. cubreobjetos y etiquetas • Agujas de disección 230 Manual de biología de suelos tropicales . forma. la foto f) muestra un detalle de Archaeospora leptoticha en donde se observan protuberancias y depresiones de las capas 2 y 3 de la pared esporal (indicada con flechas). En la foto e) se muestra una espora de Entrophospora colombiana (familia Acaulosporaceae) con la pared de la espora. La foto e) muestra un espora de Archaeospora leptoticha con el sáculo esporífero. Las esporas necesitan montarse en líquidos de montar permanentes como son el PVLG (alcohol polivínilico lactoglicerol) y PVLG mezclado con reactivo de Melzer. L2 y L3) de Paraglomus occultum y en la foto h) se muestra una espora de Paraglomus brasilianum. también con la pared formada por tres capas (L1. d). Una espora de Entrophospora colombiana mostrando las dos cicatrices características se ve en la foto f). En el microscopio compuesto pueden observarse algunas características taxonómicas importantes como son la presencia y tipo de ornamentación sobre la pared de la espora. la pared germinal 1 (gw1) y la pared germinal 2 (gw2) con su capa más interna reaccionando al reactivo de Melzer. presencia de hifa de sostén. L2 y L3) (la capa L2 está ornamentada con pequeñas crestas). la foto g) ejemplifica la estructura de la pared formada por tres capas (L1. Materiales necesarios • Portaobjetos. mostrando algunos sáculos esporíferos adheridos a las esporas. Las características taxonómicas importantes que pueden observarse bajo el microscopio de disección son tamaño de las esporas. de células suspensoras y del sáculo esporífero (raramente observado en esporas recolectadas directamente del campo). color. en la foto h).la pared de las esporas (verrugas) de Scutellospora coralloidea. c. La foto b) muestra la pared de la hifa de sostén continua con la pared de la espora de un Glomus sp. se observan. reacción al Melzer. La ilustración 6 muestra a las esporas y estructuras producidas por especies de la familia Glomeraceae (a.

Además. colocar una gota de PVLG y una gota de la solución de PVLG + Melzer. Coloque suavemente un cubre objeto sobre la gota de PVLG y otro cubreobjetos sobre la gota de PVLG + Solución de Melzer. 100 ml de agua destilada. mezcle las esporas en la solución de PVLG y de PVLG + Solución de Melzer y deje secar la superficie de la gota por lo menos cinco minutos. En un porta objetos. Colocar las esporas al centro de cada gota usando un pinza fina o una micropipeta (en este caso. 1. si se agrega demasiada agua. en el momento del muestreo. Guardar las preparaciones a temperatura ambiente durante cinco días y luego incubar a 40-60ºC. 2. 3. 100 ml de ácido láctico. ofrecen esporas nuevas y saludables que pueden ser utilizadas para establecer cultivos puros de HMA. 7. Con una aguja de disección. Etiquetar las preparaciones incluyendo número de muestra. 16. las esporas se deslizan hasta los bordes cuando se coloca el cubreobjetos en la parte superior de cada gota. El método propuesto se basa en los protocolos de Stutz y Morton (1996). tenga cuidado de no agregar demasiada agua). Mezclar el reactivo de Melzer con el PVLG (1:1) para preparar la solución de PVLG + Melzer. H ongos micorrizógenos arbusculares 231 . 6. Comentarios: el paso 2 es crucial para el montaje de las esporas sobre el portaobjetos.• Solución de PVLG (100 ml de agua destilada.5 g Iodo. género y especie (si se conoce). 5 g de yoduro de potasio. durante dos días para endurecer el medio de montaje. 5. 4. y fecha. Establecimiento de cultivos trampa Los cultivos trampa se utilizan con más frecuencia en estudios de diversidad de HMA porque revelan las especies que no están esporulando en el campo. 10 ml de glicerol. Procedimiento 1.6 g de alcohol polivínilico (PVA) • Reactivo de Melzer (100 g de hidrato de cloral. rompa cada espora individualmente bajo el microscopio de disección. Usando una aguja de disección. Este paso es importante para exponer las paredes germinales y sus capas.

in A. REFERENCIAS Adelman. Part 2: Chemical and Microbiological Methods. Madison. Cubrir las semillas con la mezcla de suelo y arena. (1965) ‘Most-Probable-Number Method for Microbial Populations’. J. 3. y Schenck. bajo condiciones del invernadero. vol. (1986) ‘Infectivity of vesicular-arbuscular mycorrhizal fungi: Influence of host-soil diluent combinations on MPN estimates and percentage colonization’. pp. 703–714. M. 18. Glomales)’.Soil Biology and Biochemistry. 232 Manual de biología de suelos tropicales . M.5 kg Bandejas o bolsas de plástico Semillas de Sorghum sudanense (Sorgo) y Vigna unguiculata (Frijol) Procedimiento 1 En una bandeja de plástico (o en una bolsa de plástico). 7–13. T. Se recomienda cualquier gramínea C4 y/o leguminosa como hospederas. J. vol. T. Klute (ed) Methods of Soil Analysis. se incluyan las raíces de las plantas ya que también sirven como propágulos para iniciar los cultivos trampa. si el sorgo y frijol no están disponibles. según lo explicado arriba. pp . (1990) ‘A Revision of the Genus Sclerocystis (Glomaceae. donde las plantas intactas colectadas del campo se trasplantan a una maceta con un sustrato libre de HMA y se evalúa la esporulación después de tres a cuatro meses. (1996) utilizan un procedimiento diferente para establecer cultivos trampa. 1467–1472. pp.5 kg y sembrar abundantemente con una mezcla de semillas de sorgo y frijol (40-50 semillas por maceta). Almeida. R. 2 Colocar esta mezcla en macetas de plástico de 1. En el paso 2. N. Mycologia. Después de tres a cuatro meses. otras plantas hospederas pueden utilizarse. Soil ScienceSociety of America. Wisconsin. y Morton. extraer las esporas e identificarlas. colecte uno o dos núcleos de suelo de 50 ml de cada maceta. 82. Alexander. Bever et al. homogeneizar el suelo de campo con arena estéril (50% de suelo de campo y 50% de arena). durante el muestreo de suelo de campo. Comentarios: es importante que. B. llamado “cultivos trampa de trasplante”.Materiales necesarios • • • • Arena estéril Macetas de plástico de 1.

J. 6. 87.. Marcel Dekker Inc. D. pp. J. Bagyaraj. D. 641–652. B. vol. R. Antonovics. 46. 720–732. Journal of Ecology. Mukerjii and G. 9. Franson. Gerdemann. pp. (1991) ‘Mycorrhizas in natural ecosystems’.. K. Giovannetti. Bever. Cochran. J. pp. Bentivenga. W. Advances in Ecological Research. K. Agricultural and Medical Research. J. (1995) ‘Interaction between arbuscular mycorrhizal fungi and plants: Their importance in sustainable agriculture and in arid and semiarid tropics’. New York. B. M. A. J. vol. pp. Morton J. J. (1987) ‘The effect of surface mining on the infectivity of vesicular-arbuscular mycorrhizal fungi’. vol. in D. P.. vol. W. Australian Journal of Botany. y Fish. R. B. vol. vol. vol. pp. 14. Robson. A. y Varma. R. 489– 500. J. L. incorporating developmental patterns of morphological characters’. 119–142. 84. y Yates. R. (1974) ‘Endogonaceae in the Pacific Northwest’. (1950) ‘Present status of biometry’. (1979) ‘Fungal and arboreal biomass in a Western Oregon Douglas-fir ecosystem: Distribution pattern and turnover’. P. 53. (1979) ‘A key to the Endogonaceae’. Transactions of the British Mycological Society. L. 75–78. Jasper. D. H. Hall. (1980) ‘An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots’. vol. pp. W. Rai. (1995) ‘A monograph of the genus Gigaspora. I. H ongos micorrizógenos arbusculares 233 . S. 235–244. D. Fogel. y Mosse. (eds) (1963) Statistical Tables for Biological. F. vol. Transactions of the British mycological Society. J. vol. T. Advances in Microbial Ecology. y Morton. y Bethlenfalvay. (1990) ‘Ecology of vesicular-arbuscular mycorrhizae’. 245–256. y Abbott. G. A. Biometrics. pp. R. pp. Brundrett. Knudsen (eds) Handbook of Applied Mycology: Soil and Plants. 73. J. 261–270. A. (1996) ‘Host-dependent sporulation and species diversity of arbuscular mycorrhizal fungi in a mown grassland’. Fisher. New Phytologist. Mycol ogi a. M. D. 1–76. C. 21. pp. G. 171–213. y Trappe. J. vol. 754–756. Edinburgh..Bagyaraj. Oliver and Boyd. vol. y Hunt. pp . K. 71–82. Mycologia Memoir. pp. Arora. Gerdemann. 35. M. y Nicolson. y Schultz. 5. B. (1963) ‘Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting’. Soil Science Society of America Journal. A. G. 84. G. pp. Canadian Journal of Forest Research. (1989) ‘Infection unit method of vesicular-arbuscular mycorrhizal propagule determination’.

Mycotaxon. y Hayman. Domoto. F. (1979) ‘The role of endomycorrhizae in revegetation practices in the semi-arid West. 702–720. y Benny. New Phytologist. pp. F. Advances in Microbial Ecology. (1985) ‘Mycorrhizal fungi at eighteen apple rootstocks plantings in the United States’. American Phytopathological Society. y Last. and interpretation of diversity in arbuscular endomycorrhizal fungi (Glomales. 77. L. a new vesicular-arbuscular mycorrhizal fungal genus in the Glomeromycetes’. y Walker. J. (1982) ‘Quantification of vesicular-arbuscular mycorrhizae in plant roots’. vol. Acaulosporaceae and Gigasporaceae. pp. Koske. P. CAB International Wallingford. R. D. M. 73 (suppl. and two new families. Transactions of the British mycological Society. D. 379–391. O. y Walker. Stribley. Mycological Research. J. B. 78. Mosse. J. J. Fitter and I. 7. J. D. Mycologia. G. P. D. 137–210. 261–267. vol. in N. P. 158–161. P. Moorman. H. B. (1989) ‘A modified procedure for staining roots to detect VA mycorrhizas’. pp. 14–18. E. Paul. Canadian Journal of Botany. (1985) ‘Species of Gigaspora (Endogonaceae) with roughened outer walls’. Journal of Applied Botany. in D. C. Kormanik. 92. based on concordant molecular and morphological characters’. (1981) ‘Ecology of mycorrhizae and mycorrhizal fungi’. R. S25–S32. Miller. y Wedin. 66. T. F. with an emendation of Glomaceae’. y Gemma. vol. Musoko. N. y Le Tacon. Archaeosporaceae and Paraglomaceae. (1970) ‘Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection’. Ecological Applications. Morton. Read.. Lewis. 234 Manual de biología de suelos tropicales . D. Philips.. vol. T. C. D. vol. 171–182. B. two new suborders. P. A. y Sieverding E. pp. N. Mason. Bentivenga. Glomineae and Gigasporineae. pp. D. pp. vol. Zygomycetes)’. y Redecker. pp. Oehl. S. vol.. St. 471–491. vol. A. H. A. 100. J. 93. 5.. Schenck (ed) Methods and Principles of Mycorrhizal Research. C. pp. 72–82. y McGraw. (1992) ‘Short-term changes in vesicular-arbuscular mycorrhizal spore populations in Terminalia plantations in Cameroon’. with two new genera Archaeospora and Paraglomus. M. Morton.Johnson. C. 37. vol. (1990) ‘Revised classification of arbuscular mycorrhizal fungi (Zygomycetes): A new order. E. C. B. y Bever. Koske. (2004) ‘Pacispora. 486–505. D. S. J. (1997) ‘Soil carbon. y Reeves. 1). (2001) ‘Two new families of Glomales. nutrients and mycorrhizae during conversion of dry tropical forest to grassland’. 55. American Journal of Botany. pp. P. B. Glomales. J. Mycologia. (1995) ‘Discovery. II: A bioassay to determine the effect of land disturbance on endomycorrhizal populations’. Alexander (eds) Mycorrhizas in Ecosystems. vol. A. A. measurement. E. vol. pp. pp. pp. 181–195 Morton.

Canadian Journal of Botany. Schwarzott. vol. (1990) Manual for Identification of VA Mycorrhizal Fungi. F. pp. y Morton. pp. B. J. with a discussion of the genus Archaeospora. y Bruns. Mycologia. Mycological Research. 74. T. H ongos micorrizógenos arbusculares 235 . J. Schenck. vol.Picone. J. (2000) ‘Diversity and abundance of arbuscular-mycorrhizal fungus spores in tropical forest and pasture’.. (2001) ‘A new fungal phylum. N. Porter. 1883–1889. C. Stutz. A. 734–750. pp.. D. vol. E. Biotropica. 1413–1421. Sieverding. pp515–519. C. Trappe. pp. Redecker. 17. y Walker. M.. C. 32. Spain. J. 1102–1108. D. 92. vol. Appendicispora: a new genius in the arbuscular micorrhiza-forming Glomeromycetes. 163-182. Y. D. vol. vol. 105. Mycotaxon vol 97. B. Synergistic Publications. 2006. pp. 72. (1996) ‘Successive pot cultures reveal high species richness of arbuscular endomycorrhizal fungi in arid ecosystems’. Gainesville.L. USA. 3rd Edition. (1982) ‘Synoptic key to the genera and species of Zygomycetous mycorrhizal fungi’. 282–285. Phytopathology. the Glomeromycota: Phylogeny and evolution’. W. M. (2000) ‘Molecular phylogeny of the arbuscular mycorrhizal fungi Glomus sinuosum and Sclerocystis coremioides’. y Oehl. Australian Journal of Soil Research. pp. Schübler. Morton. C. y Pérez. (1979) ‘Most Probable Number method for enumerating infective propagules of vesicular arbuscular mycorrhizal fungi in soil’. J.

callosum Sieverding G. y Gerd. citricola Tang y Zang G. y Gerd. Tadych y Madej G. laccatum Blaszkowski G. corymbiforme Blaszkowski G. convolutum Gerd. y Broome) Redecker y Morton G. pallidum Hall G. australe (Berkeley) Berch G. pansihalos Berch y Koske G. pubescens (Sacc. Especies de HMA de la familia Glomeraceae. monosporum Gerdemann y Trappe G. minutum Blaszk. liquidambaris (Wu y Chen) Almeida y Schenck G. G. Blanke. multisubstensum Mukerji. microcarpum Tulasne y Tulasne G. y Schenck G. magnicaule Hall G. clarum Nicol. y Bakshi G. y Ellis) Trappe y Gerdemann 236 Manual de biología de suelos tropicales . género Glomus Género/Especies Glomus G. lacteum Rose y Trappe G. Sieverding y Schenck G. Bhattacharjee y Tewari G. clavisporum (Trappe) Almeida y Schenck G. multicaule Gerd. manihotis Howeler. macrocarpum Tulasne y Tulasne G. Gemma y Olexia G.) Gerd. cerebriforme McGee G. coremioides (Berk.. antarticum Cabello G. microaggregatum Koske. aggregatum Schenck y Smith G. botryoides Rothwell y Victor G. mosseae (Nicol. mortonii Bentivenga y Hetrick G. melanosporum Gerd. canadense (Thaxter) Trappe y Gerd. caledonium (Nicol. maculosum Miller y Walker G. y Trappe G. delhiense Mukerji. Bhattacharjee y Tewari G. G. albidum Walker y Rhodes G. coronatum Giovannetti G. claroideum Schenck y Smith G. G. aurantium Blaszkowski. przelewicensis Blaszkowski G.Apéndice 7. y Trappe G. boreale (Thaxter) Trappe y Gerd. arborense McGee G. nanolumen Koske y Gemma G.1.) Trappe y Gerd. proliferum Dalpe y Declerck G. ambisporum Smith y Schenck G. y Trappe G. invermaium Hall G. constrictum Trappe G. Renker y Buscot G.

Friese.wvu. rubiforme (Gerd. etunicatum Becker y Gerdemann G. reticulatum Bhattacharjee y Mukerji G. glomerulatum Sieverding G. tenebrosum (Thaxter) Berch G. Spooner y Ivory G.) Walker G. G. diaphanum Morton y Walker G. halonatum Rose y Trappe G.caf. fuegianum (Spegazzini) Trappe y Gerdemann G. versiforme (Karsten) Berch G.edu. formosanum Wu y Chen G. Renker y Buscot G.1. globiferum Koske y Walker G. fulvum (Berk. Blanke.Apéndice 7. y Trappe) Almeida y Schenck G. dominikii Blaszkowski G. tenerum Tandy emend. y Trappe G. pulvinatum (Henn. G. xanthium Blaszk. McGee G. deserticola Trappe. warcupii McGee H ongos micorrizógenos arbusculares 237 . insculptum Blaszkowski G. Continúa Género/Especies G. intraradices Schenck y Smith Fuente: tomado de http://invam. fragilistratum Skou y Jakobsen G.) Trappe y Gerdemann G. taiwananse (Wu y Chen) Almeida y Schenck G. fasciculatum (Thaxter) Gerd. y Broome) Trappe y Gerd. G. sterilum Mehrotra y Baijal G. trimurales Koske y Halvorson G. flavisporum (Lange y Lund) Trappe y Gerd. heterosporum Smith y Schenck G. vesiculiferum (Thaxter) Gerd. radiatum (Thaxter) Trappe y Gerd.. segmentatum Trappe. tubiforme Tandy G. G. sinuosum (Gerd. Walker y Dalpe G. hoi Berch y Trappe G. dimorphicum Boyetchko y Tewari G. tortuosum Schenck y Smith G. y Gerd. Walker y Koske G. y Bakshi) Almeida y Schenck G. y Broome) Trappe y Gerd. Bloss y Menge G. viscosum Nicol. G. tenue (Greenhall) Hall G. geosporum (Nicol. G. y Trappe emend. pustulatum Koske. fragile (Berk.

mellea Spain y Schenck A.wvu. bireticulata Rothwell y Trappe A. myriocarpa Spain. cavernata Blaszkowski A. thomii Blaszkowski A. Chaverri y Rojas A. laevis Gerdemann y Trappe A. baltica Blaszkowski E. undulata Sieverding A. schenckii Sieverding y Toro 238 Manual de biología de suelos tropicales . morrowiae Spain y Schenck A. nicolsonii Walker. Reed y Sanders A. foveata Trappe y Janos A. tuberculata Janos y Trappe A. walkeri Kramadibrata y Hedger Entrophospora E. colombiana Spain y Schenck E.2. koskei Blaszkowski A. infrequens (Hall) Ames y Schneider4 E. scrobiculata Trappe A. Sieverding y Schenck A. longula Spain y Schenck A. rugosa Morton A. spinosa Walker y Trappe A. splendida Sieverding. polonica Blaszkowski A. dilatata Morton A. A. gedanensis Blaszkowski A. Pfeiffer y Bloss A. delicata Walker. rehmii Sieverding y Toro A. elegans Trappe y Gerdemann A. géneros Acaulospora y Entrophospora Género /Especies Acaulospora A. lacunosa Morton A. sporocarpia Berch A. capsicula Blaszkowski A.caf. taiwania Hu A. excavata Ingleby y Walker A. paulineae Blaszkowski Fuente: tomado de http://invam. denticulata Sieverding y Toro A. Especies de HMA de la familia Acaulosporaceae. kentinensis Wu y Liu E.Apéndice 7.edu.

brasilianum (Spain y Miranda) Morton y Redecker P. Daniels y Trappe) Morton y Redecker Ar. leptoticha (Schenck y Smith) Morton y Redecker Paraglomus P.3. y Oehl P. dominikii Sieverd. trappei (Ames y Linderman) Morton y Redecker Ar.Apéndice 7. coralloidea Sieverd. chimonobambusae Blaszk. y Oehl Fuente: tomado de Oehl y Sieverding. Sieverd. H ongos micorrizógenos arbusculares 239 . y Oehl P. boliviana Sieverd.wvu. Especies de HMA de las familias Archaeosporaceae(Género Archaeospora). robigina Sieverd. y Oehl P. Paraglomeraceae (Género Paraglomus) y Pacisporaceae (Género Pacispora) Género /Especies Archaeospora Ar. y Oehl P. 2004 y http://invam. Sieverd. occultum (Walker) Morton y Redecker Pacispora P.caf. gerdemannii (Rose. scintillans Rose y Trappe emend. y Oehl P. emend. y Oehl P. franciscana Sieverd.edu.

hawaiiensis Koske y Gemma S. dipapillosa (Walker y Koske) Walker y Sanders S. cerradensis Spain y Miranda S.) Gerd. calospora (Nicol.) Walker y Sanders S.) Walker y Sanders S. y Gerdemann) Walker y Sanders S. biornata Spain. gigantea (Nicol. y Herr. savannicola (Ferr. minuta (Ferr. y Ho) Walker y Sanders S. y Herr. y Trappe Gi. gregaria (Schenck y Nicol.) Walker y Sanders S. Gerd. persica (Koske y Walker) Walker y Sanders S. coralloidea (Trappe.) Walker y Sanders S. y Schenck Scutellospora S. gilmorei (Trappe y Herd.4. Especies de HMA de la familia Gigasporaceae. heterogama (Nicol. nodosa Blaszkowski S. armeniaca Blaszkowski S. fulgida Koske y Walker S. margarita Becker y Hall Gi. y Gerd. géneros Gigaspora y Scutellospora Género /Especies Gigaspora Gi. y Herr. albida Schenck y Smith Gi. alborosea (Ferr. Sieverding y Toro S.) Walker y Sanders S. aurigloba (Hall) Walker y Sanders S. castanea Walker S. erythropa (Koske y Walker) Walker y Sanders S. y Gerd.) Walker y Sanders 240 Manual de biología de suelos tropicales . rosea Nicol. Miller y Walker) Walker y Sanders S. y Schenck) Walker y Sanders S. reticulata (Koske.Apéndice 7. decipiens Hall y Abbott Gi. nigra (Redhead) Walker y Sanders S. dipurpurascens Morton y Koske S. arenicola Koske y Halvorson S. pellucida (Nicol.

Apéndice 7. spinosissima Walker.4. H ongos micorrizógenos arbusculares 241 . tricalypta (Herr.) Walker y Sanders S. weresubiae Koske y Walker Fuente: tomado de http://invam.wvu.caf. Continúa Género /Especies S. y Ferr. verrucosa (Koske y Walker) Walker y Sanders S. Cuenca y Sanchez S. scutata Walker y Diederichs S.edu.

.

existen dos condiciones básicas. 1997a y b). podrían ser una alternativa (Hyde. En los ecosistemas agrícolas. 2000). Los hongos son una parte importante de la cadena alimenticia en el suelo. La evaluación de la diversidad de hongos en suelos tropicales bajo diferentes usos de suelo es. debido al tiempo y la limitación de los recursos. los hongos interactúan con una compleja comunidad microbiana que incluye: bacterias. junto con una metodología precisa. Pfenning y Lucas Magalhães de Abreu INTRODUCCIÓN Los hongos del suelo juegan un papel clave en los procesos de descomposición que mineralizan y reciclan nutrientes de plantas. grupos específicos o un conjunto de predictores. Para poder obtener una evaluación confiable de la diversidad de los hongos del suelo.Capítulo 8 Hongos del suelo saprófitos y patógenos de plantas Ludwig H.. Lodge. (Wainwright. 1993). los cuales juegan un importante papel en el reciclaje de nutrientes o son mediadores del equilibrio entre los patógenos y sus antagonistas. por lo 243 . principalmente para la mesofauna que habita en el suelo (Bonkowski et al. Las actividades agrícolas pueden afectar la diversidad de organismos presentes en el suelo. los patógenos de plantas actúan en el suelo y en la rizósfera. 1988. En el suelo. Las investigaciones deben ser diseñadas en forma de estudios a largo plazo donde intervengan especialistas en taxonomía y micología. El uso de organismos indicadores. Cuando un estudio de largo plazo involucra varios especialistas no resulta viable. actinomicetos (actinobacterias) y pequeños invertebrados. causando una notable reducción en las cosechas y afectando su calidad.

1996.. 1990.. 2001). 244 Manual de biología de suelos tropicales . deben ser capaces de crecer en cultivos axénicos. han sido revisados por varios autores (Frankland et al. Gray. Bridge y Spooner. Bills et al. y su crecimiento en un medio de cultivo axénico para su posterior identificación y cuantificación.. afirmaciones genéricas de que únicamente el 1% de los “microorganismos” del suelo son cultivables aumentan la dificultad y no tienen en cuenta la inmensa diversidad biológica que realmente representan dichos microorganismos (Rondon et al. con diferentes medios de cultivos y estrategias de aislamiento. Cannon.. debido a que los medios de cultivo imponen nuevas condiciones selectivas y pueden introducir un sesgo en los análisis (Liu et al. un objetivo del proyecto CSM-BGBD. Davet y Rouxel. No obstante. 1983. 1990. medios de cultivo parcialmente selectivos y adictivos que reducen el crecimiento de ciertos grupos de hongos. Se ha progresado considerablemente utilizando técnicas de lavado. un grupo monofilético de organismos de hongos obligados asociados a las raíces de las plantas (véase Capítulo 7). (1992). puede no ser representativo de la dinámica de las comunidades del suelo. que cubran las diferentes idiosincrasias de la diversidad taxonómica y grupos fisiológicos de hongos presentes en los ecosistemas del suelo.. 2004). 1997). la mayoría de los hongos que habitan en el suelo pueden ser considerados saprotróficos. 2000). Sin embargo. Gams. 1992. 1993. 1992. Las metodologías para aislar y cultivar hongos de ecosistemas complejos. Singleton et al. Los procedimientos clásicos microbiológicos para estudiar los hongos del suelo se basan en cultivos que implican el aislamiento de propágulos microbianos o hifas activas que crecen en el suelo.. aún no están disponibles. Una medida confiable de las comunidades de hongos en el suelo sin prejuicios requiere del seguimiento de un laborioso programa de aislamientos sistemáticos. Los métodos estándares aceptados para inventariar la diversidad de hongos o para evaluar su impacto en varias prácticas agrícolas u otras actividades humanas. junto con muchos grupos homogéneos como el filum Glomeromycota.. Incluso el análisis de abundancia relativa de especies cultivables recuperadas del suelo. Una visión global de los métodos para estudiar hongos patógenos de plantas en el suelo fue descrita por Singleton et al. Los métodos utilizados para el aislamiento del suelo. por lo tanto.tanto. 2000. Muyzer et al. Dentro de este grupo se encuentran grupos filogenéticamente diversos.. tales como suelos que muestran limitaciones inherentes debido a la naturaleza de las especies y la inhabilidad de los medios de cultivo para copiar con exactitud los hábitats del suelo (Tsao et al. tales como fila de Eubacterias. rizósfera y hongos rizoplanos.

Con estos fines. es necesario adoptar métodos similares dentro de los proyectos cooperativos o multidisciplinarios para garantizar la comparación de los datos en un futuro. poca información acerca de las especies de hongos involucrados en dichos procesos. En este capítulo se hace referencia a algunos de los métodos más comunes y también a algunas técnicas menos conocidas para la evaluación y monitoreo de comunidades de hongos del suelo. por sí solos. Por ello. cada método presenta ciertas preferencias a ciertos grupos específicos de hongos.. animales y otros microorganismos. Aunque este enfoque no es exhaustivo. exudados.. reciclaje de nitrógeno y contenido de ácidos grasos del hongo o de observaciones directas del crecimiento del micelio en partículas de suelo (Widden y Parkinson.Otras metodologías que han sido desarrolladas se enfocan en el análisis de la actividad de los hongos y su papel en los procesos biogeoquímicos que ocurren en el suelo. 2003). 2006).. generalmente aceptados. sino un ecosistema compuesto por una mezcla de sustratos más diversos que incluyen partes de las plantas vivas y muertas. 1998. para un mejor entendimiento de la estructura y función de las comunidades de hongos del suelo. y no existe ninguna estimaHongos del suelo saprófitos y patógenos de plantas 245 . Por esta razón. No obstante. además. En general. Malosso et al. y no un sustrato. respiración del suelo. junto con minerales y agua. intenta ofrecer una visión global de los procedimientos disponibles. 1973. Brodie et al. pequeños invertebrados y contenidos intestinales. se deberá tomar en cuenta que el suelo no es un sustrato. se han aplicado métodos que dependen del análisis de la biomasa microbiana del suelo. 2003. Los resultados obtenidos de un estudio de hongos del suelo dependen.. esta característica complica las definiciones y la metodología. Las fracciones orgánicas se componen de material de plantas en diferentes fases de descomposición. principalmente. microorganismos. También son tomados en cuenta los principios y aplicaciones de herramientas moleculares en los estudios de comunidades de hongos del suelo. El objetivo principal es contribuir al establecimiento de una serie de métodos estándares. se requieren los procesos de aislamiento e identificación tradicionales (Brodie et al. Houston et al. estos métodos proporcionan. porque el suelo representa una mezcla compleja de fracciones orgánicas e inorgánicas con agua y organismos vivos. raíces vivas. por lo tanto. el suelo alberga una parte considerable de la biodiversidad total de hongos. de los métodos utilizados. LA IMPORTANCIA ECOLÓGICA DE LOS HONGOS DEL SUELO El suelo es un hábitat o ecosistema.

Algunos elementos biológicos han sido identificados como los principales factores de la supresión de enfermedades (Chet y Baker. Barratt et al. 1997... 2007. En sistemas agrícolas. causando que las plántulas se marchiten y. La supresión de patógenos de plantas puede resultar intrínseca en los suelos. tales como la incorporación de materia orgánica. 1997). 2003). beneficiar directamente la agricultura sustentable. 2000). Schneider. 1996. una mejor estructura física del suelo y el control de antagonistas de los patógenos de las plantas en el suelo. por tanto. los zygomycetes usan carbohidratos simples. pero también es posible que se mantenga o incremente con algunas prácticas agrícolas específicas. Los patógenos de plantas actúan en el suelo. 1988.. en la rizósfera o infectan tallos. Lodge... 2001). aunque la mayoría ataca una amplia gama de plantas hospederas. mientras los ascomycetes descomponen principalmente celulosa y hemicelulosa (Domsch et al. 2001. Los hongos también constituyen una parte importante de la cadena alimenticia dentro del suelo. mediante el suministro de nutrientes. provocan grandes pérdidas. plantas utilizadas como cubierta vegetal y la diversificación de cultivos. 2002. o Coniothyrium minitans pueden reducir la incidencia de una variedad de enfermedades en el suelo (Whipps et al. 1993. por ejemplo. Los hongos del suelo juegan un papel clave en los procesos de descomposición. Lodge. 1984. 2004). mineralizando y reciclando los nutrientes de las plantas (Wainwright. 1980. Mazzola. Zak y Visser. 246 Manual de biología de suelos tropicales . 1993).ción fidedigna del número de especies de hongos del suelo (Hawksworth. cabe mencionar que los hongos son responsables de la degradación de xenobióticos y contaminantes orgánicos introducidos en el suelo (Bordjiba et al. Beare et al. Existen evidencias de que las prácticas agrícolas causan más alteraciones cuantitativas que cualitativas en la comunidad de microhongos del suelo (Pfenning.. Se ha demostrado experimentalmente que la introducción de antagonistas específicos como Trichoderma spp. 1997). los patógenos de plantas y sus antagonistas son particularmente importantes. Rodrigues-Guzman. Éstos pueden ser específicos. 1991. Hawksworth y Rossman. Con relación al papel de los organismos descomponedores. El mantenimiento de la diversidad de hongos del suelo debería.. por ende. Los saprófitos tienen una especificidad limitada por sustratos. especialmente en el caso de la mesofauna (Bonkowski et al. 1997). 2003. Silva et al.

Estas especies se clasifican en la clase Plasmodiophoromycetes. 2001. como se discutió en el Capítulo 7. Los hongos del reino Protozoa no son numerosos. su hábitat e importancia ecológica son variables. Dentro del grupo de los Oomycetes del suelo es posible encontrar saprófitos. con un sistema de clasificación filogenético (Kirk et al. las cuales se presentan en la sesión “Procedimientos basados en cultivos”. otros habitan en el suelo. aunque también pueden encontrarse en el suelo. Chromista Los hongos que son derivados de algas y que contienen celulosa como el mayor componente en su pared celular pertenecen al reino Chromista Filum Oomycota (Dick. La detección de estos organismos requiere de bioensayos o cebos. Glomeromycota Los hongos clasificados en el reino Fungi se caracterizan por tener quitina como el mayor componente en su pared celular. A pesar de que estos hongos representan un grupo delimitado de acuerdo con sus características y filogenia. 2001). Dentro de este reino se reconocen cinco fila: los géneros que pertenecen al filum Glomeromycota forman micorrizas arbusculares y no crecen en ausencia de su planta hospedera (Schußler et al. Por sus características biológicas requieren de técnicas específicas para su aislamiento y caracterización. tales como Spongospora subterranea. así como otros géneros patógenos de plantas. Trabajar con este grupo de simbiontes biotróficos obligados requiere del uso de diferentes técnicas específicas.ASPECTOS DE SISTEMÁTICA MODERNA Protozoa Los organismos conocidos como hongos actualmente se agrupan en tres reinos. Moreira y Siqueira. 2001).habitan en restos de plantas. Los hongos llamados mohos mucosos -un grupo de organismos heterogéneos y polifilético. 2001. Kirk et al. Hongos del suelo saprófitos y patógenos de plantas 247 . 2002).... Plasmodiophora brassicae o Polymyxa graminis. Mientras que algunos son verdaderos hongos acuáticos asociados con restos de plantas en agua o con patógenos de otros organismos acuáticos. aunque algunos de ellos son importantes patógenos de las plantas del suelo.

Cunninghamella. pero normalmente son acuáticos y viven como saprófitos o parásitos de otros organismos como nematodos. El micelio vegetativo se desarrolla.. La filogenia de este grupo aún es objeto de discusión y de revisión. Especies de los géneros Absidia. 2006) y en la mayoría de los casos por la formación de un cuerpo fructífero. Los patógenos de plantas importantes en el suelo son especies de Rhizoctonia y Sclerotium. La fase asexual de los ascomycetes se llama anamórfica y es la fase más comúnmente encontrada. distinguir los grupos más importantes. La evaluación de la diversidad de estos hongos y el monitoreo de su impacto en la comunidad requieren de técnicas específicas (Rossman et al. plantas u otros hongos. Gongronella. Mortierella o Rhizopus son muy comunes en el suelo y se encuentran en casi todos los estudios de hongos de suelo. una estructura formada durante la fase sexual de su ciclo de vida. Se caracterizan por la formación de las ascas.. insectos. Mucor. tales 248 Manual de biología de suelos tropicales . 2008). Para fines prácticos. algunos de estos hongos habitan en el suelo. Varias de estas especies se conocen como trasmisores de virus patógenos de plantas (Krik et al.Chytridiomycota El único grupo dentro del reino de los hongos que forma esporas flageladas es el filum Chytridiomycota. Muchos de ellos forman ectomicorrizas en asociación con el sistema de raíces de árboles forestales. Basidiomycota El filum Basidiomycota se caracteriza por el basidium. por lo general.. un meiosporangio en el que generalmente se forman cuatro esporas sexuales (Bauer et al. Ascomycota El filum Ascomycota representa el grupo más abundante de hongos. en el suelo y en restos de plantas. Zygomycota Representan el filum Zygomycota y se consideran como hongos de azúcar por su preferencia por carbohidratos simples y por su crecimiento vigoroso en un cultivo axénico. 1998) que no son consideradas en este manual.

pueden resultar contraproducentes para la recuperación de especies de hongos. azadón..) deberán lavarse antes y después de tomar las muestras. Algunos de los ascomycetes como Aspergillus y Penicillium que habitan en el suelo. utilizando plantas altamente susceptibles. preferentemente a 4°C y congelarse lo más pronto posible para su futuro procesamiento. La hojarasca deberá ser removida justo antes de extraer la muestra. Probablemente.como plectomycetes. Para la extracción del DNA. EVALUACIÓN DE LOS HONGOS DEL SUELO: PROCEDIMIENTOS BASADOS EN CULTIVOS Todos los métodos propuestos dependen de muestras del suelo y no contemplan el uso de raíces para aislar hongos del suelo. ascomycetes que forman un asca en un cuerpo fructífero cleistotecal. con el fin de evitar la contaminación entre puntos de muestreo. si los recursos lo permiten. la detección y el monitoreo de los hongos de organismos protistas como Spongospora y Plasmodiophora puede llevarse a cabo mediante bioensayos. debido a que la micobiota de la rizósfera es altamente influenciada por las especies de plantas. las muestras del suelo deberán trasladarse al laboratorio utilizando un recipiente con aislamiento. Todos los materiales de muestreo (nucleador. Cada juego de 12 muestras se homogenizan para formar una muestra compuesta de alrededor de 500 g que se coloca en una bolsa de plástico. Hongos del suelo saprófitos y patógenos de plantas 249 . discomycetes. Debido a su pequeño tamaño y estructura poco diferenciada. MUESTREO DE SUELO Utilizando un nucleador se extraen pequeñas cantidades de suelo. en caso de que se haya previsto realizar otros análisis físicos y químicos del suelo. También se recogerá una segunda muestra compuesta de alrededor de 200 g. espátula. pyrenomycetes y loculoascomycetes puede ser útil. tres o más muestras compuestas podrán colectarse en cada punto de muestreo. 2008). pertenecen a los plectomycetes. a una profundidad de 20 cm en 12 puntos distribuidos en cada parcela de muestreo de acuerdo con el esquema mostrado en el Capítulo 2. el grupo más grande de hongos encontrados en el suelo son los pyrenomycetes anamorfos (Krik et al. La rizósfera también contiene una alta concentración de bacterias que. etc. De manera alternativa. a pesar del uso de antibióticos en los medios de cultivo.

5 g colocadas en tubos de ensayo de vidrio esterilizado con 3 ml de agua estéril. Chytridiomycetes) de muestras ambientales aparece en la ilustración 6. Se añaden granos de sorgo como cebo y se incuban por cinco días. El micelio en crecimiento se verifica directamente mediante montajes con agua en un microscopio o se transfiere del cebo al medio de aislamiento (AHM) que contiene cloranfenicol (50 mg L-¹) y benomil (10 mg L-¹) (Marks y Mitchell.1 para la composición del medio).. 1970. Gams et al. Alícuotas de 2 g de suelo se traspasan a cajas Petri que contienen agua estéril destilada. la B) una muestra de agua con cebo. la C) muestra un cultivo puro en el cebo y en la D) se observa el esporangio de Phytophthora.Oomycota: uso de cebos para el aislamiento de Pythium y Phytophthora Para poder recuperar del suelo los oomicetes es aconsejable el uso de plantas susceptibles o tejidos vegetales. 1998. se observa la liberación de zoosporas de Pythium. Al final de dicho procedimiento se deberá observar que se obtiene únicamente un aislamiento para cada placa. en la última ilustración F). Las hojas de zacate como cebo pueden ser sustituidas por pedazos de frutas o verduras como pepino.. 1983.. Este procedimiento deberá continuarse durante varias semanas. El micelio del hongo formado en el sustrato deberá traspasarse a charolas con el medio MP5 (en el caso de Saprolegniaceae) y agar con harina de maíz (AHM). 250 Manual de biología de suelos tropicales . Otra técnica con sustrato susceptible utiliza muestras de suelo húmedo de 0. Se esterilizan en autoclave fragmentos de hojas de zacate y se añaden a los tubos como tejidos para recuperar el Pythium spp. finalmente. tomate o papa. Los tejidos infectados deben transferirse en agua estéril con el antibiótico cloranfenicol durante unas horas. Tsao et al. Después de incubar durante tres a cinco días. Pueden llevarse a cabo ensayos cuantitativos utilizando la frecuencia de la colonización relativa de los tejidos del cebo entre las réplicas de cada muestra de suelo. Especies de Pythium y Phytophthora pueden causar serios daños a plantas cultivadas. agar dextrosa y papa (ADP) o agar de papa y zanahoria (en el caso de Pythiaceae) (véase Apéndice 8. Edena et al. las porciones de agar que contengan micelio serán transferidas a placas con agua estéril destilada y con dos mitades de semillas de sorgo. mientras que el oogonio y anteridio de Pythium se ilustran en E)”. La ilustración A) representa una muestra de suelo con cebo. 2000). Las muestras son incubadas durante tres a cinco días a 25°C en la oscuridad. después se comprueba la presencia de micelio en el cebo. en la sección de color de este manual. El aislamiento de hongos zoospóricos (Oomycetes.

compilados por Sneh et al. 1998). Después de un periodo de incubación de 48 horas a 25°C. a 25°C. Basidiomycota – Rhizoctonia: técnica de cebo y aislamiento directo de partículas de suelo Para evaluar este género de basidiomicetes anamórficos del suelo. y pedazos de frutas y verduras (Gams et al. Las partículas de suelo retenidas se secan con papel absorbente estéril y se transfieren a una caja Petri de 15 cm de diámetro que contenga un medio de agar con agua acidificada (al 2%) con 250 mg L-¹ de cloranfenicol. la caracterización e identificación se hace directamente en el cebo. en suelos de jardines de eucaliptus clonados fue descrito recientemente por Sanfuentes et al. se verifica el crecimiento típico de Rhizoctonia. posteriormente..5 mm. 1991). Los cebos más apropiados incluyen cáscara de camarón. El suelo retenido se resuspende y se pasa varias veces por el tamiz. se presentan dos métodos de aislamiento útiles.Uso de cebos para el aislamiento de Chytridiomycota Para evaluar los Chytridiomycota se usan las mismas técnicas empleadas para los oomicetos. se lavan con agua destilada durante Hongos del suelo saprófitos y patógenos de plantas 251 . se evalúa la frecuencia de la colonización en las partículas del suelo y el micelio se transfiere a ADP para su eventual caracterización (Sneh et al.5 mm. A continuación. después decantada usando un tamiz de 0. Un método para evaluar la densidad de inóculo de Rhizoctonia spp. se describen varios métodos. Técnica de cebo Se mezcla 1 g de semillas de betabel con 100 g de suelo húmedo en cajas Petri. se recuperan las semillas con un tamiz de 1. Para su preservación. Como el aislamiento de colonias individuales en un medio de cultivo axénico es difícil.. Después de un periodo de incubación de 24 a 48 horas. Método de partículas de suelo Una suspensión de 10 g de muestra de suelo y agua de la llave es agitada. piel de serpiente. (2002). los cebos pueden transferirse a viales. (1991). alas de insectos.

por el grupo de investigadores involucrados en el proyecto. secados con papel absorbente esterilizado y transferidos (7 partículas por placa) a 5 cajas Petri (90 mm) que contienen el medio de aislamiento AHM (30 g L-¹). 1975). en estos suelos.7 mm. Cuando se emplea ciclosporina se logra una supresión casi completa 252 Manual de biología de suelos tropicales .. La frecuencia de colonización de partículas de suelo para cada especie de hongos es utilizada en ensayos cuantitativos. para la inhibición de hongos de rápido crecimiento. el empleo de técnicas de cultivo independiente. Las partículas de suelo prelavadas son filtradas. Los coloidales de suelo y granos de arena son removidos del último tamiz. 0. fitopatógenas y sus antagonistas. ha mostrado severas limitaciones debido a la continua presencia de Trichoderma spp. Técnica de lavado Una muestra de 10 g de suelo mineral se agita con 200 ml de agua destilada en una centrífuga a 180 rpm durante 10 minutos. Después de la sedimentación de las partículas del suelo durante 2 minutos. más estreptomicina plus (50 mg L-¹) para la inhibición de bacterias y ciclosporina (10 mg L-¹) o rosa de Bengala (70 mg L-¹). De esta manera. como la amplificación de DNA ribosomal de Rhizoctonia con iniciadores (en inglés. su aplicación en el estudio de suelos bajo vegetación natural. se secan con papel absorbente estéril para ser transferidas a un medio de agar con agua al 2%. El crecimiento de Rhizoctonia se verifica y se transfiere micelio a ADP para su aislamiento y caracterización (Papavizas et al.0 mm.. 2002).20 minutos.21 mm usando agua destilada (alrededor de 2 litros) por 2 minutos. 0. Todas estas especies exhiben una fase saprotrófica en el suelo y pueden ser aisladas utilizando una metodología con placas de suelo. La técnica de lavado de suelo es un método adecuado para el aislamiento de estas especies.5 mm y 0. primers) específicos y su análisis cualitativo e incluso cuantitativo puede resultar idóneo bajo circunstancias específicas (Lees et al. entomopatógenas. A pesar del uso común de varios métodos para el aislamiento de Rhizoctonia de muestras de suelo agrícola. el sobrenadante se desecha y se repite el procedimiento dos veces. utilizando un juego de tamices de 1. que contenga 100 mg L-¹ de cloranfenicol. Ascomycota: técnica de lavado del suelo y filtración de partículas Éste es el mayor grupo de hongos del suelo que incluye especies saprófitas.

1985). éstos pueden contener fuentes de carbono preferiblemente metabolizados por algunos grupos fisiológicos de hongos o pueden modificarse con químicos que inhiben el crecimiento de organismos no deseados. 1988. se toma 10% de la suspensión.. Las alícuotas de la dilución final son distribuidas en cajas Petri que contienen un medio de agar generalmente. rutinariamente se utilizan medios selectivos.de zygomycetes saprotróficos. la cual se mantiene en agitación durante unos momentos. 1992. la diversidad de hongos que normalmente existen en forma de micelio que crece activamente en el suelo. Kacprzak y Stanczyk-Mazanek. el resultado es una estimación del número de propágulos de hongos por gramo de suelo (Bills et al. Gams et al. Básicamente. Se pueden lograr medidas cuantitativas multiplicando el promedio de las unidades formadoras de colonias (UFC) en las placas. 2003). cuando se trata de estudiar este último grupo de hongos. una cantidad conocida de suelo es suspendida en agua estéril. Bååth. Lang y Jagnow. Tsao et al.. Un factor final de dilución de 10-4 ó 10-5 se considera adecuado para el aislamiento de hongos (Dhingra y Sinclair. y que tienen poca habilidad de competir con especies de rápido crecimiento en medios axénicos son subestimados por esta técnica (Bååth. 1994. 1983). Por lo tanto. por el factor de dilución empleado. De esta suspensión se prepara una serie de 10 diluciones. Por lo tanto. Gams. se debe evitar el uso de ciclosporina (Dhingra y Sinclair. Un gran número de medios selectivos ha sido desarrollado para el aislaHongos del suelo saprófitos y patógenos de plantas 253 . Bills y Polishook. 1985. modificado con antibióticos como cloranfenicol. hasta lograr la dilución final. 1998. estreptomicina o penicilina para inhibir el crecimiento de bacterias. 2004). Este método se puede observar en la ilustración 7. 1988. El método de dilución del suelo en placa Este es el método de uso más común para el aislamiento y estimación cuantitativa de bacterias y hongos. 1986. Existe una preocupación generalizada porque el método de dilución en placas muestra un sesgo hacia los hongos que son capaces de producir grandes cantidades de esporas y que crecen muy rápido en un medio de cultivo rico.. La técnica es muy simple y se han descrito varias modificaciones. Ascomycota: medios selectivos y técnica con cebo Para un aislamiento selectivo de grupos blanco o especies de hongos del suelo.

. Wellington et al. Pettitt et al. aquéllos que contienen especies patógenas de plantas.. Sneh et al. 1991. 2000. Barratt et al. cabello para las especies queratinofílicas. Dhingra y Sinclair. Edel et al.. A pesar de ello. 1970. quitina para los productores de quitinasa. 1996. Sneh et al.. especies de Cylindrocladium y de las especies relacionadas Cylindrocladiella y Gliocladiospsis raramente son reportadas en muestras de suelo que emplean el método de dilución del suelo por placas. El aislamiento selectivo de los hongos del suelo también puede llevarse a cabo con cebos que son colonizados por grupos fisiológicos específicos de hongos. 1998.1987. 2001. 2003). utilizando como cebo hojas de Ricinus communis Cylindrocladium es un género conformado por especies saprotrófitas y patógenas de plantas comúnmente encontradas en el suelo.. después se transfiere a un medio selectivo de agar para su posterior aislamiento de los hongos deseados. el tejido cebo es incubado con una muestra de suelo durante unos días. 2003. larvas de insectos para los entomopatogénos y nematodos para los hongos nematófagos (Marks y Mitchell. 2002b). 254 Manual de biología de suelos tropicales ... Ejemplos de cebos utilizados para el aislamiento selectivo de hongos del suelo son tejidos de plantas para el caso de patógenos de plantas. 1983. en particular. Procedimiento para el aislamiento para el aislamiento de Cylindrocladium y géneros afines del suelo. 1985. el medio usado es Komada (Masago et al.. 1998). 1977. cuyo protocolo se describe a continuación. Papavizas et al. Dackman et al.miento de varios géneros de ascomycetes. para el aislamiento de Rhizoctonia solani se utiliza agua-agar acidificada. Thorn et al. La colonización del cebo por un hongo clave también puede llevarse a cabo mediante la observación directa al microscopio (Gams et al. Como el Cylindrocladium y probablemente otros géneros son sensibles a la ciclosporina. En la mayoría de los casos... En el laboratorio se utilizan hojas de ricino (Ricinus communis) como cebo para el aislamiento de hongos del complejo Cylindrocladium de manera rutinaria. Hojas jóvenes y frescas se recogen y se lavan bajo agua de la llave para posteriormente ser sometidas a una desinfección con etanol al 70% durante un minuto... por ejemplo. 1991. 1975. basidiomycetes y oomycetes del suelo. Tsao et al. 2002. Gams et al. deberán aislarse selectivamente usando cebos.. 2001). mientras que para Fusarium spp. varios materiales de plantas adecuados para su aislamiento fueron descritos en una monografía reciente (Crous.. Edena et al. Gonçalves et al..

durante 30 segundos). enseguida se lavan con agua destilada y se secan en papel absorbente esterilizado para ser transferidas a un medio de aislamiento. Hongos del suelo saprófitos y patógenos de plantas 255 .seguida de hipoclorito de sodio al 3%. Cylindrocladiella. durante dos minutos. bajo un microscopio estereoscópico (Gams et al. es recomendable para su aislamiento el uso de plántulas de tomate como cebo. (2007) aún sigue siendo una fuente importante para todos los involucrados en el estudio de hongos del suelo. Las hojas enteras se colocan un una caja Petri de 15 cm y se cubren con una capa de suelo húmedo. 1998. El trabajo de Barnett y Hunter (1998) es usado para unos pocos de los muchos saprófitos. Además de las claves y monografías de alrededor de 250 géneros. utilizando agujas finas de cristal. incluyendo hongos del suelo. Las dificultades de identificar a nivel de especie se ilustran con el género Fusarium. Los tejidos de plántulas infectadas se esterilizan con hipoclorito de sodio (al 2%. este compendio contiene claves para especies de varios géneros importantes y una recopilación de la literatura. Gonçalves et al.. tal como ADP y AM (agar extracto de malta) que contiene cloranfenicol (250 mg L-¹). endófitos y patógenos de plantas. síntomas de podredumbre.. 2001. Crous. Técnica de cebo para el aislamiento de patógenos fúngicos de plántulas Una amplia gama de hongos patógenos de plantas en el suelo puede causar la muerte prematura de las plántulas. Las semillas de tomate se germinan en 100 g de suelo y se verifica si las plántulas manifiestan o no. Después de más de 20 años. donde diariamente se verifica la esporulación típica de Cylindrocladium. que es un grupo heterogéneo que incluye saprófitos. después de tres días de incubación se lavan las hojas cuidadosamente con agua destilada y se transfieren a una cámara húmeda. El aislamiento del hongo se logra con la transferencia de esporas a un medio de cultivo. 2002b). Las hojas utilizadas sin desinfección previa tienden a ser degradadas con mayor rapidez y a ser colonizadas por bacterias. IDENTIFICACIÓN DE HONGOS DE SUELO La identificación de hongos que habitan el suelo puede causar problemas para aquéllos que no tengan suficientes conocimientos de micología. el amplio trabajo de Domsch et al. por lo tanto. Gliocladiospsis y otros géneros relacionados.

Si se trata de identificar ascomycetes. Se pueden utilizar otras metodologías para complementar los enfoques tradicionales usados para un mejor entendimiento de la diversidad y dinámica de los hongos del suelo. se puede consultar el Dictionary of the Fungi (Kirk et al. 2001). Samuels et al.. 1967. Tsao et al. Fusarium (Leslie et al. No son específicas para el caso de hongos del suelo. La monografía de Sheh et al. Una lista de referencias de guías y manuales para la identificación de grupos de hongos de suelo puede consultarse al final de este capítulo.. (1998). 1981) y para Phytophthora (Waterhouse. Trichoderma (Bissett. 1976) y coelomycetes anamórficos (Sutton.. Existen monografías disponibles para chyrids (Karling 1977) y también para el género Pythium (Waterhouse. 1993. 1971. Bridge y Spooner. sin embargo. algunos tipos de hongos como Basidiomycota son difíciles de aislar y pueden no esporular en un medio axénico (Thorn et al. éstos incluyen técnicas específicas de DNA. en ensambles de hongos a partir de muestras ambientales. Bills et al. (Klich y Pitt 1988). Penicillium (Pitt.. Samson et al. Erwin y Ribeiro. van der Plaats-Niterink. b) pueden ser un buen punto de partida. (página web).. 2004). Cylindrocladium (Crous. 1984. 2001. 2006). 1996). 1991a. (2000) o el manual de Gams et al. Para más instrucciones acerca de cómo identificar hongos o grupos específicos de hongos.. Las herramientas moleculares basadas en el análisis del DNA han sido aplicadas con éxito en el estudio de complejos bacterianos y. c. las monografías y claves de Hanlin (1990. 2000). 1996). Las secuencias de DNA son amplificadas directamente desde el suelo por medio de la reacción en cadena de 256 Manual de biología de suelos tropicales . b. No obstante. 1983. 1993). Muyzer et al.. 1970. 1980. 1983. 2002b). recientemente.Monografías y páginas web se encuentran disponibles para identificar las especies de Aspergillus. 1968. requiere de un laborioso programa de aislamientos sistemáticos con diferentes medios de cultivos y estrategias de aislamiento que reflejen la inmensa diversidad taxonómica y fisiológica de grupos de hongos que habitan en el suelo (Tsao et al. 1998a.. (1991) resulta útil para trabajar con Rhizoctonia. hifas anamórficas pigmentadas (Ellis.. EVALUACIÓN DE HONGOS DEL SUELO: TÉCNICAS ESPECÍFICAS DE DNA Una medida confiable de las comunidades de hongos del suelo. de mucha utilidad para este tema otras recopilaciones y monografías como la de Ellis y Ellis (1985).. sí. Nag Raj.

1997.. Los kits para la extracción de DNA del suelo están comercialmente disponibles. Uso de Primers específicos para “hongos” El grupo de genes para las moléculas de RNA Ribosomales 18S. El polimorfismo en la longitud del DNA y la variación en la secuencia de las bases pueden utilizarse para agrupar organismos de acuerdo con su origen y relación evolutiva. 2001). debido a una variabilidad más alta dentro de la muestra (Ranjard et al.. El rDNA también contiene espaciadores entre las regiones codificantes conocidos como espaciadores internos de transcripción (ITS) que presentan secuencias de bases menos conservadas y que pueden utilizarse para la diferenciación entre especies relacionadas o para evaluar Hongos del suelo saprófitos y patógenos de plantas 257 . este paso se logra mediante separaciones a través de columnas de separación o con el uso de kits comerciales de purificación de DNA (Liu et al. Las células de los hongos presentes en la muestra del suelo.8S y 28S se considera que son altamente conservados entre los organismos eucarióticos y normalmente se emplean como marcadores moleculares. Viaud et al. El total de DNA obtenido debe estar completamente purificado para eliminar sustancias húmicas y fenólicas que interfieren con el PCR. Los protocolos de extracción se basan. 2001). 2001). en los procesos físicos de macerado asociado con calor y lisis química.la polimerasa (PCR) y posteriormente caracterizadas utilizando varios enfoques (Bridge y Spooner. Bridge y Spooner. Varias copias del DNA ribosomal (rDNA) se encuentran en el genoma eurocariota. Las muestras muy pequeñas (menores a un gramo) deben usarse con precaución porque tienen mayor probabilidad de error. 5. incluso como micelio o esporas. tienen que estar correctamente lisadas. es la extracción del DNA directamente del suelo. facilitando la amplificación de pequeñas muestras de DNA. principalmente. Reacción en cadena de la polimerasa. 2000. La identificación de secuencias de DNA desconocidas también puede realizarse comparándolas con bases de datos de secuencias de nucleótidos de taxones conocidos. La heterogeneidad encontrada a nivel de micro-escala en el suelo debe ser considerada cuando se selecciona el tamaño de la muestra de suelo sometida a la extracción total de DNA.. Extracción de DNA Un paso crucial antes del PCR.

Secuenciación del DNA Para poder conocer las identidades del DNA de los hongos amplificados por PCR.. tales como especies de Phytophthora. los amplicones de tamaño correcto pueden separarse en geles de agarosa. conectados a vectores plásmidos y clonados en células bacterianas. 2002).. consumen tiempo y. 1999. no son adecuados para la evaluación de muestras ambientales complejas. En el caso de estos hongos. Borneman y Hartin. Basándose en las secuencias de genes de RNA ribosomal disponibles en bancos de datos especializados para varias especies de hongos. son difíciles de detectar por métodos moleculares. Sin embargo. Lees et al. 2001). El DNA clonado es secuenciado y comparado con las bases de datos que contienen secuencias oligonucleotídicas del rDNA fúngico mediante análisis de software. Por 258 Manual de biología de suelos tropicales . 2000. Como el suelo contiene un gran número de organismos. 2000. extraídos de matrices de gel. 2003).. algunos de estos Primers específicos han mostrado que amplifican DNA no fúngico o muestran preferencia hacia la amplificación de grupos taxonómicos específicos dentro del reino de los hongos (Smit et al. 2003).. La detección y/o cuantificación de pocas especies específicas de hongos es requerida generalmente en el campo de la fitopatología.. Estos procedimientos son caros. el obtener Primers o iniciadores de rDNA de hongos específicos constituye un paso fundamental en la amplificación del PCR. ya que el PCR tiende a amplificar moléculas del DNA que son dominantes en el extracto del DNA total. Filion et al. Baayen et al.. 2002. Anderson et al. 2002. Los Primers permiten la amplificación de una amplia gama de especies de hongos sin perder la especificidad de este grupo clave. utilizando Primers específicos para Géneros y/o especies de interés (Nechwatal et al. han sido desarrollados y compilados por Anderson y Cairney (2004). purificados. Down.. Algunos hongos que están presentes en muy bajas densidades en suelos naturales. la detección molecular de muestras de suelo puede ser mejorada mediante el uso de técnicas de cebo en conjunto con PCR.divergencias genéticas intraespecíficas (Viaud et al.. los Primers que son específicos para amplificar PCR del DNA de hongos de muestras complejas de suelo. además. 2000. Para este tipo de investigación se han desarrollado varios iniciadores especie-específicos para una detección directa y el monitoreo de patógenos de estas plantas a partir de muestras del suelo (Cullen et al.

2000. Milling et al.. Viaud et al. 1993). Los patrones de bandeo generados son utilizados para analizar complejas comunidades de hongos del suelo. Por lo tanto.. 1999.. Las restricciones y limitaciones están representadas en la selección de Primers utilizados en el primer paso de amplificación después de la extracción total del DNA de las muestras. Los amplicones tienen exactamente el mismo número de nucleótidos. 2000. Varias combinaciones de Primers han sido propuestas para amplificar DNA de distintos grupos de hongos como Ascomycota. parcialmente desnaturalizadas debido a las diferencias de la desnaturalización de los dominios menos estables en las moléculas.. Gomes et al.. El gradiente de desnaturalización en DGGE puede variar con el uso de diferentes cantidades de urea y de formamida en la matriz del gel. Vandenkoornhuyse et al. lo que determina el modo de desnaturalización y la movilidad electroforética al migrar en el gel desnaturalizante. 2003). 2004). 2003. Basidiomycota. Bajo estas condiciones de desnaturalización. al igual que para monitorear modificaciones o impactos debidos a prácticas agrícolas o actividades industriales (Smit et al. 2000.. Método de huella molecular TGGE y DGGE La electroforesis en gel con gradiente de desnaturalización fue introducida en estudios sobre ecología microbiana por Muyzer y Smalla (1998). En varios estudios se ha usado esta técnica para evaluar la estructura de la comunidad de hongos y otros microorganismos. Hongos del suelo saprófitos y patógenos de plantas 259 . pero con diferentes secuencias de pares de bases. Anderson et al. Los iniciadores usados en el PCR. presentan diferentes comportamientos de desnaturalización y migran hacia diferentes puntos en el gel (Muyzer et al. contienen un DNA con bases repetitivas de GC que resultan menos propensas a la desnaturalización debido a su alta estabilidad química. Elsas et al. las moléculas 18S DNA amplificadas por PCR son sometidas a una electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) o con un gradiente desnaturalizante (DGGE)... y se llaman dominios de fusión. se han desarrollado técnicas moleculares de huella o rastreo molecular (en inglés fingerprint) para estudiar la diversidad a nivel de comunidad (Borneman y Hartin. 2002. moléculas de DNA con diferentes secuencias en sus pares de bases. pero difieren en su contenido de Guanina-Citosina (GC).ello. generalmente. el DNA se extiende a la misma longitud (como resultado del PCR). En esta técnica.

. los enfoques polifásicos que incluyen la construcción de bibliotecas de fragmentos clonados. 2003). Otra limitante es que el DNA obtenido de organismos filogenéticamente distantes puede producir productos de PCR con una movilidad electroforética idéntica (Gomes et al.. 2000). 2001). Las especies de hongos relacionadas pueden identificarse de acuerdo con sus patrones típicos de RFLP.l. No obstante. la comigración de diferentes moléculas de DNA hacia un mismo punto en el gel. tales como TGGE y DGGE. son la mejor opción (Malosso et al. Los fragmentos de restricción terminal (TRFs) se marcan con fluorescencia y pueden ser detectados y cuantificados en un secuenciador automático. 2006). (1997) desarrollaron una versión complementaria del PCR-RFLP.. 2004). Recientemente. llamada polimorfismo de longitud de fragmentos de restricción terminal para el análisis (T-RFLP) de comunidades bacterianas de muestras ambientales.. Después de la amplificación. la restricción enzimática del DNA antes de la electroforesis puede utilizarse en una técnica conocida como polimorfismo de longitud de fragmentos de restricción (RFLP) del DNA amplificado por PCR (Viaud et al. En el T-RFLP. El uso de un PCR anidado puede arrojar aún mejores resultados e incrementar la resolución en la separación de los productos del PCR (Oros-Sichler et al. T-RFLP Liu et al. Zygomycota y Oomycota (Nikolcheva y Bärlocher.. 2006. por ejemplo. los análisis bioquímicos y las técnicas de aislamiento.Chytridiomycota. la técnica puede proporcionar un estándar altamente reproducible de un gran número de muestras ambientales durante un periodo de tiempo relativamente corto. Se puede construir una base de datos de TRFs a partir de especies de hongos conocidos y utilizarla en corre260 Manual de biología de suelos tropicales . el DNA es amplificado por PCR con uno de los dos Primers marcados con fluorescencia. después de la amplificación del DNA por PCR directamente extraídos del suelo utilizando Primers género-específicos (Nechwatal et al. el método de huella molecular. el DNA es tratado con enzimas de restricción y los fragmentos de restricción separados en un gel de acuerdo con su tamaño. 2006). Singh et a. Para incrementar el polimorfismo de la banda y mejorar la resolución. Técnica PCR-RFLP La escasa variabilidad de rDNA de hongos puede resultar desventajoso en la técnica de huella molecular.

SSCP Otro estudio de huella molecular utiliza la migración diferencial de moléculas de una hebra de DNA en un gel para poder estudiar a las comunidades microbianas más complejas. 1997. Edel-Hermann et al. El ARISA de hongos es una técnica altamente sensible. Kennedy et al. 2000. pero disímiles en su secuencia de pares de bases pueden ser fácilmente separados en SSCP por su diferencial de migración en el gel cuando existe la conformación de una sola hebra (Lee et al. 1996. ARISA El polimorfismo natural de la región ITS del rDNA entre especies de hongos puede utilizarse para la evaluación de comunidades de hongos de suelo.laciones taxonómicas con los haplotipos detectados en el análisis T-RFLP (Brodie et al.. el DNA fúngico es extraído del suelo y amplificado por PCR utilizando Primers específicos para la región ITS con uno de los Primers marcados con fluorescencia. 2004. 2003.. están enfocados en una o en pocas especies de hongos presentes en el suelo. Lowell y Klein 2001.. Después de la amplificación. el polimorfismo intra-específico del ITS puede presentar problemas en la separación de distintas especies filogenéticas (O’Donnell y Cigelnik.. En estos esHongos del suelo saprófitos y patógenos de plantas 261 .. Kennedy et al. especialmente con hongos patógenos de plantas.. el DNA amplificado es completamente desnaturalizado antes de ser sometido a una corrida de electroforesis. 2005). 2005. los diferentes fragmentos de ITS son separados en un gel y posteriormente detectados y cuantificados en un secuenciador automático (Ranjard et al. PCR cuantitativo Algunos estudios.. He et al.. 2001). sin embargo. 2006). los fragmentos de DNA del mismo largo. Viaud et al. En el polimorfismo de conformación de cadena sencilla (SSCP). En el análisis automatizado del espaciador intergénico ribosomal (ARISA). 2005).1 muestra algunos ejemplos de técnicas moleculares empleadas para el estudio de comunidades de hongos del suelo publicadas en años recientes. La Tabla 8. Las moléculas de una sola hebra de DNA adquieren estructuras con dobleces únicos dictados por sus secuencias nucleotídicas y migran hacia puntos específicos en el gel.. Como consecuencia. Singh et al.

. los distintos productos de PCR son cuantificados por separado de acuerdo con sus intensidades de bandeo relativas en geles de agarosa. Mauchline et al. La cantidad de DNA en la muestra puede calcularse con la adición de diferentes cantidades de DNA competitivos. la cuantificación del DNA de hongos en el suelo es requerida frecuentemente para estudios epidemiológicos y ecológicos. No obstante.. En el cPCR. Las sondas fluorescentes son capaces de emitir fluorescencia en la presencia de DNA de dos hebras. Después de un número definido de ciclos de PCR éstos se usan para cuantificar el DNA directamente de muestras de suelo. En el caso de ensayos cuantitativos. Li y Hartman.. Filion et al. por lo tanto. el PCR convencional es inapropiado para enfoques cuantitativos porque cualquier pequeña variación durante la fase exponencial en la reacción de amplificación puede alterar drásticamente las cantidades de los productos del PCR. Después de esta amplificación. 2003). Además de la detección molecular. 2002. Mauchline et al. Otro método empleado en aproximaciones cuantitativas es el de PCR en tiempo real. 2002. el incremento de moléculas de DNA durante la amplificación conlleva un incremento en la intensidad de la emisión fluorescente. Baek y Kenerley. Una curva estándar puede construirse con cantidades conocidas de DNA e intensidades de fluorescentes. 2002. 2003. 2002). Sondas fluorogénicas o colorantes adicionados al PCRs permiten el monitoreo correcto de los productos obtenidos durante la amplificación. 262 Manual de biología de suelos tropicales . Esta técnica es más rápida y más sencilla que cPCR porque no existe la necesidad de construir un competidor de DNA y no se requiere de ningún análisis post-PCR (Cullen et al. 1998.. a una cantidad estándar de una muestra de DNA en una serie de PCRs y con el monitoreo de productos PCRs competitivos producidos en cada reacción (Siebert y Larrick. lo cual puede calibrarse y medirse con precisión. 1992.. han sido desarrolladas modificaciones del PCR convencional como PCR competitivo (cPCR) y PCR en tiempo real. 2003). Filion et al.tudios. 2000. Lees et al. fragmentos de DNA que contienen los mismos sitios iniciadores que la muestra de DNA son añadidos en cantidades conocidas a las reacciones del PCR y coamplificados con el DNA específico.. se deben diseñar Primers de PCR específicos para obtener la amplificación correcta del DNA de la especie clave y otros marcadores moleculares pueden ser empleados como secuencia del gen β-tubulina o el factor de elongación de traducción del gen EF 1-α (Baayen et al..

. seguido por DGGE..1 Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes.. Suelos con diferentes propiedades fisicoquímicas. Gradiente de pastizales semi-naturales a suelos agrícolas mejorados. 2005 Kennedy et al. 2003 Brodie et al..Tabla 8.. Suelo estepario con pasto corto con o sin presencia de nitrógeno.. 2000 Lowel y Klein. 2001 Elsas et al.. Suelos bajo cultivos de papa transgénica y no transgénica. Pastizales bajo diferentes tipos de vegetación..2005 DGGE SSCP y TGGE ARISA y T-RFLP DGGE con iniciadores específicos para Fusarium DGGE y T-RFLP Singh et al. 2006 Hongos del suelo saprófitos y patógenos de plantas 263 . los efectos de cambiar el suelo al añadir composta o excremento. 2005 Yergeau et al. 2003 Agnelli et al. 2004 Edel-Hermann et al. Rizósfera de dos cultivos de maíz durante el periodo de ciclo de vida de la planta. análisis de detección y diversidad de especies de Fusarium. 2004 Milling et al. Análisis de la dinámica de comunidades de hongos del suelo vía PCR hongoespecíficos del DNA del suelo. 2003 Gomes et al. 2001 Ranjard et al. 1999 Viaud et al. Referencias Smit et al.. Una muestra de suelo por métodos de cultivo y molecular.. 2000 DGGE DGGE y TRFLP DGGE y restricción de DNA amplificado DGGE T-RFLP Anderson et al... Suelos con diferentes propiedades fisicoquímicas. Tres diferentes suelos cultivados con Lolium perenne. amplificados del DNA total. Suelos de bosque natural y plantaciones de pino hoop.. Campos de espárragos. Técnica* TGGE PCR-RFLP SSCP ARISA DGGE Evaluación de comunidades de hongos en Rizósfera y suelo compuesto con trigo. 2004 He et al. Diferentes horizontes de un suelo de selva. Gradiente de suelo desde llanuras hasta bosques de pino escocés..

requieren de una secuenciación y comparación utilizando bancos de datos de DNA al alcance del público.. pero una mejor caracterización y análisis filogénico de taxas dominantes. generalmente. Hawksworth. en la secuenciación de quimeras (Crous.. en el caso de los hongos el número de especies no cultivables es. exagerado. no se aplica en el caso de hongos saprófitos. pueden presentar algunos problemas debido a que los bancos de datos pueden estar incompletos y puede que las secuencias de DNA se encuentren mal identificadas. amplificación y secuenciación de contaminantes de hongos e incluso. los enfoques taxonómicos de hongos basados únicamente en datos moleculares.1 Continúa. 1992.. los métodos de lavado del suelo y la filtración de partículas. CONCLUSIONES Las herramientas moleculares para ensayos de comunidades de hongos del suelo fueron extraídas.Tabla 8. este método no se describe para cada ejemplo. Incluso la mayoría de los hongos patógenos de plantas no son parásitos obligados. 2003. Otra limitación del enfoque molecular basada en la amplificación del DNA es la falta de conocimientos acerca de la actividad de crecimiento o grupos funcionales 264 Manual de biología de suelos tropicales . 2004b). Tsai y Olson. Lo que puede ser verdad para organismos estrictamente simbióticos. huella molecular y técnicas de clonación. tal y como ha sido discutido. 1994). Técnica* DGGE y ARDRA Evaluación de comunidades de hongos en Diversidad de hongos en suelos antárticos que combinan cultivo de aislamiento. Sin embargo. 1992. Las técnicas de huella molecular en comunidades puede monitorear composiciones complejas de hongos de suelo. por lo tanto. sin duda. 2006 Nota: * la clonación del DNA y la secuenciación fueron usadas por todos los autores para la identificación de haplotipos dominantes amplificados del DNA total. contienen las mismas limitaciones que las técnicas de cultivos para hongos (Selenska y Klingmüller. No obstante. por ejemplo. como hongos micorrízicos arbusculares. de estudios sobre la diversidad bacteriana y. invariablemente. lo que origina errores en identificaciones morfológicas. Bridge et al. 2002a. O’Donnell et al. Referencias Malosso et al. principalmente. Muchos obstáculos para la identificación basada en cultivos han sido superados con la llegada de técnicas de aislamiento más sofisticadas como.

las transformaciones de datos. como parámetros físicos y químicos del suelo bajo análisis. 1994... generalmente. La prueba de independencia de Chi cuadrada puede usarse para este análisis. un enfoque más confiable es realizar un análisis de varianza (ANOVA). otros factores. por ejemplo. 2006). donde el número total de cepas de cada muestra se usa en comparaciones pareadas. Sokal y Rohlf. pueden añadirse al ANOVA para evaluar sus efectos y sus interacciones con otros datos cuantitativos (Setälä y McLean. Singh et al. Las curvas de acumulación de especies o curvas de rarefacción pueden proporcionar comparaciones gráficas de la riqueza de especies entre muestras. los protocolos de extracción del DNA son capaces de lisar y extraer ácidos nucleicos ya sea de micelio en crecimiento activo o de esporas latentes. Adicionalmente. Por el momento. Para solucionar ese problema. Otra opción consiste en llevar a cabo un análisis de varianza no paramétrico. dado que algunos de los datos no tienen una distribución normal. Por medio del ANOVA es posible derivar variaciones entre diferentes muestras y dentro de las muestras (error). La pendiente de las curvas muestra cuáles son las muestras con mayor riqueza de especies. 2004). Como se ha discutido. fechas de colecta o diferentes tratamientos de suelo. 2006. y también dan información sobre el esfuerzo de muestreo empleado en la investigación. 1995). por lo tanto. 1995). Se verifica el número de cepas de cada muestra y este dato puede ser usado para comparar entre sitios. Cuando están disponibles datos sobre variaciones cuantitativas entre las repeticiones dentro de las muestras. además del número de cepas. un entendimiento más completo sobre las comunidades de hongos del suelo deberá centrarse en enfoques polifásicos con ensayos basados en cultivos y taxonomía molecular en asociación con el estudio de los procesos biogeoquímicos que ocurren en el suelo (Malosso et al. constituye el primer conjunto de datos.. La forma de las curvas indica si el número Hongos del suelo saprófitos y patógenos de plantas 265 .de hongos del DNA total extraído del suelo. El conjunto de datos preliminares usualmente no es adecuado para hacer los análisis de ANOVA. las curvas que se forman con más facilidad. ANÁLISIS DE DATOS Una lista de especies o agregados de especies aisladas y su abundancia relativa en cada muestra. 1998). de acuerdo con la acumulación de las cepas muestreadas. tales como logaritmo o raíz cuadrada pueden aplicarse antes del análisis (Houston et al. por ejemplo. haciendo difícil la diferencia del crecimiento activo o grupos funcionales basados únicamente en el producto del análisis del PCR. el análisis de Kruskall-Wallis (Rodrigues. resulta ser un análisis robusto y confiable (Sokal y Rolf.

al igual que en otras técnicas de ordenación. Los resultados se muestran gráficamente y permiten el análisis de tendencias generales de la estructura de la comunidad (Gauch. si las curvas tienden a llegar a una asíntota. análisis de correspondencia sin tendencia. En el caso de AC. común o rara y a la complejidad de los modelos matemáticos que se basan en la distribución de las especies. por ejemplo. 1994. 2003). 1995). idealmente. 1988. 1993. son métodos de ordenación adecuados para la clase de datos generados de hongos y de otras comunidades. por ejemplo. 1994). se elige un límite (por ejem266 Manual de biología de suelos tropicales . datos generados de conteos.). De esta manera. tales como los métodos de ordenación. El análisis de correspondencia (AC) y su versión modificada. Curvas que no tienden a una asíntota indican que el número de especies podría aumentar si se aumenta el esfuerzo de muestreo (Bills y Polishook.. Los índices de similitud (disimilitud) de diversidad para realizar comparaciones pareadas entre diferentes muestras también son usados con frecuencia (Magurran. matrices de datos de gran tamaño (llenas de ceros) y datos de distribución no paramétricos. La diversidad de especies de cualquier sistema está compuesta por dos componentes: la riqueza de especies (el número de especies) y la equitatividad o equidad de la frecuencia de especies (Kennedy y Smith. 1998. Bettucci et al. El índice Shannon-Wiener se basa en la riqueza y equitatividad de la diversidad de las especies y se encuentra frecuentemente en la literatura (Dighton. basándose en su riqueza o equitatividad o tomando ambas variables y éstos cambian en función de la importancia relativa que se da a la especie dominante.de especies es estable después de la acumulación de todas las cepas.. Persiani et al. La información sobre la estructura de la comunidad es mejor si se usa un análisis multivariado. el análisis multivariado no se lleva a cabo en el total de comunidad debido a la naturaleza “ruidosa” de la frecuencia y a la distribución de especies raras. Howard y Robinson. El porcentaje de la varianza total explicada por el primer eje del AC y la contribución de las especies y muestras a la varianza (inercia) de cada eje apoya la designación de especies que ocurren en la comunidad como clave y “casual” (Howard y Robinson. y existen casos en donde dos comunidades distintas pueden tener el mismo índice de diversidad.. 1982. Grishkan et al. Muchos índices se han obtenido para evaluar y comparar la diversidad de especies. De manera general. 1995). Los índices de diversidad son puramente numéricos y no proporcionan información sobre la estructura de la comunidad. las relaciones multidimensionales entre muestras y especies se reducen a un número reducido de ejes que. explican la mayoría de la variabilidad de datos. 1995).

1996. Ryan y Smith. 1996). Las colecciones de recursos genéticos hoy en día son solicitadas en todo el mundo. Las colecciones de referencia deberían ser apoyadas por países con una política fuerte en ciencia y tecnología dado que contienen información acerca de la distribución geográfica y de los hospederos. son normalmente empleados para derivar resultados procedentes de los métodos de huella molecular. 2003).. 0. Kirsop. 1995. Agradecimientos Al profesor Richard Mibey y a la Dr. 1993. PRESERVACIÓN Y COLECCIÓN DE RECURSOS GENÉTICOS Los inventarios de biodiversidad proporcionan argumentos y algunas bases científicas para la preservación de hábitats y el uso sustentable de suelos. por lo que proveen material de trabajo básico para quienes estudian las características y la variación. Hawksworth. por lo tanto. Hongos del suelo saprófitos y patógenos de plantas 267 ... la biología molecular y la conservación de hongos han sido revisados recientemente (Hawksworth. así como el análisis de conglomerados (cluster). 2004a. 2002. Los métodos de ordenación de análisis de componentes principales y análisis de correspondencia. 2006). 2004). 1992.5%. 1% ó 5% del número total de aislamientos) y únicamente aquellas especies con una frecuencia de aislamientos igual o superior a este límite son incluidas en el análisis (Gauch.plo.. 1982. El estatus actual de las colecciones de recursos genéticos de hongos y los retos para apoyar la necesidad de la genómica de hongos. Bettucci y Alonso. al igual que las aplicaciones prácticas y económicas de las especies (Smith y Waller. como en el caso de la publicación de nuevos nombres (Agerer et al. es necesario que sean recopilados. Oros-Sichler et al. con el objetivo de la preservar las especies ex situ y de suministrar a instituciones de investigación e industrias de este material. en donde las matrices son construidas con datos de presencia o ausencia de bandas distintivas (de manera ideal para especies diferentes) en los geles y la estructura de la comunidad es analizada posteriormente (Fromin et al. 2002). En el futuro. Sheila Okoth por sus comentarios y discusiones durante la preparación del capítulo. para la preservación a largo plazo de especímenes de resguardo será fundamental validar las entradas de secuencia y bases de datos genómicas. Bettucci et al.

Ascher.. I. vol. M. y Waalwijk. Horak. J. E. vol. vol. S. J. Anderson.. D. R. Cortia. I.. (2000) ‘Gene genealogies and AFLP analyses in the Fusarium oxysporum complex identify monophyletic and nonmonophyletic formae speciales causing wilt and rot disease’. (1988) “A critical examination of the soil washing technique with special reference to the effect of the size of the soil particles’. Mycological Progress. Triebel. Courtecuisse.. Applied Soil Ecology. vol.REFERENCIAS Agerer. Greenhalgh. J.. (2006) ‘The simpleseptate basidiomycetes: A synopsis’.. D.. 470–480. 78–85. E. pp. A. Ennos. M. Agnelli. P. (2004) ‘Distribution of microbial communities in a forest soil profile investigated by microbial biomass. (2003) ‘Fungi are the predominant micro-organisms responsible for degradation of soil-buried polyester polyurethane over a range of soil water holding capacities’.. P. pp. Ammirati. C. vol.. Mueller. R. vol. G. M. vol. (1998) ‘Detection and enumeration of a genetically modified fungus in soil environments by quantitative competitive polymerase chain reaction’. Anderson. C. F. C. Soil Biology and Biochemistry. J. C.. Bååth. (2003) ‘Potential bias of fungal 18S rDNA and internal transcribed spacer polymerase chain reaction primers for estimating fungal biodiversity in soil’. P. pp.. soil respiration’. 41–66.P. pp.. J. Blanz. Kroon. R. A. Oberwinkler. forest’. Korf.. 268 Manual de biología de suelos tropicales . W. Begerow. 5. Halling. D. Roebroeck. 6.. G. D. Sampaio. J. 419–428... FEMS Microbiology Ecology. Ceccherini.. 95. (2003) ‘Always deposit vouchers’ Mycological Research. D. Beare.. C. y Kenerley. 642-644. 769–779. Hallenberg. (2004) ‘Diversity and ecology of soil fungal communities: Increased understanding through the application of molecular techniques’. L. 87–108. L. y Alonso. J. G. E. R... R. R. pp.. Bettucci. W. D. 6. M. P. Bonants. I. y Pietramellar.. C. y Watling. pp. pp.. y Srivastava. 859–868. G. vol. R. Cigelnik.. pp. (1997) ‘Agricultural intensification. Gams. P. soil biodiversity and agroecosystem function in the tropics. Pedobiologia. the role of decomposer organisms’.. Weiss.. Environmental Microbiology. G. vol.. Vikram Reddy. 90. 25. Baayen. M. Nannipieri. H. Baek.. Rambold. 39. R.. N. M. Bauer. K. M. y Prosser. pp. Barratt. y Handley. C. R. (1995) ‘The effect of wildfire on the opportunistic decomposer fungal community of Uruguayan Eucalyptus spp. Dejardin.. Tian. Robson. E. P. S. A. Phytopathology. Environmental Microbiology. Journal of Applied Microbiology. y Cairney.E. vol. T. J.. N. 104. Hawksworth. Summerbell. vol.. R. 5. 1566–1569. pp. Campbell. G. y Oberwinkler. G. F. 891–900.. S. L. M. O’Donnell. R. 36–47. 66. Canadian Journal of Botany. pp. P. 36.

. (1994) ‘Abundance and diversity of microfungi in leaf litter of a lowland rain forest in Costa Rica’. (2001) ‘Soil fungi. y Panchal. J. pp. Edwards. J. Hall (ed) Methods for the Examination of Organismal Diversity in Soils and Sediments. Lundgren. K. Dackman. pp. pp1378–1379. P. M. Spooner. y Duncan. D. 666–676. 127–145. M. Roberts. R.. I. Hongos del suelo saprófitos y patógenos de plantas 269 . 160.. A. E. C. St Paul. Bury. F. Bridge. y Baker.. (2003) ‘On the unreliability of published DNA sequences’. (2002b) Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. (1987) ‘Quantification of predatory and endoparasitic nematophagous fungi in soil’. vol. Crous. 89–93. R.. (2000) ‘PCR primers that amplify fungal rRNA genes from environmental samples’. B. 281–292. M. F. y Polishook. Foster (eds) Biodiversity of Fungi: Inventory and Monitoring Methods. ppv147–154. vol. pp. 45. y Clipson. M. M. E. 66.Bettucci. 4356–4360. vol. y Thorn. Brodie. M. A. P. 232. Lees. M. J. C. pp. I. Cullen. Mueller. pp. (2004) ‘Saprobic soil fungi’. Malvarez. Griffith. Kadri. (2000) ‘Food preference of earthworms for soil fungi’. y Spooner. Plant and Soil. Mycological Research. D. L. 271–302. (2002) “Paraná river delta wetlands soil microfungi’. Amsterdam. Pedobiologia. pp. vol. Toth. S. Mycologia. diversity and detection’. pp.. Christensen.. 44. MN. Jansson. y Ritz. pp994–998. Wallingford. L. I. O. W. Journal of Environmental Quality. K. Rodriguez. G. F. Steiman. 86. 187–198. y Nordbring-Hertz. B. F. Microbial Ecology. (1996) ‘Filamentous fungi’.. CAB International. 43–48. vol. (2002) ‘Detection of Colletotrichum coccodes from soil and potato tubers by conventional and quantitative real-time PCR’. Chet. pp. B. vol. (2001) ‘Removal of herbicides from liquid media by fungi isolated from a contaminated soil’. P. Pedobiologia. in G. D. New Phytologist.. K.. Pedobiologia. 37. 105–114. APS Press. vol. Semadi. Bordjiba. M. (2003) ‘Soil fungal community structure in a temperate upland grassland soil’. Bettucci. G. F. M. Borneman. 606–623. Applied and Environmental Microbiology.. vol. R. S. 72–82. (1993) ‘Fungal communities of two grazing-land soils in Uruguay’. vol. 106. vol. G. P. y Guiraud.. F. Plant Pathology. Bills. P. K... Elsevier. Bonkowski. FEMS Microbiology Ecology.. pp. Powell. pp. pp. Olsson. G. 30. S. Cannon. P. J. 13. y Hartin.W. (2002a) ‘Adhering to good cultural practice’. Bills.. G. (1980) ‘Induction of suppressiveness to Rhizoctonia solani in soil’. Crous. 51. Phytopathology. y Indarte. J. 46. in G. B. Dupont. N. P. D.. y Roquebert.. J. B. W. H. 418–426. vol. vol. pp. S. Bills y M. Bridge. vol. 70.

M. vol. vol. 49. Duarte. Grigorova y J. P. G. 43.. K. pp. Gillet. 36. 270 Manual de biología de suelos tropicales . N. (2000) ‘An efficient baiting assay for quantification of Phytophthora cinnamomi in soil’.. Pérez-Piqueres. Dighton. Dordrecht. 16. Teyssier. A. Edel. vol. y Sinclair.. 133–151. (2001) ‘Genetic diversity of Fusarium oxysporum populations isolated from different soils in France’. Gams.. S.. y Anderson. C. J.Davet. 397– 404. M. Mycological Research. D. IHW Verlag. M. (2004) ‘Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils’. G. Hamelin. Enfield. M. J. 22. Boca Raton. F. pp. CRC Press Inc. (2003) ‘Direct quantification of fungal DNA from soil substrate using real-time PCR’. (1985) Basic Plant Pathology Methods.. A. y Jabaji-Hare. Dighton. J.. St-Arnaud. R. N. Norris (eds) Methods in Microbiology. y Steinberg.. Elsas. F. Aragno. vol. S. 634–643. W. M. Edena. (2007) Compendium of Soil Fungi.. Tarnawski. 796–798. W.. (2002) ‘Fungal family trees: Finding relationships from molecular data’. (2002) ‘Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns’. C. vol. Dhingra.. L. K. B.. Frankland. pp. in R. Journal Microbiological Methods. N.. (2000) Detection and Isolation of Soil Fungi. Fromin. E. (2000) ‘Analysis of the dynamics of fungal communities in soil via fungal-specific PCR of soil DNA followed by denaturing gradient gel electrophoresis’. pp.Cuvelle. Keijzer-Wolters. y Smit. V. y Rouxel. 515–522. Kluwer Academic Publishers. Forestier. FEMS Microbiology Ecology. Dreumont. y Galpoththage. Domsch. Filion. H. pp. R. y Alabouvette. Environmental Microbiology. G. Jourdain-Miserez. 47. Hillb. vol. Eching. O. Academic Press. vol. London. Steinberg. y Boddy. 343–404.. F. Science Publishers. T. C. Roesti. Down. D. V. Mycologist. H. Journal of Microbiological Methods. (2001) Straminipilous Fungi.. pp. A. S. G. pp67–76. G. J. (1994) ‘Analysis of micromycete communities in soil: A critique of methods’. 51–58. 2nd edition. Gautheron. Dick. Edel-Hermann.. y Rossi... pp. A. D. (1990) ‘Methods for studying fungi in soil and forest litter’. M. The Netherlands. Recorbet. FEMS Microbiology Ecology.. vol. 61–71. vol. J. 98. J. M. 11. Plant Pathology. pp. 53.

Phytopathology. (1996) ‘Microbial collections as a tool in biodiversity and biosystematic research’.. S. Cambridge. 888–891. Wasser. L. L. y Hughes. and prognosis’. CBS. D. Nevo. vol. Whalley (eds) Aspects of Tropical Mycology. pp. (2004b) ‘“Misidentifications” in fungal DNA sequence databanks’. A. A. Mycoscience. D. D. pp. in R. FEMS Microbiology Letters. Alfenas. pertinence. Grigorova y J. P. 4th edition. (2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. Winterhoff (ed) Fungi in Vegetation Science. Watling y A. vol.. D. K. T. vol. Applied and Environmental Microbiology. New Phytologist. (1993) ‘The tropical fungal biota. H. A. J. S. CBS. Hawksworth. Y. vol.. 50. Dordrecht. S. Stouthamer (eds) Culture Collections to Improve Quality of Life. Jr (1982) Multivariate Analysis in Community Ecology. pp. E. Baarn. Hawksworth. C. Hawksworth. vol. Costa. pp13–15. J. 69.Gams. J.. 310–342. J. western Upper Galilee. prophylaxis. Hawksworth. The Netherlands. Israel’. pp. in W. pp. in S. Gauch. vol. A. W. y Crous. 95.. Fagbola. 247. O. New York. Gray. G. Grishkan. vol. (2003) ‘Adaptive spatiotemporal distribution of soil microfungi in ‘Evolution Canyon’ II. Mycological Research. (1992) ‘The analysis of communities of saprophytic microfungi with special reference to soil fungi’. P. 41. y Aptroot. L. R. (1998) CBS Course of Mycology. Samson. (2004a) ‘Fungal diversity and its implications for genetic resource collections’. vol. N.. H. G. 91–100. L. 527–539. (1997) ‘Where are all the undescribed fungi?’. (1990) ‘Methods for studying the microbial ecology of soil’. (2001) ‘Evaluation of bioassays to quantify Cylindrocladium inocula soil’. Academic Press. (1991) ‘The fungal dimension of biodiversity. (2005) ‘Analyses of soil fungal communities in adjacent natural forest and hoop pine plantation ecosystems of subtropical Australia using molecular approaches based on 18S rRNA genes’. W. Rumjanek. C. Studies in Mycology. pp. Gonçalves. G. D. J. Gams. Kluwer Academic Publishers.. Frankland. Stalpers. C. M. W. 22. 261–264. Cambridge University Press. Lower Nahal Keziv. A. significance and conservation’. census. A. A. y Rossman. van der Mei y A. 641–655. y Beharav. 78. 87. Proceedings of the International Congress for Culture Collections. Hoekstra. C. vol. L. pp. E.. Isaac. Norris (eds) Methods in Microbiology. y Smalla.. 161. Buchner. Maffia. R. He. R. G. Xu. 183–223. 3758–3766. Hawksworth. L. magnitude. R. Mendonça-Hagler.. Hongos del suelo saprófitos y patógenos de plantas 271 . Biological Journal of the Linnean Society. Baarn. 26–35. Z. 9–18. pp. in R. Cambridge University Press. Gomes. D. L. Hawksworth.. pp. N.. pp. London. L. R. I. A. D.

y Jagnow. Kacprzak. D. Sullivan. Zo. pp. 52. B. A. 63. Microbial Ecology. Kirsop. P. vol. (2003) ‘Molecular detection of Fusarium solani f. K. pp. Applied and Environmental Microbiology. A. K. J. glycines in soybean roots and soil’. Y. Kirk. Wallingford. Hyde. Cannon. A.. (1995) ‘Soil microbial diversity and the sustainability of agricultural soils’. y Hartman. y Kim. sp. David.Houston. A. 11. 272 Manual de biología de suelos tropicales . 50. K. pp. World Federation of Culture Collections. C. C. vol. FEMS Microbiology Ecology. Applied and Environmental Microbiology. F. J. 257–265. L. K. W. P. y Nicholson.. Whalley (eds) Aspects of Tropical Mycology. 39. Kennedy. W. S. 62. H. Lee. pp. L. 38. vol. vol. H. D. T. Lees. P. y Smith. C.. A. vol. Hyde. S. M. (ed) (1996) Access to Ex-situ microbial genetic resources within the framework to the convention on Biological Diversity. Isaac. vol. 76. pp293–302. Cheng. E. S. N. C. Lodge. N. Plant and Soil. 463–473. Visser. C. 74–83. G. in S. Frankland. D.. 3112 –3120. (1995) ‘The use of correspondence analysis in studies of successions of soil organisms’. J. M. 89–95. vol. Edwards. vol. Pedobiologia. (2001) Dictionary of the Fungi. Mycologist. CAB International. S. E. R. (1986) ‘Fungi of a forest soil nitrifying at low pH values’. pp. L. pp. Plant Pathology. WFCC. vol. Cambridge. L. Watling y A. y Forney. 51. Marsh. M. J. S.. D. G. pp. J. 170. Howard. D. y Lautenschlager.. pp. Li. y Stanczyk-Mazanek. Lang. y Clipson. A. Cambridge University Press. R.. 4516–4522. (2003) ‘Changes in the structure of fungal communities of soil treated with sewage sludge’. (1996) ‘Nonradioactive method to study genetic profiles of natural bacterial communities by PCR single-strand-conformation polymorphism’. pp. 518–527. vol. Liu. 9th edition. (1997b) ‘Can we rapidly measure fungal diversity?’. (2005) ‘Soil bacterial and fungal community structure across a range of unimproved and semi-improved upland grasslands’. 37–58. 38. Plant Pathology. (1993) ‘Nutrient cycling by fungi in wet tropical forests’. (2002) ‘Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil’. Hong Kong. 176–178. pp. J.. Biology and Fertility of Soils. L. (1997) ‘Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16s rRNA’. J. 630–640. Kennedy. Canadian Journal of Botany. Cullen. y Robinson. pp. 75–86. y Stalpers. Hong Kong University Press.. (ed) (1997a) Biodiversity of Tropical Microfungi. (1998) ‘Microbial processes and fungal community structure in soils from clear-cut and unharvested areas of two mixed wood forests’. vol. P.

(2002) ‘Mechanisms of natural soil suppressiveness to soilborne diseases’. G. Princeton University Press. pp. G. 68. y Klein. Polar Biology. vol. (1970) ‘Detection. S. Magurran. y Smalla. (2004) ‘Effects of transgenic potatoes with an altered starch composition on the diversity of soil and rhizosphere bacteria and fungi’. Lavras. 42. Masago. (1977) ‘Selective inhibition of Pythium spp. E. vol.. 127–141. F. pp. y Mitchell.. Annual Review of Plant Pathology. pp. I. de Waal. K. F. on a medium for direct isolation of Phytophtora spp. R. 35–59. vol. L. (2004) ‘Assessment and management of soil microbial community structure for disease suppression’. A. Antonie van Leeuwenhoek. E. FEMS Microbiology Ecology. pp. 36. A. Schloter. y O´Donnell. y Hirsch. G. 81. Brazil. A.. Mazzola. 73 pp. Waite. vol. Maidl. pp. J. 552–561. D. vol. pp. Moreira. M. N. (2006) “Fungal diversity in maritime Antarctic soils determined using a combination of culture isolation. (2002) ‘Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating’. Malosso. isolation and pathogenicity of Phytophthora megasperma from soils and estimation of inoculum levels’. (2002) Microbiologia e bioquímica do solo.Lodge. M. y Siqueira. molecular fingerprinting and cloning techniques’. Phytopathology. G. vol. 85–92. Biodiversity and Conservation. from soils and plants’. Hopkins.. Muyzer. C. 60. Marks. y Munch. pp. X.. Mazzola. D.. C. M.. 266. 557–564. J. Fukada.. M. pp. K. (2001) ‘Comparative single-strand conformation polymorphism (SSCP) and microscopy-based analysis of nitrogen cultivation interactive effects on the fungal community of a semiarid steppe soil’. Muyzer. C. English. M. 29. H. vol. L.. Milling. Applied and Environmental Microbiology. T. 23–39. 1846–1853. (1998) ‘Application of denaturing gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology’. Smalla. H. J. Antonie van Leeuwenhoek. D. E. Kerry. pp. G. P. (1993) ‘Profiling of complex microbial populations by denaturing gradient electrophoresis analysis of polymerase chain reacHongos del suelo saprófitos y patógenos de plantas 273 . B. vol. (1988) Ecological Diversity and its Measurement. Princeton. W. y Uitterlinden. 1687–1690. 67. Yoshikawa. A. M. Mauchline. 425–428. S. Phytopathology. 6. Editora UFLA.. vol. y Nakanishi. E. 681–688 Lowell. R. J. J (1997) ‘Factors related to diversity of decomposer fungi in tropical forests’. A. Plant and Soil. O. vol.

3. 86. y White. 345. Mycological Progress.. vol. 51. Nikolcheva. K. C. vol. Cooke. y Pineda. Mouguel... O’Donnell. y Osswald. 103–116.tion-amplified genes coding for 16S rRNA’. A. Rodrigues. Dow. pp. T. and Bärlocher. vol. J. y Kantzer. Ranjard. Phytopathology. M. Molecular Phylogenetics and Evolution. S.. Poly. T.. W. 7.. D. Lews. 720–727. K. Casado. y Smalla. Lomsden. Plant Pathology. Pettitt. (1997) ‘Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous’. D. 41–49. H. A. A.. 4479–4487. Ayers. M. Thioulouse. G. D. E. L. F. Adams. pp. 59. J. F. C. 376–385. O. C. pp. y Hawksworth. B. B. K. in K. and bait methods for detection of Pythium and Phytophthora zoospores in water’.. Oros-Sichler. vol. 31.. vol. (2002) ‘Comparison of serological. O´Donnell. Maggi. J. (2001) ‘A combination of baiting and PCR techniques for the detection of Phytophthora quercina and P. Nechwatal. G. Philosophical Transactions Royal Society London. pp. 6. C. Neuber. J. L. N. D.. y Nazaret. Mycologia. vol. citricola in soil samples from oak stands’.. Gomes. Hong Kong. F. Applied and Environmental Microbiology. 274 Manual de biología de suelos tropicales .. Applied and Environmental Microbiology. Papavizas. y Cigelnik. vol. L. F. pp. 341–365. (2006) ‘A new seminested PCR protocol to amplify large 18S rRNA gene fragments for PCR-DGGE analysis of soil fungal communities’. M. F. (2004) “Taxon-specific fungal primers reveal unexpectedly high diversity during leaf decomposition in a stream’. Goodfellow. pp. R. Lata. Journal of Microbiological Methods. 871–877. Schlenzig. 67.. A. vol. (1998) ‘Diversity and variability in soil fungi from a disturbed tropical rain forest’. (2001) ‘Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints. F. G. G. R. vol. pp.. W. culture. (1994) ‘The foliar fungal endophytes of the Amazonian palm Euterpe oleraceae’. Jung. (1997) ‘Soil and rhizosphere microfungi from Brazilian tropical forest ecosystems’. Wakeham. M. M. L. Forest Pathology. 65–73. pp. G. vol. pp. Hyde (ed) Biodiversity of Tropical Microfungi. Wainwright. pp. J. 695–700. 90. biological and methodological variability’. J.. Biological Sciences. 206–214. L. Pfenning. A. Mycologia. J.. Persiani.. R. 63–75. G. 65. 85–97. L. (1975) ‘Ecology and epidemiology of Rhizoctonia solani in field soil’. pp. M. D. pp.. vol. P. A. A. (1994) ‘Theoretical and practical aspects of the quantification of biodiversity among microorganisms’.. Duncan. E. J.. M. Hong Kong University Press.

y Waller. (1992) “Direct recovery and molecular analysis of DNA and RNA from soil’. Setälä. (1995) Biometry: The Principles and Practice of Statistics in Biological Research. S. B. (2004) ‘Decomposition rate of organic substrates in relation to the species diversity of soil saprophytic fungi’. Fitopatologia Brasileira. 557–558. 5–12. E. P. W. 2614–2621. Singleton. Smit.. 1351–1362. 12. 3rd edition. M. Sneh B. 53–78. Sokal. 41–46. (1992) ‘Competitive PCR’. Munro. S. biochemical and molecular fingerprinting methods’. T. vol. y Ogoshi. O´Dell. H. Schuessler. Rossman. vol. (2004) ‘Fungal genetic resource centres and the genomic challenge’. Silva. G. P.. St. pp. pp. Parkway Publishers. Tulloss. W. Soil and Sediment contamination. pp. B. 17. V. (1984) Suppressive Soils and Plant Disease. M. C. Hongos del suelo saprófitos y patógenos de plantas 275 . A. European Journal of Soil Science. APS Press. Mycological Research. Paul. R. Freeman.. C. pp. W.. MN. Smith. Y. APS Press. L. E (2003) ‘Filamentous fungi isolated from estuarine sediments contaminated with industrial discharges’.. (1991) Identification of Rhizoctonia Species. A. Canhos. pp. special issue no 1. Burpee. A. 139. in Eucalyptus clonal garden soils’. (2006) ‘Investigating microbial community structure in soils by physiological. St Paul. Paterson. (1999) ‘Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes enconding 18S rRNA and temperature gradient gel electrophoresis’. L. 345-356. M. Schneider. pp. L. R. (1992) Methods for Research on Soilborne Phytopathogenic Fungi. y Esposito.. y McLean. J. P. y Smith. vol. R. P. St. vol. Boone. E. J. y Klingmüller. Acta Zoológica Mexicana. G. (1998) Protocols for an All Taxa Biodiversity Inventory of Fungi in a Costa Rican Conservation Area. Maffia. S. A. M.. Potts. Sanfuentes. Applied and Environmental Microbiology. Oecologia. Pfenning. A.. B. the Glomeromycota: Phylogeny and evolution’. pp. Mihail.. Alfenas. (2001) ‘A new fungal phylum. Siebert.. MN. F. E. Umbuzeiro. y Rohlf. P. y Millard.. pp. APS Press. L. J. Paul. A. NC. Schwarzott. pp. y Silveira. J. (1992) ‘Culture collections of microorganisms. vol. D. 177–183. y Larrick. Nature. 108.. 57. Ryan. vol. 105. pp. E. pp. 1.. New York. Mycological Research. J. Ord. H. M. Australasian Plant Pathology. vol. (2001) “Biodiversidad de los hongos fitopatógenos del suelo de Mexico’. y Rush.. 72–82. 66. vol. E. R. F. Microbial Releases. D. 359. Leeflang. D. R. y Walker C. D. K. Singh. W. L. MN. y Thorn. y van Elsas. Glandorf.. M. 1413–1421 Selenska. 31. J.Rodrigues-Guzman. vol. H. D. (2002) ‘Comparison of baits to quantify inoculum density of Rhizoctonia spp. A. J.. M. Reid. D. their importance in tropical plant pathology’. 98–107. vol. E..

Vujanovic. 143– 154. y Paul. Applied Environmental Microbiology. y Bartnicki-Garcia. 2275–2290. Y. 104. H. pp. Mycological Research. M.. Applied Environmental Microbiology. vol. Science. R. y Krsek. 2357–2372. pp. M. Bissett. y St-Arnaud. Leyval. Widden. P. Tsai. y Hunter. J.. 62. II. (1988) ‘Metabolic diversity of fungi in relation to growth and mineral cycling in soil: A review’. pp. A. 58. L. S. S. (2002) ‘Extensive fungal diversity in plant roots’. 295. V. Vandenkoornhuyse. D. Pasquier. 4288–4292. Reddy. Infrageneric classification’. Canadian Journal of Botany.. L. C. vol. vol. Filion. MN. D. M. pp. exploiting genomics and stable isotope probing’. (1983) Phytophthora. H. (1996) ‘Isolation of saprophytic basidiomycetes from soil’. 309– 317.. (2000) ‘Diversity of soil fungi studied by PCR-RFLP of ITS’. Viaud. M.Thorn. Wainwright. A. D... Whipps. y Budge. 169–183. 6. P. Taxonomy. MN. (1996) ‘An appraisal of soil fungal diversity: The crossroads between taxonomic and functional biodiversity’. y Visser. 1027–1032. vol. (2003) ‘Resolving functional diversity in relation to microbial community structure in soil. P. 276 Manual de biología de suelos tropicales . pp. H. E. Zak. Baldauf. (2005) ‘A PCR-denaturing gradient gel electrophoresis approach to assess Fusarium diversity in asparagus’. P. Section Longibrachiatum sect. C. 69. McQuilken. J. vol. M. its Biology. Bissett. Wellington. p. S. vol. A. Straczek.. E. (1984) ‘A revision of the genus Trichoderma. 159–170. C. 51. 295–301. Y. APS Press. J. Transactions of the British Mycological Society. Current Opinion in Microbiology. (1991a) ‘A revision of the genus Trichoderma. Pesticide Science. B. St. Yergeau. pp. E. 1070–1074. y Young. I. Canadian Journal of Botany. pp. P. vol. 5. pp. vol. Canadian Journal of Botany. 924–931. (1992) ‘Rapid method for direct extraction of DNA from soil and sediments’. B. (1973) ‘Fungi from Canadian coniferous forest soils’. (1998) Illustrated genera of imperfect fungi.. APS Press. E. J. J. pp. 2051. M.. 60. G. M. 90. M. Ecology and Pathology. Biodiversity and Conservation. Berry. H. nov. Harris. y Olson.. y Parkinson. Paul. S. 4th edition. P.. C. J. W. vol. A. vol. Tsao. vol. (1993) ‘Use of fungal antagonists for biocontrol of damping-off and Sclerotinia disease’.’. Erwin. pp. Manuales para identificación Barnett. St Paul. 62. y Brygoo. 37. Journal of Microbiological Methods. pp. vol.

1997). CMI. Kew. A. M. MN. Brady.. C. Klich. 69. CSIRO. MacNeil. 3rd edition. Osburne. F. Wallingford. A. (1998b) Combined Keys to Illustrated Genera of Ascomycetes.. I. P. A. Ellis. 4th edition.. Co. (2000) ‘Cloning the soil meHongos del suelo saprófitos y patógenos de plantas 277 . R. B. (2006) The Fusarium Laboratory Manual. T. A. P. pp. Handelsman. K. D. APS Press. vol. M. III. London. O. K. American Phytopathological Society. Gilman.. Australia. T. J. Bissett.. y Aptroot. 1990. CAB International. C. vol. P. Crous. W. H. H. IHW Verlag. Domsch. St Paul. expanded reprint (Richmond Publ. R. London. CMI. Summerell. S. J... vol. S. CSIRO. Baarn. Cannon. I. L. (2007) Compendium of Soil Fungi.. Karling.. 2nd edition. T. J. London. (1985) Microfungi on Land Plants: An Identification Handbook. North Ryde. MN. D. Tiong. J. Australia. R. pp. y Ellis. J.. August. Canadian Journal of Botany. Pitt. Section Pachybasium’. J. (2000) A Laboratory Guide to Common Penicillium Species. Gams. Additional notes on section Longibrachiatum’. J. y Anderson. 2418–2420. Erwin. (1977) Chytridiomycetarum Iconographia. Hanlin. R. (2001) Dictionary of the Fungi. American Phytopathological Society. Canadian Journal of Botany. A. MN.. Hanlin. C. American Phytopathological Society. (1998) CBS Course of Mycology.. M. Leslie. M. Gams. (1991c). David. y Ribeiro. R. II. Ellis. (1988) A Laboratory Guide to Common Aspergillus Species and Their Teleomorphs.. P. vol.. Clardy. 9th edition. W. (1996) Phytophthora diseases worldwide. R. y Goodman. Lynch. J. St Paul. L. Rondon. R.Bissett. Loiacono. B. Grossman. Mycologue Publications. CBS. M. B. E. ‘A revision of the genus Trichoderma. (1971) Dematiaceous Hyphomycetes. A.. y Bullock. Liechtenstein Kirk.T. (1998a) Illustrated Genera of Ascomycetes.. y Stalpers. F. C. (1993) Coelomycetous Anamorphs with Appendage-bearing Conidia. A. Hoekstra. Ellis. S. R. W. Cramer. P. J.. F.. Liles. M. S. M. Illustrated genera of Ascomycetes. Waterloo. M.. St Paul. K. 2373–2417. APS Press. S. M. Blackwell Publishers. MA. T. IV. Croom Helm. J. St Paul MN. B. The Netherlands.. Eching. (1991b) ‘A revision of the genus Trichoderma. MN. I. Betterman. Hanlin. Malden. A. J. St Paul. North Ryde. B. Kew. y Pitt. 69. (1976) More Dematiaceous Hyphomycetes. I. Nag Raj. Minor. J. vols I and II. M. Vaduz. (2002b) Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. T.

. R. J. Baarn. L. pp. M. (undated) ‘Trichoderma Online’. Jr. D. pp. 1–59. vol. 1–50.tagenome: A strategy for accessing the genetic and functional diversity of uncultured microorganisms’. 122. C. vol. Mycological Papers. O. y Filtenborg. APS Press. Kew. y Ogoshi. Samuels. y Padgett. W. B. 2541–2547. Erwin. St Paul. Burpee. Sutton. pp. M. 66. B. C. A. Waterhouse. 278 Manual de biología de suelos tropicales . H. The Netherlands. Tsao. London. vol. CBS. G. Hoekstra. 110. (1983) Phytophthora: Its biology.. D. P..gov/ taxadesciptions/keys/Trichodermalndex. D. ecology and pathology. M. Waterhouse. (1967) ‘A key to Pythium Pringsheim’. Mycological Papers. C. y McCray. Farr. www. E. http://nt. MN. Sneh. Mycological Papers. (1968) ‘The genus Pythium Pringsheim: Diagnoses or descriptions and figures from the original papers’. E. MN.edu/people/padgett/book. F. A. G. (1980) The Coelomycetes.. Systematic Botany & Mycology Laboratory. P. Waterhouse. B. Samson. APS Press. y Bartnicki-Garcia. accessed November 2002. pp1–15. CMI. (2002) ‘Biology and systematics of Saprolegniaceae’. G. R..uncw. 6th edition. Applied Environmental Microbiology. 109. St Paul. Seymour. J. (2000) Introduction to Food and Air-borne Fungi.ars-gring. (1991) Identification of Rhizoctonia species. Sitios web Johnson. taxonomy. Frisvad. S. G. ARS. T.. vol. S. Chaverri. L. E. USDA. (1970) ‘The genus Phytophthora de Bary: Diagnoses or descriptions and figures from the original papers’.cfm..

molida 100g agar 18g penicilina 0.1g V8 agar V8 100 Ml CaCO3 2.1g Hongos del suelo saprófitos y patógenos de plantas 279 .1g agar 18g MP5.s zanahoria.agar papa zanahoria papa 20g zanahoria 20g agar 18g CA – agar zanahoria zanahoria.p.p.agar maltosa peptona maltosa 4. MA2% .2g pimaricina 0.2g pimaricina 0.5g glucosa 0.5g KCL 0.s.Apéndice 8.agar extracto de malta extracto de malta 20g agar 18g SNA – agar sintético pobre en nutrientes KH2PO4 1. si es necesario penicilina 0. cubitos 200g dextrosa 20g agar 18g PCA.02g estreptomicina 0.02g estreptomicina 0. (1998) y Erwin y Ribeiro (1996).02g estreptomicina 0.2g pimaricina 0.0g agar 18g agua destilada 900 ml PARP harina de maíz 17g pimaricina 10mg ampicilina 250mg rifampicilina 10mg pentacloronitrobenceno 100mg himexazol 50mg AHM + p. basados en Gams et al.0g KNO3 1. –agar con harina de maíz harina de maíz 8.0g MgSO4 x 7H2O 0. molida 100g agar 18g CA + p.2g sacarosa 0.0g penicilina 0.0g peptona 1.0g agar 18g Antibióticos.2g agar 18g OA – agar harina de avena Copos de avena 30g Agar 15g ADP – agar dextrosa y papa papa.1 Medios de cultivo y aditivos: cebos Las recetas son para un litro.

exoesqueleto de camarones. Sustratos queratinosos: cabellos de niños rubios. zanahoria o pepino. 280 Manual de biología de suelos tropicales . epidermis de cebolla. granos de polen de Pinus. hojas secas de maíz. Sustratos celulósicos: semillas de Sorghum. Los cebos de vegetales pueden ser lavados. papel celofán. Sustratos quitinosos: piel de serpiente. trozos de manzana.Cebos El uso de cebos es imprescindible para la recuperación de zoosporas formadas por hongos de sustratos complejos como el suelo. papa. los de origen animal son esterilizados usando luz UV por una hora. alas de insectos. Dependiendo del tipo de hongo pueden ser utilizados cebos específicos.

Los daños que producen las moscas de la fruta se dan durante la fase inmadura. 1992). 1972. Steck y Wharton. Se trata de insectos multivoltinos con un potencial biótico relativamente alto y una gran capacidad para infestar diferentes especies de frutos nativos y exóticos. Las características taxonómicas que permitan distinguir sexos entre pupas y larvas aún no se han determinado (Salles. Su clasificación se basa exclusivamente en los caracteres morfológicos del adulto. Algunos estudios han acentuado aspectos ecológicos y etológicos de las moscas de la fruta. el periodo durante el cual la larva destruye la pulpa de la fruta.Capítulo 9 Muestreo. éstas pertenecen al orden Díptera. y a la familia Tephritidae. Bactrocera. Rhagoletis y Dacus. excepto en la Antártida (White y ElsonHarris. volviéndola 281 . Zucchi et al.. las moscas de la fruta son consideradas una de las más preocupantes. con una punta larga y delgada. ya que representan plagas primarias para la mayoría de los cultivos frutales. y su sexo es fácilmente distinguible debido a que las hembras tienen un prominente ovopositor. 2000). Se distinguen cinco géneros importantes de esta plaga: Anastrepha. preservación e identificación de moscas de la fruta Neliton Marques da Silva INTRODUCCIÓN Entre las plagas de la fruta de América tropical. 1988). 1996. en su mayor parte. Ceratitis. enfocados a las fases de pupa y larva (Silva et al. debido al gran impacto económico que causan. que se extienden globalmente. Las moscas de la fruta muestran un comportamiento y una taxonomía complejos (Bateman.. al final del abdomen. 1996).

y constituye una de las fases más vulnerables al estrés abiótico y a muchos enemigos naturales. por lo tanto. 200 ml de proteína hidrolizada de maíz (5% en agua preservada con tetraborato de sodio con un pH entre 8. durante una parte de su ciclo de vida. dependiendo de la temperatura y de la humedad. ramas o semillas en donde las larvas de la mosca residían previamente. que también forman parte de la biota del suelo (véase Capítulo 10). normalmente. sobre todo. De manera alternativa. junto con el suelo. el uso de trampas con cebos alimenticios es lo más recomendable. Los cebos deberán reemplazarse cada semana y los especímenes capturados. puesto que ésta sólo se puede establecer usando frutos infectados.inservible para cosecha o consumo. hongos y nematodos. que es diurna y responde a estímulos visuales y olfativos. la mosca de la fruta se puede considerar un organismo del suelo. Estos antagonistas juegan un papel importante en el control biológico de las moscas de la fruta. las larvas migran de la fruta para pupar en el suelo (Ilustración 8a). Debido a que el ciclo de vida involucra las partes aéreas de la planta hospedera.5 y 9). Antes de llegar al estado adulto. la humedad y la textura. de ahí que. El desarrollo de la pupa ocurre en el suelo. esta técnica representa una relación ambigua entre la mosca y su hospedero. las larvas se mueven sobre la superficie del suelo buscando condiciones adecuadas para su desarrollo y penetran hasta una profundidad aproximada de 10 cm para entrar en la fase de pupa. Aun cuando las larvas son parasitadas dentro de los frutos. pues sólo permanece ahí durante una etapa de su vida. MUESTREO DE LA MOSCA DE LA FRUTA El muestreo de adultos de moscas de la fruta se lleva a cabo utilizando trampas McPhail (Ilustración 8b) con atrayente alimenticio. Después de que la fruta infestada cae. sin embargo. en función de la temperatura. 282 Manual de biología de suelos tropicales . el parasitoide adulto puede emerger en el suelo. se puede utilizar jugo de fruta al 10%. removidos. En el caso de la mosca adulta. por ello. en su mayor parte depredadores y entomopatógenos como bacterias. resulta de suma importancia que en el diseño de la estrategia del manejo integrado de plagas se tome en cuenta la biodiversidad del suelo como un factor fundamental que influye en la mortalidad de larvas y pupas. azúcar al 10% o jarabe de caña de azúcar al 10%. La fase pupal dura de 8 a 10 días. los procedimientos para muestrear varían de acuerdo con la fase y el propósito. Esta profundidad varía dependiendo de las condiciones físicas del suelo. la mosca de la fruta es un habitante temporal del suelo.

la trampa puede utilizar como soporte tres palitos. Cuando el objetivo es el manejo integrado. Se anota el sexo y se colocan en frascos de vidrio (de alrededor de 50 ml) etiquetados. Las trampas deberán ser colocadas de manera equidistante. M. Trampa No 5 • • • • • También deberá ser registrada la identidad de individuos de otros grupos taxonómicos capturados en las trampas. una trampa cada cuatro hectáreas resulta suficiente. primero será necesario separar las moscas de la fruta de otros especimenes. Muestreo. N. con alcohol al 70% para su identificación posterior. el contenido de la trampa deberá pasarse por una malla de nylon de 1. En el caso de plantas herbáceas. El número de trampas por unidad de superficie puede variar de acuerdo con los objetivos del proyecto. es decir.Las trampas se instalan en el centro del dosel de los árboles y su localización será tomada con GPS.5 mm para remover las moscas y separarlas de otros grupos taxonómicos utilizando unas pinzas curvas. cada tipo de uso de suelo existente debe ser monitoreado con la misma densidad de trampas. si lo hay. o bien. Por ejemplo: Manaus-AM Brasil 04° 05`S. esto se puede llevar a cabo en el campo o en el laboratorio. La etiqueta deberá incluir la información básica de muestreo y el número de la trampa. Cuando los cebos son reemplazados. Hasta cinco trampas por hectárea pueden ser instaladas en áreas con arbustos o árboles (jardines caseros). dispuestos en forma de trípode. la densidad deberá ser de tres a cinco trampas por hectárea o estar de acuerdo con el tipo de uso de suelo existente en el predio. Si el objetivo es monitorear plagas. colocarse sobre un árbol adyacente. preservación e identificación de moscas de la fruta 283 . mientras que. hasta tres por hectárea son las recomendadas para plantaciones herbáceas. 60° 04´W 23/Marzo/2006 Silva. COLECCIONANDO LOS ADULTOS CAPTURADOS Debido a la probabilidad de que distintos grupos taxonómicos de insectos sean capturados.

Las fechas de emergencia. de 1. para permitir la salida de las moscas adultas y/o parasitoides. las moscas adultas son alimentadas con una solución de miel disuelta en agua al 10% que será cambiada cada día. el número y el sexo deberán quedar registrados con relación a las moscas o parasitoides.5 mm. Los frutos muestreados se separan por especie. se cuentan y se separan para cada sitio de muestreo. durante 48 horas para permitir el endurecimiento cuticular y la pigmentación completa de los patrones alares (Ilustración 8c): características de gran importancia para la identificación taxonómica. Después de emergidas. OBTENCIÓN DE LAS PUPAS La vermiculita o arena fina deberá pasarse por una malla galvanizada. se depositan en charolas de plástico con una capa de vermiculita o arena fina como substrato de pupación. los especimenes recuperados son fijados en una solución de alcohol al 70%. se protegen con bolsas de tela y se transportan en cajas térmicas hasta el laboratorio. el aculeo de la hembra bajo un microscopio estereoscó284 Manual de biología de suelos tropicales . las charolas se cubren con una tela de gasa y se aseguran con ligas de plástico para prevenir que se escapen las moscas adultas al emerger. se pesan. para separar las pupas que posteriormente serán colocadas en jaulas. Los frutos deberán ser colectados directamente de los árboles o inmediatamente después de caer al suelo.MUESTREO DE LA FRUTA Para poder establecer la relación entre las especies Anastrepha con sus plantas hospederas. La determinación de la relación de sexos hembra-macho (SR) para moscas adultas y parasitoides se hace de acuerdo con Silveira-Neto (1976) en función de la siguiente ecuación: Número de hembras SR= Número de hembras + Número de machos IDENTIFICACIÓN DE ESPECIES La identificación taxonómica de especies de Tephritidae se basa en un examen ventral de la región apical. Finalmente. Posteriormente. Los adultos emergidos serán retenidos. Estas jaulas deberán ser examinadas diariamente. Finalmente. con sus respectivas etiquetas de identificación. se recogen frutos al azar en diferentes agroecosistemas y en diferente estado de de maduración.

preservación e identificación de moscas de la fruta 285 . A. como las de Lima (1934). L. pp. Stone (1942).pico (40X) o mediante el montaje sobre laminillas para examinar estas estructuras. Silva. M. abdomen y. A. Zucchi (eds) Moscas-das-frutas de importância econômica no Brasil: Conhecimento básico e aplicado. Annual Review Entomology. daciformis. Brazil. (2002) “Ocorrência e flutuação populacional de espécies de moscasdas-frutas eparasitóides com ênfase para o Gênero Anastrepha (Diptera: Tephritidae) na Amazônia Brasileira’. A. A. Vanzolini (ed) A Catalogue of the Diptera of the Americas South of the United States.)’. 487–575. Malavasi and R. in M. 493–518. Es recomendable que se depositen ejemplares de referencia en colecciones de museo. The Pennsylvania State University. Norrbom. es necesario extraer completamente el aculeo de la funda del ovipositor con ayuda de agujas o pinzas (Ilustración 8d). Memórias do Instituto Oswaldo Cruz (Rio de Janeiro). robusta and schausi species groups of Anastrepha Schiner (Diptera: Tephritidae)’. no. Steyskal (1977). las características morfológicas del aculeo (Ilustración 8e) con especímenes de museo o usando claves taxonómicas. o que éstas sean incorporadas a la colección institucional del laboratorio. pp. mesonoto. Ribeirão Preto. Zucchi (1978 y 2000) y Norrbom (1985). B. Manaus. University of São Paulo. vol. tergito medio. (1985) ‘Phylogenetic analysis and taxonomy of the cryptostrepha. Ronchi-Teles (2002). En primer lugar. São Paulo. Silva (1993). Federal University of the Amazon (UFAM) and National Institute for Agricultural Research (INPA). Holos. Muestreo. PhD Thesis. REFERENCIAS Bateman. R. coloración de cuerpo. L. Secretaria da Agricultura. especialmente. C. Foote. (1993) “Levantamento e análise faunística de moscas-das-frutas (Diptera: Tephritidae) em quatro locais do Estado do Amazonas’. M. Brazil. Pennsylvania. comparando el patrón alar. 4. Foote (1967). (1967) ‘Family Tephritidae’. vol. São Paulo. como lo describe Zucchi (1988). PhD thesis. 28. Salles. N. 1868 (Diptera: Trypetidae)’. H. utilizando un microscopio de transmisión (100X). PhD Thesis. (1934) “Moscas-de-frutas do gênero Anastrepha Schiner. 17. Escola Superior de Agricultura “Luiz de Queiroz”. A. La identificación de especies del género Anastrepha se logra para las hembras adultas. (1972) ’The ecology of fruit flies’. in A. Lima. Ronchi-Teles. Departamento de Zoologia. (2000) ‘Biologia e ciclo de vida de Anastrepha fraterculus (Wied.

y Elson-Harris. M. vol. M. 6. 1–112. (1988) “Moscas-das-frutas (Dip. White. Steck and B. R. Annals of the Entomological Society of America. grandis (Diptera: Tephritidae)’. R. Boca Raton. J. (1942) ‘The fruit flies of the genus Anastrepha’. limae. C.Silva. V. (1996) ‘Anastrepha species (Diptera: Tephritidae) from the Brazilian Amazon: Distribution.. PhD Thesis. pp. no.. pp. N. Boca Raton. 439. J. Ribeirão Preto. University of São Paulo. A. N. Zucchi. CRC Press. M. and Silveira Neto. 994–1003. Nakano. Malavasi and R.. 81. A. Zucchi (eds) Moscas-dasfrutas de importância econômica no Brasil: Conhecimento básico e aplicado. y Nova. (1988) ‘Description of immature stages of Anastrepha interrupta. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. A. Brazil’. Steck. R. Barbin. A. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. M. y Silveira Neto. S. A. y Wharton. CRC Press. Washington DC. Escola Superior de Agricultura ‘Luiz de Queiroz’. distribuição geográfica e hospedeiros”. Steck and B.. 286 Manual de biología de suelos tropicales . Entomological Society of Washington. Ceres. A. (1996) ‘The natural hosts plants of Anastrepha (Diptera: Tephritidae) in the State of Amazonas. S. Steyskal. Silva. I. (eds) (1976) Manual de Ecologia dos Insetos. A. Silveira Neto. Wallingford. CAB International. Tephritidae) no Brasil: taxonomia. United States Department of Agriculture Miscellaneous Publications. Stone. in G. S. A. Campinas. (2000) ‘Taxonomia’. D. A. Zucchi. Fundação Cargill. Zucchi. A. R. O. and A. hosts and lectotype designations’. L. São Paulo. A. R. (1978) “Taxonomia das espécies de Anastrepha Schiner 1868 (Diptera: Tephritidae) assinaladas no Brasil’. A. in G. vol. in A. in H. Zucchi. (1977) Pictorial Key to Species of the Genus Anastrepha (Diptera: Tephritidae). J. G. R.. M. M. (1992) Fruit Flies of Economic Significance: Their Identifications and Bionomics. São Paulo. N. Holos Zucchi. de Souza (ed) Moscas-das-frutas no Brasil.

el primero para llevar a cabo el proceso de infección y el segundo. Los principales microorganismos utilizados. Jr y Ricardo Sousa Cavalcanti INTRODUCCIÓN Existe alrededor de medio millón de especies de insectos descritas en la tierra. El control microbiano es una forma de control biológico cuyo principio es el uso racional de entomopatógenos sin que necesariamente se eliminen las poblaciones de plagas. sin intervención humana. con el fin de utilizarlas como mecanismos de control de especies que son plaga.Capítulo 10 Hongos y nematodos entomopatógenos Alcides Moino. y que han demostrado su 287 . pero sí manteniéndolas en niveles por debajo del umbral de daño económico. o bien. De éstas. prevenir su ocurrencia en insectos benéficos. 1992). para resistir la enfermedad. Las enfermedades son procesos dinámicos en donde el patógeno (microorganismo) y el hospedante (insecto) están adaptados morfológica y fisiológicamente. Esto es similar a la dinámica natural que sucede en el campo entre el patógeno y su hospedante. aunque la cifra verdadera de diversidad puede ser mucho mayor (Groombridge. La patología de insectos es la ciencia que estudia las enfermedades de insectos. frecuentemente hospedante-específico. Si se asume que cada especie de insectos es susceptible a por lo menos un microorganismo patogénico. el 10% pueden considerarse plagas agrícolas forestales o urbanas. aproximadamente. ello da la idea de la potencial importancia del estudio de estos patógenos de insectos en el contexto de control de plagas y de biodiversidad.

se han utilizado como biopesticidas para su uso contra poblaciones de plagas. los virus. los basados en toxinas). Un pequeño número de especies generalistas con capacidad para ser cultivadas y producidas de manera masiva.. ambos presentan desventajas debido a su alto costo. Leger. Los estadios juveniles parasitan a sus hospedantes. a pesar de ello.5 mm de largo. éstos aparentemente son componentes diversos y universales de las biotas del suelo. los nematodos y los protozoarios. 1995).. baja persistencia e inactividad a bajas temperaturas (en el caso de los nematodos). la Sterneinematidae y la Heterorhabditidae que son parásitos obligados de insectos y que son la base de varios plaguicidas biológicos diseñados específicamente para su uso en contra de plagas del suelo como los gorgojos y las larvas de mosca. 1997. como es el caso de Lecanicillium logisporum. debido a su alto costo. 2006). 1995): los organismos producen fases infectivas que son liberadas al ambiente cuando muere el hospedante 288 Manual de biología de suelos tropicales . A pesar del éxito limitado de hongos y nematodos entomopatógenos como productos biocidas. 1994. Se conocen cientos de especies de hongos entomopatógenos que atacan una amplia gama de insectos y ácaros. pobre persistencia (especialmente bajo condiciones tropicales) y su baja eficacia cuando se compara con los insecticidas químicos (por ejemplo. aunque esta tecnología no se ha adoptado por completo en la práctica. invadiendo su cuerpo y matándolo de cuatro a diez días posteriores a la infección. Roy et al. Los hongos producen esporas que germinan al contacto con el hospedante. aparece una nueva generación de estadios infectivos (Kaya y Gaugler. las bacterias. con varios grados de especificidad con su hospedante (Hajek y St. y convirtiéndose posteriormente en adultos. Los nematodos entomopatógenos miden alrededor de 0. 1993). permitiendo que los nematodos crezcan y maduren sobre el tejido en descomposición. causar la muerte rápida del hospedante y provocar grandes niveles de mortandad en las poblaciones de éste) y causar epizoóticas periódicas (Chandler et al.potencial en el control microbiano de insectos son: los hongos. La mayoría de los patógenos poseen una estrategia de transmisión de “sentar y esperar” (sensu Ewald. Existen dos familias. Myers y Rothaman. se producen miles de nuevas esporas que se dispersan y continúan su ciclo de vida en nuevos hospedantes. penetrando directamente la cutícula o a través de las aperturas naturales como los espiráculos. en donde pueden ser excepcionalmente virulentos (o decir. Después de una a dos semanas posteriores a la invasión del hospedante. las bacterias que se introducen junto con el parásito se multiplican rápidamente y matan al hospedante. Una vez muertos los insectos.

Lecanicillium lecanii. sugiriendo de nuevo que los patógenos se distribuyen ampliamente en el suelo. como los que habitan debajo de éste. M. Con frecuencia no hay correlación entre la densidad del hospedante y la ocurrencia de la enfermedad. H ongos y nematodos entomopatógenos 289 . el suelo es. 2001). Neozygites). son susceptibles a hongos y nematodos. Entomophaga. BIOLOGÍA DE HONGOS Y NEMATODOS ENTOMOPATÓGENOS Hongos Los hongos son microorganismos unicelulares (levaduras) o multicelulares (especies filamentosas). sin duda. Nomuraea rileyi. además de otros carbohidratos y proteínas.. Aunque los artrópodos que viven por encima del suelo.. En el caso de los hongos entomopatógenos esto se apoya en evidencia molecular que muestra que poblaciones en suelo no son totalmente clonales. aunque su eficiencia competitiva en comparación con otros saprótrofos de vida libre puede ser baja. Estas estructuras vegetativas son llamadas hifas. y hongos del orden Entomophthorales (Zoophthora. Hirsutella thompsonii. Paecilomyces spp. lo que les permite mayor distribución geográfica de la población y alta movilidad. se producen asexualmente estructuras reproductivas conocidas como esporas o conidias que ayudan a la diseminación del patógeno. Metarhizium anisopliae. Cordyceps spp.y tienen la capacidad de entrar en un estado de letargo o diapausa y permanecer latentes hasta que haya nuevos hospedantes disponibles. que constan de células alargadas provistas de una pared que contiene celulosa y quitina. Entomophthora. Los hongos poseen una gran variabilidad genética y un amplio rango de hospedantes. Esta capacidad es una adaptación a sus hospedantes artrópodos que son más grandes y con patrones de distribución en parches. Aschersonia aleyrodis. Las fases de diapausa y latencia reducen la dependencia en la movilidad de su hospedante y pueden complementarse con la capacidad para vivir saprotróficamente en suelo. flavoviride. el reservorio de las fases infectivas. ello a pesar de la ausencia de fases sexuales manifiestas y que el significativo flujo de genes ocurre localmente (Bidochka et al. Los hongos de mayor interés por su potencial como patógenos de insectos son: Beauveria bassiana. Después de la infección exitosa de un hospedante. debido a que ofrece un microambiente estable con una estructura de poros favorable para nematodos y recursos orgánicos para hongos..

A continuación se describen dos técnicas básicas para el aislamiento de hongos y nematodos entomopatógenos a partir de muestras del suelo. 290 Manual de biología de suelos tropicales . 1986. METODOLOGÍA PARA EL AISLAMIENTO DE HONGOS ENTOMOPATÓGENOS (Chase et al.Nematodos Los nematodos entomopatógenos son organismos pseudocelomados vermiformes muy similares a los que parasitan plantas y que pueden asociarse con los insectos de tres formas: forecia (adherencia pasiva y transporte). espiráculos y ano. bacterias y otros microorganismos saprotróficos que no tienen potencial como agentes específicos para el control de plagas. cuando el objetivo del muestreo es evaluar la biodiversidad (por ejemplo. Los principales grupos de nematodos de interés pertenecen al orden Rhabditida. De igual manera. cuando un insecto muerto es recogido para el cultivo de inóculo infectivo. también pueden obtenerse resultados semejantes y se requerirá de medidas adicionales para identificar patógenos con potencial. y dentro de éste a las familias Steinernematidae y Heterorhabditidae. la identificación se fundamenta en medidas hechas a partir de estructuras presentes en los estadios juveniles infectivos. Estas bacterias se multiplican dentro del insecto y lo matan al causarle septicemia (infección generalizada). Alves et al.. parasitismo obligado y parasitismo facultativo. es muy común encontrar también hongos.. La población microbiana en cualquier ambiente natural es muy grande y por lo tanto. Liud et al. 1998A) Las muestras de suelo se colectan a una profundidad de 0 a 20 cm y se colocan en bolsas de plástico debidamente etiquetadas. Los nematodos transportan internamente bacterias específicas que son liberadas en el interior del cuerpo del insecto después de que el nematodo penetra a través de aberturas naturales como boca. las cuales son los agentes primarios que inician la infección en el hospedante.. en el caso de los hongos. en el caso de los nematodos. aislar poblaciones. 1993. En cada sitio de muestreo. en el suelo). Sin embargo. Por lo general. los nematodos entomopatógenos presentan una estrecha asociación (simbiosis) con bacterias específicas. La identificación correcta de un agente entomopatógeno. para lograr una buena identificación es necesario aislar el microorganismo en cultivos puros o al menos. se basa en caracteres morfológicos del organismo en cultivo y en la estructura de los conidióforos y conidias.

Después de este paso se toman 0. con la subsecuente purificación de los cultivos (Figura 10. y agua destilada hasta completar el volumen total de un litro. 550 mg de dodina (N-dodecilguanidina acetato). utilizando agua destilada esterilizada hasta alcanzar una dilución 10-4. aunque puede prescindirse de él. el volumen añadido se reparte sobre la superficie utilizando una asa de Drigalski (ya sea de acero inoxidable o vidrio). Las cajas se incuban a 27°C (Figura 10. El medio selectivo de dodina se prepara de la siguiente manera: 20 g de harina de avena + 1 litro de agua destilada.2) y almacenaje de conidios en condiciones de congelación utilizando tubos Eppendorf para tal fin. H ongos y nematodos entomopatógenos 291 .1). 5. 200 g infusión de papa (preparada a partir de papas rebanadas y hervidas para extraer el almidón). Estas muestras pueden tomarse mediante el método de extracción de núcleos (véase Capítulo 4: Mesofauna).. En el laboratorio se debe mezclar muy bien la muestra compuesta y tomarse alícuotas de 1g de suelo.1ml y se colocan en medio de cultivo selectivo (el cual contiene el fungicida dodina) y en medio ADP (Agar-Dextrosa-Papa). El medio ADP se prepara de la siguiente manera: 15 g de agar. Esto suele ser efectivo especialmente con Metarhizium anisopliae.0 mg de tetraciclina y 10 mg de cristal violeta. De las diluciones 10-3 y 10-4 se toman 0. 20 g de dextrosa. se esteriliza durante 20 minutos a 120°C y se filtra. A partir de estas alícuotas se preparan diluciones 10-1 sucesivamente. Beauveria bassiana y Paecilomyces spp. El fungicida dodina se añade en pequeñas concentraciones (cerca de 10 mg ml-¹) al medio selectivo con el fin de aislar hongos entomopatógenos a partir del suelo y preservar los aislamientos menos susceptibles al fungicida.. se añade agua destilada hasta alcanzar el volumen original de 1 litro y posteriormente se añaden 20 g de agar. tales como conidióforos. El crecimiento de los hongos y su esporulación se evalúan de 7 a 15 días posteriores a la inoculación.se toma una muestra compuesta a partir de seis submuestras tomadas en puntos localizados alrededor de un monolito central (véase Capítulo 2). Samson et al. conidias y fiálides (Alves et al. Después de la incubación. 1998b.1 ml de la última dilución y se colocan sobre la superficie del medio de cultivo contenido en una caja Petri. 1998). la identificación de los cultivos de interés (principalmente Metarhizium anisopliae.) puede llevarse a cabo usando un microscopio compuesto y claves de identificación basadas en caracteres morfológicos de las estructuras reproductivas.

creciendo en medio ADP.Figura 10. Nota: la separación de contaminantes se logra recogiendo una pequeña porción de cualquiera de las colonias del hongo de interés con una aguja.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) dilución seriada de la suspensión acuosa que contiene al hongo. bajo condiciones de congelación. 292 Manual de biología de suelos tropicales . c) incubación bajo condiciones controladas en una cámara DBO. y transfiriéndola a una caja Petri nueva con medio de cultivo ADP (tres puntos de inoculación por caja).2 Cultivos purificados de Beauveria bassiana. d) almacenaje de conidios en tubos Eppendorf. b) inoculación de la suspensión (alícuota de 0.1 ml) en una caja petri con medio de cultivo. Figura 10.

1mM.3) para colectar los estadios juveniles infectivos a partir de los cuerpos muertos.7H2O 0. Después de dos días.. pH 6. Las larvas de este lepidóptero son conocidas como mealworms (o gusanos de la harina).4M. el cual cae hasta tocar el líquido en el borde de la caja inferior.3M. si se encuentran estados infectivos en el líquido. y pueden adquirirse comercialmente.METODOLOGÍA PARA EL AISLAMIENTO DE NEMATODOS ENTOMOPATÓGENOS (Bedding y Arkhurst. que contienen las muestras de suelo y se mantienen cerradas a 23°C en oscuridad. 1μM colesterol) a la que se le añaden 26 ml de una solución nutritiva fresca que contiene citrato de K 0.3mM.1M NaCl. MgSO4 0.6mM. El medio “S” consiste en un litro de solución madre (0. H ongos y nematodos entomopatógenos 293 .7H2O 0. La mortandad de las larvas se evalúa después de cinco a siete días. Na EDTA 0. Los ejemplares de nuevas especies pueden someterse a un análisis molecular para así comparar los patrones de DNA. la suspensión se lava adicionando una solución de formaldehído (1%) o solución de Ringer para obtener una concentración final de 10. Posteriormente.. 1998b.) (Lepidoptera: Pyralidae). Figura 10.000 estados infectivos ml-¹. Los nematodos se almacenan en envases cerrados de 50 ml a 11°C o cercano a esa temperatura. Las larvas de insectos infectadas se colocan en el centro del papel filtro. CaCl2 0. CuSO4 0 1μM. La suspensión se deja reposar para permitir que los nematodos queden en el fondo. Las larvas muertas se colocan en una trampa White (Chen et al. 0. 2002). utilizando la técnica de trampas de insectos con cinco larvas de Galleria mellonela (L. 1974) Se recogen las muestras de la misma forma que fue descrita anteriormente.0. Adams y Nguyen.05M KH2PO4. La detección de nematodos se lleva a cabo mediante bioensayos. FeSO4. 2004.4M. Una trampa de White se puede construir utilizando dos cajas Petri: una caja de 5 cm de diámetro se coloca invertida dentro de una caja de 9 cm que contiene agua esterilizada o medio “S” esterilizado y cubierta con un círculo de papel filtro de 9 cm. éstos deben colectarse y colocarse en agua destilada dentro de un frasco Becker. ZnSO4. Las larvas se colocan en cajas de plástico de 500 ml. La identificación se lleva a cabo con base en las claves específicas de identificación para cada familia de nematodos (Steinernematidae y Heterorhabditidae) (Alves et al.

B. A. Alves. Piracicaba Brazil. B. (2002) ‘Taxonomy and Systematics’. N.. Gaugler. B. Bidochka. A. C. B. J. J. (1998b) “Chaves para identificação de patógenos de insetos”. T. E. M.. S. L. Gaugler (ed) Entomopathogenic Nematology. A. in S. Ferraz. y Akhurst.Figura 10. M. Almeida. R. A. FEALQ.. REFERENCIAS Adams. J. Fotos: R. y Alves. (2001) ‘Habitat association in two genetic groups of the insect-pathogenic fungus Metarhi294 Manual de biología de suelos tropicales . 109–110. M. B. y De Croos.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). y Nguyen. (1998a) “Técnicas de laboratório”. A.. y Castello Branco Jr. 2nd edition. Moino Junior. CAB International. R. Wallingford. in R. S. c) larvas que muestran la patología típica de infección por nematodos. Lavender.. Alves. J. A. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. in S. Nematologica. J. (1974) ‘A simple technique for the detection of insect parasitic nematodes in soil’. L. Deckoning. Bedding. F. d) emergencia de juveniles infectivos en la trampa White. C. Alves (ed) Controle Microbiano de Insetos. 2nd edition. J. vol. 21. pp.. Kamp. M. B. FEALQ. K. Alves (ed) Controle Microbiano de Insetos. Piracicaba Brazil. B.

pp. D. C. Trends in Ecology and Evolution. R. D. 81. J. pp. A.. M. y Pell. Milner. London. pp. R. (1995) ‘The evolution of virulence: A unifying link between parasitology and ecology’. E. Annual Review of Entomology. New York. 1335–1342. Groombridge. from soil’. vol. y St.. Hajek. A. vol. vol. Annual Review of Entomology. Samson. (1995) ‘Virulence and transmission of infectious diseases in humans and insects: Evolutionary and demographic patterns’. B.. vol. 5. CAB International. 51. Liu. y Ferguson. J. vol. pp. H. 659–669. Osborne. 331–357. Z. pp. Evans. (1988) Atlas for Entomopathogenic Fungi. y Latgé. (2006) ‘Bizarre interactions and endgames: Entomopathogenic fungi and their arthropod hosts’.. 10. J. Annual Review of Entomology. vol. R. L. J. E. A. R. y Read. 181–206. D. Z. H. G. y Rothaman. (ed) (1992) Global Biodiversity: Status of the Earth’s Living Resources. y Dickson. Y. 248–251. Chandler. pp.. y Lutton. Applied Soil Ecology. 285–292. vol. Kaya. 39. Chapman and Hall. 194–198. pp. Journal of Invertebrate Pathology. A.zium anisopilae: Uncovering cryptic species’. McRae. Journal of Parasitology. y Gaugler. A. 67. World Conservation Monitoring Centre. V. Eilenberg.. 133-141. Ewald. Y. (1986) ‘Selective isolation of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium’. (1997) ‘Sampling and occurrence of enomopathogenic fungi and nematodes in UK soils’. S. pp. K. Applied and Environmental Microbiology. vol. J. W. S. (1993) ‘Entomopathogenic nematodes’. Hay. Chen. pp. (1994) ‘Interactions between fungal pathogens and insect hosts’. H. 293–322. P.. K. 62. Springer-Verlag. P. Hajek. Advances and Perspectives. D. G. Chase. H. Wallingford. Steinkraus. J. Chen. C. 38. C. W. Florida Entomologist..P. 69. L. Meyers. Roy.. Leger. X. E. vol. H ongos y nematodos entomopatógenos 295 . (1993) ‘The use of Dodine in selective media for the isolation of Metarhizium spp. R. (2004) Nematology. E. F.

.

se necesitarán mediciones reales. los dominios de los valores de los atributos se especifican. La clasificación de uso de suelo se facilita por una estructura jerárquica donde se ordenan los atributos. dependiendo de los datos disponibles. Cuántas clases de uso de suelo pueden ser definidas con respecto a la intensidad de usos de suelo se ilustra a continuación. En la mayoría de los casos. entrevistas o preguntas. Solamente en algunos casos. 297 . en los puntos de muestreo. cuando se precise un alto nivel de detalle.Capítulo 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo E. Jeroen Huising RESUMEN DE LA METODOLOGÍA PARA LA DESCRIPCIÓN DE USO DE SUELO Este capítulo muestra una lista estructurada de atributos de uso de suelo que sirve como guía para la observación de características de uso de suelo en el campo. lo cual requiere solamente el valor adecuado por evaluar en el campo. Esto se lleva a cabo mediante la observación directa. en función del propósito y del contexto de la clasificación misma. Este método ofrece varios niveles de detalle que describen las características. pero las clases finales de uso de suelo dependerán de la selección de dichos atributos a considerar para la clasificación.

Para comprobar esta hipótesis. la historia de uso de suelo y las prácticas de manejo de los mismos. En lugar de utilizar clases predefinidas de uso de suelo. se considera uno de los factores determinantes de la abundancia y riqueza de poblaciones de organismos del suelo. 1975). especialmente en las regiones tropicales. 2005). La idea general es que el contenido de un estudio depende de la naturaleza de la región (Vink. dada la variación en los cultivos y sus posibles combinaciones. pero dependen de los clasificadores o atributos seleccionados para la asignación de la clase de usos de suelo a cualquier observación particular.ANTECEDENTES Y PRINCIPIOS DE DISEÑO Propósito de la clasificación del uso de suelo y de su cobertura vegetal El uso de suelo.. Las clases de uso de suelo predefinidas no son necesariamente aplicables o relevantes para todas las áreas involucradas porque será muy difícil definir un grupo estándar de clases de usos de suelo. y al mismo tiempo. lo que facilita el análisis de los factores determinantes actuales y una clasificación a posteriori. Los procesos dominantes que determinan la presencia e incidencia de la biota del suelo y la escala espacial donde éstos se manifiestan no se conocen completamente. Dicha estructura necesita ser flexible. proporciona una estructura para la clasificación de usos de suelo. en cuanto al uso de varios recursos como fotos aéreas o imágenes satelitales para el propósito de la clasificación. y es por lo tanto. de manera que se puedan definir las clases de uso de suelo. Lo último. y en particular la intensidad de su uso. de modo que se puedan reflejar las diferencias en la intensidad de uso de suelo. la hipótesis central del proyecto CSM-BGBD (Giller et al. se requiere de un sistema que permita el registro de las características de uso de suelo en las parcelas de muestreo y su clasificación posterior. implica que las clases de uso de suelo no están definidas a priori. Este capítulo presenta una estructura que provee el registro sistemático de las características de uso de suelo. el enfoque que se describe a continuación se aleja de la idea de que las clases de uso de suelo sean definidas de acuerdo con la identificación de las características relevantes de uso de suelo (atributos) que permiten una 298 Manual de biología de suelos tropicales . razón por la cual fue adoptado un sistema regular en cuadrícula para muestrear la biodiversidad del suelo con un inventario detallado de su uso y cobertura en los lugares de muestreo. basadas en un común denominador en todas las áreas bajo estudio. a través de puntos de referencia de los países tropicales involucrados.

áreas cultivadas y manejadas) mientras que el marco del LCCS incluye sistemas terrestres vegetales (semi) naturales. El método que se presenta pretende ser de utilidad para la descripción de uso de suelo a nivel parcela. El sistema de clasificación de uso y cobertura del suelo ayuda a la armonización de los procedimientos para la recolección de datos y al manejo de los mismos. No obstante. Asimismo. El enfoque del inventario de uso de suelo aquí descrito se apoya principalmente en ese sistema de clasificación. Para la clasificación y descripción de las áreas de vegetación (semi) natural se puede seguir el LCCS. sistemas acuáticos y principalmente áreas sin vegetación. Los objetivos mencionados arriba fueron también citados en el programa Africover. La estructura de las descripciones del uso de suelo actual no ha sido hecha para registrar el uso de suelo histórico. Lo anterior.. para el propósito actual. Un segundo objetivo para los inventarios de uso de suelo es proveer información básica para definir los usos de suelo alternativos y las prácticas de manejo que mejoran la sustentabilidad de la producción agrícola y conservan la biodiversidad del suelo. generalmente se traduce en el registro de la ocurrencia de cultivos. 1975). como clima. Las clases de usos de suelo obtenidas de esta manera pueden ser utilizadas para la extrapolación de los resultados más allá de los lugares de estudio. El método no incluye una estructura para la descripción de los atributos ambientales. sin incluir elementos relacionados con el manejo de ganaD escripción y clasificación de uso de suelo en puntos de muestreo 299 . los fenómenos relacionados con la forma en que se está utilizando el suelo (p. ej.discriminación entre clases de usos de suelo. el manejo de los cultivos y del suelo) son de particular importancia porque impactarán notablemente sobre la distribución de los organismos del suelo. ej. es diferente al monitoreo usado con frecuencia que incluye en la descripción de uso de suelo y el estudio de las condiciones naturales y socioeconómicas del suelo como un primer objetivo (Vink. aunque atributos relacionados con la historia del uso de suelo o condiciones ambientales podrían ser adicionados o modificados del sistema de clasificación. etc. especialmente en su intensidad. La descripción detallada de uso y la cobertura de suelo deberán formar parte del inventario. El objetivo del inventario para proveer datos que permitan evaluar cambios en la biodiversidad del suelo en relación con el uso del suelo. forma del paisaje. los métodos descritos en este capítulo se aplican únicamente en paisajes agrícolas terrestres (p. aunque contiene elementos añadidos relacionados con el manejo de suelo y cultivos. que desarrollaron el Sistema de Clasificación de Cobertura de Suelo (LCCS) por Di Gregorio y Jansen (2000).

El principio básico se apoya en el uso de clasificadores que refieren a criterios de diagnósticos o atributos independientes. no resulta apropiado para la descripción y mapeo de áreas más grandes. más detallado queda el nivel de clasificación. porque esto no está particularmente relacionado a nivel de parcela. el sistema de clasificación de uso de suelo y de su cobertura del US Geological Survey. basada en la interpretación de fotografías aéreas con el propósito de elaborar mapas de uso y cobertura del suelo. ni incluye elementos relacionados con el sistema de cultivo. a no ser la cobertura del suelo per se. aunque se reconoce que para los estudios a una escala mayor o para considerar opciones alternativas de uso de suelo. Concepto y principios de diseño Los conceptos y principios de diseño del LCCS adoptados utilizan criterios diagnósticos ordenados de manera jerárquica para permitir un sistema de clasificación consistente con límites claros para las clases. Nivel 5: Características de uso de suelo del área directamente circundante a Manual de biología de suelos tropicales 300 . Estos “sistemas” de clasificación básicamente representan leyendas. representan un subconjunto de un rango de posibles usos y coberturas de suelo) y debido a que no existe un sistema de clasificación de referencia. son rígidos y de capacidad limitada para incorporar nuevas clases. utilizados para definir una clase. no son exhaustivos (es decir. donde cada jerarquía se relaciona con diferentes niveles de detalle temático y espacial. resultarían de gran utilidad. Dicho sistema a menudo carece de una definición clara de los límites de clases. dispuestos en un sistema jerárquico. Nivel 4: Características relacionadas con el manejo de prácticas del suelo. Nivel 3: Características relacionadas con aspectos culturales como irrigación y cultivo de temporada. por ejemplo. descrita por Lillesand y Kiefer (1987). La jerarquía de clases es construida sobre un conjunto de clasificadores. Obsérvese. son limitados cuando se les compara con otros sistemas. por lo tanto. por lo tanto. Muchos sistemas de clasificación utilizan a priori definiciones descriptivas de uso de suelo y clases de cobertura del suelo. Existen cinco niveles en la jerarquía de clasificación: Nivel 1: Características relacionadas principalmente con el cultivo y el campo Nivel 2: Características relacionadas con la combinación de cultivos.do. Cuantos más clasificadores se añaden. El método que se describe a continuación.

la parcela de muestreo. en secuencia. son características que no se evalúan en los primeros niveles de clasificación. En el siguiente nivel de la clasificación jerárquica se consideran las prácticas culturales relacionadas con el suministro de agua y factores de cultivos de temporada. lo que sirve para D escripción y clasificación de uso de suelo en puntos de muestreo 301 . un sistema de barbecho o un sistema de cultivo permanente. ej. Las características no siempre son fácilmente observables. Estos tres primeros niveles forman la base para la clasificación de uso de suelo y la colecta de datos en relación con dichas características se sugiere representan los datos mínimos requeridos. el manejo de los campos agrícolas (es decir. Esta información puede ayudar a determinar si la parcela bajo consideración representa una característica (o patrones) del uso de suelo o tipo de cobertura. El quinto nivel en los sistemas de clasificación se relaciona con elementos de vegetación leñosa (semi) permanentes dentro de la parcela y en los campos aledaños. Esto puede ser señal de cultivos simultáneos o. éstos pueden ser evaluados. el deshierbe y la fertilización del mismo. 1993). Este último determina si el campo forma parte de un sistema de cultivo migratorio. incluyendo arreglos espaciales de los campos agrícolas. Dichos clasificadores. pero que se consideran importantes en relación a la intensidad del uso y pueden tener un impacto directo sobre la biodiversidad del suelo. o basados en los datos proporcionados por el agricultor. como setos. Estos elementos de vegetación se relacionan con características permanentes en el paisaje. se refieren a las operaciones realizadas en una parcela en particular. normalmente. Por ejemplo. cercas vivas. se han añadido clasificadores que relacionan el manejo del suelo y cultivos que permiten la determinación del nivel de intensidad de uso. Las características de rotación de cultivos se consideran en otros estudios. que muchas veces es referencia de la clase social y del tipo de manejo (Huising. “cultivo de árboles” para un sistema basado en árboles). Asimismo. Las subclases pueden definirse basándose en otros cultivos que forman parte del sistema del cultivo general. Otros aspectos que se deben considerar son la distribución. tales como la preparación del suelo. especialmente en relación con elementos leñosos de la vegetación que no se reconocen como cultivo y en relación con cultivos en campos adyacentes. pero con algunos antecedentes de uso de suelo y de los sistemas de cultivo habituales. barreras de viento y otras estructuras semipermanentes. junto con el tamaño de las áreas de los campos. la clase mayor es definida por el tipo de cultivo principal (p. patrones de campo) y los cultivos asociados. El tamaño del campo generalmente es indicador del tamaño de la finca.

Por otro lado. la descripción cuantitativa de la intensidad del uso del suelo. por ejemplo. Además. información más específica se remite a variedades y esto representaría un mayor nivel de detalle (especificidad). no son independientes y pueden involucrar algún tipo de medición con un nivel más alto de detalle. por lo tanto. el cultivo principal se puede describir como maíz (Zea mays). el cultivo principal puede describirse a un nivel más general (de género) como Zea o a un nivel de familia como Gramineae (pastos). el patrón del campo ofrece información sobre la fragmentación del suelo y constituye otro aspecto de la intensidad de uso de suelo que puede impactar directamente sobre la biodiversidad del suelo. sirven para trazar la cartografía del uso de suelo (mediante la interpolación de puntos de observación que complementan un mapa). pueden añadirse sin mayores consecuencias para el sistema de clasificación. Los atributos. por lo tanto.identificar posibles asociaciones de usos de suelo que. Los niveles de clasificación definen un eje de la clasificación jerárquica en donde atributos adicionales (conjuntos de ellos) en cada nivel subsecuente definen las subclases (que representan un mayor nivel de detalle). por ejemplo. 1998) y Huising (1993). Estos atributos técnicos específicos. En el caso de algunos de estos atributos. La transformación de las listas de atributos a formatos para registrar los datos en el campo resulta fácil. Los principios de las clasificaciones jerárquicas son explicados por Molenaar (1991. Además de este eje existe uno más en la clasificación jerárquica que hace referencia al nivel de precisión con que se describen las características de uso o añade información específica (detalles técnicos) de las características de uso de suelo descritas. Registro de datos en campo y observaciones adicionales En las siguientes secciones se presenta la lista de atributos para la descripción de usos de suelo. el valor de clase a un nivel más detallado de generalización puede ser inferido. Estos nuevos atributos ofrecen información más específica sobre el objeto de observación. Los valores de datos posibles (dominios de valor) para la mayoría de los atributos son dados para proporcionar una descripción estándar de las características de uso de suelo. son consideradas observaciones a nivel de parcela. a su vez. Los atributos técnicos específicos permiten una definición más precisa de clases de uso de suelo asociados. que pueden incluir. Si se conoce el valor de clase a un nivel más específico. Éstas sirven para guiar las observaciones en el campo en los puntos de muestreo y sus áreas circundantes. los dominios de valor no son específicos para permitir la definición de 302 Manual de biología de suelos tropicales . como los refiere el LCCS.

si la información sobre la tasa de aplicación de un fertilizante inorgánico en particular no se considera confiable o correcta. una tasa particular de aplicación (baja. A menudo. Si éste no es el caso.6b). la información puede generalizarse para la clase de “fertilizante aplicado” (implicando el uso de fertilizante inorgánico). a partir de la observación directa en el campo. Los atributos pueden agregarse para facilitar la descripción de características específicas de un área en particular. A priori. Por ejemplo. sus fuentes no son totalmente confiables. El sistema para describir el uso de suelo muestra varios niveles de detalle. El nivel de detalle al cual la información es reunida depende del propósito del inventario de uso de suelo y de la posibilidad de obtener D escripción y clasificación de uso de suelo en puntos de muestreo 303 . pero ello se compensa con la aplicación de la jerarquía en la precisión de los datos (referidos anteriormente como el segundo eje en el sistema de clasificación). relacionada con el manejo. simplemente. basada en observaciones secundarias. media o alta. con los conocimientos de un sistema habitual de cultivo y las prácticas de manejo en el área. junto con la información relacionada con el tercer nivel (es decir. esto no es prescriptivo en el sentido de que los datos necesitan ser colectados en todos los niveles de detalle. como documentos). La información de estas fuentes de datos puede resultar incorrecta. Sin embargo. pero éstos deberán añadirse a los niveles más bajos de la clasificación jerárquica para evitar que interfieran con la estructura de la misma. Las clases de datos deben indicar una discriminación relevante (significativa) de objetos y el subconjunto de clases debe ser extensivo (no exclusivo). basados en la definición de la clase adoptada (ver Tabla 11. o bien. Sin embargo. La información en el cuarto nivel. o bien. clases de tamaño estándar definidas en campo con límites fijos no podrán ser significativas por esa razón. se debería poder inferir información sobre el manejo de la parcela en particular. características culturales) obtenida de un informante o derivada de la información general de las prácticas culturales en el área. Las observaciones para los tres primeros niveles del sistema de clasificación se pueden hacer directamente en el campo. los datos relacionados con niveles muy detallados de observación son muy difíciles de obtener. media o alta) puede ser asumida. no se obtiene a través de observaciones directas en el campo. utilizando otros recursos. es aceptable clasificar la tasa de aplicación como baja.valores de datos en los rangos de observación y distribución de los valores de datos. sino que requiere del acceso a fuentes adicionales de información (a través de entrevistas a los agricultores. a personas externas. La situación contraria sería con el conocimiento de la práctica común en el área.

Estas observaciones secundarias sirven. Para este propósito. (por ejemplo. el segundo. además de los datos administrativos como hora. no se incluyen en las listas de atributos que se detallan a continuación. OBSERVACIONES DE USO DE SUELO: CLASIFICADORES Y ATRIBUTOS Observaciones respecto del cultivo principal y tamaño del campo El primer nivel del sistema de clasificación se reserva para las observaciones del cultivo principal. Se deberá registrar la localización específica del punto de muestreo dentro del campo (por ejemplo. fecha. El sistema para la descripción de uso de suelo requiere de una estructura que pueda implementarse a detalle y que se considere viable bajo las condiciones reales. dependiendo de la experiencia del encargado del proyecto. la cobertura del dosel deberá clasificarse como “abierta” o “cerrada”. Observaciones secundarias pueden relacionarse con el estatus del cultivo o con la presencia de maleza. El hecho de que el encargado del proyecto se encuentre familiarizado con el uso de suelo y con las prácticas de manejo en el área. donde el cultivo de árboles se considera como el principal. sí pueden aportar información para el análisis de datos. será siempre una ventaja. nombre del encargado del proyecto y nombre de la persona que toma los datos. Estas observaciones no se consideran como clasificadores y. Si la selección se realiza entre dos 304 Manual de biología de suelos tropicales . como un mecanismo para la validación de los datos en atributos y clasificadores e incluso para los resultados de clasificación finales. la explicación de posibles datos atípicos). El uso de una cuadrícula regular para el muestreo permite que se tomen puntos de muestreo en cualquier lugar dentro de la parcela y posibles efectos de borde deben tomarse en cuenta.la información requerida. el centro o los linderos). sin embargo. Si bien estas observaciones no se incluyen en la clasificación del uso de suelo. siempre y cuando la cobertura del suelo no se clasifique como escasa. por lo tanto. ya que puede tener un efecto en la distribución de la biodiversidad del suelo. Este tipo de información deberá registrarse en la libreta de campo. Se recomienda revisar el trabajo de Stocking y Murnaghan (2001) para los indicadores relevantes de observaciones en el campo. pueden ser incorporadas fácilmente a las libretas de campo en caso necesario. al mismo tiempo. como el elemento de vegetación más dominante. para la selección entre un cultivo de árboles y un cultivo anual en el mismo campo. la información sobre el tipo de lindero se debe registrar.

nueces y otros. deciduo] Tipo de hoja [aguda. pero en lugar de dejarlo abierto. no se enlista bajo el título “Atributos técnicos 1” en la Tabla 11. más de 10 años] 305 D escripción y clasificación de uso de suelo en puntos de muestreo . una especificación con más detalle indica si el cultivo pertenece a la categoría de “raíces o tubérculos”.1. es conocido el tipo de cultivo. Generalmente. El valor de dominio no se especifica aquí. Se prevé para una descripción de un segundo y tercer cultivo. “leguminosas o vegetales”. “forrajes o fibras”. La información más concreta sería entonces el tipo específico de cultivo. entre 1 y 3 años. proporcionando una mayor especificación de la forma de vida a nivel de detalle. Cuando se considera relevante.variedades) pre verde. hierba. para madera o leña). porque su apariencia (características de vegetación) puede ser muy distinta.o más cultivos de la misma forma de vida. 1 año. el propósito) y duración del cultivo. el cultivo con el mayor porcentaje de cobertura califica como el cultivo principal. dependiendo. entre 3 – 10 años. arbusto. La categoría de cultivo herbáceo representa un nivel adicional en la clasificación jerárquica (nivel de especificación) y. En la Tabla 11. o gramíneas] Atributo técnico 1 Atributo técnico 2 Cultivo de árboles o arbusto Tipo de cultivo (especies y Fenología de la hoja [siem. es mejor definir una lista de Tabla 11. de la edad de la plantación.1 los valores posibles (clasificadores o atributos) se enlistan entre corchetes. por ejemplo. La clasificación se basa en la forma de vida del cultivo. ej. En el caso de un cultivo de árboles o arbustos se puede añadir información sobre el aspecto (es decir. cosecha de toda la planta (p. ancha] Propósito [vivero. se puede añadir un cuarto nivel que ofrezca información sobre la variedad específica del cultivo. por lo tanto. cosecha de frutas. árboles de sombra] Duración del cultivo [Estación (parte del año).1 Clasificadores y atributos técnicos para el cultivo principal Nivel 1a – Clasificador Forma de vida [árbol. En el caso de cultivos herbáceos. Los atributos técnicos son específicos para cada una de las diferentes formas de vida.

legumbres y vegetales.plátanos y otras plantas herbáceas arbóreas. pero manteniendo la distinción conceptual entre pequeño.2). no obstante. véase la lista LCCS (Di Gregorio y Janssen. pastos] Si no son gramíneas Categoría del cultivo [I.Tabla 11. a manera de ejemplo. mediano y grande. fibras] (si se conoce. especificar el tipo de cultivo) Atributo técnico 2 Tipo de cultivo (especies o variedades) Tipo de cultivo Tipo de cultivo nombres permitidos para los tipos de cultivo. 2000). IV. aunque está más relacionada con las características del cultivo que con las características del campo. La cobertura del cultivo se anexa aquí. cereales. con el propósito de evitar cualquier confusión. “mediana” o “grande” no aparece. es mejor definir clases significativas basadas en un estudio piloto del rango de tamaño de campo presentes en el área de estudio (Huising. III-cultivos de cobertura. ésta queda fuera del marco de este capítulo. Aquí se incluye la “cobertura de los cultivos”. caña. aunque esto se relaciona más con las características del cultivo que. arroz. El siguiente nivel en la clasificación jerárquica se determina por las características espaciales de la parcela en observación (Tabla 11.herbáceas. La cobertura del cultivo se usa generalmente como un parámetro para la interpretación de 306 Manual de biología de suelos tropicales . con las características de campo. sirve como indicador del grado de organización y mecanización de las prácticas de manejo. además. La forma del campo se añade principalmente como una preocupación respecto a posibles efectos de borde y. puesto que ello dependerá del contexto de estudio.1 Continúa Nivel 1a – Clasificador Atributo técnico 1 Gramíneas Tipo [bambú. 1993) con la opción de utilizar diferentes definiciones para cada una de las distintas regiones en donde se esté llevando a cabo el estudio. II. La definición de clases de tamaño de campo “pequeña”. forrajes.lúpulo y otras enredaderas perennes] Herbáceas Categoría de cultivos [raíces y tubérculos.

la cobertura del cultivo puede resultar difícil de interpretar debido a la variación en la arquitectura de las plantas. grande] lar. los límites de clases son ligeramente diferentes (ver Di Gregorio y Janssen. mediana (60 – 30%). circular. escasa (20-10%)] Observaciones relacionadas a combinación de cultivos y prácticas culturales Las combinaciones de cultivos se consideran el segundo nivel. rectangula [chica. pero dependería mucho del tipo de cultivo. esto se refiere a que en una misma parcela y durante una sola temporada se realizan uno o varios cultivos. multiangular. Se pueden hacer distinciones de acuerdo con el número de cultivos y con su secuencia. proporciona información acerca de la densidad del cultivo y es un indicador útil de la intensidad del uso de suelo. abierta (70-60 – 20-10%).imágenes de percepción remota. Esto puede servir para entender la importancia relativa del cultivo en sistemas de cultivos múltiples. en los casos donde un clasificador de segundo nivel “combinación de cultivos” indica que existe un segundo o tercer cultivo creciendo en el campo. Además. su densidad puede medirse directamente en términos del número de plantas por unidad de medida (m² o ha) o en términos de espacio entre plantas (el espacio entre surcos y la distancia entre las plantas). mediana.Forma [cuadrada. Nivel 1b -Clasificador Atributo técnico 1 Tamaño de campo o parce. El segundo y tercer cultivo pueden describirse por los mismos D escripción y clasificación de uso de suelo en puntos de muestreo 307 . En el caso de formas de vida permanentes. generalmente. Tabla 11. Una cubierta “abierta” significa que la distancia entre los perímetros de las copas puede ser hasta dos veces mayor que el diámetro medio del dosel. a las diferencias en las etapas de crecimiento y otros factores. En el caso de un segundo o tercer cultivos.2 Tamaño del campo y características de la cobertura del cultivo. Para coberturas no permanentes. En el caso de cultivos anuales. baja (30 -15%)] Cobertura permanente: [cerrada (> 70-60%). la distribución espacial en el campo puede especificarse. y especialmente en el caso de los cultivos anuales. se refiere a que se produce un empalme entre las copas. 2000). el tipo de cobertura “cerrada”. Las clases de densidad podrían especificarse. Por lo tanto. en tira o irregular] Tamaño del campo (metros cuadrados) Atributo técnico 2 Cobertura del cultivo Cobertura no permanente: [alta (> 60%).

secuencial] Atributo técnico 2 (Segundo tipo de cultivo) Simultáneo o traslapado Arreglo espacial [una o dos filas intercaladas. El segundo (o tercer) cultivo o elemento de la vegetación puede incorporarse en la descripción de clase del sistema de uso de suelo como elemento descriptivo o como atributo.4). Es necesario registrar cuando se practica una rotación de cultivo en particular. la totalidad de su cobertura (es decir. plantaciones. fragmentadas o dispersas] Tabla 11. postinundaciones.3 Atributos de cultivos combiandos. Tabla 11. aspersión o goteo] Atributo técnico 2 Demanda de agua por irrigación [mm de agua suministrada por temporada de crecimiento o cultivo] 308 Manual de biología de suelos tropicales . Un segundo tipo de cultivo puede referirse a un cultivo de sotobosque como el cardamomo. La descripción para las características del suministro de agua es muy sencilla (ver Tabla 11. franjas alternas. por ejemplo. los cultivos de árboles (hule) en un campo grande (plantación). serían suficientes. definidas como características de suministro de agua y características relacionadas con el barbecho. 2 o más] Secuencia [simultáneo. El nivel tres en el sistema de clasificación se refiere a las prácticas culturales. relacionadas con el “factor de tiempo del cultivo” para especificar esta información. en cuyo caso. Nivel 2 – Clasificador Combinación de cultivos [simple (monocultivo). junto con la fenología y tipo de hoja. con un sotobosque herbáceo cerrado. múltiple (intercalado)] Atributo técnico 1 Cultivos múltiples No. también en estos casos. como por ejemplo.4 Características del suministro de agua Nivel 3a – Clasificador Suministro de agua [lluvia. igual que para el cultivo principal. traslapar. La vegetación del sotobosque también puede referirse a vegetación (semi) natural. El segundo tipo de cultivo se añade como un segundo atributo técnico. en los varios niveles de especificación. Se realizan previsiones al tercer nivel de clasificación. en donde la especificación de la forma de vida. no habría un arreglo especial.atributos. de cultivos adicionales [1. el porcentaje de cobertura del cultivo adicional o añadido) puede alcanzar fácilmente el 100%. irrigación] Atributo técnico 1 Irrigación Tipo de irrigación [superficial.

permanente] Atributo técnico 1 Cultivo migratorio Período de barbecho [corto.El cultivo post inundación se define. esta distinción no se mantiene. Nivel 3b . Los cultivos migratorios típicamente se refieren a situaciones donde los agricultores abren nuevas parcelas para el cultivo. al empleo de técnicas de cosecha de agua (tratado por separado en la sección relacionada con el manejo de suelos y cultivos). se debe hacer la distinción entre si esto se hace con el objetivo de restaurar la fertilidad del suelo o debido a que las condiciones no permiten cultivar (bajas temperaturas o disponibilidad de agua limitada). en principio.5. El barbecho se refiere al periodo (estación de crecimiento) durante el cual se deja descansar el suelo. en términos prácticos. el suelo está cultivado por más de 66% del tiempo. mientras que en el sistema de barbecho Tabla 11. mejorado] Duración del barbecho[corto. barbechos y cultivos permanentes. sin embargo. 1980). natural. de la siguiente forma: “después de que un campo ha sido inundado con agua de lluvia. y debido a que no trae consecuencias en la intensidad del uso de suelo.Clasificador Factor tiempo de cultivo [cultivo migratorio. Se hace una distinción entre cultivos migratorios.. El factor de tiempo del cultivo indica la fracción de tiempo durante la cual el suelo es usado para el cultivo. El cultivo migratorio se define como suelo cultivado durante menos del 33% del tiempo (Ruthemberg et al. la lluvia infiltrada en el suelo se usa intencionalmente como reserva para los cultivos”. largo] Permanente Permanente [continuo o intermitente] Atributo técnico 2 Índice de cultivo (valor del índice de cultivo Ruthenberg) Si es mejorado: Tipo de cobertura (ej. Los sistemas de barbecho se definen como suelo cultivado entre el 33% y el 66% del tiempo y en los cultivos permanentes. Los atributos técnicos se especifican en la Tabla 11. aunque no lo mismo. Leguminosas. o largo plazo] Barbecho Tipo de barbecho[suelo desnudo.5 Factor tiempo de cultivo. de acuerdo con el LCCS. u otro tipo) Índice de cultivo (valor del índice de cultivo Ruthenberg) Intermitente No. mediano. de cultivos en dos años D escripción y clasificación de uso de suelo en puntos de muestreo 309 . mediano. Esto es similar. barbecho.

Periodo largo: > 8–9 meses El barbecho de periodo corto se refiere a situaciones donde normalmente existen dos temporadas de cultivo en un año y el suelo se deja descansar durante el resto del periodo. el periodo de barbecho típicamente tiende a reducirse. Bajo la presión de una población en aumento. por ejemplo. Si se requiere de datos más precisos. éstos se pue310 Manual de biología de suelos tropicales . resulta relevante anotar la duración de dicho periodo. por lo tanto. Periodo medio: 4–5 meses. con un periodo de > 1–2 años. se sobreponen los límites de clases y se especifican para cubrir la variación específica de un periodo de barbecho para cualquier área que probablemente sea dependiente de las condiciones socioeconómicas y biofísicas habituales. La definición de estos límites de clases se basa en la experiencia en el campo. pero eso no resulta lo suficientemente largo para clasificarlo como cultivo migratorio. forrajes. Barbecho medio. pero < 8–10 años. En el caso de cultivos migratorios. pero necesita confirmarse y puede ajustarse con base en los datos reales sobre la duración de los periodos de barbecho en el área en cuestión. Estas son evaluaciones parcialmente cualitativas y. se hace una distinción entre la duración del periodo de barbecho: Barbecho corto. lo cual es muy común en algunos lugares donde uno o dos cultivos “cortos” ocurren durante un año o donde el agricultor deja un periodo de barbecho más largo. El barbecho medio refleja la situación donde el suelo descansa durante seis a siete meses. dejándola descansar durante diferentes periodos de tiempo para restaurar la fertilidad del suelo. No se hace ninguna distinción referida al tipo de cultivo o propósito. Los barbechos se consideran como “mejorados” en el momento en que se planta o se siembra para cambiar la composición de la vegetación de barbecho o para mejorar su calidad. con un periodo de < 1–2 años. con un periodo de > 8–10 años. Barbecho largo.cultivan la misma parcela o área de suelo. Para sistemas de barbecho. El periodo largo de barbecho es la situación típica en donde el suelo se deja en barbecho durante un año o más. por ello. durante el segundo año. pero < 8–9 meses. la clasificación del periodo de barbecho es la siguiente: Periodo corto: < 4–5 meses.

el manejo de las malas hierbas. 1980): CIr = Tc/(Tc + Tf) En donde: Tc = duración del cultivo (tiempo). tal y como se muestra en la siguiente fórmula (Ruthenberg et al.5. Los datos deberán especificar el número de años del ciclo de rotación de cultivos y la secuencia de los cultivos en el ciclo. una opción para combinar ambos clasificadores dentro de uno que describa el grado de mecanización. Esto es.den calcular utilizando el índice de cultivos de Ruthenberg. Alternativamente. tal y como se observa en la Tabla 11. Los mayores componentes de las prácticas de manejo discutidas se refieren a técnicas para la preparación del suelo o su cultivo. se podría prever. Se añade la “preparación del suelo” por su relevancia en los márgenes de la selva en los trópicos. por lo que no han sido incluidas en el sistema de clasificación. por lo tanto. como un clasificador podría ser excluida de la clasificación porque la preparación del suelo es generalmente la D escripción y clasificación de uso de suelo en puntos de muestreo 311 . es un factor que deberá tomarse en cuenta en relación con la biodiversidad del suelo. Características de manejo del suelo y de cultivos Las prácticas culturales mencionadas incluyen: “manejo de agua” como una operación de manejo. el “factor tiempo de cultivo”. la cosecha. el mejor momento para incluir una descripción de las secuencias de los cultivos sería en el segundo nivel de la clasificación jerárquica donde “la combinación de cultivos” puede describirse como “secuencial”. puesto que el barbecho a menudo forma parte de un sistema de rotación de un cultivo en particular.6a). fertilización y cosecha. el manejo del suelo y de los cultivos se consideran representativos de un nivel separado en el sistema de clasificación (Tabla 11. sin embargo. plagas y enfermedades. Tf = duración del barbecho o duración del tiempo en el que no se cultiva el suelo. Si se practica una rotación de cultivos. De manera alternativa. Hasta este momento no se han considerado las rotaciones de cultivo.. donde potencialmente existe un alto impacto en la biodiversidad del suelo. En cuanto a la preparación del suelo y la cosecha. el principal aspecto que se debe considerar sería si esto se realiza por medios mecánicos o no.

por ejemplo. se podría considerar combinar ambos (mecánica y química) dentro de un clasificador que describa el uso de agroquímicos (excluyendo fertilizantes orgánicos). 2000). tales como la unidad de sembrado directo (ripper-planter) utilizada en la agricultura de conservación (de Freitas. en el sentido de que una mayor o menor eficiencia no causará mayor o menor impacto en el suelo y los organismos que se encuentran en él. De acuerdo con el orden mencionado. la profundidad del arado. La labranza mínima se refiere a aquellos sistemas donde el arado y la siembra son típicamente una combinación de una sola operación. Se debe mencionar aquí si se practica la labranza mínima. sería más sencillo 312 Manual de biología de suelos tropicales . comparado con animales “ligeros” o maquinaria de igual consideración. La eficiencia se refiere más a lo económico que a lo ambiental. La principal preocupación relacionada con el control de las malezas. estos arados se presentan desde el menos eficiente en remover el suelo y dejará más estructura intacta en el suelo. el uso de combustibles debería añadirse como atributo en el siguiente nivel más alto de especificación. tipo de equipo y tipo de tracción. Se hace una distinción basada en si el suelo ha sido labrado o no. La “eficiencia” en términos de horas por hectárea requerida para la operación se añade como un atributo opcional. Por lo tanto. aquí se incluye su compatibilidad con los métodos que incorporan el uso de combustibles fósiles en los cálculos de la intensidad del uso de suelo. Se presume que animales “pesados” o maquinaria pesada causan un mayor impacto en el suelo. en lugar de labrar el campo entero o donde el grado de perturbación se minimiza con el uso de equipos especializados. se basa en el tipo de tracción utilizada: animal o mecánica. Opcionalmente. plagas y enfermedades es el uso de agroquímicos. tomando en cuenta el impacto directo del peso del animal o la maquinaria y el impacto generado por los diferentes tipos de equipo operados por maquinaria o animales de diferentes capacidades. o arado de cincel. Una distinción más detallada de acuerdo con los requerimientos reales de poder o capacidad en términos de caballos de fuerza no se considera relevante. ya que no resultará un indicador directo del grado de perturbación del suelo. El uso de combustibles puede fácilmente estimarse si se conoce su eficiencia. en caso afirmativo. tales como tipo de suelo. porque esto dependerá de las condiciones locales. Se añade un atributo técnico que describe el tipo de arado usado. sin embargo. las opciones son: arado de vertedera. arado de disco.primera operación para ser mecanizada y tiene un profundo efecto en la biodiversidad del suelo. el suelo (y otras condiciones ambientales) afectarán la eficiencia de la operación. El tipo de animal o el tipo de maquinaria empleada es indicado en el siguiente nivel de detalle. donde la labranza del suelo se restringe a hacer agujeros para sembrar. pero al contrario. refiriendo su capacidad.

sea por el método de herbicidas. directo (ripper-planter)] vaca. estas han sido registradas de las prácticas de uso de suelo en los niveles previos del sistema de clasificación y. caballo. reducida o mínima] Eficiencia (horas/ha) Tipo de arado [vertedera. “No quitar malezas” puede atender a situaciones donde no existe la extracción real de las malezas. mecánico. mecánica] Alcance de la labranza [labranza completa. cincel. por ejemplo. desmontar y cubrir con abono verde] Mecánica Grado [limpieza moderada. Tracción animal Tipo (y número) de anima. intermedia e intensa] Manual Atributo técnico 2 Labranza [Sin labranza. mecánico. El clasificador para el control de malezas especifica el modo de mecanismos de control. manual. labranza mínima/unidad de das (pesada)] sembrado directo (ripperplanter)] Eficiencia (horas/ha) Deshierbe [Sin deshierbe.[vertedera. Respecto al deshierbe manual se hace una distinción Tabla 11. labranza mínima/unidad de sembrado les usados [búfalo. químico] Tipo de deshierbe [con azadón. el barbecho. por ello. biológico o cultural. labranza y deshierbe.disco. mula/burro] Eficiencia (horas/ha) Mecánico Tipo de arado Clase de maquinaria [dos ruedas (ligera). no se incluyen en el valor de dominio.disco. cuatro rue. manual (azadón). buey. Nivel 4 – Clasificador Limpieza [Sin limpiar. la rotación de cultivos. cincel.y práctico manejarlas por separado. En el caso de medidas de control culturales (y biológicas).6a Clasificadores y atributos relacionados con la limpieza de la parcela.. química] Atributo técnico 1 Manual Modo [desmontar y quemar. a Deshierbe a mano Eficiencia (horas/ha) mano. tracción animal. mecánica. con la mano] D escripción y clasificación de uso de suelo en puntos de muestreo 313 . etc.

6a Continúa. Si se considera de vital importancia. ingrediente activo y tasa de aplicación entre si esto se lleva a la práctica con el uso del azadón o mediante la extracción totalmente manual. azadón de presión. se considera un volumen alto (VA).Tabla 11. VA (> 2500 g ia/ha)] Herbicida. por lo 314 Manual de biología de suelos tropicales . cultivo para el control de malezas] Atributo técnico 2 Eficiencia (horas/ha) Tipo de equipo (ej. weeds.edu/mgmt/2004) por la cantidad de aplicaciones especificada en gramos equivalentes de ácido (ea) por hectárea de glifosato. dado que el Roundup es. junto con la cantidad en gramos del ingrediente activo por hectárea. si se requiere información más detallada acerca del Roundup. si se considera el gran número de herbicidas que se encuentran disponibles en el mercado. o cualquier otro tipo de herbicida. 2005). la distinción se hace acorde con su aplicación: el uso de aspersor de mochila es el más común. Una tasa de aplicación de (ea) menos de 850 gha-1 se considera un volumen bajo (VB) de aplicación. el herbicida más usado en los trópicos (www.edu/pnw/weeds). que es la sustancia activa del Roundup. Las especificaciones de manejo de malezas no cubren todas las medidas de control de malezas. los cuales se convierten de libras por acre a gramos por hectárea (weeds. Una diferencia más. se basa en el volumen de la aplicación que resulta no viable. otros mecanismos] (entre 850 y 2500 g ia/ ha). Sin embargo. se recomienda implementar un sistema de clasificación para la aplicación de volumen de herbicidas que sea relevante para el área en cuestión. orst. Nivel 4 – Clasificador Atributo técnico 1 Mecánico Tipo de deshierbe [labranza frecuente. se debería especificar el ingrediente activo (ia). basadas en recomendaciones generales para su aplicación en diferentes cultivos. Las especificaciones son asignadas de manera arbitraria. mientras que una aplicación (ea) de más de 2500 gha-1.ippc. azadón rotatorio) Eficiencia (horas/ha) Químico Volumen de aplicación Tipo de equipo [aspersor de [VB (< 850 g ia/ha). por mucho. En cuanto al uso de químicos en el control de malezas. VI mochila. los diferentes tipos de ingredientes activos y las fórmulas que existen (Oregon State University.iastate.

Tasas de aplicación bajas de menos de una tonelada por hectárea por año se consideran insuficientes para mantener los niveles de humus y de materia orgánica en el suelo. Con relación a las medidas de control de plagas y enfermedades. las cifras se convierten en tasas de aplicación por año.6b). se presume que se requieren entre 5 y 10 toneladas por hectárea para poder mantener los niveles de humus en el suelo. Los volúmenes especificados se refieren a la forma líquida en la cual el pesticida o el fungicida se obtienen.que la libreta de campo es un buen complemento para la observación relacionada con cualquier medida específica de control de malezas. se prevén especificaciones para la tasa de aplicación. Se presume que el modo de aplicación no traerá muchas consecuencias para la tasa de aplicación. Los elementos nutritivos pueden referirse a un solo elemento (por ejemplo N) en los fertilizantes simples o la combinación de elementos en mezclas incompletas o mezclas completas (el porcentaje de peso se relaciona al N para el nitrógeno. en caso de considerarse relevante. se deberán tomar en cuenta los valores más altos. se podrían especificar cantidades reales de aplicación. Generalmente. Eso se hace para poder acomodar los diferentes grados de fertilizantes. En este punto. (2002) y son usadas en caso de aspersión aérea. mientras que los fertilizantes de alto grado contienen hasta el 50% de elementos nutritivos. estos se basan en asumir un contenido de materia orgánica del 30%. P2O5 para el fósforo y K2O para el potasio) El índice toma D escripción y clasificación de uso de suelo en puntos de muestreo 315 . control biológico o mecanismos de control químico (Tabla 11. fungicidas u otros químicos. estas cantidades se suministran una vez cada cuatro a seis años (ILACO. En cuanto a los fertilizantes orgánicos e inorgánicos. se hace una distinción basada en si éstos son ampliamente aplicados en todo el campo o si la aplicación se restringe a puntos específicos y también al tipo de equipo utilizado. Dos toneladas por hectárea por año se consideran suficientes para todo tipo de cultivo. 1985). Para abonos. La frecuencia de la aplicación puede variar y en la tabla que se observa a continuación. Respecto al uso de pesticidas. y las mismas clases de volumen se consideran relevantes. Las clases de volúmenes para aplicar pesticidas se obtienen de Craig et al. Los fertilizantes de bajo grado tienen menos del 25% de nutrientes para las plantas. sin tomar en cuenta su modo de empleo. en lugar de usar un valor en particular. dentro del rango especificado. se definen clases similares: control natural o medidas culturales. sin considerar las disoluciones hechas antes de la aplicación. Con respecto a la aplicación de fertilizantes inorgánicos. los rangos de tasas de aplicación se especifican para los límites superiores e inferiores de las clases. Cuando se utilicen fertilizantes de bajo grado.

La aplicación del fertilizante. Esto sería la aplicación recomendada para un suelo moderadamente fértil que produce alrededor de cuatro toneladas de maíz (grano). La conversión puede incluir operaciones para nivelar el suelo. La limpieza también es importante en sistemas de barbecho. se podría considerar añadir una clase para las tasas muy altas que serían aplicaciones de 300 kg ha-1 o más. cuando incluyen quemas. Sin embargo. “La limpieza moderada” está indicada cuando se utilizan medios manuales y mecánicos.75 kg ha-1 de N como punto de referencia para la aplicación de N. Otra distinción se hace basada en el tipo de equipo usado. para alrededor de tres toneladas de trigo en suelos relativamente fértiles y 25 toneladas de mandioca en suelos moderadamente fértiles. 6a) se enlista cuando el campo ha sido convertido a partir de bosque o vegetación secundaria desde hace más de 20 años. estos valores se toman como el límite superior de la clase de “tasa de aplicación de fertilizante medio”. en donde los árboles se cortan a mano o con sierra de cadena y los troncos se remueven utilizando tractores u otra maquinaria más ligera. en donde una tasa muy baja de aplicación representa alrededor de 10 a 15% de esta cantidad de referencia. Las otras clases se derivan de estas cifras. En todos los sistemas es importante registrar si la quema se lleva a cabo para eliminar la vegetación muerta o si esta vegetación se queda como abono orgánico. por lo tanto. La manera en que se prepara la parcela puede tener un profundo impacto en la biodiversidad del suelo. Si las tasas de aplicación son generalmente altas. por lo tanto. Actualmente. ya sea en o alrededor del hoyo de plantación. se hace una distinción entre sistemas de “desmontar y quema” y “desmontar y cubrir con abonos verdes”. lo que ha ocurrido en algunos márgenes de selvas en donde opera el proyecto CSMBGBD. Una aplicación de 75 kg ha-1 de N requerirá 150 kg ha-1 de un fertilizante con N de alto grado y alrededor de 350 kg ha-1 de un fertilizante de bajo grado. especialmente. cualquier incidencia de fue316 Manual de biología de suelos tropicales . se incluye como clasificador separado. será relevante en el caso de tasas bajas o muy bajas de aplicación. de un fertilizante de alto grado y de 700 kg ha-1 o más de un fertilizante de bajo grado. La “limpieza intensa” significa que la tierra se limpia completamente con el uso de tractores oruga y otra maquinaria pesada. Esto sería particularmente relevante donde se practican cultivos migratorios o donde las selvas han sido convertidas recientemente en suelo agrícola. “Sin limpieza” (ver Tabla 11. lo cual coincide más o menos con la duración máxima de barbecho bajo sistemas de cultivos migratorios. o si las tasas de aplicación altas son de particular interés.

aspersión en toda la parcela] Atributo técnico 2 Volumen de aplicación [UVB (<10L/ha). fertilizantes químicos. fertilizantes y cosecha. baja (entre 25–60 y 75–175 kg/ha). Nivel 4 – Clasificador Manejo de plagas y enfermedades [medidas preventivas y control natural. abonos. combinación de fertilizantes químicos y orgánicos] Equipo usado [aspersor de mochila. VI (entre 100 y 200L/ha).go como parte de las prácticas de manejo deberá registrarse en esta sección como fenómeno importante. aspersor de motor. mezclas incompletas. estiércol de corral] Aplicación [hoyos. o de manera homogénea en la parcela] Cosecha [manual. franjas. franjas.6b Clasificadores y atributos para el manejo de plagas y enfermedades. Tabla 11. media (entre 75– 175 y 150–350 kg/ha). aviones] Fertilizantes orgánicos Tipo de fertilizantes [residuos de cultivos. composta. vehículos. o de manera homogénea en la parcela] Inorgánico Clases de fertilizantes [simple. control químico y biológico] Atributo técnico 1 Control químico Aspersión [aspersión focalizada. (VA >200L/ha)] Tipo de químico y tasa de aplicación Tasa de aplicación [baja (<1t/ha/año). mezclas completas] Tasa de aplicación [muy baja (<20 – 60 kg/ha). alta (>2 t/ha/año)] Fertilizantes [sin fertilizante. VB (entre 10-100L/ha). mecánica] Eficiencia (Horas/ha) D escripción y clasificación de uso de suelo en puntos de muestreo 317 . media (entre 1–2 t/ha/año). alta (>150–350 kg/ha) Aplicación [hoyos. abono verde.

Las observaciones del estatus de los cultivos podrían ser útiles para corroborar los resultados anteriores (o resultados de clasificación). se recomienda que las observaciones de las prácticas de conservación de suelo y agua.Otras observaciones sobre el manejo de suelo y cultivos Aparte de registrar las características del manejo de suelo y de cultivos como se describió en las tablas anteriores. sean incluidas. Las técnicas de recolección de agua como cavar zanjas.net). 2001). corta vientos y otros) o medidas estructurales que incluyen terrazas. Las medidas de conservación de suelo y agua afectarán las poblaciones de organismos del suelo indirectamente por el almacenamiento de agua mejorada. De manera alternativa. altura y diámetro relativos del cultivo en crecimiento (ver Stocking y Murnaghan. El registro debe contener la descripción de las medidas de conservación del suelo y el agua. hondonadas y otras. El rendimiento del cultivo como indicador integra muchos factores. si se conoce la técnica con un nombre en particular (por ejemplo “Zai”. en donde se observa que la altura del cultivo es menor. lo que aumenta la capacidad de retención y reduce la pérdida de suelo. Las evaluaciones del rendimiento basadas en campo deberán incluir lo siguiente: población de plantas por metro cuadrado.). el uso de elementos de vegetación (referido a tiras de pastizales. se incluyen como medidas estructurales. Estos datos proporcionan información adicional sobre el cultivo principal tal y como se especifica en el primer nivel del sistema de clasificación. cultivos en curvas de nivel. las características del crecimiento del cultivo pueden utilizarse como una medida representativa del rendimiento. número de macollos por planta de cereal. cuando se compara con un cultivo de 318 Manual de biología de suelos tropicales . La información sobre el rendimiento de la cosecha es igual de útil. wocat. provee una visión general en su página web de muchas técnicas existentes (www. entre otras. muros de contención. La información de las medidas de conservación no se captura directamente en el registro de los atributos enlistados arriba. especialmente. barreras de setos. La World Overview of Conservation Approaches and Technologies (WOCAT). esta información deberá adjuntarse. por lo que es difícil obtener cifras confiables y del todo correctas. pero no como base de clasificación. De manera general. el crecimiento puede clasificarse como: crecimiento retardado. que se practica en el Níger). al igual que las del estatus del cultivo. acolchonado. bancos. la mejor manera de categorizarlas es determinar si incluyen medidas agronómicas (como cultivos mixtos. construcciones y empalizadas. Probablemente. etc. incluyendo las relacionadas con técnicas de recolección de agua. cuando se relacionan con su manejo.

crecimiento vigoroso. dentro de una proporción espacial entre barbecho y el suelo cultivado en el uso de suelo actual. lo que resulta importante para un mapeo del uso de suelo. Existen guías disponibles para registrar deficiencias específicas de nutrientes en cultivos (ver Stocking y Murnaghan. lo cual puede ocurrir cuando los árboles están dispersos dentro de la parcela. y la severidad de la infección en términos del grado en el cual la planta es afectada. y cultivo de crecimiento vigoroso. Esto permite la inclusión de elementos de vegetación leñosa en la descripción que no están capturados en el sistema de descripción de uso de suelo. permite la validación y la verificación de las observaciones en el lugar del muestreo. y finalmente. la primera distinción se hace en función de si éstos son continuos. permite una evaluación del uso del suelo en un punto de muestreo particular. Patrones de distribución en el campo y árboles en la finca Las observaciones relacionadas con el tipo de campo y con los elementos de vegetación leñosa dentro de la parcela bajo observación y sus alrededores están incluidas. El uso de suelo en el área circundante del punto de muestreo tendrá una notable influencia sobre la biodiversidad del suelo de la parcela en observación. un importante aspecto de la intensidad del uso del suelo. plantas de menor vigor. por sí misma. con un diámetro del cultivo menor y una decoloración generalizada en sus hojas. cercas vivas y otros elementos de vegetación importantes. deberá enlistarse su nombre. Las observaciones del estatus del cultivo deberán acompañarse de observaciones acerca de la incidencia de plagas y enfermedades e incluir el porcentaje del cultivo afectado. en el caso de cultivos migratorios o sistemas de barbecho. frijol y col. 2001) por signos de déficit de nutrientes en maíz. están disD escripción y clasificación de uso de suelo en puntos de muestreo 319 . se esperaría encontrar barbecho como parte del patrón de uso de suelo. dentro del contexto del uso de suelo en las áreas de los alrededores (esto ayuda a establecer si el uso de suelo en la parcela en observación es representativo o no). el factor Ruthenberg se establece. en principio. Además. Respecto a la distribución de los campos (evaluación del patrón de distribución). La fragmentación del uso de suelo que puede ser evaluada a partir de estas observaciones resulta ser. Queda fuera del marco de este capítulo proporcionar información más detallada sobre plagas. enfermedades y sus clasificaciones. todos a nivel parcela o paisaje. Si se conoce la plaga o enfermedad específica. por ejemplo. Este es el caso cuando la cobertura de árboles es escasa (menos de 10 a 20%).

Clasificador espacial Distribución espacial de la parcela [continua. utilizando las clases mayores de cobertura de suelo del LCCS. industrial. Residencial.7 Características de la parcela y distribución del uso de suelo.) 320 Manual de biología de suelos tropicales . etc. vegetación acuática (semi) natural. La segunda distinción se refiere al tamaño. mediana. en donde se especifican los cultivos principales. áreas acuáticas cultivadas o de inundación regular. irregular] Patrón de la parcela [regular.tribuidos en forma de racimos o dispersos (ver Tabla 11.7). agrupada. lo que parece relevante especialmente en el caso de áreas cultivadas terrestres. son las características del suministro de agua y la permanencia del cultivo. El patrón del campo se relaciona a la forma del lugar y al arreglo espacial del mismo. queda una opción para especificar los porcentajes del área usando varias categorías: tierras cultivadas y áreas manejadas. Los distintos componentes de uso del suelo pueden describirse con mayor detalle. Tabla 11. superficies artificiales. grande] Cultivo principal (lista de los cultivos de cuatro parcelas vecinas ) Cultivo principal (lista de cultivos de cuatro parcelas vecinas) Cobertura del suelo (cobertura dominante de áreas no cultivadas) Tipo de cultivo o actividad Tipo de área acuática Tipo de área urbanizada (ej. forma y patrón de los campos y finalmente. áreas terrestres seminaturales. irregular] No continuo Parte de las tierras cultivadas [% de cultivo y área de manejo] Parte de la cobertura vegetal [% de área (semi) natual] Parte del área acuática cultivada [% de área acuática cultivada] Parte acuática no cultivada [% de área acuática no cultivada] Área urbanizada [% de superficie artificial] Atributo técnico 2 Uniforme clases de tamaño (mayoría del campo) [pequeña. áreas vacías o cuerpos de agua artificiales y cuerpos de agua naturales (hielo y nieve). dispersa] Atributo técnico 1 Continuo Distribución del tamaño de la parcela [uniforme.

En el caso de porcentajes bajos de cobertura de árboles y árboles dispersos dentro del campo o alineados en forma de cerca viva. para cosechar frutas. Se hace referencia a éstos como árboles en una finca (TROF). Se entiende que los tramos de bosque y otra vegetación leñosa fueron ya cubiertos por el método de clasificación para uso de suelo.8 especifica los atributos utilizados para describir los TROF. DESCRIPCIÓN Y CLASIFICACIÓN DE USO DE SUELO Definición y descripción de clases de uso de suelo No es el propósito de este capítulo describir cómo las clases de uso de suelo se definen. Las “zonas verdes” se refieren a árboles espaciados en filas dispuestas como empalizadas. natural (especificar tipo. si es posible)] El último elemento que debe ser registrado es la presencia de elementos permanentes de vegetación leñosa en el paisaje. nueces. La Tabla 11. pantanos. es importante registrar la localización del punto de muestreo respecto al lindero del campo.Tabla 11. especificado en términos del número de árboles por hectárea o longitud de los elementos lineales de la vegetación leñosa. Como se ha mencionado. La información sobre los árboles pertenecientes a la familia leguminosa es útil en relación con la ocurrencia de las bacterias formadoras de nódulos. Más información trata de la cobertura o densidad del componente árbol. presas. Los atributos técnicos permiten una descripción del tipo de árbol (ya sea por especie u otro nivel taxonómico) y el propósito de tener árboles (por ejemplo. como estanques. este podría no ser el caso. a partir de los claD escripción y clasificación de uso de suelo en puntos de muestreo 321 .7 Continúa. para leña o material de construcción). Es importante derivar las clases de manera sistemática. aunque estos elementos pueden ser característicos del uso y cobertura del suelo y tener mayor influencia sobre la presencia de la biota específica del suelo. El primer atributo describe la distribución espacial de los árboles. para madera. Clasificador espacial Atributo técnico 1 Atributo técnico 2 Suelo desnudo [% de áreas desnudas] Cuerpos de agua [% de Tipo de cuerpos de agua [arcuerpos de agua] tificial.

principalmente árboles de sombra. Esto se traduce en “plantación de árboles”. son explicados a continuación. Nivel 5 Clasificador Tipo de TROF [sin TROF. No todos los atributos o clasificadores tendrán que tomarse en cuenta. cercas vivas. barreras contra el viento u otros elementos leñosos. Las clases se definen por la combinación particular de clasificadores y atributos (determinados por el valor de los mismos). lo que determina el nivel de detalle con que se definen las clases. de manera que un conjunto de clases definido para un área en particular puede ser fácilmente mapeado en el conjunto de clases utilizados para otra área y viceversa. tipo de cultivo). Los principios de la definición de usos de clase de suelo. árboles dispersos dentro de la parcela. Si únicamente se consideran los primeros tres niveles en la clasificación jerárquica. “cultivo de temporada” y “cultivo permanente”. es posible distinguir entre una plantación de teca y otra de hule. “parcela de tamaño grande”.Tabla 11. utilizando reglas de decisión. distintos grados de cobertura de árboles pueden observarse dentro de la clase “plantación de árboles” (o aun dentro de las plantaciones de teca). el diseño de la clasificación jerárquica y el atributo de los valores de clase. por ejemplo. otros] Barreras contra el viento u otros arreglos lineales: especies de árboles Empalizadas: tipo o especie dominante Atributo técnico 2 Cobertura (% de linderos que constituyen cercas vivas) Densidad (número de árboles por ha) Longitud total por ha (m/ha) sificadores y atributos presentados aquí. no necesariamente tienen que implicar una definición de un conjunto adicional de clases en el siguiente nivel de la clasificación jerárquica. Por otra parte. principalmente madera. zonas verdes] Atributo técnico 1 Cercas vivas: especies de árboles Árboles dispersos dentro de la parcela Propósito [principalmente frutas y nueces. relacionados con observaciones de campo. pero esto pue322 Manual de biología de suelos tropicales . Si se contemplan atributos adicionales del cultivo principal (por ejemplo. cuando se toman en cuenta atributos técnicos adicionales. “cultivo único”. una clase de uso de suelo podría ser definida en función de los siguientes valores de atributos: “cultivo de árboles”.8 Características de los árboles en la finca (TROF).

y “un cultivo permanente”. el factor “tiempo de cultivo” puede tener prioridad sobre el cultivo principal como la característica dominante. XO y NO). Los clasificadores especifican un “cultivo de árboles”. Las clases se asignan de acuerdo con las reglas de decisión y al mismo tiempo las clases se definen. y no a los niveles de generalización (el segundo eje en el sistema de clasificación). Y. Las reglas de decisión generalmente toman la forma de un conjunto de condiciones SI – ENTONCES que aplica los atributos. “sin irrigación”. Una clasificación jerárquica se establece de manera similar. hay que tomar en cuenta los valores especificados para los diferentes clasificadores y atributos técnicos.10. ver Huising (1993).8. y por ello podría usarse para realizar ejercicios de mapeo a pequeña escala. no todos los atributos pueden ser fácilmente organizados en una tabla. Para una explicación de clasificación y jerarquías agregadas. Debido a que el sistema que se presenta trata de áreas cultivadas y manejadas. Debido a la estructura anidada. Esto se refiere a los niveles de la clasificación jerárquica. Para información precisa habrá que referirse a las Tablas 11.9 proporciona una lista generalizada de los clasificadores y atributos de clases de acuerdo con el nivel la clasificación jerárquica. en áreas donde los cultivos migratorios o permanentes se practican uno al lado del otro. en la jerarquía de clasificación para observaciones en parcela. se retiene la información sobre el porcentaje de cobertura como un valor de atributo en particular para cada observación individual (instancia u ocurrencia) del objeto clase (es decir. plantación de árboles). esta característica es general en áreas grandes y no en parcelas. en donde el factor “tiempo de cultivo” sería el parámetro en la jerarquía agregada y no.9 contiene una vista global de la estructura de la clasificación principal. combinados a través de operadores Booleanos (es decir. lo que D escripción y clasificación de uso de suelo en puntos de muestreo 323 .de no ser relevante para definir clases separadas de plantaciones de árboles. Para ilustrar la definición y descripción de la clase.1 a la 11. la jerarquía considera el cultivo principal como la puerta de entrada. O. Más bien. Por ejemplo: SI (<forma de vida> igual a ‘árbol’ y <tamaño de parcela> igual a ‘grande’ y <combinación de cultivos> igual a ‘único’ y <factor tiempo de cultivo> igual a ‘permanente’) ENTONCES <clase> = ‘plantación de árboles’. decidiendo la presencia de un clasificador sobre otro. sin embargo. No obstante. tal y como se observa en la Tabla 11. un “campo grande”. La Tabla 11. La Tabla 11. como han sido presentados arriba.

se clasificará como “extensivo”. se podría definir una subclase añadiendo la descripción “intercalada con un cultivo de leguminosas” para distinguirla del maíz como único cultivo. que la parcela es cultivada de manera permanente con un pequeño periodo de barbecho cada dos años. Algunos de los clasificadores de suelo y atributos de suelo y cultivos. porque la preparación del campo. por ejemplo.11 muestra los datos para una parcela imaginaria de maíz. En cuanto a los clasificadores del nivel 5. lo cual únicamente tendrá sentido si existe una gran variación de dichas características dentro del área y si éstas reflejan diferentes regímenes de manejo. 2002) o en lugares donde se cultivan únicamente árboles de hule. frecuentemente no son relevantes para cultivos de plantación. La principal categoría de uso de suelo a la que esta parcela en particular pertenecerá puede definirse como “cultivos permanentes a pequeña escala con maíz como cultivo principal”. una plantación de más de 10 años de teca (que forma un dosel cerrado). el segundo nivel indica que entre el maíz se encuentran otros cultivos y. De manera alternativa. es importante informar sobre el uso del suelo circundante. a un sistema agroforestal en donde los árboles de hule (Hervea brasiliensis) crecen dentro de la selva (Joshi et al. se pueden distinguir plantaciones de árboles destinadas a la producción de madera para tablas o para otros fines y si se utiliza la información sobre el propósito. con relación a la variedad de plantaciones. de cacao y otras. se pueden distinguir plantaciones de frutales. si la plantación de árboles bajo estudio es un pequeño bosque aislado dentro de un ambiente dominado por cultivos anuales. por ejemplo.. podría basarse en la clase de atributo nivel 1 “densidad de árboles” o en el atributo nivel 2 “combinación de cultivo de árboles”. Se pueden tomar en cuenta medidas para el control de malezas mediante corte o también el uso de químicos.000 m² por tamaño de la parcela). Tomando en cuenta la información del cultivo principal (clasificadores del nivel 1) se describirá la parcela como grande (con 10. el manejo de plagas. Esto. por lo tanto. el tercer nivel.significa una plantación grande de árboles. El manejo de estas plantaciones. enfermedades y la fertilización del suelo no tienen lugar. Si se utiliza la información sobre la especie de árbol. El primer nivel especifica que se trata de una pequeña parcela cuyo cultivo principal es el maíz. con 100 árboles por hectárea y que recibe 1. permitirá una distinción entre hule de “jungla”. Posteriormente. si la información es correcta y se considera importante en el contexto de la clasifica324 Manual de biología de suelos tropicales .200 mm de lluvia por año. o si forma parte de un paisaje dominado por plantaciones de cultivos de árboles. La Tabla 11. Las diferencias entre la intensidad de uso de suelo.

9 Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo.) Nivel 4 manejo Modo de cosecha y clasificación de uso de suelo en puntos de muestreo Clasificador Medios de limpieza Atributos Nivel de especie 1 Grado de limpieza Modo de limpieza 325 .Tabla 11. Nivel 2 cultivo combinado Cultivos simples o múltiples Suministro de agua Factor tiempo de cultivo Nivel 3 prácticas culturales Cobertura del cultivo Nivel 1 características del cultivo y el campo Clasificador Forma de vida del cultivo principal Tamaño del campo Segundo Densidad o espacio entre tipo de cultivo plantas Tercer tipo de cultivo Cantidad de agua suministrada Número de Clase de cobertura del cultivos cultivo Tiempo de secuencia Arreglo espacial Tipo de irrigación Duración del período de barbecho Índice Ruthenberg Clase de tamaño del campo D escripción Modo de preparación del campo Tipo de tracción Frecuencia Tipo de operación Alcance de la operación Frecuencia Modo de deshierbe Manejo de plagas y enfermedades Prácticas de fertilización Tipo de fertilizante Volumen aplicado Atributos Nivel de especie 1 Tipo de cultivo (categoría) Forma del campo Tipo de barbecho Tipo especifico de barbecho Atributos Nivel de especie 2 Cultivo especifico (categoría o especies) Atributos Nivel de especie 3 Cultivo variedad (especie o variedad.

3 Atributos Nivel de especie 4 Nivel 5 Configuración espacial del campo y árboles en la finca Clasificador Configuración espacial de los árboles en la finca Atributos nivel 1 Propósito de los árboles en la finca Atributos nivel 2 Tipo de especies de árboles dominantes . Modo de equipamiento Aplicación Nivel 3 prácticas culturales Tipo de arado Alcance de la operación Eficiencia Clasificación de la aplicación Tipo de fertilizante Tipo de químicos Tipo de herbicida Volumen Volumen aplicado Volumen aplicado aplicado Patrones de distribución del campo Cobertura de árboles (copa) Densidad de árboles o longitud de barreras Patrones de distribución del tamaño del campo Partes del área terrestre cultivadas y manejadas Partes terrestres no cultivadas Arreglo espacial del campo Forma de vida del cultivo principal Otros tipos de uso o cobertura Clasificación de la aplicación Clasificafión de la aplicación Tipo de equipo 326 Eficiencia Nivel 1 características del cultivo y el campo Atributos Nivel de especie 2 Manual de biología de suelos tropicales Atributos Nivel de especie.Tabla 11. Nivel 2 cultivo combinado Tipo de equipo Ubicación.9 Continúa.

9 Continúa.Tabla 11. Tamaño o clases de tamaño del campo Tipo de cultivo principal % cobertura Nivel 5 Configuración espacial del campo y árboles en la finca Atributos nivel 3 Especies de árboles D escripción y clasificación de uso de suelo en puntos de muestreo 327 .

10 Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca. Nivel 2 Combinación de cultivos Único 328 Nivel 3 Prácticas culturales De temporada n/a n/a n/a n/a Permanente n/a Grande Regular Cerrado Vegetación natural* 10. .Teca nico nivel 2 Atributo téc.Tabla 11. si es relevante. se puede describir las plantas debajo de los árboles y estas plantas pertenecerán a la categoría de vegetación (semi) natural. aunque no se discuten en este capítulo.200 mm** n/a n/a Nivel 1 Características del cultivo y el campo Clasificador Árboles Atributos técnicos Nivel 1 Perenes. para lo cual se utilizan otros parametros. ** En el caso de sistemas de temporada de ser posible debe especificarse la cantidad de lluvia. aunque esto por lo general se describe en las características del sitio.Tectona grandis nico nivel 3 * En este caso.000 m2 100 árboles/ ha n/a n/a 1. de hoja ancha leñoso >10 años Manual de biología de suelos tropicales Atributo téc.

11 Ejemplo de clasificadores y valores de atributos para parcelas de maíz.Tabla 11.infraestructura 329 n/a .000 m2 Mediano a grande 75 x 25 cm Frijoles NA 0. habas. Nivel 2 Combinación de cultivos Múltiple 2.16 1 cultivo adicional Simultaneo 2 filas alternadas NA Intermitente De temporada Permanente Mejorado Nivel 1 Características del cultivo y el campo Nivel 3 Prácticas culturales Clasificador Gramíneas Pequeño Atributos nivel de especie 1 Cereales Cuadrada D escripción Mecánica y química Labranza frecuente (2x) y fumigación una vez (1x) Aspersor de mochila VB (Roundup) Continuo n/a n/a Pequeño Uniforme 90% Regular Hierbas y gramíneas Chícharos. maíz 10% n/a n/a n/a n/a Ninguno Fertilizante químico Directamente hoyos Manual VMB (muy bajo) 50 kg CAN/ha n/a Atributos nivel de especie 2 Maíz Mucuna (abono verde) Atributos nivel de especie 3 Nivel de manejo 4 n/a Tracción animal n/a 2 bueyes n/a Arado de vertedera n/a Nivel 5 Configuración espacial del campo y árboles en la finca No TROF y clasificación de uso de suelo en puntos de muestreo n/a n/a Caminos .

pero una definición de un índice o medida de la intensidad de uso de suelo no es fácil. sin el uso de fungicidas o pesticidas y únicamente con muy baja cantidad de fertilizantes. Esto podría traducirse. Un esquema de clasificación estándar no funcionará porque la definición de un conjunto de clases depende del contexto y del propósito específico de la clasificación. Manejo y nivel de insumos: la información en el manejo del cultivo y el suelo habla de que el nivel de perturbación del suelo se considera intermedio (habiendo sido arado dos veces con el uso de tracción animal) y que el insumo de químicos ha sido bajo. el manejo tiene por objetivo modificar o establecer condiciones que propicien la producción de un cultivo. uso de nutrientes. con escasa o sin presencia de árboles. al arreglo específico de la combinación del cultivo y a qué especie es utilizada para mejorar el barbecho. Giller et al. que indica patrones de uso de suelo fragmentados y un uso intensivo del suelo. La información específica se refiere a la densidad de la planta. con cultivos anuales. que las parcelas son generalmente pequeñas. Ordenamiento de las clases de uso de suelo respecto a la intensidad de su uso En sistemas agrícolas. Parece que existe un consenso sobre los factores que determinan la intensidad del uso de suelo. sin que esto quede reflejado en la definición de las clases. La norma general es que los sistemas culturales y manejados son más intensivos que los naturales (cuanto más insumos de manejo se requieran para mantener los sistemas. Esta sección pretende demostrar cómo un conjunto de clases podrá definirse y organizarse en una estructura jerárquica y que el sistema es bastante flexible en cuanto a la selección de clasificadores y atributos considerados para su clasificación. con un bajo volumen de herbicidas. manejo de plagas. en “un manejo caracterizado por el uso de tracción animal y bajo insumos agroquímicos”. dependiendo de las reglas de clasificación. insumos de ener330 Manual de biología de suelos tropicales . el criterio para mejorar el barbecho podría considerarse en la definición de las subclases. más intenso será su uso). principalmente. El grado de interferencia con (perturbación o alteración) el ecosistema natural sería una buena medida de la intensidad del uso de suelo.ción. (1997) definieron un índice de intensidad de uso de suelo que considera la frecuencia de la ocupación de suelo (según lo expresado en el índice Ruthenberg).. Los clasificadores de nivel 5 y los atributos describen que el suelo es cultivado de manera continua.

Esto se hace considerando aquellos atributos (y clasificadores) que expresen un aspecto en particular de la intensidad de uso de suelo. la presencia de vegetación permanente disminuirá la influencia de la variación climática en el ecosistema del suelo. Lo anterior permite un arreglo de los componentes de la vegetación (objetos) a lo largo de dos gradientes. los esfuerzos para crear un índice universal o una medida de la intensidad de uso de suelo serán inútiles. puesto que cada índice es una expresión particular de la intensidad del uso de suelo. Han existido varios intentos por definir una medida de intensidad de uso de suelo. También. se refiere a la permanencia (o frecuencia) de operaciones y el segundo. La presencia de vegetación permanente en el sistema de cultivo limitará las posibilidades para cultivar el suelo o la proporción del suelo que puede ser cultivado. El primer gradiente representa la presencia (proporción en el espacio o tiempo) de vegetación seminatural. la proporción del tiempo durante el cual la vegetación del suelo se restablece de manera semipermanente. pero éstos no han sido del todo exitosos. se traduce directamente en la frecuencia del cultivo. el componente de la cobertura de la vegetación (semi) permanente es un indicador útil. En ambos casos. El segundo gradiente D escripción y clasificación de uso de suelo en puntos de muestreo 331 . que en el entorno de márgenes de selva se traduce en elementos de vegetación leñosa. aunque no directamente relacionado con la influencia de la operación del manejo.gía y manejo de agua. indicando que el sistema con una proporción mayor de vegetación permanente (ya sea como elementos de vegetación natural o cultivada) representa una intensidad menor de uso o un grado menor de perturbación. Además. Es decir. de la misma manera como lo ilustran Kuechler y Zoonneveld (1988). Existen dos principales ejes a lo largo de los cuales se mide la intensidad del uso: el primero. a la intensidad (o amplitud) de las operaciones. puesto que es difícil asignar un peso adecuado a las variables explicativas. reflejando el grado en el que estos factores tienen un efecto en los ecosistemas (el grado en el que se altera o perturba el ecosistema natural) y debido a que algunas veces los datos requeridos para una evaluación cuantitativa de la intensidad del uso de suelo no son accesibles. como factores relevantes. Para los propósitos de investigar tendencias en la pérdida de la diversidad del suelo en relación con un incremento en la intensidad de su uso. con la relevancia de que un índice en particular dependiente del contexto o propósito para el cual se está desarrollando. en el caso de cultivos migratorios. se requieren categorías de clases de uso de suelo en términos de la intensidad de uso de suelo (o alternativamente una definición de clases de uso de suelo que reflejen diferentes niveles de la intensidad de uso de suelo).

y presencia o ausencia del componente arbóreo. En segundo lugar. como en el sistema de “hule de la selva” mencionado arriba. los objetos de uso de suelo son ordenados a lo largo del segundo gradiente de intensidad de uso de suelo.representa la cobertura de vegetación leñosa. a árboles plantados o cultivados (árboles cultivados) o elementos de vegetación no leñosos (por ejemplo. Los objetos se refieren a árboles que existen en la naturaleza (en el caso de vegetación natural). dentro del sistema de cultivo. de acuerdo con el incremento en la intensidad: “sin cultivar”. de acuerdo con el componente Figura 11. Cultivos anuales-campo Componente de le vegetación leñosa y semileñosa (natural) Componente de la vegetación leñosa cultivada Componente de la vegetación leñosa no cultivada Componente árbol Selva Tiempo de cultivo-permanencia Plantación 332 Manual de biología de suelos tropicales . pero sobre todo. En primer lugar. selva). La localización a lo largo de los dos ejes. cultivos anuales y pastizales) en el caso de elementos de vegetación cultivados. en el siguiente nivel de especificación. sólo de árboles plantados (plantación) o sólo de cultivos anuales o pastizales. como se ha especificado en el atributo técnico 1.“sistemas de barbecho”-“cultivos permanentes” (véase Tabla 11. Además de servir como una partición en el tiempo.5). dentro de cada una de las clases definidas. para el sistema de cultivo permanente. El continuo puede representarse gráficamente con un triángulo en donde los tres ángulos representan los valores extremos de la cobertura del suelo que solo pueden estar constituidos por árboles naturales (es decir. la permanencia se expresa con el factor “tiempo de cultivo” y el sistema de clasificación permite un arreglo de clases de uso de suelo.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. Se puede hacer una subdivisión adicional basándose en la duración del periodo de barbecho. lo que resulta relevante en el caso de sistemas particulares de uso de suelo. este eje también expresa una partición en el espacio entre los elementos de vegetación natural y cultivada.“cultivos migratorios”. se determina basándose en los clasificadores y atributos del sistema de clasificación.

2) y combinaciones de cultivo (Tabla 11. Por ejemplo. Existen dos aspectos que deben ser considerados en relación al manejo: uno se relaciona con el grado de perturbación física debida a las operaciones de manejo y el otro se relaciona con el grado de interferencia química con el sistema (uso de agroquímicos). porcentaje de la cobertura del cultivo. “cereales” y “arroz” (ver Tabla 11. Una vez más.1) junto con las características de la cobertura del cultivo (es decir. Si únicamente se toma en cuenta la forma de vida del cultivo principal. deshierbe y de manejo de plagas y enfermedades) son utilizados para definir las clases de intensidad. tracción animal o medios mecánicos). se deberá considerar la intensidad de las operaciones. Respecto al tipo de cultivo de gramíneas. D escripción y clasificación de uso de suelo en puntos de muestreo 333 .árbol o arbusto en el sistema de cultivo (referido a las proporciones en el espacio o en el tiempo). En el tercer paso. la clase “bambú” aparece antes que las clases de “pastos”. En el caso de cultivos de árboles (sistema basado en árboles) se puede considerar el número de estratos de la vegetación y el porcentaje de cobertura del suelo para una categoría posterior. operación de cultivo) y con el grado de uso de agroquímicos (para el control de malezas y manejo de plagas y enfermedades) tal y como se indica en la Figura 11. Las clases se ordenan de acuerdo con este gradiente utilizando las características del cultivo principal (Tabla 11. las plantaciones de árboles se consideran menos intensivas que cuando se trata de arbustos pequeños como el del café o té. manual. como un nivel más de intensidad.5). Una asignación de la intensidad de clases se basa en el valor del clasificador en las operaciones de cultivo (es decir. Una diferenciación adicional para cultivos que no son árboles se basa en la permanencia o duración del cultivo. Si la cobertura de los árboles es escasa. los cultivos de árboles se consideran menos intensivos cuando se comparan con cultivos de arbustos. sin cultivo. “lúpulo y otras enredaderas perenes herbáceas” y “cultivo de cobertura”. el rango se lleva a cabo basado en las características de manejo (el cuarto nivel en el sistema de clasificación). como se ve reflejado en la información sobre la categoría del cultivo (ver atributo técnico 1.3). tiene que considerarse la información relacionada con los árboles en la finca (Tabla 11. Tabla 11. Respecto a los cultivos sin gramíneas. Los clasificadores y atributos del nivel 4 (especialmente relacionados con las operaciones de cultivo. A un nivel más general. Tabla 11. de gramíneas y con formas de vida herbáceas.1). dentro de las clases resultado de los dos pasos explicados arriba. el orden de intensidad de uso sería el siguiente: “cultivo herbáceo”. “plátano y otras plantas herbáceas similares”. También se podrían considerar operaciones de deshierbe con “deshierbe mecánico”. las cuatro clases de intensidad se definen de acuerdo con el grado de mecanización (es decir.1).2.

El procedimiento jerárquico descrito arriba producirá ramificaciones claramente separadas en la clasificación del árbol.3.Figura 11.2. ALTO NIVEL DE INSUMOS QUIMICOS Uso de agroquimicos INTENSIDAD ALTA: ALTO GRADO DE MECANIZACIÓN. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. Esto se puede observar en la figura 11. la clase de uso de suelo más intensiva pertenece a “cultivos migra334 Manual de biología de suelos tropicales . ver Tabla 11.6b). En cuanto al orden de categoría respecto del uso de agroquímicos.3. Como se ilustra en la figura 11. Para poder llegar a una clasificación final de clases de uso de suelo en términos de intensidad de uso. A nivel más general. Al final. considerando una plantación de árboles (cultivo permanente bajo manejo extensivo) representará un sistema menos intensivo que un cultivo manejado intensivamente bajo un sistema de barbecho corto. INTENSIDAD MEDIA: BAJO GRADO DE MECANIZACIÓN. BAJO NIVEL DE INSUMOS QUIMICOS Otra diferencia podría establecerse en función del tipo de animales o maquinaria usada (de acuerdo con los caballos de fuerza) y el tipo de arado empleado. por último. BAJO NIVEL DE INSUMOS QUIMICOS INTENSIDAD MEDIA: ALTO GRADO DE MECANIZACIÓN. son considerados de manera conjunta. en el primer paso de la clasificación. El arado de vertedera tiene un efecto más profundo en el suelo (remoción completa). que representa el nivel más bajo de perturbación. La superposición será considerable entre las clases de sistemas de barbecho y sistemas de cultivos permanentes. únicamente se considera el “uso” o el “no uso” de agroquímicos. el arado escarificado. ALTO NIVEL DE INSUMOS QUIMICOS Grado de disturbio físico INTENSIDAD BAJA: BAJO GRADO DE MECANIZACIÓN. el arado de cincel y. los clasificadores para el control de malezas y manejo de plagas y enfermedades. y no reconoce que puede haber una superposición considerable en términos de intensidad de uso de suelo entre las clases. pero una diferencia más. estas clases tienen que relacionarse entre sí. seguido por el arado de disco. una evaluación por pares de clases de uso de suelo individuales en la región de superposición dará la clasificación final en términos de la intensidad de uso de suelo. podría basarse en el volumen de aplicación (aplicación selectiva o localizada. tipo de equipo o maquinaria usada en el caso de plagas y enfermedades y el volumen de aplicación.

en primera instancia. sistema de barbecho (barbecho > 8-9 meses) Fmcm: cultivo de intensidad media.Figura 11. Esto quiere decir. Donde: Fn: selva natural Fl: selva explorada Slce: cultivo extensivo. que corresponde al 66% del tiempo que la tierra no es cultivada. en esta fase. si el suelo está en barbecho el 60% del tiempo y la vegetación de ese suelo es pasto. sistema de barbecho (4-5 meses < barbecho < 8-9 meses) Fsci: cultivo intensivo. que se considera la forma de vida de la vegetación dominante o cultivo. cultivo migratorio (barbecho < 1–2 años) Flce: cultivo extensivo. se aplican los mismos criterios que en el segundo y tercer pasos de la clasificación. si proviene de orígenes culturales o (semi) naturales (por ejemplo. sistema de barbecho (barbecho 4-5 meses) Pte: cultivo de árboles extensivo. cultivo permanente torios” y es seguida por el de menos intensidad de uso “cultivo permanente”. en las regiones superpuestas entre la categoría mayor de uso de suelo. cultivo permanente Pchi: cultivo intensivo. cultivo permanente Pcmi: cultivo de intensidad media. este pasto se considera el tipo de vegeD escripción y clasificación de uso de suelo en puntos de muestreo 335 . considerando que la cobertura de árboles en plantaciones puede ser entre el 60% al 70% de la intensidad de uso. donde se determina el orden a lo largo del gradiente de intensidad de uso de suelo descrito anteriormente. sin distinguir. cultivo permanente Pgi: pastizales intensivos. lo que se toma como el límite superior para la clase “cultivos migratorios”. Para establecer una comparación de clases de uso de suelo individual. cultivo permanente Pge: pastizales extensivos. bajo cultivo migratorio (periodo de barbecho > 8-10 años) Smce: cultivo extensivo.3 Clasificación del uso del suelo en términos de la intensidad de uso. bajo cultivo migratorio (1-2 años < barbecho < 8-10 años) Ssce: cultivo extensivo. cultivo permanente Pti: cultivo de árboles intensivo.

V. A. Columbia University Press. selva manejada y selva explotada. Huang. L.. y Jansen.-X. FAO. Strategies and Methods of Introduction. se hace una distinción entre selva natural. es decir. Marcel Dekker Inc. con la introducción de una noción de que la extracción de productos de la selva sirve como un indicador para la intensidad de uso. (2005) ‘Belowground diversity assessment: Developing a key functional group approach in best-bet alternatives to Slash-and-Burn’.. Rome. M. M. Tondoh. 2005). los pastizales permanentes. H. y Dorr. Palm.New York.. Agradecimientos Al profesor Ken Giller por sus comentarios y al Dr.. B. Sanchez and P. D. N. un cultivo con un manejo intensivo bajo un sistema de barbecho corto (Fsci) puede subir una posición. E. P. J. Nwaga. aun en el caso de que sean manejados intensivamente (Pgi) tendrán una clasificación más baja en términos de intensidad de uso de suelo. De esta manera. (2002) Soil Management and Conservation for Small Farms. Techniques and Equipment. (2002) ‘Aerial application’. FAO. J. En el segundo ejemplo se considera la intensidad de manejo (en relación con el cultivo más demandante del sistema. L. J. Peter Okoth por las discusiones en la preparación de este capítulo. si se compara con un área de cultivo permanente bajo manejo intermedio o bajo (Pcmi). (2000) Land Cover Classification System (LCCS): Classification Concepts and User Manual. Moreira. Woods. Pimentel (ed) Encyclopaedia of Pest Management. A. F. A. Vosti. in C. Susilo. New York. Craig. 336 Manual de biología de suelos tropicales .tación dominante). S. A. si se compara con un cultivo anual con un sistema de barbecho corto (Fsc). “sistemas de barbecho” refiriéndose al componente de cultivo. I. Rome. P. REFERENCIAS Bignell. y Swift.. G. J. de acuerdo con los sistemas de uso de suelo en el trópico húmedo a diferencia del proyecto ASB (Bignell et al. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. Management and Conservation Service. P.. in D. Di Gregorio. FAO Soils Bulletin 77. GCP/RA/287/ITA Africover – East Africa Project and Soil Resources.. De Freitas. F. S.. Respecto a la selva. Dibog. Igualmente.. D. más que al barbecho en sí) para permitir a la clase bajo consideración subir una o dos posiciones en el orden de clasificación. Pashanasi.

www. Iowa State University (2004) ‘Weed Science’. G. www. F. R. W. M. Indonesia. A pattern recognition approach to land use inventory at the sub-regional scale using remote sensing and GIS applying an object oriented and data-driven approach’. and Murnaghan. D. Huising. Wageningen Agricultural University. A.. M. The Netherlands. Usher. Oxford. Barois. soil biodiversity and ecosystem function’. I. M. M. 3rd edition. Applied Soil Ecology. G. y Swift. Zandstra. Swift.asp. Kluwer Academic. Cambridge University Press.. Giller. y Huising.iastate.orst. N. Heipke (eds) Digital Photogrammetric Systems. L.. J.. Cambridge.org/swcmeas. Amsterdam. (2005) ‘Soil biodiversity in rapidly changing tropical landscapes: Scaling down and scaling up’. Elsevier Science Publishers B. Wibawa. New York. London. Akiefnawati.. Clarendon Press. Joshi. Dordrecht. Molenaar. (1997) ‘Agricultural intensification. in M.. ICRAF-Southeast Asia Regional Research Programme. M. in H. Lavelle.. 6. H.. (1987) Remote Sensing and Image Interpretation. S. (1991) ‘Formal data structures. The Netherlands. van Noordwijk. N. Karanja. 10. y Collinsons. Bardgett and D. van Noordwijk.weeds. E. Berlin WOCAT. vol. E.. M.. P. A. H..edu/mgmt/2004/ world. P. y Kiefer. K.shtml..D.. 3–16. (2001) Handbook for the Field Assessment of Land Degradation. M. D. (1998) An introduction to the Theory of Spatial Object Modelling for GIS. G. K. Boutin. Thesis. pp. Stocking. B. R. ippc. Lavelle. Vink. Kuechler. M. S. MacArthur. Ebner. (1975) Land Use in Advancing Agriculture. Izac. John Wiley & Sons. Bignell. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. Springer Verlag.. Ruthenberg. D. Moreira. J.. vol. www. (2002) Jungle Rubber: A Traditional Agroforestry System Under Pressure. Karlsruhe. D.. R.. Handbook of Vegetation Science. H. N. Lillesand. A.V. E. P. Hopkins (eds) Biological Diversity and Function in Soils. Fritsch and C. W. World Overview of Conservation Approaches and Techniques. E.edu/pnw/weeds. Oregon State University (2005) Pacific Northwest Weed Management Handbook. object dynamics and consistency rules’. y Williams. J. D escripción y clasificación de uso de suelo en puntos de muestreo 337 . W. P. Manurung.. I. Baere. (eds) (1988) Vegetation Mapping. Taylor & Francis Ltd. Earthscan Publications Ltd.. D. E. M. J.. Molenaar. M.-M. J. Ph. (1980) Farming Systems in the Tropics. Bogor. Wichman Verlag. T. The Netherlands. A. ILACO (1985) Compendium for Agricultural Development in the Tropics and Sub-Tropics. Vincent. London. y Zonneveld..Giller. Barrios.wocat.

.

Colaboradores L. S. PO Box 30677-00100. DF.hu. Brazil. DF. E. Brazil. Universidade de Brasilia. AM. Coe. Universidade de Brasilia (UNB). India. Cx Postal 4457. Huang. E. Brazil. CEP 70910-900 Brasilia. Brazil. dbagyaraj@vsnl. Cx Postal 4457. Cx Postal 478.bignell@qmul. CEP 70. University of Agricultural Sciences. 13. Universidade Federal de Minas Gerais.com.br.com. constant@unb. DF. GKVK Campus. csuzdi-alef@nhmus.gov. R. cares@unb. United Nation Avenue. Belo Horizonte MG. J. CEP 70. Brazil. Bignell. Manaus. Brasilia. Coordenação de pesquisas em Entomologia. CEP 69011-970.uk. World Agroforestry Centre (ICRAF). Instituto de Química. Universidade de Brasilia (UNB). Barross str. lmabreu@gmail. Sabah. Universiti Malaysia Sabah. E. Franklin. J. Instituto Nacional de Pesquisas da Amazõnia (National Institute for Amazonian Research-INPA). Instituto de Ciencias Biológicas. Kenya. Departamento de Fitopatología. Abreu. M. 339 . d.ac. P. beth@inpa.904-979. Gigiri.br.coe@ criar. Campus Universitario Darcy Ribeiro. Bangalore. Cares. Constantino.904-970. D. Bagyaraj. Systematic Zoology Research Group of Hungarian Academy of Sciences and Hungarian Natural History Museum. H-1088 Budapest. 88999 Kota Kinabalu. R.org. Departamento de Zoología. C. Csuzdi. Malaysia. (finado). Nairobi. r.br. Brasilia. Departament of Agricultural Microbiology. Departamento de Fitopatología. D. Hungary. Instituto de Ciências Biológicas. Institute for Tropical Biology and Conservation.

fr. X. jlouzada@gmail. Universidade Federal de Lavras.rahmadi@lipi. swiftmj2003@ yahoo. C. Abidjan 02. CEP 37200-000. cahyo. F. RC Biology. Swift. A. Université d’Abobo-Adjamé. PO Box 30677-00100 Nairobi.com. N. Faculty of Agriculture. Morais. J. nmarques@ufam. Tropical Soil Biology and Fertillity (FSBF) Institute of CIAT. United Nations Avenue. AM Brazil. Cx Postal 3037. Karyanto. Bandar Lampung 35145. alcmoino@ufla.edu. H. morais@inpa. SC. Brazil. 16001 Indonesia.br. J. M. CEP 89010-971. Huising. S. Departamento de Ciência do Solo (Soil Science Department). S. M. PO Box 161.van-noordwijk@cgiar.. L. C. Brazil. Lavras. Manaus. Jr. 02 BP 801. Moreira. MG. 801. Kenya. Côte d’Ivoire. J. Louzada. Université d’Abobo-Adjamé.P. M. Jalan Sumantri Brojonegoro nº 1. Departamento de Ciências Naturais. Indonesia. W. Blumenau. Coordenação de Pesquisas en Entomnologia. E. Stürmer. J. Tondoh. Raya Jakarta-Bogor Km. Universidade Regional de Blumenau. c/o ICRAF. fmoreira@ufla. Bogor. Departamento de Entomología. Instituto Nacional de Pesquisas da Amazônia (Nationale Institute for Amazonian Research-INPA). Zoology Division. J. fxsusilo@tlkom. Universidade Federal de Lavras. Moino.com. Universidade Federal doAmazonas. van Noordwijk. Cx Postal 3037. Faculdade de Ciências Agrárias. Bandar Lampung 35145. Cx Postal 1507. Cibinong. UFR des Sciences et de la Nature. F. j. Jalan Suantri Brojonegoro nº1.go.com. 46. CEP.huising@cgiar. Lavras. 340 Manual de biología de suelos tropicales . Skonate2@yahoo. Faculty of Agriculture. Silva. Brazil.com. Departamento de Biología (Biology Department). m.br. Rahmadi.id. Centre de Recherche en Ecologie.com. University of Lampung. Brazil.gov. Pfenning. Gigiri. LIPI JI. tondohj@ yahoo. S. M. CEP 69070-000 Manaus. A. Departamento de Fitopatologia. PO Box 30677-00100. Nairobi. L. Kenya.br. Lavras . Department of Plant Protection. CEP 37200-000. Universitas Lampung. Universidade Federal de Lavras. Cx Postal 3037. Universidade Federal de Lavras.net. Brazil. Abidjan. 69011-970. sturmer@furb. CEP 37200-000 Lavras MG.org. Indonesia. Indonesia. B. Cx Postal 478. ludwig@ufla.br. CEP 37200-000. Konaté. Cx Postal 3037. AM. MG. N. Brazil.br. c/o ICRAF. Gigiri. Susilo.br.E. United Nations Avenue. Tropical Soil Biology and Fertility Institute of CIAT. asgknila@yahoo. World Agroforestry Centre SE Asia. Côte d’Ivoire.

Zanetti. zanetti@ufla. C olaboradores 341 .R. Universidade Federal de Lavras. MG. Cx Postal 37.br. CEP 37200-000. Lavras. Brazil. Departamento de Entomologia (Enthomology Department).

.

290-294 alimentación especializada o incidental 111 almacenamiento de las muestras 78. 243. 280 África 141–142 agroecosistemas 43. 334 aislamiento 190.314. 263 análisis de conglomerados (cluster) 267 análisis de correspondencia (AC) 266 análisis de varianza (ANOVA) 265 análisis filogenéticos198. 252-153 Asia 140–141 atributos 297. 334 Ascomycota 248. 40. 247–248 arado 311. 194-197. 132 mesofauna 159. 291 análisis automatizado del espaciador intergénico ribosomal (ARISA) 261. 191. de uso de suelo 302 B bacteria 39.Índice analítico A abundancia macrofauna 98. Véase análisis de correspondencia ácaros oribátidos 150 ácaros 149-159 acceso a puntos de muestreo 84. 132 343 .127. 99. 217. 246 agroquímicos 313. Véase atributos atributos técnicos específicos. 251-252 bienes y servicios. Véase servicios ecosistémicos biomasa 127. 93. 288.85 ácido láctico 156 aditivos 279. 177-214. 151.164. 290 bacterias fijadoras de nitrógeno (BFNFNL) 177-213 Basidiomycota 248. 302-329 atributos de tamaño de unidades de muestreo campo o parcela 304-307 cuadrícula 81-82 atributos técnico. 126.160 nematodos 171-172 AC.

Véase Proyecto. cultivo 305-307 depredadores 37. 265-267 macrofauna 98-100. Véase PCR competitivo CSM-BGBD. 334335 clasificación de procesos 93. 325-329 colecciones de recursos genéticos 267 Collembola 123. 164 descomposición 29-35. 298. 307 características del cultivo 301. 124. 302-304 densidad. Véase colonizadores cálculo. 317 cPCR. jerarquía 323 clasificadores 297. 190 caracterización de sitios 87-88 caracterización genética 197 cartografía. 331-332 Chromista 247 Chytridiomycota 248. 158-160. 129. 94. 304-324. 325-329 conjunto mínimo de datos 129-132 contaminación 78 control microbiano 287 cosecha 311. Véase disturbio datos requeridos y análisis 49-50. 310. Véase enumeración cobertura. 301. 188. 58 . 226-232 hongos 244. conservación y manejo sostenible de la biodiversidad del suelo 344 Manual de biología de suelos tropicales cuadrícula estratificada 84-85 cultivo post inundación 308 cultivos de sotobosque 308 cultivos migratorios 309. 58. uso de suelo 81 categorías tróficas 110-112. 302. 319-320. 300. 245. 304307. 265-267. 101. 197. 96. 313-315 determinación a priori 65. 251 ciclo de nutrientes 34 clasificación de uso de suelo 332. 125-132. 303 DGGE. 194 HMA 219-222. 149-162 colonización 219-224 colonizadores (c) 172-174 combinación de cultivos 308-311. 243. cultivo 305. 102 clasificación. 171-172 cercas vivas y otros elementos de vegetación 319-321. 110 nematodos 171-172 uso de suelo 42-43. 265 curvas de rarefacción 265 Cylindrocladium spp. 316 cultivos puros 198 cultivos secundarios 307 cultivos trampa 231-232 curvas de acumulación de especies 113. Véase taxonómica clasificación. 97. 246 descriptores genéricos 194 desmonte de la tierra 311. 302. 325-329 caracterización cultural 189.biopesticidas 288 bioturbación 34 C C. 37-38. 254-255 D D. Véase electroforesis en gel con gradiente de desnaturalización diapausa 289 disección 157 diseños multiescala 64 diversidad BFNFNL 178-182.

257 esporas de HMA 226-228 método de Berlese 152-154 método de extracción Winkler 92. 70. 71 etiqueta 97. 128 especies epigeas 78. 128 fertilizantes 314-316. 218. 152-155 enfermedad 35. 193 equidad 266 ERA. 317 fertilizantes inorgánicos 315 fijación de nematodos 165-169 G glomerales 220 Glomeromycota 247 gradientes. 99. 132 nematodos 165-166 extracciones núcleo por núcleo 154 F factor tiempo de cultivo 309.6567. 317. 128 especies clave 129 especies endógenas 99. 163-165 grupos funcionales de la biota del suelo 38-41 H herbívoros 37 hidróxido de potasio (KOH) 156 hipótesis de CSM-BGBD 57 Í ndice analítico 345 . 191 enumeración 168.99-100. 128 especies trampa 185-186 esporas 88. 263 embudo de extracción 149. 36. 288 esquemas de muestreo alternativos 5789. 85-86 escarabajos 100-113. 114-118. 190. 98 estándares para BFNFNL descripción de especies 194-196 estatus de los cultivos 318 estratificación en el muestreo 55-57. 189. 226-228. 319 enfoque sesgado 65 enfoques transversales 57 ensamble de especies 110 ensayo de reducción de acetileno (ERA) 185. 283 extracción DNA 197. 162. 287. 315. 312. 229-231. 330-333 familia Acaulosporaceae 238 familia Archaeosporaceae 239 familia Gigasporaceae 240 familia Glomeraceae 236 familia Pacisporaceae 239 familia Paraglomeraceae 239 fase de pupa 284 fauna de la hojarasca 37. 110-111. 113. 112125. 192 . 130. 94-100 esquemas de puntos de muestreo 72-75 estacionalidad 88. 140 especies anécicas 100. 115-117. Véase ensayo de reducción de acetileno escala 62 escalas espaciales de muestreo 42-50. 116-125. muestreo 80-81 gremios 114-115 grupos funcionales 29-41. 322-323. 104.E eficiencia en la labranza 312-314 electroforesis en gel con gradiente de desnaturalización (DGGE) 259-260.

87-88. 187. 37. 243-280 hongos saprofitos 41. 330-336 inventarios 41-50. 259-260.HMA. patógenos de plantas 41. Véase hongos micorrizógenos arbusculares hongos entomopatógenos 287-294 esquema de medición por puntos 74 grupos funcionales 39. 100–113 .93–100. 313. 229-230 hongos 255-256 lombrices de tierra 98-100 macrofauna 105-110. 44. 217-241 hormigas 40. 140 hospederos promiscuos 178-185. 46 datos requeridos 48-50 descripción y clasificación 299. 91. 64. 243-280 hongos antagonistas 41 hongos del suelo. Véase también taxonomía IM. muestreo de 63. 129 inoculación 47. 91. 293. 41 HMA 217–241 patógenos de plantas y saprofitos 41. 317 J jarras de Leonard 186. 140-144 mesofauna 156-159 moscas de la fruta 284-285 nematodos 163-165. Véase índice de madurez imágenes satelitales 67. 263-264 índice fitoparasítico (IFP) 172-174 índice de madurez (IM) 172. 193 jerarquía clasificación 323 clasificación de uso de suelo 300-302. 305-306. 166-168 organismos entomopatógenos 290.173 índice de riqueza de género 171 índice de Shannon–Wiener 266 infiltración de glicerina 168 ingenieros del ecosistema 34. 297-336 investigaciones piloto 60 irrigación308. 91-92. 185–187 huella molecular 196-198. 304. 114-118. Véase Sistema de clasificación de cobertura de suelo límites. 302-304 manejo de la biota del suelo 47-49 muestreo 79-80 replicación y tamaño de muestra 60–65 I identificación grupos funcionales en macrofauna 112-113 HMA 226-228. 193 insectos 287-294 intensidad de uso de suelo agrícola 42. 53. 217. 310 limpieza de malezas 313-315 listas de especies 107-109 lombrices de tierra 40. 243-280 hongos fitopatógenos 41 hongos micorrizógenos 217-241 hongos micorrizógenos arbusculares (HMA) 41. 301. 100-113. 306 índice de diversidad de Shannon 171 346 Manual de biología de suelos tropicales L labranza 312. 334 labranza mínima 312 LCCS.

97 muestreo no aleatorio 67 muestreo secuencial 64 muestreo simple aleatorio (MSA) 55. 73. 131 número de muestras 81–83 esquema de puntos de muestreo 72–75 muestreo estratificado 67. 67-68 muestreo sistemático 67-68 N nematodos 163–176. 39. 263 método de Seinhorst 168 método de Seinhorst modificado 169 método Winkler 92. 48-49 monolitos 94–100. 249.M macrofauna 39. 82–83. 290 método de filtración de partículas 252– 254. 193 muestras control 193. 75-77. 130 métodos de extrapolación 105 métodos de montaje 157–158. 260. 214 muestreo dentro de una parcela 65 muestreo animales 39 BFNFNL185–189.84–85 paisajes 61-63 aleatorio y sistemático 67-68 muestreo en transectos monolitos para lombrices de tierra 97 macrofauna 75. 40. 229–230 métodos TSBF 93–94 microfauna 37-38. 197.114–118. 40. 193–195 clasificación de usos de suelo 297-336 diseño y estrategias 53-90 hongos 249 inventarios de biodiversidad 42-47 macrofauna 91-148 mesofauna 149-162 moscas de la fruta 282-285 muestreo adaptativo 64. 91-148 manejo 311-319. 56.256–259. 334 media poblacional 25 medidas de conservación 318 “medio 79” 214 medio “S” 293 medio selectivo. 40.84–85 nematodos 165 punto de muestreo 62-63 muestreo aleatorio 55–56 muestreo en cuadrícula clasificación de uso de suelo 304 CSM-BGBD 79–80. 321-330 materia orgánica 29-35 materia orgánica del suelo (MSO) 34. 58 mecanismos de control 313-315 mecanización 311. 73 microhabitat 47. 73. 261.118125. 287–295 nematodos bacteriófagos 164 nematodos omnívoros 164 Í ndice analítico 347 . para hongos 252-255 mesofauna 39. 54. 98-100. 118. 126. 114-118. 263-264 método de la cuadrícula de intersección 227-228 método de partículas de suelo251–253 método de reacción en cadena de la polimerasa (PCR) 196. 131 monolitos complementarios para lombrices de tierra 97 moscas de la fruta 281-286 muestras compuestas 61–65.149-160 método de Berlese 149-160 método de Berlese modificado 154-155 método de centrifugación en azúcar 166 método de de extracción 190.

298 prueba de hipótesis 55–57. muestreo 81. muestreo 60-62 polimorfismo de conformación de cadena única (SSCP) 261. subparcela o microhabitat 47. separación de 85-86 puntos. 126 número más probable (NMP) 218. 126. 174 pesticidas 286. 329 preparación de la tierra 311-312 primers específicos para “hongos” 257258 principales grupos funcionales 35-38. 49 nitrogenasa 184. 57.140–144 nomenclatura 106.185–198. 49 nivel neotropical 142. 307–311. 41 procedimientos basados en cultura 333–245. 263 polimorfismo de longitud de fragmentos de restricción (RFLP) 260 polimorfismo de longitud de fragmentos de restricción terminal (T-RFLP) 260. 314 Phytophthora spp. 145. 191 nivel de nicho 47. 325. 81. 250 plagas 35. 63 prueba piloto 60 pseudo-replicas 62 puntos de medición 53 puntos de muestreo 74 puntos de muestreo. 165. 300–336 patógenos fúngicos de plántulas 255 perturbación (P) 56. Conservación y manejo sostenible de la biodiversidad del suelo (CSMBGBD) 45–47. 249–255 proceso de aclarado 156-157 procesos de degradación 44 procesos de rehabilitación 44 productores primarios 37 programa Africover 299 propágulos infectivos 219-224 protozoa 247 proyecto. 328. 48. 219 población.218. 7980.61-62 parcelas de muestreo y clasificación de uso de suelo 46–47.79–89. 330 PCR competitivo (cPCR) 262 PCR cuantitativo 261-262 PCR. 48-49. 64-65. Véase persistencia paisajes 44–47. Véase Método de reacción en cadena de la polimerasa permanencia de la vegetación 330–332 persistencia (p) 172.147–148 nivel regional 44. 319 plantaciones 322–324 348 Manual de biología de suelos tropicales plantaciones de teca 328 plantas hospederas 178–182. 315. 49. 317. 132 Pythium spp. 83–84. 102 nivel de parche 46–47. 244. 38. 78.nematodos parásitos de plantas 164 nematos micofagos 164 nicho. 263 prácticas culturales 301. 219224 O observación directa 302 observaciones secundarias 303 Oomycota 250 organismos entomopatógenos 287–295 organismos mutualistas 39 P p. 85–86. 250 . 184–186.

100–113. Véase Polimorfismo de conformación de cadena única sustancias químicas 156-158 349 . Véase electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) 259–260. 155158 técnicas específicas de DNA 197. 317 taxonomía BFNFNL 177–182 HMA 219-222. medición del estatus de los cultivos 318-319 resguardo de especímenes 192-193. 140. 124. 147 termitas que se alimentan de madera 111 termitas que se alimentan del suelo 110 TGGE. 103. 103105. 285 respuestas multivariadas de interés 63-64 RFLP ver polimorfismo de longitud de fragmentos de restricción rhizobia 177-183 Rhizoctonia spp. 297–299 rizosfera 249 rotación. 93-95. 334. 188189 técnicas de cebo 119. cultivos 310-311 roundup 314 T tasas de aplicación 303. 304–319. 126. 130-132. 36-41 técnica de infección de plantas 178.279–280 técnicas de lavado para partículas del suelo 252. 79 solución de nutrientes Jensen’s 215 solución Nesbitt 158 SSCP. 335–336 sistemas de cultivo 42. 145. 82.249–252. 256–265 termitas 40. 314–316. 149 trampa White 293 Í ndice analítico S secuencia de cultivos 107 secuenciación 16S rDNA 196 selección subjetiva 67 servicios ecosistémicos 29–36. 149 trampa 118-125.267 técnicas de procesamiento de muestras 78. 325. 91. 253-255. 130-132.124. 30–33. 300–302. 229-230 macrofauna 105 mesofauna 158-159 moscas de la fruta 281.R reactivo de Melzer 230-231 reglas de decisión para la clasificación de usos del suelo 323 rendimiento. 251 Ricinius communis 254–255 riqueza de especies 265–267. 284 neotropical 145 Véase también identificación visión general 29. 263 tinción de raíces 224–226.187 trampas McPhail 282 BFNFNL 190 pitfall 118-125. 329 sitios de muestreo 60-63. 263 técnicas de preservación 267 técnicas de preservación 93-94. 123. 41. 328. 163 sistema de clasificación de cobertura de suelo (LCCS) 299 sistemas de barbecho 309–310. 227 tipos de anidación 112-113 trampa de especies múltiples 185.

trampas sin cebo 118 transecto de entrenamiento 102 transformación de datos 126. 58 hongos 243 inventarios 87-88 muestreo 65-67. 70–72. Véase polimorfismo de longitud de fragmentos de restricción terminal trituradores 260 V valores cp 171-174 variabilidad 70-72 variabilidad de datos 44. 331–333 ventanas para muestreo 60. 132 U uso de suelo a priori definición de clases descriptivas 65. 87 variabilidad intragrupo 51 vegetación leñosa 319. 300. 320–322 vegetación semi-permanente 331 vegetación. 83. 64. 48 W WOCAT World Overview of Conservation Approaches and Technologies 318 Z Zygomycota 248 350 Manual de biología de suelos tropicales .7981. 61–62. 298. efectos de mitigación 301. 83-84 Véase también intensidad de uso de suelo área de uso de suelo 46. 303 BFNFNL 186 cartografía 81 definición de clases 321–324 descripción y clasificación 297–336 diversidad 42. 159-160 transformadores procariotas 38 T-RFLP.

91190. Xalapa. Jeroen Huising y David E.proagraf. de C. P. Moreira. S. Tel/FAX (228) 890 6204/815 1876 www.V.A.Manual de biología de suelos tropicales.mx Se tiraron 1. Col. editado por Fátima M. Badillo.com. 20 de Noviembre No 649. Veracruz.000 ejemplares . E. Av. S. Muestreo y caracterización de la biodiversidad bajo suelo . Bignell se terminó de imprimir durante el mes de mayo de 2012 en los talleres gráficos PROAGRAF. C. México.

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->