Manual de biología
de suelos tropicales

Esta publicación presenta parte de los resultados del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity”, implementado en siete países tropicales: México, Brasil, Costa de Marfil, Kenia, Uganda, India e Indonesia. El proyecto es coordinado por el Tropical Soil Biology and Fertility Institute del CIAT (TSBF-CIAT) con co-financiamiento del Global Environment Facility (GEF), y con apoyo para su implementación del Programa de Naciones Unidas para el Medio Ambiente (PNUMA-UNEP). Las opiniones expresadas en esta publicación pertenecen a los autores del libro y no necesariamente concuerdan con las de PNUMA-UNEP o GEF. La traducción y publicación de este libro en español fue posible gracias al apoyo financiero del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity” y al Instituto Nacional de Ecología (INE). También queremos agradecer todas las facilidades proporcionadas por Tiberious Brian Etyang del Tropical Soil Biology and Fertility Research Area of CIAT (TSBFCIAT) Nairobi, Kenia, a Teotonio Soares de Carvalho de la Universidade Federal de Lavras, Brazil, al Dr. José Antonio García Pérez por sus valiosos consejos y sugerencias, y a Caridad González Lerma por cuidar los últimos detalles.

Manual de biología de suelos tropicales
Muestreo y caracterización de la biodiversidad bajo suelo
Fátima M. S. Moreira, E. Jeroen Huising y David E. Bignell (editores )

Secretaría de Medio Ambiente y Recursos Naturales (S emarnat) Instituto Nacional de Ecología (INE)

Título original de la obra: A Handbook of Tropical Soil Biology Sampling and Characterization of Below-Ground Biodiversity © Earthscan en el Reino Unido y Estados Unidos en 2008 Hardcover ISBN: 978-1-84407-621-5 Paperback ISBN: 978-1-84407-593-5

Revisión de capítulos por especialistas en el tema: Dra. Isabelle Barois Boullard, Instituto de Ecología, A.C. Dra. Simoneta Negrete Yankelevich, Instituto de Ecología, A.C. Dra. Rocío Vega Frutis , Instituto de Ecología, A.C. M.C. José Antonio Gómez Anaya , Instituto de Ecología, A.C. M.C. Francisco Franco Navarro, Colegio de Posgraduados Dra. Esperanza Martínez-Romero, Centro de Ciencias Genómicas, UNAM Dra. Lucia Varela Fregoso, Hongos y Derivados, S.A. de C.V. Dr. Juan Rull Gabayet, Instituto de Ecología A.C. Dra. Dora Trejo Aguilar, Universidad Veracruzana

Primera edición: 2012
D.R. © Instituto Nacional de Ecología

Periférico Sur 5000. Col. Insurgentes Cuicuilco, Deleg. Coyoacán, 04530, México, D.F. www.ine.gob.mx

Coordinación General de la Publicación en Español: Isabelle Barois Boullard Coordinación editorial y formación: Raúl Marcó del Pont Lalli Corrección de estilo: Adriana Victoria Arcos Méndez Revisión y preparación de originales: Martín De Los Santos Bailón Colaboradora en la traducción al español: Judy Shirley Adaptación del texto: Mariluz Pérez Lorenzo Diseño portada: Álvaro Figueroa Foto de la portada: Claudio Contreras Edición para internet: Susana Escobar Maravillas Forma sugerida de citar el libro: Moreira, F., E. J. Huising y D. E. Bignell. 2012. Manual de biología de suelos tropicales. Muestreo y caracterización de la biodiversidad bajo suelo. Instituto Nacional de Ecología, México, 337 pp., México.
Ninguna parte de esta publicación, incluyendo el diseño de la portada, puede ser reproducida, traducida, almacenada o transmitida de forma alguna ni por ningún medio, ya sea electrónico, químico, mecánico, óptico, de grabación o de fotocopia sin permiso previo de los editores. Pequeños párrafos, tablas o figuras, pueden reproducirse dentro de lo estipulado en la Ley Federal de Derecho de Autor y el Convenio de Berna, o previa autorización por escrito de la editorial. ISBN: 978-607-7908-31-9 Impreso y hecho en México

Índice

1 2 3 4

Listado de tablas Listado de figuras Prólogo a la edición en español Prólogo Prefacio Lista de acrónimos y abreviaturas El inventario de la biodiversidad biológica del suelo: conceptos y guía general Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo Macrofauna Collembola, acari y otra mesofauna del suelo: el método Berlese

9 10 13 17 21 25 29 53 91 149

5 6 7 8 9 Nematodos del suelo Bacterias formadoras de nódulos en leguminosas Hongos micorrizógenos arbusculares (HMA) Hongos del suelo saprófitos y patógenos de plantas Muestreo. preservación e identificación de moscas de la fruta 163 177 217 243 281 287 10 Hongos y nematodos entomopatógenos 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo Colaboradores Índice analítico 297 339 343 .

procesos asociados de cambio y componentes relevantes de la biodiversidad Grupos de organismos del suelo colectados utilizando diferentes métodos de captura Ejemplo de lista de especies Densidad numérica (individuos m-2) de termitas en siete localidades. fertilizantes y cosecha Características de la parcela y distribución del uso de suelo Características de los árboles en la finca (TROF) Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca Ejemplo de clasificadores y valores de atributos para parcelas de maíz 26 33 44 72 103 122 154 167 168 169 174 210 253 295 297 298 298 299 303 307 310 312 315 318 319 .1 3.2 5.3 2. unidades de referencia. amplificados del DNA total Clasificadores y atributos técnicos para el cultivo principal Tamaño del campo y características de la cobertura del cultivo Atributos de cultivos combiandos Características del suministro de agua Factor tiempo de cultivo Clasificadores y atributos relacionados con la limpieza de la parcela.9 11.3 11.4 11.1 7.10 11.8 11.5 11. a través de una gradiente de perturbación de la selva.11 Número de especies descritas en las principales categorías taxonómicas de plantas. Especie de bacterias formadoras de nódulos en leguminosas Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes.6b 11.7 11.1 5.1 1. Familia.1 8. en la provincia de Jambi del centro de Sumatra Composición química para aclarar y montar especímenes Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina Familias y valores cp utilizados para el índice de madurez Familias y valores cp utilizados para el índice fitoparasítico Filum/Orden.1 5.6a 11. biota del suelo y principales grupos funcionales a los que pertenecen Principales grupos funcionales de la biota del suelo Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo.2 1.1 11. labranza y deshierbe Clasificadores y atributos para el manejo de plagas y enfermedades. Género.Listado de tablas 1.1 11.3 6.2 11.1 3.2 4.

c) incrementando la replicación.5 2. 91 Esquema de alineación de monolitos complementarios de lombrices de tierra. 54 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. El muestreo se puede ampliar si se usa uno o dos transectos para termitas. dando un estimado pobre de la pendiente.1 2. 116 Sacabocados de metal.2 2. b) si se incluyen de manera deliberada valores de MOS más extremos.6 3. 81 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). para muestrear la mesofauna en la hojarasca y en el suelo mineral. 109 Esquema de una trampa pitfall con cebo. cuatro palitos pequeños y una cubierta de celofán. utilizando una pequeña cuchara o cuchillo de campo. 32 Principales grupos funcionales. 71 Ejemplos de diferentes configuraciones de ventanas de muestreo.4 3. utilizando permutaciones de datos al azar. hormigas y escarabajos. tres y dos ventanas. b) tres cuadrículas que muestrean tres diferentes parches de selva. 99 Ejemplo de curva de acumulación de especies con una desviación estándar. esto aumentará la precisión de la estimación de la pendiente.Listado de figuras 1.1 1. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. b) ilustración de la división de una cuadrícula entre seis.3 3. clasificados de acuerdo con dominios y reinos.3 2. 59 Esquema de muestreo por puntos para toda la biota.1 3. tamaños y procesos de ecosistemas relacionados. 77 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. d) reconociendo los límites como otra categoría.2 3. probablemente arrojará la mayoría de los valores de MOS cercanos a la media.6 3. utilizando un transecto de 50 m. 93 Separación a mano de lombrices de tierra en charolas de plástico. mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra. por estratificación.7 4. hormigas. con puntos de muestreo adicionales. 35 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula.2 2. estudiados en el proyecto CSM-BGBD. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado.5 3. hecha con un vaso. 70 Esquema alternativo para muestrear macrofauna.4 2. dispuestas a lo largo del gradiente. 148 . a) cuadrícula completa. 94 Extracción de termitas de una muestra de suelo en una charola de aluminio. b) se utilizan guantes como precaución contra enredaderas. 115 Trampa pitfall improvisada. arañas y otros artrópodos.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. según se requiera.

6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. 166 6.4 Embudo Berlese modificado.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) disolución seriada de la suspensión acuosa que contiene al hongo.3 Embudos Berlese llenos de suelo y hojarasca. fijadoras de nitrógeno en diversos sistemas de uso de suelo. c) larvas que muestran la patología típica de infección por nematodos. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa. 162 5. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. 282 10. 282 10.1 ml) en una caja Petri con medio de cultivo. creciendo en medio ADP.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas. c) incubación bajo condiciones controladas en una cámara DBO. 189 7.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos. 184 6.5 Equipo básico requerido para extracciones núcleo por núcleo Berlese-Tullgren.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos 165 5.3 Producción de acetileno en campo o laboratorio. 187 6. hecho de aluminio.1 Evaluación de bacterias formadoras de nódulos en leguminosas. b) muerte de nematodos en agua caliente.2 Cultivos purificados de Beauveria bassiana. d) almacenaje de conidios en tubos Eppendorf. 163 5.2 a) contenedor de apoyo para embudos Berlese–Tullgren.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. b) sistema Berlese– Tullgren en operación. 149 4. 166 5. 151 4. con embudo superior de 40 cm de diámetro.7 Charola con montajes permanentes de especímenes de nematodos.1 A la izquierda.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos.3 a) Nematodos recuperados mediante el lavado de malla de 400. Las cajas Petri no deben contener más de una tercera parte de líquido. suspensión de suelo en reposo. 284 . juego de tamices de metal (de malla de 45 arriba y de 400 abajo). y a la derecha. resumida en seis pasos. 152 5. d) emergencia de juveniles infectivos en la trampa White.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). 151 4. bajo condiciones de congelación. 180 6. 216 10. 163 5. b) inoculación de la suspensión (alícuota de 0.4. 165 5. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. de 50cm de altura.

3 Clasificación del uso del suelo en términos de la intensidad de uso. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. y presencia o ausencia del componente arbóreo.2.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural.11. 11. 322 324 325 . 11.

El conocimiento de esta biodiversidad se ha dejado de lado durante mucho tiempo por la dificultad para abordarla. Por otra parte. la fijación de nitrógeno. en términos generales. el ciclaje de nutrientes. las bacterias. termitas. N2O.Prólogo a la edición en español Este prólogo es el segundo elaborado para esta misma obra y se presenta para su versión en español. es decir. 13 . escarabajos y pequeños mamíferos. que pueden incorporar y asimilar estos conocimientos en beneficio de la biodiversidad del suelo. colémbolos y nematodos. pero ahora sabemos que interviene y participa ampliamente en los servicios ambientales que brinda el suelo: por una parte. la elaboración de la estructura del suelo y el mantenimiento del régimen hídrico la desarrollan los ingenieros del ecosistema. hongos y protozoarios y los reguladores biológicos como los ácaros. José Sarukhán. por la importancia que reviste su divulgación en un idioma que puede ser leído por un amplio grupo de países de América Latina. “¡Se sabe más de las estrellas que de los organismos del suelo!”. CH4) son realizados principalmente por el grupo funcional de los ingenieros químicos del ecosistema. fundador de la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad de México. la captura de carbono y la reducción de emisiones de gases traza (CO2. La biodiversidad del suelo alberga más del 25 % de la que existe en todo el planeta y. Como lo afirmó el Dr. es la que menos se conoce. hormigas. la sostenibilidad y el desarrollo de sus comunidades rurales. la regulación de la dinámica de la materia orgánica del suelo. que son las lombrices de tierra. Cabe mencionar que un tipo de organismo puede participar en varios grupos funcionales.

se requieren muchos años más de investigación taxonómica y funcional para comprender y manejar los procesos edáficos. silvícolas y ganaderas en el mundo. entendidas ahora bajo el concepto de calentamiento global. Durante años los estudios del suelo fueron enfocados al conocimiento de la física y química del suelo. La pérdida de la fertilidad. pesticidas y técnicas mecánicas de cultivo modifican fuertemente las condiciones originales del suelo. con repercusiones a nivel global. tanto del punto de vista morfométrico como molecular para lograrlo. particularmente en los ecosistemas tropicales. permite el control de plagas y fomenta la producción de las plantas y de los animales. que se encuentran entre los más afectados por la deforestación y el 14 Manual de biología de suelos tropicales . Ante este panorama. Y aunque es difícil cuantificar el valor económico de estos servicios. combinada con las necesidades alimenticias de una población humana en continuo crecimiento. que han sido desarrolladas y probadas en siete países y tres continentes.De manera global. el equilibrio y la funcionalidad de los suelos modificados por las prácticas agrícolas. las técnicas de muestreo y estudio de la materia orgánica y los organismos del suelo que permitan obtener información veraz. pues permitirán diseñar y establecer estrategias para mantener la sustentabilidad. el uso de fertilizantes. particularmente en las regiones tropicales. contribuye a nuestro alimento. fibra y combustible. Mientras leemos estas líneas. son fundamentales. sobre el verdadero impacto que están teniendo las prácticas de manejo. generan y provocan el avance de la frontera agrícola y la intensificación productiva. Este manual reúne técnicas de muestreo en campo. su biodiversidad. lo que visto desde el punto de vista antropogénico. pero su impacto y repercusiones sobre los procesos de funcionamiento. En este sentido. son grandes pero se desconocen en buena medida los mecanismos y procesos que se afectan. las condiciones de la biota del suelo continúan alterándose aceleradamente en todo el mundo debido a las actividades humanas. Y si bien se ha avanzado mucho al respecto. más aun. se reconoce la necesidad de estimular la formación de profesionales en taxonomía y sistemática de la biodiversidad del suelo. conocer y aprender a manejar dicha biodiversidad resulta fundamental para conservar o restaurar la fertilidad del suelo. reduciendo la materia orgánica contenida y alterando gravemente sus redes biológicas y funcionales. y se dejó de lado el estudio de la biología del suelo y. conservación y equilibrio del ecosistema. actualizada y rápida. esta biodiversidad le da estabilidad al paisaje. así como preservar y restaurar la fertilidad natural de los suelos. que se estiman en miles de millones de euros anuales.

estudiantes.C. sino constituir un apoyo en el camino hacia la sustentabilidad y la relación armónica entre el hombre y la naturaleza. La información contenida en este manual es útil para investigadores. las consecuencias de un mal manejo de suelos pueden provocar consecuencias dramáticas. inglés. lo que demuestra la mayor presencia y formación de especialistas nacionales preocupados por sus recursos naturales. incluso en plantaciones agrícolas con manejo de bajo insumos.cambio en el uso del suelo. profesores y profesionales involucrados en el manejo productivo de los suelos y también en su conservación. financiado por el GEF. mientras que al final se encuentra un capítulo integrador que permite relacionar los inventarios de los organismos del suelo con una clasificación del uso de suelo para estimar el impacto del manejo del suelo sobre su biodiversidad. para que su alcance e impacto sea más amplio. permitiendo llevar a cabo evaluaciones sobre la diversidad y salud del ecosistema que sirvan como base para el diseño de prácticas de manejo sustentables. por sus siglas en inglés) . Agradecemos a todos los especialistas que revisaron la traducción de los textos que correspondían a su especialidad y competencia. pues en este caso fueron probados. implementado por el PNUMA y ejecutado por el TSBF a nivel internacional y por el Instituto de Ecología A. portugués y español. Su elaboración tiene como finalidad no sólo ser una herramienta de utilidad en el trabajo técnico. La información de este manual se ha organizado de acuerdo con la funcionalidad de los grupos del suelo. Fondo para el medio ambiente. Cabe mencionar que la mayoría de los autores que colaboraron para desarrollar este manual residen justamente en países tropicales. mejorados y actualizados durante el desarrollo del proyecto Conservación y manejo sostenible de la biodiversidad debajo del suelo (CMS. Con esta versión en español. ahora este manual se encuentra disponible en tres idiomas. De manera especial queremos P rólogo a la edición en español 15 . Estas técnicas de muestreo básicas han demostrado ser poderosas herramientas para llevar a cabo investigación básica y aplicada. Al inicio del manual se incluyen dos capítulos que ofrecen una guía para establecer un método de muestreo representativo que permita evaluar y comparar la biodiversidad del suelo en diferentes sitios. en México.BGBD. Esto es así porque. generando información útil no sólo para investigadores o especialistas sino para toda persona interesada en el estudio de la conservación y la productividad del suelo. Las técnicas y métodos de muestreo presentados en este manual no constituyen sólo una recopilación de los procedimientos originales ya conocidos.

Isabelle Barois Boullard Coordinadora de la traducción y del proyecto CSM-BGBD en México 16 Manual de biología de suelos tropicales .agradecer al Instituto Nacional de Ecología. por su trabajo editorial y su paciencia ejemplar. y en particular a Raúl Marcó del Pont y su equipo.

Dicha intensificación es necesaria para asegurar el suministro global de alimentos. en la medida que esto ocurra. sólo en tiempos recientes se ha planteado que los suelos contienen un componente biológicamente activo. se enfatizó la importancia de la diversidad bajo suelo y se exhortó a abrir nuevas líneas de investigación multidisciplinaria. Sea como fuere. Una línea de investigación surgida a partir de entonces es la de cómo evaluar y manejar diversidad bajo suelo en sistemas de agricultura que faciliten la productividad agrícola y sustentabilidad de suelo a largo plazo. es el cambio de uso de suelo asociado a la intensificación agrícola. sin embargo. Este manual es. sin embargo. Mediante la aprobación de la Iniciativa Internacional para la Conservación y el Uso Sustentable de la Biodiversidad del suelo en la Convención sobre Biodiversidad Biológica. la mejor muestra –y la más actual– para poder evaluar la biodiversidad del suelo en ecosistemas que están siendo rápidamente alterados como consecuencia de los cambios en el uso del suelo. celebrada en el año 2006. los suelos en todo el mundo enfrentan una grave crisis. sin lugar a dudas. a su vez. Ante esta situación. la regulación biológica del suelo se verá afectada e incluso sustituida por fertilizantes y cultivos mecánicos. surge la gran necesidad de aplicar los conocimientos referentes al papel que desempeña la biodiversidad bajo suelo para su sustentabilidad.Prólogo Durante mucho tiempo la sociedad ha reconocido su dependencia respecto del suelo. Un aspecto a destacar del cambio global en las regiones tropicales. tiene como consecuencia 17 . Esto.

no solamente en regiones en vías de desarrollo. problema cuya solución implica un gran reto: ¿es posible. En última instancia. entonces. La relación entre la diversidad de especies y la diversidad funcional de la biota del suelo sigue siendo incierta. sino también en países de primer mundo. asociada a la deforestación y al proceso de Intensificación agrícola en los márgenes de los bosques. manejar la biodiversidad del suelo para poder incrementar la productividad agrícola en regiones que están siendo degradadas? La respuesta a esta pregunta atañe a toda la humanidad porque la tierra está siendo degradada. pero constituye uno de los principales objetos de investigación en todos los niveles. Dichos conocimientos son. así como la conservación de la biodiversidad en todo el mundo y no. El propósito de este manual es proveer de métodos estándares internacionales para el inventario de comunidades bajo suelo y la caracterización del uso de suelo en el trópico húmedo. en los trópicos. desde luego. Un metro cuadrado de bosque templado puede contener hasta mil especies de invertebrados y. un número mayor de diferentes tipos de microorganismos. Durante mucho tiempo los ecologistas han debatido sobre la importancia de la diversidad biótica del suelo: el secuestro de carbono en suelos. desde los invertebrados más grandes hasta las bacterias. La biodiversidad tropical ha sido subestimada y es posible que las verdaderas densidades de especies sean mayores que en otras latitudes. vitales para poder alcanzar la meta: productividad agrícola sustentable. El objeto explícito en este caso es práctico: proveer de una herramienta definitiva para establecer una línea de base y luego documentar la pérdida de biodiversidad de suelo. las relaciones entre la biodiversidad del suelo y la ocurrencia y magnitud de los procesos ecológicos son inciertas. además. en bioprospección y para promover mejoras sustentables en la pro18 Manual de biología de suelos tropicales . Del mismo modo. la reducción de las emisiones de gas invernadero.una reducción de la biodiversidad del suelo. estas herramientas pueden ser utilizadas para aprovechar los organismos del suelo en el manejo de los ecosistemas. únicamente. la capacidad de retención de agua del mismo. la provisión de nutrientes en las plantas y el control de patógenos en plantas como contribuciones específicas de los organismos del suelo a la fertilidad de éste. el mantenimiento de la estructura física del suelo. cubre casi la totalidad de la gama de biodiversidad biológica. por lo que representa el resultado publicado de más de una década de intensa discusión y un amplio trabajo de campo por parte de un gran número de expertos investigadores de muchos países. quizás. tanto en el laboratorio como en el campo.

Finalmente. también donde es necesario. Tal selección es inevitable cuando se trata del suelo. los métodos han sido desarrollados y monitoreados en condiciones de campo. manuales metodológicos de muestreo para organismos del suelo. no obstante. consecuentemente. dentro del alcance de la población que se encuentra relacionada con su productividad. Otro aspecto notable de este manual es que la biota del suelo está agrupada en ocho categorías. los métodos presentados en este manual contemplan también los ecosistemas terrestres en general. tanto nacionales como extranjeros. especialistas en agricultura y empleados técnicos de todos los niveles. considerado importante o esencial en la función del suelo y. Inevitablemente. sino también para biólogos en general. Muchas de las técnicas asociadas con una evaluación de diversidad dentro de grupos específicos microbianos han surgido a partir de P rólogo 19 . con cierta frecuencia. Durante los últimos cincuenta años se han publicado. sin embargo. especialmente en el caso de los pueblos más pobres del mundo. distribuidos en siete países y tres continentes. esto implica la reconciliación de los intereses y preocupaciones de los agricultores pobres. por lo tanto. por lo que algunos taxa han sido excluidos. En segundo lugar. En la medida de lo posible esto aplica a la identificación: las claves recomendadas son los más funcionales. Una de las más importantes es que la mayoría de los colaboradores pertenece a los países que se encuentran más afectados por la deforestación y el cambio en el uso de suelo. porque la verdadera biodiversidad es tan amplia que queda fuera del marco de cualquier sistema científico para que se pueda documentar totalmente. no obstante. el presente manual contiene notables diferencias respecto de los anteriores. pero que también corresponde a un grupo funcional mayor.ducción agrícola. se aconseja referir los especímenes a especialistas. cada una con amplia identidad taxonómica. los autores han incluido la revolución en metodología molecular que ha incursionado en las ciencias biológicas durante los últimos diez años. ofrece la ventaja de traer consigo los medios para poder hacer una evaluación aproximada de la salud del suelo. los objetivos nacionales de desarrollo y calidad de nuestro ambiente. a muchos servicios ambientales que los suelos proveen. El proceso responde a una necesidad selectiva. son de interés no sólo para expertos en taxonomía. en doce localidades como puntos de referencia. representan a instituciones académicas y gubernamentales en las que se requiere poner en práctica nuevas políticas para el manejo del suelo que han de ser validadas. si es que aún estamos a tiempo de parar la pérdida de la biodiversidad tropical.

discusiones entre colaboradores y durante talleres específicamente pensados para la publicación del presente manual. Diana H. Wall Natural Resource Ecology Laboratory Colorado State University Mayo de 2008 20 Manual de biología de suelos tropicales .

Este proyecto es ejecutado por el Instituto de Biología y Fertilidad del Suelo Tropical (TSBF). El proyecto se lleva a cabo en México. al (TIGER). India e Indonesia. El proyecto se inició en 2002 con el objeto de generar información y conocimientos que puedan ser utilizados para un mejor manejo y conservación de la BGBD en espacios de agricultura tropical. que permitan la comparación de resultados de inventario en áreas específicas de países tropicales con validez científica y estadística. y para su puesta en marcha. Costa de Marfil. El manual describe métodos de muestreo y laboratorio para evaluar la biodiversidad de una gama de grupos funcionales básicos de biota de suelo. institución que pertenece al Centro Internacional de Agricultura Tropical (CIAT). para mantener la productividad agrícola y reducir la extensión de la agricultura en paisajes naturales. sobre todo. Kenia. al NERC por el Reino Unido (UK). y.Prefacio Este manual es uno de los resultados del proyecto PNUMA/GEF “Conservación y Manejo Sostenible de Biodiversidad Bajo Suelo” (CSM-BGBD) que surge como respuesta a la necesidad de crear métodos estándares e instrucción práctica para el inventario de la biodiversidad bajo suelo. recibe apoyo para su financiamiento del Fondo Global del Medio Ambiente (GEF por sus siglas en inglés). constituye una actualización de los métodos y protocolos que fueron inicialmente propuestos por investigadores afiliados al Instituto de Biología y Fertilidad del Suelo Tropical del CIAT. a la Red de Macrofauna financiada por la Unión Europea (EU). Brasil. del Programa de Naciones para el Medio Ambiente (PNUMA/UNEP). Uganda. asimismo. al PNUD/ 21 .

por parte de la UNESCO. India 2005. dentro del alcance de laboratorios nacionales. Países Bajos). hongos entomopatógenos. en el de 2004 (Embu. diciembre 2004. HMA y Ectomycorrhiza. lombrices de tierra. Hall. Indonesia) y. 2003 (Sumberjaya. Los métodos para una evaluación de biodiversidad de suelo fueron descritos en el ASB (Nota de Lectura 6B). Los métodos estándares propuestos contienen avances tecnológicos recientes en genética molecular. al programa DIVERSITAS. saprófitos y patógenos y una amplia gama de artrópodos mayores. la gama completa -geográfica y biogeográfica.dentro del trópico húmedo. editado por Swift y Bignell (2001). Kenia. Los métodos fueron discutidos y posteriormente perfeccionados en reuniones anuales celebradas entre los años 2002 y 2005. al igual que en varios talleres temáticos de taxonomía específica (técnicas moleculares con énfasis en T-RFLP. elaborado por Anderson e Ingram (1993). S. febrero 2005. Manaus. una evaluación de la diversidad de especies resulta un proceso poco práctico. Nairobi. provee detalles adicionales en el caso de grupos funcionales específicos: como el uso de trampas Winkler para hormigas y trampas Pitfalls para escarabajos en muestras de hojarasca. También cubre. Una 22 Manual de biología de suelos tropicales . o la actualización de métodos para evaluar la diversidad de nematodos. octubre 2003). cuya evolución se muestra en los reportes de 2002 (Wageningen. Londrina. en términos de grupos funcionales. Cali. como es el caso de aquéllos que se refieren a la mesofauna. en donde también se habla del principio de grupos funcionales del inventario de organismos de suelo. Brasil mayo/2004 y Nairobi. editado por G. Colombia. al igual que métodos que no han sido considerados en las publicaciones mencionadas. Kenia). Dado que muchas especies aún son desconocidas o no se han descrito. Los métodos para algunos de los grupos funcionales de organismos de suelo fueron incluidos en un manual pionero.UNDP-GEF con el apoyo financiero destinado al Proyecto Alternativas de RozaTumba-Quema (ASB). termitas y hormigas. en su caso. Brasil. y en varios talleres llevados a cabo desde el inicio del proyecto. ampliamente. tales como el registro de huellas genéticas del BFNFNL. bacterias formadoras de nódulos en leguminosas (BFNFNL) y sus plantas hospederas. además. termitas. Los métodos que se describen en este manual reflejan una amplia gama de actividades del proyecto CSM-BGBD. Ésta fue la contribución. Bangalore. La definición de métodos estándares aprovecha la experiencia obtenida con la implementación de los métodos utilizados en los siete países participantes en el proyecto. agosto 2004. en especial. Un manual formal de técnicas para organismos de suelo y organismos que viven en agua dulce y sedimentos marinos fue publicado en 1996.

sin embargo. dejándolo como estaba antes de ser alterado. Al mismo tiempo. tenga implicaciones en la BGBD. Para responder a algunas de las preguntas mencionadas se requiere: P refacio 23 . Además de estos efectos. hay otros asociados con un incremento en la intensidad del uso de suelo. como consecuencia del labrado o del creciente uso directo de agroquímicos. restablecer la BGBD no implica precisamente devolver los servicios del ecosistema. Es por esto que el control de la erosión y la rehabilitación de suelos fuertemente erosionados deberá considerarse parte de las estrategias para conservar y sustentar un buen manejo de la BGBD. de manera que causará un impacto inmediato en la BGBD que fácilmente se antepondrá al efecto combinado de todos los factores mencionados. Quedan muchas interrogantes en cuanto al manejo de BGBD. llega a influir sobre la abundancia y diversidad de dichos organismos. La premisa es que la diversificación agrícola (en varios niveles) genera biodiversidad en el suelo y que la producción agrícola sustentable (en los márgenes de la selva tropical) se mejora significativamente. La conversión de uso de suelo y la intensificación de su uso. frecuentemente provocan una reducción de materia orgánica del suelo que forma el sustrato básico para la mayoría de los organismos que en él habitan y. así. esto se traduce en una alteración del suelo como hábitat. interpretar esos procesos en el contexto ecológico. en contra de una productividad sustentable. estos cambios de uso de suelo. Aun si se pudiera regresar a sus condiciones originales. Además. La mayoría de los organismos del suelo se encuentran en los primeros 20 centímetros de su perfil. Los efectos en BGBD son condiciones compuestas por el medio ambiente y por características físicas y químicas del suelo (por ejemplo: pH. provoca una pérdida de servicios del ecosistema. la erosión puede llegar a nulificar todos los demás procesos degenerativos. La hipótesis actual es que una intensificación en el uso de suelo trae consigo una reducción de la biodiversidad del suelo y a su vez. así se podrían entender las consecuencias de una pérdida en el BGBD y. generalmente. no necesariamente se lograría restaurar la BGBD. nivel de nutrientes y densidad). que se espera. por lo tanto.mejor opción sería investigar la pérdida de grupos funcionales básicos dentro de la BGBD que muestran un cambio en el uso de suelo o una intensidad del mismo. poco se sabe de las relaciones entre ambos factores o sobre los mecanismos por los cuales ocurren cambios en la BGBD. van acompañadas por reducciones drásticas en la diversidad de plantas. por lo tanto. la erosión del suelo significa la más catastrófica de las alteraciones.

International Centre for Research in Agroforestry.pdf. G. M. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. E. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. experimental o de muestreo) hasta un paisaje natural. Se espera que los métodos descritos en este manual sean útiles para el diseño y la ejecución de estudios para inventario y monitoreo de la BGBD en todos los niveles. CAB International. Fátima M. Hall. y observar cómo esta relación se modifica y se altera por las condiciones prevalecientes en el medio ambiente (incluyendo condiciones de suelo). • Establecer una relación entre la biodiversidad de la superficie y bajo del suelo en los actuales y alternativos sistemas de uso de suelo. desde una parcela (agrícola. J. 2nd edition. 24 Manual de biología de suelos tropicales . Jeroen Huising y David. mediante la introducción y/o manejo de biota de suelo (se experimenta con varios manejos alternativos). S. S. I. E. South East Asian Regional Research Programme. M. www. caracterizada por un cultivo continuo y un elevado uso de químicos y mecanización. e Ingram. Moreira. desde bosque natural hasta agricultura de monocultivo. Bignell ReFERENCIAS Anderson.• Una caracterización de la biodiversidad del suelo en un amplio rango de uso de suelo de varias intensidades. Indonesia. CAB International. D.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. S. J. (ed) (1996) Methods for the Examination of Organismal Diversity in Soils and Sediments. • Identificar “puntos de entrada” para mejorar el manejo de la tierra. Swift. ASB Lecture Note 6B. Wallingford. Wallingford.fao. un conocimiento más amplio de prácticas existentes y un uso más efectivo de tecnologías disponibles que no requieran altos insumos. y Bignell. Estos “puntos de entrada” pueden incluir un mejor entendimiento del uso de prácticas indígenas. Bogor.

Lista de acrónimos y abreviaturas AC ADP AFLP AHM AM ANOVA ARISA B BFNFNL cPCR CSM-BGBD BGBD DGGE ea EBI ERA FID FURB GEF Análisis de correspondencia Agar dextrosa y papa Polimorfismo en el tamaño de fragmentos amplificados Agar con harina de maíz Agar extracto de malta Análisis de varianza Análisis automatizado del espaciador intergénico ribosomal Bacteriófagos Bacterias fijadoras de nitrógeno. formadoras de nódulos en leguminosas Reacción en cadena de la polimerasa competitiva Conservación y Manejo Sustentable de Biodiversidad Bajo Suelo Biodiversidad Bajo Suelo Electroforesis en gel con gradiente de desnaturalización Equivalente de ácido European Bioinformatics Institute Ensayo de reducción de acetileno Detector de ionización de flama Universidade Regional de Blumenau Global Environment Facililty 25 .

GF HMA ia ICRAF IFP IM INPA ITS KOH LCCS M MAS MOS NCBI Nd NMP P Pc PCA PCR PFGE PNUMA PP RAPD Rep-PCR RFLP RIA SR SSCP TGGE TRF T-RFLP TROF TSBF-CIAT 26 Grupo funcional Hongos micorrizógenos arbusculares Ingrediente activo World Agroforestry Centre Índice fitoparasítico Índice de madurez National Institute for Amazonian Research (Instituto Nacional de Pesquisas da Amazônia) Espaciadores de trascripción interna Hidróxido de potasio Sistema de clasificación de cobertura de suelo Micófagos Muestreo aleatorio simple Materia orgánica del suelo National Center for Biotechnology Information Nivel de dilución Número más probable Perturbación Porcentaje de colonización Análisis de componentes principales Reacción en cadena de la polímerasa Electrofóresis en campos pulsados Programa de las Naciones Unidas para el Medio Ambiente Parásitos de plantas DNA polimórfico amplificado al azar De fragmentos repetidos palindrómicos-éxtragenicos Polimorfismo de longitud de fragmentos de restricción Resistencia intrínseca a los antibióticos Sensores remotos (imagen) Polimorfismo de conformación de cadena sencilla Electroforesis en gel con gradiente de temperatura Fragmentos de restricción terminal Polimorfismo terminal de la longitud del fragmento de la restricción Árboles en finca Tropical Soil Biology and Fertility Institute of the International- Manual de biología de suelos tropicales .

UC UFAM UFC UFLA UFMG UnB VA VB Center for Tropical Agriculture Unidad de colonización Universidad Federal de Amazonas Unidades formadoras de colonias Universidad Federal de Lavras Universidad Federal de Minas Gerais Universidad de Brasilia Volumen alto Volumen bajo A crónimos y abreviaturas 27 .

.

1998.000 en el caso de procariontes.1 se enlistan los principales fila de organismos eucariontes y procariontes que son o pueden ser representativos en la comunidad del suelo. Moreira et al. Lavelle. Swift. La clasificación taxonómica de organismos vivos aún se encuentra en una situación polémica (Margulis y Schwartz. 2005. con más de 1.5 millones de especies de eucariontes y con una riqueza de especies estimada muy por encima de 10.Estos procesos apoyan a los servicios del ecosistema. contri29 . Fátima M. Jeroen Huising Organismos y servicios del ecosistema del suelo El suelo es un hábitat que alberga una amplia gama de organismos dentro de los tres dominios taxonómicos (sensu Woese et al. Ya que no es ni práctico ni coherente tomar en cuenta todos los organismos presentes. Sin embargo. 2004).. Brussaard et al. Wall. la biota (relativa a agentes no bióticos y entre ellos mismos) será evaluada por su contribución relativa a los procesos del ecosistema (sensu Daily. cuando se hace una evaluación biológica de la salud de los suelos (Lawton et al. 1998.Capítulo 1 El inventario de la biodiversidad biológica del suelo: conceptos y guía general Mike J. 1997. cualquiera que sea el sistema de clasificación utilizado. 1996. 1979. Bignell. especialmente cuando se trata de los taxa a ser creados en altos niveles y los números de tales categorías altas (como reinos) a ser consideradas. 2004. 1990) y muchos fila. Moreira y E. Wall.. David E.2004). Cavalier-Smith. En la Tabla 1. 2006).. 1998). 1997. S.. la diversidad de la biota del suelo es elevada en todos los niveles de análisis (véase Swift et al.. Bardgett.

000–40.000 cochinillas) Filum Mandibulata (Artropoda) Grupo funcionalb 1 1 1 1 1 1 1 1 1 2.4 muy raro en el suelo 3.000 Filum Crustacead [>6 clases] 25.000 Monocotiledoneas 65.000 Filum Mollusca 35. 4 4 común localmente 5 - 30 Manual de biología de suelos tropicales .000 >10 millones Reino Animalia [37 fila] 750 Filum Tardigradad (osos de agua) d 99.000 Reino Plantae [12 fila] Filum Bryophyta (musgos) 10.000 Filum Annelidad (lombrices segmentadas) Clase Polychaeta 9.1 Número de especies descritas en las principales categorías taxonómicas de plantas.000 Clase Malacostracad (incluye orden Decapoda con un esqueleto externo calcificado) Orden Isopoda (ácaros de la madera y >11.000 Filum Cycadophyta (gimnospermas) 185 Filum Coniferophyta (gimnospermas) 550 Filum Gnetophyta 70 Filum Anthophyta (angiospermas) 235.4 2.000 Clase Gastropodad (incluye babosas y caracoles) 18.800 y Enchytraeidae) Clase Hirudinea (sanguijuelas) 500 45.000 hepáticas) Filum Filicinophyta (helechos) 12.000 Filum Hepatophyta (plantas 6.Tabla 1.000 Clase Oligochaeta(lombrices de tierra 8.000 Dicotiledoneas 130. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Dominio Eucarionte 255. biota del suelo y principales grupos funcionales a los que pertenecen.

000 Orden Dermaptera (tijerillas) 1.162 ciempiés) Clase Diplopoda (milpiés) 10. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Subfilum Hexapoda (Insectos) >900. 9 2. grillos.1 Continúa. 4 2. 9 2.000 Orden Coleoptera (escarabajos) >350. 7.) Orden Trichoptera 12. 180. abejorros) Familia Formicidae (hormigas) 11.826 Orden Lepidoptera (mariposas. 9 3.000 abejas.500 Orden Diplura (doble cola) 659 Orden Protura 500 Subfilum Myriapoda (milpiés y 15. 7 4.500 Clase Symphyla 200 Clase Pauropoda 700 El Grupo funcionalb 4 4. avispas.000 etc. peri55.000 Orden Collembola (colémbolos) 7. >125. 6. 6.000 Clase Chilopoda (ciempiés) 2.000 quitos. 23. 6 4.000 gegenes. 4.800 Orden Orthoptera (saltamontes. pulgones. 6 2. mosquitos. 6 2. 9 2.000 Suborden Homoptera (cigarras. 3. 9 6 2. 9 4.000 langostas) Orden Thysanoptera (trips) 6. 9 2. escamas) Suborden Heteroptera 25. 9 2.6 4 2. 7 31 inventario de la biodiversidad biológica del suelo .9 Sólo en la rivera 4.000 Orden Isoptera (termitas) 2. afidos. 115. 4. 7 2.800 Orden Hemiptera (chinches) >80.Tabla 1.000 Orden Archaeognatha (pececillos de 350 cobre ó bristetails) Orden Thysanura 700 Orden Blattoptera (cucarachas) 4. 4.000 Orden Diptera (moscas. mosquitos pequeños) Orden Hymenoptera (hormigas. polillas. 9 2.

lombrices enterobius. lom15.7 7 1. 9 2. 7 1 5.000 briz redonda. incluidas planarias) Número sin Reino Protoctistac [30 fila] determinar Filum Rhizopoda (amibas) Número sin determinar 4000 Filum Dinomastigotad (dinoflagelados) Filum Ciliophora (ciliados) 10.000 Filum Discomitochondria (flagelados 800 y zooflagelados) 10. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos critas en el taxón (todos de organismos de suelo/nombre los hábitats) común Subfilum Cheliceratad [3 clases] >100. garrapatas) 45.000 Filum Diatomacead (diátomos) Filum Oomycota (Oomycetes) Cientos Filum Rhodophyta (alga roja) 4. alfilerillos) 25.455 Orden Palpigradi (micro-escorpiones) 80 Orden Acari (ácaros.100 Grupo funcionalb 6 2. 6.000 Order Scorpionida (escorpiones) 2000 400 Filum Gastrotrichad (gastrotricha) d 1000 Filum Acanthocephala (lombrices con cabeza espinuda) 2000 Filum Rotiferad (animales de ruedas) 900 Filum Nemertinad (gusanos planos) Filum Nematoda (nematodos.000 Filum Plathyheminthesd (Helmintos.1 Continúa. 4. 9 1 32 Manual de biología de suelos tropicales . 9 6 6 6 7 Parásitos artrópodos 4.235 (Pseudoescorpiones) Orden Araneae (arañas) 40. 7. 7. 6.000 Clase Arachnida [11 órdenes] 93.6 7 1.Tabla 1. 7 Muy raros en suelo 2.000 Orden Pseudoscorpionida 3.

1996. 9.Tabla 1. desde el más bajo hasta el más alto nivel: dominio.000 >344f >8.342.. 2008). Procariotas (Dominio Archaea y Bacteria). b) Grupos funcionales.nlm. clase. (1990). respectivamente. 8 5. por su influencia en la calidad y salud del suelo (Hoavelle. 1997.Grupo funcionalb critas en el taxón (todos los hábitats) 16.nih. Clasificación.9 5 5. e) Rappé y Giovannoni (2003). género y especies. (2006).000 1. 8. buyendo al mantenimiento y a la productividad de los mismos. Hongos de acuerdo con James et al.000 1. familia. filum.. orden.1 Continúa. 10 Nota: a) Considerando las categorías taxonómicas.250 >30. consultado el 13 de mayo de 2007).gov. 5. 2006. de acuerdo con Woese et al. excluyendo organismos no clasificados. c) Considerados por algunos autores como Protistas o Protozoos y Chromistas. 1998. Kibblewhite et al. reino. Brussard et al. f) National Center for Biotechnology Information: (www. Categorías taxonómicasa (número total de fila existentes) ejemplos de organismos de suelo/nombre común Filum Chlorophyta (alga verde) Reino Fungi [6 fila] Filum Microsporídia Filum Chytridiomycota (Hongos quitridios) Filum Zygomycota (mohos) Filum Glomeromycota (hongos micorrízicos arbusculares) Filum Basidiomycota (incluidos hongos y algunas levaduras) Filum Ascomycota (incluidas levaduras) Dominio Archaead [4 fila] Dominio Bacteriad [52 fila]e Número de especies des.. 8 5.2 (de este capítulo). sin cultivo y no especificados.500 1.ncbi. de acuerdo con la Tabla 1. d) Incluye organismos acuáticos y del suelo..100 204 >22. Reinos de Eucariotas clasificadas de acuerdo con Margulis y Schwartz.000 >70.398f 1 sólo parásitos 5. Fuente: Moreira et al. Dichos procesos pueden ser agrupados de acuerdo a cuatro funciones agregadas del ecosistema: El inventario de la biodiversidad biológica del suelo 33 . 8 10 1. cuando éstos se incluyen. la riqueza correspondiente arrojará 3090 y 79.

es decir. principalmente como CO2 o CH4. siempre que no se incluya a los ingenieros del ecosistema (véase más abajo). milpiés. y dispersan los propágulos microbianos. el paso que marca la operación del proceso se determina mediante micropredadores. lombrices de tierra y termitas.1. Ciclo de nutrientes. que no dependen directamente de la materia orgánica como fuente de alimento. estabilidad del suelo. sin embargo. nematodos. aunque el atributo “transformadores de hojarasca” es el más utilizado hoy en día para describirlos. Bioturbación. los microorganismos y los animales involucrados se llaman “descomponedores”. agregados y montículos. estabilidad de agregados 34 Manual de biología de suelos tropicales . colémbolos y ácaros. en gran parte realizada por animales del suelo como ácaros. el carbono orgánico es liberado en la atmósfera. Las raíces de plantas. lombrices de tierra. pero también es incorporado en diferentes reservorios en forma de materia orgánica (MOS). Estos procesos de “bioturbación” influyen y determinan la estructura física del suelo y la distribución de materia orgánica del suelo. hormigas y algunos otros de la macrofauna del suelo. poros. Algunos grupos de bacterias del suelo están involucrados en transformaciones elementales autotróficas. es esencial para todo tipo de agricultura y silvicultura. aunque en un tipo de suelo y medioambiente determinados existe un equilibrio entre el contenido del MOS y las entradas y salidas de carbono en el sistema. estos grupos son afectados indirectamente por factores como el contenido de agua. sin embargo. La descomposición de materia orgánica. Estas fracciones de MOS varían en su estabilidad y longevidad. drenaje. 2. crean y modifican microhábitats para otros organismos más pequeños y determinan propiedades del suelo como aireación. los cuales trituran los residuos de plantas y animales. y moviendo partículas de un horizonte a otro. Así. termitas. 3. Aquí también los microorganismos son mediadores de la mayor parte de las transformaciones. se mantienen físicamente activos dentro del suelo formando canales. porosidad y contenido de carbono. Juntos. El ciclo de nutrientes. tales como protoctistas. que ocurre principalmente por actividad enzimática de bacterias y hongos. Como resultado de la descomposición. Animales más grandes mejoran algunos procesos porque proveen nichos para un crecimiento microbiano dentro de sus intestinos o excremento. por la biota del suelo. mediante la formación de asociaciones simbióticas como las micorrizas y la fijación de N2 en nódulos de raíces. lo que controla el resto de la biota. Microorganismos específicos del suelo también incrementan la cantidad y eficiencia de absorción de nutrientes por la vegetación. estrechamente asociado con la descomposición orgánica.

A este conjunto de organismos. Lavelle et al. en el cambio climático. pero tales epidemias sí son comunes en la agricultura. Para poder interrelacionar El inventario de la biodiversidad biológica del suelo 35 . La bioturbación juega un importante papel en la regulación del equilibrio del agua en el suelo (infiltración. y también una amplia variedad de interacciones antagonistas microbianas.. basándose en la función particular que desempeñan o en el proceso específico del suelo del que son mediadores. se le ha denominado “ingenieros del ecosistema del suelo” (Stork y Eggleton. capacidad de almacenaje y drenaje) y tiene una fuerte influencia sobre la susceptibilidad a la erosión. Jones et al. Especialmente. y hasta humanos. debe hacerse notar que la interacción entre la descomposición de materia orgánica. por lo tanto. La Figura 1. Los organismos del suelo juegan un papel importante en la regulación de la composición atmosférica y. que incluyen microbívoros y micropredadores que se alimentan de las plagas microbianas y de animales.. todos los organismos enlistados.1 muestra la contribución de la biota del suelo a servicios ambientales. 1992. hongos y animales invertebrados capaces de invadir plantas y animales. CH4. En ecosistemas naturales. brotes intensivos de enfermedades en el suelo y plagas. 4. En suelos saludables.y capacidad de retención de agua. son relativamente raros. Enfermedades y control de plagas. bacterias. respectivamente. debido a una diversidad biológica disminuida y/o en cambios ambientales del suelo. La estructura y las propiedades del suelo también están influenciadas por la producción de excretas de animales. como resultado de los procesos anteriores. 1994. este rango de interacciones puede encontrarse reducido. incluyendo complejos organominerales estables durante meses o periodos más largos (Lavelle et al. y de causar enfermedades y muerte. tales como los causados por un contenido de MOS más bajo. La biota del suelo incluye un amplio rango de virus. 1997).. como miembros de la comunidad del suelo. por tanto. 1997). las actividades de plagas potenciales y patógenas son reguladas por interacciones con otros miembros de la biota del suelo. NOX. bioturbación y ciclo de nutrientes determinará el equilibrio entre la cantidad de carbono secuestrado en el suelo (véase arriba) y entre las emisiones de gases invernadero (principalmente CO2. En los agroecosistemas. N2O). Grupos funcionales de la biota del suelo En principio. pueden ser asignados dentro de una o más de las cuatro categorías funcionales genéricas descritas.

Fuente: Kibblewhite et al.. Ciclaje de nutrientes Transformadores de nutrientes: Descomponedores Transformadores de elementos Fijadores de nitrógeno Micorrizas Ingenieros del ecosistema: Megafauna Macrofauna Hongos Bacteria Biocontroladores: Predadores Microherbívoros Hiperparásitos Figura 1. 2008 Servicios agrícolas Procesos de entrega basados en el suelo Alimentos y fibras Captura y ciclaje de nutrientes Descomposición de la MO adicionada Dinámica de MOS Mantenimiento de la estructura del suelo Regulación de la población biológica Manual de biología de suelos tropicales Servicios no agrícolas Calidad y suministro de agua Control de erosión Regulación de la composición atmosférica y del clima Degradación y disminución de contaminantes Control de enfermedades y plagas no agrícolas Conservación de la biodiversidad .36 Funciones agregadas del ecosistema 1. Transformaciones C Ensamblaje funcional Descomponedores: Hongos Bacterias Microherbívoros Detrívoros Procesos de entrega basados en el suelo Mantenimiento de la estructura del suelo Ciclaje de nutrientes Mantenimiento de la estructura del suelo Dinámica de la MOS Descomposición Ciclaje de nutrientes Regulación de población biológica Provisión de hábitat Regulación de población biológica 4.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. Regulación de la población biológica 3. Mantenimiento de estructura del suelo 2.

que incluyen minadores de hojas y de tallos. 1998) pero también calificado en función de la respuesta fisiológica. ni de cuántos de estos grupos deberán definirse dentro de un ambiente de suelo típico. Microrreguladores (microfauna como nemátodos): animales que regulan ciclos de nutrientes mediante forrajeo y otras interacciones con los microorganismos descomponedores. 1998) es necesario tomar en cuenta el concepto de grupos funcionales básicos. Esta actividad puede ocurrir a varias escalas espaciales. por lo tanto. 7. No existe acuerdo preciso en la definición de grupos funcionales.organismos específicos del suelo (biodiversidad colectiva) con las categorías genéricas funcionales y. translocando compuestos orgánicos sintetizados arriba del suelo. el Tabla 1. y que son los responsables de la mayor parte del flujo de energía en la red alimenticia de los descomponedores. Predadores (mucha macrofauna y mesofauna): animales que regulan a los herbívoros. también de acuerdo con sus características taxonómicas. muchas hormigas. 3. 6. de comportamiento bioquímico o ambiental y.. por ejemplo. morfológica. normalmente definido por criterio trófico (Brussaard. ingenieros del ecosistema. 1. 5. El inventario de la biodiversidad biológica del suelo 37 . Microsimbiontes (hongos micorrícicos.2 Principales grupos funcionales de la biota del suelo. descomponedores y microrreguladores por depredación. rizobia): microorganismos asociados con raíces que facilitan la absorción de nutrientes. 4. de alguna manera. y chupadores de sabia. Transformadoras de hojarasca (mucha macrofauna y mesofauna. en última instancia. Descomponedores (hongos o bacterias degradadores de la celulosa): microorganismos que poseen las enzimas polímero-degradadoras. 8. incluyendo el ciclaje de nutrientes. haciéndolo más accesible para los descomponedores o favoreciendo el crecimiento microbiano de excretas en forma de gránulos. Productores primarios (plantas superiores e inferiores): organismos fotosintéticos que asimilan bióxido de carbono del aire y penetran en el suelo mediante sistemas de raíces. transformadores de hojarasca. Ingenieros del ecosistema (macrofauna como termitas y lombrices de tierra): organismos que causan un impacto físico mayor en el suelo mediante su transporte. Herbívoros: animales que consumen y parcialmente digieren tejidos vivientes de plantas. construcción de estructuras agregadas y formación de poros. Pueden incluir predadores. con los servicios del ecosistema (Setäla et al. 2. alguna microfauna): invertebrados que se alimentan de desechos orgánicos originados por microbios y por trituradores de este material.

Los grupos taxonómicos propuestos a continuación son seleccionados de acuerdo con su significado funcional diverso. también es importante buscar dentro de los grupos funcionales para descubrir los taxa que alcancen el criterio de ser considerados como ingenieros del ecosistema (sensu Jones et al. Éstas están representadas formalmente en la Tabla 1. 2003). plagas) especies de control biológico también pueden incluirse (ej. existen pocos estudios sobre la salud del suelo agrícola. enlistadas en la Tabla 1. no obstante. no relacionados. en cuanto a la fertilidad y calidad del suelo. 10. Véase que algunos grupos funcionales incluyen una amplia gama de taxa relacionados y.2 y se usan para anotar las categorías taxonómicas. 1994) y especies clave (sensu Davic. 9. Grupos selectivos de biota de suelo En el diseño de trabajo de campo. en donde el espectro taxonómico completo ha sido objeto de un muestreo representativo en el mismo lugar y al mismo tiempo (Bignell et al. al mismo tiempo.. invertebrados. Éstos son grupos taxonómicos que fueron tomados en cuenta en el proyecto Conservation and Sustainable Management of Below-Ground Biodiversity (CSM-BGBD). cuyos métodos de inventario y caracterización se describen en los siguientes capítulos. 38 Manual de biología de suelos tropicales . incluya todos los grupos funcionales considerados como importantes.2 Continúa. no obstante. existe un argumento válido que establece por lo menos diez categorías. Plagas y enfermedades del suelo (hongos patógenos. La importancia funcional de cualquier especie o de grupos de especies. S o P (nitrificación y fijación de nitrógeno). probablemente se relaciona con su abundancia relativa y con la biomasa. mientras que otros son muy específicos en cuanto a su taxonomía. a veces. concepto es heurístico y puede modificarse en función del propósito analítico necesario.1. (razón por la cual se emplea el término “taxa seleccionado”) y por su facilidad relativa a ser muestreado.. aislado e identificado (Figura 1. Transformadores procariontes: Archaea y bacterias que transforman de manera específica el carbono (metanotrofa) o elementos nutricionales como N. parasitoides e hiperparásitos de plagas y enfermedades). 2005).: depredadores.2). Por esta razón y porque muchos componentes de biota de suelo son taxonómicamente difíciles de identificar. uno de los principales desafíos es seleccionar un subgrupo de la biota del suelo que refleje adecuadamente el espectro taxonómico anticipado y que.Tabla 1.

MACROFAUNA Lombrices de tierra I Escarabajos Otros Hormigas Termitas Diversidad y biomasa alta Diversidad alta Ingenieros del ecosistema. especialmente protoctistas Archaea y Bacteria El inventario de la biodiversidad biológica del suelo 39 .0 mm. nematodos y protoctistas pueden considerarse como componentes de la microbiota general. transformadores de hojarasca. clasificados de acuerdo con dominios y reinos. estudiados en el proyecto CSM-BGBD. macropredadores ANIMALES. trituradores de hojarasca. trituradores de hojarasca.transformadores de hojarasca plantas HONGOS Y BACTERIAS MUTUALISTAS Hongos micorrizógenos Bacterias formadoras de nódulos en leguminosas Omnipresentes con especificaciones típicas de variedad de hospederos (a varios grados) III Omnipresentes Microsimbiontes mejoran la absorción por la raíz y la fijación de nitrógeno Hongos saprotróficos. mesofauna 0. tamaños y procesos de ecosistemas ANIMALES. Por su parte. y microfauna <0. transformadores procarióticos.0 mm.1 mm. antagonistas. patogénos y antagonistas IV Omnipresentes con diversidad alta indeterminada Descomponedores. patógenos.Figura 1. un grupo que incluye muchos organismos con papeles especiales y una diversidad de descomponedores genéricos MICROBIOTA GENERAL Microfauna. promotores de crecimiento Nota: la fauna se clasifica de acuerdo con el ancho de cuerpo: macrofauna >2.MICROFAUNA Y MESOFAUNA Nematodos Ácaros Colémbolos Otros Biomasa alta II Alta diversidad y biomasa Micropredadores.1-2. parásitos de Micropredadores.2 Principales grupos funcionales.

por ejemplo. varios de estos grupos taxonómicos son muy importantes por sí mismos como contribuidores a la diversidad biótica en general. c) el control biológico como depredadores. arácnidos grandes y otros tipos de insectos). Enchytraeidae. 5 Microfauna: nematodos y protoctistas que. 3 Otra macrofauna: cochinillas (Isópoda). la distribución geográfica. En este contexto. de la mesofauna. en los que viven dependientes de películas de agua. al cavar sus túneles y mediante la ingestión de materia mineral y orgánica. nematodos y. a) influyen en la tasa de recambio por su papel como forrajeros de raíces (parásitos de plantas).1). lombrices de tierra. de esta manera contribuyen en procesos orgánicos de trituración a pequeña escala y ejercen un importante papel regulatorio dentro de la biota del suelo. también representan factores de interés y preocupación. hormigas y escarabajos que intervienen en: a) la porosidad y la textura del suelo. la trituración y digestión de materia orgánica. protoctistas. b) el ciclo de nutrientes. b) ocupan espacios que existen en pequeños poros. hormigas. y la pérdida de especies endémicas. arañas. que intervienen en la porosidad del suelo y en sus nutrientes. e) 40 Manual de biología de suelos tropicales . a escala pequeña. probablemente. escarabajos. c) normalmente representan una riqueza genérica y de especies muy alta d) juegan un papel importante en la regulación de abundancia y actividad microbiana. Algunas especies también resultan perjudiciales porque se convierten en plaga. por ejemplo. la introducción de especies exóticas e invasivas. al construir galerías y al cavar túneles e ingerir suelo. omnívoros y depredadores. microfauna y microsimbiontes. Algunas especies de ácaros y formas de larvas de muchos artrópodos de suelo son lo suficientemente pequeñas como para clasificarse dentro de la microfauna. 4 Mesofauna: colémbolos y ácaros que actúan como transformadores de hojarasca y micropredadores (forrajeros de hongos. micófagos.Además. bacteriófagos. todos ellos conforman un gran número de especies. también actúan como reguladores de las poblaciones de biota del suelo. Los grupos incluidos en la selección son: 1 Macrofauna: lombrices de tierra. ácaros. mediante el transporte. 2 Macrofauna: termitas. milpiés (Diplópoda) y otros tipos de larvas de insectos que actúan como transformadores de hojarasca con una importante acción trituradora sobre el tejido de plantas muertas y sus depredadores (ciempiés. bacterias y depredadores de otros animales del suelo). al compararse con otros grupos taxonómicos superiores (Tabla 1.

en ocasiones. sean los más vulnerables ante situaciones de estrés y perturbación que afectan a dichos grupos funcionales. saprotróficos y antagonistas: que determinan o median (en diferentes casos) la viabilidad de cultivos. de esta manera. la mayoría de las especies aún son desconocidas. Métodos para inventario de la biodiversidad bajo suelo: principios generales La metodología actual no permite la identificación de todas las especies en el suelo. Se espera que los servicios de ecosistema. Los métodos empleados para la extracción de diferentes grupos de organismos del suelo también son muy diferentes de un grupo a otro. por ejemplo. otros fijadores de nitrógeno microsimbiontes que transforman el nitrógeno atmosférico N2. utilizando el concepto de grupos funcionales clave como los descritos anteriormente. En la biota del suelo. requieren de un enfoque selectivo para llevar a cabo un inventario de la biodiversidad bajo suelo. el concepto de especies también es muy variable. que dependen de grupos funcionales. hongos y animales invertebrados. y contribuyen al potencial control biológico de plagas y enfermedades. representan un importante control biológico. que es asimilable para las plantas. bacterias que nitrifican y denitrifican (como parte de los transformadores procariotas). Estos factores. 6 Hongos micorrizógenos arbusculares: se asocian con las raíces de las plantas y mejoran la disponibilidad de nutrientes. diversidad funcional (el número de grupos funcionales). entre bacterias. rotación de carbono orgánico en descomposición. lo anterior aplica para los trituradores de materia orgánica (véase transformadores de hojarasca en Tabla 1. 8 Hongos fitopatógenos. reducen ataques patógenos en plantas y mejoran la tolerancia al estrés del medio ambiente. Aún sigue siendo una pregunta sin respuesta la relación existente entre diversidad de especies. en NH3. Hasta donde se conoce. bacterias involucradas con el compuesto El inventario de la biodiversidad biológica del suelo 41 .2). aunados a la inmensa escala de diversidad encontrada en el suelo. En los casos de Archaea y bacteria. compuestos por relativamente pocas especies y/o especies altamente especializadas. composición funcional (la naturaleza de los grupos funcionales) y ocurrencia e intensidad de los procesos ecológicos.como insectos patógenos. 7 Bacterias formadoras de nódulos en leguminosas y. En muchos Fila. la caracterización molecular y bioquímica reemplaza al enfoque de identificación tradicional. y enfermedades de las plantas.

En este manual no se abordan problemas taxonómicos. escogidos y modificados. Si éste es el caso. Este manual aborda métodos para el inventario y caracterización de la biodiversidad del suelo. La evaluación de la composición de la comunidad biótica depende de la identificación de los especímenes recolectados. las consecuencias pueden ser negativas. esto conlleva a una serie de interrogantes como ¿cuál es el número mínimo de especies dentro de los grupos funcionales que garanticen la resistencia del suelo contra el estrés del ecosistema natural y antropogénico. En el prefacio se plantea una breve descripción del proyecto. especialmente. puesto que se reflejarán en los métodos a utilizarse. lo que exige un alto nivel de conocimientos taxonómicos. de manera que sea posible evaluar. Inventario de biodiversidad bajo suelo en escalas de espacio y tiempo Cambio de uso de suelo como la causa principal del cambio de diversidad biológica del suelo Un inventario puede demostrar si la biota del suelo responde a intervenciones humanas como prácticas agrícolas. que para algunos grupos y en algunos países es un desafío importante. hierro. para su aplicación en paisajes con diferentes usos de suelo. preguntas como las anteriores deberían ser consideradas en la definición del propósito del objetivo de la investigación de la biodiversidad bajo suelo. cobre y azufre quimiolitotrofos. y en relación con que “especies clave (si existen) en los grupos funcionales?. el impacto que provoca la intensificación agrícola. deforestación. cuando se adopta el concepto de los grupos funcionales principales. Por lo tanto. hongos micorrizogenos (entre los microsimbiontes) y bioturbadores (ingenieros del ecosistema). la fragmentación de hábitat y el manejo de cultivos en la diversidad biológica del suelo. Los métodos han sido desarrollados.C1 y en las transformaciones de hidrógeno (metanogénicas y metilotróficas). Los métodos estándar son necesarios para describir los ecosistemas de manera consistente. centrándose en los grupos funcionales que permitan la evaluación de la diversidad. aunque se dan referencias de claves para la identificación de especies de varios grupos funcionales. en términos de una dis42 Manual de biología de suelos tropicales . abundancia y composición de las especies. por ejemplo. contaminación y cambio climático. para el cual se han desarrollado y probado los métodos. Esto debería servir como respuesta a un gran número de preguntas en contextos similares.

fertilizantes químicos y pesticidas (Kibblewite et al. El suministro global de alimentos depende de la agricultura intensiva. especialmente. también se manifiestan en diferentes escalas espaciales y temporales (por ejemplo. la complejidad de los agroecosistemas ha sido drásticamente reducida.. para mejorar la complejidad estructural y diversidad funcional. debido a cambios en la fertilidad del suelo y/o incrementos de enfermedades en el mismo. El principio central es que el significado funcional de la diversidad biológica cambia de acuerdo con las escalas de El inventario de la biodiversidad biológica del suelo 43 . interrupción de los ciclos elementales globales y respuesta ante los efectos de los gases invernadero y de la erosión. incluso puede producirse la pérdida de la productividad primaria. pérdida del potencial para la limpieza de los residuos y contaminantes. puede causar pérdidas de función y reducir la habilidad de los sistemas agrícolas para soportar periodos inesperados de estrés. además. un gran número de agricultores tienen acceso limitado a insumos. Una solución alternativa sería intensificar y. los procesos de disturbio -y recuperación. Sin embargo. produciendo efectos indeseables. muchas veces enlazadas entre sí. por ende. de los que puedan realizar las funciones biológicas esenciales.que afectan la biodiversidad bajo suelo. en la medida que proceda la intensificación. especialmente en suelos degradados. a pesar de que la producción se ha intensificado. El mantenimiento de una variedad de cultivos y otras plantas es aceptado como una práctica que protege al agricultor contra los riesgos a corto plazo.minución de los servicios del ecosistema. dónde y cuándo Aunque éste es un manual de instrucción práctica. debería reflejar un consenso de la teoría ecológica y del pensamiento actual sobre estructuras de la comunidad en diferentes escalas espaciales y temporales. si se acompaña de la extinción de especies individuales. Este hecho puede considerarse tanto a nivel de campo como de paisaje. 2008). la biodiversidad y complejidad arriba del suelo favorecen el restablecimiento o protección de la diversidad de organismos bajo suelo. En los trópicos. en la medida de lo posible. tales como cultivo mecánico. lo cual implica una reducción de la biodiversidad bajo suelo y. Se presume que de esa forma se reducirá la diversidad bajo suelo y que. Dichas funciones regulatorias frecuentemente se describen como “sustitutos” por insumos. retener una buena cantidad de diversidad sobre el suelo. varias frecuencias). la biodiversidad arriba del suelo se verá reducida. Para qué muestrear. al mismo tiempo. escalas que determinan la predicción de servicios ecosistémicos. la regulación biológica de los servicios de ecosistema basados en el suelo.

mientras se mantuviera en un paisaje mixto. que combina estos elementos dentro de un sistema de uso de suelo. El mayor reto. El clima. o bien. por ejemplo.espacio y tiempo (Swift et al. a escala regional. la erosión de finas partículas de suelo y la reducción al mínimo de materia orgánica compleja que. incluso. la pérdida progresiva de macroporos. si uno o más grupos funcionales importantes estuvieran ausentes o permanecieran en baja presencia en una de las localidades o si el ecosistema original de bosque se hubiera reducido a una presencia mínima en uno de los lugares. no obstante. pero en el caso de dos campos colindantes. Las escalas temporales son importantes en los procesos de degradación. en un mismo paisaje. los materiales parentales y los suelos serán los principales determinantes de todos los servicios del ecosistema a nivel paisaje. con el propósito de lograr lo anterior. el inventario de especies de lombrices de tierra. Asimismo. puede haber una influencia biótica significativa. Por ejemplo. destruir la capacidad productiva. al punto de llegar a hacerla ser irrecuperable. espaciales y temporales. De la misma manera. puede quedarse corto en relación con el propósito de evaluación de la diversidad de toda el área. tomando en cuenta los aspectos de la biodiversidad que puedan afectar. la diferencia que puede ocurrir en la descomposición o la fijación de nitrógeno simbiótico entre dos paladas de suelo del mismo campo. del campo hacia setos que delimitan el terreno. a los servicios del ecosistema en diferentes tipos de comparaciones. en última instancia podría. 2004). los ciclos de vida de diferentes 44 Manual de biología de suelos tropicales . si el objetivo del inventario es conservar la biodiversidad bajo suelo. se puede esperar una variación grande. los números o diversidad pueden mantenerse estables. o bien. En términos generales. La formación del suelo. mientras que en el caso de la zona de uso de suelo. en caso de rehabilitación. dónde y cuándo se mide. entonces. es cómo definir estos “grupos” en relación con niveles de escala. El objetivo debería ser reducir la variabilidad intragrupo y maximizar la variabilidad entre grupos. se pensaría que el material parental y el clima fueran los factores determinantes en el proceso de formación del suelo. probablemente es cuestión de saber cuáles microorganismos existen en cada una. a la existencia de termitas o cualquier otro ingeniero del ecosistema que haya presentado mayor actividad en un lugar que en otro. puede que se deba al drenaje o manejo previo del lugar. esto quiere decir qué se mide. en número y diversidad de lombrices de tierra al moverse de un lugar a otro. en un lugar específico. de manera general. Esto quiere decir que.. Lavelle et al. constituye uno de los servicios del ecosistema que integra procesos en todas las escalas. como se podría esperar.. en otro lugar. Entre dos paisajes o dos regiones. 2002.

A nivel paisaje es difícil evaluar el efecto de la biodiversidad bajo suelo sobre algunos servicios del ecosistema. incluyendo el descubrimiento de especies invasivas exóticas es. por los gradientes o transiciones de las condiciones de humedad o por los gradientes de las propiedades del suelo. El inventario de biodiversidad bajo suelo. en este caso. deberá capturar la distribución. 1. también será diferente de un organismo a otro.taxa de biota varían de horas a años y pueden incorporar estados obligados de inactividad. (2006). geología. tamaño y forma de estos gradientes y fragmentaciones. de gran relevancia en ese nivel. como calidad y suministro de agua o control de erosión y no parece que éste juegue un papel importante. el tiempo requerido para que una población creciente alcance un tamaño crítico mínimo donde es autosuficiente. No obstante. como se indica más adelante. ampliamente discutidos. La Tabla 1. Las características espaciales de la distribución de uso de suelo (“parches” de uso de suelo. a escala de paisaje. Los principales conceptos teóricos que corresponden a estos criterios son: apertura y conectividad. mientras que las fecundidades también varían y. comparado con los efectos que produce la vegetación misma. En el nivel más alto. como puede ser dentro de los bosques). al igual que en los protocolos de medición. La biodiversidad bajo suelo. La protección y conservación de los principales agroecosistemas y hábitats representa la mejor El inventario de la biodiversidad biológica del suelo 45 . por lo tanto. la distribución espacial de la biodiversidad bajo suelo estará fuertemente influenciada por los gradientes de altitud y temperatura. al igual que los procesos de cambio relacionados. será un determinante más de dicho nivel. que afectan a la biodiversidad bajo suelo (y servicios ambientales asociados) y el componente de la biodiversidad bajo suelo. El impacto en el diseño de muestreo.3 muestra un resumen de niveles jerárquicos modificados a partir de los propuestos por Lavelle et al. se enfatiza en el capítulo 2 de este manual. derivados de la base mineral y vegetal. también tendrán una importante influencia en la biodiversidad. vegetación y tipo de suelo. cada proyecto necesitará determinar su propia escala en función de sus objetivos. en el caso del ecosistema de suelo y sedimentos (Wall. El patrón de uso de suelo superpuesto en función de dichos efectos de clima. Paisaje. más útil como indicador de la respuesta del suelo al manejo. 2004). para explicar las posibles variaciones en la biodiversidad bajo suelo. son usados en el proyecto CSM-BGBD (véase prefacio) y están considerados como ejemplo. Los cuatro niveles de escala espacial en muestreo.

y para la manera en cómo funciona el sistema. queda dentro de los dominios funcionales de los ingenieros del ecosistema. 2007. la estructura comunitaria y sus interacciones son reguladas por la arquitectura del suelo del lugar en específico (Lavelle et al. Vanlauwe et al.. Los gradientes de las propiedades de suelo sí ocurren en este nivel. 2006 y Tittonell et al. Las áreas de uso de suelo se definen en función de su uso y régimen de manejo (Huising. es en este nivel donde la biodiversidad bajo suelo debería estudiarse de manera minuciosa. normalmente. rompevientos. tendrán un 46 Manual de biología de suelos tropicales . también lo es la abundancia de especies relativas. describen los gradientes de la fertilidad del suelo en función de los recursos destinados al terreno. En este nivel. cercos vivos. por lo tanto. se asocia con la extracción de elementos vegetales como árboles. A nivel de parcela. cuando se trata de agrosilvicultura. Las interacciones laterales son componentes muy importantes para la biodiversidad bajo suelo. 3. si no es demasiado grande. pero son asociados con el manejo. que implican una pérdida de sus aportes e impactos. El terreno o parche. éste es el caso de algunos árboles donde ciertos organismos de suelo hacen uso de sus nichos. La intensificación de uso de suelo. La biodiversidad sobre el suelo se determina por la variedad de cultivos encontrados en el área y por los elementos vegetales asociados con barbechos. típicamente.. tramos de bosque y otros elementos de manejo de paisajes. los cambios relacionados con el uso y cobertura del suelo. La escala de tiempo de estos procesos (cambio de la composición de uso de suelo y configuración de paisaje) para ser observable necesitaría de varios o.. Cambios en la arquitectura del suelo. por ejemplo. tal es el caso de un área con plantaciones comerciales de té o la caracterizada por la agricultura de autoconsumo. de cientos de años. 2. son visibles en escalas de tiempo más cortas que pueden abarcar desde pocos años hasta varias décadas. de manera que la relación entre el patrón de distribución espacial de la biota sobre el suelo con la de bajo suelo son particularmente interesantes. Área de uso de suelo. A este nivel. Estas áreas muestran. 2006). aunque sean provocados por cambios en la composición funcional y actividad de los ingenieros del ecosistema o del arado del suelo. respecto al cambio de uso de suelo. Parcela o parche. sobre todo. incluyendo a las raíces de suelo. incluso. pertenecientes a varios niveles tróficos y grupos funcionales que gobiernan la estabilidad de redes alimenticias y la provisión de funciones de apoyo. una combinación específica de tipos de cobertura. la composición y actividades funcionales de la biota son de gran interés y. en el caso del inventario de biodiversidad bajo suelo. 1993).opción para dicha intervención.

drilósferas. condicionados por los organismos de suelo en la producción de servicios de apoyo tales como mantenimiento de la estructura de suelo y la descomposición de materia orgánica introducida. por ende.3 son parcialmente derivadas del concepto “el manejo jerárquico de la biota del suelo”. subparcela o microhabitat. 2001. pertenecientes a grupos funcionales definidos o a niveles tróficos dentro de la cadena alimenticia. Las opciones para intervenciones de manejo en una escala de subparcela son actualmente limitadas. reflejándose la dependencia de los organismos más pequeños en los ingenieros del suelo para el suministro de sus sustratos (véase Lavelle y Spain. Tal intervención debería apoyarse en el inventario y la abundancia relativa de especies. la inoculación con especies microbianas. dentro de los microorganismos.efecto sobre las interacciones tróficas y. termitósferas. El manejo de materia orgánica y el uso de agroquímicos causarán un mayor impacto en la estructura de la red alimenticia. dado que ésta es la unidad fundamental de la función del suelo. según lo describe Swift (1998). sino más bien ilustrativa. pero un entendimiento de los procesos e interacciones es vital. El inventario de la biodiversidad biológica del suelo 47 . La redundancia funcional entre los transformadores primarios (especies o familias diferentes que cumplen una misma función). no es necesariamente exhaustiva. Nicho. puede servir para corregir desequilibrios en la composición funcional o para mejorar algunas funciones en particular. Cualquier tipo de inoculación causará un impacto directo sobre la diversidad bajo suelo y. también despiertan gran interés. los procesos involucrados. para mayores detalles y terminología). composición funcional) pueden necesitar de varios años. por lo tanto. la introducción de depredadores para el control de una enfermedad en particular. la competencia y la eficiencia son de particular relevancia y. en relación con esto. A nivel parcela. son segregados en los dominios funcionales: rizósferas. Este nivel se refiere a los microhábitats que alojan a los microbios y a los componentes de la microfauna del sistema de suelo que los regulan. Éstos existen en la escala de los horizontes de suelo. tienen escalas de tiempo relativamente cortas y mostrarán variaciones estacionales.. Cambios estructurales en la comunidad biótica (conexiones en la cadena alimenticia. etc. en la estructura de la red alimenticia. el grado de diversidad genética. como en la cadena alimenticia. 4. del agregado individual y de la partícula individual. La lista de intervenciones y mediciones correspondiente a la biodiversidad bajo suelo. principalmente. Las “intervenciones” enlistadas en la Tabla 1.

3 Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. de relevancia específica para la biodiversidad y mantenimiento de la provisión de servicios de ecosistema. Número de cla.de suelo. de un país. Tabla 1.Proceso/ ses o unidades intervención Área de uso de suelo 48 Manual de biología de suelos tropicales . por ejemplo. dentro de degradación diversidad y tico y patrón de composición cobertura de suelo un paisaje espe.cas e invasoras. Capa de nivel de agregación Paisaje Tipo de unidad Medida/ parámetro de biodiversidad Área caracterizada Sin especificar: Cambio de uso de Diversidad biopor un mosaico de tal vez. manejo ecosistemas: integrado de patrón de distrirecursos naturales bución espacial. varias suelo: protección lógica de suelo: uso de suelo y de por bioma o por de usos de suelo y especies exótiecosistemas como región dentro elementos de pai. cuenca mayor.relacionada con diversidad arriba ingenieros de clasificación). procesos asociados de cambio y componentes relevantes de la biodiversidad. suelo caracteríssuelo. del suelo. saje. y prácticas de conservación del suelo. corredores biológicos. unidades de referencia. mancífico (depentenimiento de de especies y régimen de especialmente diente del nivel áreas de refugio manejo. parches de selva.existiendo una superposición entre niveles de escala dentro de los parámetros a medir. 3–20 tipos de Intensificación Diversidad Área con uso de áreas de uso de de uso de suelo. funcional. de detalle de la biológicas y bio.

Datos requeridos Los métodos expuestos en este manual. composición labranza mínima. drilósfera. materia orgánica. funcional.área de uso de jo particular. Sin tomar en cuenta los objetivos específicos y el diseño experimental de cualquier estudio. campo agrícola. microhábitat horizontes de suelo. los datos tendrán que ser acumulados en cada punto de muestreo. el inventario bajo suelo de la biodiversidad.Tabla 1. inoculación con microsimbiontes. Por regla general. cepas para microsimbiontes). etc. Biomasa y actiManejo de vidad microbiabiota clave. dependiendo del tipo de análisis realizado: En cuanto a la biodiversidad: • Riqueza taxonómica a nivel de especie. • Proporciones relativas de GF.3 Continúa. Capa de nivel de agregación Parcela. etc. na. diversidad introducción genética. dentro mejoramiento de y entre grupos funcionales y sistemas de cultivo y manejo de niveles tróficos. El inventario de la biodiversidad biológica del suelo 49 . inoculación. Nicho Por ejemplo. utilizando los métodos previstos en este manual. parcelas de vegetación. rizósfera. • Abundancia (total) y biomasa (en el caso de animales) de taxa. parche Tipo de unidad Número de cla.Proceso/ ses o unidades intervención Medida/ parámetro de biodiversidad Intensificación de Abundancia manejo de suelo y relativa de cultivos. provee los siguientes datos e información. que consisten en el uso oportuno de tiempo y recursos. proveen un gran número de parámetros para la evaluación de la biodiversidad bajo suelo. por suelo. erosión. de agentes de control biológico. 10 a 100 por Área con un uso particular y mane. ejemplo. especies. o a nivel más alto o más bajo (por ejemplo. • Abundancia y biomasa de los grupos funcionales (GF). selva. para lo cual se indican en los capítulos 3 y 9 los mejores métodos.

vol 9. Cavalier-Smith. V. M. Oxford University Press. En cuanto al suelo. B. Brussaard.. vol 5. Historia precisa del uso de suelo desde su estado de selva no perturbada hasta otro tipo de vegetación pre-cultural. y Swift.. Susilo.. Bignell. Island Press.. R. (2003) ‘Linking keystone species and functional groups: A new operational definition of the keystone species concept’.. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. Vosti. Hattori. Tiedje. (1997) ‘Biodiversity and ecosystem functioning in soil’.. Pashanasi. D. Hole. E. pp. D.. 75–112. J. Palm. (1998) ‘A revised six-kingdom system of life’. pp. vol 26. P. W. Oxford. Moreira. J. D. issue 1. R. Applied Soil. S. Behan-Pelletier. T. (2005) The Biology of Soil. D. pp. Geoderma.. Davic. E.. P. (1998) ‘Soil fauna. S. Promedio de datos climáticos y precipitación real hasta la fecha de muestra. 563–570. D. B.. C. pp. Sanchez.Ecology. Nwaga. F. Fragoso. response 11. J.. D.. vol 73.. Dibog. Bignell. Lavelle. Características de vegetación. vol 271. R. Freckman. Tondoh. 203–266. Klopatek. F.. C. Cavalier-Smith. vol 7. Hawksworth. Brussaard. Washington DC. Didden. J. pp. V. guilds. Daily. Brown. J. intensidad de uso y cobertura de suelo: • • • • • • Cultivo aparente o uso de barbecho. C. Soderstrøm. Malloch. (2005) ‘Belowground diversity assessment: developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. Proceedings of the Royal Society of London Series B.Rusek. D. y Virginia. Prácticas actuales de manejo de suelo y cultivos. T.. D.. A. Gupta. G. functional groups and ecosystem processes’.. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. (ed) (1997) Nature’s Services. Huang. X. A. Huising. Conservation Ecology. P. F. A pattern recognition approach to land use inventory at the sub-regional scale 50 Manual de biología de suelos tropicales . (2004) ‘Only six kingdoms of life’. Ambio.. Referencias Bardgett. in C.. L. L. Propiedades físicas y químicas básicas: pendiente y aspecto del suelo. 123–135. (1981) ‘Effects of animals on soil’. uso del suelo. Folgarait... P. V. 1251–1262. Columbia University Press. New York... D. Biological Reviews. T.• Índices cuantitativos generales de riqueza y equitatividad. L. A. P..

pp. Thesis. H. M. J. C. P.. M. D. B. W. y Paul. (2008) ‘Soil health in agricultural systems’. A.. 3–16. B. A. M. Berlin. D. Wallingford. (1997) ‘Soil function in a changing world: The role of invertebrate ecosystem engineers’. in D.S. Larsen. y Shachak.. E. Garey.. P. Bignell. J. Volters. Lavelle. M. V. P. Porter.. G.. Holt. R. y Dillion. Bureau. Levin y M. F. F. Washington. (1996) ‘The role of species in ecosystems: Aspects of ecological complexity and biological diversity’.. Srivastava. Powell. Island Press... J. P. Roger. H. P. indicator taxa and effects of habitat modification in tropical forest’. M... K.. A. Austen. Lavelle. P. vol 33. Abe. P. Spain. A. E. Barot. y Swift.. C.J.. Bloemers. Lavelle. E.D. Siqueira. R. 72–76. S. y Brussaard.. Brown. vol 33.. W. O. Mawdsley. P. Heal.. 860–871.. E. Oikos. P. Mycologia. pp. Wall (ed) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. Wageningen Agricultural University.pp.. L. 373–386. Eggleton. an Ecological Perspective. vol 391. Margulis. L. Lepage. R. CAB International. D.using remote sensing and GIS applying an object oriented and data-driven approach’. y Rossi. G. Mora. Behan-Pelletier. Bignell. P. Ph. D. J-P. pp.. J.. Freeman. H. New York. pp. 3rd edition. Boulton. (1994) ‘Organisms as ecosystem engineers’. H. Mozley-Standridge. D. Longcore. D. DC Lavelle. Nature (Lond). Stork. J. in T. pp. European Journal of Soil Biology. (2001) Soil Ecology. Kluwer Academic Publishers. 685–701. V.Griffith. D. Ineson. Giller. H. 159–193. J. Hunt. Ritz.... M.. V. G. y Vilgalys.. pp. (2006) ‘Soil invertebrates and ecosystems services’. (2004) ‘Connecting soil and sediment biodiversity: The role of scale and implications for management’. G. Aubert. M. vol 42. Hawkins. St John. E.. T.. Springer.. M. Margerie. N.. Brown. G. (1998) Five Kingdoms – An Illustrated Guide to the Phyla of Life on Earth. Moreira.. J. M. Biology International. S. Bignell. vol 363. T. Philosophical Transactions of the Royal Society Series B. y Watt. W. Kibblewhite.. M. M. Higashi (eds) Biodiversity.. S. Letcher. T. S. K. V. E. V.. H. Lawton. Y. N.. W. (2006) ‘A molecular phylogeny of the flagellated fungi (Chytridiomycota) and a proposal for a new phylum (Blastocladiomycota)’. Hammond.. The Inventory of Soil Biological Diversity 15ES_HTSB_11-6 13/6/08 18:14 Page 15 European Journal of Soil Biology.. K.. vol 98. J.vol 69. M. (1998) ‘Biodiversity inventories.. El inventario de la biodiversidad biológica del suelo 51 . G. S3–S15. S. P. P.. Lawton.. Dordrecht Lavelle. Jones. A. The Netherlands. y Schwartz.. (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. James. S. F. S. E. (1996) ‘Diversity of soil fauna and ecosystem function’.. M. Blouin. Lawton. Hodda. P. Decaëns.

Mikola. vol 9. Lavras. pp. S. y Van Noorwidjk. M. W. Ecosystems and Environment. (2003) ‘The uncultured microbial majority’. pp. inJ. Stork. pp. Setäla. 369–394. S.. G.. E. Kandler. vol 87. pp. M. Faquin.. vol 7. American Journal of Alternative Agriculture.. (ed) (2004) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. C. Oxford. R. pp. H. S. Bacteria. (1998) ‘Towards the second paradigm: Integrated biological management of soil’. vol 104. Annual Review of Microbiology. vol 94. J. F. Woese. (2006) ‘Within-farm soil fertility gradients affect response of maize to fertilizer application in western Kenya’. E. N. Izac.Rappé. and Eucarya’. vol 76. J. A. J. Soil Biology and Plant Nutrition interrelationships. P. (1998) ‘Functional diversity of decomposer organisms in relation to primary production’. M. Nutrient Cycling and Agroecosystems. Guilherme. 52 Manual de biología de suelos tropicales . Carvalho (eds) Soil Fertility. J. Heal. Blackwell. y Giller. Lopes. (2002) ‘Biodiversity and ecosystem services in agricultural landscapes – are we asking the right questions?’ Agriculture. M. Vanlauwe. O. Siqueira. Wall. J. y Huhta. 23–32 Swift. (1990) ‘Towards a natural system of organisms: Proposal for the domains Archaea. pp.. S. D. y Wheelis. R. M. Tittonell. M. 113–134. (2007) ‘Heterogeneity of crop productivity and resource use efficiency within smallholder Kenyan farms: Soil fertility gradients or management intensity gradients’. Tittonell. pp.. SBCS/UFLA/DCS. 4576–4579. N. Moreira. M. 11–24. Island Press. y Eggleton. 376–390. G. y Anderson. Vanlauwe B. Washington. L. K. J.. J. Proceedings of the National Academy of Sciences USA. L. y Mukalama. vol 57. O. V. Swift. Swift. A. (1992) ‘Invertebrates as determinants and indicators of soil quality’. (1979) Decomposition in Terrestrial Ecosystems. pp. V. 25–31. P. Brazil. J. de Ridder. E. 171–182.. N. M. Agricultural systems. B. Furtini Neto y J. H. Applied Soil Ecology. M. N. P. A. y Giovannoni. Laakso. O.

1977). que aplica en todos los casos (Cochran. Souleymane Konaté. En cuanto al argumento es más complicado que una mera elección al azar. se necesita determinar en dónde va a estar localizado todo el estudio. Meine van Noordwijk y Shiou P. El problema de localizar los puntos de muestreo se presenta a diferentes escalas. Huang (†) INTRODUCCIÓN Gran parte de este manual contiene instrucciones de cómo tomar mediciones una vez que se tiene un sitio de muestreo. Existe una larga tradición de muestreo en la ecología de campo y. Hay numerosos textos que describen la teoría y su aplicación (ej. se encuentra el problema de la elección de los sitios. por tanto. Gregoire y Valentine. el problema gira en torno a cómo escoger el número y localización de los puntos de muestreo en el paisaje en cuestión. En algún punto entre estos dos. Jeroen Huising. Entonces ¿para qué se necesita otro capítulo que discuta las técnicas de muestreo de la biodiversidad del suelo? A pesar de los conocimientos y experiencias en rela53 . Moreira. Julio N. Juvenil E. Ronald Zanetti. Richard Coe. S. mismos que se describirán en los siguientes capítulos. Cares. es necesario escoger el lugar dónde se tomarán las muestras de suelo para los análisis químicos. 2000. se cuenta con una teoría de muestreo bien establecida. En una primera escala. Susilo. una gran experiencia al respecto. Southwood y Henderson. en otra.Capítulo 2 Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo E. Francis-X. La base del problema radica en el muestreo. Fátima M. Además. en los cuales se llevarán a cabo los protocolos de medición. también incluye cómo determinar la localización de estos sitios de muestreo: lo que se discutirá más abajo. 2007). Louzada. en un punto predeterminado del paisaje.

54 Manual de biología de suelos tropicales . Por ejemplo.ción con el tema. están los que “Ven lo que está ahí. Ford (2000) hace referencia a una amplia discusión de los objetivos de investigación en ecología. OBJETIVOS DEL ESTUDIO Y BASES DEL MUESTREO La mayoría de los autores que escriben sobre diseños de investigación puntualizan que el diseño se determina en función de los objetivos. debido al tiempo y al costo. pueden discrepar en lo referente al carácter práctico del estudio que está siendo diseñado. Comúnmente hay malos entendidos de algunos de los principios básicos. Kenkel et al. se presenta un ejemplo del enfoque utilizado en el proyecto CSM-BGBD. estos podrían no estar completamente desarrollados o los objetivos múltiples podrían sugerir diferentes enfoques para el muestreo. 5 Los investigadores toman diferentes posturas filosóficas relacionadas con el enfoque de muestreo. Por ejemplo. el acceso a sitios de muestreo ideales puede ser restrictivo. Si datos similares no han sido colectados antes. 2 La aplicación de una teoría de muestreo puede requerir de información con la que no se cuenta hasta que los datos han sido colectados. En este capítulo se describen algunas opciones para muestrear la biodiversidad del suelo y las ventajas o desventajas de los diferentes enfoques. o bien. A continuación. 4 Los objetivos del estudio determinan el diseño. en cualquier proyecto habrá desacuerdos y discusiones en cuanto a las estrategias de muestreo. tales como por qué el trabajo de muestreo debe ser de manera aleatoria. entonces tratan de entenderlo” y aquéllos que “empiezan con una hipótesis y tratan de probarla”. Sin embargo. el tamaño de muestra requerido depende de la variación entre las muestras. entonces esta variación es desconocida. (1989) lo explican con detalle en el contexto de muestreo ecológico. Muchos de los debates sobre los métodos apropiados de muestreo se deben a diferencias de opinión en cuanto a los objetivos exactos del estudio. Son varias las razones para ello: 1 La aplicación de una teoría completa o de métodos tan extensivos como los utilizados en otros estudios. o qué es una réplica. 3 Puede haber límites en cuanto a la teoría. es posible que no sea fácil tomar tantas muestras como se desearía.

en ecología. su imaginación y descubrimientos potenciales podrían estar restringidos. entonces los nichos raros deben ser incluidos. situado en el lindero entre el bosque y la pradera. Un ejemplo de un objetivo que requiere diferentes enfoques de muestreo son los inventarios. Un enfoque de muestreo consiste en colectar datos usando el método de MAS o mediante una cuadrícula. La teoría. dividir la población en sub-poblaciones o estratos. esto es atractivo. y la precisión aumenta con un tamaño de muestra fijo. existen pocos estudios ecológicos cuyo objetivo sea estimar la media poblacional. argumentando que si se empieza partiendo de un objetivo limitado. Cuando el objetivo es identificar todas las especies de un grupo dado en el área de estudio entonces el MAS resulta inapropiado. a través de la estratificación (es decir. se han hecho imD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 55 . Los seguidores del primer enfoque pueden argumentar que no quieren ser prejuiciados por hipótesis previas. no importará si los nichos raros son omitidos o no. La media de la muestra es una estimación imparcial de la media poblacional. intentan entender los patrones en la biodiversidad. y luego diseñar un estudio cuyo objetivo específico sea probar estas hipótesis. Piense en un nicho raro en el paisaje (por ejemplo. el caso de las orillas de un estanque. Si el objetivo del estudio es estimar la biomasa media de escarabajos en general. y en cada estrato tomar una muestra aleatoria). Otra alternativa es formular algunas hipótesis predictivas para explicar los patrones en la biodiversidad. Por supuesto. Intuitivamente. intentando describir patrones (por ejemplo. incluyendo los del proyecto CSM-BGBD. Otra alternativa al MAS consiste en usar un muestreo sistemático usando una cuadrícula. indica cómo la precisión de la estimación puede ser controlada mediante la elección de la muestra. encontrando correlaciones con variables ambientales). entonces.El muestreo aleatorio simple (MAS) constituye el punto de partida para la discusión sobre cómo muestrear. análisis de conglomerados y ordenación) y luego explicarlos (por ejemplo. o el número promedio de especies de hongos en 1 cm3) el MAS adquiere propiedades relevantes. existirá solamente una pequeña porción del área de estudio ocupada por este tipo de nichos. y su error estándar puede ser estimado sin hacer supuestos acerca de la variación dentro de la población (técnicamente. La mayoría de los estudios. No obstante. pero si el propósito es realizar un inventario de especies. por lo que prefieren mantener la mente abierta y partir de la observación. existe una estimación del error de muestreo basada en el diseño). lo que se discutirá en la sección de muestreo aleatorio y sistemático. Si el objetivo es estimar la media poblacional (la biomasa media de escarabajos por m2 dentro del área de estudio.

No obstante. no obstante. los que proponen el enfoque “no hipotético” en realidad parten de alguna forma de hipótesis. por ejemplo. separar los efectos de las dos variables. existen tres razones para tratar de diseñar un estudio con objetivos específicos que incluyan hipótesis comprobables: 1 Los descubrimientos inesperados usualmente tienen la naturaleza de formulación de hipótesis observacionales que sugieren explicaciones.portantes descubrimientos por casualidad. relativamente. además. son los puntos más extremos los que proporcionan más información (Figura 2. Entonces es difícil y hasta imposible. • La MOS y la P pueden estar correlacionadas. 2 De hecho. Si las hipótesis implícitas se hacen explícitas el diseño de los estudios pueden ser mejorado. Por ejemplo. 56 Manual de biología de suelos tropicales . Sin embargo. sin seguir estudios planeados. el estudio podría ser diseñado para incluir específicamente algunas muestras con valores altos de P y de MOS y otras muestras con valores bajos de P y de MOS. sin alguna noción de los factores ambientales que puedan controlar la biodiversidad. si se trata de entender la relación entre la biodiversidad del suelo y la MOS o la P. es imposible elegir cuáles. pocos puntos con valores altos o bajos. deberían ser medidos en los sitios de muestreo. frecuentemente. frecuentemente. parcelas con un valor alto de P. entonces es probable que: • La mayoría de los sitios de muestreo tengan valores de P y MOS alrededor de la media con. es posible mejorar el diseño del estudio. está determinada por el nivel de Perturbación (P) y el nivel de Materia Orgánica del Suelo (MOS) y se colectan los datos por medio del MAS o por muestreo de cuadrícula. haciéndolo más eficiente. 3 Si se parte de hipótesis específicas. La estratificación puede usarse para incrementar el número de puntos con MOS más extremos y mejorar la estimación de la relación sin incrementar el número de muestras. aunque ésta sea implícita. Se requiere de estudios minuciosamente planeados para poder probar dichas explicaciones. Si suponemos la hipótesis de que la biodiversidad del suelo en parcelas agrícolas.1). Este último punto subraya o enfatiza gran parte de lo que sigue en este capítulo. tienen valores bajos de MOS. cada investigador debería estar abierto a la posibilidad de observaciones no anticipadas y explicaciones verdaderamente nuevas. entre un número infinito de factores.

El objetivo global del proyecto CSM-BGBD fue comprobar la hipótesis de que un incremento en la intensidad del uso del suelo cambia la biodiversidad del suelo (más específicamente. no siempre resulta viable. se aplican los mismos principios de diseño. se utiliza una aproximación transversal. que indiquen lo que pasaría con la biodiversidad del suelo si los usos de suelo cambian en el futuro. el investigador hace una selección de las escalas importantes para su estudio. señala una pérdida de biodiversidad del suelo). En la práctica. los efectos de ambas variables. Las discusiones en este capítulo sólo consideran esquemas alternativos de muestreo para datos colectados por el método transversal. Si tenemos que utilizar un diseño de estudio observacional. pero aún puede resultar útil cuando se enfoca con un diseño de muestreo.1 y las relaciones pueden ser más complejas que el caso de dos líneas rectas. generalmente. y sus efectos combinados pueden ser estimados. como el que se observa en la Figura 2. Si éstas se seleccionan explícitamente. en donde las parcelas sean monitoreadas a través del tiempo para observar si los cambios en la biodiversidad del suelo pueden ser correlacionados con cambios en el uso del suelo. La única manera cierta para determinar el efecto de un cambio. entonces se abren nuevos debates con una probabilidad de mejorar el diseño del estudio. puesto que se desconoce el tiempo necesario para el monitoreo. es hacer justamente el cambio y esto precisamente constituye la base de un enfoque experimental. Lo anterior. Cuando se determina la distancia entre los sitios de muestreo y el tamaño total del área de estudio. como en muchos otros.Entonces. muchas veces es la única opción disponible. lo ideal sería llevar a cabo un estudio longitudinal. En el presente estudio. considerando un rango de usos de suelo en un momento específico de tiempo. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 57 . sin embargo. tampoco es viable en un proyecto de duración fija y corta. Aunque la validez de este enfoque puede ser cuestionable. sin embargo. puede que sea imposible o inútil producir un solo índice de biodiversidad del suelo. Este planteamiento es muy amplio. Se espera que las correlaciones entre la intensidad de usos de suelo y la biodiversidad del suelo reflejen alguna conexión causal. Otro ejemplo de una hipótesis implícita en muchos de los estudios es la escala espacial en la que ocurren los patrones interesantes. En términos ideales. dicha investigación iría acompañada de un experimento. en lugar del experimental.

Los detalles de cómo dichos factores prácticos y teóricos pueden mezclarse. la necesidad de transportar con rapidez las muestras desde el campo hasta el laboratorio. Sin embargo. podría surgir una serie de restricciones adicionales. ENFOQUES PRÁCTICOS El diseño de un esquema de muestreo exitoso y práctico es todo un arte. tiempos y disponibilidad de expertos. Requiere de un entendimiento profundo. esto aumentará la precisión de la estimación de la pendiente. Asimismo. por lo tanto. es posible que se especifiquen algunos pasos del proceso en general que se deben seguir en cualquier estudio. Paso 1: Defina objetivos Como se indicó en la sección de objetivos del estudio y bases de muestreo. no obstante. es necesario que se combine con las restricciones prácticas impuestas por costos. b) si se incluyen de manera deliberada valores de MOS más extremos. serán diferentes para cada estudio y darán a cada investigación un aspecto único. dando un estimado pobre de la pendiente. los objetivos determinan todos los aspectos del diseño. el acceso limitado a localidades deseadas para muestrear. desde un principio deberán ser expresados de manera clara y precisa. por estratificación. con base científica y de las propiedades que ofrecen los diversos métodos. o bien. Escríbalos y compártalos con otros para 58 Manual de biología de suelos tropicales . por ejemplo. probablemente arrojará la mayoría de los valores de MOS cercanos a la media.Figura 2.1 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula.

mapas de uso de suelo (ej.. Paso 3: Reúna datos relacionados Reúna información o antecedentes que serán necesarios para diseñar los detalles del muestreo.. imágenes de detección remota (ej. Escriba el diseño con tantos detalles como sea posible. para ayudar a decidir cuáles son las temporadas idóneas para el muestreo de campo). Anote específicamente el tamaño de las muestras utilizadas y la variación de los resultados. Cada estudio cuenta con aspectos únicos y siempre habrá estudios previos de los cuales puede aprender: ésto le permitirá entender qué aspectos de los métodos utilizados han tenido éxito y cuáles limitan la eficiencia y calidad de los resultados.que pueda discutir algunas sugerencias. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 59 . ¿Cuáles cumplen con sus objetivos y proveen evidencia para su hipótesis?. otros que tienen experiencia en los métodos que va a utilizar. Después deberá comprobar con cuidado que: a) los resultados realmente logren los objetivos y b) que el diseño de muestreo simulado realmente pueda mostrar estos resultados. La Figura 2. para identificar los principales usos del suelo que se incluirán en el estudio). Consiga el mayor número de comentarios y sugerencias de los expertos en la materia. Imagínese que ha finalizado el estudio y ha obtenido resultados ¿Qué tablas y gráficas le gustaría presentar?. Estos incluyen: mapas topográficos (ej. diseños utilizados en otros estudios y su imaginación. Paso 2: Consulte otros estudios Consulte los estudios relacionados con su investigación. o bien. otros que han trabajado en el mismo sitio. Si bien puede haber aspectos sobre los cuales tenga poca idea..1 es un ejemplo simple. siempre deberá plantear un proyecto realista. su propia experiencia. Una herramienta que ayuda a refinar los objetivos es la presentación de resultados simulados. Estos expertos pueden ser investigadores que trabajan sobre temas similares en otros lugares. Paso 4: Elabore un diseño Elabore un diseño tentativo utilizando una combinación de principios generales.. mapas de cobertura del terreno). anótelas y numérelas. indican la estratificación por altitud o nos permiten entender los problemas de acceso). datos meteorológicos (ej.

revise los objetivos a la luz de nueva información. Un buen estadista. que han usado métodos similares o que han trabajado en la localidad o simplemente. también permita estimar el tiempo del muestreo y el procesamiento de las muestras. un error común es obtener información que sugiere que los objetivos son inalcanzables. Dentro de cada sitio de estudio alrededor de 100 puntos de muestreo fue60 Manual de biología de suelos tropicales .. En cada área. esto dará una indicación de la variabilidad. El proyecto CSM-BGBD es un buen ejemplo. Asimismo. fueron seleccionadas una o más áreas de estudio. considerará algunos aspectos que pueden pasar desapercibidos por el ecólogo. procese algunos datos hasta llegar a un análisis estadístico. Paso 7: Revise los pasos En cualquier paso. puesto que involucra varios países. De ser posible. probablemente. En particular. lo que puede ser útil para ayudar a decidir el tamaño final de la muestra. Dentro de cada país. REPLICACIÓN Y TAMAÑO DE MUESTRA La mayoría de los diseños de estudio son jerárquicos y el problema de muestreo no sólo consiste en seleccionar el sitio de muestreo dentro del área de estudio. pero deberás seguir adelante. JERARQUÍA. Trate de incluir un estadista con experiencia en investigación en ecología.Paso 5: Revise su diseño Comparta su diseño con otros investigadores para que expresen su punto de vista y sus comentarios. uno o más sitios de estudio (etiquetadas como “ventanas”) fueron seleccionados. De nuevo. Una investigación piloto abre la posibilidad de evaluar el aspecto práctico del esquema de muestreo. que expresan su opinión acerca de su tema. procedimientos de manejo de datos. Paso 6: Realice una prueba piloto Pruebe su enfoque. puede ser que tenga que retroceder a un paso anterior para volver a intentar. permita probar y refinar los protocolos de medición. etc. éstos pueden ser personas que han trabajado con temas similares.

en algún nivel. puede concluir (con un grado conocido de incertidumbre. es necesario repetir observaciones con el fin de determinar si los patrones son realmente consistentes. La selección de algunos países puede estar basada en función de su política o de los intereses de algunas agencias financiadoras e investigadores que dirigen el proyecto. La intención es saber a qué se refieren sus resultados. El muestreo implica que el conjunto sobre el que nosotros queremos hacer inferencias (“la población”) necesita ser delimitado antes de que un esquema de muestreo pueda ser planteado. lo que requerirá de una muestra de fincas pertenecientes a esta localidad. Suponga que cuenta con diez muestras tomadas de un bosque y diez en las cercanías de campos cultivados y que las muestras de bosque tienen consistentemente una alta biodiversidad del suelo ¿qué podría concluir? Si las muestras fueron seleccionadas de manera apropiada. Como ejemplo. Lo primero es centrarse en la idea de una teoría de muestreo de una “población”. Los patrones de interés son los que mantienen una consistencia a través de un número de casos.ron seleccionados y en cada punto se tomaron muestras (el protocolo de medición determina más capas en la jerarquía. ¿cuáles son? En los niveles más altos. que trata de mantener la consistencia de patrones y relaciones. En cada capa jerárquica. El objetivo de la investigación es encontrar algunos patrones. las respuestas no necesariamente estarán basadas en la ciencia. La terminología es confusa y no tiene nada que ver con una población biológica. evaluada mediante un análisis estadístico) que las muestras de bosque contienen mayor diversidad que las de los campos cultivados. entonces también se necesitará una muestra de otros bosques. relacionados con los usos de suelo. como consecuencia de la extracción de cuatro muestras tomadas para la caracterización del suelo y sub-muestras de éstas para los análisis químicos). sólo podemos hacer afirmaciones sobre el monte Kenia con base en los datos obtenidos y no es posible extrapolarlos a otros lugares. estrictaD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 61 . Por lo tanto. pero. ya que estos patrones pueden utilizarse para hacer predicciones y pueden reflejar algunas reglas o procesos. se plantean las mismas preguntas: ¿cuántas unidades deberían de ser seleccionadas?. La segunda idea es la de replicación. se podría estudiar la biodiversidad del suelo en fincas alrededor de los límites del bosque en el monte Kenia. Sin eso. Si se desean resultados que apliquen a los límites del bosque de África del Este en general. tales como los patrones de la diversidad del suelo. dicha selección se deberá basar en los objetivos del estudio y en la aplicación de algunos principios. aunque.

a través de un diseño que replique bosques y otros elementos de uso de suelo. Dentro de cada sitio de estudio se podrán establecer conclusiones más contundentes si por ejemplo. Dentro de un estudio jerárquico.mente hablando. Sin embargo. ha sido construida una cuadrícula de tal manera que incluya los dos usos de suelo. La palabra “escala” es confusa y controversial en la ecología (Peterson y Parker. los bosques en general. Nótese que no es necesario muestrear todos los usos de suelo en cada ventana. muestras múltiples de un mismo bosque no sirven al mismo propósito. Dicha cuadrícula es una “ventana” con 77 puntos de muestreo (intersecciones) definidos. Una crítica a este tercer tipo de diseño es que todos los sitios de muestreo en tierras agrícolas quedan cerca de un límite de bosque. varios bosques son muestreados. En la Figura 2. utilizando más ventanas y más pequeñas (Figura 2. puesto que representan “pseudo-réplicas”. las unidades de nivel más alto. Si este proceso de reducir el tamaño de las ventanas mientras se incrementa su número se continúa. Algunas de las implicaciones de estas ideas en el muestreo de cuadrícula son ilustradas a través de un ejemplo simplificado que se muestra en la Figura 2. para poder examinar las diferencias en la biodiversidad del suelo. la 62 Manual de biología de suelos tropicales . Por ejemplo. Un enfoque más certero es asegurar una replicación válida y algunos resultados genéricos. La replicación puede aumentarse y abarcar más área total observada.2c). El objetivo es muestrear un paisaje con dos usos de suelo.2a. patrones consistentes entre sitios. sólo podrá concluir que ese bosque en particular es más diverso y no.2. Una respuesta a esto es definir una nueva categoría de “límites de bosque” y asegurar ventanas en los tres sitios de muestreo (Figura 2. 1998). determina el nivel jerárquico donde se requiere tener réplicas. por lo que no pueden ser considerados representativos del uso de suelo. del diseño de muestreo. como los sitios de estudio pueden proveer un nivel de replicación. representan una “regla” aplicable ampliamente. probablemente. El que muestras repetidas dentro de un bosque sirvan para ser interpretadas de igual manera que las muestras de diferentes bosques depende de las propiedades de los datos y no. etiquetados como: “bosque” y “agricultura”. deberá buscar una consistencia en varias de ellos. En la Figura 2. entonces en algún momento se perderán las ventajas posibles de muestrear por cuadrícula y se terminará con un diseño que podría parecer un muestreo aleatorio de sitios individuales. Si busca una conclusión válida para los bosques.2b se pueden observar tres ventanas más pequeñas para muestrear tres diferentes parches de bosque y no uno solo. por lo tanto.2d). pero queda claro que la escala en que se anticipan o hipotetizan los patrones.

suponiendo que fue definida como áreas de 1 km². D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 63 . puede ser investigado con parcelas (sitios de muestreo) en un intervalo de distancias. La réplica dentro de la unidad es importante para determinar la precisión con que la biodiversidad del suelo es medida para cada unidad. utiliza datos en el nivel de parcela y el otro. hipótesis puede ser “la biodiversidad del suelo en parcelas agrícolas decrece con el aumento a la distancia del límite del bosque”. d) reconociendo los límites como otra categoría.2 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. se basan en datos de diferentes niveles jerárquicos: uno. por lo tanto. En este caso. Para poder evaluar la biodiversidad del suelo dentro de un 1 km². la escala espacial en que se evaluó la cobertura del bosque. Lo anterior. con varios niveles de cobertura de bosque. b) tres cuadrículas que muestrean tres diferentes parches de selva. es decir. se requerirá de más muestras.Figura 2. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. con réplicas en cada distancia. los objetivos de un proyecto de biodiversidad del suelo pueden incluir “análisis del paisaje”. se necesita definir el significado de “en el paisaje”. Una hipótesis diferente sería “la biodiversidad del suelo en parcelas agrícolas decrece con la reducción de la cobertura del bosque en el paisaje”. con la definición de algunos sitios dentro de cada unidad. En otras áreas de la ecología. sin embargo. factores del paisaje como la fragmentación del bosque. Ahora es la réplica quien determina la necesidad de varias áreas en cada nivel de cobertura de bosque. c) incrementando la replicación. no queda claro el diseño de muestreo que se necesita. Entonces la hipótesis necesita una muestra de una unidad de 1 km². pero no es relevante para afirmar la consistencia del patrón a través de la unidad de 1 km² necesaria para examinar las hipótesis. si se intenta hacer un “análisis en el nivel de paisaje”. afectan los procesos. Los dos ejemplos del párrafo anterior son análisis que utilizan factores del paisaje. El mensaje es claro: “el nivel de paisaje” no está bien definido y. datos en el nivel de unidades de 1 km².

No obstante. El muestreo adaptativo (Thompson y Seber. Los patrones a escala fina requieren puntos muy cercanos. es improbable que sean prácticos para los estudios de biodiversidad del suelo porque el trabajo necesita planearse en distintas fases de campo y de laboratorio. Aunque sean teóricamente atractivos. Cuando la investigación es dirigida a medir respuestas económicas para decisiones de manejo (por ejemplo. los métodos estándares están disponibles para ayudar a seleccionar el tamaño de muestra. biomasas y proporciones de estos grupos funciones o especies. requieren puntos más lejanos. con muchas mediciones que sólo están disponibles después de un largo periodo de muestreo en campo. ningún estudio real ha multiplicado las respuestas de interés. números. etc. a diferentes escalas. de tal manera que los patrones. Por lo tanto. se incluyen ambos 64 Manual de biología de suelos tropicales . y estudios previos similares y pilotos. cuando el objetivo de la investigación es detectar y entender algunos procesos. pero normalmente resulta difícil especificarlos. como la diversidad de diferentes grupos funcionales. es improbable su viabilidad. el tamaño de muestra se ha basado en una combinación de información de métodos formales (lo que puede indicar los órdenes de magnitud requeridos). medida de diferente manera. 1996) permite que el diseño responda a patrones que se detecten. y la variabilidad entre réplicas del mismo uso de suelo. La idea de estos diseños es elegir posiciones de muestreo. Si bien existe cierta atracción por esta idea. sin embargo.Una vez que se sepa lo que hay que replicar. muchas veces no es posible especificar un tamaño de muestra que resulte importante. pero saber qué relevancia tendrá en nuevos ambientes puede ser desconocida. Queda claro que la decisión sobre el tamaño de muestra depende de esto. Enfoques secuenciales (Pedigo y Buntin. Una estimación aproximada de la varianza puede ser obtenida de estudios previos. Patrones a escala más grande. Otra complicación surge a partir de las respuestas multivariadas de interés. Los métodos requieren conocimiento de dos cosas: de la magnitud de las diferencias (por ejemplo. Por lo tanto. Los métodos estándares presumen que existe una respuesta medible de la biodiversidad del suelo que se puede utilizar para obtener el tamaño de muestra. la respuesta de un cultivo a un fertilizante) entonces es viable especificar la respuesta mínima que es importante detectar. 1993) permiten continuar con el muestreo hasta que algunos criterios se cumplan. Una variedad de diseños a multi-escala han sido utilizados en estudios ecológicos. la diversidad del suelo entre dos usos de suelo) que es importante detectar. al igual que el software para iniciar el análisis. puedan ser investigados. en la práctica. dada la necesidad de planear campañas de campo por adelantado.

2003). la segunda. quizá en un área del orden de 100 m². Stein y Ettema. Piense en un lugar seleccionado. lo que asegura que se obtengan muestras realmente representativas. No obstante. antes de cuantificar la biodiversidad del suelo. requieren establecer comparaciones en diferentes usos de suelo. existen dos razones para ello: una. y los diferentes usos de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 65 . muestras de cada uno de ellos. esto quiere decir que se tiene que medir en el mismo lugar. Un buen enfoque para mejorar el diseño de muestreo es el uso de la “estratificación”. responde a la necesidad de contar con mediciones iguales de diferentes grupos funcionales del suelo. En cada sitio de muestreo seleccionado. puesto que habría demasiadas muestras para procesar si no fuera así. Normalmente. Así. no en función de un punto. Necesitará muestrear dentro de toda esta parcela. entonces los resultados pueden estar sesgados. esto significa que la variación y los patrones en la escala dentro de la parcela (por ejemplo. se sugiere que un buen enfoque en los objetivos de un estudio mejorará la eficiencia en su diseño e incrementará la posibilidad de lograrlos. Cuando varios grupos de especies están siendo evaluados. todas las mediciones se realizan a nivel de parcela. de tamaños adecuados.y los diseños eficientes tienen una estructura en forma de conglomerado (Urban et al. sino de una parcela.. simplemente es práctica. se requiere tomar muestras (ver esquema de puntos de medición abajo). Algunas veces se piensa que este enfoque puede estar “sesgado” porque los tipos de uso de suelo para tomar las muestras se determinan a priori. pero únicamente un volumen de suelo muy limitado puede ser examinado en la mayoría de las mediciones de biodiversidad del suelo y se toman varias muestras para poder representar toda la parcela. podrá alterar otros grupos. de manera deliberada. En este sentido. seguramente las relaciones entre ellos son importantes. Si los datos se usan para hacer afirmaciones sobre el área de estudio en general (por ejemplo. <10 m) no se han examinado. los estratos son áreas con diferentes usos de suelo y la idea es obtener. 2002. lo que quiere decir que se mezclan varias muestras de suelo. dentro de cada parcela se reúnen las muestras. El objetivo de descubrir y entender los efectos del uso de suelo en la biodiversidad del suelo. para cada uso de suelo. ENFOQUE DE OBJETIVOS: ESTRATIFICACIÓN En la introducción de este capítulo. el número promedio de escarabajos por m2) sin tomar en cuenta un diseño. normalmente sólo resulta posible examinar un grupo en una muestra de suelo dada y la extracción de la muestra de un grupo.

En un enfoque estratificado. 2 Las localizaciones de estos usos de suelo deben ser conocidas. no es deseable excluir algunos usos de suelo. sin embargo. Se requiere de un mapa de uso de suelo del área bajo estudio. Sin embargo. tiene que considerarse en algún momento. con frecuencias proporcionales a su ocurrencia en el área de estudio. La predefinición. ni aquellas zonas de transición que puedan ser importantes. es probable que la muestra incluya únicamente algunas observaciones de estas categorías. Si se emplea este enfoque. si el objetivo es hacer un inventario del paisaje. ¿dónde se encuentra el límite entre “pastizales con árboles” y “bosque secundario”?. el diseño no es parcial para el objetivo de comparar los usos de suelo y además es eficiente. el mejor diseño es tener N/2 en cada uno de los dos grupos. Por supuesto. las áreas ambiguas pueden ser excluidas del muestreo. Con un enfoque de muestreo estratificado. Si un diseño de muestreo no toma en cuenta el uso de suelo. a partir de las cuales no se podrán establecer conclusiones. ¿cuándo se debe uno de mover a lo largo de un gradiente para incrementar la cobertura de árboles? Aquí tenemos otra ganancia potencial en la eficiencia del pensamiento a través de estos requerimientos en el diseño y no sólo en la etapa de análisis. Si los objetivos incluyen investigación en límites entre áreas de diferentes usos de suelo o de nichos raros. éstos deberán ser incluidos específicamente en el muestreo. puesto que no habrá certeza en cómo clasificarlas. de no ser así. Resulta más eficiente incluirlas en un número 66 Manual de biología de suelos tropicales . entonces existen dos prerrequisitos: 1 Se necesita saber cuáles son los usos de suelo a comparar y contar con definiciones precisas de ellos. pero si el objetivo es investigar los efectos de uso de suelo. al igual que la necesidad de definir con precisión. rasgos lineales. entonces probablemente muchos de los sitios de muestreo seleccionados terminarán siendo posiciones ambiguas en lo que se refiere a la definición de uso de suelo. Si se cuenta con un total de N muestras para comparar dos usos de suelo entonces. tiene sentido excluir tales sitios. Por ejemplo.suelo pueden no estar representados en las muestras. por ejemplo. El primer aspecto hace que algunos investigadores se sientan incómodos ante la idea de que una predefinición de uso de suelo para la investigación excluya el descubrimiento de patrones potencialmente importantes. podemos elegir un tamaño idóneo de muestra para cada uso de suelo. en ausencia de alguna otra información.

si los objetivos no lo requieren. abierto al debate cuando los resultados son presentados. ya que existe la posibilidad de la interpretación de imágenes por sensores remotos (SR). no es una limitante. cuando se toman muestras en lugares considerados interesantes o importantes. y seleccionar los sitios de muestreo de manera aleatoria.suficientemente grande. Cuando se usan variables como la MOS en la estratificación. sino variables ambientales. los estudios ecológicos no siempre usan un muestreo aleatorio. entonces dicha área queda representada por esa ventana y el hecho de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 67 . no son usos de suelo per se. cuando una “ventana” única se coloca en un área. Aunque a veces es necesario. el que estos no tengan una resolución idónea. Un enfoque común no aleatorio es una selección subjetiva de los sitios de muestreo. El no contar con un mapa de usos de suelo. resultan muy útiles en la práctica. Para la implementación del MAS es necesario delimitar el área de estudio. Nótese que muchos de estos argumentos también aplican cuando los factores hipotéticos que influyen sobre la biodiversidad del suelo. Si se toma un tamaño de muestra subjetivo igual a 1. puede ser útil hacer un monitoreo rápido de la MOS. la limitante de este enfoque es la posible falta de “representatividad” del área de muestreo (la medida en que los resultados pueden razonablemente ser asumidos para aplicarlos a una población más grade) porque ésta depende de la percepción del ejecutor y no. MUESTREOS ALEATORIO Y SISTEMÁTICO Las razones esenciales para utilizar el muestreo aleatorio simple (MAS) fue descrito anteriormente y son detalladas en textos tales como Cochran (1977). calibrarlo en un mapa de uso de suelo. de la propiedad inherente del diseño. Sin embargo. de tal modo que: a) cada punto tenga las mismas posibilidades de ser seleccionado. esto es equivalente a limitar el área de estudio. o bien. algunas veces por una buena razón. influenciadas por el uso de suelo. por ejemplo. tales como la MOS o la frecuencia de fuego. Por ejemplo. Ello queda. El muestreo aleatorio estratificado requiere hacer lo mismo en cada estrato. o en imágenes de SR y utilizar esto para definir los estratos. por lo tanto. que frecuentemente sirven como base para seleccionar unidades de muestreo a niveles jerárquicos más altos. si los objetivos lo requieren. El uso de un software para ayudar en la aleatorización y un GPS para localizar los puntos de muestreo en el campo. y b) la selección de un punto no cambie la probabilidad de incluir cualquier otro punto. excluirlas (dándoles un equivalente de tamaño cero).

que esa área sea o no, representativa dependerá únicamente de la habilidad del ejecutor. El muestreo sistemático tiene muchas aplicaciones en la ecología, usando transectos de una dimensión o cuadrículas de dos dimensiones. En el caso de los transectos, las muestras son seleccionadas en puntos que se encuentran a una distancia fija entre sí, a lo largo de una línea predeterminada. Para un muestreo de cuadrícula, una cuadrícula rectangular (usualmente) es definida en el área y las muestras son tomadas en cada punto de intersección. Las ventajas potenciales de este tipo de muestreo sistemático se derivan de la teoría y de la práctica. Las ventajas de la práctica incluyen:
• La facilidad de localizar puntos de muestreo, describir su ubicación y los medios de llegar a los puntos de muestreo; por ejemplo, el protocolo puede ser algo tan simple como “desde el punto de partida, camino al norte y muestreo cada 50 m”. • La facilidad de planear el trabajo de campo; por ejemplo, de estimar el tiempo requerido para muestrear un número fijo de puntos. La razón estadística para utilizar muestreos sistemáticos es que pueden ser eficientes (Webster y Oliver, 1990). Si se considera un estudio con el propósito de calcular la media o el total de algún parámetro (por ejemplo, el carbono total en el suelo en el área de estudio o la media de escarabajos por m2). Si la cantidad medida no es constante, una muestra que utilice la cuadrícula dará una mejor estimación que una simple muestra al azar del mismo tamaño, lo que frecuentemente es el caso de variables ambientales y biológicas. La eficiencia se basa en el hecho de que puntos cercanos son similares, por tanto, no proporcionan mucha información nueva; mientras que en la cuadrícula las muestras están de manera uniforme en toda el área de estudio. Por razones similares, el enfoque de cuadrícula resultará útil para compilar el inventario de un área bajo estudio, salvo que puede excluir nichos raros (véase abajo). Sin embargo, hay aspectos negativos: • Algunos puntos de la cuadrícula tendrían que ser excluidos del estudio, tales como caminos o cuerpos de agua. • Las cuadrículas incluyen muestras de diferentes usos de suelo, con un tamaño más o menos proporcional en cada tipo de uso de suelo. En particular, tipos de uso de suelo raros pueden ser omitidos, lo que se puede compensar moviendo
68
Manual de biología de suelos tropicales

la ventana y añadiendo puntos, aunque el proceso podría llegar a ser arbitrario y subjetivo. • Algunas veces no es posible caracterizar el uso de suelo claramente en cada punto de muestreo. Estos puntos están relacionados con el problema discutido en la sección “enfoque de objetivos: estratificación”. Si el objetivo del estudio es comparar clases de uso de suelo, entonces el muestreo por cuadrícula, a veces, no los captura de forma óptima, de manera que las cuadrículas y los transectos probablemente son más apropiados para muestrear la biodiversidad del suelo, cuando a) no existe ningún objetivo explícito o hipótesis que involucre comparaciones o relaciones con variables ambientales, o b) la hipótesis se refiere a una unidad espacial de un nivel más alto que la escala en que el muestreo por cuadrícula o por transecto fue hecho. Por ejemplo, Swift y Bignell (2001) recomiendan transectos de 40 m de largo, pero éstos quedan dentro de cada clase de uso de suelo. Cuando se comparan usos de suelo, se hacen réplicas de los transectos y se asignan aleatoriamente los estratos definidos por diferentes usos de suelo. De esta forma, el muestreo sistemático por cuadrícula o transecto, normalmente, es combinado con un muestreo aleatorio. Por ejemplo, puede haber varias cuadrículas definidas como se aprecia en la Figura 2.2d, con una localización y orientación hecha al azar. De manera similar, el punto de inicio y la orientación de los transectos que se repiten pueden ser hechos aleatoriamente. Los transectos también pueden ser útiles cuando se alinean con gradientes ambientales considerados importantes; esto se conoce como “gradsectos” (Wessels et al., 1998). Con la aleatorización en algún nivel en la jerarquía, es posible hacer un análisis estadístico basado en las propiedades aleatorias del diseño; por ejemplo, si un número de cuadrículas pequeñas es colocado aleatoriamente en el área de estudio, entonces contamos con las réplicas necesarias para establecer una consistencia, a través de patrones encontrados. El análisis estadístico elegido para una muestra tomada en un diseño sistemático no puede estar basado en la aleatorización, porque los sitios no fueron seleccionados de manera independiente dentro de cada cuadrícula. Existen dos posibles enfoques para el análisis: el primero asume que los datos se comportan de forma aleatoria (por ejemplo, las propiedades estadísticas son las mismas, como si el punto hubiera sido localizado aleatoriamente); el segundo, es utilizar un modelo explícito de patrones espaciales. En la mayoría de los análisis que buscan relaciones entre variables ambientales y la biodiversidad del suelo se usa el primer análisis,
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

69

principalmente, porque las alternativas son complejas. Las consecuencias de suponer esto son raramente investigadas. Es claro que la distancia y el tamaño total de la cuadrícula determinan la escala de los patrones que pueden ser detectados. No es posible observar patrones (por ejemplo, agregación de la biodiversidad del suelo) a escalas espaciales menores que las distancias entre los puntos de la cuadrícula; de la misma manera, tampoco será posible detectar patrones más grandes que el tamaño total de la cuadrícula. Sólo se pueden reconocer los patrones cuando existen varias repeticiones dentro de la misma cuadrícula. Es este aspecto de escala de patrones, definido por los objetivos del estudio, el que debería determinar los espacios y el tamaño total de la cuadrícula. Algunas veces se sugiere que los espacios deben ser de tal manera que los puntos vecinos no estén correlacionados. Esta noción de correlación espacial es importante, pero también confusa. La correlación entre las mediciones de una determinada distancia, no es una cantidad absoluta, pero es una medida relativa a un promedio (técnicamente, el problema tiene que ver con el recambio). Para poder ver esto, piense en analizar datos de una sola ventana en Kenia, donde los puntos de una distancia de más de 200 m entre sí, pueden no indicar similitud en la biodiversidad del suelo, pero si juntamos los datos con otra base de datos global se esperaría encontrar similitud, no sólo en los puntos que pertenecen a una misma ventana, sino entre todos los puntos dentro de Kenia. HABLANDO DE VARIABILIDAD La experiencia de estudios pasados sugiere que se debería de esperar un alto nivel de variación en muchas de las mediciones principales de la biología del suelo. Aún cuando se trata de distancias cortas, se puede esperar una variación grande en número y diversidad de diferentes grupos funcionales. En paisajes agrícolas tropicales la variación dentro de una categoría de uso de suelo puede ser debida a las prácticas de manejo, la variación en las características de la vegetación, las diferencias históricas en el uso de suelo de la parcela, efectos de borde, posición topográfica y características biofísicas. Si los métodos formales para determinar los requerimientos del tamaño de muestra fueran seguidos, probablemente indicarían un tamaño de muestra mucho más grande de lo es viable o costeable, ¿Qué se debe hacer entonces? Primero, ¡no tiene sentido no hacer nada! Simplemente, si se sigue con un tamaño de muestreo preconcebido, no se alcanzarán los objetivos; si el plan original fue
70
Manual de biología de suelos tropicales

trabajar con diez muestras por cada uso de suelo dentro de un sitio de referencia, y las indicaciones son que se necesitan alrededor de 100 muestras por cada uso de suelo, no tiene sentido continuar, puesto que se terminarán obteniendo resultados vagos y no concluyentes, los cuales se traducirán en errores estándares altos y sin efectos significativos cuando se analizan los datos. Tres son las posibles opciones: 1. Incrementar el tamaño de muestra. 2. Utilizar métodos de muestreo para reducir la variabilidad. 3. Reducir la amplitud del estudio. La primera opción no resulta práctica en la mayoría de los casos, pues siempre hay limitaciones de tiempo, dinero, recursos y experiencia. Existen varios métodos para reducir la variabilidad de las muestras; los más útiles consisten en la estratificación y la congruencia. Nótese que el uso del término “estratificación” se usa para el muestreo, pero es diferente a cómo se aplica en “enfoque de objetivos: estratificación” (arriba). Si algunas fuentes de variabilidad pueden ser previstas, éstas pueden ser usadas para definir estratos y removerlas del análisis. Por ejemplo, si el sitio de estudio cubre un rango de altitudes, se puede esperar una variación en la biodiversidad del suelo dependiendo de la altitud. La estratificación, entonces, divide el sitio de estudio en zonas de altitud y los sitios de muestreo dentro de cada una de ellas. En esta fase del análisis de datos, la variación de los usos de suelo se compara dentro y entre estratos para no oscurecer los resultados. Este enfoque requiere que algunos (no todos) de los diferentes usos de suelo estén localizados dentro de zonas de altitud. Si el uso de suelo únicamente varía con la altitud, entonces los dos factores están confundidos y sus efectos en la biodiversidad del suelo no se distinguen. Dado que existe una variación ambiental, la variabilidad en la biodiversidad del suelo estará en respuesta a la variación ambiental. Consecuentemente, los estratos pueden ser útiles para definir puntos de muestro cercanos geográficamente. Las ventanas en la figura 2.2 pueden ser vistas de esta manera. Comparar conlleva la idea de la estratificación a un extremo. Imagine que si dos de los usos de suelo a comparar son bosque y campos de maíz, se puede esperar que la biodiversidad del suelo dependa de muchas variables ambientales, tales como el clima, topografía, y geología. Estas variables ambientales varían típicamente de manera irregular, con sitios cercanamente similares. De esta manera, si seleccionamos parcelas de bosque y maíz que están cercanas, las diferencias entre ellas, principalmente, se deberán al uso de suelo y no, a otros factores, lo que nos
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

71

permite eliminar las variables que “meten ruido” en el análisis. Entonces, el enfoque sería identificar y muestrear, por ejemplo, diez pares de sitios, donde cada par esté formado por parcelas de bosque y maíz cercanas, situadas a cada lado de un lindero de uso de suelo. Formalmente, cada par constituye un estrato de tamaño 2. Más de dos usos de suelo pueden incluirse en el diseño. Las ideas de diseño para experimentos de bloques incompletos son relevantes para seleccionar pares de usos de suelo similares. Controlar la variabilidad mediante la reducción del área de estudio, muchas veces es la mejor solución. El área podría ser reducida, si se reduce el tamaño del sitio de muestreo, reduciendo naturalmente la heterogeneidad, lo que puede ser insatisfactorio porque también reduce la generalidad de los resultados. Si únicamente tomamos muestras en un área pequeña, entonces no existe una base para asumir que se han encontrado patrones ampliamente aplicables. Otras maneras de reducir el ámbito del sitio de estudio son: No incluir todos los usos de suelo encontrados en el área de estudio, sino una selección que cubra un gradiente de intensidades de uso de suelo o que represente alguna transición típica en el uso de suelo. Ajustarse a la definición de una clase de uso de suelo. Por ejemplo, en lugar de tomar un “campo de maíz” como uso de suelo, se podrá limitar la atención a campos de maíz que han sido cultivados continuamente durante los últimos diez años, que no han sido fertilizados en los últimos tres años y que son trabajados con azadón. Evitar tomar muestras en sitios ambiguos, como aquellas que se encuentren cerca de linderos. Mientras esto ayudará a detectar y medir el efecto de la intensidad de uso de suelo en la biodiversidad del suelo, pueden ser inconsistentes con los objetivos del inventario de las especies. Un compromiso entre los dos objetivos puede ser necesario. Esto es común en el diseño de proyectos y, en resumidas cuentas, no se puede esperar encontrar todo en un tamaño limitado de muestra. ESQUEMA DE MEDICIÓN DE PUNTOS Una vez localizados los puntos de muestreo, tiene que ser definido un protocolo de medición, lo que implica la necesidad de un muestreo adicional. El esquema básico
72
Manual de biología de suelos tropicales

de muestreo por puntos adoptado por el CSM-BGBD se presenta en la Figura 2.3, que a la vez se complementa con la Tabla 2.1. Aunque el esquema de medición utilizado para el muestreo de grupos funcionales que son descritos por los procedimientos del proyecto alternativas de roza, tumba y quema (Swift y Bignell, 2001), es diferente de lo que fue propuesto por Swift y Bignell para adecuarse al enfoque basado en la cuadrícula. Por ejemplo, los pocos monolitos en cada punto de muestreo son compensados por el gran número de puntos de muestreo, que resulta en aproximadamente el mismo número de eventos de muestreo. No obstante, los resultados preliminares han indicado que con un pequeño monolito por punto de muestreo no todas las especies pueden ser capturadas. Si éste es el objetivo para llevar a cabo el muestreo, se prevén opciones adicionales para incluir monolitos más grandes. Macrofauna: un solo monolito, trampas de caída (pitfall) y, por lo menos un transecto de 20 m son colocados en cada sitio de muestreo. El muestreo por transectos se amplía para incluir hormigas y escarabajos, en adición a las termitas. En un esquema alternativo adicional los monolitos pueden ser excavados para mejorar el muestreo de lombrices de tierra y se puede introducir un sistema simple para tomar muestras de termitas. Nótese que en las parcelas pequeñas, los sistemas de cultivo pueden estar altamente disecados o los terrenos son difíciles, por lo tanto, no es necesario que el transecto sea lineal. Un transecto puede tener un ángulo de 90 grados, y muestrear parcelas de forma irregular o para evitar arroyos, fuertes pendientes o rocas. Los árboles caídos deben incluirse en el transecto si estos quedan sobre la línea (Swift y Bignell, 2001). Mesofauna: 12 extracciones de suelo tomadas en círculos concéntricos alrededor de un solo monolito a 3 y 6 metros de radio, y extraídas utilizando el método Berlese. Adicionalmente, las trampas pitfalls sin cebo abiertas durante un periodo de 24 horas sirven para colectar mesofauna y macrofauna que viven en la superficie. Las trampas pitfalls generalmente son apropiadas para hormigas, algunos escarabajos, algunos saltamontes, milpiés y arañas. Muestras de suelo extraídas con sacabocado por el método de Berlese contienen colémbolos, ácaros y en sitios húmedos enquitreidos. Microfauna: muestreos con sacabocado de manera similar en 12 extracciones de suelo de dos círculos concéntricos, a 3 y 6 metros de radio del monolito. La “microfauna”, principalmente se refiere a nematodos, aunque también a pequeños ácaros (y larvas de ácaros) extraídos de las muestras de suelo; por el método Berlese pueden cuantificarse.
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

73

Figura 2.3 Esquema de muestreo por puntos para toda la biota. El muestreo se puede ampliar si se usa uno o dos transectos para termitas, hormigas y escarabajos, mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.

Monolito Núcleo de suelo para mesofauna Núcleo de suelo para nemátodos y microbios Muestras para análisis físicoquimicos Transecto 1 m2 para muestra de hojarasca (Winkler) Trampa pitfall

Microsimbiontes y hongos del suelo: muestreos de manera similar mediante 12 extracciones de suelo con sacabocado, puestas en dos círculos concéntricos alrededor de un solo monolito, a 3 y 6 metros de radio. Parámetros físicos y químicos del suelo: cuatro extracciones de suelo con sacabocado puestas en un círculo de 6 metros de radio de un monolito. En el caso de estudios de co-ubicación, una extracción adicional de suelo puede tomarse de la pared exterior de la zanja del monolito (véase Capítulo 3, muestreo de macrofauna). En un esquema alternativo (Figura 2.4) los usos de suelo pueden ser muestreados por una combinación de monolitos principales y subsidiarios, transectos de 50 metros, cuadrantes de hojarasca espaciadas y trampas pitfalls. El muestreo casual alrededor de los transectos puede ser empleado y también trampas Malaise colocadas para capturar insectos voladores mayores. El protocolo difiere de la propuesta anterior, en lo concerniente a los puntos del transecto, cuadros de hojarasca, trampas pitfalls y monolitos subsidiarios colocados en líneas paralelas de 50 m, con una separación lateral de 10 m. Este protocolo debe ser tomado básicamente como una extensión del propuesto anteriormente y se considera aplicable en donde se le dé más importancia al muestreo de todas las especies que existen dentro del área y en los casos donde la frecuencia de muestreo es baja (número de parcelas muestreadas) por las razones explicadas anteriormente. Estas modificaciones
74
Manual de biología de suelos tropicales

resultan más adecuadas cuando se encuentran diferentes usos de suelo en todos los sitios. CONSIDERACIONES PRÁCTICAS EN LA ORGANIZACIÓN DEL TRABAJO DE CAMPO La colecta de muestras o la medición directa en el campo deberían, en la medida de lo posible, realizarse de forma secuencial y durante una sola salida. En el caso de parámetros físicos y químicos del suelo que permanecen estables en el tiempo, el muestreo puede hacerse en un momento diferente. Lo anterior, por supuesto, no se aplica en el caso de características dinámicas del suelo, por ejemplo, el contenido de agua en el suelo.
Figura 2.4 Esquema alternativo para muestrear macrofauna, utilizando un transecto de 50 m.
Extracción Winkler Transecto Mini-monolito

Trampa pitfall Monolito adicional
12 muestras de suelo (12 x 12 x 10 cm)
MS MS MS MS

Monolito principal 10 m

10 m 10 m 5m 50 m
MS MS MS

MS MS

Monolito adicional

MS MS MS

30 cm Hormigas de hojarasca Hormigas endogeas Termitas

2m

D iseño

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

75

Tabla 2.1 Grupos de organismos del suelo colectados utilizando diferentes métodos de captura.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Manual de biología de suelos tropicales
Suelo Mesofauna Descripción X X X X X X X X

76
Trampas pitfall con cebo* - 3 trampas por punto de muestreo. Las trampas se deben quitar después de 48 horas en campo. Transectos semi-cuantitativos 2 x 20 m uno por punto de muestreo, perpendicular a la pendiente Trampas Winkler para muestras pequeñas de hojarasca (1 x 1 m) a lo largo del transecto, 3 Winkler por punto de muestreo Núcleos de suelo con hojarasca (3.5 x 3.5 x 5 cm),12 submuestras por punto de muestreo (profundidad de 0-5 cm). Para mesofauna se hace una muestra compuesta (1er opción), o 4 muestras compuestas por 3 submuestras de cada cuadrante (segundo opción) o 3 muestras compuestas por 4 submuestras. Núcleos de suelo para microbios de 0-20 cm de profundidad sin hojarasca. En círculos a 3 y 6 m, del punto de muestro, una muestra compuesta de 12 submuestras por punto de muestreo.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

Trampa (pitfall)

X

X

X

Transecto

X

X

Trampa Winkler

X

X

X

Embudo de Berlese

X

X

X

Varios

Tabla 2.1 Continúa.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Monolito X

X

X

X

X

X

X

Mesofauna

D iseño
Suelo Descripción Monolito (25 x 25 x 30 cm), incluyendo hojarasca, una muestra por punto método TSBF. Muestra de suelo, una muestra compuesta de suelo por al menos 4 submuestras para análisis físicos y químicos, profundidad 0-10; 10-20; 20-30 cm.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

*Nota.- El cebo sugerido para las trampas pitfall es excremento de monos o de humanos, el cual es muy efectivo para extraer escarabajos coprófagos (Coleoptera) y, al mismo tiempo, no interfiere con la captura de escarabajos saprofíticos (Scarabaeidae, Aphodidae, Trogidae) y predadores (Sistiridae, Staphilinidae). El excremento de omnívoros, resulta más adecuado, en el caso de áreas de selva tropical porque los omnívoros predominan en estos ambientes

77

La colecta de muestras de los principales grupos funcionales de organismos del suelo, requiere de la colaboración de mucha gente en cada punto de muestreo, con el riesgo de lastimar el cultivo en pie, al igual que afectar el inventario, especialmente de aquellos organismos con alta motilidad o sensibles a la intromisión humana. Por ejemplo, las lombrices de tierra epígeas y algunos tipos de termitas comedoras de tierra son sensibles al disturbio, y especialmente a las pisadas, por lo que se alejarían rápidamente. Por lo tanto, es importante reducir el número de personas involucradas en la colecta de las muestras, aunque se necesita un número suficiente de manos para poder manejar y procesar las muestras. Durante el entrenamiento de técnicos y asistentes de campo, es necesario prestar atención a los riesgos que pudieran surgir en cada grupo específico de organismos de suelo. El riesgo de contaminación cuando se trata de microorganismos debe ser entendido y la importancia de utilizar procedimientos adecuados para evitar la contaminación debe ser enfatizada, especialmente en las personas inexpertas. El mismo principio rige cuando existe la posibilidad de que dichos organismos escapen de los sitios de muestreo, como consecuencia de una severa perturbación. Otra preocupación es el gran volumen de suelo que será colectado durante el muestreo y la necesidad de reducir dicho volumen para transportarlo. Desde este punto de vista, la extracción de especímenes de las muestras se hace mejor en, o cerca, del sitio de muestreo. También, en el sitio de muestreo se deben agrupar todas las muestras y extraer sub-muestras para su posterior análisis. El tiempo y la temperatura a la que se almacenan las muestras juegan un papel importante, dado que muchos organismos del suelo pueden morir a temperatura ambiente, en la superficie del suelo, o cuando son guardados en bolsas o contenedores durante unas cuantas horas. Para poder evitar dichos riesgos es importante identificar una instalación local adecuada antes de colectar las muestras o, hacer la extracción inmediata in situ de los especímenes. En algunas ocasiones, por ejemplo, el embudo de Berlese para la mesofauna y de Winkler para la extracción de hormigas y escarabajos de la hojarasca, pueden instalarse en el campo para su uso inmediato; en otros casos, cuando los organismos necesitan ser cultivados in vitro o cuando las propiedades del suelo necesitan ser determinadas, es necesario disponer de un transporte rápido para su traslado hacia el laboratorio. Bajo ninguna circunstancia las muestras deberán permanecer bajo el sol, ni aun cuando el protocolo de extracción requiera de un secado final de la materia. Otros detalles sobre las precauciones a tomar en cuenta y consejos
78
Manual de biología de suelos tropicales

sobre la logística general, se pueden encontrar en los capítulos que tratan grupos y métodos específicos.

MUESTREO EN EL PROYECTO CSM-BGBD
La jerarquía de muestreo
En el proyecto fueron seleccionadas áreas de siete países tropicales, con el propósito de evaluar la pérdida de biodiversidad del suelo con el incremento en la intensidad del uso de suelo. Los sitios se localizaron en las principales regiones biogeográficas de los trópicos, desde la selva tropical húmeda Amazónica hasta la selva montañosa del Himalaya, en la India; áreas que presentan una biodiversidad global importante. Cada sitio incluyó un intervalo de usos de suelo desde selvas prístinas relativamente no perturbadas, hasta tierras agrícolas sometidas a uso intensivo, para determinar tendencias comunes, que puedan ser observadas en el cambio de la biodiversidad del suelo en relación con la intensidad del uso del suelo. El uso de métodos estándares de muestreo en los países y sitios de estudio, permite hacer comparaciones entre los sitios. Se adoptó un enfoque para el muestreo dentro de los sitios que hace uso del muestreo por medio de ventanas. Una ventana es (usualmente un rectángulo) una parcela de tierra que incluye en el estudio varios usos de suelo locales y se consideran “representativos” de los sitios de estudio. Típicamente, las ventanas miden entre 2 y 5 km²; estas ventanas de muestreo varían en tamaño y número debido a la configuración del uso del suelo en cada sitio, y sólo se presentó un caso donde el acceso fue problemático. Por ejemplo, se utiliza una ventana más grande para incluir los usos de suelo relevantes en el área y hasta seis ventanas más pequeñas se distribuyen dentro del área para los diferentes usos de suelo requeridos. Una cuadrícula regular (con espacios variables, véase a continuación) se utiliza para identificar un conjunto de posibles puntos de muestreo dentro de cada ventana; los puntos corresponden a las intersecciones de las líneas en la cuadrícula. El muestreo de cuadrícula se usó por las razones descritas anteriormente, eficiencia estadística y para racionar el trabajo de campo. Además, el inventario es de naturaleza exploratoria, sin tomar en cuenta la hipótesis general formulada, pues quedan pendientes las siguientes preguntas: ¿cuáles de los factores que determinan las prácticas intensivas de uso de suelo influyen en la distribución y riqueza de la biota del suelo? y, ¿a qué escala los patrones de distribución espacial se manifiestan? Este
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

79

enfoque es similar al usado para el proyecto de BioAssess, financiado por la Unión Europea, cuyo objetivo, similar al de éste proyecto, fue evaluar la biodiversidad en función de la intensidad del uso del suelo en paisajes agrícolas (véase Ponge et al., 2003; Federoff et al., 2005). La biodiversidad del suelo se muestrea en el nivel de parcela (punto de muestreo o sitio). La cuadrícula define una serie de parcelas, con un objetivo de cerca de 100 a 200 parcelas por ventana. La parcela es un área de, por lo menos, 25 x 25 m determinada por el área mínima requerida para colectar todas las muestras necesarias y realizar su medición, tal y como se describió anteriormente. El principio de co-ubicación es adoptado para análisis de muestras físicas y químicas del suelo y para los inventarios de la biodiversidad del suelo. Al mismo tiempo las ventanas permiten comparar la biodiversidad del suelo entre los componentes del paisaje.

Localización y definición de las ventanas de muestreo y cuadrícula
La posición de las ventanas dentro del sitio de estudio se hace de tal modo que abarque los diferentes usos de suelo. Generalmente, una ventana no puede abarcar los diferentes usos del suelo, por lo que son necesarias otras ventanas más pequeñas. La Figura 2.5 describe las distintas configuraciones utilizadas. La Figura 2.5a ilustra el uso de una ventana de 9 x 11 puntos de muestreo (además de algunos puntos adicionales de muestreo). La figura 2.5b ilustra el uso de 6, 3 y 2 ventanas separadas. En el caso donde se usan seis ventanas separadas, una ventana medirá 1 km², dependiendo de la distancia entre los puntos de la cuadrícula. En sitios caracterizados por fuertes pendientes se esperaría que el gradiente del uso del suelo esté orientado en la misma dirección, y las ventanas estarán entonces localizadas a lo largo del gradiente (Figura 2.5b). En los linderos de la selva en los trópicos, frecuentemente se observa que el patrón de distribución de usos de suelo refleja un gradiente de intensidad de uso de suelo, con un uso más intensivo a mayor distancia de la selva. En tales casos, las ventanas de muestreo se localizan a lo largo de tal gradiente. Se necesita, por lo tanto, contar con suficientes conocimientos de la región antes de seleccionar los sitios de muestreo. Cuando algunos gradientes no son obvios, la selección de las ventanas deberá cubrir dos o tres de los usos de suelo más importantes y, por tanto, también las transiciones observadas con mayor frecuencia de un tipo a otro tipo de uso de suelo. Por ejemplo, en los márgenes del bosque puede darse la transición de bosque a pastizal, bosque a tierras de cultivo o bosque a grandes plantaciones, en donde
80
Manual de biología de suelos tropicales

Esto permitirá un análisis comparativo de transiciones de uso de suelo (por medidas relativas). con puntos de muestreo adicionales. el área ocupada por cada uso de suelo. Figura 2. Lo anterior se obtiene mediante varias configuraciones de ventana(s) D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 81 . variaciones topográficas o climáticas. se introduce un elemento de replicación. Cuando se encuentran disponibles mapas digitales de uso de suelo. Mapas detallados de uso de suelo y de vegetación también son adecuados para este propósito.5 Ejemplos de diferentes configuraciones de ventanas de muestreo. se hace una selección manual por interpretación visual. dispuestas a lo largo del gradiente.una ventana cubre cada transición típica de uso de suelo. De esta forma. mientras minimiza los cambios en la biodiversidad del suelo que surgen de los diferentes usos. lo que facilitará la selección de las ventanas. a) cuadrícula completa. Para la selección de las ventanas de muestreo se utilizaron fotos aéreas o imágenes de satélite de alta resolución. tres y dos ventanas. Cuando únicamente están disponibles materiales análogos. utilizando un papel traslúcido sobre la fotografía. antes que un cambio de uso de suelo per se. b) ilustración de la división de una cuadrícula entre seis. dentro de una ventana definida puede ser determinada utilizando software de Sistemas de Información Geográfica (SIG) estándar. Número de parcelas de muestreo y tamaño de la cuadrícula El número total de puntos de muestreo por área de referencia se mantiene fijo entre 100 y 120. según se requiera.

cada uso de suelo es evaluado en. termitas). suponiendo que existan entre seis y siete usos de suelo distintos por cada área de referencia (correspondientes a seis o siete clases de usos de suelo generalmente definidos en el sistema de clasificación de usos de suelo) donde cada uso de suelo es muestreado por tres transectos. Los resultados del inventario del proyecto CSM-BGBD indican que es necesario un esfuerzo mínimo de muestreo de 100 a 120 puntos para poder capturar la mayoría de las especies dentro del sitio. dando un total de 90 a 105 monolitos muestreados (y el mismo número de muestras agrupadas para evaluar los microsimbiontes) aproximadamente igual al número de puntos en la cuadrícula. termitas y hormigas). 2002.. En este sentido Swift y Bignell (2001) argumentan.de muestreo y las dimensiones de las cuadrículas.. y el procedimiento recomendado por el proyecto ASB (Swift y Bignell. La principal diferencia con el enfoque de muestreo de cuadrícula. en parte por consideraciones logísticas. Se añaden puntos de muestreo donde el uso de suelo es altamente variable. Por ejemplo. En este último. el número de puntos de muestreo deberá incrementarse de 5 a 8 por transecto (es decir. Mientras el tamaño de muestra sigue siendo más o menos igual en los transectos y cuadrículas. Davies et al. De esta manera. que para incrementar la confiabilidad de los datos del esquema basado en transectos. 2003) recomienda un número similar de puntos de muestreo. En un muestreo basado en transectos la idea de replicación recomendada por Swift y Bignell (tres transectos por cada uso de suelo) casi nunca se logra. en el caso de por lo menos algunos de los grupos funcionales (ej. más puntos en la misma parcela). 2003). por lo menos. otra opción es ensamblar de una manera sinóptica por combinación de transectos a lo largo de diferentes años o en proyectos no relacionados (ej. descritos anteriormente.. con un transecto extendido en el caso de algunos grupos (por ejemplo. el esfuerzo de muestreo promedio probablemente varía. El número total de puntos de muestreo concuerda con otras estrategias de muestreo propuestas en ejercicios similares de evaluación de la biodiversidad. un transecto de 40 x 5 m. del cual un mínimo de cinco monolitos son cavados para muestrear la macrofauna y cinco muestras conjuntas para los microsimbiontes. La captura adicional de especies requiere de un esfuerzo de muestreo considerable. Con 100 a 200 puntos por área de referencia generalmente se llega al punto donde la curva de acumulación de las especies para grupos de macrofauna es asintótica. es que únicamente se toma un monolito y una muestra agrupada para los microsimbiontes por parcela. el diseño 82 Manual de biología de suelos tropicales . el proyecto BioAssess (Ponge et al. Eggleton et al. 2001) tendrá un esfuerzo de muestreo comparable.

Dado el alto nivel de variación en las medidas de los componentes de la biodiversidad del suelo. el procedimiento correcto para reducir el número total de puntos de muestreo deberá ser estimado. 1998). El número de muestras requeridas por uso de suelo deben ser representativas de la biodiversidad del suelo presente y entonces. La colecta de muestras rara vez es el paso que limita la evaluación de la biodiversidad porque la extracción. Número de puntos de muestreo por categoría de uso de suelo Con seis o siete tipos de uso de suelo en cada área determinada. La experiencia del proyecto CSM-BGBD indica que el procesamiento de 100 a 120 muestras es viable con los recursos generalmente disponibles. si esta prueba confirma alta variabilidad en la biodiversidad del suelo dentro de las D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 83 . el número de puntos por categoría de uso de suelo aumenta. basándose en otros datos o en un estudio piloto. Con menos categorías de uso de suelo presentes.de muestreo se ajusta a los objetivos del inventario del área de estudio. Se aconseja hacer una prueba piloto para informar el diseño de muestreo. es importante considerar el número mínimo de puntos requeridos para cada categoría de uso de suelo. restringir el número de usos de suelo de manera que el esfuerzo total sea compatible con la capacidad de procesamiento. etc. En números pequeños o en una distribución irregular de puntos de muestreo en los diferentes usos de suelo. identificación y catalogación de especímenes son los pasos que requieren mayor tiempo en el proceso (Lawton et al. Se le da prioridad al tipo de agricultura de subsistencia a la hora de incrementar el número de muestras porque es precisamente en esta categoría dónde se espera que ocurra una mayor variación debido al manejo. normalmente no todas las especies son capturadas y hará más difícil demostrar las diferencias en biodiversidad del suelo entre los tipos de usos de suelo que normalmente se caracterizan por una alta variabilidad en la riqueza de especies. un promedio alrededor de 15 puntos por clase de cobertura de suelo resultan de muestrear la cuadrícula. historia. Si la capacidad para procesar y analizar esta cantidad de muestras no está disponible.. Reducir el número de puntos de muestreo por categoría de uso de suelo mientras se mantiene el número de categorías de uso de uso de suelo investigado puede comprometer el objetivo de obtener resultados estadísticamente verificables. en lo que concierne a la evaluación de la diversidad de especies. pero aun así se requiere de una campaña organizada en el campo y de instalaciones establecidas para poder procesar y analizar las muestras.

se necesita una 84 Manual de biología de suelos tropicales . de acuerdo con los principios detallados en “Hablando de variabilidad” (arriba). de forma separada hasta que se cumpla con el requerimiento del número mínimo de puntos de muestreo. se aplica un procedimiento no-sesgado para restar un número de puntos que permitan contrarrestar el incremento en el número total de puntos de muestreo que resulta de ampliar la cuadrícula. seleccionar las clases de uso de suelo que cubren un claro gradiente en intensidad de usos de suelo. Cuando éste no es el caso. Aunque la inserción de puntos adicionales es conveniente. La segunda opción es seleccionar puntos adicionales dentro de las ventanas entre los puntos existentes de la cuadrícula para aquellas categorías de uso de suelo que están siendo muestreadas.6. de tal manera que se cumpla el criterio para un mínimo número de puntos de muestreo en cada uno de los tipos de uso de suelo. Para poder seleccionar o eliminar sitios de muestreo (parcelas) es necesario conocer los usos de suelo en cada punto de la cuadrícula y se requiere de un inventario de uso de suelo previo al muestreo de la biodiversidad del suelo. se define una cuadrícula mayor (resaltando el número de intersecciones). El enfoque de la cuadrícula asume un acceso libre al terreno o parcela donde se localizan los puntos de muestreo. Esta estrategia implica incluir ventanas de muestreo irregulares. deberán hacerse algunos intentos para aleatorizar la selección de los puntos originales para ser divididos en dos. Para este propósito. La definición de un sistema de clasificación de uso de suelo se detalla en el Capítulo 11.categorías de uso de suelo. entonces se hace un ajuste de la definición de clases de uso de suelo.5a. De la misma manera. se puede partir de una cuadrícula vacía (que únicamente contenga posibles puntos de muestreo). Este procedimiento permitirá eliminar los puntos que caigan en tipos de uso de suelo no especificados. donde la distancia mínima entre puntos necesita ser respetada. Una estrategia es usar una “cuadrícula estratificada” según lo ilustrado en la Figura 2. posteriormente. con el propósito de seleccionar aleatoriamente puntos de muestreo para cada categoría de uso de suelo. Adaptación del enfoque de muestreo a condiciones de campo Hay dos estrategias disponibles para asegurar una representación de los usos de suelo y clases de cobertura en el muestreo. Esto implica adoptar un nivel más alto de detalle en el sistema de clasificación de uso de suelo y. Esta opción se puede observar en la Figura 2. mientras se cumplen los requerimientos para el número mínimo de puntos de muestreo para cada categoría de uso de suelo. Posteriormente.

aquéllos de carbono orgánico y prácticas de cultivo. Por ejemplo: en un área determinada en México. Distancia entre los puntos de muestreo La distribución de los organismos del suelo puede reflejar gradientes. estrategia de muestreo alterna. de una a tres ventanas fueron colocadas en cada comunidad disponible.6 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada.Figura 2. el acceso a las tierras de los agricultores estuvo restringida. en lugar de utilizar una cuadrícula regular que cubriera un área mayor. Los patrones de distribución de los organismos del suelo puede correlacionarse con la topografía. debido al aislamiento de las comunidades. por ejemplo. En este caso las tierras seleccionadas fueron aquéllas que pertenecían a agricultores que sí permitieron el acceso y se adoptó un patrón específico para muestrear dentro de estas tierras. En el área determinada en La Amazonia en Brasil. colocando una cuadrícula fija dentro de dichas ventanas. con D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 85 .

los espacios en la cuadrícula fueron reducidos en el área determinada en Brasil. si las parcelas individuales miden más de dos a cuatro hectáreas. en el caso de paisajes altamente fragmentados. dependiendo de los organismos implicados. Al mismo tiempo reduce la dependencia espacial de las observaciones para la mayoría de los principales grupos de organismos del suelo. con parcelas muy pequeñas (menos de 0. la distribución y agrupación de organismos de suelo también son gobernadas por fuerzas intrínsecas de procesos poblacionales tales como dispersión. Una distancia de 200 m parece aceptable porque permite un área relativamente mayor de muestreo a través de la cuadrícula y es probable que refleje los usos de suelos más dominantes en la muestra. el muestreo en cuadrícula permite examinar patrones espaciales a escalas entre la distancia inter-muestra y el tamaño de la cuadrícula. en la mayoría de los casos. 86 Manual de biología de suelos tropicales . o bien. reproducción y competencia (Lavelle y Spain. en la Amazonia. atravesar de un punto a otro. se debe considerar aumentar la distancia entre los puntos. anidadas en estructuras más grandes.5 ha) y donde no es posible atravesar (ej. Sin embargo. se pueden reducir los espacios en la cuadrícula. Ettema y Wardle (2002) mencionan que la biomasa microbiana y los colémbolos son espacialmente dependientes en intervalos de más de 200 m. tales como las lombrices de tierra. con gradientes de recursos del suelo. vegetación secundaria muy densa dentro de parcelas barbechadas). No obstante. Por otro lado. al mismo tiempo permite. que las termitas siguen patrones espaciales en un intervalo de hasta 330 m y que la distribución de especies de nematodos muestra tamaños de parches entre 6 a 80 m. con la ubicación de árboles individuales. a 100 m. la investigación de la distribución de patrones específicos no representa un objetivo deseado.los parches de vegetación. En el caso del proyecto de la biodiversidad del suelo. Por estas razones. 2001). con muchos grupos diferentes de organismos del suelo estudiados. También se registra una distribución parchada en una escala miniatura de centímetros a metros. razón por la que no fueron considerados esquemas de muestreo adecuados para llevar a cabo un análisis de la distribución espacial. En la literatura se pueden encontrar varios ejemplos de la estructura espacial de la biota de suelo sobre distancias de menos de un centímetro hasta de cientos de metros en el campo. Existen varias teorías para explicar la riqueza extremadamente alta de las comunidades del suelo y el bajo grado de especialización en recursos.

deberían registrarse para la ventana e incluso para el área seleccionada. pendiente y aspecto. El conjunto básico de las propiedades físicas y químicas del suelo debería incluir densidad aparente. asumir que una categoría de uso del suelo está en una escala correcta para acomodar su variación puede ser incorrecto. junto con la altitud. la diversidad del suelo es inventariada independientemente a lo largo de un gradiente de intensidades de usos de suelo para cada área seleccionada. y de las características del suelo. C y N total. con referencia especial al uso del suelo también es importante de conocer (aunque no siempre se cuenta con este dato). a fin de permitir un análisis completo de los datos para identificar los parámetros que explican la variabilidad en la biodiversidad del suelo. Sin embargo. textura (la proporción arcilla/arena/limo). en términos de los factores que determinan la biodiversidad del suelo. las condiciones bióticas y abióticas. Es posible que la variabilidad en abundancia y diversidad de organismos del suelo dentro de una categoría de usos de suelo pueda ser mayor que la variabilidad entre categorías de uso de suelo. lo indicado será incluir una descripción detallada de uso y cobertura del suelo. temperatura y humedad media. como parte del proceso del inventario. La definición de clases de uso de suelo resulta importante y se discute en el Capítulo 11 de este manual. etc. materia orgánica del suelo) y características de manejo (tipo de labranza. pH. descrita a nivel de las principales categorías de uso de suelo. La historia del sitio. cationes D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 87 .Inventario de uso del suelo y caracterización del sitio La hipótesis central plantea que la mayor variación en la biodiversidad del suelo está asociada con la diferencia en la intensidad de usos de suelo. pF (tensión de humedad del suelo). Existn un número de factores interrelacionados: bióticos y abióticos (ej. y debido a que las características completas del sitio no pueden ser obtenidas solamente por la apariencia del uso del suelo. Por lo tanto. días de lluvia. uso de químicos. especialmente en sistemas tan diversos como los representados en los trópicos. Al mismo tiempo. así como las características de uso y manejo del suelo pueden variar considerablemente entre regiones. diversidad de plantas.) que afectan la distribución de organismos del suelo y se asume que las principales categorías de uso de suelo proporcionan una diferencia significativa. la información sobre la precipitación anual. Debido a que se sabe muy poco sobre la importancia relativa de los factores antes mencionados. duración de secas y la precipitación acumulada hasta la fecha de muestreo.

lo que puede ser diferente. el porcentaje de cubierta vegetal. Una descripción de los sitios puede ser completada por el tipo de vegetación. los inventarios deberían elaborarse durante la época de lluvias y también en la época de seca. dependiendo de los métodos utilizados. características como la altura media del dosel. Épocas de muestreo Los organismos del suelo responden a cambios estacionales. 1993). La diversidad y abundancia de especies de leguminosas son de particular importancia en relación con la presencia de las bacterias formadoras de nódulos en leguminosas. Respecto de hongos micorrizógenos arbusculares. por esta razón se hace el muestreo al final de la época de lluvias 88 Manual de biología de suelos tropicales . Al3+ y H+. Además. puesto que de esta manera surge la posibilidad de correlacionar las propiedades del suelo con la presencia o ausencia de un taxa en particular y grupos funcionales (véase Anderson e Ingram. ayudan a elegir sitios a lo largo de un gradiente de diversidad botánica que tiene alguna relación con sus posiciones actuales en las cronosecuencias e intensidades de perturbaciones. la época seca será la más apropiada para muestrear. P. en la práctica. en el caso de cultivos anuales las esporas son más abundantes durante la época seca. El Capítulo 11 proporciona más detalles sobre los requerimientos respecto de usos de suelo específicos. área basal. debido a la senescencia de las raíces. La producción de esporas responde a la fenología de las plantas y. la actividad de las lombrices de tierra es mayor al final de la época de lluvias (Tondoh y Lavelle. pero inmediatamente adyacentes a la zanja de cada monolito (la zanja exterior probablemente sea el mejor lugar). Sin embargo. Idealmente. ver Anderson e Ingram (1993). CIC. por ejemplo. no siempre suele ser factible. Muestras de suelo son tomados de suelos no perturbados. También. y los resultados del inventario de la riqueza de especies y abundancia (relativa) mostrarán marcadas diferencias entre las épocas. En los casos de hongos fitopatogénos y hongos ectomicorrízicos. cuando el método depende del conteo e identificación de esporas. por ejemplo. acumulación y abundancia de hojarasca. cobertura dominante/abundancia de flora en el nivel del suelo. la evolución de las estructuras y ciclos reproductivos (como la formación de esporocarpos) se sincronizan con los cambios estacionales que ocurren dentro del hospedero y son mejor observados durante y hacia finales de la época de lluvias. en áreas de bosque.intercambiables. 2005). Para el muestreo de otras variables relacionadas con la caracterización del sitio. especies de plantas y la riqueza de géneros.

J. Columbia University Press. A. E. pp. Eggleton. L. Nature (Lond).. L. A. 72–76. Davies. D. (2005) “Small-scale response of plant species to land-use intensification”. T. CRC.. D. Eggleton. C. T. F. H. D. A. (2001) Soil Ecology. T. Boulton. Gathorne-Hardy. New York. S. (2000) Scientific Method for Ecological Research. pp177-183. T. Hodda. Gregoire... E... (2007) Sampling Strategies for Natural Resources and the Environment. D. y Madong. A. vol 90. y Hernandez. Ecosystems and Environment. Kluwer Academic Publishers. 847–877. CAB International. G. Chapman and Hall/CRC Press. F. F. Peterson. vol 391. G. Jones. Larsen. L.. Wallingford. Agriculture. C.. D . S. D. Pedigo. y Valentine. Journal of Biogeography. L.. vol 17. M.. Hammond. N. (2002) ‘Termite diversity across an anthropogenic disturbance gradient in the humid forest zone of West Africa’. Ford. R. M. V. M. I. Mawdsley.. Cambridge. Ecosystems and Environment.con la opción de tomar muestras adicionales durante la época de secas. Cambridge University Press. E.. Vegetatio. Federoff. y Watt. vol 105. (1977) Sampling Techniques. REFERENCIAS Anderson. Cochran W. P. B. pp.E. 89–202. y Spain. D. y Podani. D. 195–207. Holt. London. G. Dubs. P. y Parker. B. Hauser. (1998) ‘Biodiversity inventories. (eds) (1998) Ecological Scale: Theory and Applications. Ponge. P. 283–290. J... P. N. F. G. P. (eds) (1993) Handbook of Sampling Methods for Arthropods in Agriculture. (2003) ‘Evolution of termite functional diversity: Analysis and synthesis of local ecological and regional influences on local species richness’. Stork.. (1989) ‘On sampling procedures in population and community ecology’. (1993) Tropical Soil Biology and Fertility: A Handbook of Methods.. y Wardle. Ettema. pp. Bignell. Bloemers. y Buntin. Trends in Ecology and Evolution. Lavelle. Dibog. P. Eggleton. Norgrove. P. S. B. Dordrecht Lawton. Lo último puede realizarse con el objetivo específico de investigar cambios temporales en la biodiversidad del suelo. Kenkel. J-F. New York. pp. Fernández-González. R. L... vol 83. Agriculture. J. D. H. J. indicator taxa and effects of habitat modification in tropical forest’. vol 30. e Ingram. T. Wiley. E.. 3rd edition. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 89 . G.. (2002) ‘Spatial soil ecology’. y Lavelle. New York.. Bignell. N. pp. Srivastava. D. Juhfisz-Nagy. 2nd edition.. P.

y Oliver. Southwood. Journal of Tropical Ecology. D.. T.org/SEA/Publications. Oxford. 3rd edition. New York. P. vol 9. P. R. Oxford University Press. (2000) Ecological Methods. 90 Manual de biología de suelos tropicales . J. vol 35. S. Bogor. E. y Ettema. www. Wessels. y van der Linde. A. K. y Lookingbill. Eudrilidae) in Ivory Coast’. A. Soil Biology & Biochemistry. 31–47. 1093–1121. C. T.Ponge. South East Asian Regional Research Programme.. y Seber. S. y Lavelle. Federoff. (1996) Adaptive Sampling. pp. Wiley.worldagroforestrycentre. Jaarsveld. Biodiversity Conservation. S.. J. Indonesia. 493–500. Sousa. International Centre for Research in Agroforestry. G. Stein. E. 813–826. (2002) ‘Extending community ecology to landscapes’. Gillet.. Ecoscience. E. D. L. J. Goslee. Agriculture. Haese. J. vol 94. F. S. M. pp. ASB-Lecture Note 6B .. pp. y Lavelle. M. F. Urban. A. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. J. pp. Oxford. D. Blackwell Science. A. Ecosystems and Environment.. K. y Bignell. Webster. J.. Dubs. M. E. Tondoh. R. Swift. 200–202. A. (2003) ‘An overview of spatial sampling procedures and experimental design of spatial studies for ecosystem comparison’. y Henderson.. van. K. (2003) ‘Collembolan communities as bioindicators of land use intensity’. vol 21. P. pp. Pierce. F. (1998) ‘An evaluation of the gradsect biological survey method’. (eds) (2001) Standard Methods for the Assessment of Soil Biodiversity and Land-use Practice. Thompson. (1990) Statistical Methods in Soil and Land Resource Survey. P. vol 7. Grimbeek.

los invertebrados más importantes en el suelo de regiones templadas. Souleymane Konaté. Csaba Csuzdi. hormigas y escarabajos. Bignell. Las lombrices de tierra son. aunque éste se concentra en los grupos más significativos: lombrices de tierra. termitas. sin embargo. Una diversidad de organismos de suelo se incluye en esta categoría (capítulo 1). probablemente. Además. Jérôme Ebagnerin Tondoh y Ronald Zanetti INTRODUCCIÓN Este capítulo describe los métodos para realizar el inventario de la macrofauna del suelo. se consideran un componente determinante de la biota del suelo. e influyen de manera notable en las propiedades físicas y químicas de los suelos. Mucha macrofauna desempeña un importante papel en los ecosistemas del suelo. predominan las termitas y las hormigas. en la creación de macroporos y en la transformación y redistribución de materia orgánica. Agus Karyanto. los grupos de macrofauna frecuentemente son utilizados o propuestos como indicadores de la calidad biológica del suelo. Francis-X. 91 . en ambientes tropicales. Susilo. Julio Louzada. Debido a su importante papel en los procesos del ecosistema y a su sensibilidad ante condiciones ambientales. sobre todo. o que tienen una anchura o diámetro de más de 2 mm. por tanto. indicativos de la biodiversidad de suelo y de los efectos del cambio de uso y prácticas de manejo del mismo. que habitan especialmente en ambientes tropicales.Capítulo 3 Macrofauna David E. Reginaldo Constantino. el grupo macrofauna incluye aquellos animales del suelo que miden más de un centímetro de largo. Otros son trituradores que deshacen la materia orgánica y un buen número de estos grupos son macropredadores. debido a su biomasa. como ingenieros del suelo.

utilizando cualquiera de los métodos enlistados en el capítulo 2. Como en el caso de otros grupos de biota de suelo. Éstos están basados en monolitos de suelo y. el hecho de que se pueda dedicar un capítulo entero al muestreo de macrofauna. algunos grupos representativos de macrofauna específica son capturados. cada uno de los métodos descritos es idóneo para un grupo en particular: los monolitos son especialmente escogidos para el inventario de lombrices de tierra. se requiere de métodos estándares en el muestreo para diversidad. demuestra cómo ha crecido durante los últimos años nuestra percepción de la importancia de estos organismos. en el caso de termitas. el método de transecto es más adecuado para un inventario de termitas. No obstante. y no simplemente tres páginas que fueron impresas en los métodos originales “TSBF”. tal y como fueron aplicados en el proyecto CSM-BGBD. con la extracción de los insectos de los marcos de hojarasca por el método Winkler (Bestelmeyer et al. sin embargo. este capítulo se estructura de acuerdo con el método utilizado y no tanto en función del grupo funcional. en cada una de las siguientes secciones que describe un método en particular. y la extracción Winkler es el método más idóneo para la captura y extracción de hormigas de muestras de hojarasca. forman un importante componente de la red alimenticia en el suelo. el punto de partida de desarrollo de los protocolos han sido los procedimientos de Anderson e Ingram (1989.generalmente alta. Generalmente. por ende. Para poder contar con datos de diversidad y abundancia de lombrices de tierra. en un transecto corto (20-40 X 2m) al que ahora han sido añadidas trampas pitfall (principalmente para escarabajos) y otras guías para muestreo casual. 1993) consolidados y mejorados por Swift y Bignell (2001). al mismo tiempo. mientras que las trampas pitfall con cebo son apropiadas para la captura de escarabajos. 92 Manual de biología de suelos tropicales . En este capítulo se describen métodos propuestos para realizar un inventario de macrofauna. cuyo énfasis se concentra en un grupo específico de organismos asociados y. abundancia y biomasa. podrán ser utilizados más ampliamente. Nuevos esquemas son propuestos en el diseño de monolitos para mejorar el muestreo de lombrices de tierra. en la generalidad de la macrofauna. se explica que no existe un sólo método para llevar a cabo un inventario de un grupo específico de macrofauna. los que generalmente se refieren como métodos “TSBF”. que sirvan como indicadores para monitorear el cambio de efecto de uso de suelo. Un avance mayor consiste en utilizar el principio de transecto para hormigas y escarabajos. En el capítulo 2. por lo tanto. 2000). Se entiende que los métodos propuestos son aplicados en ambientes tropicales.

En una variante del método.1b). Este transecto también puede ser utilizado para hormigas y escarabajos. con dimensiones de 50 x 50 x 20 cm de profundidad para lombrices de tierra. Monolito TSBF Los procedimientos generales.INVENTARIO DE MACROARTRÓPODOS DE SUELO. una charola de plástico grande de cocina. éstos. con la adición de trampas pitfall (Swift y Bignell. de 0-10 cm. Para revisar el suelo es conveniente utilizar la superficie de una mesa grande de campo para llevar a cabo la extracción. pero que representan una biomasa importante.1d). Se divide el bloque del monolito en tres capas. con un reborde. excavados de la zanja y la hojarasca pueden ser colectados. HOJARASCA Y LOMBRICES DE TIERRA EN PARTICULAR. 2000). Se aísla el monolito utilizando una pala a unos pocos centímetros fuera del marco y luego se cava una zanja a su alrededor de 25 cm de ancho y 30 cm de profundidad.. Se utiliza un transecto adicional de 20 x 2 m para muestrear las termitas. en su mayor parte. aunque es mejor si se muestrea la hojarasca delimitada por marcos dispuestos en una línea paralela.1c y 3. Para la discusión del número y posicionamiento de monolitos. En el caso de la hojarasca. preferentemente en el lugar y bajo sombra. aislando el monolito como un pilar no perturbado (Figuras 3. Primero se coloca un marco de 25 x 25 cm para marcar la posición del monolito y cualquier hojarasca o madera dentro de él es removida e introducida en una charola (Figura 3. Se revisa manualmente la hojarasca y cada capa de monolito por separado. sirve como un buen recipiente para la M acrofauna 93 . UTILIZANDO MONOLITOS DE SUELO Macroartrópodos de hojarasca y de suelo. de manera que puedan trabajar varios asistentes en la misma muestra de suelo o en muestras diferentes. La muestra de suelo en botes se debe guardar alejada del sol directo y deberá ser revisada antes de 24 horas. 10-20 cm y 20-30 cm. hay que meter la muestra en un bote de 19 L y llevarla al laboratorio. la anchura aproximada del monolito más dos anchuras de zanja. véase el capítulo 2. 2001) y las extracciones con trampas Winkler (Bestelmeyer et al. serán milpiés y lombrices de tierra con bajas densidades de población.1a y 3. todos los invertebrados mayores de 10cm de largo. es decir. utilizando un machete o parang tomado de forma horizontal y agarrado por ambos lados. son dictados por Anderson e Ingram (1993). esto se puede hacer de manera sencilla. Si no hay mucho tiempo o si la luz es insuficiente (colectar en selva cerrada es difícil porque la luz disminuye muy temprano). junto con monolitos extraídos del suelo. Su abundancia y biomasa podrán ser calculadas con base en las muestras de 0.50 m².

montículo. Para evitar confusión en lugares ricos. deberán preservarse en alcohol al 80%. etc.revisión. en el caso de las termitas. 94 Manual de biología de suelos tropicales . sin embargo. de 5 mm. • El microhábitat en cuestión (madera nueva. La información es importante para establecer la naturaleza de los organismos encontrados (especialmente la diversidad de grupos funcionales) y para construir una curva de acumulación de especies. el número de la sección en el transecto en donde se encontró el espécimen (1. como en el caso de un transecto. Se diseccionarán los pedacitos de madera en diferentes piezas para ver si hay termitas. al igual que obreras.). madera seca. Se deberá utilizar un tubo o frasco por cada especimen o población encontrada (o colonia aparente). en la que se anotan los datos siguientes (con lápiz o tinta indeleble. Las hormigas. termitas y escarabajos colectados. hormigas o escarabajos. el periodo destinado deberá incluir el tiempo para el llenado de la etiqueta. suelo de raíz de árbol. Protocolo de muestreo alternativo para evaluar la abundancia y diversidad de lombrices de tierra en ecosistemas tropicales Introducción Este protocolo alternativo combina el llamado monolito de suelo TSBF (25 x 25 x 30 cm) y tres grandes monolitos (50 x 50 x 20 cm) para evaluar la abundancia y diversidad de lombrices de tierra a nivel local y de paisaje en ecosistemas tropicales. las etiquetas deberán escribirse en el momento en que los especímenes sean introducidos en los tubos o frascos. no usar bolígrafo o pluma): • Fecha y clave de identificación del lugar. generalmente. suelo. En otros casos. El tamiz retiene las hormigas que pueden ser aspiradas. Se añadirá una etiqueta dentro del alcohol o formaldehído. Las lombrices de tierra y moluscos. Las hormigas pueden ser extraídas tomando un puñado de suelo. las pequeñas ramas deberán romperse y ser golpeadas en la charola para que se desprenda cualquier insecto que contengan. pasándolo a través de un tamiz de malla grande. cuando se hace la extracción durante un tiempo determinado. las etiquetas se pueden hacer cuando se ha completado la extracción en cada sección del transecto. hojarasca. se incluirán soldados.2. en una charola.3 ó 4). • En el caso de transectos o monolitos alineados. madera podrida. se conservan en formol (formaldeído) al 4% para evitar la supuración de la mucosa.

(2002) y Mathieu et al. cinco monolitos por parcela bajo estudio. Por más de una década. la mayoría de los estudios sobre lombrices de tierra han sido elaborados utilizando el método TSBF (Anderson e Ingram. un monolito cuadrado de suelo de 25x25 cm y de 30 cm de profundidad. (1994. los monolitos se distribuyen a lo largo de un transecto corto (40 m) con. por lo menos. (1995). siendo la unidad de muestreo. A B C D Nota: las ilustraciones A y B muestran la colocación de un marco de madera para delimitar el monolito y la limpieza de hojarasca suelta.Figura 3. antes de muestrear el monolito. La ilustración C muestra un monolito grande (50 x 50 x 30 cm) y la D un monolito pequeño (25 x 25 x 30 cm) y la excavación de la zanja. Barrios et al. véase Bhadauria et al. (2003). 1993) para macroinvertebrados. 2004). satisface el requerimiento de rapidez y la necesidad de tomar en cuenta la heterogeneidad del suelo a nivel parcela. véase Gilot et al. Haymes et al. Dlamini y Haynes (2004) para el muestreo de lombrices de tierra en África. M acrofauna 95 . (2000) para Asia y Decaëns et al. En todos los casos. (2004).1 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). para ejemplos de América del Sur.

Se pueden usar argumentos similares para justificar un muestreo más extensivo de lombrices de tierra. 1969.. aunque pocas investigaciones se han enfocado a la evaluación de la abundancia y diversidad de lombrices de tierra en paisajes agrícolas. 2002). Protocolo de muestreo De manera ideal. Como las prácticas agrícolas contemporáneas muestran un mosaico de tipos de uso de suelo. 2001. 1997. Este esquema de muestreo estratificado. Fragoso et al..A pesar del éxito relativo del método TSBF para estimar la abundancia y diversidad de los macroinvertebrados del suelo. se estudió la demografía de lombrices de tierra. 2005). el muestreo debería realizarse al final de la temporada de lluvias. Las lombrices de tierra son colectadas a mano. Decaëns y Jiménez. 2005). (2000). Decaëns y Jiménez. 1997. ha sido reportada para monitorear la dinámica de población de la lombriz peregrina Hyperiodrilus africanus (Tondoh y Lavelle. cuando se sabe que las lombrices de tierra son más activas (Tondoh y Lavelle. respectivamente. cubriendo grandes áreas. aunque pequeños monolitos han sido utilizados con éxito para identificar cambios importantes en la diversidad de lombrices de tierra a nivel parcela. 1978). Eggleton et al. 1999. 1998) porque las lombrices de tierra son reconocidas por presentar sensibilidad ante la perturbación antropogénica (Fragoso et al. por ejemplo. (1999) y Agosti et al. pero consumen mucho tiempo y resultan tediosos. 2002). debido a su especificidad de grupo funcional. utilizando grandes monolitos de suelo de 1 m² x 40 cm de profundidad. el reto será desarrollar un protocolo de muestreo rápido para muestrear a nivel paisaje. Se seleccionan cinco puntos de muestreo al azar. han propuesto protocolos de muestreo más exhaustivos para muestrear termitas y hormigas. 10-20 cm y 20-30 cm. Lavelle. que combina pequeños y grandes monolitos. Burel et al. Recientemente. en cada punto de muestreo se extrae un pequeño monolito de 25 x 25 x 30 cm que se rebana en tres capas: 0-10 cm. la carencia relativa de centros de colonias y su distribución altamente parchada. Originalmente. Tal avance será crucial para desarrollar indicadores de degradación de suelo (Moreno y Halffter.. una combinación más eficiente de 100 x 100 x 40 cm para grandes y de 25 x 25 x 30 cm para monolitos pequeños de suelo. Vincent. permite tomar en cuenta la variación a 96 Manual de biología de suelos tropicales . Los monolitos de tamaño medio (50 x 50 x 40 cm) fueron utilizados por Ortiz-Ceballos y Fragoso (2004) para evaluar el impacto de una cobertera en poblaciones de lombrices de tierra. bajo diferentes prácticas de manejo de suelo (Fragoso et al. en cada tipo de uso de suelo.

M acrofauna 97 . cuando se considere apropiado (TSBF modificado. 1993). Cada monolito mayor se separa en dos capas (0-10 y 10-20cm) y no en tres. como en los pequeños monolitos. 1993). de acuerdo con el procedimiento de TSBF (Anderson e Ingram. Las lombrices de tierra se colectan a mano (Figura 3. El transecto aparece representado esquemáticamente en la Figura 3. contados y pesados. perpendicular a la pendiente. Monolitos grandes (50x50x20 cm) Monolito pequeño (25x25x30 cm) nivel parcela de las poblaciones.2 Esquema de alineación de monolitos complementarios de lombrices de tierra. De manera adicional. con un punto de partida elegido al azar. Anderson e Ingram. Monolitos adicionales son extraídos para poder tomar en cuenta la heterogeneidad a nivel de la parcela. Los individuos después son identificados. mientras la variación a nivel paisaje se hace con un muestreo en los usos de suelo más representativos. a lo largo de un transecto. las lombrices de tierra son muestreadas. 2005). se extraen tres grandes monolitos de 50 x 50 cm y de 20cm de profundidad.2. porque la mayoría de los especímenes (57-99%) son localizados en los primeros 20cm durante la temporada de lluvias (Tondoh y Lavelle.Figura 3. En cada punto seleccionado. en intervalos de 5 m.3) y son almacenadas en una solución de formol al 4% para su posterior identificación.

3 Separación a mano de lombrices de tierra en charolas de plástico. Fragoso y Rojas-Fernández. que se encuentran distribuidas en toda la región tropical. no existen a la fecha monografías disponibles para la identificación de lombrices de tierra de América Central y América del Sur. Identificación de lombrices de tierra y estimaciones de su abundancia Especímenes de lombrices de tierra. se debe consultar la descripción original de especies. 1971. son identificables a nivel especie utilizando las guías y descripciones dadas por Blakemore (2002). 1994. pueden ser identificados a nivel de familia. Para las especies africanas de Eudrilidae y Acanthodrilidae (Benhamiinae) se pueden utilizar las revisiones de Sims (1980. 1987) y Csuzdi (1996) y. La abundancia de lombrices de tierra se estima 98 Manual de biología de suelos tropicales . sin embargo. Zicsi. las monografías de Gates (1972). por lo tanto. 2001. debido a la carencia de guías comprensivas para su identificación. previamente agrupados como morfoespecies. la revisión de Eisen (1900) y estudios seleccionados de varios autores (Righi. Desgraciadamente. utilizando las claves desarrolladas por Blakemore (2005). Sims e Easton (1972). las especies nativas requieren de la pericia específica del país. Easton (1979) y Julka (1988) son las apropiadas.Figura 3. 1995. Para la identificación de lombrices de tierra de la India y del Sureste de Asia. Las especies de lombrices de tierra peregrinas comunes. cuando sea necesario. 2005) son los principales puntos de referencia.

1997). La diversidad de lombrices de tierra se estudia en dos niveles complementarios: diversidad taxonómica y funcional (Bouché. Lombrices endógeas: de tamaño medio.. a nivel de la superficie del suelo. Fragoso et al. en casi todos los casos. 1977. producen excretas dentro del perfil del suelo y sobre la superficie.. La relación nativas vs exóticas puede utilizarse como un índice para calcular la extinción de especies nativas o como un claro indicador de la invasión de especies exóticas o peregrinas. 1997. Lavelle 1983. Lavelle. éstas han sido llamadas peregrinas para indicar su amplia distribución a niveles regionales y continentales (Lee. El primer nivel de diversidad taxonómica trata del número y de la identidad de especies de lombrices de tierra. 1997 y Lavelle et al. Desde el punto de vista ecológico. se lleva a cabo mediante la identificación en cada tipo de uso de suelo de especies nativas y exóticas o peregrinas.. mientras que las especies exóticas son. Fragoso et al. regional y continental. introducidas por interferencia humana. 2. Especies nativas son las caracterizadas por una distribución restringida a nivel local. 1981): 1.. Los servicios que proveen las lombrices de tierra al ecosistema se relacionan con el impacto de su actividad en el sistema de suelo (Lavelle et al. 1987). Se pueden utilizar tres categorías de expresión de la riqueza de especies: 1) el número de especies registrado en todos los monolitos. dos grupos de lombrices de tierra pueden ser distinguidos de acuerdo con su origen: especies nativas o exóticas. 1977). las comunidades de lombrices de tierra pueden dividirse en tres grupos (Bouché. El segundo nivel de diversidad taxonómica trata de la biogeografía de lombrices de tierra (Fragoso et al. M acrofauna 99 . 1977.. 2) la diversidad promedio expresada en términos de la media de número de especies por cada tipo de uso de suelo y 3) el índice ShannonWiener de diversidad (Pielou. El análisis de comunidades de lombrices de tierra. La estructura de las comunidades de lombrices de tierra puede ser caracterizada por la densidad y biomasa de lombrices nativas y exóticas La importancia de la diversidad funcional en las lombrices de tierra ha sido ampliamente documentada (Lavelle. 1983. Dentro de un ecosistema dado.como el número de individuos por m² y la biomasa como g de individuos por m².. Lombrices epígeas: de tamaño pequeño. El aspecto funcional de la diversidad resulta de gran interés para evaluar la relación entre diversidad y servicios del ecosistema. Como resultado de su actividad. 1997). 1996). 1997). Blanchart et al. con este enfoque. con pigmentación y que viven en la hojarasca. no pigmentadas y que viven dentro del suelo. en cada tipo de uso de suelo.

Cada persona lleva un machete o parang afilado. Swift y Bignell (2001). relativamente. HORMIGAS. sin pigmentación y viven en el suelo. para el proyecto CSM-BGBD y a 50 m en el esquema alternativo de muestreo (véase Capítulo 2). cinta métrica de 30 m o preferiblemente cuerda de nylon o mecate. aunque se considera que. tumba y quema. El método. 50 o 20 x 2m. La mayoría de las lombrices de tierra que pertenecen a los tipos endógeos y anecicos son destacados ingenieros del ecosistema (Lavelle et al. Los datos obtenidos son cualitativos (identificación y número de especies) y/o semi-cuantitativos (abundancia relativa de especies y/o grupos funcionales específicos). se basa en un transecto de 100 m. una 100 Manual de biología de suelos tropicales . y sigue las descripciones formales de Jones e Eggleton (2000). 1997) porque son activas mezclando y cavando el suelo. Sus actividades forman una red densa de túneles dentro del suelo. aunque se ha acortado a 20 m en el protocolo estándar. ESCARABAJOS Y LOMBRICES de tierra Introducción Este método utiliza un transecto de 100. tal y como se describe y desarrolla más adelante. Lombrices anecicas: de tamaño grande. presentan una alta resolución. modificando así las propiedades hídricas y químicas del mismo. marcada en secciones de 5 m.. MÉTODOS DE TRANSECTO PARA TERMITAS. Este método se considera de bajo impacto y resulta idóneo para ser usado por aquellos que no son especialistas en termitas y puede ser completado en cada punto de muestreo por dos personas en un día (dos días para un transecto de 100 m). por lo que los transectos se tratan separados de los monolitos y de las trampas pitfall. A las lombrices de tierra se les puede asignar una categoría ecológica o grupo funcional y posteriormente comparar dichos grupos con base en su densidad y biomasa. fue desarrollado para bosques o localizaciones recientemente derivadas como en la agricultura de roza.3. Equipo requerido Brújula. utilizando cinta naranja o amarilla fluorescente o a prueba de agua y un palo de 2 m. pero comen en la superficie.

por lo menos. para evitar obstáculos naturales. de alrededor de 8-10 cm. Es necesario anotar el punto de partida. en cada sección de 5m. estrechas zanjas con arroyos o cortes en el dosel. el transecto puede incorporar otros fenómenos naturales del ambiente biótico que contribuyen a su heterogeneidad física. ese tiempo podrá reducirse si se trabaja con varios equipos de dos personas. en diferentes secciones. una charola de plástico o metal con reborde alto. acantilados o caminos en uso que no sean hábitats adecuados para termitas. 50 o 100 m junto al monolito. tales como pendientes. con alcohol al 80% (se necesitarán más para hábitats ricos en termitas). Si la línea atraviesa un árbol. siempre que no se crucen con ellas mismas. de manera simultánea. Frecuentemente se necesita evaluar. No obstante. un transecto puede curvarse sucesivamente por dos ángulos de 90° para que corra hacia atrás hasta su punto de partida. un cuchillo de campo de hoja fija. a una distancia suficiente para evitar cualquier perturbación durante el muestreo.cuchara de albañil. Se coloca el transecto de manera que visualmente atraviese los alrededores de manera homogénea. a 15m de distancia. Las líneas de transecto no necesariamente tienen que ser rectas. Alternativamente. para evitar pisadas excesivas en un solo lugar. sin embargo. Si se emplean otros transectos en la misma parcela (por ejemplo. alrededor de 40 frasquitos de aproximadamente 1 x 5 cm. se pueden colocar dos transectos de 50m (o de 10 m) para que queden en paralelo. siempre que por lo menos una parte del sistema de raíces quede dentro de la cinta de muestra de dos metros de ancho. dirección del transecto con la brújula y cualquier cambio de dirección. pero los dos “brazos” principales de la línea del transecto deberán encontrarse. de área basal muy grande. cuando se trata de decidir sobre la línea ideal. Un equipo de dos personas será capaz de muestrear entre 8 y 12 secciones por día (2 a 3 transectos). pueden inclinarse para alcanzar ángulos de hasta 90°. El tiempo requerido para realizar transectos de 20 m es de 30 minutos de muestreo por dos personas. evitando grandes arroyos. especialmente en los casos de pequeñas parcelas. puede ser útil para picar madera o suelo. En una parcela pequeña. el transecto se puede desviar hacia un lado. Procedimiento Se traza una línea de transecto de 20. Se debe asegurar que las líneas de pitfall se mantengan sin perturbación en todo momento. de modo subjetivo. para poder replicar un monolito) los transectos deberán posicionarse para evitar interferencia mutua y separarse. dos pares de pinzas. El muestreo se estratifica por M acrofauna 101 .

por lo tanto. Normalmente se requiere de un corto periodo de entrenamiento u orientación para que colectores sin experiencia puedan muestrear con la misma eficiencia que un experto. nidos de termitas o pistas de tierra en troncos de árboles y otra vegetación. El suelo. posiblemente. nidos subterráneos epígeos y arbóreos y montículos de una altura de hasta 2 m sobre la superficie del suelo (incluyendo nidos de bolsitas suspendidos en la vegetación). La madera podrida. o cubierta de pedazos de suelo. Los pedazos más grandes de madera deberán cortarse tomando en cuenta que pueden estar infectados en alguna parte. Otras especies pueden habitar montículos y nidos o podrán coexistir con los que están construyéndolos. sin olvidarse de las ramificaciones o de los helechos que pueden acumular suelo que contenga termitas. otros invertebrados. escarabajos y lombrices de tierra en nichos crípticos o cuando escasea la luz. Es imposible muestrear con lluvia fuerte. El tronco de un árbol vivo puede ser investigado para ver si contiene túneles de termitas a una altura accesible. esto ayuda mucho a ver las termitas (Figura 3.nichos. se recomienda completar no más de 12 secciones en un día. la hojarasca y los restos de madera pueden diseccionarse rápidamente en charolas. es aconsejable comprobar la periferia y la base de la estructura. lombrices de tierra y. Los palitos deberán romperse en pedazos y golpearse moderadamente en las charolas para desplazar cualquier termita u hormiga que contengan. Los siguientes micronichos son investigados con detalle: hojarasca y la superficie del suelo hasta una profundidad de alrededor de 5 cm. Idealmente. un transecto de entrenamiento. por ello se permite interrumpir la labor 102 Manual de biología de suelos tropicales . sin necesidad de usar una escalera o tener que trepar (alrededor de 2 m). acumulaciones profundas de hojarasca y suelo entre grandes raíces que funcionan como retenedores. frecuentemente contiene termitas. incorporada en el suelo de superficie. debería muestrearse la primera vez bajo la supervisión de un colector experimentado. junto con sus cámaras centrales. por esta razón y para poder minimizar la necesidad de tener que trabajar con escasa luz. Los colectores deberán trabajar de manera constante (no frenética) en cada uno de los periodos de muestra de 30 minutos y tratar de mantener el mismo nivel de eficiencia de muestreo en cada sección del transecto. de 50 ó 100 m.4). También resulta de ayuda descansar unos minutos entre secciones. En la mayoría de las localizaciones no es necesario colectar cada termita y las especies más comunes podrán ser ignoradas después de muestrearse inicialmente para poder buscar las formas más raras o crípticas o para buscar soldados en especies que tengan una relación relativamente baja de soldado/obrero (tomando en cuenta que algunas especies no tienen soldados). madera en todas sus etapas de descomposición.

contener soldados y obreros.5 x 2 m. cada persona trabaja en una cinta de un metro de ancho. Procesamiento de especímenes Los especímenes representativos de las termitas encontradas deberán ser preservadas en alcohol al 80% y. en el M acrofauna 103 . Alternativamente. es importante observar el protocolo de muestreo con precisión. Se debe destinar un tubo de especímenes para cada población (o colonia aparente). de manera que mientras uno muestrea la madera. sin dañarlos. El trabajo puede dividirse entre los colectores. a pesar de que se trate de una pequeña cosecha. sección a sección. en lados opuestos de la línea. para dividir cada sección en dos subsecciones de 2. sin interrumpir el trabajo. por lo menos. Se recomienda que el suelo se extraiga en. el otro examina el suelo y las raíces de los árboles. en lo posible. Nota: las pinzas finas son idóneas para atrapar insectos con cuidado. En los transectos donde se encuentran pocas termitas. una docena de lugares separados en cada sección del transecto. previo acuerdo.Figura 3. Esto dependerá de la naturaleza del lugar y de la topografía. se puede usar un pincel de artista humedecido con alcohol para depositar el espécimen en el frasco colector. por ejemplo.4 Extracción de termitas de una muestra de suelo en una charola de aluminio. hasta que mejoren las condiciones climatológicas.

todas las etiquetas seguirán el mismo patrón. por morfoespecies o especies nombradas. utilizando una impresora láser. suelo. sin embargo. se podrán imprimir etiquetas numeradas. se añade alcohol fresco y se escriben las etiquetas nuevas). • El micro hábitat en cuestión (madera fresca. Los especímenes pueden resultar dañados o afectados en su color por el suelo o basura contenido en el frasquito. madera seca. • Número de sección en el transecto donde se encontró el espécimen (1. etc. se podrán escribir etiquetas o notas. Todas las notas de campo se guardan en la libreta y. se podrá construir una curva de acumulación por especies basada en especímenes o simplemente por especies. hojarasca. para los taxónomos expertos.). en el campo únicamente se añaden las etiquetas a los frasquitos y se toma nota en la libreta de campo de los números por sección y del transecto. el mismo día en que son colectados o tan pronto como sea posible. Alternativamente. razón para destinar un mínimo de dos días a cada transecto de 100 m (proporcional para transectos más cortos). los números de las etiquetas estarán relacionados. En otros lados. Lo anterior hace que el procesamiento sea más eficiente. al completar cada sección del transecto. reduciendo así las posibilidades de cometer errores en la numeración. La información referente al micronicho en donde se encuentra cada espécimen es importante para poder establecer la naturaleza de la comunidad de termitas (especialmente la diversidad funcional del grupo) y para construir una curva de acumulación de especies. Se generan diez secuencias al azar de las secciones por 104 Manual de biología de suelos tropicales . madera podrida. montículo. los siguientes datos: • Fecha y clave del transecto. suelo a raíz de árbol). en lugares ricos en termitas. se deberán escribir las etiquetas (o las notas de campo) tan pronto como se hayan colocado las termitas en los tubos de especímenes. con lápiz o tinta indeleble y no.cual se introducirá una etiqueta. que se cortarán y pegarán en una libreta de campo. en orden secuencial. por lo que se podrán leer con mayor facilidad. con pluma o bolígrafo. 3. 2. los treinta minutos para el trabajo deberían incluir el etiquetado. Para evitar la confusión. Al tratar cada sección de 5 m. Las termitas deberán separarse en unidades taxonómicas reconocidas. lo que facilitará el trabajo. razón por la cual deben limpiarse lo antes posible (se separan las termitas del suelo o de la hojarasca. donde se anotan. por lo tanto. como una muestra independiente.

2004) que son implementados por el software libre EstimateS (Colwell. 2004). Identificación El primer paso para compilar una lista de especies y organizar los datos del ensamble de las especies encontradas. Cuando se comparan datos de diferentes hábitats o localidades. finalmente. M acrofauna 105 . Las especies y morfoespecies encontradas por transecto pueden ser desde sólo unas cuantas hasta más de 50. es importante utilizar el mismo esfuerzo de identificación y métodos. Una curva ideal debería ser asintótica. debería subir y posteriormente inclinarse. se separaran en morfoespecies. indicando que se encontrarían pocas o nuevas especies con transectos adicionales en el área. en el lugar 1. un subjuego en una colección de una institución nacional. La identificación de organismos de suelo. dependiendo del lugar y de la región biogeográfica. es decir. El número de especies encontradas en cada sección se usa para calcular el número acumulativo de especies. de manera permanente. el resto. será identificar cuáles son las que están presentes en la muestra. se identificaría a nivel género y. en un museo. 2000. parcialmente compuesta por especies identificadas y. normalmente requiere una pericia taxonómica alta. entre otros (Magurran. Lo ideal sería que todos los especímenes fueran identificados hasta especie. género y especie. en el lugar 2. para cada selección de las diez secuencias. Una taxonomía pobre podría resultar en una baja o sobreestimación de diversidad y similitud de especies y hacernos llegar a establecer conclusiones erróneas. También es importante que las morfoespecies “A”. Una manera más realista sería obtener la lista final. Chao y ACE. Las muestras y los especímenes necesitan ser etiquetados y organizados cuidadosamente. lo que resulta muy laborioso en términos de tiempo. la identificación consiste en la determinación de la posición de un espécimen en la clasificación existente. sean las mismas que “A”. La colección entera deberá ser preservada durante un tiempo después de la identificación para su posterior confirmación y se debe de depositar. se calcula la media acumulativa de especies de los diez juegos de 20 secciones para cada sección y se construye una curva de acumulación de especies. tales como Jackknife de primer orden y Jackknife de segundo orden. La riqueza específica del lugar puede ser estimada utilizando métodos de extrapolación. sin reemplazo. a nivel especie.medio de un trazo (en cada secuencia) de 20 secciones al azar. pero esto muchas veces no es posible para algunos grupos de organismos de suelo. o bien. trabajando desde niveles altos como órdenes hasta familia.

y para bacterias. el Código Internacional de Nomenclatura Botánica (Greuter et al.Los métodos comunes de identificación de la fauna del suelo incluyen: a) uso de claves de identificación publicadas. Tal abreviación se usa para indicar que la identificación es incierta. c) comparaciones con colecciones de referencia y d) envío de especímenes a un experto taxónomo. Lista de guías y catálogo de identificación Se puede consultar una lista integrada de claves de identificación para termitas. aunque frecuentemente se recomienda. (abreviación del latín confer. que deberán ser respetadas: los géneros y especies se imprimen en cursiva. para grupos de organismos diversos o poco conocidos. lo cual generalmente resulta más práctico que un “orden taxonómico” subjetivo. La Tabla 3. tienen un significado y su uso se determina de acuerdo con las reglas de nomenclatura. 1999). excluyendo animales. N. compare). b) comparaciones con descripciones. Se muestran tres niveles de identificación. En el caso de animales. se utilizan con la misma connotación o de manera similar.1 presenta un ejemplo de una lista de especies. si existen. será el Código Internacional de Nomenclatura Zoológica (Comisión Internacional de Nomenclatura Zoológica. el Código Internacional de Nomenclatura de Bacterias (Sneath. por ejemplo. No obstante. hormigas y escarabajos en el apéndice 1 y listas más especializadas en las publicaciones 106 Manual de biología de suelos tropicales . para plantas. La abreviación “cf” en el caso de Coatitermes y Armitermes. 2000). a modo de rutina. 1992). Consulta un catálogo taxonómico que te permita comprobar la validez y cómo se deletrean los nombres. Termes sp. técnicas moleculares para la identificación de microorganismos. nunca se deben utilizar nombres manuscritos no publicados. similis. de manera particular. los Códigos de Nomenclatura contemplan reglas muy estrictas de formato para nombrar autores. Otras abreviaciones. El dato de autor y año de publicación no forma parte de un nombre de especies y su uso es opcional. Se trata de una lista organizada en orden alfabético. corniger y N. Nota que las abreviaciones “sp” y “cf” no aparecen en cursivas. Se utilizan. Los paréntesis. B fueron identificadas únicamente a nivel género y morfoespecie. fueron identificadas plenamente a nivel especie. A y Termes sp. ocasionalmente. El formato de los nombres deberá seguir el código respectivo de nomenclatura. pero no es obligatorio. El paréntesis que abarca el nombre de los autores indica que la especie fue originalmente descrita en otro género y después se transfirió al género actual. por lo tanto.

14 Angularitermes sp. 2 Angularitermes sp. 1 Angularitermes sp. 17 Angularitermes sp. peruanus Caetetermes taquarussu Constrictotermes cavifrons M acrofauna 107 . Angularitermes sp. 13 Angularitermes sp. 7 Angularitermes sp. 3 Angularitermes sp. 5 Angularitermes sp.Tabla 3. 16 Angularitermes sp.1 Ejemplo de lista de especies. 18 Angularitermes sp. 11 Angularitermes sp. 6 Angularitermes sp. 19 Araujotermes nanus Armitermes holmgreni Armitermes minutus Armitermes teevani Atlantitermes osborni 1 1 1 13 9 13 46 2 2 1 15 7 1 1 1 1 1 2 2 6 1 7 3 4 1 3 1 2 1 1 5 1 1 1 1 1 4 14 1 6 1 6 25 8 1 1 2 19 20 3 1 9 4 10 71 47 3 10 1 2 16 7 1 3 Armitermes cf. 9 Angularitermes sp. 15 Angularitermes sp. No. 8 Angularitermes sp. 12 Angularitermes sp. 10 Angularitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Kalotermitidae Angularitermes nasutissimus Angularitermes sp. 4 Angularitermes sp.

A Nasutitermes sp. I 5 1 10 9 10 1 22 4 1 1 1 3 85 1 6 29 1 35 6 1 89 4 2 8 3 2 7 4 1 10 7 1 18 2 2 3 15 1 12 17 21 1 56 29 6 2 11 1 9 1 5 29 1 1 2 16 1 1 1 37 19 1 Nasutitermes sp. No. Especie Selva Barbecho Cultivo Agroforestal Pastizales 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 Coptotermes testaceus Cornicapritermes mucronatus Cornitermes pugnax Cornitermes sp.1 Continúa. Neocapritermes talpa 1 2 6 1 1 1 108 Manual de biología de suelos tropicales . Curvitermes odontognathus Cylindrotermes flangiatus Cylindrotermes parvignathus Embiratermes parvirostris Heterotermes tenuis Labiotermes psilus Microcerotermes strunckii Nasutitermes callimorphus Nasutitermes corniger Nasutitermes gaigei Nasutitermes guayanae Nasutitermes octopilis Nasutitermes sp.Tabla 3. J Nasutitermes surinamensis Nasutitermes unduliceps 1 Nasutitermes wheeleri Neocapritermes pumilis Neocapritermes sp.

Tabla 3. 1 6 8 1 1 1 2 1 1 1 2 3 9 3 6 5 1 1 5 1 1 1 9 9 259 52 20 3. 1 Ruptitermes sp.4 M acrofauna 109 .8 203 18 13 2.1 25.3 50.81 14. Planicapritermes planiceps Rhinotermes hispidus Rhinotermes marginalis Rotunditermes bragantinus Rugitermes sp.4 1 5 2 2 1 3 8 7 471 50 39 2. No. 2 Ruptitermes sp.6 81.04 .1 Continúa. 3 Triangularitermes triangulariceps Velocitermes sp.4 3 2 1 229 35 18 2. Ruptitermes sp.90 26.1 3 119 15 10 2.01 . 3 Subulitermes baileyi Subulitermes microsoma Syntermes molestus Syntermes spinosus Syntermes territus Termes hispaniolae Termes medioculatus Triangularitermes sp.91 .8 72.96 34. Especie Selva Barbecho Cultivo Agroforestal Pastizales 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Neocapritermes taracua Neocapritermes villosus Obtusitermes sp.41 0.6 4 Muestras Especies Transectos Índice Shannon(H) Índice Simpson Rarefacción (100 muestras) Estimación de Chao 86.2 18.3 25.90 25.3 52.3 17.80 .80 14.7 Estimación de Jackknife 1 74.

La caracterización de un ensamble de especies involucra varios pasos. de un hábitat o área geográfica específica. Interpretación de resultados Los ensambles de especies son grupos de especies relacionadas taxonómicamente. en los apéndices 2 y 3. otra información puede ser obtenida del transecto. varían entre el taxa y entre regiones. la disponibilidad de claves adecuadas publicadas. Si los detalles bibliográficos no están incluidos en la tabla. Invariablemente. al final del presente capítulo. Algunas veces se refieren a “comunidades de especies”.taxonómicas para termitas. esto se obtiene como resultado de la anotación del número de especies y morfoespecies. por lo tanto. antes de tomar las muestras. El mejor enfoque para identificación. con un grado de selección de limos y fracciones de ar110 Manual de biología de suelos tropicales . Las termitas distribuidas en el perfil de suelo. por lo que muchos museos o instituciones científicas dedicadas a la taxonomía y conservación de la biodiversidad. Las termitas pueden colocarse dentro de las siguientes categorías tróficas: • Las que se alimentan del suelo. por ende. formar un grupo funcional (GF) uniforme y su composición también puede verse afectada por los métodos de muestreo utilizados. desde muestreo en campo hasta identificación y análisis de datos. la cual se puede definir y estimar por varios métodos. pueden consultarse en la lista de literatura. Los ensambles de diferentes hábitats o localidades pueden compararse con varias estimaciones o índices y agruparse de acuerdo con sus similitudes. conferencias y documentos producidos por proyectos de desarrollo internacional sin una distribución global. los cuales no están disponibles para el público en general. Los ensambles pueden o no. Aunque la información básica generada es la de riqueza especifica. es necesario extrapolar de la muestra y utilizar estimaciones comparables de la diversidad local. será el entrenamiento o bien que el procesamiento de especímenes esté a cargo de un taxónomo con experiencia. Casi siempre la muestra no contiene todas las especies presentes en el hábitat. aparentemente. Lo más importante es la diversidad funcional del grupo. junto con su calidad. en relaciones ecológicas actuales. que se centran en una sola región. pero este término no es correcto. Una de las principales propiedades de un ensamble es “la diversidad de especies”. pues dichos ensambles son delimitados por una clasificación taxonómica basada en historia y filogenia y no. la capa de hojarasca orgánica y/o montículos epigeos se alimentan del suelo mineral. cuentan con sus propios manuales. Existe también una “literatura gris” extensiva de reportes de talleres.

.raíces. todos menos los que se encuentran en una fase de descomposición terminal. que pueden volverse centros de colonias. y menos tejidos de plantas reconocibles que en otros grupos (Sleaford et al. Esta categoría sigue la lista de alimentación de termitas de acuerdo con Wood (1978). provenientes de pasajes subterráneos o la formación de columnas descubiertas de individuos. Ruptitermes y otras especies de Constrictotermes en América del sur que se M acrofauna 111 . Las que forrajean la hojarasca (Termitas forrajeras). incluye especies que se alimentan de hongos.• • • • cilla. Este grupo incluye algunos Macrotermitinae subterráneos y constructoras de montículos y otras Nasutiterminitinae y algunas otras que se alimentan en la superficie del suelo. hojarasca y superficie del suelo y porque hace agujeros que se abren en la superficie. normalmente compuestas por obreros y soldados forrajeros. todavía unidas del árbol viviente y árboles muertos en pie. Este tipo de termita forrajera usualmente es más conspicua que otros tipos alimenticios. Las termitas que se alimentan de madera y que cavan túneles en piezas más grandes de madera. 1996). Las que se alimentan de madera. Este grupo incluye termitas con nidos arbóreos. o mezclada con hojas podridas en complejos de limo . Las que se alimentan del suelo y de madera. al igual que otros que se han caído y se conservan aún frescos. Este grupo es sinónimo de “alimentadores medios” sensu DeSouza y Brown (1994). pero que se alimentan en otro lado y muchas Macrotermitinae que cultivan jardines de hongos. algas. Las termitas que buscan hojas muertas. Las termitas que se alimentan de madera muy podrida. Las termitas de alimentación especializada o incidental. la cual se ha vuelto fácilmente desmenuzable y que se asemejan al mismo suelo o que predominan dentro del suelo. subterráneos o epígeos. briofitas y líquenes en la corteza de los árboles (por ejemplo. pastos vivos o secos y pequeños pedazos de madera. reconocida por Collins (1989). normalmente cortan el material antes de consumirlo o lo llevan a sus nidos. junto con por lo menos una termita inferior del sur de África Hodotermes mossambicus con un hábito similar. pero no en la misma categoría de “alimentadores de madera podrida”. Aunque el material digerido es altamente heterogéneo. por razones de las numerosas galerías o placas de suelo que construye encima de la madera. o bien. quedan proporciones más altas de materia orgánica del suelo y sílica. El término “madera” incluye ramas muertas. debajo de troncos o en suelo adherido a la superficie de troncos en estado de putrefacción. Hospitalitermes hospitalis en el sureste de Asia.

las comunidades de selva son frecuentemente dominadas por las que se alimentan de suelo. que habitan dentro de los nidos de Constrictotermes). es posible comparar ensambles de termitas en base a tipos de nidos. especialmente bajo condiciones desfavorables. aunque el excremento se puede considerar como forma de basura descompuesta) y también ciertas habitantes secundarias de montículos de termitas que se alimentan de los forros hechos de rica materia orgánica. La forma de distribución de dichas categorías indica la estructura de la comunidad de termitas. una aproximación útil se obtiene dividiendo las especies en “alimentadas de suelo” o geófagas (alimentadas de suelo.Gay y Calaby. etc. Ophiotermes y Tuberculitermes. Las categorías no son mutuamente excluyentes y muchas especies toman sus alimentos de por lo menos dos fuentes diferentes. Inquilinitermes. generalmente.alimentan de líquenes). Algunas veces la madera muerta es gradualmente reemplazada por material acartonado o por panales de hongos. las que se alimentan de excrementos o las carroñeras de cuerpos de vertebrados (probablemente consumidos oportunamente. el lugar de su descubrimiento (en madera. La identificación del grupo funcional puede hacerse de acuerdo con el color abdominal en especímenes vivos (las alimentadas de suelo y suelomadera son más oscuras). en Australia. aunque ninguna especie es realmente fitófaga. Las termitas cuyos centros de colonia normalmente se concentran en troncos muertos o árboles en pie. Si se dificulta la selección de un grupo funcional. incrementa las proporciones de otros grupos funcionales. la mayoría de la Apicotermitinae se alimentan de suelo o de suelo y madera). y suelo y madera) como las definidas arriba.). otros aspectos biológicos como el lugar donde anidan (las que anidan en árboles normalmente no se alimentan de suelo). Los centros son pocos definidos y amorfos (especialmente en 112 Manual de biología de suelos tropicales . Eggleton y Bignell. las Macrotermitinae no se alimentan del suelo. suelo. de manera similar. 1970. encontrada en las cámaras interiores como inquilinas obligadas (Por ejemplo: Ahamitermis y Incolitermis. Termitas cuyos centros de colonia quedan bajo el suelo. y “las que no se alimentan de suelo” (todas las demás). pero la perturbación o un periodo de secas. 1997. la ausencia de soldados (generalmente indica las que se alimentan del suelo) y la afiliación taxonómica (por ejemplo. Algunas termitas también se alimentan de tejido de planta viva. según las siguientes categorías: • Las que anidan en madera. • Las que anidan de manera hipogea. en África oeste y central.

que se forman por sí solos o que se asocian con los contrafuertes de los árboles. pero excluyen montículos arbóreos. estos nidos están conectados con el suelo mediante pistas cubiertas que pueden ayudar a distinguir algunos nidos de termitas arbóreas de los de hormigas. con estructura interna poco obvia. Termitas cuyos centros de colonia se sitúan arriba del suelo.5 Ejemplo de curva de acumulación de especies con una desviación estándar. Figura 3. usualmente construidos con material de apariencia acartonada (cartón). normalmente están bien definidos y constituyen estructuras altamente complejas. En la mayoría de los casos. hechas de acuerdo con especificaciones típicas de la especie. Nidos que se sujetan a árboles y que se localizan en diferentes alturas. • Montículos arbóreos. adiciones y ocupación por parte de habitantes secundarios. • Montículos epigeos. M acrofauna 113 . pero con una tendencia a volverse más irregulares con el paso del tiempo por razones de erosión. Estos montículos. Este grupo incluye especies que son habitantes secundarias facultativas de montículos epigeos. aunque algunas forman nidos subterráneos complejos (por ejemplo Marcotermitinae). utilizando permutaciones de datos al azar.los Apicoterminotenae que no tienen soldados).

muestra. es únicamente una gráfica del número de especies acumuladas. número de especies y. o área. con un 5% de nivel de probabilidad. Los análisis de multivariados. trampa. OTRA MACROFAUNA Y MESOFAUNA EN HOJARASCA. en la secuencia en que fueron anotadas en el campo. HORMIGAS. producción de excretas por cada tipo de uso de suelo.Curvas de acumulación de especies Las curvas de acumulación de especies son gráficas que representan la relación entre el esfuerzo de muestreo y el descubrimiento de las especies en un hábitat o región. tienen diferentes sig114 Manual de biología de suelos tropicales . Aunque algunos autores consideran estos nombres como sinónimos. El esfuerzo de muestreo puede ser medido por espécimen. en el caso de lombrices de tierra. La forma más simple de estas curvas es conocida como la curva del colector. el de correspondencia (AC) y el de co-inercia pueden ser útiles para determinar factores que afectan la densidad y la diversidad de lombrices de tierra. Para más análisis estadísticos. en todos los paisajes agrícolas (Thioulouse et al. Otro método será normalizar la densidad y la biomasa de las lombrices de tierra antes de llevar a cabo el análisis paramétrico de varianza (ANOVA). 2000). la curva es asintótica y tiende a inclinarse.0b1 (Colwell. utilizando el software de EstimateS versión 6. se establece la comparación de la media del índice Shannon-Wiener. La prueba Kruskal-Wallis ANOVA puede utilizarse para probar si existe un efecto significativo de los tipos de uso de suelo en relación con la abundancia de lombrices de tierra. La relación entre abundancia de lombrices de tierra y el índice de uso de suelo se comprueba utilizando regresiones.5) u otros métodos que normalmente requieren de programas computacionales especializados. En el caso de un esfuerzo de colecta grande. en relación con el número de unidades de muestreo. tiempo (o persona por tiempo).. Las curvas más sofisticadas. tales como el de componentes principales (PCA). se pueden obtener utilizando permutaciones (reiteraciones) de los datos al azar (Figura 3. Las curvas de acumulación de especies pueden ser obtenidas reiterativamente mediante remuestreo al azar de los monolitos de suelo o por secciones de transectos. con desviaciones estándar. mediante la prueba Fisher. hasta 500 veces. 1997). UTILIZANDO EL MÉTODO WINKLER Introducción Las hormigas pueden clasificarse en grupos funcionales o gremios.

) muestran adaptaciones fisiológicas. Aunque han sido varias las propuestas de esquemas de clasificación de grupos funcionales. mientras que los grupos funcionales se refieren a especies que utilizan estrategias similares para explotar el recurso y pueden estar formados por más de un gremio.. Paratrechina spp. Bothroponera y Odontomachus). 2000). morfológicas y de comportamiento que reducen su interacción con la dominante Iridomyrmex spp. de modo que minimizan el contacto con otras hormigas que no ocupan este hábitat (Brachyponera spp. 1986). Meranoplus spp. • Especies crípticas: especies de hormigas forrajeras que normalmente anidan bajo el suelo (en la capa de suelo y hojarasca).nificados: los gremios son un grupo de especies que utiliza el mismo tipo de recurso para su supervivencia (Terborgh y Robinson.). no especialistas y altamente competitivas. que pueden coexistir con la dominante Iridomyrmex spp. • Especies especialistas en clima y suelo: estas especies (Melophorus spp. Ejemplo: Iridomyrmex spp.. se recomienda utilizar el de Andersen (1997).. Eurhopalothrix spp. en su mayoría. Los siguientes son ejemplos de gremios en la selva brasileña de la Costa Atlántica (Delabie et al.. • Especies oportunistas: escasamente competitivas. hormigas no especialistas que frecuentemente viven en ambientes perturbados (Rhytidoponera spp. son cosmopolitas. pues es la más usada en diferentes paises. M acrofauna 115 . • Especies dominantes: especies muy abundantes y agresivas que influyen sobre la distribución y el comportamiento de otras especies de hormigas. Aphaenogaster spp. Crematogaster y Pheidole. • Especies forrajeras solitarias de tamaño relativamente grande: predadoras solitarias que manifiestan muy poca interacción con otras especies de hormigas (especies dentro de los géneros Myrmecia.. y Notoncus spp..). originalmente diseñado para hormigas australianas. • Especies generalistas myrmicines: especies que pertenecen al género Monomorium. las pertenecientes al género Camponotus. • Especies subordinadas asociadas: incluyen. debido al tamaño relativamente grande de su cuerpo y a su comportamiento sumiso.

la empleada en el taller CSM-BGBD (2005): 116 Manual de biología de suelos tropicales . Solenopsis (especies grandes) y Wasmannia. ejemplo: Odontomachus y Ectatomma. • Especies de hormigas subterráneas: dependen de gotitas de aguamiel y comen secreciones de azúcar de otros insectos. carroña y restos de plantas para cultivar sus hongos. forrajean toda la vegetación arriba de la superficie y en la hojarasca. ejemplos: Gnamptogenys (hormigas y otros insectos depredadores). por ejemplo. • Especies de hormigas legionarias: también conocidas como “formigas da correição”. • Especies predadoras generalistas: especies que se alimentan de diferentes tipos de presas. ejemplo: Azteca y Crematogaster. • Especies predadoras de suelo: especies que se establecen en el suelo y en la hojarasca. se subdividen en dos grupos: a) predadoras generalistas grandes. Atta. • Especies de hormigas arbóreas dominantes: especies omnívoras que anidan en árboles. ejemplo: Amblyopone (predadoras de termitas) y Thaumatomyrmex (predadoras de miriápodos) y Strumigenys (predadoras de colémbolos). 1995). También existen otras clasificaciones funcionales. Campanotus. Apterostigma. incluyendo los restos de animales muertos. • Especies de hormigas dominantes en suelo u hojarasca: hormigas forrajeras de hojarasca y suelo o de la superficie. b) verdaderas omnívoras: Brachymyrmex. Pachycondyla y Centromyrmex (inquilinas de nidos de termitas). son generalistas o especialistas dentro de las especies predadoras. Mycocepurus. Anochetus e Hypoponera. es conveniente escoger las clasificaciones más cortas. Sericomyrmes y Trachymyrmex. probablemente comedoras de larvas de termitas del género Syntermes (Delabie. por ejemplo. ejemplos: Acromyrmex. ejemplo: Megalomyrmex. ejemplo: Acropyga. • Especies cultivadoras de hongos: especies que utilizan hongos simbióticos. Myrmicocrypta. Pheidole y Solenopsis. normalmente miembros de Attini. donde son forrajeras. Labidus (predadoras generalistas) y Neivamyrmex y Normamyrmex.• Especies omnívoras: especies que se alimentan de varias fuentes. Paratrechina. Cyphormyrmex. son altamente agresivas y presentan una influencia competitiva sobre otras especies. Utilizan hojas frescas. ejemplos: Eciton. • Especies predadoras especialistas: especies que se alimentan de un solo tipo de presa. predadoras especialistas que comen otras hormigas. para trabajo de campo práctico.

realizando movimientos laterales. • Carnívoras (especialistas o generalistas). Se utiliza un marco para delimitar un área de un 1 m2 y se remueve la hojarasca a mano. con un centro de colonia en las capas superficiales de hojarasca. posteriormente. Se coloca un frasco con alcohol al 70% en la base de la trampa Winkler. junto con las hormigas y se transfiere a bolsas en campo. c) extraer las hormigas dentro de la trampa Winkler. véase también el Capítulo 2). con un centro de colonia epigeo o arbóreo. por lo menos. que se encuentra en. 1999). con el centro de colonia epigeo o arbóreo. Procedimiento de muestreo El procedimiento completo se lleva a cabo en tres fases: a) tamizar en campo para separa la hojarasca fina (con hormigas) de la materia más gruesa. de manera que no escape ningún insecto. sobre una sábana blanca. estas redes se fijan dentro de la trampa Winkler. el contenido de las bolsas de campo se transfiere a redes. tres cuadrantes de 1 m2. junto a la coordenada GPS y al monolito (Ilustración 1. los cuales son colgados en un lugar cubierto. • Herbívoras. Este procedimiento permite separar la macrofauna pequeña y alguna de la mesofauna M acrofauna 117 . cerrado pero ventilado. • Herbívoras. cuando los Winklers no se encuentren disponibles. trabajando desde el borde hacia el centro. como complemento o alternativa. • Carnívoras (especialistas o generalistas).• Carnívoras (especialistas o generalistas). preferentemente colocados a lo largo de la línea de transecto. se mantiene la trampa durante por lo menos 72 horas. La fracción fina queda en el fondo de la bolsa del tamiz. Esto debe hacerse con suficiente habilidad. • Herbívoras. lentamente las hormigas y otros insectos migran hacia afuera y se caen en el alcohol. con el centro de su colonia en las capas superficiales de hojarasca. Se recoge primero la hojarasca. Una vez en el laboratorio. con guantes de cuero. en alcohol al 70%. con el fin de maximizar la recuperación de los especímenes (Delabie. conforme se seque la hojarasca. hacia arriba. ventilado y bajo condiciones ambientales. con un centro de colonia subterráneo. de manera que se puedan separar los fragmentos más gruesos. con un centro de colonia subterránea. se puede pasar la hojarasca burda por una malla de 2 mm. b) transportar al laboratorio dentro de una bolsa segura. Se almacenan los especímenes en tubos cerrados y etiquetados. Se tamiza cada muestra de hojarasca para remover pedazos grandes.

una por cada trampa. tazas. dichas trampas están hechas de envases profundos relativamente pequeños. que se entierran de manera que la parte superior del envase quede exactamente al ras del suelo. el cual contiene alcohol al 70%. a prueba de insectos y mide 1. • Bolsas de nylon. ESCARABAJOS. 25 cm de ancho y 20 cm de profundidad central. se pueden recolectar los especímenes de la sábana. deberá ser pesada al final de la extracción. hasta el lugar donde se encuentren las trampas Winkler. vasos.. por ejemplo. de aproximadamente 34 cm de ancho x 55 cm de largo. Se achica el fondo de la bolsa para que se pueda colocar un frasco de aproximadamente 200 ml de capacidad. de aproximadamente 1. 2000) es la siguiente: • Marco con una medida de 1 x 1 m de madera. las cuales serán llenadas holgadamente con la hojarasca trasportada en las bolsas del campo y se colocaran en el centro de la trampa Winkler para dar paso a los invertebrados. Como variación de este método. utilizando un aspirador manual (pooter). • Redes. de esta manera. • La trampa Winkler consiste en una bolsa porosa de algodón o nylon. la parte superior del envase puede situarse a 1 cm más arriba de 118 Manual de biología de suelos tropicales . contenida en la trampa Winkler. La lista completa de los materiales para la extracción con trampas Winkler (Bestelmeyer et al. OTRA MACROFAUNA Y MESOFAUNA QUE SE ENCUENTRAN EN LA HOJARASCA: TRAMPAS PITFALL CON Y SIN CEBO Introducción Las trampas pitfall o de caída constituyen un método efectivo de recolección de muestras de los invertebrados meso y macro que viven en la hojarasca. botellas de plástico. las cuales se usarán en campo para transportar el material tamizado. plástico o aluminio para delimitar el área de muestreo.50 m de largo. • Tamiz de malla grande. La hojarasca seca. que entre dentro de una bolsa resistente de nylon o tergal. se marca un límite de búsqueda de 30 minutos por cada metro cuadrado de hojarasca muestreada. de alrededor de 5 mm.5 m de largo. latas. después de limpiar la hojarasca suelta en el punto donde se va a colocar la trampa. de 25 cm de ancho y 37 cm de largo.del material orgánico y. tarros. en este caso.

Las trampas normalmente se limpian y se recolocan una vez al día. de manera simultánea.6 Esquema de una trampa pitfall con cebo. colémbolos). arañas y otros arácnidos grandes tienden a dominar. al igual que a actos de vandalismo. Las trampas se colocan bajo cubierta para evitar que entre la lluvia y funcionan como colectores de artrópodos que viven en el suelo y que caen en el envase. M acrofauna 119 . se encuentran dispuestas de manera lineal (para facilitar la instalación y el retiro) sufren la misma desventaja que los transectos. Una típica trampa pitfall puede observarse en la Figura 3. miriápodos. Nota: frascos con diámetro de 10 a 20 cm generalmente son efectivos. presentan algunas desventajas: sobre todo que no muestrean todos los grupos taxonómicos con la misma eficiencia (escarabajos. hormigas. se pueden utilizar específicamente para atrapar animales nocturnos. puesto que en ambas existe un alto grado de autocorrelación entre muestras adjuntas.la superficie y se construye una rampa de suelo suelto a su alrededor. mientras que los insectos alados se escapan). El diámetro más pequeño ofrece la ventaja de sufrir menos perturbación al momento de insertar la trampa. pero la trampa debe ser lo suficientemente amplia como para poder colectar un número razonable de especímenes y suficientemente profunda Figura 3. la macrofauna y parte de la mesofauna (especialmente. Las pitfall son baratas. las pitfall son proclives a sufrir daños ocasionados por mamíferos y aves. Además. éstas ofrecen ventajas adicionales: se puede muestrear. ortópteros juveniles. Las trampas pitfall no son cuantitativas y dado que. ahogándose en agua contenida en el fondo de la trampa.6. No obstante. por lo que se utilizan frecuentemente en los trabajos de inventario de la biodiversidad. las dimensiones no son fundamentales. normalmente. de fácil instalación.

cuatro palitos pequeños y una cubierta de celofán.7 Trampa pitfall improvisada. sin embargo.para impedir la fuga. una caja Petri de vidrio invertida. Los clavos galvanizados o de madera son la mejor opción para elevar el techo hasta dos Figura 3. es lo ideal. ésta descansará sobre palitos o clavos. Entre 1 o 2 cm de agua en el fondo y un poquito de detergente serán suficientes para ahogar o inmovilizar a la mayoría de los animales y el detergente contrarrestará las propiedades hidrofóbicas de muchas cutículas de artrópodos. 120 Manual de biología de suelos tropicales . hecha con un vaso. éstos pueden ser improvisados en el campo. Un aditamento usual a las trampas es un techo inclinado para protegerlas de la lluvia.

¿cuál sería el número apropiado de trampas pitfall requeridas para colectar el 85% o más de las especies capturables en una unidad vegetal dada? En el muestreo basado en transectos (Swift y Bignell. pueden ser útiles para la estimación de la diversidad alfa. Se puede argumentar que cuando se trata de sol directo. por lo que el techo se mantendrá más estable. 2001). Colocación de trampas Mientras las pitfall son estrictamente no cuantitativas. de manera que no atraiga insectos voladores. de manera que permitan el acceso a las trampas. pero deberán evitarse siempre que se pueda. El uso de envases de color fuerte o con dibujos puede mejorar la captura de parasitoides u otros insectos voladores que serán atraídos por los colores. con la excepción de agua y roca.7). retardando así la descomposición. El número de réplicas puede basarse en curvas de acumulación de especies y ha de ser seleccionado para lograr un 85% o más de las especies buscadas. Las trampas pitfall pueden usarse en cualquier sustrato a nivel del suelo. En algunas variaciones de este procedimiento se añade sal como conservador. plástico. combinados con un poco de glicerina) para mejorar su conservación. El techo puede hacerse también de loseta de cerámica. En otras palabras.o tres centímetros. En estudios referidos a riqueza de especies. lo que resulta atractivo para los artrópodos diurnos activos en la superficie. el techo debería ser opaco para evitar un efecto invernadero dentro de la trampa. madera podrida y turba. El vidrio pesa más que el plástico. madera u otro material lo suficientemente pesado como para que no lo eleve el viento o que pueda ser afectado por la lluvia o el sol y que además no sea comestible para las termitas. las pitfall normalmente se colocan en paralelo y M acrofauna 121 . de manera alternativa. dentro de un rango de unidades vegetales. también crea un microhábitat como si fuera una cueva. éste deberá ser gris claro. aunque su aplicación más común es en un sustrato de suelo para la fauna de artrópodos activa en la superficie del suelo (Figura 3. Pueden emplearse para muestrear artrópodos en madrigueras. una solución de hidrato de cloruro al 5% o una mezcla de ácido láctico/ácido acético (10% de cada uno de ellos. pero se puede utilizar. al mismo tiempo que ayuda a mantener el contenido fresco. hojarasca. con una respuesta negativa a la luz. ajenos a la fauna del suelo. muestran que un nivel de captura aproximada puede obtenerse mediante la replicación de trampas pitfall. Estudios que se enfocan a la abundancia. el número de especies obtenidas por medio de las trampas pitfall se incrementa cuando éstas son colocadas en un máximo de unidades vegetales.

3 El suelo fino. según el orden de vulnerabilidad decreciente: primero las pitfall (de un día para otro) seguidas por los transectos. se aplana con cuidado para mantener el mismo nivel que el borde de la trampa. podrá hacerse en cualquier momento. cualquier microhábitat de interés podrá ser investigado. finalmente. el monolito. Se debe tener especial cuidado para evitar remover suelo y raíces. a una distancia de alrededor de 5 m. Se muestrea. colocados en la superficie del suelo. especialmente a pisadas. de manera que se minimice al máximo la perturbación del microhábitat adjunto. deberán ser extraídas a mano. de manera que los animales caminen sin obstáculos hacia el borde de la trampa. sugerido por Southwood (1978) hace uso de tablas de madera o de algunos obstáculos similares de hasta 30 cm de alto. 2 Se coloca la trampa pitfall en el hoyo y el borde externo se llena de tierra procedente de la excavación. ello depende del largo del transecto. El número recomendado es de 3 a 5 trampas por cada punto de muestreo. capítulo 2. Instalaciones de las trampas pitfall Las trampas pitfall deben ser introducidas en el suelo con el borde superior del envase al ras del mismo o de la superficie de la hojarasca.a cada lado. ordenar el lugar entero. fuera del área principal de actividad. Un esquema variable de muestreo con pitfall. es decir. se canalizan los animales móviles hacia la base de la “V” o embudo. una precaución sensata sería. En el sistema de muestreo recomendado para el proyecto CSM-BGBD. que cae en la trampa durante su colocación. Se usa el relleno para construir una rampa. No se especifica el número. puede soplarse hacia afuera. 1 Se utiliza una cuchara de albañil para cortar y sacar las raíces y suelo. De esta manera. Cuando una parcela es botánicamente compleja y varias unidades vegetales pueden ser reconocidas. las pitfall pueden ser distribuidas de la misma manera que en el muestreo casual para hormigas y termitas. extracciones de núcleos de mesofauna y de microsimbiontes y. La colecta de las pitfall es sensible a la perturbación. en forma de “V” o de embudo. Un muestreo ocasional. donde se puede colocar una colección de pitfall de manera cercana (véase "cercas movibles”). se sugiere que las pitfall sean colocadas a lo largo de la línea de transecto y a un lado de los cuadrantes de 1 m² del muestreo para hojarasca. por lo tanto. 122 Manual de biología de suelos tropicales . las partículas más grandes. pero esto no trata de ser prescriptivo. con el fin de hacer un hoyo del tamaño del vaso a introducir.

Se añade un poquito de detergente como agente tensoactivo. utilizando un flujo suave de agua. animales más grandes. durante varios minutos. un palito. enjuagando el contenido de cada bolsa en la red. Cada trampa se debe procesar de manera separada y se coloca en la bolsa o frasco una etiqueta con la identificación del lugar. situado en su parte superior.5 cm de cada soporte visible. El lavado de ejemplares en agua fresca es esencial porque el detergente y la suciedad forman una película sobre los insectos. lo que servirá para separar los últimos ejemplares.4 Se insertan tres soportes de techo en el suelo alrededor de la trampa. palitos. lo que dificulta que sean manipulables y visibles bajo M acrofauna 123 . Se transfieren los especímenes en bolsas de plástico o frascos desde la red. Se extraen los elementos grandes. se utiliza por separado un colador de 53 µm. colocado verticalmente con un pedazo de cinta o banderín amarillo o naranja. 5 Se llenan las trampas hasta alrededor de ¼ de su capacidad con agua y suficiente sal como para lograr una solución saturada (en caso de escoger una solución salina). 7 Se coloca un indicador con el número de lugar y trampa (en tinta indeleble o lápiz) cerca de la trampa. Los especímenes deberán procesarse el mismo día en laboratorio o la base de campo. la sal y el detergente. El mantenimiento y el procesamiento de especímenes El mantenimiento de las trampas se lleva a cabo de la siguiente forma: se quita el techo y se levanta el vaso interior que contiene el cebo (en el caso de que lo contenga. Se retira cualquier basura grande restante y se trata de retirar al máximo la tierra u otra basura orgánica. utilizando un frasco para enjuague o pipeta de agua. dejando así 2. etc. tales como hojas. trampa y fecha de recolección. se agita suavemente el contenido restante del vaso para levantar los especímenes del fondo y se filtra con una red de acuario. El detergente facilitará la inmovilización por ahogamiento de animales activos. ver abajo). a no ser que la frecuencia de mantenimiento sea de 24 horas o menos. con el fin de remover la suciedad. arriba del substrato. 6 Se coloca el techo sobre los soportes. que hayan caído en la trampa. resulta útil para identificar la localización de la trampa y para prevenir pisadas accidentales. esta película es difícil o hasta imposible retirar una vez que los ejemplares quedan conservados. siempre se necesitará sal u otro tipo de conservador en climas tropicales. Para poder retener los colémbolos. si se les introduce directamente en alcohol.

Las trampas con cebo no podrán utilizarse en una evaluación semi-cuantitativa como medio de captura (por ejemplo. lleno de alcohol. Se cubre con alcohol la muestra hasta la altura de los ejemplares que se encuentran dentro de la muestra. se invierte el contenido de la red en una bolsa de especímenes y con un atomizador o piseta. se usa alcohol al 95% en el caso de colémbolos y al 70% para otros especímenes. El cebo deberá separarse del líquido conservador. si es posible. Las muestras almacenadas deberán quedarse en una bolsa doble o frasco. por supuesto. esto se lleva a cabo con la suspensión del cebo en un pequeño bote colocado en la boca del envase principal. y se introducen las etiquetas (escritas con tinta indeleble o con lápiz). frutos caídos u hongos en descomposición que resultan indistintamente atractivos para los detritívoros y algunos otros tipos de artrópodos. El cebo puede ser estiércol. en espera de futuros procedimientos. el porcentaje de todas las trampas estará ocupado por una sola especie) porque no se puede determinar 124 Manual de biología de suelos tropicales . porque la capacidad de captura de las pitfall está en función del tamaño de su circunferencia. carroña. cebos de color (amarillo. Se recomiendan dos trampas de este tipo más tres de diseño convencional por cada punto de muestreo. se lava suavemente el contenido de la red y los lados de la bolsa o frasco con el fin de que los ejemplares caigan hasta el fondo. La principal modificación en el diseño consiste en agrandar su diámetro. feromonas). se encuentra fácilmente disponible. Se pueden preparar trampas pitfall adicionales (opcional) con un contenido de 120 ml de etanol al 95% + glicerina (9:1) que se dejan en campo durante 72 horas. El hecho de usar cebos atractivos implica un mejoramiento general para la captura de una gran variedad de artrópodos. El excremento humano fresco también es apetecible para una gran variedad de escarabajos y. Para mejorar la capacidad de captura con trampas pitfall Es posible mejorar la capacidad de captura con las trampas pitfall haciendo varios cambios en el diseño de la trampa o usando cebo atractivo para artrópodos. Después de este lavado.microscopio. se refrigeran o se congelan las muestras. rojo o azul) para atraer moscas o parasitoides. o sustancias sintéticas atractivas (por ejemplo. Después de siete días se debe cambiar el alcohol y. Para el procesamiento de ejemplares de colémbolos véase Capítulo 4 (Mesofauna). El uso de cebos resulta controversial porque el muestreo se sesga hacia los animales con un marcado olfato. Una variante de este proceso es usar dos filtros para colémbolos (malla 53 µm y 38 µm) se utilizan para separar estos animales de la otra fauna (ver Capítulo 4).

el área en donde se llevó a cabo el muestreo y la captura no sólo depende de la abundancia de animales. trampas Winkler. sin embargo. pesados después de un secado con papel absorbente. Si no se cuenta con una balanza disponible en el campo. Lista de materiales requeridos • Trampas pitfall: vasos de plástico de 1000 ml (con dimensiones de 180 mm de diámetro superior x 120 mm de profundidad). utilizando el nombre genérico y por orden alfabético. loseta de color gris claro. REGUISTRO E INTERPRETACIÓN DE DATOS Parámetros Registre el número y peso fresco de todos los organismos e identifique. 2 o 6B) • Etiquetas tipo tarjeta. • Detergente puro: detergente líquido no perfumado para platos. se combinan los resultados de los monolitos. sino también de la movilidad relativa. siempre que sea posible agruparlas en familias o subfamilias. se puede estimar el peso fresco para ejemplares conservados. Para completar la lista. esto es aplicable para las lista de especies de la localidad. se hace una lista de especies. • Lápiz de grafito (ej. M acrofauna 125 . por lo menos. trampas pitfall junto con un muestreo casual. • Agua: agua de la llave o de una fuente natural. hasta el nivel de determinación taxonómica y funcional más alta posible. • Red de acuario o similar (de malla fina). transectos. • Indicadores de plástico o de madera. • Sal. • Alcohol al 70 al 90%. no. • Cubeta o envase para agua. • Bolsas de plástico para muestreo con sello (tipo ziplock son las más convenientes para el almacenamiento de especímenes de campo) o frascos. • Soportes del techo: clavos de madera o galvanizados de 152 mm (seis pulgadas). La presencia y el peso de hongos cultivados por las termitas (si los hay) también deberán anotarse. • Techo de 200 x 200 mm (uno por trampa).

y Crematogaster sp. A. a través de un gradiente de perturbación de la selva. los cuales se muestrean en el mo126 Manual de biología de suelos tropicales ..892 BS3. de cada monolito y de cada estrato. Sitio Media aritmética individuos m-2 (n=5) BS1. deberán enlistarse sin letras: Ejemplo Colobobsis sp.046 2-9. Hule 128 BS10.2 Densidad numérica (individuos m2) de termitas en siete localidades. Incorpore la lista de especies en una tabla que muestre las localidades donde fue encontrada cada una. Las especies identificadas únicamente a nivel género. La abundancia se estima como número o individuos por m2. se multiplica el número crudo de cada monolito x 16.Las especies plenamente identificadas deberán enlistarse con su nomenclatura binomial (género y especie) y la autoridad que las describió completas: Ejemplo Dorylus laevigatus Smith. Selva de hule 211 BS12. la especie A es la misma especie en toda el área de muestreo. Alang-alang 3 BS14. Tabla 3.445 2-1. Árboles talados 163 BS6. Las morfoespecies deberán enlistarse por letra: Ejemplo Crematogaster sp. en la provincia Jambi del centro de Sumatra. Paraserianthes 512 BS8. B. 2003.772 0-20 2-534 95% de confianza 3-64 43-148 24-78 1-50 * Datos retrotransformados. Selva primaria 2. Es importante que la designación de letra sea consistente entre las localidades. Cassava 26 Media aritmética Nivel del estrato (Promedio de todas individuos m-2 (n=5) las localidades) 46 0–10 cm 106 10–20 cm 55 20–30 cm 49 Media geométrica individuos m-2 (n=5)* 971 65 47 11 25 2 10 Media geométrica individuos m-2 (n=5)* 15 80 44 4 95% de confianza 347-12. Por ejemplo.827 22-977 5-16. con la excepción de las lombrices de tierra y milpiés. Fuente: datos de especies de Jones et al.

1996). Se citan las medias para datos no transformados. y prepare una tabla resumida.2). se puede probar una transformación loglog. Este concepto no se puede aplicar de la misma manera para las pitfall. derivar en índices de diversidad de especies y de equitatividad. Los datos transformados pueden usarse para histogramas y comparaciones de lugar a lugar (Eggleton et al. Eggleton et al. Se evita el uso del peso seco debido a las diferentes temperaturas de los hornos que usan algunos investigadores y por el contenido variable de agua de los diferentes tipos de organismos. Para la información completa obtenida de transectos. o sea. Donde se dispone de especímenes de insectos de varios tamaños. también para cada grupo taxonómico superior y se combinan los datos de todas las especies. los datos primarios deberán transformarse en log10(x+1). número de pitfall respecto al total. o para otros grupos individuos separados a lo largo del transecto completo. etc.nolito y la zanja (véase monolitos arriba). Se aplican estadísticas descriptivas al juego de datos transformados. resulta más conveniente M acrofauna 127 . El peso de los desconocidos puede entonces estimarse desde la curva. si es posible. (1997). por lo tanto. se calculan las medias aritméticas. Para poder estimar el 95% de límite de confianza. incluyendo el 95% de los límites de confianza y con los datos transformados se obtiene una media geométrica. se determina la abundancia para cada taxón. puedan ser parámetros útiles de población. se utiliza peso fresco o la masa de un espécimen parcialmente seco. en especímenes representativos que cubren todo el rango de tamaños. es posible asignar dominancia y. tal y como se muestra en la tabla 3. datos transformados y los límites de confianza para log10(x+1). En casos difíciles. existe un método alternativo que consiste en calibrar la biomasa viva con el ancho de cabeza. Se estima la biomasa en g. (2005). el número de veces que se descubren colonias separadas en el caso de hormigas o termitas. también es posible que el número total de encuentros. También partiendo de que un transecto completo representa una muestra única y grande. Jones e Eggleton (2000). En el caso de transformaciones a log de los datos..m-2 de manera similar a como se calcula la abundancia.). finalmente. véanse las discusiones en Eggleton y Bignell (1995). Algunos indicadores de la abundancia relativa se pueden obtener a partir de la frecuencia de encuentro de diferentes especies (número de secciones de un transecto en donde se localizó la especie con respecto al número total muestreado. junto con las medias geométricas. Cuando no hay demasiados ceros (muestras sin organismos) este procedimiento debería normalizar los datos y producir varianzas homogéneas de grupo a grupo. Woodcock (2005) y Jones et al.

el efecto de estos invertebrados es fraccionar y despedazar la hojarasca. Cantidades considerables de suelo. pero también algunos arácnidos. elementos minerales y materia orgánica se redistribuyen con esta actividad y también se acompañan de efectos físicos sobre la estructura del suelo y las propiedades hídricas. la clasificación de lombrices de tierra (ya mencionada) puede aplicarse a todos los invertebrados del suelo. escarabajos. una variedad de artrópodos (hormigas. sin embargo. abundancia y biomasa en forma gráfica. Este grupo incluye. definido por su hábito alimenticio y su distribución en el perfil del suelo. caracoles y pequeñas lombrices de tierra completamente pigmentadas. Especies epigeas que viven y se alimentan en la superficie del suelo. cucarachas.trabajar en (mg+1) y luego se transforman y se expresa en gramos. Análisis Los análisis se deben llevar a cabo por grupo funcional. Los dos grupos principales son las lombrices de tierra y las termitas que se alimentan del suelo. Las lombrices de tierra y las termitas que no se alimentan de suelo constituyen los principales grupos dentro de esta categoría. como arriba. es decir. pero no redistribuyen activamente materiales de las plantas (aunque el material despedazado sea más fácilmente transportado por el viento o el agua que el material de donde deriva). cochinillas y grillos). Nota: determinar solamente la abundancia resulta fácil. las cuales pueden ser incluidas en una o más 128 Manual de biología de suelos tropicales . Especies anécicas son las que retiran hojarasca de la superficie del suelo a través de su actividad alimenticia. puesto que no implica pesar especímenes individuales o hacer otras medidas para estimar la biomasa. por tanto. en su mayoría. Se debe mostrar riqueza de especies/morfoespecies. milpiés. y liberar nutrientes. La macrofauna activa en la superficie incluirá a los organismos muestreados en las trampas pitfall. ciempiés. de manera que monitorear datos sin estimaciones de biomasa proporciona información incompleta y. menos informativa. Se prepara una tabla resumida. Ensambles pueden ser comparados por la proporción relativa de especies o unidades taxonómicas (morfoespecies). ingiriendo grandes cantidades de materia mineral. muchas tasas de procesos en el ecosistema son proporcionales a la biomasa y no a la abundancia. Para poder establecer una comparación. Especies endógeas que viven en el suelo y se alimentan de materia orgánica y de raíces muertas.

que son complejos organominerales. según se explica a continuación. lombrices epigeas y ácaros grandes) ingieren una mezcla de materia orgánica y biomasa microbiana y forman heces holorgánicas de corta vida. Jacquard y Sorensen (véase Southwood. ACE. Transformadores de hojarasca (normalmente artrópodos no sociales o semisociales. ICE y EstimateS. La riqueza de especies actual puede ser estimada por medio de Sob. por categoría de uso de suelo y por ventana de muestreo. pero algunos animales más pequeños (varios ácaros) pueden tener funciones análogas. Macropredadores (especies predadoras >0. Este grupo incluye invertebrados grandes (> 1cm) y medianos (0. Los grandes invertebrados (> 1cm. normalmente procedentes de varios grupos de artrópodos). de forma incorrecta. Conjunto mínimo de datos por punto muestreado De todo el muestreo Lista de especies/morfoespecies para hormigas. como sinónimos. 1978 y Krebs.categorías funcionales. Nota: los términos “ingeniero de ecosistema y especies claves” con frecuencia son utilizados. Los índices de diversidad y de similaridad útiles incluyen: ShannonWiener. termitas y escarabajos capturados con cebo. Jackknife. 1998).2 a 1cm). Las especies clave (termitas y posiblemente algunos transformadores de hojarasca) proveen oportunidades físicas de nichos para organismos de nivel más bajo y determinan la estructura de la comunidad de estos organismos. Simpson.2 cm. CONJUNTO mínimo DE DATOS El conjunto mínimo de datos puede ser expresado por cada punto de muestreo. M acrofauna 129 . utilizando las siguientes categorías: Los ingenieros del ecosistema (normalmente hormigas. Se recomienda probar la clasificación de un grupo funcional (GF) adicional para la macrofauna. Lista por familia de los otros escarabajos. termitas y lombrices anécicas y endógeas). y forman heces longevas y estables. pero ocasionalmente más pequeños) ingieren una mezcla de materia orgánica y minerales.

en su defecto las que se alimentan de madera o de suelo).). GF 2. Se hace un cálculo para cada GF. Todas las lombrices de tierra (además por GF 1. etc. 130 Manual de biología de suelos tropicales . utilizando todas las secciones de transectos disponibles para el muestreo.. GF2. GF 2. Desde el transecto o los transectos Abundancia relativa de termitas. Datos de abundancia para hormigas y escarabajos (número de individuos m²). La abundancia relativa para cada GF está dada por el número de encuentros de divididos entre el número total de encuentros de todos los GFs. Nótese que un encuentro es un evento en una sección de 5 m del transecto. etc. varía de 0 a 4 para transectos de 20 m y de 0 a 20 para transectos de 100 m.Lista de los otros invertebrados en la resolución taxonómica la más alta posible. De las trampas Winkler Frecuencia de especies por muestra. Abundancia total en número m2 de forma separada para: Todas las hormigas (y por grupo funcional GF1. Todas las termitas (y por GF 1. por lo tanto. Para cada taxón se indica el método de muestreo empleado: C = casual T = transecto W = Winkler P = pitfalls M= monolito (Para el monolito no observar estratificaciones de 3 x 10 cm. etc. Se pueden juntar los datos obtenidos de diferentes transectos en puntos de muestreo separados. con la excepción de lombrices de tierra). En el caso de las hormigas.) también pueden estimarse. GF2. el número de encuentros. números totales por cada grupo funcional (GF1. Todos los escarabajos Otros invertebrados Todos los invertebrados.). etc.

De todo el muestreo Listas de especies/morfoespecies para hormigas. utilizando las mismas claves que las especificadas anteriormente: C= Casual. o en su defecto las que se alimentan de madera o de suelo). todas las lombrices de tierra (y por grupos GF 1. GF 2.). GF 2. etc. donde n = número de puntos por uso de suelo. etc. GF 2. M acrofauna 131 .De las trampas pitfall Se desglosa los taxa no muestreados por otros medios (únicamente).). todas las termitas (y para los grupos GF 1. lombrices de tierra y escarabajos capturados con cebos. GF 2. como % ± SD. Lista de familias para los demás escarabajos Lista de invertebrados en la resolución taxonómica la más alta posible Para cada taxón se indica el método de muestreo empleado. T = Transecto. otros invertebrados y todos los invertebrados (igual a lo indicado para datos mínimos por punto de muestreo). De los transectos Abundancia relativa media de termitas GF 1. todos los escarabajos. etc. P= Pitfalls y M= Monolito De los monolitos Es necesario proveer la abundancia media como: a) Número de individuos m² ±SD b) Media geométrica ± 95% de intervalo de confianza c) Media aritmética ± 95% de intervalo de confianza donde n = número de puntos por uso de suelo.. etc. separado para hormigas (y para grupos funcionales GF1. Conjunto mínimo de datos por uso de suelo Las categorías de uso de suelo son anotadas y cuando esto no es posible se clasifican de acuerdo con la intensidad de uso de suelo. W= Winkler. termitas.

GF 2. 132 Manual de biología de suelos tropicales .. la escala del esfuerzo requerida para poder evaluar la biomasa es enorme (véase Eggleton y Bignell.De las trampas Winkler Abundancia media de hormigas (y como GF 1. muestreo anidado y estratificado ejemplo Eggleton et al.) como individuos m² ± SD.. será sobreestimada (Colwell y Coddington. 1996) y que la biomasa es tan importante para la determinación del impacto ecológico que no se puede prescindir de ella o sustituirla. si el muestreo se hace en una colonia. De manera similar. incluyendo los resultados de intensificación de uso de suelo. se argumenta que los organismos se deben asignar únicamente como ingenieros del ecosistema. La frecuencia de especies por muestreo presenta un parámetro alternativo. el cálculo retrospectivo hasta llegar a la densidad numérica. 1995. si el régimen de muestreo es suficientemente robusto (incluyendo réplicas adecuadas. existen contra argumentos de que los insectos sociales pueden evaluarse correctamente en cuanto a su abundancia y biomasa. no obstante. Por ejemplo. Lawton et al. etc. Abundancia media de escarabajos como individuos m² ± SD. El uso de datos crudos de abundancia y de biomasa en la interpretación de la función del ecosistema resulta controversial. se dice que la abundancia de individuos no se debe usar en el caso de hormigas porque son insectos sociales que se organizan en colonias formadas por miles de individuos que se alimentan en grupos. donde n = número de puntos por uso de suelo. Desafortunadamente. Para todas las abundancias medias totales y las abundancias medias relativas de los GF Correlación con parámetros individuales del gradiente. ejemplo Diversidad β. 1994). Conjunto mínimo de datos por ventana de muestreo De todos los métodos de muestreo Recambio de especies a lo largo del gradiente como la β de Whittaker. cuando su abundancia o biomasa lo justifique. en base de lugar a lugar.

I. S. Smithsonian Institution.338–347. e Ingram. Alonso. E. in N. (1997) ‘Regulation of soil structure by geophagous earthworm activities in humid savanna of Côte d’Ivoire’. W. y Srivastava. Persson (eds) Soil Organisms as Components of Ecosystems. (2000) ‘Diversity and distribution of endemic and exotic earthworms in natural and regenerating ecosystems in the central Himalayas. Standard Methods for Ground-living Ants. N. Lavelle. 433–460. vol. J. 35. Lohm and T. D. J. E. Washington. K. 24. Brandão. B.. pp. Constantino. Soil Biology and Biochemistry. D. Soil Biology and Biochemistry. R. Bouché. y Saha. Ecological Bulletins. Barrios. Andersen. M. J. 29. Ito (eds) A Series of Searchable Texts on Earthworm Biodiversity. T..T.. T. Agosti. H. vol. VermEcology. L. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. N. Majer. E. 1st edition. Journal of Biogeography. 143–147. vol.ynu. (eds) (1989) Tropical Soil Biology and Fertility: A Handbook of Methods. Pashanasi. e Ingram. Halder. DC. Blakemore. F. Kaneko and M. T. Bhattacharya. y Valentin. Alonso L. pp. Yokohama National University.. 2nd edition. (eds) (2000) Measuring and Monitoring Biological Diversity. 431–439. (2002) Cosmopolitan Earthworms – An Eco-Taxonomic Guide to the Peregrine Species of the World. P. lo que compromete la caracterización de la heterogeneidad del paisaje porque restringe el número de puntos de muestreo que pueden ser utilizados.. C. C. Japan. Wallingford.ac. y Lavelle. 3. (2005) ‘Introductory key to revised earthworm families of the world’. pp. (2002) ‘Effects of land-use system on the soil macrofauna in western Brazilian Amazonia’. www. Lebissonnais. Y. J. 32... 122–132. K. C. M. E. CAB International. I.1998).. (2000) ‘Soil microarthropods of a rubber plantation and a natural forest’. Biology and Fertility of Soils.htm. (1997) ‘Functional groups and patterns of organization in North American ant communities: A comparison with Australia’. vol. in U. 25.. vol. Bhadauria T. Ecology and Systematics from Various Regions of the World. M.jp/eng/index.. D.. P. Delabie. Kippax. Wallingford.eis. R. pp. 2045–2054. Environmental & Ecology. REFERENCIAS Agosti. R. pp. Australia. A. J.bio-eco.. Ramakrishnan. Braudeau.. J. (1977) ‘Stratégies lombriciennes’.. CAB International. pp. Leeanne. T. B. S. vol. J. Anderson. Brown. R. J. Blanchart. S. COE Soil Ecology Research Group.. M. Anderson. y Schultz T. R. Blakemore. G.. India’. Bestelmeyer. M acrofauna 133 . P.

y Nascimento. Revista Brasileira De Entomologia. J. Csuzdi. Alonso and T. Colwell. pp. vol. F. C. E.. (1996) ‘Revision der Unterfamilie Benhamiinae MICHAELSEN. Mitteilungen aus dem Zoologischen Museum in Berlin. S.eeb.. T. J. uconn. J. Delabie. Escobar. y Coddington.. Petit. P.edu/estimates. J. vol. 240.. Software and User’s Guide’. Dubs. Resumos Feira De Santana. A. Ponerinae) em cupinzeiros de Syntermes sp. D. J. Ecosystems and Environment. Jiménez. pp. R. P. (2005) ‘EstimateS.. vol. Blanchart. G.. Version 7. A. J. (2002) ‘Earthworm communities under an agricultural intensification gradient in Colombia’. vol. São Paulo. http://viceroy. (2000) ‘Statistical Estimate of Species Richness and Shared Species from Samples. Decaëns. 101–118. T. C. 12. Amsterdam. y Jiménez. D. E. Werger (eds) Tropical Rain Forest Ecosystems. Collins. Delettre...5: Statistical Estimation of Species Richness and Shared Species from Samples. Y. Philosophical Transactions of the Royal Society (Series B). 47–60. Chauvel.. J. vol. Delabie. C. Encontro De Zoologia Do Nordeste. Thenail. (1999) ‘Comunidades de formigas (Hymenoptera: Formicidae): Métodos de estudo e estudos de casos na Mata Atlântica’. Plant and Soil. A. and Rippstein. C. 301–312 Decaëns. N. Feira De Santana. Barros. J. Le Coeur. J. Schultz 134 Manual de biología de suelos tropicales . A. P.. Elsevier Science Publishers. vol. Lavelle. (2004)‚‘Soil macrofauna communities in permanent pastures derived from tropical forest or savannas’. R. Kenya.ucon. H. 58–68. Agriculture.. pp. Paillat. CSM-BGBD (2005) Global workshop on ant and termite sampling and identification. Brunel. Delabie.0b1’.eeb. http://viceroy. (Isoptera. 1897 (Oligochaeta: Acanthodrilidae)’. (1995) ‘Inquilismo simultâneo de duas eespécies de Centromyrmex (Hymenoptera.-C. R. C.. C. Morvan. pp. Clergeau. J. (1994) ‘Impact of land management on soil macrofauna in the Oriental Llanos of Colombia’. L. in H.. Nasutermitinae)’. G. J. Colwell. Sociedade Nordestina De Zoologia. Decaëns. 605–609. N. (1994) ‘Estimating terrestrial biodiversity through extrapolation’. Acta Oecologia. Version 6. Formicidae. vol. D. Jiménez. (2000) ‘Litter ant communities of the Brazilian Atlantic rain forest region’. Fragoso. Agosti. pp133-143.. K. Baudry. G. E. Nairobi. J. 103. 39.. 30. C. H. 72. (1998) ‘Comparative biodiversity along a gradient of agricultural landscapes’. Majer. T. Agosti. K.. H.Burel.. J.. 157–168.. pp. 345. in D. J. Tropical Soil Biology and Fertility Institute of CIAT. (1989) ‘Termites’. Leith and M. K. S. F. M. 347–367. y Lavelle. 19. y Lefeuvre. European Journal of Soil Biology. Termitidae. pp.. Colwell. pp. Butet. I. vol.edu/EstimateS. T.

. Academic Press. (1997) ‘The incidence of secondary occupation of epigeal termite (Isoptera) mounds by other termites in the Mbalmayo Forest Reserve. East Malaysia’. E. D. Bulletin of the British Museum (Natural History) Zoology. vol. Southern Cameroon. Ecotropica. Jones. pp. K. y Brown. Smithsonian Institution. y Rojas-Fernandez. Jeeva. Proceedings of the Californian Academy of Sciences. J.. MacDonald. J. Homathevi. Planapheretima. C. Davies. New Acanthodriline genera and species (Megascolecidae. P. Jeeva. Metapheretima. pp. M. pp. Megadrilogica. (2004) ‘Influence of agricultural land use on the size and composition of earthworm communities in northern KwaZulu-Natal. D. 51–68. R. Philosophical Transactions of the Royal Society of London. 6. in R. E. Haynes. Eggleton. DeSouza. Journal of Tropical Ecology. Eggleton. 111. D. (1996) ‘The diversity. V. pp.. 351. 1–128. 87–276. London. vol. A.. (1900) ‘Researches in American Oligochaeta with especial reference to those of the Pacific Coast and adjacent islands’. 3. vol. (1999) ‘Termite assemblages. G. (1979) ‘A revision of the ‘acaecate’ earthworms of the Pheretima group (Megascolecidae: Oligochaeta): Archipheretima. O. 119–128. E. Philosophical Transactions of the Royal Society of London. Eggleton. 354. Jones. vol.. D. y Bignell. y Maryati. R... Washington. H. W. P. G. D. G. pp. A. (1994) ‘Earthworms from Southeastern Mexico. vol. Journal of African Zoology.. pp. Series B. y Bignell. pp. D. M acrofauna 135 . and its biological significance’. Wood. forest disturbance and greenhouse gas fluxes in Sabah. Series B. T.. Pleinogaster and Polypheretima’. P. Oligochaeta)’. M. Bignell... 27. vol. Harrington and N.(eds) Measuring and Monitoring Biological Diversity: Standard Methods For Groundliving Ants. vol. Eisen. Eggleton. Sands. Homathevi. (1995) ‘Monitoring the response of tropical insects to changes in the environment: troubles with termites’. E.. G. R. Davies.. E. T. E. T. abundance and biomass of termites under differing levels of disturbance in the Mbalmayo Forest Reserve. N. P. R. DC. y Maryati. 77–88.. vol. Easton. R. Stork (eds) Insects in a Changing Environment. South Africa’. D. C. y Bignell. Mawdsley. N. 10. 1791–1802. C. Southern Cameroon’. G. 489–498. Eggleton. Bignell. East Malaysia’. (1994) ‘Effects of habitat fragmentation on Amazonian termite communities’.. pp. P. 1–12.. D. 197–206. A. F. Fragoso. Applied Soil Ecology. Lawton. Dlamini. P. 35. (1997) ‘The species richness and composition of termites (Isoptera) in primary and regenerating lowland dipterocarp forest in Sabah. J. 2. vol. F. pp.

pp.. 136 Manual de biología de suelos tropicales . J. E.. D.. pp. A. Indonesia’.Fragoso. 4th edition. Decaëns. M. D.. E. J. J.-X. M. J. Blanchart. J. Lavelle. M. y Eggleton. Brussard and P. H. in S. 453–464 International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature. Bignell. D. Senapati.. Suryo. W. D. (1999) ‘Earthworm communities of tropical agroecosystems: Origin.. J. Gillison. Applied Soil Ecology. Acta Zoologica Fenica. T. 40. South Africa’. P. E. Konigstein. J. Oxford. R. pp. 17–35. V. Ecosystems and Environment. Lavelle. 191–203.. E. P. Journal of Applied Ecology. J.. Gates. 37. soil biodiversity and agroecosystem function in the tropics: The role of earthworms’. P. 186–189. Blackwell.. vol.. C. (2000) ‘Sampling termite assemblages in tropical forests: Testing a rapid biodiversity assessment protocol’. vol... E. Martinez. Hendrix (eds) Earthworm Management in Tropical Agroecosystems.. Journal of Applied Ecology. (2003) ‘Effect of agricultural land use on soil organic matter status and the composition of earthworm communities in KwaZuluNatal. Senapati. C.. 62.. D. F. F. Susilo.. New York.. F. J. Jones. S. J. 6. y Calaby. vol. y Hawksworth. (1972) ‘Burmese earthworms. Academic Press. (1997) ‘Agricultural intensification.. T. Kouassi. y Guillaume. Jones.. W. B. A. pp. McNeill. in K. y Kumar. L. Krishna and F. Keli. Leather (ed) Insect Sampling in Forest Ecosystems. Megadrile Oligochaeta (Earthworms) Family Octochaetidae. Weesner (eds) Biology of Termites. K. F. Greuter. P. vol.. Trehane.. Blanchart. M. an introduction to the systematics and biology of Megadrile oligochaetes with special reference to South-East Asia’. P. 380–391. Fragoso. H.. Calcutta. C. (2005) ‘Methods for sampling termites’. Lavelle. G. Koeltz Scientific Books. Nicolson. Zoological Survey of India. (1995) ‘Biological activity of soil under rubber plantation in Côte d’Ivoire’. D. pp. R.. S. Brown. R. P. E.. P. y Graham. L. E.. International Trust for Zoological Nomenclature. 196. Julka. H. y Eggleton. C.. CAB International. P. 95.. T. C.. T. Haynes. Transactions of the American Philosophical Society. structure and influence of management pratices’. G. J. in P. Gay. Lavelle. Jiménez. Blanchart. Filgueiras. Gilot. Verkerk.. pp.. Wallingford. Burdet. vol.. T. B. T. (1970) ‘Termites of the Australian region’.. Jones. B. Patron. G. (2003) ‘Termite assemblage collapses along a land-use intensification gradient in lowland central Sumatra.-M. Skog. vol. 1–326. Agriculture.. J. H. P. London. Silva. Dominy. y Eggleton. y Tondoh. G. Barrie. H. Turland N. (2000) International Code of Botanical Nomenclature (St Louis Code). Demoulin. C. J. (1988) The Fauna of India and the Adjacent Countries. Pashanasi.

pp. 391. (1998) ‘Biodiversity inventories. (2001) ‘Spatial and temporal analysis of. 159–193. Stork. (1971) ‘Sobre a familia Glossoscolecidae (Oligochaeta) no Brasil’. E. 300–305. y Watt.. Heal. and diversities of bats in a fragmented landscape’. V.. 438–445. Srivastava. C. A. Grimaldi. Larsen. (1981) ‘Strategies de reproduction chez les vers de terre’. S. C. 213–226. G. France. J. E. C. Modena. (1998) Ecological Methodology. (1987) ‘Peregrine species of earthworms’. y Rouland-Lefèvre. G. Biodiversity and Conservation. Righi. Biology and Fertility of Soils. Eggleton. Lavelle. M acrofauna 137 . P. P.. vol. pp. Pielou. European Journal of Soil Biology. Elsevier Publishing Company. (1983) ‘The soil fauna of tropical savannas.. Bonvicini and P. Bourlière (ed) Tropical Savannas. and Fragoso. C. pp. F. D. Lepage. A.. E. pp.. y Dhillion. 1–95.. P. B. y Halffter. vol. Boulton. Laboratoire de Zoologie. Bloemers. pp. M. Bignell. E. 4. 10. Mucchi. I. Oxford. vol. vol. vol. J. P. vol. M. Biology and Fertility of Soils.-P. P. Blackwell Science. vol. M. Lavelle. Moreno. populations et fonction dans l’écosystème’. vol.. Mathieu. Roger. C. S. Lavelle. (2004) Measuring Biological Diversity. 149–158. Moreno. Pearson Education... (1995) ‘Colombian earthworms’. (1978) ‘Les vers de terres de la savane de Lamto (Côte d’Ivoire): Peuplements. Lawton. H. Magurran. Lee. D. 485–607. Studies on Tropical Andean Ecosystems. G. pp367–382 Ortiz-Ceballos. Righi. P. M. 2. Mawdsley. Omodeo (eds) On Earthworms: Selected Symposia and Monographs. K.. (2000) ‘Assessing the completeness of bat biodiversity inventories using species accumulation curves’. D. Rossi.Krebs.. N. pp. Hodda. A. 20. (1996) ‘The measurement of diversity in different types of biological collections’. indicator taxa and effects of habitat modification in tropical forest’. E. D. J. 37. 117–133. E. in A.. Lavelle. Mora. N.. O. 40. Arquivos de Zoologia. E. T. in F. Université Paris VI. Unione Zoologica Italiana 2. Bignell.. P. 13. P. M. Nature (Lond). B. Wolters.. Hammond. 39. J. II The earthworms’. vol. pp. pp. Journal of Theoretical Biology. Thèse de Doctorat. 72–76. London. Lavelle.. Journal of Applied Ecology. Acta Oecologia – Oecologia Generalis.. 2nd edition. R.. Holt. P. A. 33.. (1997) ‘Soil function in a changing world: The role of the invertebrate ecosystem engineers’. pp. C. G. (2004) ‘Earthworm populations under tropical maize cultivation: The effect of mulching with velvet bean’. vol. D. Ecole Normale Supérieure 12. y Halffter. G. (2004) ‘A multi-scale study of soil macrofauna biodiversity in Amazonia pastures’. Amsterdam.

T. Pattern and Process. Blackwell. y Easton. Bulletin of the British Museum (Natural History) Zoology. pp. Regenwürmer aus Südamerika’. 103–124. selected symposia and monographs’. Chapman and Hall. (1997) ‘ADE: A multivariate analysis and graphical display software’. G. Herndon. V. E. pp. A. 75–83. 169–268. Statistics and Computing. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition’. Terborgh. 138 Manual de biología de suelos tropicales . 4. 33.. Eudrilidae) in Ivory Coast’. (1972) ‘A numerical revision of the earthworm genus Pheretima auct. Ecological Entomology. South East Asian Regional Research Programme. E. D. 493–500. y Eggleton. J. (1992) International Code of Nomenclature of Bacteria: Bacteriological Code. Modena. H. in J. pp.fao. in M. Cambridge. Thèse de 3e cycle. Southwood. vol. R. y Olivier. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. 2nd edition. Zicsi. www. (2005) ‘Pitfall sampling in ecological studies’.. Tondoh. T. G.Sims. Anderson (eds) Community Ecology. R. Brian (ed) Production Ecology of Ants and Termites. vol. VA. Journal of Tropical Ecology. E. 1995) (Oligochaeta: Glossoscolecidae). R. Chessel. B. W. Wood. vol. Oxford. (1978) Ecological Methods with Particular Reference to the Study of Insect Populations. M. (1978) ‘Food and feeding habits of termites’. A.pdf. y Bignell.. vol. (1996) ‘A pilot analysis of gut contents in termites from the Mbalmayo Forest Reserve. 7. International Centre for Research in Agroforestry. in A. Leather (ed) Insect Sampling in Forest Ecosystems. suborder Lumbricina (Haplotaxida: Oligochaeta)’. 1990 Revision. Woodcock. vol. ASB Lecture Note 6B. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. J. M. Sleaford. ASM Press. Dolédec. J. R. 21. 279–288. Sims. Cambridge University Press. D. Bignell. 21. P. pp. P. M. E. E. Cameroon’. in S. Oxford. (2001) ‘Revision der Untergattung Martiodrilus (Maipure Righi. Omodeo (eds) ‘On earthworms. (1969) ‘Recherche sur le peuplement en Oligochète de la savane de Lamto (Côte d’Ivoire)’. Vincent. F. 39. P. y Robinson. France. Indonesia. Swift. J. London. Sneath. D. (1986) ‘Guilds and their utility in ecology’. Mucchi. Pagliani and P. W. R. A. vol. Thioulouse. S.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. Opuscula Zoologica Budapest. Unione Zoologica Italiana 2. Kikkawa and D. Sims.. y Lavelle. (1987) ‘A review of the Central African earthworm family Eudrilidae (Oligochaeta)’. Université Paris VI. Biological Journal of the Linnean Society. W. Blackwell Science. P. pp. S. 113–131. pp. (1980) ‘A classification and the distribution of earthworms. Bogor.

Regenwürmer aus Südamerika 39. 95–130. 92. Berichte des Naturwissenschaftlicher-Medizinischer Vereins in Innsbruck. A. M acrofauna 139 . (2005) ‘Über den heutigen Stand der Regenwurmfauna (Oligochaeta) Ekuadors mit einem Bestimmungsschlüssel der Glossoscoleciden-Arten’. vol.Zicsi. pp.

Clave moderna y de fácil interpretación. S. Forest Research Institute of Malaysia. 2003. Región y autor Hormigas del S. vol. Kepong. Título y referencias ‘Manual for Bornean Ant (Formicidae) Identification’. y Homathevi. (2 003). de fácil manejo. dentro del clado Termes. Sarawak Museum Journal. ‘Introducción a las hormigas de la región Neotropical’ Instituto de Investigaciones de Recursos Biológicos. útil para Sumatra. (1992) ‘Termites of peninsular Malaysia’ en L. Y. Disponible y económica. pp. (1984). 12-26 octubre. pp.Apéndice 1. Bien ilustrada clave de fácil identificación para los soldados. with descriptions of one new genus and new species and including a key to genera’ Journal of Natural History. 1-398. ‘Termites of Sabah’ Forest Record 12.E. pp 95162. 140 Manual de biología de suelos tropicales . 36. taxonomía y la importancia económica de las hormigas. Hormigas Neotropicales Fernández. F. Universidad Malasis Sabah. 1485-1506. Gathorne-Hardy. Bogota. (1984) Collins. ‘A review of the South-east Asian Nasutitermitinae (Isoptera Temitidae). P. 65-87. vol. de Asia Thapa. pp1-244. R. 30. pero no cubre toda la diversidad de animales que se alimentan del suelo. (2001). Y. Trabajo estándar. protocolos de muestreo por región. Kirton (ed) Malaysian Forest Records.G.R. Colombia. Preparado por “Tools for Monitoring Soil Biodiversity in the ASEAN Region”. Claves de identificación de termitas. ‘The termites (Isoptera) of Gunung Mulu National Park with a key to the genera know from Sarawak’. N. M. 35 pp. (2003) Termitas del S. Notas Clave de géneros de hormigas de Borneo (útil en el S. de Asia Hashimoto. vol. Alexander von Humboldt. F. escarabajos y hormigas. Borneo Java y Sulawesi. E. Clave un poco obsoleta de géneros de termitas del Norte de Borneo. Bien ilustrada con sinopsis genérica. Tho. pp. Incluye una revisión de la biología ecología. XXVI. Fácil de usar. 1-374. Publicación clave para géneros de la región Neotropical. de Asia. incluyendo Indonesia).E.

‘A review of the termites of the genus' Antitermes the Ethiopian region. S. 129-156 Keys to the Genera of the African Termites. (1961). 12–26. Escarabajos en general.Cox. Termitidae) from the Ethiopian region’. International Institute of Entomology (and Institute of escarabajos. Termitas africanas Sands. Continúa. Webb. 2003. G. W. 2–38. (2003). 1-374. CAB International). Sabah Forest Record 12 pp. Supplement 4. 3. Clave de géneros de imagos y soldados. (2006). Clave bien ilustrada a nivel género de soldados. 1–384. Clave moderna. Hormathevi. fácil de usar. Nigeria. La autoridad estándar del momento para este genero. 18-22 Septiembre. ‘A revision of the termite subfamily Nasutitermitinae (Isoptera. The Natural History Museum. A. Ibadan University Press. Claves hasta especies. Bulletin of the British Museum (Natural History). (2003) Título y referencias ‘Manual for Bornean Termites (Isoptera)’ preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Bien ilustrada. Thapa. 1-28. Universiti Malaysia Sabah.E. Y. corta y bien ilustrada de familias con una sinopsis diagnóstica de más de 100 familias y casi 50 subfamilias. 12–26 Octubre 2003. R. “Termites of Sabah”. Notas Clave inédita de géneros de termitas en el S. B. M acrofauna 141 . curation and data management. Booth.. pp. R. vol 8. Un poco anticuado. Trabajo estándar. preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. de Asia. (1981). con muchas referencias que incorporan descripciones taxonómicas recientes. de fácil manejo. A. Coleoptera. R. G. pp. pp. C. Explicación detallada de la IIE Guides to insects of importance morfología y agrupaciones de to Man. Sands W. (1990). 2006. Lo que opera actualmente sobre esta subfamilia en África. Octubre 2003. Bulletin of the British Museum (Natural History). R. tanto para imagos como soldados. Región y autor Homathevi. L. (1959).Apéndice 1. pp. incluyendo Indonesia. Universiti Malaysia Sabah. London pp. Adaptación de Chung. y Madge R. Escarabajos de Asia Chung. (1965). A. 1–172. Coleoptera. ‘Manual for Bornean beetle (Coleoptera) family identification’. Training course on Arthropod preservation. M. Universiti Malasia Sabah. 36 p. C.

Lo que opera actualmente este género. E. 365–444. Región y autor Bouillon. 24. incluye detalles del enrollamiento del intestino y de cómo está conformada la válvula entérica para identificar algunas Apicotermitinae. V. W.Apéndice 1. Natural Science 6. Abe. vol 67. (1980). Higashi (eds) Termites: Evolution. 187–323. de difícil manejo. Incluye una sinopsis de familias y subfamilias en forma de clave con notas e identifica caracteres diagnósticos. muy útil para termitas subterráneas crípticas. pero recomendada para formarse. Symbioses Ecology. pp. L. (2000). pp. vol. utilizando imagos. 1. Clave completa muy ilustrada y detallada. (1966). London. y Mathot. Título y referencias Quel est ce termite Africain? Zooleo. Termitas neotropicales Constantino. (1971). Longman. Continúa. especialmente Apicotermitinae y todas las que se alimentan del suelo. Termites. no muy útil como clave. 500 pp. obreros y soldados. más 32 referencias. Estudio prestigiado. Notas Clave a nivel familia de imagos y soldados. anticuada. Clave corta. E. (1998). A.. Clave hasta género para soldados y muchos géneros ilustrados de manera detallada a nivel de especies (en francés). A. R. pero útil para confirmaciones. G. ‘Taxonomy and phylogeny of termites’. ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. Series B. 142 Manual de biología de suelos tropicales . Clave de especies para imagos. pp. J. Mitchell B. (2002). Harris W. y Eggleton P. Kambhampati. D. ‘Report on a survey of the termites of Zimbabwe’. pp 1–23. únicamente para géneros principalmente en el contexto africano. Zootaxa. Sands. Their Recognition and Control. CAB International. Ruelle. (1970) A revision of the termites of the genus Macrotermes from the Ethiopean (Isoptera: Termitidae) Bulletin of the British Museum (Natural History) Entomology vol. en: T. Wallingford. 1–40. Sociality. Estudio comprensivo que incluye claves hasta géneros de soldados. S. pp. Bignell and M. Occasional Papers of the National Museums of Rhodesia. Kluwer Academic Publishers. 1–115. “The Identification of Worker Castes of Termite Genera from Soils of Africa and the Middle East”. soldados mayores y soldados menores.

utilizadas en taxonomía. ‘Taxonomy of Termites’. vol. (1997). Harvard University.Uganda. ed) International Centre of Insect Physiology and Ecology. Documento de base. subfamilias. Continúa. No publicado. Ward. eje de muchas claves privadas de museos nacionales. Calcutta. R. Los volúmenes I y II cubren todo el The Fauna of India and Adjacent subcontinente de la India. II. Centre for Overseas para géneros de África del Oeste y Central. UC Davis. Zoological Survey of India. Listas de material requerido para un muestreo de hormigas con precios en $US del 2001. O. 672 pp. O. Sinopsis ilustrada de subfamilias y su distribución. 'Ant subfamilies’. No publicado. Tanzania y Zanzibar. y Chhotani. (2001). C.Apéndice 1. L. ‘Equipment specifications’ Department of Entomology. Título y referencias Notas No es una clave. I. 801 pp. Chhotani. E. incluyenCountries: Isoptera (Termites). imagos y soldados. (Family Termitidae) Zoological survey of do Sri Lanka. pero sí un listado Checklist of the Species of Termites que identifica la distribución entre (Isoptera) Recorded from East Africa. K. (2001). Excelente para entrenaPest Research. The Fauna of India and Adjacent Countries: Isoptera (Termites). (sin fecha). (1989). P. reporte detallado con definiciones de características morfológicas. M. M acrofauna 143 . con una amplia bibliografía. Fisher. (2003). P. incluye claves hasta familias y subfamilias. (J. vol. Guías para caracterización del sitio y anotaciones relacionadas con el muestreo de hormigas. (1983). 'Guidelines for data collection for ants’. Entomology department. miento avanzado. Bibliografía completa. Harvard University. M. B. B. Clave detallada y de fácil manejo A Key to the Genera of the Termitinae by the Soldier Caste. Darlington. Documentos variados Roowal. Williams R. y Williams. B. Región y autor Claves inéditas de termitas y listas de comprobación Wanyoni. S. India. C. Kenia. A. Los volúmenes I y II contienen claves hasta familias. C. Department of Entomology. géneros y especies para imagos y soldados. Centre for Overseas Pest Research. Calcutta. Sands W. M. Fisher. B. (sin fecha).

Bibliografía amplia y actual. pero sin ilustraciones. escarabajos del suelo. pp. 2003.Apéndice 1. Harvard University Entomology. lectura obligatoria. Department of Entomology. 1–39. (ed) 2003. Universiti Malaysia Sabah. prepared for ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. D. Notas Revisión moderna y completa de la naturaleza de la biodiversidad del suelo y métodos de evaluación rápidos para hormigas. Título y referencias ‘Tools for the Rapid Assessment of Soil Invertebrate Biodiversity in the ASEAN Region’. Harvard University 144 Manual de biología de suelos tropicales . termitas. Región y autor Jones. 12–26 October. T. (Anónimos. Continúa. sin fecha). lombrices de tierra diplópodos. No publicado. Isópteros y arañas (Araneae). “Glossary of morphological characters used in ant taxonomy”. Completo.

Constantino (1990). Clave de soldados de América del Sur. Claves de soldados de especies de Las Antillas (anticuado).Apéndice 2. Constantino y DeSouza (1997). Constantino (1997). Género KALOTERMITIDAE Cryptotermes Eucryptotermes Procryptotermes Bacchus (1987) Scheffrahn y Krecek (1999). Scheffrahn y Krecek (2001). Neocapritermes Parvitermes Krishna y Araujo (1968). Mill (1983) y Constantino (1999. Araujo (1954). Emerson (1952). Clave de soldados de Paracomitermes (anticuado). Revisión y claves. Clave de soldados. Revisión y claves de soldados (en portugués). Referencia Contenido RHINOTERMITIDAE Heterotermes TERMITIDAE Amitermes Anoplotermes Atlantitermes Cornitermes Cyranotermes Cyrilliotermes Labiotermes Light (1932). Clave de soldados. 2002). Revisión de Labiotermes sensu stricto. Revisión y claves (anticuado y en alemán). únicamente Kalotermitidae). Claves de soldados de especies de Las Antillas (anticuado). Fontes (1985). Constantino (2001). Scheffrahn and Krecek (1993). M acrofauna 145 . con claves. Revisión y claves. Revisión y claves. Las claves hasta género son dadas en Krishna (1961. Revisión y claves (anticuado). Scheffrahn y Krecek. Constantino et al. Revisión de mapas de distribución de especies del Nuevo Mundo con clave de soldados y alados. Clave de soldados. Emerson (1952). Clave de alados (anticuado). Nasutitermes Parvitermes Procornitermes Holmgren (1910). Emerson y Banks (1965). Trabajos taxonómicos con claves de especies de algunos géneros neotropicales. Cancello (1986). (2006). Revisión y claves. Revisión mundial con revisión de claves de las especies antillanas con claves hasta la diagnosis de los soldados. Snyder (1926).

Cancello (1986). Constantino (1995). Revisión y claves de soldados (en portugués). Rhynchotermes Rotunditermes Syntermes Fontes (1985). Fontes y Bandeira (1979). 146 Manual de biología de suelos tropicales . Continúa. Claves de soldados (anticuado). Emerson (1945) . Género Procornitermes Referencia Emerson (1952).Apéndice 2. Claves de soldados. Revisión y claves. Contenido Revisión y claves. Revisión y claves (anticuado).

31. pp. A. Constantino. Zootaxa. (1990) ‘Notes on Cyranotermes Araujo with description of a new species (Isoptera. 475– 540. 36. Tropical Zoology. Tropical Pest Bulletin. R. pp. pp. 181–189. (1952) ‘The Neotropical genera Procornitermes and Cornitermes (Isoptera. R. (1997) ‘Key to the soldiers of Atlantitermes Fontes 1979. Cuezzo. vol. S. vol.. Termitidae. (1945) ‘The Neotropical genus Syntermes (Isoptera: Termitidae)’. F. A. Zootaxa. Sociobiology. y Vasconcellos. 205–213. pp. R. pp. Carvalho. 30. L. 2. 7. vol. 1–91. (2001) ‘Key to the soldiers of South American Heterotermes with a new species from Brazil (Isoptera: Rhinotermitidae)’. vol. Termitidae. pp. 55. 1–44. 99. A. R. Termitidae. Bulletin of the American Museum of Natural History. paper 67.Apéndice 3. E. A. 83. R. E. F. (2006) ‘A taxonomic revision of the Neotropical termite genera Labiotermes Holmgren and Paracornitermes Emerson (Isoptera: Termitidae: Nasutitermitinae)’. Emerson. Papéis Avulsos de Zoologia (São Paulo). vol. University of Kansas Science Bulletin. K. Termitidae)’. E.. R. Goeldiana Zoologi. H. 427–472. Constantino. paper 1340. distribution and ecology (Isoptera. Constantino. Emerson. pp. Termitidae. (2002) ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. Nasutitermitinae)’. Revista Brasileira de Entomologi. y DeSouza. Bulletin of the American Museum of Natural History. pp. pp. R. A. Constantino. F. no 2208. (1987) ‘A taxonomic and biometric study of the genus Cryptotermes (Isoptera: Kalotermitidae)’... R. Constantino. N. Insect Systematics and Evolution. pp. Nasutitermitinae)’. C. Cancello. (1954) ‘Notes on the genus Paracornitermes Emerson 1949 with description of two new species (Isoptera. S. (1997) ‘Notes on Eucryptotermes with a new species from central Amazonia (Isoptera: Kalotermitidae)’. 455–518. y Banks. 1. Constantino. M. Nasutitermitinae)’. with a new species from Brazil (Isoptera: Termitidae: Nasutitermitinae)’. 10. pp. A. Literatura especializada en termitas neotropicales Araujo. Bacchus. American Museum Novitates. vol. M acrofauna 147 . Acioli. 125–131. 1–33. pp. pp. vol. (1995) ‘Revision of the Neotropical termite genus Syntermes Holmgren (Isoptera: Termitidae)’. Constantino. 189–236. E. vol. Nasutitermitinae)’. 1–11. vol. O. vol. 463–472. Emerson. Schmidt. A. (1986) ‘Revisão de Procornitermes Emerson (Isoptera. (1965) ‘The Neotropical genus Labiotermes (Holmgren): Its phylogeny. 1–40.

122. 335–414. (1968) ‘A revision of the Neotropical genus Neocapritermes (Isoptera. 3. (1932) ‘Contribution toward a revision of the American species of Amitermes Silvestri’.Fontes. vol. Bulletin of the American Museum of Natural History. Krishna. (2001) ‘New world revision of the termite genus Procryptotermes (Isoptera : Kalotermitidae)’. Bulletin of the American Museum of Natural History. R. 138. G. 94. Nasutitermitinae)’. pp. (1926) ‘Termites collected on the Mulford Biological Exploration to the Amazon Basin 1921–1922’. Krishna. K. vol. Systematic Entomology. y Krecek. Snyder. J. 171–325. a new subterranean termite (Isoptera: Termitidae) from Cuba and the Dominican Republic’. A. (1979) ‘Redescription and comments on the Neotropical genus Rotunditermes (Isoptera. 27. L. Florida Entomologist. Termitidae. vol. pp. E. vol. 1–76. H. pp. Insecta Mundi. Termitidae)’. F. y Krecek. pp. pp. R. vol. S. Light. vol. R. vol. T. University of California Publications in Entomology. pp. (1985) ‘New genera and new species of Nasutitermitinae from the Neotropical region (Isoptera. pp. vol. Annals of the Entomological Society of America. y Araujo. R. (1999) ‘Termites of the genus Cryptotermes Banks (Isoptera: Kalotermitidae) from the West Indies’. Scheffrahn. 179–190. K. Holmgren. Nasutitermitinae)’. Proceedings of the US National Museum. N. R. Scheffrahn. Revista Brasileira de Zoologia. A. (1910) ‘Versuch einer Monographie der amerikanische Eutermes – Arten’. 7–25. L. pp. 9. 23. Scheffrahn. 107–110. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten. L. (1993) ‘Parvitermes subtilis. vol. pp. Termitidae. Mill. y Bandeira. E. Revista Brasileira de Entomologia. H. vol. 84–138. y Krecek. Fontes. 68. 5. 111–171. 76. R. 530–539. 13. pp. J. 603–607. (1983) ‘Generic keys to the soldier caste of New World Termitidae (Isoptera: Insecta)’. 148 Manual de biología de suelos tropicales . 303–408. vol. J. H. (1961) ‘A generic revision and phylogenetic study of the family Kalotermitidae (Isoptera)’. pp.

149 . Cahyo Rahmadi. Protura. Pauropoda y otros Nematodos son típicos representantes de la mesofauna. sin embargo. formas de larvas de especies de macrofauna también caen dentro del rango de tamaño de mesofauna. En cada punto de muestreo. por debajo de la hojarasca de la superficie y en la hojarasca en sí. Susilo y Jose Wellington de Morais INTRODUCCIÓN La mesofauna está conformada por animales cuyo tamaño de cuerpo oscila entre 0. sirven para colectar mesofauna que habita en el suelo mineral. bien por el método Berlese-Tullgren o por el de Berlese modificado. Los núcleos de suelo. La mesofauna se colecta utilizando dos métodos de muestreo: a) una muestra compuesta que contiene varios núcleos de suelo y hojarasca extraída de la superficie.2 y 2.Capítulo 4 Collembola. mientras las trampas pitfall se utilizan para colectar los que habitan en la superficie del suelo. Collembola (colémbolos). los núcleos de suelo se localizan en dos círculos concéntricos. descrito en el Capítulo 2. Acari (ácaros). y se complementan con pitfall. Francis-X. y cuya abundancia no puede ser evaluada con exactitud por medio de la selección manual del suelo. a 3 m y 6 m de radio del monolito. acari y otra mesofauna del suelo: el método Berlese Agus Karyanto. El muestreo de la mesofauna (y otra biota del suelo) se encuentra integrado como parte de la estrategia global del inventario de la biodiversidad bajo del suelo.0 mm. Enchytraeidae. localizadas a por lo menos 14 m del centro del monolito. b) del contenido líquido de las trampas pitfall. Elizabeth Franklin. en principio. respectivamente.

El principio es colectar pequeños núcleos o bloques y combinarlos para hacer una sola muestra compues150 Manual de biología de suelos tropicales . El método pitfall (Capítulo 3. normalmente. por ejemplo. Los ácaros oribátidos (también conocidos como Cryptstigmata a los que se refieren como ácaros escarabajos o ácaros de caja) son artrópodos numéricamente dominantes en los horizontes orgánicos de la mayoría de los suelos. asimismo. no resulta útil para colectar ácaros oribátidos (Acari: Oribatida) porque estos animales. MÉTODOS DE MUESTREO Los protocolos aquí descritos abordan principalmente los de los ácaros y colémbolos presentes en los horizontes minerales y en la hojarasca. Estos ácaros se alimentan de materia de plantas vivas o muertas y de carroña. 1990). fue desarrollado por Antonio Berlese. 1990).El método Berlese es un sistema de extracción por embudo para separar los pequeños artrópodos del suelo. Debido a su papel regulador en la descomposición y el reciclaje de nutrientes. constituyen un componente integral de la estructura del suelo. Se sugiere que para un muestreo normal ambas extracciones de embudo y pitfall deben emplearse de manera conjunta. En este sistema circula agua caliente entre las paredes dobles de latón del embudo (o embudos). Tullgren modificó el método Berlese. a su vez. a finales del siglo XIX. se convierten en un importante desecho nitrogenado. 2004). su densidad puede alcanzar cientos de miles de individuos por m². sin embargo. de manera que la muestra se seca lentamente. son sedentarios (con la excepción de algunas familias como Galumnidae y Scheloribatidae). se pueden encontrar entre 50 y 100 especies (Norton. se alimentan de nematodos vivos (Siepel.) es suficientemente eficaz como para poder capturar colémbolos que viven en la superficie del suelo (edáficos). en contraste con los grupos más oportunistas como los colémbolos. composición de especies y diversidad en un hábitat específico son buenos indicadores de un suelo “sano” (Minor. y algunos son predadores. después de muertos. Lo anterior es aplicable para los grupos mayores de microartrópodos del suelo o a partir de las proporciones de abundancia y diversidad entre los grupos de mesofauna del suelo. En 1918. su abundancia. con una diversidad de especies también muy alta y. en suelos no perturbados. Sus heces fecales proporcionan una amplia superficie para la descomposición primaria por hongos y bacterias y. al igual que en la formación de la estructura de suelo. reemplazando la envoltura de agua por un foco de luz eléctrica. forrajean en hongos y algas.

1a y b). De la misma manera. se etiquetan y se transfieren a un costal de tela de 30 x 35 cm de tamaño. De manera alternativa. utilizando un sacabocados. son dañinos para los animales que se encuentran en la muestra. Se ha observado que los costales de tela son muy eficientes para almacenar temporalmente y transportar las muestras durante largas distancias y tiempos. el suelo deberá someterse de inmediato a su extracción. la cual es entonces sub-muestreada por extracción por el método de BerleseTullgren. donde serán identificadas. No se debe usar un costal de plástico porque la temperatura del suelo puede aumentar sustancialmente. Las muestras de suelo. De manera alternativa. también se deben proteger de la lluvia durante el traslado. de acuerdo con su localidad de muestreo. Enseguida se empacan las muestras en una caja de cartón. Si se transporta la muestra sin aire acondicionado. El siguiente paso es almacenar las muestras en cajas grandes para transportarlas hasta el laboratorio. con una capa de papel para mantener un ambiente de humedad estable dentro de la caja. ésta deberá situarse en el asiento del pasajero. con o sin hojarasca. la fauna también puede morir. C ollembola . Así. acari y otra mesofauna del suelo 151 .ta.5 x 5 cm de profundidad. para ello es recomendable utilizar un vehículo con aire acondicionado. Este aparato mide 3. evitando que la temperatura se eleve. y toma muestras a una profundidad de hasta 5cm que posteriormente se transfieren a un recipiente de plástico de 300 ml de volumen (Figuras 4. Una vez en el laboratorio. el suelo de 12 sub-muestras se coloca entonces en una bolsa de 5 kg como una muestra compuesta.5 cm de ancho y 10 cm de alto. La muestra compuesta de suelo se divide en 10 bolsas de nylon. Dichas muestras deben permanecer alejadas del calor del motor del vehículo y de su sistema de escape. Ahora las muestras estarán listas para su traslado al laboratorio. se colocan todos los costales de tela bajo techo. con un promedio de un kilo por bolsa. lo que provocaría la muerte de la mesofauna antes de su extracción.5 x 3. tanto la luz solar como el calor del motor. se colectan en el campo. se debe evitar que la muestra se exponga a sol directo durante el encostalado en el campo. Al llegar al campo de base o laboratorio. las muestras del suelo pueden ser colectadas en muestras de 3. utilizando una pequeña cuchara que tome un volumen constante de aproximadamente 100 ml. porque la tela permite que circule el aire. para evitar que la mesofauna muera. porque si éstas se mojan o humedecen demasiado. se utilizan tres o cuatro muestras compuestas y no sólo una.5 x 3.

arañas y otros artrópodos. para evitar que otros insectos voladores pasen a formar parte de la muestra. se debe incrementar el calentamiento de manera gradual cada día. utilizando para ello focos eléctricos (los de 25 W son ideales). a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. Se calientan ligeramente los embudos. A B EXTRACCIÓN Método Berlese-Tullgren El aparato Berlese-Tullgren (Figura 4. cada compartimento contará con un marco para sostener los embudos de plástico (Figura 4. cerca del área de referencia.W. éstos se suspenderán a 14 cm por encima del tamiz. se mantiene el aparato en el laboratorio del campo de base. de 1. b) se utilizan guantes como precaución contra enredaderas. La manera ideal es utilizar un contenedor de madera de alrededor de 160 x 50 cm. deberá contener cuatro agujeros de 4 mm de diámetro para permitir que animales mayores escapen hacia abajo.1 Sacabocados de metal para muestrear la mesofauna en la hojarasca y en el suelo mineral.2) es utilizado para extraer la mesofauna activa que habita en las muestras de suelo y en la hojarasca. utilizando una pequeña cuchara o cuchillo de campo.5 mm.2 a) al igual que puertas. dividido en compartimentos superiores e inferiores. hormigas.Figura 4. Cortesía de: J. Franklin. Se coloca un tamiz (de 8 cm de diámetro y 5 cm de altura) con muestras de suelo y hojarascas encima del embudo. dejando los focos encendidos cada vez 152 Manual de biología de suelos tropicales . aunque también se podrían usar los de 40 W. El tamaño de malla del tamiz. Morais y E.

la temperatura de la muestra se aumenta gradualmente de 27°C hasta aproximadamente 40-45°C.W. la cual contiene un conservador. para una mayor efectividad.2 a) contenedor de apoyo para embudos Berlese–Tullgren. es decir. si se dejan durante más tiempo nacen los C ollembola . Nota: nótese que las patas están sumergidas en agua para evitar la invasión de hormigas y de otros insectos. Morais y E. por un periodo de hasta 8 días. Figura 4. en una botella que los recibe hasta la base del embudo. hasta que mantengan un peso seco constante que generalmente tarda unos 8 días. evitando así que las especies que se mueven con mayor lentitud queden atrapadas en las capas secas y duras del suelo. esto inmovilizará a la mesofauna antes de que se escape. para evitar que el material de la muestra se seque demasiado rápido. por lo tanto. Típicamente. b) sistema Berlese–Tullgren en operación. Las muestras se quedan en el aparato hasta que estén completamente secas. el embudo deberá presentar una superficie lisa y una fuerte pendiente. El principio básico del aparato Berlese-Tullgren es que los organismos de suelo responden al incremento de temperatura o sequedad en el suelo migrando hacia abajo hasta que finalmente caen a través de la malla. de modo que los animales que caen por la malla lo hagan de manera rápida hasta llegar a la botella que los recibe.durante mayor tiempo. Cortesía de: J. Se ajusta la posición de la lámpara para asegurar que la temperatura del suelo suba gradualmente. acari y otra mesofauna del suelo 153 . Franklin.

el equipo completo requerido es barato y puede ser fácilmente improvisado (Figura 4. Son baratos y sencillos. al 96%. por lo que las muestras serán menos representativas. es el adecuado para el secado sin electricidad. El aparato Berlese sensu stricto puede transformarse en un modelo Berlese-Tullgren. Una ventaja de dichos sistemas es que se pueden operar a diferentes escalas.3. el agujero de ventilación de la tapa deberá cerrarse durante la noche. 2002). al tiempo que utilizan el mismo principio para extraer un solo núcleo o una muestra conglomerada mayor. Un sistema Berlese que opera sin luz muchas veces permite una mejor extracción. el tiempo de espera será de 7 a 14 días. arriba de las muestras de suelo. En la presencia de luz. aun en regiones remotas (Frankin y Morais. Como líquido conservador. generalmente. 154 Manual de biología de suelos tropicales . Para evitar lo anterior. en cierta manera. lo único que se requiere es un embudo más grande y un tiempo de secado más largo. se utiliza formol al 4% o etanol. Asimismo. el de Berlese. El envase receptor se llena con etanol al 96% para su conservación y durante intervalos de 4 a 5 días se cambia el envase receptor. en este caso. especialmente si el embudo Berlese no está perfectamente cerrado. El método Berlese modificado Cuando no se cuenta con electricidad. aunque tomará más tiempo.. con la colocación de una bombilla de 10 a 40W. el embudo se coloca sin luz y el proceso de calentamiento-secado se lleva a cabo simplemente a temperatura ambiente. dependiendo de las condiciones de humedad inicial del suelo. es uno de los más usuales para la extracción en la evaluación de la diversidad y densidad de microartrópodos del suelo (André et al. el sistema Berlese-Tullgren y. que se muestra en la figura 4. 2006). cuando se compara con otros métodos de muestreo. pueden moverse con facilidad desde el lugar del muestreo y ser ajustados para acomodar un gran número de muestras. A pesar de una eficiencia menor.huevos y las formas inmaduras se vuelven adultos. un embudo de aluminio modificado de Berlese. en donde se coloca un tamiz con una malla de 2 x 2 mm (malla 13).5). El uso de un foco puede atraer insectos nocturnos. el tiempo de incubación (tiempo necesario para extraer la fauna del suelo) es aproximadamente de 4 a 5 días. éste se cerrará con una tapa para prevenir la entrada de otros insectos.

3 Embudos Berlese llenos de suelo y hojarasca. hecho de aluminio. con embudo superior de 40 cm de diámetro. acari y otra mesofauna del suelo 155 . El proceso de montaje debe realizarse bajo un microsC ollembola . los especímenes de mesofauna son montados sobre laminillas. después de su aclarado. R. PROCESOS DE ACLARADO Y MONTAJE DE ESPECÍMENES Para su identificación. de 50cm de altura.Figura 4.4 Embudo Berlese modificado. Fuente: cortesía del Dr. Suhardjono LIPI Bogor. Figura 4. Y.

durante unos minutos. en donde se sumergen y calientan durante los diferentes periodos de tiempo. Después de la inmersión en KOH. aunque Greenslade et al. copio de disección. Proceso de aclarado El aclarado consiste en volver más transparente el tejido de los especímenes.. fácil y seguro. dependiendo del tamaño. Un método más simple de aclarado es utilizando ácido láctico. Para ello. Los especímenes pueden ser aclarados con un 15% de KOH. 2008). Los taxa con cutículas delicadas. como algu156 Manual de biología de suelos tropicales . este método es más barato. dependiendo del pigmento y de la grasa del cuerpo del animal.R. Cortesía de: M. mediante el lavado y removido de las grasas y pigmentos del cuerpo. aunque el hidróxido de potasio (KOH) y el ácido láctico son alternativas efectivas. hasta neutralizar la reacción. se transfieren los especímenes a una solución de cloral fenol.5 Equipo básico requerido para llevar a cabo extracciones Berlese-Tullgren núcleo por núcleo.Figura 4. la observación de la morfología. (2008) propusieron una solución de KOH 10% durante 1 a 5 minutos. con o sin calentamiento. normalmente. y da buenos resultados (Greenslade et al.. requiere de un microscopio compuesto. Coelho. normalmente se usa una solución de Nesbitt (su composición se describe a continuación). durante dos a cinco minutos.

En cada caso se debe regular y controlar el tiempo. porque el ácido láctico continúa aclarándolos y ablandándolos. La posición de los especímenes sobre el portaobjetos difiere entre los órdenes: por ejemplo. Para un almacenaje permanente. como característica clave. por lo menos. Algunos grupos necesitan ser disecados o disectados antes del montaje. 2008). el medio líquido Hoyer. tubo ventral y en los segmentos V y VI abdominales. mientras que para los Entromobrymorpha. con el propósito de identificarlos viendo la quetotaxia de cada parte. Las partes diseccionadas del cuerpo de los Entromobrymorpha deberán colocarse de forma dorso-ventral sobre el portaobjetos. Normalmente.1). Los ácaros también pueden aclararse y conservarse trasladándolos del alcohol a un medio de Hoyer. De nuevo. Montaje No existen métodos totalmente satisfactorios para el montaje (Greenslade et al. abdomen pequeño y fúrcula (dorsoventral). Para dicho montaje se requiere de una solución Berlese. fúrcula. al que se añade un 5% de glicerina.nos Diplura. siete días. Symphypleona y Neelipleona. Protura y Pauropoda no deben meterse en una solución concentrada de ácido. para que puedan ser bien identificados. muchos ácaros oribátidos se guardan en viales etiquetados. los colémbolos Poduromorpha se deben colocar en posición dorso-ventral. si no se hace. por ejemplo. Después de su identificación. con alcohol 70%. La disección se realiza en varias partes del cuerpo. es aconsejable montar todas las partes del cuerpo en una sola preparación. la posición indicada es látero-lateral. Los ácaros esclerotizados pueden ser aclarados con lactofenol (compuesto por ácido láctico. Las especímenes son montados en laminillas y secadas en el horno a 70°C durante. mientras que las partes del cuerpo de los Symphypleona grandes se montarán de la siguiente manera: cabeza (dorsoventral). se recomienda la disección en el caso de Symphypleona y de las Paronellidae y Entomobrydae mayores (6 a 8mm). estos especímenes deberán sumergirse en una mezcla de 50% de ácido láctico/etanol durante unas horas. en el C ollembola .. En el caso de especímenes mutilados. cristales de fenol y agua destilada. los especímenes deben transferirse a otro medio. también pueden usarse para el proceso de montaje (Tabla 4. los especímenes pueden destruirse o desarticularse. acari y otra mesofauna del suelo 157 . utilizando el ejemplo de los colémbolos. patas. sin calentamiento. abdomen grande (látero-lateral). tales como cabeza. en proporciones 50:25:25) o simplemente con ácido láctico (frío o caliente). Otras soluciones.

pero las preparaciones pueden hacerse semipermanentes sellando el recubrimiento con barniz de uñas transparente. 10 g de glucosa y 5 ml de ácido acético glacial. IDENTIFICACIÓN DE ESPECÍMENES Y ANÁLISIS DE DATOS Identificación La mayoría de los invertebrados del suelo pueden identificarse hasta orden o familia con la ayuda de trabajos estándares de referencia. Se coloca de manera parcial un cubreobjetos sobre la depresión y se empuja el espécimen por debajo del recubrimiento. Trave (1965).htm o http://soilbugs.1 Composición química para aclarar y montar especímenes. 30 g de goma arábiga. Montaje de especimenes: medio líquido de Hoyer Nota: montaje Berlese: calentar a 70°C durante 7 días. Para aclarar especimenes solución Nesbitt’s 10% KOH ó NaOH Montaje de especimenes : medio líquido de Berlese 25 ml de agua destilada. ofrecen una buena discusión de fondo acerca de cómo aclarar y montar ácaros. www. se hace un montaje temporal. en el caso de la mayoría de los grupos de artrópodos de suelo. de donde se pueden obtener guías de ayuda para la identificación.php. El espécimen puede rodarse suavemente hasta conseguir la orientación deseada. tales como los de Bachelier (1978) y Dindal (1990).caso de ácaros de suelo. El medio líquido de Hoyer es un agente temporal y no se endurece con calentamiento. Krantz (1978) y Norton (1990).edu/course/ent591k/kwikey1. 50 ml de agua destilada. resulta difícil.ncsu. aunque también se puede usar para otros grupos de mesofauna. 40 g de hidrato de cloro y 2. sin embargo.ac. esta última dirección también concentra la literatura principal. A nivel de especies. 200 g de hidrato de cloro y 20ml de glicerina. donde se indican las características distintivas de varios grupos de invertebrados.5 ml de ácido hidroclórico 20 ml de agua destilada.cals. 50 g de hidrato de cloro. Se encuentran disponibles varias páginas en la web. El espécimen se traslada a unas gotas de ácido láctico o glicerina en un portaobjetos excavado. la pericia taxonómica quizás sea el factor determinante en la selección de una taxa para su estudio posterior. Tabla 4. 5 ml de glicerina. 15 g de goma arábiga. 158 Manual de biología de suelos tropicales . Por ejemplo.nz/key.massey. una identificación más allá de este nivel. hacia el borde de la depresión.

la identificación de colémbolos. El libro contiene claves de identificación para todas las clases. Symphyla. Asimismo. Pseudoscorpionida. Los subórdenes de ácaros y muchas familias de colémbolos son de fácil identificación. Adis (2002) ofrece guías ilustradas para principiantes y cualquier persona interesada en Arachnida y Myriapoda Neurotropicales. por lo menos. Araneae. la identificación a nivel género y/o especies. 1999). algunas veces. Pauropoda. Coleoptera. es utilizado para estimar su abundancia. 2008. Balogh y Balogh (1990) ofrecen una breve caracterización y claves de identificación para ácaros oribátidos que habitan en la región neotropical. hasta nivel de familia y. C ollembola . taxonomía y ecología de grupos de la biota del suelo. ya que contiene guías de identificación ilustradas. 1982a. Balogh y Mahunka (1983) y Balogh y Balogh (1992). El libro se escribió para un fácil manejo. algunos géneros y listas de especies terrestres conocidas. Mites.. Chilopoda. órdenes. son combinadas para crear una muestra compuesta que se somete a extracción. están disponibles en Kranz (1978) y Dindal (1990). Protura. La base de identificación y clasificación se encuentra resumida en las referencias que se citan a continuación. por lo que es recomendable tanto para principiantes como para profesionales. es mostrado en Dindal (1999). Scorpiones. Collembola.permitiendo así. son escasas las guías específicas para este grupo en los trópicos.1982b y 1983) pueden utilizarse para identificar colémbolos a nivel especies. Enchytraeidae. al igual que referencias de la taxonomía actual de estos grupos. a nivel familia. familias. Desafortunadamente. Isóptera. Las muestras colectadas. en las familias Entomobryidae y Paronellidae. se encuentra disponible en Greenslade et al. Opiliones. Análisis de datos El número de individuos en cada orden y en cada lugar. una vez conocida su morfología y características básicas (Crossley y Coleman. 1981b. Diplura. Balogh (1972). por ejemplo. Bachelier (1978) ofrece buena información de fondo dentro de las amplias unidades taxonómicas de artrópodos del suelo e incluye guías ilustradas para varios grupos. Diptera y Hymenoptera. Un estudio completo de la biología. utilizando pequeños núcleos o bloques. Los recursos para la identificación de ácaros. Isopoda. al igual que una lista de comprobación y bibliografía de especies descritas en esta área. acari y otra mesofauna del suelo 159 . a nivel genérico. de especies para algunos grupos como Nematoda. Publicaciones de Yoshii (1981a. quienes ofrecen guías y figuras a nivel genérico para ácaros que pertenecen a la suborden Oribatida.

2006). La comparación de la composición de taxa entre usos de suelo debería llevarse a cabo utilizando un análisis jerárquico de agrupación y la unión promedio de agrupaciones de los datos transformados. pp. junto con otros índices de diversidad. 1988). también pueden detectar los efectos de la perturbación con poca pérdida de información y llegar a ser una herramienta preliminar para describir patrones y sucesiones en ecosistemas del suelo perturbado por humanos (Caruso y Migliorini.. del paquete de metodología ecológica para Windows. Los datos obtenidos deben. 160 Manual de biología de suelos tropicales . (1978) “La faune des sols. 3–24. X. J. Este índice resulta especialmente útil para eliminar invertebrados hiper-diversos. G. de acuerdo con su función ecológica mayor (detritivoros. ejemplo: ácaros oribátidos. André. Paris. Dado que los grupos de lugares similares ofrecen una fauna similar y que la mayoría de animales del suelo pueden distribuirse en los grupos funcionales básicos (Ruf et al. Se ha demostrado que datos a nivel género y familia. reality or conning?” Oikos. Este procedimiento mejora la eficiencia de la extracción porque maximiza las posibilidades de captura de grupos o especies representativos. También puede llevarse a cabo un análisis adicional como rarefacción y estadística multivariada.utilizando el método Berlese-Tullgren. o bien. son écologie et son action“. etc. no 38. incluir la riqueza de especies en el caso de los taxa seleccionada para la identificación a nivel especies. El número de individuos normalmente se transforma de forma logarítmica log: x’=log10 (x+1) para evitar dar mayor peso a las especies dominantes en el análisis de datos (Ludwig y Reynolds. tales como colémbolos. pueden ser calculados utilizando el programa EstimateS (Colwell. El programa DIVERS. (2002) “Soil biodiversity: Myth. 2005. REFERENCIAS Adis. Ph. 2006).. vol. puede usarse para calcular los índices de riqueza de especies. fitofagos. 96. Ducarme. 2003). H. Bachelier. un nuevo estimador estadístico que toma en cuenta especies compartidas no detectadas. Pensoft. Initiations et Documents Techniques. con numerosas especies raras.. predadores. por lo tanto. basada en la correspondencia estadística entre combinaciones de singletons y de otras especies raras (estimador de abundancia Chao-SØrensen) fue desarrollada por Chao et al. Sofia-Moscow. (2002) Amazonian Arachnida and Myriapoda. ácaros oribátidos y hormigas.). 2006. Este estimador. M. y Lebrun. ORSTOM. los taxa escasamente conocidos también se pueden clasificar a niveles taxonómicos más altos (orden o familia).

CABI Publishing.nz/~maminor/mites. R. D. Chazdon. A. Franklin. Biometrics. O. L. Balogh. 46–53. E. 2. no. Oregon. (2008) Handbook to Collembola of Indonesia. Fauna Malesiana. L. Version 8 User’s Guide and Application’. J. P. Crossley. 2. New York. S Moreira. L. M. www. (1988) Statistical Ecology: A Primer on Methods and Computing. 142–162. F. y Coleman. (2006) ‘Soil Mesofauna in Central Amazon’. Amsterdam. Ecology Letters. Norton.edu/estimates. y Shen. 59–65. Minor. pp. (1978) A Manual of Acarology.. T-J. (2006) ‘Abundance-based similarity indices and their estimation when there are unseen species in samples’. R. Colwell. Chao. Chazdon. L. Elsevier. Mahunka (eds) The Soil Mites of the World. vol.. C ollembola . in D.. T. pp. Colwell. (1990) ‘Oribatid Mites of the Neotropical Region II’. Ludwig. R. Boca Raton. E. (1999) ‘Microarthropods’. (2006) ‘Micro-arthropod communities under human disturbance: Is taxonomic aggregation a valuable tool for detecting multivariate change? Evidence from Mediterranean soil oribatid coenoses’. y Shen. R. y Balogh. vols 1 and 2. (1972) The Oribatid Genera of the World. John Wiley and Sons.Balogh. Wallingford. K. J. R. y Reynolds. pp. P. Chao. Sumner (ed) Handbook of Soil Science. A. A. D. (1992) The Oribatid Mite Genera of the World. J. in M. J. Greenslade. Hungarian Natural History Museum Press. y Suhardjono. Y. R. A. CRC Press. M. vol. Brill. acari y otra mesofauna del suelo 161 . 30. (1990) Soil Biology Guide.eeb. uconn. S. A.. D. (2005) ‘A new statistical approach for assessing compositional similarity based on incidence and abundance data’. 62.. G. John Wiley & Sons. pp. W. no. W. R. Leiden (in press). y Morais. Krantz. in F. y Migliorini. Budapest. K. 8. no 1. Colwell. Akadémiai Kiadó. Oregon State University Book Store Inc. vol. L. Dindal (ed) Soil Biology Guide. 148–159. Amsterdam. y Balogh. 779–803. pp. M. html.massey. Balogh and S.ac. J. New York. Elsevier. (2004) ‘Soil mites and other animals’. J. 361–371. Balogh. New York. y Mahunka. in J. Dindal. J. J. accessed 10 January 2008. Bedos. pp. Budapest. (1990) ‘Acarina: Oribatida’. Brussaard (eds) Soil Biodiversity in Amazonian and Other Brazilian Ecosystems. P. T-J. K.. John Wiley and Sons. Balogh. (1983) Primitive Oribatids of the Palaearctic Region. Caruso. Siqueira and L. http://viceroy. Deharveng. Acta Oecologica.. (2006) ‘EstimateS: Statistical estimation of species richness and shared species from sample.

y Spelda. J. vol. pp. 23–47. Oribatida. Fert. Yoshii. Yoshii. A. 1–38. pp. Römbke. Yoshii. 8112. pp1–38. no. 4. Travè. Ecosystems and Environment. Camisiidae)’. Japan International Cooperation Agency. 1–3. d’observation et de conservation des Oribates (Acariens) et autres microathropodes”. R. Japan International Cooperation Agency. Siepel. 2. K. R.. 98. vol. (1982b) ‘Studies on the Collembolan Genera Callyntrura and Dicranocentroides’. Japan International Cooperation Agency. (1982a) ‘Lepidocyrtid Collembola of Sabah’. Soils. J. Revue d’Écologie et de Biologie du Sol. pp.. (2003) “A biological classification concept for the assessment of soil quality: “Biological soil classification scheme” (BBSK)’. Entomological Report from the Sabah Forest Research Centre No. Japan International Cooperation Agency. 162 Manual de biología de suelos tropicales . Hund-Rinke. 2. Entomological Report from the Sabah Forest Research Centre No. pp.. Agriculture. 5. Yoshii. 263–271. 81-12. R. R. 6. no. Oribatida. 139–144. pp. (1965) “Quelques techniques de récolte. Dreher. Biol. 9. (1983) ‘Studies on Paronellid Collembola of East Asia’. pp. 3. Nothridae) and Platynothrus peltifer (Koch) (Acari. Japan International Cooperation Agency. pp. Entomological Report from the Sabah Forest Research Centre No.Ruf. (1981a) ‘Paronellid Collembola of Sabah’. Entomological Report from the Sabah Forest Research Centre No. (1981b) ‘Neanurid Collembola of Sabah’. (1990) ‘Niche relationships between two panphytophagous soil mites. de triage. EX-1 JR. H. R. P. Entomological Report from the Sabah Forest Research Centre No. EX-1 JR. L. 7. Yoshii.. J. vol. 1–70. 1–70. Nothrus silvestris Nicolet (Acari. Beck. 1–28.

1990). Los nematodos en una primera aproximación. Debido a su gran capacidad de adaptación. sin embargo. ya que poseen un cuerpo alargado y cilíndrico. Aunque la biomasa de nematodos en el suelo es pequeña (10¹ a 104 mg peso seco m-2).Capítulo 5 Nematodos del suelo Juvenil E. ellos juegan un papel importante como agentes de ciclado de nutrientes y como reguladores de la fertilidad del suelo mediante el flujo de energía y la movilización y utilización de nutrimentos (Procter. algas. animal y de plantas. son conocidos como una amenaza para la salud humana. Derivado de su evolución. los nematodos están presentes en cualquier lugar donde exista carbono orgánico. Cares y Shiou P. en todas las latitudes del planeta y desde fondo del mar hasta la cima de las montañas. además de estos bene163 . 1980. De esta manera. La palabra nematodo deriva del griego “nema” que significa “forma de un hilo”. protozoarios. los cuales se consideran uno de los grupos de animales más abundantes y más diversos en el planeta. los nematodos se adaptaron a la exploración de una amplia variedad de fuentes de alimento. Huang (†) INTRODUCCIÓN Los nematodos del suelo son pequeños invertebrados dependientes del agua. mientras que las formas de vida libre se alimentan de microorganismos (bacterias y hongos). otros nematodos y microinvertebrados. 1982). ellos son responsables del 10 a 15% de la respiración de los animales del suelo (Sohlenius. los nematodos parásitos tienen la capacidad de colonizar y alimentarse de tejidos de plantas y animales. Petersen.

influir en la nodulación por parte de bacterias tipo Rhizobium. así como su ciclo de vida corto y sensibilidad ante alteraciones ambientales. una condición que puede interpretarse como indicador de la fertilidad del suelo (Ferris et al. microinvertebrados y protozoarios. Su omnipresencia y abundancia en todo tipo de suelos y hábitats acuáticos. en algunos casos. Los nematodos bacteriófagos. el aparato bucal incluye un estilete tipo aguja (lustración 2a). los califican como poderosos bioindicadores de condiciones ecológicas (Huang y Cares. compuestos por lo general de cinco grupos funcionales principales: parásitos de plantas. bajo condiciones de enriquecimiento de nutrimentos. Algunos nematodos viven en un amplio rango de ambientes. Se distinguen también entre ellos mismos por su 164 Manual de biología de suelos tropicales . también participan en importantes servicios del agroecosistema al fungir como agentes de control biológico de plagas de insectos. Como típicos estrategas r. o en algunos casos. Por tal motivo. se alimentan de las hifas de hongos saprofíticos. algunos nematodos micófagos son pueden comportarse como parásitos facultativos de plantas. pueden alimentarse de bacterias y esporas de hongos. tal es el caso de los nematodos entomofílicos Deladenus siricidicola o los entomopatógenos Steinernema carpocapsae y Heterorhabditis bacteriophora. micófagos. por lo que pueden fungir como micófagos. en la mayoría de los casos la identificación de los diferentes grupos funcionales puede lograrse en base a la morfología de su aparato bucal. los nematodos están bien representados a lo largo de la red trófica del suelo. poseen un estilete que les permite alimentarse de otros nematodos. 2006). así como alimentarse y diseminar bacterias benéficas y fitopatógenas. con la capacidad de alimentarse de cualquier fuente. depredadores y omnívoros (Ilustración 2). patogénicos. bacteriófagos. los nematodos bacteriófagos pueden incrementar su población ante cualquier perturbación del suelo o bien. mientras otros ocupan áreas más restringidas. Los micófagos. 2001). Aunque la identificación de estos organismos requiere de intenso entrenamiento. mediante el cual puede causar pérdidas significativas en varios cultivos. En el caso de nematodos parásitos de plantas. Los omnívoros tienen la cavidad bucal armada con un estilete hueco (Ilustración 2e). equipados en su mayoría con un estilete pequeño y delicado (Ilustración 2b).ficios para el ecosistema. pueden regular el nitrógeno y el fósforo disponible para las plantas. Los nematodos del suelo viven en grupos o gremios. Los nematodos depredadores tienen la cavidad bucal equipada con una o más estructuras en forma de dientes (Ilustración 2d). mismos que carecen de estilete (Ilustración 2c). son polífagos. bacteriófagos. herbívoros y también como depredadores al alimentarse de otros nematodos. benéficos y micorrízicos.

se trazan dos círculos concéntricos. Para colectar el suelo se utiliza un nucleador de acero y las muestras se toman en cuatro puntos equidistantes en el círculo pequeño. Las muestras son transportadas al laboratorio en una caja aislada y almacenadas a 4° C hasta su extracción. Según lo propuesto por Bongers (1990) y Bongers y Borgers (1998). con un radio de 3 m y 6 m. producen pocos huevillos. puede presentar un índice de sistemas de uso de suelo y cambios de uso de suelo y medir los niveles de perturbación provocados por contaminantes y otros factores. y ocho puntos en el círculo grande. poseen una baja movilidad. los nematodos colonizadores (similares a los estrategas r) típicamente poseen un tiempo de generación corto. además son los más resistentes a la perturbación del suelo y a contaminantes químicos. A esta última suspensión de nematodos se le pueden eliminar aún más partículas de N ematodos del suelo 165 . la cual se vacía a una cubeta con 2 litros de agua. y los nematodos se colectan directamente en un tamiz de 400 mallas (tamaño de malla de 37 µm) (Figura 5. muestran la presencia de dauerlarva e incrementan sus poblaciones cuando existen condiciones ricas en alimentación. EXTRACCIÓN DE NEMATODOS La muestra de suelo se mezcla completamente y se toma una submuestra de 300 ml.sensibilidad a la perturbación del suelo y a los contaminantes químicos. lo cual deberá hacerse con la mayor rapidez posible. pero más grandes. los nematodos persistentes (similares a estrategas k) se caracterizan por necesitar un largo tiempo de generación. se agita durante 30 segundos y se deja reposar otros 2 minutos para que las partículas del suelo se sedimenten. un análisis apropiado de la comunidad de nematodos. producen muchos huevecillos pequeños. MUESTREO DE SUELO En cada punto de muestreo dentro de un sistema de cuadrícula (véase Capítulo 2). tomando en cuenta su diversidad.1). respectivamente. una ausencia de dauerlarva y sensibilidad ante contaminantes y otros factores de perturbación. Esta suspensión se pasa a través de tamices de 40 a 60 mallas (tamaño de malla de 250 a 350 µm. Por otra parte. todos los núcleos de suelo se deben tomar a una profundidad de 20 cm. por tal motivo. Los doce núcleos de suelo se depositan en una bolsa de plástico que deberá sellarse para evitar su desecación y además protegerla de la luz solar. respectivamente). abundancia y estructura de comunidad.

Los especímenes que se hallan sobre la malla se lavan y arrastran con agua. En este procedimiento. La suspensión. posteriormente se fijan con solución Golden 2X (Hooper. Posteriormente. suspensión de suelo en reposo. se distribuye en tubos de ensayo para su fijación. para luego colectarse en un vaso de precipitados (Figura 5.suelo mediante un método modificado de centrifugación con flotación de azúcar (Jenkins.000 rpm durante uno a dos minutos.500 rpm durante 5 minutos y el sobrenadante se descarta. 1964). juego de tamices de metal (de tamaño de malla 45 arriba y 400 abajo). la suspensión acuosa se centrifuga primero a 3.2a) y se centrifuga de nuevo a 1. dejando así una suspensión de nematodos de 10 a 20 ml. el sedimento o botón dentro del tubo de centrífuga se resuspenden en solución de sacarosa (456g L-1) (Figura 5. Posteriormente. Una vez calentados los tubos. los nematodos se colectan a partir del sobrenadante utilizando un cernidor con tamaño de malla de 37 µm (Figura 5. contenida en el vaso.2b). se añade un volumen igual de solución Golden Figura 5. 1970).1 A la izquierda. 166 Manual de biología de suelos tropicales . y a la derecha. éstos se dejan reposar durante 30 minutos y se remueve el exceso de sobrenadante utilizando una pipeta o por medio de succión al vacío (preferentemente).3a). FIJACIÓN Y CONTEO DE NEMATODOS Los nematodos extraídos se matan con agua caliente a 50-60°C durante un máximo de un minuto (Figura 5.3b) y.

La suspensión resultante se ajusta a un volumen de 15 ml y se cuenta el total de nematodos en la población mediante la toma al azar. de alícuotas de 1 ml.2%. b) muerte de nematodos en agua caliente. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa. 2X.Figura 5.3 a) Nematodos recuperados mediante el lavado de malla de 400. con lo que se obtiene una concentración final de formol 3. a b Figura 5. el número total se obtiene de multiplicar la media de tres conteos de manera que el número total representará el número medio de 3 conteos de submuestras x 15. N ematodos del suelo 167 .2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos.

en esas condiciones se retira la tapa de la caja para que se reduzca por lo menos a la mitad de su volumen. El procedimiento se ilustra en la Figura 5. Anderson y Potter. 1992. Después de este proceso. se coloca una tira de cinta adhesiva para evitar que el cubreobjetos aplaste a las especímenes. utilizando un microscopio compuesto (se requiere un aumento de 400 a 1. Jairajpuri y Ahmad. Goseco et al. utilizando una gota de glicerina deshidratada como medio de montaje. 1991. al final.5. Hunt. Smart Jr y Nguyen. Al segundo día. 1991.1974. Loof. 1991. La identificación de nematodos por caracteres morfológicos se basa en la literatura taxonómica especializada (Goodey. 1991.. la caja se coloca en un desecador a 43°C durante la noche (Figura 5. aunque en la última ocasión no es necesario añadir solución Seinhorst II pero sí incubar a la misma temperatura durante otras 48 horas para evaporar todo el alcohol.6).7).1. Cares y Huang. 2001). Thorne. 2000. Andrássy. 1961. May et al. 1991. 1991. 1993. Se hace una selección al azar de aproximadamente 100 nematodos montados para su identificación a nivel de género.1) y el volumen resultante se vacía por completo en una caja Petri de 5 cm de diámetro. 1951. Smart Jr y Nguyen. 168 Manual de biología de suelos tropicales . Tabla 5. El volumen de la caja se reestablece con solución Seinhorst II. La modificación consiste en reducir a 3 ml el volumen de la suspensión (Figura 5. luego se añaden 7 ml de la solución Seinhorst I (Figura 5. 1991. 1988. se tapa la caja y se deja nuevamente en el desecador durante la noche. 1959) suele modificarse para evitar la laboriosa tarea de pescar individualmente cada nematodo y elaborar numerosas preparaciones permanentes. 1996. Baldwin y Mundo-Ocampo. la caja se retira del desecador y se deja evaporar a la misma temperatura durante un mínimo de cuatro horas.000 x). mientras que la composición de las soluciones se puede observar en la Tabla 5. Raski. 1984) (Figura 5.4). 1991. 1991. los nematodos de la caja se montan en laminillas. Nickle y Hooper. 1983. la preparación se sella utilizando bálsamo de Canadá (Huang et al.5. 1994. Fortuner. Antes de colocar el cubreobjetos de vidrio sobre la gota.INFILTRACIÓN CON GLICERINA Y OBSERVACIÓN DE NEMATODOS El método de Seinhorst (Seinhorst. Maggenti. 1988. Bongers. Geraert. Estos pasos se repiten tres veces. 1991.. Decraemer.

Figura 5. Evaporación a 43°C durante 4 hrs para reducir a la mitad del volumen Completar volumen con Seinhorst II Evaporación a 43°C durante 4h para reducir el volumen a la mitad Desecador a 43°C durante la noche N ematodos del suelo 169 .4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos Figura 5. Las cajas Petri no deben contener más de una tercera parte de líquido.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos. Nematodos en: Golden (3 ml) + Seinhorst I (7 ml) Evaporación a 43°C durante 4h para reducir el volumen a la mitad Completar volumen con Seinhorst II Desecador a 43°C durante la noche Desecador a 43°C durante la noche Desecador a 43°C durante la noche Evaporación a 43°C durante 48 horas.

170 Manual de biología de suelos tropicales . Teixeira. Nota: el fondo del contenedor se mantiene a 43°C. Figura 5. Foto Francisco Franco.Figura 5. Foto: Marcella A.7 Charola con montajes permanentes de especímenes de nematodos.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina.

donde S = número de géneros y N = número total de nematodos]. Índice de Riqueza de Género [d = (S – 1)/log N.Σpi log2 pi]. Si un nematodo posee dos tipos de hábito alimenticio. Índice de Diversidad de Simpson [Ds = 1 – Σ(pi)². Índice de Diversidad de Shannon [H’ = . Los datos sobre frecuencia absoluta. empleando las fórmulas que se mencionan líneas adelante. cuando un nematodo tiene dos tipos de hábitos alimenticios.1 Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina. abundancia total y abundancia relativa de cada uno de los géneros. Golden X Formol (+ 40% formaldehído) Glicerina Agua destilada Alcohol 96% Glicerina Agua destilada 8 partes 2 partes 90 partes Seinhorst I 20 partes 2 partes 78 partes Golden 2X 16 partes 4 partes 80 partes Seinhorst II 95 partes 5 partes ÍNDICES Y PARÁMETROS PARA LA CARACTERIZACIÓN DE POBLACIONES DE NEMATODOS Los nematodos identificados a nivel de género pueden dividirse en cinco grupos tróficos: parásitos de plantas. Equitatividad del Índice de Diversidad de Simpson [Es = Ds/Ds max’ donde Dsmax = 1 – 1/S Equitatividad del Índice de Diversidad de Shannon (J’= H’/H’max’ donde H’max = Log2 S]. Los datos de frecuencia y abundancia de los diferentes grupos tróficos se usan para calcular el Índice de Diversidad Trófica y varios cocientes que consideran la abundancia relativa de los grupos tróficos. su número poblacional se divide entre dos para cada hábito. pueden utilizarse para calcular índices de diversidad y equitatividad. N ematodos del suelo 171 . (1993).Tabla 5. bacteriófagos. donde pi = porcentaje de género ‘i’ en la abundancia total]. depredadores y omnívoros. todos ellos basados en los criterios de Yeates et al. micófagos.

los persistentes cp5 se distinguen por tiempos generacionales largos. Índice de Diversidad Trófica [T = 1/ Σ(pi)². ausencia de dauerlavae y elevada sensibilidad ante la presencia de contaminantes y otros factores de perturbación (Bongers y Bongers. se han utilizado varios índices para la evaluación del suelo. Σ(vi x fi) (donde vi = valor c-p de 1 a 5 para el género ‘i’. La relación micófagos/bacteriófagos (M/B) y (micófagos+bacteriófagos)/parásitos de plantas [(M+B)/PP]. el Índice de Madurez (IM) (que incluye únicamente nematodos de vida libre) (Tabla 5. En base a estos conceptos. baja movilidad. y el cociente IFP /IM como un indicador de fertilidad del suelo. Para medir el nivel de perturbación del suelo (Bongers. Los colonizadores cp1 se caracterizan por tener tiempos generacionales cortos. respectivamente). Krebs. 1994].2 Familias y valores cp utilizados para el índice de madurez* Familia Neotylenchidae Anguinidae Aphelenchidae Aphelenchoididae Rhabditidae 172 valor cp 2 2 2 2 1 Familia Achromadoridae Ethmolaimidae Cyatholaimidae Desmodoridae Microlaimidae valor cp 3 3 3 3 3 Manual de biología de suelos tropicales . Tabla 5. presentan dauerlarvae o estadios de sobrevivencia y crecen bajo condiciones de riqueza de alimento. 1978. véase Norton. Bongers y Bongers (1998) propusieron IM2–5 (igual que IM. producen muchos huevecillos pequeños. Porcentajes de criconematidos y de dorylaimidos en la población. Magurran. siempre están activos. asignándoles un “valor cp” en una escala de 1 a 5. 1988. Bongers (1990) dividió a los nematodos del suelo en una serie desde los colonizadores (c) hasta los persistentes (p) (similar a los estrategas r y k.2) y el Índice Fitoparasítico (IFP) (que incluye únicamente parásitos de plantas) (Tabla 5.3). Por el contrario. donde pi = abundancia relativa de un grupo trófico . 1998). pero excluyendo a los nematodos cp1) para evaluar factores de estrés inducidos por contaminación. Yeates (1994) amplió el Índice de Madurez para incluir a todos los nematodos del suelo (mIM). la producción de pocos huevecillos pero muy grandes. y fi = frecuencia relativa del género ‘i’). 1990).

Tabla 5.3 Familias y valores cp utilizados para el índice fitoparasítico cp2 Tylenchidae Psilenchidae Tylodoridae cp3 Dolichodoridae Hoplolaimidae Pratylenchidae cp4 Trichodoridae cp5 Longidoridae N ematodos del suelo 173 Nota:*modificado de Bongers (1990). .Tabla 5.2 Familias y valores cp utilizados para el índice de madurez* Familia Alloionematidae Diploscapteridae Bunonematidae Cephalobidae Ostellidae Panagrolaimidae Myolaimidae Teratocephalidae Diplogasteridae Neodiplogasteridae Diplogasteroididae Tylopharyngidae Odontopharyngidae Monhysteridae Xyalidae Linhomoeidae Plectidae Leptolaimidae Halaphanolaimidae Diplopeltidae Rhabdolaimidae Chromadoridae Hypodontolaimidae Choanolaimidae valor cp 1 1 1 2 2 1 2 2 1 1 1 1 1 1 2 3 2 3 3 3 3 3 3 4 Familia Odontolaimidae Aulolaimidae Bastianiidae Prismatolaimidae Ironidae Tobrilidae Onchulidae Tripylidae Alaimidae Bathyodontidae Mononchidae Anatonchidae Nygolaimidae Dorylaimidae Chrysonematidae Thornenematidae Nordiidae Qudsianematidae Aporcelaimidae Belondiridae Actinolaimidae Discolaimidae Leptonchidae Diphtherophoridae valor cp 3 3 3 3 4 3 3 3 4 4 4 4 5 4 5 5 4 4 5 5 5 5 4 3 Nota: *Bongers (1990).

in W. Chave sistemática simplificada para gêneros Parte I”. O. y Potter. P. J. E. no. pp. Cares. Oecologia. I. Marcell Dekker. E. Bongers. y Bongers. vol. P. New York. Pirola. G. Revisão Anual de Patologia de Plantas. W. Siqueiera and Brussaard. 177–235. vol. S. pp.and non-cyst-forming nematodes’. Budapest. Bongers. (1991) ‘Stunt nematodes: Tylenchorhynchus. M. 3. M. Eötvös Lorand University. 2nd edition. Marcel Dekker.3 Continúa cp2 Ecphyadophoridae Paratylenchidae Anguinidae cp3 Heteroderidae Hemicycliophoridae cp4 cp5 Nota: * modificado de Bongers (1990). S. T. (1994) De Nematoden van Nederland. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian amazon and savanna vegetation’. Schoorl. 185–223. (1988) De Nematoden van Nederland. R. (1991) ‘Heteroderinae cyst. (1990) ‘The maturity index: An ecological measure of environmental disturbance based on nematode species composition’. J. 83. (2001) “Taxonomia de fitonematóides. Baldwin. T. Cares. 14–19. (2000) “Taxonomia atual de fitonematóides. 8. Nickle (ed) Manual of Agricultural Nematology. 529–586. The Netherlands. T. Merlinius. Revisão Anual de Patologia de Plantas. REFERENCIAS Anderson. (1983) A taxonomic review of the suborder Rhabditina (Nematoda Secernentia). (eds) (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. Moreira. pp. 46. T. pp.Tabla 5. Bibliotheekuitgave no 46. 239–251. Nickle (ed) Manual of Agricultural Nematology. S. Andrássy. and related genera’. vol. CABI Publishing. y Mundo-Ocampo. J. y Huang. Bongers. Applied Soil Ecology. The Netherlands. pp. Chave sistemática simplificada para gêneros Parte II”. Schoorl. 275–362. in W. Bongers. V. M. Koninklijke Nederlandse Natuurhistorische Vereniging. in F. 9. Koninklijke Nederlandse Natuurhistorische Vereniging. R. (1998) ‘Functional diversity of nematodes’. R. pp. 163–183. J. y Huang. Pirola. J. New York. 174 Manual de biología de suelos tropicales . J. E. pp. Cares. y Huang. L. Bibliotheekuitgave no. vol. 10. P. London.

pp. T. no 1. Brussaard (eds) Soil biodiversity in Amazonian and other Brazilian ecosystems. and Trichodoridae: Their systematics and bionomics. pp. E. S. and Monotrichodorus’. CAB International. vol. Purdue University. (1970) ‘Handling. D. E. Jairajpuri. C. A. F. Allotrichodorus. T. Purdue Nematode Collection Department of Entomology. Marcel Dekker. 1949’. in W. Geraert. 13–29. Wallingford. R. Journal of Nematology. Harper Collins College Publishers. F. Bongers. New York. W. R. Moreira. Huang. J. C. 18. fixing. Fortuner. 1st edition. pp. pp. Indiana. J. F. vol. Marcel Dekker. (1991) ‘Tylenchidae in agricultural soils’. M. Southey (ed) Laboratory Methods for Work with Plant and Soil Nematodes. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian Amazon and savanna vegetation’. Goseco. R. Siqueira and L. 48. R. (1994) Ecology: The Experimental Analysis of Distribution and Abundance. y Silva. 662–665. G. G. C. Loof. 587–626. y Goede. (1991) ‘Stubby root and virus vector nematodes: Trichodorus. Brill. J. pp. 16. J. West Lafayette. Goodey. New York.. Nickle (ed) Manual of Agricultural Nematology. Jenkins. Applied Soil Ecology. E. Ministry of Agriculture. New York. V. Ferris. Hunt. (1991) ‘Nemata: Higher classification’. S. Nickle (ed) Manual of Agricultural Nematology. Marcel Dekker. S. Ltd. Marcel Dekker. M. Plant Disease Reporter. in W. Nickle (ed) Manual of Agricultural Nematology.Decraemer. (1992) Dorylaimida: Free-living. no 9. R. in W. no 3. vol. pp. D. R. y Cares. 795–826. W. Hooper. W. Methuen and Co. staining and mounting nematodes’. in W. P. O. C. New York. (1984) ‘Preparing nematode permanent mounts with adhesive tapes’. in W. M. 363–422. Longidoridae. 341–342. Nickle (ed) Manual of Agricultural Nematology. E. (1991) ‘The family Pratylenchidae Thorne. 34–39. (1991) ‘The Hoplolaimidae’. M. London. Predaceous and Plant Parasitic Nematodes. (1974) Revision in Leptonchoidea (Nematoda: Dorylaimida). S. H. 163–183. New York. Fisheries and Food. P. R. R.. (1964) ‘A rapid centrifugal flotation technique for separating nematodes from soil’. Krebs. Technical Bulletin No 2. pp. 4th edition. Ferris. pp. Leiden. (1951) Soil and freshwater nematodes. in J. CAB International. pp. R. Nickle (ed) Manual of Agricultural Nematology. A.. Maggenti. 669–720. pp. R. M. (2001) ‘A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept’. in F. and Ahmad. Wallingford. J. 147–190. Marcell Dekker. J. y Ferris. N ematodos del suelo 175 . Bittencourt. New York. Paratrichodorus. (1993) Aphelenchida. Huang.

. Freckman. W. (1978) Ecology of Plant Parasitic Nematodes. vol. C. pp.. 4. M. no. (1996) Pictorial Key to Genera of Plant Parasitic Nematodes. C. D. y Georgieva. New York. W. Oikos. E. Nickle (ed) Manual of Agricultural Nematology. W. Mullin. H. y Hooper. 5th edition. G. R. Journal of Nematology. Oikos.. pp. (1959) ‘A rapid method for the transfer of nematodes from fixative to anhydrous glycerin’. T. (1991) ‘Sting and awl nematodes: Belonolaimus spp. Nickle (ed) Manual of Agricultural Nematology. vol. vol. Gainesville. 1. Lyon. 38. W. John Wiley and Sons. (1990) ‘Global overview of the functional roles of soil-living nematodes in terrestrial communities and ecosystem’. no. (1991) ‘The Aphelenchina: Bud. 315–331. New York. W. B. W. Marcel Dekker. J. Smart Jr. 25. J. in W. G. D. New York Petersen. L. (1961) Principles of Nematology. pp. biomass and contribution to energy flow by soil nematodes in terrestrial ecosystems’. P. New York. no. R. (1980) ‘Abundance. 97–101. Procter. B. vol. New York. (1982) ‘Structure and size of soil animal populations’. D. 22. G. Bongers. pp. 306–329. 2. Nickle. Marcell Dekker. May. University of Florida. pp. (1994) ‘Modification and quantification of the nematode maturity index’. vol. Cambridge University Press. G. (1988) Ecological Diversity and its Measurement. B. pp. D. 186–194. A. 67–69. R. Yeates. G. de Goede. D. and Nguyen. 465–508. vol. Raski. F. and insect nematodes’.’. Journal of Nematology. in W. C. pp. pp. y Loeffer. Yeates. C. J. Cornell University Press. pp. Norton. Nematologica. Cambridge. and Dolichodorus spp. (1988) Illustrated Key for Identification of Common Nematodes in Florida. New York. S. G.. (1991) ‘Tylenchulidae in agricultural soils’. Thorne. McGraw Hill Co.Magurran. 1–7. in W. H. H. (1993) ‘Feeding habits in soil nematode families and genera .an outline for soil ecologists’. y Nguyen. Marcel Dekker. S. Seinhorst.. Smart Jr. K. Nickle (ed) Manual of Agricultural Nematology. G. R. 39.. K. Sohlenius. R. 34. 761–794. K. 627–668. leaf. 3. Pedobiologia. 176 Manual de biología de suelos tropicales .

Ilustración 1. que contiene alcohol al 70%. Sistema de extracción de hormigas y escarabajos con trampas Winkler a) Delimitación de un metro cuadrado de hojarasca. d) Transferencia del material tamizado a bolsas de nylon en campo. c) Introducción de la hojarasca en un tamiz para separar los fragmentos más gruesos. i . e) Cada muestra de hojarasca tamizada se transfiere a una red. por un marco. b) Colecta de la hojarasca utilizando guantes de cuero. desde el borde hacia el centro. f y g) Se fijan las redes al interior de la trampa Winkler previamente colgadas en un espacio bien aireado con un frasco colocado en el fondo.

D) depredador. E) omnívoro. A y B: Estoma con estilete C: Estoma sin estilete D: Diente dorsal E: Odonto estilete ii Manual de biología de suelos tropicales . Fotomicrografías de la región anterior en las que se muestra el aparato bucal (flechas) de nematodos de suelo pertenecientes a diferentes grupos funcionales: A) parásito de plantas. Fotos: Juvenil Cares.Ilustración 2. B) micófago. C) bacteriófago.

2009. Pasos de la metodología para caracterizar a las bacterias fijadoras de nitrógeno y formadoras de nódulos en leguminosas (BFNFNL) aplicada en el proyecto CSMBGBD. Fotos: F. cr CL CL d) Características de dos aislamientos de Bradyrhizobium (CL de crecimiento lento) y de R. a) Siratro en bolsa de plástico con solución de nutrientes Pheseolus vulgaris c) Pruebas en plantas de Pheseolus vulgaris para ver la eficiencia de aislamientos en Jarras de Leonard. en gel de poliacrilamida. Moreira excepto e) de Lima et al. I lustraciones a color iii . tropici (CR crecimiento rápido) creciendo en YMA f) Perfiles de Rep-PCR de e) Perfiles de proteínas totales obtenidos por electroforesis diferentes cepas.. b) Plantas de Prosopis juliflora en agar inclinado con solución de nutrientes. PAB vol 319.Ilustración 3.

iv Manual de biología de suelos tropicales . mostrando algunos sáculos esporíferos todavía fijados a la espora (flecha). h) esporas de Acaulospora sp. típica de la familia. Fotos: Sidney Stümer. b) espora de Scutellospora scutata con la célula suspensora bulbosa (flecha). d) células auxiliares nudosas diferencias por miembros del género Scutellospora.Ilustración 4. Esporas y estructuras producidas por especies de hongos micorrizógenos arbusculares de la familia Gigasporaceae: a) espora de Gigaspora albida mostrando la célula suspensora bulbosa (flecha). f) espora de Entrophospora colombiana mostrando las dos cicatrices (flecha). g) espora de Acaulospora scrobiculata mostrando la cicatriz (flecha) que queda en la espora después de que se suelta el sáculo esporífero. pared germinal 1 (gw1) y pared germinal 2 (gw2) con su capa más interna en reacción con el reactivo Melzer. c) detalle de la ornamentación de la pared de la espora (verrugas) de Scutellospora coralloidea. Esporas y estructuras producidas por especies de HMA de la familia Acaulosporaceae: e) espora de Entrophospora colombiana mostrando la pared de la espora. obsérvese el escudo redondo de germinación de color café que contrasta con el color hialino de la espora.

Fotos: Sidney Stümer. b) Espora de Glomus sp.wvu. d) Esporocarpo de Glomus sp. brasilianum que fueron tomadas de http:// invam. obsérvese que la capa más profunda de la pared de la espora se separa y se asemeja a la pared germinal. L2 y L3) (obsérvese que la capa L2 está ornamentada con pequeñas crestas). f) Detalle de Archaeospora Leptoticha mostrando salientes y depresiones en las capas 2 y 3 de la pared de la espora (flecha). h) Espora de Paraglomus brasilianum mostrando la estructura de la pared de la espora formada por tres capas (L1. Esporas y estructuras producidas por especies de HMA de la familia Archaeosporaceae (e y f) y Paraglomeraceae (g y h): e) espora de Archaeospora Leptoticha con sáculo esporífero. c) Esporocarpo de Glomus clavispora. excepto de Paraglomus occultum y P.caf.Ilustración 5. I lustraciones a color v . L2 y L3).edu. Esporas y estructuras producidas por especies de HMA de la familia Glomeraceae: a) Espora de Glomus clarum mostrando la hifa de sostén. mostrando la pared de la hifa de sostén de manera continua con la pared de la espora. g) Espora de Paraglomus occultum mostrando la estructura de la pared de la espora formada por tres capas (L1.

b) muestra de agua con cebo. e) Oogonio y anteridio de Pythium. c) cultivo puro en cebo. Aislamientos de hongos zoospóricos de muestras del ambiente (Oomycota y Chytridiomycota): a) muestra de suelo con cebo. d) esporangio de Phytophthora. f) Pythium liberando zooesporas. vi Manual de biología de suelos tropicales .Ilustración 6.

b) tamices con diferentes mallas.Ilustración 7. f) medio de cultivo en placas. d) continuando con el procedimiento de lavado. Abreu. Fotos: Lucas M. Técnica de lavado del suelo para el aislamiento de microhongos del suelo: a) Pre-lavado. I lustraciones a color vii . c) suelo pre-lavado. h) colonias de hongos en medio de cultivo para retardar el crecimiento. e) partículas de suelo lavado. g) placa con partículas de suelo para su incubación.

A) Larvas y pupas de la mosca de la fruta en el suelo. E) Adulto de mosca de la fruta y detalle del aculeo.Ilustración 8. B) Trampa MacPhail con cebo. C) Patrones alares típicos con bandas. D) Extracción del aculeo. A C Banda costal Banda “s” Banda “s” D B E Cabeza Punta del oviducto Mesonoto Aculeo Mediotergio Abdomen Terminalia viii Manual de biología de suelos tropicales .

Capítulo 6 Bacterias formadoras de nódulos en leguminosas Fátima M. donde se cosecharon cerca de 57 millones de toneladas de soya. 1975). considerando un área de 21 millones de hectáreas. en el caso de la soya. pues proporciona alrededor del 70% de todo el nitrógeno requerido en los ecosistemas naturales y agroecosistemas (Burns y Hardy. 177 . En el año 2006.3 billones de gastos en fertilizantes mediante la aplicación de esta biotecnología. usadas para la inoculación. se utiliza en algunos países con un pequeño y selecto grupo de leguminosas con el propósito de reemplazar el uso de fertilizantes químicos de nitrógeno. la inoculación con cepas de Bradyrhizobium reemplaza completamente la aplicación de fertilizantes sintéticos. provienen de una diversidad que se encuentra en el suelo. En Brasil. por lo tanto. un conocimiento de la diversidad de BFNFNL en el suelo deberá ser el primer paso para el manejo y la conservación de este recurso genético de tanto valor. S. se ahorraron alrededor de US$ 3. debido a las múltiples interacciones que se dan entre organismos del suelo y plantas. al mismo tiempo. la biodiversidad del suelo puede afectar el comportamiento de la formación de nódulos de manera positiva o negativa. Las cepas. La inoculación con cepas de BFNFNL altamente eficientes y adaptadas a las condiciones ambientales dominantes. Moreira LA IMPORTANCIA ECONÓMICA Y ECOLÓGICA DE LA SIMBIOSIS DE BACTERIAS FORMADORAS DE NÓDULOS EN LEGUMINOSAS (BFNFNL) La fijación biológica de nitrógeno es uno de los procesos más importantes para mantener la vida en el planeta. manteniendo así la armonía con el medio ambiente.

1997 Chen et al. 1998 Wang et al. tropici R.proteobacteria (por ejemplo. 1879. Una extensión reciente de conocimientos acerca de las bacterias formadoras de nódulos en leguminosas fue el descubrimiento que estableció que las bacterias pertenecientes al β-proteobacteria (género Burkholderia y Ralstonia/Cupriavidus) y a otras familias de la α. 2003) (Tabla 6.. trifolii. 2002. mongolense R. giardinii biovars phaseoli.. etli biovar mimosae 178 Manual de biología de suelos tropicales Frank. 1938). 1989 Martinez-Romero et al. Especie de bacterias formadoras de nódulos en leguminosas. giardinii R. Filum/Orden. 1997 van Berkun et al. 1999a . el nombre ”rhizobia” ya no resulta idóneo para describir bacterias formadoras de nódulos.. El término rhizobia se deriva de Rhizobiaceae (Conn. hainanense R. por esta razón. 2001.Familia/Género/Especie α-Proteobacteria-Orden Rhizobiales Referencia Rhizobiaceae Rhizobium R. gallicum R. Tabla 6. viceae R. forman nódulos en las raíces (y algunas veces en los tallos) de algunas especies de leguminosas y en las raíces de Parasponia spp. Familia. una taxa a nivel familia de bacterias creada expresamente para acomodar organismos que pueden formar nódulos en leguminosas. 1997 Amarger et al. (Ulmaceae).1 Filum/Orden. 2004 Rivas et al. 1984 Lindström. Género. galegae R. conocidas anteriormente como rizobios. Jordan.1). Chen et al. 1889. 1993 Amarger et al. 2001. 1998 Wang et al.TAXONOMÍA ACTUAL DE BFNFNL Las bacterias fijadoras de nitrógeno. etli R.. leguminosarum biovars phaseoli. Jourand et al. Methylobacterium Methylobacteriaceae y Dovosia Hyphomicrobiaceae) también pueden formar nódulos en leguminosas (Moulin et al.. aunque se continúa usando en alguna literatura. 1991 Segovia et al. huautlense R. Sy et al. Las citas referidas describen a las especies y/o comprueban su capacidad de nodulación. 2001.

tibeticum R. 2008 Ren et al. multihospitium R. xinjiangense E. vignae R. 2008 Ramirez-Bahena et al. 2011 Dangeard. miluonense R. 2009 Tian et al. de Lajudie et al. 2003 Quan et al. 2005 Valverde et al. Filum/Orden. indigoferae R. 2011 Zhang et al. 2002 Toledo et al. 2002 Wei et al. 1926. 1994. alkalisoli R. 1994 Chen et al. 2003 Scholla & Elkan. medicae E. saheli E. 2003 B acterias formadoras de nódulos en leguminosas 179 . 2006 Hunter et al. 1996 Nick et al. oryzae R. 2007 Gu et al.Tabla 6. selenireducens R. Chen et al. sullae R. kostiense E. kummerowiae E. yanglingense R. pisi R. 2002 Wei et al. 2009 Li et al. daejeonense R. arboris E. 2009 Lin et al. mesosinicum R. de Lajudie et al. teranga E. 2001 Squartini et al. tubonense Ensifer (Sinorhizobium) E. fabae R. americanum Referencia Tan et al. Jordan et al. alamii R. fredii E. morelense E. 1984. 2008 Peng et al. 2009 Hou et al. 1984. 1994 de Lajudie et al. 1994 Rome et al. 1999 Nick et al.Familia/ Género/Especie R.1 Continúa. lusitanum R. Chen et al. loessense R. 1988 de Lajudie et al. 2008 Han et al. 1988. 1988. 2002 Wang et al. meliloti E. Young. 2008 Berge et al. 1999 Wei et al.

Young et al. 1982. 2003 Lloret et al. denitrificans** Xanthobacteraceae Azorhizobium A. chiapanecum E. 2002. caulinodans A. van Berkun et al. jicamae B.Tabla 6. 1984 Kuykendall et al. 1991. numidicus Allorhizobium* A. 2009 Islam et al. Jarvis et al. Young. 1997 Manual de biología de suelos tropicales . kummerowieae Bradyrhizobiaceae Bradyrhizobium B. Jarvis et al.1 Continúa. 1984. (Rhizobium) undicola Agrobacterium* A (Rhizobium). adhaerens E. Jarvis et al. 2007 Rincon-Rosales et al. elkanii B. liaoningense B. pachyrhizi B. iriomotense Bradyrhizobium (Blastobacter) B. garamanticus E. 1982.adiobacter/ tumefasciens Shinella S. 2002 Vinuesa et al. 1992 Xu et al. 2008 Jordan. (2010) Merabet et al. 2006 Jordan et al. 2006** Dreyfus et al. doebereinerae Phyllobacteriaceae Mesorhizobium M. Filum/Orden. loti M. 1995 Yao et al.Familia/Género/ Especie E. 1988 Moreira et al. 2008 van Berkun & Eardly. 2009 Merabet et al. mexicanus E. 1997 Chen et al.canariense B. 2005a Ramírez-Bahena et al. Willems et al. 2003. japonicum B. 1998a. (2010) de Lajudie et al. 2001 Cummings et al. yuanmingense B. 2009 Ramírez-Bahena et al. 2009 Lin et al. huakuii 180 Referencia Casida.

ciceri Hyphomicrobiaceae Devosia D. 2009 Nandasena et al. Filum/Orden. 2008 Li et al. Jourand et al.1 Continúa.Tabla 6. tianshanense M. 1999b Velásquez et al. cytisi O. 2007 Imran et al. septentrionale M. 1997 De Lajudie et al. albiziae M. leguminum*** Methylobacteriaceae Methylobacterium M. 1995. neptuniea Referencia Nour et al. 2004 Wang et al. 2002.Familia/Género/ Especie M. caraganae M. 2005 Mantelin et al. gobiense M. 2007 Gu et al. 2006 Sy et al. 1998b Wang et al. amorphae M. 1997 Nour et al. 2004 Gao et al. 2008 Han et al. 2010 Valverde et al.alhagi Phyllobacterium P. opportunistum M. australicum M. 1997 Chen et al. chacoense M. 2009 Chen et al. 1995. metallidurans M. 2009 Vidal et al. 2003 B acterias formadoras de nódulos en leguminosas 181 . temperatum M. 2006 Mantelin et al. ciceri M. plurifarium M. 2009 Nandasena et al. shangrilense M. Jarvis et al. 2010 Rivas et al. 2001. 2004 Trujillo et al. nodulans Brucellaceae Ochrobactrum O. mediterraneum M. tarimense M. trifolii P. 2008 Han et al. 2005 Zurdo-Pineiro et al. lupini O. 1994. Jarvis et al. ifriqiyense*** P. 2001 Gao et al. Jarvis et al.

en su mayoría plantas tropicales leñosas). del trópico. 2008 Chen et al..1 Continúa. distribuidas en las subfamilias Caesalpinoideae (2250 spp.Tabla 6. Arubi y A. Mimosoideae (3270 spp.. 2004 Chen et al. 2006 Chen et al. (Ralstonia) taiwanensis ***** Referencia Bautista et al. phymatum B. Vandamme & Conye 2004 Notas: * Se propuso incluir a las especies Agrobacterium como A. 2002 Vandamme et al. A. 2004) y más tarde del género Cupriavidus (Vandamme y Conye. caribensis B.. larrimoorei (Young 2004) en Rhizobium.cepacia genomovar VI) B. 2005). yakushimensis β-Proteobacteria Orden Burkholderiales Burkolderiaceae Burkholderia **** B. 2010 Moulin et al. Vandamme et al.. adiobacter). pero descubrieron que pueden formar nódulos en leguminosas ***** El género Wautersia (Vaneechoutte et al. 2001 Vandamme et al. rhizogenes. Las leguminosas contienen alrededor de 20 mil especies. **** Estos autores no describieron el género. plantas leñosas. en su mayoría herbáceas) (Lewis et al. únicamente el 57% del género y el 20% de las espe182 Manual de biología de suelos tropicales . 2002 Vandamme et al. 2004) fueron propuestos para acomodar dichas especies de Ralstonia. 2007 Chen et al. subtrópico y zona templada) y Papilionoidae (13. sabie Cupriavidus (Ralstonia) C. 1999. mimosarum B. 2002 Achouak et al.800 spp. 2001) y A. tumetaciens (syn.Familia/Género/ Especie D. Vermis et al. tuberum B. 2002. Hasta 1989. Filum/Orden.. ** Estos autores no describieron estas especies. 2001. A. pero descubrieron que pueden formar nódulos en leguminosas y la propusieron para que se incluyera en el género Bradyrhizobium. dolosa (B. *** Fueron aislados de nódulos. El alcance de la simbiosis con BFNFNL entre leguminosas queda todavía sujeta a investigación. nodosa B. vitis y (Young et al. pero su capacidad de nodular no fue comprobada.

. como la que surge en el suelo. Aunque algunas plantas hospederas se consideran muy promiscuas. De esta manera. puede proveer información sobre la composición taxonómica de poblaciones de BFNFNL y determinar el grado de especificidad entre cepas específicas y candidatos hospederos. 2007).cies habían sido examinadas por la formación de nódulos y los porcentajes de las especies que sí podían formar nódulos se encontraron en porcentajes de 23. se requiere de un método que separe claramente BFNFNL de otras especies bacterianas y que permita un muestreo fácil y sistemático de los nódulos.. únicamente el 25% de las especies existentes han sido examinadas. Para poder aislar o enumerar BFNFNL en una población microbiana diversa. 1989. 90 y 97% entre Caesalpinoideae. de leguminosas hospederas.. El proceso de infección de la planta es el resultado de la formación de nódulos en sí. 2006) EVALUACIÓN DE DIVERSIDAD DE BFNFNL EN EL SUELO Los estudios sobre poblaciones y diversidad de BFNFNL dependen de un aislamiento exitoso de nódulos de raíces y ocasionalmente de tallos.1). 1982. y que han sido desarrolladas nuevas técnicas de genética molecular. 2004) y Mesorhizobium thiogangeticum (Ghosh et al. Odee et al. 1992. tradicionalmente. se estima que hoy en día. en 1984 (véase Tabla 6. respectivamente (Faria et al. aunque este método puede resultar difícil en el caso de hospederas perennes o leñosas (Moreira et al. ha ocurrido una revolución en la taxonomía con 90 especies y 10 géneros adicionadas a las 4 especies y a los 2 géneros originales enlistados por Jordan. El cultivo posterior y caracterización de BFNFNL y de los nódulos. la taxonomía del BFNFNL estaba basada en cepas aisladas de cultivos de zonas templadas. Moreira et al. por ejemplo. Mimosoideae y Papilionoidae. en selvas tropicales). 1989)... Tres especies de los géneros descritos de BFNFNL no fueron incluidas en la tabla porque no fueron aisladas de nódulos ni la capacidad de nodulación se comprobó hasta el momento: Rhizobium cellulosilyticum (García-Fraile et al.. ahora que se encuentran disponibles las que han sido aisladas de otras especies y regiones. para poder estimar la población de BFNFNL en el suelo. los nódulos pueden muestrearse en plantas cultivadas en el campo (colecciones in situ). especialmente en Brasil (Magalhães et al. 1992). Bradyrhizobium betae (Rivas et al. Faria et al. 1995). en ecosistemas naturales (por ejemplo. y se esperan más revisiones en un futuro. es posible que nuevas simbiosis se identifiquen en el futuro. Aunque se han llevado a cabo búsquedas extensivas para nuevos géneros y especies formadoras de nódulos... Sin embargo. muestran una B acterias formadoras de nódulos en leguminosas 183 ..

entre otros sustratos. siratro (Macroptilium atropurpureum) atrapa BFNFNL en los 98 puntos de muestreo del proyecto CSM-BGBD (Lima et al. atropurpureum fue nodulado. de crecimiento lento. punto de referencia CSM-BGBD.. de hecho. atropurpureum y que el frijol Phaseolus vulgaris. no existe ninguna cepa de BFNFNL que sea lo suficientemente promiscua como para nodular a todas las especies leguminosas. 2007) y Burkholderia. indican que M. 2009).. se reporta que suele estar nodulado por la especie Bradyrhizobium (Woomer et al. Resultados obtenidos en Brasil (Alto río Solimões) muestran que caupí (Vigna unguiculata) captura más especies que M. en Kenia.. También reduce. representa una comprobación útil de la exactitud del procedimiento en el laboratorio. aisladas e identificadas. La nitrogenasa es la enzima responsable de la reducción del gas nitrógeno a amoniaco. 1966. 2006 y 2008. tiene una especificidad muy baja y puede ser nodulada por Rhizobium spp.. Pereira.. 2002. es deseable hacer uso de una variedad de especies de plantas hospederas candidatas y cuantas más sean empleadas. 1988a). la comparación de BFNFNL. Lima et al. 184 Manual de biología de suelos tropicales . más variedad resultará de cepas de BFNFNL. 2000). debería incluirse una especie leguminosa nativa como trampa hospedera. de rápido crecimiento. Lewin et al. normalmente considerada como hospedero de Badyrhizobium.. De manera similar. 1970). Lima. con los que se muestrea con el bioensayo. 1987 demostraron que Vigna unguiculata. Para poder evaluar la diversidad de BFNFNL en el suelo. se recomienda llevar a cabo experimentos preliminares para cada tipo de suelo. Por lo anterior. 2009).. donde sea posible.baja especificidad. de manera natural. únicamente. ningún hospedero promiscuo puede ser nodulado por todas las especies o cepas existentes de BFNFNL y. también cabe la posibilidad de que sea nodulado por especies de rápido crecimiento como Rhizobium (Pereira. en la mayoría de los casos. 1997. de manera contraria. Moreira. cultivados en muestras de suelo tomadas del campo o inoculadas con suspensiones del suelo (Moreira et al. 1993. entre otras (Moreira et al. pero. y... por ejemplo: Macroptilium atropurpureum es uno de los hospederos ampliamente conocido (Vicent. Las especies encontradas posteriormente deberían compararse con las especies que forman nódulos en el lugar. acetileno a etileno (Dilworth. aisladas de nódulos formados de manera natural. por Bradyrhizobium spp. 2000. Resultados preliminares de Taita. Aunque algunas de las asociaciones mencionadas pueden ser relativamente específicas. El bioensayo para BFNFNL puede hacer uso de hospederos promiscuos. Antes de escoger las plantas hospederas para realizar un bioensayo. Odee et al. en la mayoría de los casos.

METODOLOGÍA APLICADA EN EL PROYECTO CSM-BGBD: UNA REVISIÓN GENERAL Los pasos utilizados en la metodología para la caracterización de BFNFNL. Una descripción previa fue hecha por Moreira en 2004. con esto se B acterias formadoras de nódulos en leguminosas 185 . La actividad de la nitrogenasa constituye una información invaluable porque en muchos casos es imposible verificar que los nódulos aún son efectivos y viables (color interior rojo). Giller. ya que posee pequeñas semillas y resulta fácil de manipular bajo condiciones controladas en bolsas de plástico y jarras de Leonard. resulta idóneo Macroptilium atropurpureum (siratro). Por ejemplo. dado que la anatomía de los nódulos varía ampliamente en forma y en tamaño. Los nódulos sin actividad de la nitrogenasa pueden estar senescentes o ser inefectivos. es que destaca por su gran sensibilidad y velocidad. el personal que no posee la suficiente experiencia podrá confundirlos con estructuras no inducidas por BFNFNL. El ensayo también puede usarse para confirmar una nueva simbiosis de BFNFNL o en el caso de nódulos no usuales (Moreira et al.1. 1987. Esta reacción se utiliza como técnica para medir la actividad de la nitrogenasa. Bajo estas circunstancias. como trampas para aislar las BFNFNL de las muestras del suelo. con una solución nutritiva. resulta muy útil para la detección simple de fijadores de nitrógeno. Cuando se llevan a cabo varios experimentos. dentro de cámaras de crecimiento o invernadero. Paso 1A: recoger muestras de suelo del campo. Paso 2A: para el proyecto se utiliza el método convencional de uso de especies promiscuas. 1992).. aplicados en el proyecto CSM-BGBD. puesto que deben quedarse intactos para su aislamiento posterior o secarse cuando requieran ser almacenados durante un largo periodo. es barato y fácil de realizar aun en condiciones de campo. el uso de especies múltiples no es viable con un gran número de puntos de referencia (por ejemplo 100).Schollhorn Burris. dado lo afanoso del procedimiento. y estará limitado por el tiempo disponible y las facilidades que ofrezca el laboratorio. Es por ello que se emplea una única especie promiscua como trampa. sin embargo. 1987). cuyos seis pasos a seguir se muestran en la ilustración 3a hasta la 3f. la gran ventaja de un ensayo de reducción de acetileno (ERA). tal y como se describe a continuación. Aunque el uso de ERA para obtener estimaciones cuantitativas de fijación de nitrógeno a la nutrición de la planta ha sido ampliamente discutido (Boddey. deben utilizarse semillas de la misma procedencia. 1966). se encuentran resumidos en la Figura 6.

Caracterización de aislados verificados. Bioensayos con aislados: verificación (postulados de Koch) y propiedades simbióticas (número de nódulos y peso seco de materia). 2A. Caupí (opcional) 3. ** Algunos nódulos pueden guardarse en gel de sílice para su aislamiento. Aislamiento de NLB de nódulos ** en YMA/79 con azul de bromotimol (Ilustración 3. Nota: 1A. Especies nativas (opcional) Bolsas de plástico (Ilustración 3. basados en una 186 Manual de biología de suelos tropicales . c) 2 B. Jarra de Leonard. * Puede usarse para conteo NMP (opcional). resumida en seis pasos. b). en caso necesario. tamizar según características de cultivo y REP-PCR o perfiles de proteína (Ilustración 3. secuencia del gen (16S rRNA para todos los géneros. Eficiencia de poblaciones nativas: número de nódulos. utilizando la técnica de infección de planta. Capítulo 2). (Ilustración 3.Figura 6. fijadoras de nitrógeno en diversos sistemas de uso de suelo. Claves de identificación de plantas. 6. 2A. Dos controles sin inoculación (con o sin mineral N) más un control con un tipo eficiente (Ilustración 3. Doce muestras en cada punto de muestreo (véase esquema global CSM-BDBG. f (ii). a). más un control de una cepa conocida. tales como dnaK. peso seco de materia aérea de planta. representativos de grupos previos. con la muestra de suelo. La eficiencia de poblaciones nativas es evaluada con la floración. Frijol (opcional) 4. capturadas con suspensiones de suelo 1:1. Caracterización de cultivos (son necesarios los experimentos preliminares con suelo de selvas y cultivos de leguminosas para determinar el número de aislamientos requeridos para caracterizar las comunidades de simbiontes en su conjunto. peso de materia seca y peso seco de planta (contenido N). solución de nutriente de suelo o NaCl a 0. Ensayo de reducción con acetileno (opcional) 3 B. 3A. 1A.1 Evaluación de bacterias formadoras de nódulos en leguminosas. agar inclinado (Ilustración 3. especialmente para Bradyrhizobium). Nódulos de especies de plantas locales 5. Almacenaje en frascos con gel de sílice o CaCl2 4. Origen del hospedero. 12 muestras compuestas de suelo por punto. dos controles sin inoculación (con o sin mineral N). índices de diversidad. cuando se aprecian diferencias significativas entre tratamientos 4. Captura de BFN. d) caracterización de cultivo 3 A.55% 1. otros genes. Siratro* 2. colectadas bajo condiciones asépticas Área de referencia /Uso del suelo/ Puntos de muestreo 1B. eficiente. contenido de N por planta (opcional). 2e) 1C. capturando BFN: técnica de infección de planta: inoculación de especies promiscuas.

éste no es obligatorio. deberán corregirse para los ensayos. Se selecciona Phaseolus vulgaris con base en que en varios países existen datos. por supuesto. Bradyrhizobium. pueden cultivarse especiestrampas en bolsas de plástico. Las semillas que se encuentren disponibles en la localidad proveerán información útil para agricultores del lugar. Cuando un equipo puede manejar más de una trampa de especies. aunque también se puede aplicar a otros géneros). caupí y frijol) se pueden seleccionar otras. jarras de Leonard o en macetas que contengan las muestras de suelo. incluyendo algunas especies nativas que. Los suelos con un alto contenido de N deberán evitarse. Después de las tres especies mencionadas (siratro. acidez y un alto contenido de Al. ni forma parte de la metodología estándar. basados en características de cultivo (si este es el caso) y/u otro método deben ser secuenciados para 16SrRNA y otros genes como dnaK (por ejemplo. Incluye características de cultivos obtenidos en el paso número 4. Las especies-trampas pueden usarse para capturar y contar BFNFNL o simplemente para capturarlas. Las muestras de suelo en macetas pueden usarse únicamente cuando haya disponibilidad en los laboratorios y se deben seguir todas las técnicas asépticas normales de la microbiología. Representantes de racimos. debido a diferentes relaciones simbióticas (diferentes especies de plantas) y condiciones ambientales. B acterias formadoras de nódulos en leguminosas 187 . sobre poblaciones de BFNFNL donde se utiliza el frijol común como especie-trampa. otros factores limitantes como deficiencias de macro y micronutrientes. para trampas promiscuas adicionales se recomienda usar Vigna unguiculata (como segunda especie) y Phaseolus vulgaris (frijol) como tercera especie. en el tamizado de la colección entera de aislamientos (para conseguir racimos) y elementos repetitivos extragénicos palindrómicos/secuencias de DNA (REP-PCR) (u otros métodos como perfiles de proteínas por electroforesis con SDS-PAFE/poliacrilamida gel puede ser complementario).evita cualquier variación de NFNLB debida a las plantas. incluso puede indi- curva de extinción de especies). es fácil de medir y proporciona información útil sobre la variabilidad y eficiencia de las poblaciones nativas. esto puede servir como un punto de referencia. aún dispersos. pueden ser diferentes en cada país. Paso 3 A: aunque la eficiencia bajo condiciones controladas no refleja lo que está pasando in situ. aunque sería imposible estandarizar esta selección. Dada la complejidad del primer ejercicio. Las dos especies fueron escogidas por ser bastante promiscuas y porque se cultivan en muchos países. Para poder capturar BFNFNL. El criterio para la selección debe basarse en que la especie-trampa sea ecológica y económicamente relevante para el país. las cuales se describen a continuación.

2001). por ejemplo. y quizá más de 100 por uso del suelo (Jesús et al.. junto con los de nódulos recogidos de plantas nativas que naturalmente forman nódulos. los nódulos deberán muestrearse a partir de plantas que nodulen y representen niveles secuenciales de diluciones (Moreira y Pereira.. en los diferentes sistemas de uso de suelo. lo que permite la construcción de curvas de muestreo para evaluar si la diversidad en un lugar ya ha sido completamente caracterizada. 2001) porque los tipos de BFNFNL capturadas pueden variar también con la dilución (Bala et al. con una inoculación de suspensiones de suelo. en condiciones de laboratorio (Bala et al. de esta forma estarán disponibles para futuros aislamientos. Una comparación de BFNFNL aisladas de nódulos del campo y de nódulos introducidos en una especie-trampa. 2001). se necesitan entre 30 y 50 nódulos. por lo menos. En la literatura se ha discutido que. en caso de no alcanzarlo.2). Se necesitará aplicar las curvas de muestreo a todos los aislados. y los de plantas. 188 Manual de biología de suelos tropicales . Se sabe que la diversidad genética en poblaciones naturales de las NFNLB del mismo lugar puede presentar diferencias entre los aislados de nódulos. tal y como se explicó anteriormente. deben ser inventariadas para que las relaciones con poblaciones naturales de BFNFNL puedan determinarse. Paso 4: después de la aparición y crecimiento de nódulos. los aislados de estos nódulos. las BFNFNL deben ser aisladas. esto indica que no se han detectado todas las especies y que muestras adicionales (aisladas de nódulos) deberán ser analizadas. de ocho metros de radio alrededor de cada punto de muestreo. hará posible la mejor evaluación de diversidad y de eficiencia de la especie-trampa. cultivadas en una serie de diluciones de suelo. Paso 1B/2B. Paso 1C: las especies de leguminosas en un área específica. a los del bioensayo y a los nódulos colectados en campo.. Las curvas de muestreo (acumulación o escasez) pueden revelar el número de aislados requeridos para evaluar correctamente la diversidad. Considerando que estas curvas se obtienen con base en el número de diferentes cultivos que todavía pueden mostrar características genéticas variables. se necesitarán más aislamientos para obtener una buena resolución. formados en el campo. para una especie hospedera en particular. Cuando se usa la técnica de infección por planta. 3B: se recomienda también que las BFNFNL sean aisladas de especies leguminosas (nativas e introducidas) que nodulan naturalmente. proporcionarán los datos de la diversidad. es decir.car la existencia de cepas eficientes en las poblaciones del suelo. pertenecientes a los diferentes sistemas de uso de suelo en cuestión. Los nódulos se almacenan en sílica gel (Figura 6. Este número se encuentra en el punto (asíntota) donde la curva alcanza su mayor nivel. 2005).

El aislamiento de BFNFNL de nódulos deberá hacerse en el medio 79 con azul de bromotimol (Fred y Waksman, 1928). El medio 79 se conoce también como YMA (Vincent, 1970) (anexo 6.1); esto permite la caracterización completa del cultivo (tasa de crecimiento, cambio de pH, producción de exo-polisacáridos, morfología de colonia, color, tamaño, etc.). Para obtener grupos a partir de estas características de cultivo. La diversidad genética de poblaciones de BFNFNL puede evaluarse al agrupar los perfiles que resultan de rep-PCR, utilizando un software como Gelcompar (Brujin et al., 1997) o mediante el uso de otra técnica: perfiles de proteínas por electroforesis con gel de SDS-Poliacrilamida; que dan una buena resolución a nivel cepa (Paso 6); sin embargo, esto puede ser opcional, de acuerdo con los recursos disponibles en cada país y debe llevarse a cabo después del paso 5 para evitar perder el tiempo con contaminantes. Finalmente, los representantes de cultivos de los clados generados mediante el agrupamiento por Rep-PCR u obtenidos mediante otros métodos se secuenciarán para obtener el gen 16SrRNA (Paso 6). Cuando existen recursos suficientes, dnaK u otros genes involucrados en el mantenimiento de la bacteria, tales como atpD, rpoB, recA, glnII (Parker, 2004; Vinuesa et al., 2005b; Gaunt et al., 2001), pueden ser probados para algunas cepas de género que no hayan sido bien discriminadas por 16 SrRNA, como en el caso de Bradyrhizobium.
Figura 6.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. Fuente: Moreira y Pereira, 2001.
1 ml de C2H2 Muestra de gas Tapón de goma (a) Vial (10 ml) 30 minutos a 1 hora Tapón de goma Tubo al vacío

Nódulo Nódulo efectivo Nase C2H2+2H++2e 2C2H4 Tubo de ensayo 8.5 ml (b)

Tapón de rosca Tapón de rosca, nódulo, algodón y sílica gel o CaCl2

B acterias

formadoras de nódulos en leguminosas

189

REQUERIMIENTO DE MATERIALES PARA TRABAJO DE CAMPO Y LABORATORIO Trabajo de campo: para muestrear suelo: alcohol al 95%, agua para eliminar el suelo del equipo de muestreo antes de la esterilización con alcohol, caja refrigeradora, bolsas de plástico esterilizadas (300 ml), espátula, bolsas grandes de plástico (5 l) y un pequeño sacabocados. Para muestrear nódulos: tijera pequeña, cuchara, azada y azadón, pinzas, pala, tubos de tapón de rosca, sílica gel o CaCl2 anhidro. Para resguardo de plantas: alcohol, prensa y periódico. Trabajo de laboratorio para aislar y enumerar BFNFNL: pipetas de 1 ml y 5 ml, solución para dilución, matraces Erlenmeyer de 1 L y 125 ml, agitador orbital, bolsas esterilizadas de plástico (125 ml) para crecimiento, tubos de ensayo (150 x 20 ml ó 200 x 30 mm), o botellas de cerveza recicladas, rejillas para bolsas de crecimiento o tubos, solución de nutrientes, semillas de plantas leguminosas hospederas promiscuas o nativas, temperatura ambiente controlada de luz y humedad. Trabajo de laboratorio para aislamiento de BFNFNL y caracterización de cultivos: cajas Petri, alcohol al 95%, HgCl2 al 0.1% (acidificado con HCl concentrado a 5ml/L) (Hipoclorito de Na o Ca; puede usarse H2O2 para sustituir al HgCl2), agua esterilizada, pinzas, medio de cultivo que contiene levaduras, manitol y sales minerales (hipoclorito de sodio o calcio, o H2O2 (pueden sustituir al HgCl2), agua esterilizada, pinzas, medio de agar con sales, levadura-manitol-mineral, pH6.8. Para la actividad de nitrogenasa mediante reducción de acetileno: matraces Kitasato Erlenmeyer, globo de hule, jeringas de 1 ml a prueba de gas, tubos de vacío de 5 ml, frascos de 10 ml o de mayor capacidad con tapones de goma, carburo de calcio CaC2, cromatógrafo de gases equipado con un detector de ionización de flama (FID) y columna RN Poropak para determinaciones de acetileno/etileno. Nota: los ensayos de nitrogenasa pueden llevarse a cabo en campo. MÉTODOS DETALLADOS Muestreo del suelo. Se saca una muestra de suelo a una profundidad de 20 cm, en 12 puntos, distribuidos alrededor de cada parcela de muestreo (véase Capítulo 2, Figura 2.3). Se utiliza el mismo esquema de extracción del núcleo para el muestreo en todos los grupos microbianos, incluyendo el BFNFNL. Se junta cada juego de 12 muestras, para formar una muestra compuesta de alrededor de 300 g que, posteriormente, se introduce en una bolsa plástica esterilizada. De manera alter190
Manual de biología de suelos tropicales

nativa, cuando lo permitan los recursos, se pueden obtener tres o más muestras compuestas en cada punto. Todas las herramientas: sacabocados, espátulas, azadón, etc. deberán lavarse muy bien con agua para remover partículas de suelo y ser esterilizadas mediante alcohol y flama antes y después de cada muestreo, con el fin de evitar la introducción de BFNFNL exóticas. Se deben minimizar las pisadas cerca de los puntos de extracción y la hojarasca deberá ser removida justo antes de que se lleve a cabo el muestreo. Las muestras de suelo se trasladan al laboratorio lo antes posible, utilizando un envase con aislamiento (preferiblemente debe permanecer a 4° C). Una segunda muestra compuesta de alrededor de 200 g será recogida en una bolsa de plástico no estéril para su análisis físico-químico. Muestreo de nódulos. Se deberán identificar plantas leguminosas dentro de un radio de 8 m (lo mismo que para un inventario de vegetación) en el punto de muestreo y se recogerá el material vegetal resultante. Será de gran ayuda contar con información previa acerca de cuáles son las especies que pueden nodular, de manera que se confine el muestreo a estas especies en concreto; sin embargo, hay que aclarar que existe un enorme potencial para el descubrimiento de nuevas especies de leguminosas de este tipo. En el caso de plantas herbáceas, se puede extraer todo el sistema de raíces del suelo, utilizando una azada, un azadón o una pala, cuidando no romper nódulos de manera accidental. Los nódulos de plantas leñosas deberán descubrirse extrayendo las raíces y poniendo gran atención para no dañar las ramificaciones delgadas en donde éstos normalmente se encuentran. Se debe verificar, con extremo cuidado, que las raíces delgadas pertenezcan a la planta leguminosa identificada; por este motivo, se recomienda empezar la excavación junto al tallo; se extirpan los nódulos (dejando un pedazo de raíz para facilitar la manipulación) y se guardan en tubos de tapón de rosca con un desecador (Figura 6.2b). Antes del almacenaje, las partículas de suelo deberán removerse, bien por sacudido o bien mediante lavado, retirando el exceso de agua con una servilleta. Por lo menos se recogerán 50 nódulos por cada punto de muestreo y la muestra será representativa de todas las especies nodulantes existentes en la parcela de muestreo. En ocasiones, algunos nódulos pueden ser demasiado grandes para los tubos normales de rosca: deberán ser almacenados en un recipiente de mayor capacidad. Actividad nitrogenasa. La actividad de nitrogenasa puede medirse en el campo o a partir de cada nódulo, justo después del muestreo o en el laboratorio (Figura 6.2). Se introduce el nódulo en un frasco de tapa de goma de 10 ml o de mayor capacidad, en caso necesario. Se produce acetileno en un matraz Kitasato Erlenmeyer
B acterias
formadoras de nódulos en leguminosas

191

por la reacción de CaC2 con agua (Figura 6.3). Si se lleva a cabo el trabajo en laboratorio, se obtiene acetileno de cilindros de gas comerciales. Se inyecta 1 ml de este gas en el frasco que contiene el nódulo. Después de una hora aproximadamente, se remueve 1 ml de gas de la superficie y se transfiere a un tubo al vacío para su posterior análisis de etileno por cromatografía de gases (Figura 6.2a). Especímenes de resguardos de plantas. Los especímenes de resguardos de plantas nodulantes, deberán recogerse en el área que se encuentra alrededor del punto de muestreo (radio de 8 m). Se debe poner especial atención en el etiquetado (véase a continuación) y si es posible, incluya flores y frutas. Enseguida, los especímenes se mandan al herbario para su identificación junto con una tarjeta de identificación de las mismas: Proyecto: CSM-BGBD Colector: Fátima Moreira Fecha: 2 de abril de 2005 Localidad: Benjamin Constant Altitud: 500 m Nombre vulgar de la especie: faveira Nombre científico de la especie: ¿? Número de vale: 05 Características del nódulo: crecimiento medio, tamaño 0.5 a 1.5 cm Descripción del lugar: pastizales abiertos con ganado y troncos de madera Tipo de suelo: limo arenoso
Figura 6.3 Producción de acetileno en campo o laboratorio.
Agua Globo de hule CaH2

Tubo de goma

CaC2

CaC2 + H2O ⇒ C2H2 + Ca (OH)2 Sólido Gas Sólido

192

Manual de biología de suelos tropicales

Características de la planta: herbácea con frutos maduros Otros comentarios: se recogieron semillas; flores amarillas. El conteo de BFNFNL. Se someten muestras de suelo a una serie de diluciones antes de la inoculación de las plantas hospederas candidatas (Figura 6.4). La correlación de diluciones varía entre 2.0 (1:2) y 14.5 (1:14.5), según la concentración de células esperada en la muestra. Esto significa una mayor dilución para suelos con más BFNFNL; sin embargo, aún es necesario inocular plantas hospederas en todas sus diluciones (véase a continuación). Asimismo, en cada dilución se debe emplear una réplica del bioensayo (2 a 5 veces). Las plantas se cultivan en condiciones controladas (Vicent, 1970) y después de 15 días, se les examina para ver si han formado nódulos. Las poblaciones de BFNFNL se estiman por el método del Número más Probable (Cochran 1950; Woomer et al., 1988b, 1999). En el caso de inocular las plantas únicamente para capturar las BFNFNL, las muestras de suelo deberán resuspenderse en agua esterilizada o en una solución de nutrientes (la misma que se utiliza para un medio de cultivo o crecimiento de plantas) (véase anexo 6.1 y 6.2) en una correspondencia 1:1. Las plantas pueden cultivarse en bolsas de plástico, jarras de Leonard u otro tipo de frasco. Se deben utilizar tres tipos de controles sin inoculante de suelo: el primero comprueba la presencia de contaminación durante los procedimientos experimentales. Si no se mantienen de manera correcta las condiciones axénicas, este control resultará en nódulos y el experimento se invalidará (aún cuando nódulos ocurren en una sola réplica). Se recomienda que el número de réplicas dentro de este control sea mayor que las réplicas de tratamientos de inoculación y el control debe localizarse dentro de diferentes posiciones en el protocolo. Los otros dos controles permitirán comprobar la eficiencia de las comunidades de BFN. Las comunidades que nodulan la planta hospedera indican si las condiciones del experimento (temperatura, concentraciones de nutrientes) son adecuadas para que se lleven a cabo la nodulación y la fijación de nitrógeno en las plantas y su crecimiento. El primero de los controles se complementa con nitrógeno mineral (para jarras de Leonard, 70 mg N-NH4NO3) cada semana desde la tercera hasta la penúltima, pero no se inocula. Para bolsas de plástico o recipientes de pequeños volúmenes, se utiliza una sola aplicación de 70 mg N-NH4NO3). De esta manera el caupí, que alcanza su nivel de floración en dos meses, con el uso de jarras de Leonard recibirán un total de 350 mg N-NH4NO3, mientras que los frijoles con un periodo de crecimiento de mes y medio, en jarras de Leonard, recibirán 280 mg de N-NH4NO3. El otro control se inoculará con un inoculante recomendado para esta
B acterias
formadoras de nódulos en leguminosas

193

especie de planta; por ejemplo, CIAT 899 para Phaseolus vulgaris en Brasil, pero no se añade nitrógeno. Aislamiento y caracterización de BFNFNL. Las BFNFNL son aisladas de los nódulos recogidos en campo y por bioensayo en el laboratorio. En el último caso, los nódulos obtenidos en cada dilución sucesiva pueden indicar cuáles son las cepas menos frecuentes en la muestra de suelo y cuáles, las más comunes. El primer paso será esterilizar la superficie de los nódulos con una breve inmersión en 95% de alcohol, seguida de una inmersión más larga de tres a cuatro minutos en HgCl2 (hipoclorito de Na o Ca, o H2O2 pueden usarse como sustitutos) y lavado mediante varios enjuagues con agua estéril (Vicent, 1970). A continuación se aplasta el nódulo dentro de unas gotas de agua estéril, utilizando pinzas y esto se vierte sobre un medio de agar. En el caso de los nódulos disecados, éstos deben remojarse en una solución de agua esterilizada para mejorar la absorción de la solución desinfectante. Los tiempos de inmersión en HgCl2 u otros desinfectantes, deberían ajustarse al tamaño del nódulo (más corto para nódulos pequeños). En la composición del medio de agar: levadura-manitol-sales minerales (Fred y Waksman, 1928) (Anexo 6.1), especialmente el pH y la fuente de carbohidrato pueden variarse, tomando en cuenta las condiciones específicas del suelo (Date y Halliday, 1979; Souza et al., 1984; Elkan y Bunn, 1991). Puede incluirse azul de bromotimol como indicador porque los cambios en el pH, causados por la formación de BFNFNL, pueden resultar útiles en la identificación de género. Otros caracteres incluyen: la tasa de crecimiento (tiempo TAIC de aparición de colonias aisladas), la cantidad de polisacáridos celulares, forma y tamaño de colonia, diámetro y color según lo descrito por Moreira et al. (1993) y Jesús et al. (2005). Los principales descriptores de cada género son: Allorhizobium, Rhizobium y Sinorhizobium: colonias circulares, de 2 a 4 mm de diámetro, normalmente unidas debido a la copiosa producción de polisacáridos extracelulares, convexas, semitraslúcidas, elevadas y mucilaginosas, la mayoría con el centro de color amarillo (debido al indicador de pH), de crecimiento rápido (TAIC: de 2 a 3 días). Mesorhizobium: igual que Rhizobium, pero normalmente de crecimiento más lento (TAIC: de 4 a 5 días). Bradyhizobium: colonias circulares que no exceden de un milímetro de diámetro, producción extracelular de polisacáridos de abundante a escasa (esto último, generalmente en el caso de los tipos que toman más de diez días para su crecimiento), opacas, raramente traslúcidas, blancas y convexas, granulares en textura y que producen un cambio de pH a alcalino, de crecimiento lento o muy lento (TAIC: de 6 a más días).
194
Manual de biología de suelos tropicales

Figura 6.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.

Paso de dilución

Nivel de dilución

El porcentaje base de la dilución (Nd) puede variar de 1:2 hasta 1:14.5 y el numero de replicas por dilución (N) de 2 a 5. Fuente: adaptado de Woomer, 1993 y Vincent, 1970 por Moreira y Pereira, 2001.
B acterias
formadoras de nódulos en leguminosas

195

de acuerdo con los postulados de Koch. secuencia de la subunidad pequeña del RNA ribosomal (Young y Haukka. resistencia intrínseca a los antibióticos (RIA) (Kingsley y Bohlool. producen un cambio de pH a alcalino. Moreira et al.5 mm de diámetro. 1989).Azorhizobium: colonias circulares. Cupriavidus: similar a Azorhizobium. lo que puede ser muy útil para numerosos estudios. 1996).. de color cremoso. dentro de la especie puede ser genéticamente y fenotípicamente alta. de 0. hibridación rRNA-DNA y polimorfismos en los tamaños de fragmentos de restricción del DNA. donde incluyeron serología (Dudman y Belbin. será necesario definir el nivel apropiado de diversidad que permita caracterizar géneros y especies específicos. con la excepción de modificación de pH porque pueden producir una reacción ácida o alcalina (dependiendo de la edad)... La diversidad de cepas. crecimiento en diferentes fuentes de carbono (Dreyfus et al. con un poco más de producción extracelular de polisacáridos. a veces. mediante una demostración en la que formen nuevos nódulos en una planta hospedera de prueba.. Las cepas aisladas deben reconfirmarse como BFNFNL.. al mismo tiempo. perfiles de plásmidos (Giller et al. 1988).. contienen gránulos refráctiles de poly-β-hidroxibutirato en microscopio de contraste de fases. hibridación DNA:DNA. 1988. 1983).1 se pueden observar referencias que ofrecen amplios detalles de las características de especies de NFNLB. 1988). generalmente. muy poca producción extracelular de polisacáridos (mucho menos que en el caso de Bradyhizobium).. por ejemplo. se han descrito nuevas técnicas para la caracterización de los procariotes. Las BFNFNL son bastoncillos Gram negativos que no forman esporas y que. morfológicas y fisiológicas. 1993). en sus características simbióticas. Recientemente. En la Tabla 6. sino también la capacidad de discriminación dentro de diferentes taxas: cada una tiene un nivel específico de resolución para la clasificación bacteriana. 1986). también conocidas como huellas 196 Manual de biología de suelos tropicales . lipopolisacáridos celulares (De Maagd et al. Burkholderia: con características de crecimiento muy similares a las de crecimiento rápido. patrones totales de proteína por SDS-PAGE (Dreyfus et al. Graham et al. 1988). (1991) aportaron estándares mínimos para la descripción de nuevos géneros y especies. lo que mejora no sólo la clasificación bacteriana. por lo tanto. electroforesis de enzimas metabólicas (Selander et al. bajo condiciones bacteriológicas controladas. composición de bases de DNA (%C + G). Estas técnicas. de crecimiento rápido a medio (TAIC: de 3 a 4 días). por ejemplo Rhizobium.

en algunos casos. la secuenciación directa de 16S rARN u otros genes puede ofrecer ventajas económicas. dependiendo de la tasa de crecimiento específica para cada cepa (de 2 a 10 días).genómicas. RAPD (DNA polimórfico amplificado al azar): AP-PCR (PCR Con Arimers Arbitrarios). Los costos de la secuenciación de DNA se han reducido notablemente durante los últimos años y. se restringe únicamente a representantes de grupos. Los análisis numéricos con un número adecuado de cepas y la comparación con las cepas de BFNFNL permiten la caracterización de grandes poblaciones. tRNA-PCR o ITS (Amplificación y Análisis del tRNA y de Regiones Intergénicas del 16S-23S rRNA). Alternativamente. la secuenciación de genes específicos puede aplicarse directamente a un número de cepas determinado por las curvas de rarefacción o acumulación. deben tomarse en cuenta. homología DNA:DNA) requiere de mucho tiempo y de equipo especializado y. El número total de placas de 96 muestras cuesta alrededor de US $350 para la secuenciación.) (Rademaker y Bruijn. Empresas privadas dan buenos servicios para productos PCR y su purificación y secuenciación. Extracción de DNA: el DNA genómico es aislado de cultivos de fases log en 79/YMA durante diferentes periodos de incubación. puede costar alrededor de US $6. Los métodos basados en la reacción de Polimerasa en Cadena (PCR). 23S rARN u otras secuencias de genes. la purificación y secuenciación de un fragmento de genes (una muestra) ya amplificada por PCR. La caracterización genética de DNA (secuencia del 16S. Se pueden utilizar el kit “Ultraclean” para el aislamiento de DNA de suelo de los laboratorios MOBIO o cualquier otro kit recomendado por el productor. tales como ARDRA (Análisis de Restricción del rDNA Amplificado). 1997. por otro lado. Se cuantifica el DNA a A260 nm con un espectrofotómetro o se estima por comparación con diferentes estándares de concentraciones de DNA en geles de agarosa. si existe disponibilidad de recursos. REP-PCR (Huellas Genómicas de Elementos Genómicos Repetidos de DNA. si se piden las placas completas de 96 muestras. Bruijn et al.. Los costos y beneficios de una caracterización previa y secuenciación de representantes versus una secuenciación directa de un número mayor de aislados. para cada tipo se suspende una azada con bacterias de una colonia aislada en 1 ml de agua B acterias formadoras de nódulos en leguminosas 197 . normalmente. Por ejemplo. 1997). incluyen: la digestión de DNA genómico con endonucleasas que cortan sitios (de restricción) poco frecuentes seguido por PFGE (Electroforesis en Gel en Campos Pulsados) y otros métodos de RFLP. en la actualidad. AFLP (Polimorfismo de Tamaño de Fragmentos Amplificados) para el análisis de todo el genoma.

El programa para PCR incluye un paso inicial: desnaturalizar a 94°C durante 5 minutos. tales como la del National Center for Biotechnology Information (NCBI) (www. 2. Sin embargo.msu. Un paso de secuenciación del PCR amplificado se obtiene con el primer 27F.ac. Estos pares de oligonucléotidos corresponden a posiciones 8-27 y 1507-1492. Cuando se requiere la secuencia de todo el gen se deben elegir otros primers internos y usarse para amplificar y secuenciar el fragmento del gen que falte después de utilizar 27F y 1492R.nlm. Otros oligonucleótidos pueden utilizarse si permiten la síntesis de un gen 16S rARN casi completo.. Se comparan las secuencias con otras conocidas contenidas en las bases de datos.nih.2 μm de cada oligonucleótido y dos unidades de la enzima Taq polimerasa (DNA extraído o cultivos líquidos): 6 μl.ebi. apareamiento a la temperatura de 55°C. similares a los presentados en la Figura 6. 1990). usando los aislamientos representativos de diferentes grupos (obtenidos bien por caracterización de cultivo. MANTENIMIENTO Y COLECCIÓN DE CULTIVOS PUROS Normalmente.esterilizada. la viabilidad de dichos cultivos no es larga: los métodos como liofilización y almacenaje en un congelador (–80°C) garantizan una larga conservación de las células viables. perfiles REP-PCR. los cultivos puros se mantienen en agar inclinado dentro de tubos de tapa rosca en el mismo medio de cultivo.ncbi.gov/). respectivamente. Secuenciación 16S rDNA. se utiliza un volumen de esta suspensión como templado para el PCR.uk) y el Ribossomal Database Project (RDP) (http://rdp. 0. durante 40 segundos. durante 7 minutos.jsp). Análisis filogenético. 0. lo que produce una suspensión ligeramente turbia que posteriormente se hierve durante cinco minutos para lisar las células.2. del gen 16S del RNA ribosomal de Escherichia coli (Wilson et al. por otras técnicas). con extensión a 72°C durante 90 segundos.2 mm de cada dNTP. Los genes casi completos del 16S rDNA se amplifican con un par de oligonucleótidos 27F (pA: 5`AGAGTTTGATCCTGGCTCAG) y 1492R (5´GGTTACCTTGTTACGACTT). La purificación de los productos PCR se hace con filtros Microcon™ (Millipore) o mediante otros métodos de purificación. el European Bioinformatics Institute (EBI) secuenciación de base de datos (www. La extensión final se lleva a cabo a 72°C. Las concentraciones finales en las mezclas de reacción (100 ml) son: 1 x PCR Buffer. o bien.edu/index.cme.5 mm MgCl2. 198 Manual de biología de suelos tropicales . seguido por 30 ciclos de desnaturalización a 94°C durante 40 segundos. pero también con el primer reverso 1492R.

International Journal of Systematic and Evolutionary Microbiology vol 49. Young. M. nov.787-749. M. M. S. Y. pp996–1006. J. Bontemps. Sprent. nov. J. W. Barakat.. (1975) Nitrogen Fixation in Bacteria and Higher Plants. Giller. y Yakta. (2010) ´Devosia yakushimensis sp. Heulin.. vol 47. vol 33. R. M.. isolated from root nodules of Mimosa caesalpiniifolia´ International Journal of Systematic and Evolutionary Microbiology vol 58.. nov.. W. N. V. . Bautista.. Chou. Christen. nov. Brandelet. nov. Critical Reviews in Plant Sciences. N. Murphy.. vol 16..... Santealla. S... E. pp209–266. (1997) ‘Rhizobium gallicum sp.. pp.. from Phaseolus vulgaris nodules’. W. M.. Cnockaert. Chou. Soil Biology and Biochemistry. J. E. y Vandamme..) Ohwi´ International Journal of Systematic and Evolutionary Microbiology vol 60. and Rhizobium giardinii sp.: A bacterial predator of bacteria in soil’. Chen. G. K. K. R. REFERENCIAS Achouak. J. A. I.. vol 32.G. New York. nov. (2009) ´Rhizobium alamii sp. pp627-632. James. Chen. M.. A. P. E. International Journal of Systematic Bacteriology... Lin. G. Casida Jr.. R. E. nov. Amarger. De Faria. Bala.. C.W y Vandamme.H. R. V. sp. isoled from root nodules of Pueraria lobata (Willd. G. G. y Hardy..V. W.. an exopolysaccharide-producing bacterium isolated from vertisol microaggregates in Martinique‘. Elliot. Monsalud. nov. (2001) ‘Genetic diversity of rhizobia varies from natural populations with the soil dilution sampled’.P. M. James.. Elliot. (1999) ‘Burkholderia caribensis sp. pp2174-2179. R. an exopolysaccharide-producing species isolated from legume and non-legume rhizospheres´ International Journal of Systematic and Evolutionary Microbiology vol 59. A. Y. Berge. pp339–345. (2007)´ Burkholderia nodosa sp. David Odee y Nancy Karanja. L. P.. K..pp367-372. Springer-Verlag. M. nov.. M. R.. Esperanza Martínez. (2008) ´Burkholderia sabiae sp. (1987) ‘Methods for quantification of nitrogen fixation associated with Graminae’. C.H. y Heulint. Boddey. pp841–843. De Faria. (1982) ‘Ensifer adhaerens gen. Lodhi. Sheu. J... T. K. S.. O. P. J. International Journal of Systematic Bacteriology. Christien. F. y Achouak. Roncato. W. N... Sprent.. I. C.AGRADECIMIENTOS Agradecimientos especiales por sus comentarios y revisiones a los Drs. Macheret. y Laguerre. Marlet. T.. Burns. B acterias formadoras de nódulos en leguminosas 199 .

Coenye. Chen. pp275–280. 6.. G. Li. K.. pp1847–1851. Vos. Moreira.. isolated from wild Alhagi sparsifolia in north-western China´. y Wang. Chen.isolated from root nodules of the woody Brazilian legumes Mimosa bimucronata and Mimosa scabrella´ International Journal of Systematic Bacteriology..... Gao. Barrios.. (2010) ´Mesorhizobium alhagi sp. vol 57. Y. (1997) ‘Rhizobium hainanense sp. International Journal of Systematic and Evolutionary Microbiology vol 60 pp958962. Cummings. pp105-116.. Tan. P. Chen. T.S. Cochran. W. Viniesa.P. isolated from nodules of Mimosa species and sputum of a cystic fibrosis patient’.. nov. Faria. S. Yan.’. J. Chen. isolated from tropical legumes’.. J. L. Mergeay.. W. S. Botaniste (Paris). (1988) ‘Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned to Sinorhizobium gen. Sprent. E. M.P. L. pp392–397. vol 41. E.. (1926) ‘Recherches sur les tubercles radicaux des légumineuses’. P. Chen. Elliot. W. X. Chen. (2006) ‘Burkholderia mimosarum sp. X. (2009) ´Nodulation of Sebania species by Rhizobium (Agrobacterium) strain IRBG74 and other rhizobia´Environmental Microbiology. S. D. H.. Gyaneshwar. Andrews. 200 Manual de biología de suelos tropicales . P. nov. vol.. W.M. Wang.. Coenye. J.. Young. Bontemps. W. Dangeard.. W. nov.. E. isolated from the root nodules of Astragalus sinicus’. Yuan. T. vol 45. F.. vol 47. Li.. vol 11. S. M. International Journal of Systematic and Evolutionary Microbiology. Qi. P. International Journal of Systematic Bacteriology. pp1729–1735. International Journal of Systematic and Evolutionary Microbiology vol 51.. X. from Taiwan and South America’. Y. M.. pp10551059. J. X. Wang. nov.. vol 56. Li. W.F. G.. L. vol 38. L. nov. nov. P. Y. M.. N.K. W..G. a moderately and slowly growing root nodule bacterium isolated from an arid saline environment in Xinjiang. James. E. Chou. International Journal of Systematic Bacteriology. A. Chen. y Vandamme. T. F.P. S. Wang. Humphry.. Z.. Laevens.. Zhu. Odee.. Y. T. M. I. G. Y. W. y Vandamme. Biometrics. D. E. X. T. J.W y Wei...M. E. y James. pp2510-2525. Young.. J.. y Li.. H. (1950) Estimation of bacterial densities by names of the “most probable number”. G. J. L..I..W. nov.. C. (1991) ‘Rhizobiumhuakuii sp. (1995) ‘Characteristics of Rhizobium tianshanense sp. Chen. y Li. S. J. People’s Republic of China’. M. y Li. Lee. Farruggia. International Journal of Systematic Bacteriology. (2001) ‘Ralstonia taiwanensis sp. Sprent. Shen. P. pp1–275.T. International Journal of Systematic Bacteriology. isolated from nodules of Mimosa spp. M. pp870–873. vol 16. pp153–159.

. M.. Schultz. pp1277–1290. Balows. B. that uses a qualitative coding of immunodiffusion reactions’. U. K. J. Kluwer Academic Publishers. a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata’. D. M. U. De Lajudie. vol 48. G. y Belbin.. G. Collins. vol 170. A. W. Schlegel and H. pp1825–1830. Applied and Environmental Microbiology. M.. Coopman. J. De Bruijn. J. Date. A.. Kersters. Neyra. Dreyfus.. R. B. Elkan (ed) Symbiotic Nitrogen Fixation Technology. R. Neyra. sp. Dreyfus. nov. y Stoltzfus. M.. vol 277. A.. vol 54. E. Dordrecht. vol 38.. Lindstrom. nov. A... vol 127. Berlin. Millcamps. W. Davey. nov. Willems. Dilworth. B. (1988) ‘Recognition of individual strains of fast-growing rhizobia by using profiles of membrane proteins and lipopolysaccharides’. Nick. (1987) ‘Collection.. nitrogenfixing bacteria that efficiently nodulate Neptunia natans in Senegal’. L. y Gillis. J.. Dewettinck. (1998a) ‘Allorhizobium undicola gen. International Journal of Systematic Bacteriology. The Prokaryotes.’.. (1997) ‘Molecular approaches in microbial ecology to assess genomic diversity and stress-induced gene expression in plantassociated diazotrophs’. L. Kersters.. Torck. C... Marcel Dekker Inc. (1998b) ‘Characterization of tropical tree rhizobia and description of Mesorhizobium plurifarium sp. Elmerich. cultivation and maintenance of rhizobia’ . M. (1988) ‘Characterization of Azorhizobium caulinodans gen. A. nov.. nov. 2nd Edition. M. Dreyfus. M. Journal of Bacteriology. Ragatz. nov. F.. pp285–294. Elkan. Collins. De Maagd. M. H.. y Halliday. A. Torck. (1994) ‘Polyphasic taxonomy of rhizobia: Emendation of the genus Sinorhizobium and description of Sinorhizobium meliloti com. D. G. Newton (eds) Biological Nitrogen Fixation for the 21st Century. G. B acterias formadoras de nódulos en leguminosas 201 . Willems. van Rossum. pp89–98. Pot. E. International Journal of Systematic Bacteriology. International Journal of Systematic Bacteriology..Date. K. infertile soils of the tropics’. J.. L. Garcia. (1966) ‘Acetylene reduction by nitrogen fixing preparations of Clostridium pasteurianum’. J. Dworkin. H.. Hoste. y Lugtenberg. A. E.. R. McSpadden-Gardener.. Nature. B.. vol 48. M.. D. vol 44. Kondorosi and W. isolation. in G. P. L. D. Dreyfus. De Lajudie. New York. Biochemica et Bioophysica Acta... D. F. International Journal of Systematic Bacteriology. y Halliday. y Gillis. nov. Moreira.. M. M.. Springer-Verlag. De Lajudie. Struffi.. Maestrojuan.. Truper (eds). J. in C. B.’. K. y Bunn. Sinorhizobium saheli sp. Collins. R.. F. Dudman. J. Laurent-Fulele. F. pp369–382. P.. Rademaker. P. sp.. (1988) ‘Numerical taxonomic analysis of some strains of Rhizobium spp. in A. and Sinorhizobium teranga sp. A.. Molouba. C. nov. B. y Gillis. pp715–733. pp62–64. H. (1991) ‘The Rhizobia’. M. Willems.. B. R.. P. pp3782–3785. y Gilles. M. (1979) ‘Selecting Rhizobium for acid.

.X. Young. International Journal of Systematicand Evolutionary Microbiology. B. G. Berichte der Deutschen Botanischem Gesellschaft. (1991) ‘Proposed minimum styards for the description of new genera and species of root. y Young. isolated from Astragalus adsurgens growing in the northernregions of China’. A. (2007) Rhizobium cellulosilyticum sp.. isolated from sawdust of Populus alba’. E. L. y Hirsch. Y. pp783–784.F. Jarvis.. pp91-97. Rigottier-Gois. H. International Journal of Systematic and Evolutionary Microbiology. M. Martens. Terefework. J. (1987) ‘Use and abuse of the acetylene reduction assay for measurement of “associative” nitrogen fixation’... Kan. Z. vol5. Y. W. New York and London... P. pp 582–587. vol 19. Peix. Barnet.M.. pp2037–2048. T. Keyser. S. Turner. Lindstrom. P. H. L. Gu. vol 7. E.. Botanik Zeitung. Ghosh. B. Sadowsky. S..and stem-nodulating bacteria’. Fred.. Mateos. J. (2008) Rhizobium miluonense sp. Strijdom. J. and Mesorhizobium temperatum sp. y Velázquez. P. y Waksman. W. W. E.. vol 21. T... Soil Biology and Biochemistry. (1989) ‘Occurrence of nodulation in the Leguminosae’. W. J. Lewis. Frank. pp332–346. S. Qiu.. J. nov. P.. X. C. P.. pp 844-848. S. International Journal of Systematic and Evolutionary Microbiology. P. Y. E.. B. 394–399. L. pp 607–619. International Journal of Systematic and Evolutionary Microbiology. E. F. Gaunt. vol 41. J.. International Journal of Systematic Bacteriology. y Chen. K.T...F.H.. X. (2006) ´Mesorhizobium thiogangeticum sp. A.. W. Graham. a novel sulfur-oxidizing chemolithoautotroph from rhizosphere soil of an Indian tropical leguminous plant´. Tan. I. R. pp 841–848. nov. R. y Chen. pp2003–2012. (2004) ‘Mesorhizobium septentrionale sp. Z. K. Sprent.... S. B. E. (1879) ‘Ueber die Parasiten in den Wurzelan-schwillungen der Papilionaceen’. Turner. (1928) Laboratory Manual of General Microbiology. W. Willems. P.. H. Gao. E. M.. vol 37. nov. A. Lloyd-Macgilp. New Phytologist. C. W. S.F. J. nov.. McGrath. Soil Biology and Biochemistry. a symbiotic bacterium isolated from Lespedeza root 202 Manual de biología de suelos tropicales .. Wang.. D. R. vol 111. L.. Martínez-Molina. Bradley. M. y Roy.. (1889) ‘Ueber die Pilzsymbiose der Leguminosen’. y Sutherly. S. W. W. L. B. M. Rivas.. vol 56. Sui. (2001) ‘Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia’. de Ley. Cooper.P. H.X. J. E. E. y Young. vol 51.nov. R. J. Chen. M. Han. vol 57. B. A. García-Fraile.. Tian.T. K. (1989) ‘Absence of nitrogen fixation in clover grown on soil subject to long-term contamination with heavy metals is due to survival of only ineffective Rhizobium’. Giller. Frank. Roslycky. P.. Wang...Faria. McGraw-Hill Book Company. W. pp376–387. Inc. Giller.

isolated from wild legumes growing in desert soils of Xinjiang.. Nour.X. X. Muramatsu.X. (2008) Mesorhizobium gobiense sp..K. F.F. Rhizobium mediterraneum and Rhizobium tianshanense to Mesorhizobium gen. nov. (2005) ‘Leguminosae nodulating bacteria diversity from three different land use B acterias formadoras de nódulos en leguminosas 203 . Li. International Journal of Systematic and Evolutionary Microbiology. S.X.. a novel rhizobial species nodulated with Caragana spp. pp378–380. M... China‘. B. International Journal of Systematic Bacteriology.. H.s. nov. W... pp2646-2653. Kawasaki. E. pp2610-2618.nodules‘.. B. vol 60: 1548 . L. A... E. y Chen...F. vol 55. isolated from nodules of Cicer arietinum´... W..T. Han.. Kuykendall. C. pp1693-1699..H. Y. Jarvis. S. vol 47. L. Han. A. nov. y Patel. Rhizobium ciceri. K.(2008) ‘Rhizobium multihospitium sp. Y. W. R. D. Schumann. Fernyez. Wang. C.J.. E. nov.T.. T. Pankhurst. S.... M. W. L. and Mesorhizobium tarimense sp. Tian C. T.G. Guan. y Chen.Z.. W. A.. Chen.. Biosci.L. Yan. W. isolated from multiple legume species native of Xinjiang.T. E.vol 59. B.pp3051-3057. D.H. Chen. W... J. Imran.International Journal of Systematic and Evolutionary Microbiology. y Chen. Gu. E. P. Wang.X. Y. a symbiotic bacterium isolated from Trigonella archiducis-nicolai (irj. (2008) ‘Bradyrhizobium iriomotense sp.. Wang. Dong. e Seky.. Rodrigues. Sui. T. nov. M.X. X. 895–898.. y Manter D. Hou. Gao. nov... J..G. nov. A. y Stackebrandt. nov. Biochem vol 72. Gu. Cleyet-Marel. X. vol58. (1982) ‘Rhizobium loti.) Vassilcz´. (2007) ´ Rhizobium selenireducens so. Jarvis. International Journal of Systematic and Evolutionary Microbiology. Isolated from a Tumor-Like Root of the Legume Entada koshunensis from Iriomote Island in Japan‘. vol 58. Gu.I. (2008).: a selenite-reducing (alpha)-Protobacteria isolated from a bioreactor´Current Microbiology. Hafeez.. (1997) ‘Transfer of Rhizobium loti. vol 58..F. International Journal of Systematic and Evolutionary Microbiology.’.J. China‘.. International Journal of Systematic Bacteriology. vol58. Florentino. M. J. pp1364-1368. Mesorhizobium caraganae sp. pp1416-1429. W..T. Rhizobuim huakuii..J. Oliveira. Malik. F.B. C. Y. Lu.R. Zhang. y Moreira. a new species of legume root nodule bacteria’. (2010)´Ochrobactrum ciceri sp. y Chen..1553. Jia. International Journal of Systematic and Evolutionary Microbiology. Nakagaka.. Chen. W. L. nov.F. E. Han. pp455-460. P. Hunter. D. M.. (2009) ´Rhizobium tibeticum sp. W..F. X. C. W.T. in China ‘.J.X. Y. M. Islam. L. E.. Wu. I. R.. P. Jesus. M. Chen. J.. vol 32. Frühling. Biotechnol. van Berkum.C. J.X. International Journal of Systematic and Evolutionary Microbiology. Wu. W. Y. y Gillis. Chen. Wang.

T. Pesquisa agropecuária Brasileira. H.. A.F. vol 38. B. Saxena.. Krieg and J.Y.. B. D.. (1984) ‘Rhizobiaceae Conn 1938’.. S. Lin. D.X. F.. Sy. Chen. pp447–459... a symbiotic bacterium isolated from root nodules of the herbal legume Kummerowia stipulacea ‘. Chen.. C. vol 29. isolated from root nodules of three different legume´.F. isolated from root nodules of Caragana species ‘. H. L. pp769–776..T. y Chen. C. W. Schrire.X. Wang. X. Wang E.. Lewis.. (2009)´Rhizobium mesosinicum sp. in N.T. W. D. International Journal of Systematic and Evolutionary Microbiology. pp518–526. Sui. J. E. Mackinder. F. (Cicer arietinum L. vol 8. Nelson.. Dreyfus..) by immunofluorescence. E. M.. Rosenberg.X. pp3006-3011. D. vol 54. D... pp30123018. pp1409-1413. Li. International Journal of Systematic and Evolutionary Microbiology. Meyer. J. He. Wong.F. F. Canadian Journal of Microbiology. NGR234 selected using the widely compatible legume Vigna unguiculata’. pp501–505. E.. Tang. N.. vol 59: 1919 . G.. vol 59. y Bohlool. B. D.. nov. Chen. Jordan. Giraud.X.X. Li. W. Wang. London.. L. (2008) ´ Shinella kummerowiae sp...H. Manen. legume root-nodule-forming and nitrogen fixing bacteria’.. Wang E. y Chen. Dowling. Wang E.H. T.. W. H. pp2269–2273. y Broughton.Q. vol 58.L.. Plant Molecular Biology. Canadian Journal of Microbiology. (1983) ‘Characterization of Rhizobium sp. X. y Chen. Lewin.H. J. (2004) ‘Methylobacterium nodulans sp.X. W. Stanley. Wang. Guan.Y. International Journal of Systematic and Evolutionary Microbiology..Q. Hu. Holt (eds) Bergey’s Manual of Systematic Bacteriology. nov.’.nov. R.T. Willems. P. International Journal of Systematic and Evolutionary Microbiology. T. B. nov. Y. Devine.systems in Brazilian Western Amazon’. M... isolated from Caragana intermedia growing in saline-alkaline soils in the north of China´. vol 40. Han. J. (2009)´Rhizobium alkalisoli sp.. L. nov. S.1923. immunodiffusion and intrinsic antibiotic resistance’. W. (1987) ‘Multiple host-specificity loci of the broad host-range Rhizobium sp.. D. y Chen.. B. for a group of aerobic facultatively methylotrophic. D. Lin. vol 59. (2009) ´ Mesorhizobium shangrilense sp. Han.. y Lock. (2005) Legumes of the world. W. Kuykendall. Jourand.. nov. Dénarie... Sui..L. y de Lajudie.T. International Journal of Systematic and Evolutionary Microbiology. A. W. M. B. P. G. Williams and Wilkins. Bena.. Kingsley. A. Hu. (1992) ‘Genetic diversity in Bradyrhizobium japonicum and a proposal for Bradyrhizobium elkanii sp. C.. Gillis.X. y Udell. L. Royal Botanic Gardens. 204 Manual de biología de suelos tropicales . Kew.R..

Conservation and Sustainable Management of Below-ground Biodiversity CSM-BGBD. A. M. L. pp827-839.´. Nairobi. Le Roux. International Journal of Systematic and Evolutionary Microbiology.. (2007)´Ensifer mexicanus sp. PhD Thesis. L.R. Béna. de Lajudie. P. F.. S. vol 319. Lindström. Zakhia.. Rincon. vol 12. vol 41. Mahdhi. S..) Kuntze in Mexico... D. Mantelin. F. A. A. F.. nov. Llorente. vol 60: 664 . B. Silva. International Journal of Systematic Bacteriology. Moreira. M. A. R. Brasil.. (2010) Multilocus sequence analysis of root nodule isolates from Lotus arabicus (Senegal).. pp417– 426..S. J. a new species nodulating Phaseolus vulgaris L. E. A. Magalhães. Segovia. Systematic and Applied Microbiology.M. M. Phyllobacterium leguminum sp. beans and Leucaena trees’. nov. S.. (1989) ‘Rhizobium galegae. y Döbereiner. Acta Amazônica. y Martínez-Romero. Jeder. R..Lima.127-145.. Oliveira. E. vol 30.M... nov. Martínez-Romero.. pp280-290. F. O. (2007) ‘Densidade. (1991) ‘Rhizobium tropici.. M.... Fischer-Le Saux. S. nov´. Mars. F. eficiência e diversidade de bactérias fixadoras de N2 que nodulam o siratro (Macroptilium atropurpureum) de solos sob diferentes usos na Amazônia Ocidental’. Merabet. Mercante.M. Martínez-Romero. vol 56. and Ensifer garamanticus sp. pp365–367. Zakhia. G.S. Sy. A. K. PP. vol 39. F. L. Coopman. P. C. Ormeno-Orrillo.. y Pardo. Lotus creticus.S. Minas Gerais. A. and Phyllobacterium brassicacearum sp. nov. pp509-514. Bonneau. J. P. Magalhães.A. Universidade Federal de Lavras. A. Willems.. y de Lajudie. Annual meeting report 4. Lima.674. Kenya. H. International Journal of Systematic Bacteriology. Martens.A.. M. Barberi. M.. Domergue. L... Phyllobacterium ifriqiyense sp. y Moreira. a new species of legume root nodule bacteria’. a new specie nodulating Acacia angustissima (Mill. Argyrolobium uniflorum and Medicago sativa (Tunisia) and description of Ensifer numidicus sp. nov.M..A. Franco. Rogel-Hernández. M. B acterias formadoras de nódulos en leguminosas 205 . Graham. (2009) ´Nitrogen-fixing bacteria communities occurring in soils under different uses in the Western Amazon Region as indicated by nodulation of siratro (Macroptilium atropurpureum)´ Plant and Soil. E. (1982) ´Ocurrência de nodulacão en leguminosas florestais notivas de terra firme da região de ManausAM´.C. A. J.. y Cleyet-Marel. Ferreira.F. (2004) ‘Methodology for the inventory of nitrogen-fixing Leguminosae nodulating bacteria’. nov.S. Nóbrega. (2006) ´Emended description of the genus Phyllobacterium and description of four novel species associated with plant roots: Phyllobacterium bourgognense sp.. K.. Bekki. International Journal of Systematic and Evolutionary Microbiology.. C.

(2001) ‘Microsymbionts: rhizobia’.. F. P. Dreyfus. Moulin. in Australia´. D. K. Siqueira and L. T.. Editora. y Marsh. (2006) ‘Nitrogen-fixing Leguminosae nodulating bacteria’. in F. isolated from leguminous trees in Sudan and Kenya’..org/AG/agl/agll/soilbiod/docs/manual-soil%2). L. Martínez-Romero. vol 16. Munive. F.. M. Moreira. S. Memorias da XXI Reunión Latinoamericana de rhizobiologia.. vol 121.G.. J. Cocoyoacan. G. Brussaard (eds) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. vol 40. Nick. International Centre for Research in Agroforestry. Brussaard (eds) Biodiversidade do solo em ecossistemas brasileiros. S.G. Nour.. (2002) ‘Burkholderia spp. S. y Lidstrom.Moreira. M. isolated from Biserrula pelecinus L. (1994) ‘Genotypic y phenotypic diversity of Rhizobium isolated from chickpea (Cicer arietnum L. M. Marsh. F. Systematic and Applied Microbiology. F. M. S. X. pp135–146. Paulin.. 768pp. G. M... (2001) ‘Nodulation of legumes by members of the b sub-class of Proteobacteri’. pp1359–1368. S. O. nov. S. Moreira. C. F. Bignell (eds) Standard Methods for Assessment of Soil Biodiversity and Land Use Practice. F..)’. microsymbiont of Sesbania virgata (Caz. M. F. A. International Journal of Systematic Microbiology. nov. y Howieson. Effosse. A. E. Faria. Moreira.. and Mesorhizobium opportunistum sp.W. pp345–354. M. y Pereira. Nature. S. S. Siqueira and L. M. International Journal of Systematic and Evolutionary Microbiology.. in M. y Franco. 280pp.. Pedrosa. K. vol 59. (2006) ‘Azorhizobium doebereinerae sp. J. CAB International.. M. Wallingford. J. y Bolvin-Masson. Systematic and Applied Microbiology. (1992) ‘Occurrence of nodulation in legume species in the Amazon region of Brazil’. (1999) ‘Sinorhizobium arboris sp... pp563–570. Gillis. Eardly. pp197–206... G. F. Moreira.. L. L. (2008) ‘Bactérias fixadoras de nitrogênio que nodulam Leguminosae’. Moreira. P. pp2140-2147. de Lajudie. M. M. Nandasena. nov. P. O. Silva. Willems. O. Beck. in F. R. UFLA. J. Tiwari. Indonesia (available at http://fao. S. M. vol 411.... Pot. (2009) Mesorhizobium australicum sp. Gillis. México. T. B. nov. S. Tiedje. vol 29. Moreira. A.) Pers.P.. K. 206 Manual de biología de suelos tropicales . Zhang. Pitard. B. y Faria. vol 49. Swift and D. y Young. J. W. Suomalainen. Cleyet-Marel. S. M. S. pp948–950. y Fernandez. A. C. S. L. and Sinorhizobium kostiense sp. New Phytologist.. are among fast growing symbiotic diazotrophs isolated from diverse land use systems in Amazônia and from Brazilian Leguminosae forest species’.nov. Moreira.. M. Moreira. Bogor. O’Hara..’. M. R. M.. Kersters. A. J. B. F. D. Cruz. M. (1993) ‘Characterization of rhizobia isolated from different divergence groups of tropical Leguminosae by comparative polyacrylamide gel electrophoresis of their total proteins. Canadian Journal of Microbiology. E. Lavras.

W. L. (2000) ‘Diversity of rhizobia isolated from different land use systems in Amazon region’. vol 58. M. pp65–75. y Fernandez. Baek. S. Im. W. W. nov. isolated from a cyanide treatment bioreactor’. R. (2008) ´Rhizobium oryzae sp. Plant and Soil. Parker. John Wiley and Sons Inc.. M. Kimiti.. Sutherland.F. C. G. (2004) ‘rRNA and dnaK relationships of Bradyrhizobium sp. Martínez-Molina.. I. pp2484-2490. isolated from effective nodules B acterias formadoras de nódulos en leguminosas 207 .. M. Applications. J. J.. J... vol 58. E. and Bradyrhizobium jicamae sp.. Igual. J. Yuan.M. Reclassification of the strain R. New York. M. nov. Brazil. (2005) ‘Rhizobium daejeonense sp..Nour. D. y de Bruijn. D. J. Cleyet-Marel. M.. International Journal of Systematic Bacteriology. pp211–224. Li. vol 173. y Tan.. Pereira..N..nov.) and description of Rhizobium mediterraneum sp.H. A. J. Rivas.. in G. McInroy. Rivas. W.. Peix.. pp334–342. Odee. International Journal of Systematic and Evolutionary Microbiology.. T. E. P. Mateos.F. Z. R. and P. y Sprent. Peix. S. nodule bacteria from four Papilionoid legume trees in Costa Rica’. vol 188. J. (2009)´ Bradyrhizobium pachyrhizi sp. Makatiani. G. y Lee. Z.. P. Valverde. W. Martínez-Molina. M. pp2543–2549. (1995) ‘Natural rhizobial populations and nodulation status of woody legumes growing in diverse Kenyan conditions’. Mateos. nov.. Ramírez-Bahena. P. H. Sutherland. E.. D.. vol 27. and Overviews.. trifolii is a later synonym of R... International Journal of Systematic and Evolutionary Microbiology. Systematic and Applied Microbiology. Zhang. (1997) ‘Characterization and classification of microbes by rep-PCR genomic fingerprinting and computer-assisted pattern analysis’. J. Lavras. y Velázquez. Gresshoff (eds) DNA Markers: Protocols. P. Rademaker... leguminosarum DSM 30132 (=NCIMB 11478) as Rhizobium pisi sp. H. García-Fraile.H.. Plant and Soil. M. vol 45. E. D. M. Caetano-Anollés. P. Chen.’. International Journal of Systematic and Evolutionary Microbiology.. (1997) ‘Phenotypic characteristics and composition of rhizobia associated with woody legumes growing in diverse Kenyan conditions’. M. W. Ramírez-Bahena. Q. PhD Thesis. y Velázquez. Quan. Rhizobium phaseoli Dangeard 1926AL and Rhizobium trifolii Dangeard 1926AL. y Sprent... R. pp2158-2163. Peng. A. (1995) ‘Genomic heterogeneity of strains nodulating chickpea (Cicer arietnum L. Normy. A. leguminosarum. Universidade Federal de Lavras. isolated from the wild rice Oryza alta´. Willems. nov. nov. E. Rodríguez-Navarro. pp640–648. F. E. Odee. I. A. S. Camacho. M. vol 55.. A. (2008)´Revision of the taxonomic status of the species Rhizobium leguminosarum (Frank 1879) Frank 1889AL. G. Bae. J.

. Gilmour. H. Young.. N.. International Journal of Systematic and Evolutionary Microbiology. Rivas.’. vol 26. vol 54. Mateos. W. L.W. E. an aquatic legume from India’. M. International Journal of Systematic Bacteriology. A. that nodulates and fix nitrogen in symbiosis with Neptunia natans. N. y Whittam. (1984) ‘Rhizobium fredii sp. Ren. Musser. which has common symbiotic genes with Sinorhizobium mexicanum´. B. y Martínez-Romero.. Systematic and Applied Microbiology. R. nov. Subba-Rao. (2003) ‘Description of Devosia neptuniae sp. P. pp255. Velázquez. vol 24.’. Vizcaíno. J. Sui. Willems. nov.. Dazzo. y Martínez-Romero. Kroppenstedt.. F.f. Llorente.. (2002) ‘A new species of Devosia that forms a unique nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (L. Scholla. Normy. E. (1993) ‘Reclassification of American Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp.. D. Proceedings of the Federation of American Societies for Experimental Biology. nov. (1966) ‘Study of intermediates in nitrogen fixation’. pp580-586.. Subba-Rao.. C.. W. Martinez-Molina.. F. P.H. pp1271-1275. S.. A. P. International Journal of Systematic and Evolutionary Microbiology. Gillis. M.. M. R. Mateos. a fast-growing species that effectively nodulates soybeans’..of Pachyrhizus erosus’. y Velázquez. H. Ochman. R. vol 34. G. W.L. P.. P.. Chen. FEMS Microbiology Ecology Vol 68. isolated from roots of Beta vulgaris affected by tumour-like deformations´ International Journal of Systematic and Evolutionary Microbiology. A. y Martinez-Molina. pp484–486. vol 46. (2004) Bradyrhizobium betae sp. pp5217–5222. (2011)´Rhizobium vignae sp. vol 68.nov. pp873–884. Gillis. pp5217-5222. N. including Sinorhizobium chiapanecum sp.T. Selyer. vol 59. Palomo. pp47–53. E. y Chen.. Rome. Willems. L. Willems. vol 61. F. N... T. J. Ponce. International Journal of Systematic Bacteriology. (1996) ‘Sinorhizobium medicae sp. vol 43..F. K. E. P. E. D. Fernadez. D. 208 Manual de biología de suelos tropicales . M. Dazzo. y Cleyet-Marel.. a symbiotic bacterium isolated from multiple legume species´.. E. E.. M. (1986) ‘Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics’. R. pp374–377. p710 Segovia... Mateos. nov. S. R. nov. R. J. D. P. A.. Applied and Environmental Microbiology. X. M. N.) Druce’. International Journal of Systematic Bacteriology. pp972–980. M. Schollhorn. Caugant. F. R. y Vizcaíno. Rivas.. Martínez-Molina.F. isolated from annual Medicago spp. Rivas. Gillis.. Brunel.. Rincón-Rosales. García-Benavides. (2009)´ Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico.X. Applied and Environmental Microbiology. nov. vol 51. H.. y Elkan... Wang. y Burris. M. H. E.. R. J.. E..

nov. Tola. B. A. Rivas. D. (2005) ‘Phylobacterium trifolii sp.. M... E. Ludeña. y Chen. Tian. vol 71. vol 55. Cervantes. Z. Mateos. de Lajudie. Wang. W. vol 51. y Chen. A. F. (2008) ‘Rhizobium favae sp. nov. Squartini. Reinhold-Hurek. G.. Selnska-Pobell. A. P. vol 68. X. M.. Pesquisa Agropecuária Brasileira – Ediçao Especial 19.nov.. nov. pp54–64. y Mateos. M. y Dreyfus. y Martínez-Romero. F. Systematic and Applied Microbiology.. (2006) ‘Rhizobium lusitanum sp. B.. Prin. E. E. 58: pp 2871-2875... Velázquez. the root-nodule microsymbiont of Hedysarum coronarium L. Igual.T. y Eardly. y Nuti.. Toledo. a bacterium that nodules Phaseolus vulgaris´. N. (1984) ‘Avaliaçao do crescimento de rhizobium de leguminosas florestais tropicais em diferentes meios do culura’.. T.. F. Gillis. nov. Lloret.. S. A.. Peix. nov. Gu. International Journal of Systematic Bacteriology.. (2002) ‘Rhizobium sullae sp. R. Van Berkum... Rivas. E. Willens. M. pp1985– 1989. L. A. Neyra. International Journal of Systematic Bacteriology.. pp214–220. Boivin-Masson. A. International Journal of Systematic and Evolutionary Microbiology. y Velazquez. E.X.. Vendramin.. E. Tan. is one of three rhizobial genotypes identified which nodulate and form B acterias formadoras de nódulos en leguminosas 209 . in Mexico’. D. vol 52. a bacterium that nodulates Vicia faba. Trujíllo.M. E.. Valverde. nov..F. nodulating Trifolium and Lupinus in Spanish soils’. Wang. Willems. Sy. International Journal of Systematic and Evolutionary Microbiology‘. G. pp901–914. Dazzo. (formely ‘Rhizobium hedysari’). A. vol 56. a new Sinorhizobium species nodulating Acacia spp.. (1998) ‘Rhizobium mongolense sp. L.G.. Joury. W.. (2002) ‘The aquatic budding bacterium Blastobacter denitrificans is a nitrogen-fixing symbiont of Aeschinomene indica’. E.. S. C..J. vol 183. Wu. (2001) ‘Rhizobium yanglingense sp.. Journal of Bacteriology..G. A. pp1132–1136. E. (2003) ‘Sinorhizobium americanum sp. E. Campbell. Gu. P. Casella. T. J. C. B. Y... Döring. Vizcaíno. C. Y. Garcia. Struffi. A.’. vol 26. y Oliveira. B.Souza. F. isolated from arid and semi-arid regions in China’.. Abril. F. Fernández-Santos. Magalhaes. P.. Chen.. P. A. Beyene.. Mateos. A.. I. Giacomini. L. J.. pp. Planchuelo. A. y Eardly. International Journal of Systematic and Evolutionary Microbiology. pp1267–1276. Van Berkum. Applied and Environmental Microbiology. nov. P..F. s/n.. Valverde. G. P. A. Han. E. Applied and Environmental Microbiology. (2005) ‘Nodulation of Lupinus albus by strains of Ochrobactrum lupine sp. R.. P. pp1318–1327. M.. E... (2001) ‘Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes’. L. Matínez-Molina..X.. B. Bao. y Martínez-Molina. H. P. Kan. E..’. D. Velázquez. M. W. P. F.. 2631-2637. X. N.T. Giraud.

y Willems. M. G. A. de Vos. pp850-855. M. A... Werner. vol 54. pp2285–2289. O.. y Conye. (2004) ‘Wautersia gen... Systematic and Applied Microbiology. Jarabo-Lorenzo. LiPuma. Silva. L. France´. Toro. pp507–512.. (Aeschynomene indica) with Blastobacter denitricans and to transfer Blastobacter denitrificans (Hirsh and Muller... (2002) ‘Burkholderia tuberum sp. pp1011–1021... M. nodulate the roots of tropical legumes’. Vincent. a new genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species. nov. pp689691. International Journal of Systematic Bacteriology. Fernyez. E. Léon-Barrios. R.)’. Escarré. International Journal of Systematic Bacteriology vol 54. Vandamme.. (2001) ‘Mesorhizobium chacoense sp. M. P. B. Falsen. nov. A. T.... P. nov. and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al. J.’. M. pp317–327. Cervantes. y Martinez-Molina. W. Normy. nov.. E. an acid tolerant endosymbiont that nodulates endemic genistoid legumes 210 Manual de biología de suelos tropicales . M. nov. Willems. pp13–22.. de Baere. N. M.J. E.. vol 59. y Eardly.. (2006) ‘Proposal for combining Bradyrhizobium spp. E. P. (2005a) ‘Bradyrhizobium canariense sp. Mauré. J.. T. Blackwell Scientific Publications. sp. Velazquez. (2004) ‘Taxonomy of the genus Cupriavidus: A tale of lost and found’. pp207–215.. Goris. D. Pérez-Galdona. Chen. Chantreuil. H.... Oxford. vol 25. J. A.-M. Willems. Vaneechoutte. nov. J. C. A.. F.. P. P.J. vol 54..C. P. vol 29. Systematic and Applied Microbiology. J. nov. nov. Vinuesa. J. y Martínez-Romero. y Verschraegen. P.. y CleyetMarel. P. C. Leibold. Van Berkum. Abril. Berge. E.) Ledebour]’. M. E.. Mateos. International Journal of Systematic and Evolutionary Microbiology. vol 48. Gillis. International Journal of Systematic and Evolutionary Microbiology. International Journal of Systematic and Evolutionary Microbiology.. Coenye. Béna. D.. nov. Nelis. nov. Vermis. K. Mahenthiralingam. Igual.. a novel species that nodulates Prosopis alba in the Chaco Arido region (Argentina)’. J. (2009)´Mesorhizobium metallidurans sp. P. a metal-resistant symbiont of Anthyllis vulneraria growing on metallicolous soil in Languedoc. Vandamme.. Kamfer. T. 1990) comb. vol 51. 1985) to the genus Bradyrhizobium as Bradyrhizobium denitrificans (comb. P... C..nitrogen fixing symbioses with Medicago ruthenica [(L. Munoz. Brunel. (1970) A Manual for the Practical Study of Root-Nodule Bacteria. and Burkholderia phymatum sp. G... (2004) Proposal to accommodate Burkholderia cepacia genomovar VI as Burkholderia dolosa sp.. Vidal. y Vandamme. B. International Journal of Systematic and Evolutionary Microbiology.

Wang. E. a Leucena leucocephala-associated bacterium that is highly resistant to multiple antibiotics’. International Journal of Systematic and Evolutionary Microbiology. Y. y MartínezRomero.. pp1479–1491. vol 52.. nov. pp1687–1693.H. D. J. M. G. P. International Journal of Systematic Microbiology.. Beyene. vol 57. International Journal of Systematic Bacteriology.. M. Z. Zhu..(Papilionoideae:Genisteae) from Canary Islands. Wei.. Han.. H. Wang. P.. nov. P. Dorado. H. pp2231–2239. E. T. International Journal of Systematic Bacteriology... A. H. Wang. Tan. Wei.. vol 48. Martínez-Romero. International Journal of Systematic and Evolutionary Microbiology. D. J. Wang. Chen. X. pp1192-1199. (1998) ‘Rhizobium huautlense sp. (2002) ‘Sinorhizobium morelense sp. T. pp51–65. E. International Journal of Systematic and Evolutionary Microbiology. (2005b) ‘Population genetics and phylogentic inference in bacterial molecular systematics: The roles of migration and recombination in Bradyrhizobium species cohesion and delineation’. F. (2002) ‘Rhizobium indigoferae sp. nov. Sui.. Chen.. van Berkum.Q.. Zhu. nov. T.. E.. y Martínez-Romero. Santos. X. Silva. X. along with Bradyrhizobium japonicum bv. X. y MartínezRomero. Cevallos. W. y Martínez-Romero. (1999a) ‘Rhizobium etli bv. E.. E. Chen. Z. y Martínez-Romero. International Journal of Systematic Bacteriology. a novel bacterium that nodulates Albizia kalkora in a subtropical region of China´.. vol 49. X. M. pp687–699. mimosae. T. H.T. Chen. S. D. Sui. G.. Tan. (1999b) ‘Diversity of rhizobia associated with Amorpha fruticosa isolated from Chinese soils and description of Mesorhizobium amorphae sp. M. A. Rinhold-Hurek. T. E. B.’. Werner. (2003) ‘Characterization of rhizobia isolated from legume species within the genera Astragalus and Lespedeza grown in Loess Plateau region of China and description of Rhizobium loessense sp.. vol 55. M. A. Fernández-López. vol 53. Wang. a novel biovar isolated from Mimosa affinis’. nov. Wang. Vinuesa.. respectively isolated from Indigofera spp.. y Chen. O. Wang.. van Berkum. W. X.. y Chen. Sui. E. Molecular Phylogenetics and Evolution. International Journal of Systematic and Evolutionary Microbiology. vol 34. pp569–575. W... E. a symbiont of Sesbania herbacea that has a close phylogenetic relationship with Rhizobium galegae’. vol 49. Willems. Wang. E. Liu. pp29–54. E. (2007)´Mesorhizobium albiziae sp. nov’.. Rogel-Hernández. nov. pp1575–1583 B acterias formadoras de nódulos en leguminosas 211 . and Kummerowia stipulacea’.. E. W.. E. T.. y Chen. W. and Sinorhizobium kummerowieae sp. Q.. Wang. genistearum. X. T. W. E. vol 52..X.. Beyene. A.F... E. E. Bradyrhizobium genospecies a and Bradyrhizobium genospecies b’. G. C..

pp2219–2230. Vos.. CAB International. Ingram (eds) Tropical Soil Biology and Fertility: A Handbook of Methods. Yao. (2004) Renaming of Agrobacterium larrymoorei Bouzar and Jones 2001 as Rhizobium larrymoorei (Bouzar and Jones 2001) comb. C. X.. P. Z.Willems. Li. S. M. Ge. Toro. W. M. I. International Journal of Systematic Bacteriology.. P. International Journal of Systematic and Evolutionary Microbiology. W. J. P. R. Young. vol 54. R. C.. (1993) ‘Most Probable Number Counts of Rhizobia in Soils’. in J.. 212 Manual de biología de suelos tropicales . vol 54 pp149. vol 28. Kan. Bennet. Applied and Environmental Microbiology. pp172–178. P. J. B. (1988b) ‘Reliability of the most-probable technique for enumerating rhizobia in tropical soils’. B. (1990) ‘Agroclimatology and modeling – overcoming the inflexibility of most-probable-number procedures’. isolated from the root nodules of soybeans’... vol 82. pp2107–2110. (2002) ‘Characterization of rhizobia that nodulate legume species within the genus Lespedeza and description of Bradyrhizobium yuanmigense sp. vol 53. B. Goris.. pp1207–1217. B. M. L. vol 54. J. M. vol 45... nov. A. N. y Gillis.. Wilson.’. Fernández-Lopez. H.. y Fan. Applied and Environmental Microbiology. Z. nov. pp349–353. Blitchngton. Young.. W. Muñoz-Adelantado. (2003) ‘The genus name Ensifer Casida 1982 takes priority over Sinorhizobium Chen et al 1988 and Sinorhizobium morelense Wang et al 2002 is a junior synonym of Ensifer adhaerens Casida 1982. nov. P. P. J. E. y Bohlool. pp1112– 1116. M. Wang. pp706–711.. International Journal of Systematic Bacteriology. Singleton. K. J. Journal of Clinical Microbiology. E. (1990) ‘Amplification of bacterial 16S ribossomal DNA with polymerase chain reaction’. Cui. nov. R. Xu. E. T. L.´ International Journal of Systematic Evolutionary Microbiology. Wallingford. pp1942–1946.. Woomer. International Journal of Systematic and Evolutionary Microbiology. B. (2003) ‘Description of new Ensifer strains from nodules and proposal transfer Ensifer adhaerens Cassida 1982 to Sinorhizobium as Sinorhizobium adhaerens comb. Agronomy Journal.. Singleton. Y. y Chen. y Bohlool. Woomer. vol 53. Woomer. (1995) ‘Bradyrhizobium liaoningense sp. pp1494–1497. Request for an opinion’. H. P. Woomer. vol 52. MartínezRomero. F. M. y Yost. Is the combination “Sinorhizobium adhaerens” (Casida 1982) Willems et al 2002 legitimate? Request for an opinion’. y Green. Yerson and J. (1988a) ‘Ecological indicators of native rhizobia in tropical soils’.

rubi. B. vitis’. and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. E. 1998 as new combinations: Rhizobium radiobacter. X.F. Kuykendall. Zhang.J. y Haukka.X.. K. P.. Zhang.. pp89–103. M..T.. H. A... Zurdo-Piñeiro. .vol 133. (2007)´Ochrobactrum cytisi sp. Trujillo.. R. Palomares.. M.X. R. nov. A. Martínez-Molina.. pp87–94.. Li.E. isolated from nodules of Cytisus scoparius in Spain´ International Journal of Systematic Evolutionary Microbiology. E.Young. (2001) ‘A revision of Rhizobium Frank 1889. Y. vol 57. L.C. E.L. R. (1996) ‘Diversity and phylogeny of rhizobia’. B acterias formadoras de nódulos en leguminosas 213 . Mateos. Carrasco. P. M. Wang. rhizogenes. nov.A. R. W... with an emended description of the genus. undicola and R. pp512-517.. Young J.. Vizcaíno. E. J. J. Kerr. N. New Phytologist.. Hou. y Velázquez. vol 61. (2011)´Rhizobium tubonense sp. Chamber. Martínez-Romero. isolated from root nodules of Oxytropis glabra´International Journal of Systematic Evolutionary Microbiology. pp784-788. J. y Sawada. R. D.. W. International Journal of Systematic Evolutionary Microbiology. Rivas. vol 51. y Chen. E.

1 gl–1) 4ml sol. 214 Manual de biología de suelos tropicales . Cuando pH <5. Medio sólido: 15g Agar Medio semisólido: 1.0.APÉNDICE 6. 0. KH2PO4 (10%) (o 0. 7H2O (10%) (o 0. para hacer 1000 ml con agua destilada pH 6.2 gl–1) 1ml sol. 1928) (similar a medio YMA – Vincent.5% azul de bromotimol en 0.2 N KOH.0 se reemplaza azul por Azul de Bromotimol por Verde de Bromocresol y se aumenta agar hasta 20 gl–1.1 gl–1) 100ml extracto de levadura (o polvo 0.1 Composición de medio 79 para el crecimiento de Bfn Medio 79 (Fred y Waksman.8–7.75g Agar Autoclave a 120°C durante 15 minutos. 1970): 10g manitol o sacarosa 1ml sol.4 gl–1) 2ml sol.4 gl–1) 5ml sol. MgSO4. NaCl (10%) (o 0. K2HPO4 (10%) (o 0.

. Normalmente.... pues las dosis elevadas inhiben la nodulacíon.09 g El mismo protocolo que para agar con semillitas. 0.... 0..... Si al final del experimento esto resulta insuficiente para el crecimiento sostenido y el color verde de las plantas control.000 ml pH = 6. los controles nitrogenados no presentan nódulos.7H2O (2%) NaCl (2%) CaHPO4(10%) FeCl3.....7% KNO3) pueden ser tóxicas..7H2O . por lo tanto.4H2O .05% KN03 o NH4 NO3). entonces la concentración puede aumentar o hacer una suplementación dividida..2 Solución de nutrientes Jensen’s para el crecimiento de espe- cies de leguminosas en bolsas de plástico y jarras de Leonard Componentes K2HPO4 (2%) MgSO4...03 g ZnSO4.... o entre 7 a 10 días después de plantar....7... 2.. Diluir solución a 1:4. * Solución de micronutrientes (para 1 l de agua).86 g MnSO4. Vicent (1970) recomienda la mezcla para una solución de nutrientes.... ajustar con KOH........... H3BO3 . las concentraciones más altas (>0. También después se usa la solución con sirato en bolsas de plástico.. diluida de la misma manera....7 % o FeCl3 1% Solución de micronutrientes* Agua destilada (completar a) Volumen 10 ml 10 ml 10 ml 10 ml 10 ml 1 ml 1.. es decir.5H2O ...............H2O ....... 0. 2.... Esto puede añadirse a la solución de nutrientes al principio del experimento.... sin inoculación del suelo B acterias formadoras de nódulos en leguminosas 215 .... Control Se proveen los controles con nitrógeno a una concentración final de aproximadamente 70 ppm N (0.. los controles absolutos.....6H2O 1.APÉNDICE 6..08 g Na2MoO4.. Sin embargo.22 g CuSO4.

Otro control importante. Si existe la disponibilidad de las cepas recomendadas. no mencionado por Vincent. es el uso de una cepa eficiente como un control positivo para la nodulación y la fijación de nitrógeno. éstas deberán utilizarse.son necesarios para comprobar las condiciones asépticas del experimento. 216 Manual de biología de suelos tropicales .

Capítulo 7 Hongos micorrizógenos arbusculares (HMA) Joseph D. producción de cultivos redituables o plantaciones forestales industriales provoca cambios en las características quí217 . provee una mayor superficie de absorción que los pelos radiculares y.. se encuentra bien documentado que los hongos micorrizógenos arbusculares (HMA) mejoran la salud y el crecimiento de las plantas de importancia agrícola. esto limita el desarrollo de las plantas. altas temperaturas. se ha demostrado que las plantas micorrizadas tienen mayor tolerancia a metales tóxicos. 1991). Stürmer INTRODUCCIÓN Actualmente. pH desfavorable del suelo y al choque por trasplante que sufren las plantas no micorrizadas (Mosse et al. Bagyaraj and Varma. La red de hifas producidas por los HMA en el suelo durante su asociación con la planta huésped. selvas tropicales. 1990. la agricultura se practica en áreas previamente ocupadas por dos principales ecosistemas naturales ricos en especies vegetales: bosques tropicales y sabanas. huertos y cultivos agrícolas (Brundrett. tales como fosfato. 1995). patógenos de la raíz. En la mayoría de los suelos tropicales. el fósforo disponible es muy bajo. En los trópicos. Además. La conversión de estos dos ecosistemas en agro-ecosistemas ya sea para agricultura de subsistencia. por lo tanto. 1981. aumenta significativamente la captación de iones relativamente inmóviles. salinas y sistemas manejados como praderas. hortícola y forestal. dunas de arena. salinidad. Bagyaraj y Sidney L. Bagyaraj. cobre y zinc. sequía. Los HMA han sido registrados en ecosistemas naturales como desiertos.

1979). Jasper et al.micas. También notaron un cambio en la composición de especies. como los hongos dominantes. estas determinaciones no detectan a las especies crípticas de HMA que no están esporulando en el momento del muestreo (pero que están asociadas con las plantas hospederas) e impiden la adecuada identificación de algunas especies. se siembran con una sola especie de la misma edad. Picone (2000) demostró que la densidad de esporas y la comunidad fúngica disponible para la formación de micorrizas eran relativamente similares entre praderas y bosque tropical lluvioso. Asimismo. Las macetas trampa preparadas con suelo de campo han sido usadas exitosamente para detectar y recobrar especies crípticas durante estudios de diversidad en huertos de manzano en regiones templadas (Miller et al. sin embargo. (1992) encontraron que el número de esporas de HMA en una plantación de Terminalia ivoriensis en Camerún disminuyó notablemente después de tres meses de una desforestación. (1987) observaron un descenso en el número de esporas y un cambio en la composición de especies después del disturbio en algunos lugares de Australia. especialmente de los géneros Glomus y Gigaspora. La infectividad micorrízica se determina fácilmente por el método del número más probable (NMP) y puede servir para propósitos comparativos (Porter. físicas y biológicas del ambiente edáfico.. 1985). 1996). En estos sitios. las medidas de diversidad taxonómica deberían estar acompañadas de algunas evaluaciones de la actividad de la comunidad micorrízica. por lo general. 1996) y también en desiertos (Stutz and Morton. La medición del porcentaje de colonización (PC) (Moorman y Reeves. 1989) son también adecuadas. Johnson y Wedin (1997). La conversión de los ecosistemas naturales para distintos usos de suelo influye en la abundancia de esporas y composición de especies de HMA. en donde se detectaron 28 morfotipos de HMA con Glomus aggregatum y dos especies de Glomus no descritas. Aunque comúnmente no es reportado. La medición de la diversidad taxonómica de HMA se ha hecho.. No obstante. 1979) y la determinación de las unidades de colonización (UC) (Franson y Benthlenfalvay. pastizales (Bever et al. se eliminan muchas especies vegetales de todas las edades y. De igual forma. usualmente. a través de una cuenta directa y de la identificación de esporas recuperadas del campo. Mason et al. 218 Manual de biología de suelos tropicales . generalmente. encontraron una riqueza similar de especies en la selva tropical seca y en praderas con dominio de una especie.

la identificación de especies está basada principalmente en las características morfológicas de las esporas. 2001). (2001) transfirieron todas las especies de HMA a una nueva división monofilética: Glomeromycota. Redecker et al. con aquellos de Morton y Redecker (2001) y Schüßler et al. Este género es incluido en el orden Diversisporales en la filogenia molecular propuesta por Schüßler et al.. se propone un esquema de clasificación para estudios de diversidad que surge de los esquemas de Morton y Benny (1990).TAXONOMÍA Y CLASIFICACIÓN DE HMA Debe establecerse un esquema taxonómico antes de cualquier estudio de diversidad. colocando a este grupo de hongos en el mismo nivel que Basidiomycota y Ascomycota. Gerdemann y Trappe (1974) incluyeron todas las especies de HMA dentro del orden Endogonales en la familia Endogonaceae (División Zygomycota). cuando se requieren comparaciones entre los sistemas de uso de suelo. Datos moleculares y morfológicos fueron usados para transferir a los miembros del género Sclerocystis a Glomus (Almeida y Schenck. Schüßler et al. un género nuevo llamado Pacispora fue propuesto por Oehl y Sieverding (2004). Recientemente..1). Se basa en una serie de diluciones decimales H ongos micorrizógenos arbusculares 219 . También incluyeron en el Nuevo esquema de clasificación tres nuevos órdenes y varias familias. Aunque se han aplicado técnicas moleculares para aclarar la clasificación filogenética entre las especies de HMA. MÉTODOS PARA EVALUAR PROPÁGULOS INFECTIVOS DE HMA Y COLONIZACIÓN MICORRÍZICA Número más probable (NMP) El protocolo propuesto para estimar la diversidad de HMA (descrito en el Capítulo 2) es el mismo que se sigue para todos los microorganismos y no será discutido aquí. (2001). El método del Número Más Probable se ha utilizado para estimar el número de propágulos infectivos de HMA en varios suelos.. especialmente. Por lo tanto. 2000) y para erigir dos nuevos géneros en dos familias distintas (Morton and Redecker. La taxonomía y clasificación de los hongos micorrizógenos han cambiado radicalmente en los últimos años. (2001) (Tabla 7. 1990. Morton y Benny (1990) transfirieron todas las especies de HMA al orden Glomerales (División Zygomycota) con tres familias y seis géneros. La formación de esporas en este género es similar a la de Glomus pero éste diferencia paredes germinales internas.

Entrophospora Ames y Schneider (cinco especies) Esporas formadas dentro de un cuello de un sáculo esporífero el cual deja dos cicatrices sobre la superficie de la espora. Scharzott y Walker Orden Glomerales Morton y Benny Suborden Glomineae Morton y Benny Familia Glomeraceae Pirozysnki y Dalpé Glomus Tulasne y Tulasne (85 especies) Esporas formadas blásticamente sobre una hifa de sostén. Hifas intrarradicales raramente enrolladas. en agregados laxos o en esporocarpos. No se observan paredes germinales diferenciadas. La pared de la espora esta formada por tres o cuatro capas y no se forma una verdadera bicapa germina. arbúsculos.1 Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales. y Trappe emend. Familia Archaeosporaceae Morton y Redecker Archaeospora Morton y Redecker (una especie) Esporas formadas terminalmente de una hifa de sostén o como una ramificación de una estructura que semeja un sáculo esporífero. Germinación a través del lumen de la hifa de sostén o a través de la pared de la espora. conectada a una hifa ramificada. Esporas con la pared esporal formada por un número variable de capas todas originadas a partir de la hifa de sostén. La pared germinal más interna tiene una superficie con excrecencias. solitarias. Las vesículas y células auxiliares no están diferenciadas. La micorriza se tiñe débilmente. hifas intrarradicales y micorriza se tiñen como en Acaulospora. Hifas intrarradicales rectas o enrolladas cerca de los puntos de entrada. Vesículas de pared delgada y elipsoides. Se presentan especies dimórficas formando esporas acaulosporoides y glomoides. Esporas con la pared esporal formada por dos capas. Familia Acaulosporaceae Morton y Benny Acaulospora Gerd. Las vesículas varían en forma con protuberancias y concavidades. La micorriza se tiñe muy obscuro. Germinación a través de una estructura de germinación esférica. División Glomeromycota Schüßler. Los arbúsculos e hifas intrarradicales se tiñen débilmente. Vesículas. plana. flexible.Tabla 7. 220 Manual de biología de suelos tropicales . Otras estructuras subcelulares de la espora y germinación idéntica a la de Acaulospora. Berch (31 especies) Esporas formadas a los lados del cuello de un sáculo esporífero el cual deja una cicatriz en la superficie de la espora. Arbúsculos con troncos aplanados o cilindricos adelgazándose sucesivamente en las ramificaciones.

Vestberg & Schüßler Ambispora Walter. Schüßler y Schwarzott Pacispora Sieverding y Oehl (siete species) Esporas formadas terminalmente de una hifa de sostén (como en Glomus). Arbúsculos con troncos hinchados angostándose abruptamente en las ramificaciones. Esporas con la pared esporal formada por dos capas permanentes. La segunda capa de la pared germinal generalmente reacciona con el reactivo de Melzer. Vesículas y arbúsculos las raíces teñidas en azul franco con azul tripano. Germinación de la espora directamente de la pared germinal a través de la pared de la espora. Las vesículas y células auxiliares no están diferenciadas. Familia Paraglomeraceae Morton and Redecker Paraglomus Morton y Redecker (dos especies) Esporas formadas terminalmente de una hifa de sostén como en Glomus.1 Continúa Familia Ambisporaceae Walter. Esporos acaulosporoide formado un apéndice hifal emergiendo lateralmente del cuello de un sáculo esporífero. y Trappe (cinco especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. Las estructuras subcelulares de la espora y la germinación como en Glomus. Vestberg & Schüßler (ocho especies) Especies generalmente dimórficas con asociaciones micorrizicas produciendo morfotipos acaulosporoide y glomoides. Blaszkowski. No se forman vesículas. No se forman vesículas. células auxiliares finamente papiladas o equinuladas. cerca de los puntos de entrada. y germinan atreves de hifa suspensora. no se diferencian paredes germinales. Scutellospora Walker y Sanders (30 especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. especialmente. Las paredes de la hifa de sostén son continuas con la primera y segunda capa de la pared esporal. Esporos glomoides de forma aislada en el suelo o agregados en racimos. Hifas intrarradicales frecuentemente enrolladas. Pared de la espora generalmente formada por tres capas distintas y la pared germinal compuesta también por tres capas. Arbúsculos e hifas intrarradicales similares en morfología a las de H ongos micorrizógenos arbusculares 221 .Tabla 7. células auxiliaries que van de casi lisas a nodosas. Al germinar. Familia Pacisporaceae Walker. Suborden Gigasporineae Morton y Benny Familia Gigasporaceae Morton y Benny Gigaspora Gerd. se diferencia una capa delgada con verrugas esparcidas y crece un tubo germinativo a través de la pared esporal. a menudo nodosas o con proyecciones. Los arbúsculos y las hifas intrarradicales se tiñen débilmente.

pero el número calculado tiene hasta un 95 por ciento del nivel de confianza (Adelman y Morton. basándose en una tabla estadística. Materiales necesarios • • • • tubetes para plantas (150 X 2. 2006 y http://invam. La ventaja es que. como el sorgo y el Paspalum. El tubo de germinación crece a partir de un escudo flexible plano. 1986). Si no contamos con semillas de cebolla.Tabla 7. y puede llevarse a cabo por cualquiera que esté familiarizado con la morfología de la micorriza.5 cm) y gradillas bolsas de plástico (30 X 20 cm) diluyente esterilizado (arena: mezcla de suelo 1:1) semillas de cebolla. Fuente: compilado de Morton y Benny. 1990. que se diferencia sobre la superficie de la última pared germinal.wvu. se puede utilizar cualquier otro hospedero.1 Continúa Gigaspora. el método es apropiado para comparaciones entre sistemas con diferente uso del suelo si los ensayos del NMP se establecen de forma simultánea. Esporas con una pared formada por dos capas permanentes y de una a tres paredes germinales internas.. Sin embargo. cada una con dos capas. el análisis de las raíces de las plantas trampa para comprobar la colonización es fácil y rápido. La planta hospedera recomendada para el ensayo del NMP es la cebolla. 2004.caf.edu. se pueden utilizar gramíneas C4. Spain et al. ya que es dependiente de la micorriza y las raíces son fáciles de teñir. si tiene cierta dependencia micorrízica. Una de las desventajas de esta prueba es que se requiere mucho tiempo para la preparación del bioensayo. Oehl y Sieverding. Como el resultado es un solo número. 222 Manual de biología de suelos tropicales . de suelo en donde la presencia o ausencia de colonización micorrízica se registra y da como resultado el número más probable de propágulos infectivos.

Al cosechar. 3. lavar el suelo de las raíces y teñirlas con azul de tripán (véase más abajo). 2. si es necesario). la combinación sería: N1 = 5. se ilustra con el siguiente ejemplo. El procedimiento para el cálculo del NMP. H ongos micorrizógenos arbusculares 223 . sólo tres números de una secuencia dada son necesarios. 5. 3. hacer cinco replicas por cada dilución. 4. Bajo un microscopio de disección. En este ejemplo. se obtiene la siguiente secuencia de números de tubetes positivos: 5. 5. El primer número (N1) corresponde al número de tubetes positivos para la colonización micorrízica en la dilución que muestra el mayor número de tubetes positivos (se toma la serie menos concentrada. 6. si el número de tubetes positivos es el mismo en diluciones posteriores). Sembrar las semillas de cebolla en cada tubete. Para el cálculo del NMP. El número de tubetes positivos (los que contienen colonización) en diluciones diferentes se utilizan para calcular los valores de NMP. 7. tres réplicas fueron positivas en la dilución 10-3 y dos réplicas fueron positivas en la dilución 10-4. 2. Agitar bien para obtener una dilución decimal. 10-3 y 10-4). Después de emerger. Retirar 30 g de la dilución anterior y colocarlo en otra bolsa que contiene 270 g del diluyente estéril. Utilice las tablas de Cochran (1950). hacer más diluciones decimales hasta la dilución 10-4 (o más. considerando las cinco réplicas (tubetes) para cada una de los cuatro diluciones (10-1. Los otros dos números (N2 y N3) son los correspondientes a las próximas dos diluciones. Agitar bien para obtener una dilución 10-1. 10-2. N2 = 3 y N3 = 2. Esto significa que las cinco réplicas fueron positivas para la colonización micorrízica en las diluciones 10-1 y 10-2. dejar una sola planta por tubete y dejarlas crecer en un invernadero o en una cámara de crecimiento durante seis semanas. Distribuir el suelo de cada dilución en los tubetes para plantas. de Fisher y Yates (1963) o Alexander (1965). determinar la presencia o ausencia de colonización micorrízica en cada réplica. Supongamos que. si no se dispone de las semillas de cebolla puede utilizar cualquier otro hospedero (ver arriba).Procedimiento 1. Pesar 30 g de suelo de campo en una bolsa de plástico y añadirle 270 g del diluyente esterilizado.

para detectar y medir la colonización micorrízica. el suelo tiene 1. 224 Manual de biología de suelos tropicales .4 X 10-3 propágulos infectivos g–1.05 % en solución de glicerol (0. este valor debe de ser multiplicado por la dilución media.5 g/l) • H2O2 alcalinizada (3 ml NH4OH al 20%. Sumergir las raíces en KOH a 90°C por una hora o a 120°C por 15 minutos en autoclave. en contraste con las asociaciones ectomicorrízicas. se propone para la tinción de raíces el método de Philips y Hayman (1970) modificado por Koske y Gemma (1989). Kormanik y McGraw (1982) eliminan el fenol en las soluciones para tinción y decoloración. mientras que Koske y Gemma (1989) modificaron el procedimiento mediante la eliminación de ácido láctico de estas soluciones sin interferir con la intensidad de la tinción. las raíces son sometidas a un procedimiento de clareo y tinción. 450 ml de H2O. El método más ampliamente utilizado es el descrito por Philips y Hayman (1970). 50 ml de de HCl al 1%) • azul de tripano 0. (500 ml de glicerol. 567ml de agua). no altera la morfología de la raíz. Procedimiento 1. Por lo tanto. Lavar las raíces para eliminar residuos de suelo y enjuagar con varios cambios de agua.Usando la tabla del NMP el valor dado para esta combinación de tubetes positivos es 1. (en este caso 10-3). Para obtener el NMP de propágulos infectivos de HMA en la muestra. 30 ml de H2O2 al 3%.4. Materiales necesarios • solución de KOH al 10% (hidróxido de potasio) • solución de HCl al 1% (ácido clorhídrico) • solución acidificada de glicerol. Tinción de raíces para observar la colonización micorrízica La colonización de las células corticales de la raíz por HMA. Teniendo en cuenta el costo de los productos químicos y el ahorro al reducir el número de productos químicos sin interferir con la calidad de la tinción. Por lo tanto. 2.

El paso 4 puede ser omitido si las raíces no están muy pigmentadas. Elimine el HCl. crecidas bajo condiciones del invernadero.01%. Esta medida estima el crecimiento de un aislamiento de un hongo o de una comunidad fúngica dentro de la corteza de la raíz. Para los pasos 2 y 7. Enjuagar nuevamente las raíces con agua.3.1 x 1. Tiña las raíces en una solución de glicerol ácido con azul de tripano a 90°C por una hora o a 120 °C por cinco minutos. es usado comúnmente para medir la longitud de la raíz y el porcentaje de la colonización micorrízica. la solución de glicerol acidificada puede ser reemplazada por una solución de lactoglicerol (20 ml de ácido láctico. H ongos micorrizógenos arbusculares 225 . un baño de agua a 90°C es apropiado para mantener las muestras. Descargue la solución colorante y mantenga las raíces en glicerol acidificado (sin azul de tripano) o agua a temperatura ambiente o 4°C. Eliminar el KOH y enjuagar las raíces con agua (dos o tres veces) para quitar el exceso de KOH. 1980) que se presenta a continuación. se realiza con frecuencia en raíces colectadas de campo (sacadas directamente del suelo o de plantas individuales) o en plantas experimentales. Comentarios: si lo desea. No enjuague las raíces en esta paso ya que éstas deben estar acidificadas para una tinción adecuada.1 cm. El método de intersección de cuadrante (Giovannetti y Mosse. 4. • Agujas de disección. Sumerga las raíces en HCL al 1% por cinco minutos. Para almacenar por un tiempo largo. Si las raíces están demasiado pigmentadas se deben sumergir en agua oxigenada alcalinizada durante 10-30 minutos. 7. 8. las raíces pueden guardarse en agua adicionada con unas gotas de azida de sodio al 0. la solución de agua oxigenada alcalinizada debe de prepararse justo antes de su uso. 40ml de glicerol y 40 ml de agua destilada). 6. Medición de la colonización micorrízica La determinación de la colonización micorrízica de la raíz. 5. Material necesario • Cajas de Petri cuadriculadas en la base con cuadrados de 1.

Comentarios: los datos obtenidos en el paso 3. Registre: a) el número total de intersecciones de las raíces y las líneas de la cuadricula y b) el número de intersecciones con raíces micorrizadas. seguido por centrifugación en un gradiente de sacarosa.edu/ methods/mycorrhizae/rootlengths. Si se toma una muestra pequeña de toda la raíz. también se pueden utilizar para determinar las longitudes tanto de la raíz completa como de la raíz micorrizada. 1963). 2. Por lo tanto. usando la relación entre el peso seco de la planta y la submuestra. Bajo el microscopio de disección explore las líneas horizontales y verticales de la cuadrícula.wvu. En una caja de Petri extienda al azar las raíces teñidas. se teñirá y se medirá en el microscopio con este método.. 3.1 cm. las esporas son la única parte del organismo del hongo que puede utilizarse para delimitar las especies.htm. 1995). Las esporas se extraen del suelo mediante un tamizado húmedo (Gerdemann y Nicolson. Métodos para evaluar la diversidad de HMA Extracción de esporas del campo La Identificación de las especies de HMA está basada en el análisis de estructuras subcelulares de las esporas asexuales.Procedimiento 1. De esta manera. Calcule el porcentaje de colonización micorrízica (% CM) utilizando la siguiente fórmula: % CM = (Número total de intersecciones con raíces micorrizadas/ Número total de intersecciones entre la raíz y las líneas de la cuadrícula) X 100. Para más detalles ver http://invam. Es posible calcular la longitud total de la raíz y la longitud de la raíz micorrízada de la planta completa. el total de la longitud de la raíz micorrizada será el número de intersecciones. La morfología del micelio interno y externo durante la asociación micorrízica es prácticamente indistinguible entre las especies del mismo género y entre géneros. En contraste. el número total de raíces que interceptan las líneas de la cuadricula. 4. las estructuras subcelulares de las esporas están altamente conservadas y son fenotípicamente estables independientemente del ambiente y la planta huésped (Morton et al. con las líneas de la cuadricula separadas en 1. 226 Manual de biología de suelos tropicales .caf. Si toda la raíz se extiende en la caja de Petri. representan la longitud total de la raíz en cm. con estructuras micorrízicas.

vidrio de reloj. después de expander las raíces. En el diagrama las infecciones de micorrizas son representadas con puntos negros. Materiales necesarios • Un juego de tamices anidados que tengan al menos 710 µm y 45 µm de abertura de malla. el largo de la raíz = 43 cm (25 + 18) y el largo de la raíz micorrizada=12 cm (Seis intersecciones positivas sobre líneas horizontales y seis intersecciones positivas sobre líneas verticales).1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. • Cubeta de plástico o un vaso de precipitados grande. Nota. • Vasos de precipitados. Figura 7. H ongos micorrizógenos arbusculares 227 . Ejemplo. el numero de intersecciones entre una raíz y las líneas horizontales y verticales tendríamos: • 25 intersecciones (Línea horizontal) • 18 intersecciones (Línea vertical) y • 12 intersecciones (Puntos negros) presentando colonización micorrizica.9%.Figura 7. • Por lo tanto. • Tubos para centrífuga y centrífuga. cajas de Petri. • Soluciones de sacarosa (20 % y 60%). • El porcentaje de colonización micorrízica= (12/43) x 100=27.1 provee una ilustración del método de intersección de línea.

comprada en el supermercado. En este momento. al menos. Transferir las esporas y el material retenido en el tamiz 45 µm a una caja de Petri y bajo el microscopio colecte las esporas en un vidrio de reloj limpio. 2. las esporas se pueden separar por morfotipos de acuerdo con su color y tamaño y si las esporas están en buen estado se pueden identificar hasta género y especie. se pueden anidar otros tamices entre los dos recomendados. 7.Procedimiento 1. ya que el tamaño de las esporas de HMA para la mayoría de las especies está en un intervalo de 40 a 600 μm. Centrifugue a 2. 228 Manual de biología de suelos tropicales . Vacíe el sobrenadante en el tamiz de 45 µm y lave con agua corriente para quitar el exceso de sacarosa. 8. 6. La solución de sacarosa se hace con azúcar comercial. si hay demasiados pedazos de raíz y otros desechos. en el fondo. es preferible vaciar la suspensión de suelo a través de un tamiz de 1 mm antes de pasar por el tamiz de 710 μm. Pasar la suspensión repetidamente a través de dos tamices anidados con abertura de malla de 710 µm y 45 µm. Sin embargo. Comentarios: en el paso 3. Los suelos con alto contenido de arcilla pueden obstruir los tamices.1M (Fogel y Hunt. 1979) para dispersar las partículas de arcilla y liberar las aberturas del tamiz. 3.000 rpm durante 60 segundos. Colocar 100 g de la muestra de suelo en la cubeta /vaso de precipitados y suspender en. Para preparar el gradiente de la sacarosa. Agitar hasta que las esporas queden suspendidas y dejar reposar 30 segundos . después transfiera este material a un tubo de centrífuga que contenga un gradiente de sacarosa de 20–60%. Los tamices recomendados (con mallas de 710 µm y 45 µm) son adecuados para recuperar la mayoría de especies. agregue 15 ml de la solución de sacarosa al 20% en un tubo de centrífuga de 50 ml y después. Coloque el material retenido en el tamiz de 710 µm en una caja de Petri grande y observe bajo el microscopio de disección para observar esporas grandes (esporas de Gigaspora y Scutellospora) y esporocarpos. Esto separa a las esporas por tamaños pero incrementa la cantidad de trabajo ya que el material retenido en cada tamiz debe centrifugarse por separado. Coloque el material retenido en el tamiz de 45 µm en una vaso de precipitados con una pequeña cantidad de agua. 4. 500 ml de agua. 5. Las esporas pueden separarse de los residuos orgánicos y recogerse de la caja de Petri usando unas pinzas finas o una pipeta Pasteur adelgazada en la punta. se puede agregar una pequeña cantidad de pirofosfato de sodio a 0. agregue otros 15 ml de la solución al 60% .

las esporas extraídas del campo no son identificables bajo el microscopio de disección. Trappe. alberga todos los problemas inherentes a esas descripciones (falta de estandarización de las estructuras subcelulares de las esporas. W. Fotografías de esporas de especies representativas de diferentes géneros se muestran en las ilustraciones 4 y 5.ar. café. Sin embargo. c y d) y Acaulosporaceae (e. la INVAM y el sitio de Blaszkowski poseen excelentes fotografías con detalles de la estructura subcelular de las esporas. y por consiguiente. 3 y 4 se proporcionan los nombres de las especies y los autores. de 160 especies de HMA descritas en total. a la vez que Bentivenga y Morton (1995) proponen una clave para identificar las cinco especies de Gigaspora.edu) y por Dr. Joseph Morton en la INVAM (Colección Internacional de hongos micorrizógenos arbusculares. West Virginia University. En los anexos 1. este manual incorpora en un solo volumen toda la descripción de las especies hasta 1990.V. 1982) se publicaron antes de algunas revisiones de taxonomía recientes e importantes. 2. y h). contrastando con el color hialino de las esporas). deben ser montadas en portaobjetos y observadas en un microscopio compuesto.Identificación de especies y montaje de preparaciones En la mayoría de los casos.agro. en estos sitios web se describen 79 y 55 especies respectivamente. el tamaño de las esporas y una descripción estandarizada de las especies de HMA.szczecin. 1979. Poland) en http://www. 1990) y comparando con las descripciones e ilustraciones de las especies proporcionadas por el Dr. La fotografia a) muestran una espora de Gigaspora albida con la hifa de sostén bulbosa típica de esta familia. usando como referencia al Manual para la identificación de HMA (Schenck y Pérez. El manual de Schenck y Pérez es una copia de las descripciones originales de las especies y por lo tanto. f..pl/~jblaszkowski. La identificación de especies de HMA se puede hacer por comparación con la descripción original de la especie. USA) sitio web (http://invam. falta de buenas fotografías para las comparaciones y las descripciones están hechas con esporas extraídas del suelo de campo por lo cual pueden no incluir características taxonómicas importantes). c) un detalle de la ornamentación de H ongos micorrizógenos arbusculares 229 . b) espora de Scutellospora scutata con la hifa de sostén bulbosa (note el escudo de germinación redondo. La ilustración 4 muestra las esporas y las estructuras producidas por las especies de la familia Gigasporaceae (fotografías a.wvu. Janusz Blaszkowski (Department of Plant Pathology of the Agricultural University of Szczecin.caf. Por otro lado. Algunas claves de identificación para HMA (por ejemplo Hall y Fish. g. Koske y Walker (1985) proponen una clave para algunas especies de Scutellospora con esporas con paredes ornamentadas. b.

En la foto e) se muestra una espora de Entrophospora colombiana (familia Acaulosporaceae) con la pared de la espora. Foto a): espora de Glomus clarum indicando la hifa de sostén (note que la capa más interna de la pared de la espora se desprende y se ve parecida a la pared germinal. forma. finalmente. se observan. la foto f) muestra un detalle de Archaeospora leptoticha en donde se observan protuberancias y depresiones de las capas 2 y 3 de la pared esporal (indicada con flechas). La foto e) muestra un espora de Archaeospora leptoticha con el sáculo esporífero. La ilustración 6 muestra a las esporas y estructuras producidas por especies de la familia Glomeraceae (a. color. L2 y L3) (la capa L2 está ornamentada con pequeñas crestas). esporas de Acaulospora sp. d). reacción al Melzer. b. y d) células auxiliares nodosas que diferencian a los miembros de Scutellospora. L2 y L3) de Paraglomus occultum y en la foto h) se muestra una espora de Paraglomus brasilianum. Las esporas necesitan montarse en líquidos de montar permanentes como son el PVLG (alcohol polivínilico lactoglicerol) y PVLG mezclado con reactivo de Melzer. presencia de hifa de sostén. Materiales necesarios • Portaobjetos. Un esporocarpo de Glomus clavispora se observa en la foto c) y un esporocarpo de Glomus sp. de células suspensoras y del sáculo esporífero (raramente observado en esporas recolectadas directamente del campo). también con la pared formada por tres capas (L1. cubreobjetos y etiquetas • Agujas de disección 230 Manual de biología de suelos tropicales . la foto g) ejemplifica la estructura de la pared formada por tres capas (L1. Archaeosporaceae (e y f) y Paraglomeraceae (g y h). La fotografía g) representa una espora de Acaulospora scrobiculata que muestra la cicatriz que queda en la espora después de que el sáculo esporifero se desprende. en la foto h). mostrando algunos sáculos esporíferos adheridos a las esporas. número de paredes germinales y grosor de la pared de la espora. Una espora de Entrophospora colombiana mostrando las dos cicatrices características se ve en la foto f). en la foto d). Las características taxonómicas importantes que pueden observarse bajo el microscopio de disección son tamaño de las esporas. En el microscopio compuesto pueden observarse algunas características taxonómicas importantes como son la presencia y tipo de ornamentación sobre la pared de la espora. la pared germinal 1 (gw1) y la pared germinal 2 (gw2) con su capa más interna reaccionando al reactivo de Melzer.la pared de las esporas (verrugas) de Scutellospora coralloidea. c. La foto b) muestra la pared de la hifa de sostén continua con la pared de la espora de un Glomus sp.

durante dos días para endurecer el medio de montaje. rompa cada espora individualmente bajo el microscopio de disección. Establecimiento de cultivos trampa Los cultivos trampa se utilizan con más frecuencia en estudios de diversidad de HMA porque revelan las especies que no están esporulando en el campo.6 g de alcohol polivínilico (PVA) • Reactivo de Melzer (100 g de hidrato de cloral. Procedimiento 1. 1. 4.• Solución de PVLG (100 ml de agua destilada. colocar una gota de PVLG y una gota de la solución de PVLG + Melzer. Además. mezcle las esporas en la solución de PVLG y de PVLG + Solución de Melzer y deje secar la superficie de la gota por lo menos cinco minutos. y fecha. Usando una aguja de disección. 5. en el momento del muestreo. tenga cuidado de no agregar demasiada agua). 100 ml de ácido láctico. 6. Guardar las preparaciones a temperatura ambiente durante cinco días y luego incubar a 40-60ºC. 10 ml de glicerol.5 g Iodo. género y especie (si se conoce). 16. Mezclar el reactivo de Melzer con el PVLG (1:1) para preparar la solución de PVLG + Melzer. 7. En un porta objetos. Colocar las esporas al centro de cada gota usando un pinza fina o una micropipeta (en este caso. las esporas se deslizan hasta los bordes cuando se coloca el cubreobjetos en la parte superior de cada gota. H ongos micorrizógenos arbusculares 231 . Este paso es importante para exponer las paredes germinales y sus capas. Coloque suavemente un cubre objeto sobre la gota de PVLG y otro cubreobjetos sobre la gota de PVLG + Solución de Melzer. 100 ml de agua destilada. 2. Con una aguja de disección. Etiquetar las preparaciones incluyendo número de muestra. El método propuesto se basa en los protocolos de Stutz y Morton (1996). si se agrega demasiada agua. ofrecen esporas nuevas y saludables que pueden ser utilizadas para establecer cultivos puros de HMA. 5 g de yoduro de potasio. Comentarios: el paso 2 es crucial para el montaje de las esporas sobre el portaobjetos. 3.

Comentarios: es importante que. pp. J. 232 Manual de biología de suelos tropicales . REFERENCIAS Adelman. Mycologia.5 kg Bandejas o bolsas de plástico Semillas de Sorghum sudanense (Sorgo) y Vigna unguiculata (Frijol) Procedimiento 1 En una bandeja de plástico (o en una bolsa de plástico).5 kg y sembrar abundantemente con una mezcla de semillas de sorgo y frijol (40-50 semillas por maceta). y Morton. Alexander. Glomales)’. 1467–1472. se incluyan las raíces de las plantas ya que también sirven como propágulos para iniciar los cultivos trampa. 7–13. colecte uno o dos núcleos de suelo de 50 ml de cada maceta. 703–714. Klute (ed) Methods of Soil Analysis. llamado “cultivos trampa de trasplante”. (1965) ‘Most-Probable-Number Method for Microbial Populations’. 18. M.Materiales necesarios • • • • Arena estéril Macetas de plástico de 1. 82. vol. J. Wisconsin. Se recomienda cualquier gramínea C4 y/o leguminosa como hospederas. otras plantas hospederas pueden utilizarse. Bever et al. según lo explicado arriba. Part 2: Chemical and Microbiological Methods. Después de tres a cuatro meses. si el sorgo y frijol no están disponibles. durante el muestreo de suelo de campo. M. (1990) ‘A Revision of the Genus Sclerocystis (Glomaceae. En el paso 2. 2 Colocar esta mezcla en macetas de plástico de 1. Cubrir las semillas con la mezcla de suelo y arena. bajo condiciones del invernadero. N. Soil ScienceSociety of America. Almeida. (1996) utilizan un procedimiento diferente para establecer cultivos trampa. 3. R.Soil Biology and Biochemistry. pp. T. T. in A. B. y Schenck. Madison. homogeneizar el suelo de campo con arena estéril (50% de suelo de campo y 50% de arena). (1986) ‘Infectivity of vesicular-arbuscular mycorrhizal fungi: Influence of host-soil diluent combinations on MPN estimates and percentage colonization’. donde las plantas intactas colectadas del campo se trasplantan a una maceta con un sustrato libre de HMA y se evalúa la esporulación después de tres a cuatro meses. pp . extraer las esporas e identificarlas. vol.

(1996) ‘Host-dependent sporulation and species diversity of arbuscular mycorrhizal fungi in a mown grassland’. L. (1991) ‘Mycorrhizas in natural ecosystems’. (1987) ‘The effect of surface mining on the infectivity of vesicular-arbuscular mycorrhizal fungi’. W. J. Morton J. B. Mycologia Memoir. y Trappe. Edinburgh. Transactions of the British Mycological Society. New Phytologist. Cochran. C. Soil Science Society of America Journal. I. K. (1980) ‘An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots’. G. Bagyaraj. pp. 235–244. Knudsen (eds) Handbook of Applied Mycology: Soil and Plants. y Hunt. 14. 75–78. y Schultz. y Varma. Advances in Ecological Research. Marcel Dekker Inc. vol. (1995) ‘Interaction between arbuscular mycorrhizal fungi and plants: Their importance in sustainable agriculture and in arid and semiarid tropics’. y Abbott. Brundrett. H ongos micorrizógenos arbusculares 233 . Fisher. pp. 720–732. Mukerjii and G. pp. y Mosse. pp. D. T.. 641–652. 171–213.Bagyaraj. J. y Morton. vol. W. Gerdemann. M. 261–270. 6. Bentivenga. 71–82. F. Canadian Journal of Forest Research.. pp. 84. H. 53. vol. A. M. (1979) ‘Fungal and arboreal biomass in a Western Oregon Douglas-fir ecosystem: Distribution pattern and turnover’. (1989) ‘Infection unit method of vesicular-arbuscular mycorrhizal propagule determination’. y Yates. pp. 87. 46. (eds) (1963) Statistical Tables for Biological.. Robson. 21. incorporating developmental patterns of morphological characters’. W. G. 489– 500. 245–256. (1990) ‘Ecology of vesicular-arbuscular mycorrhizae’. R. J. P. Transactions of the British mycological Society. J. R. D. (1963) ‘Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting’. R. A. K. Agricultural and Medical Research. J. 754–756. J. (1974) ‘Endogonaceae in the Pacific Northwest’. 84. vol. 5. vol. pp. B. A. Hall. vol. 119–142. (1995) ‘A monograph of the genus Gigaspora. G. vol. D. Franson. A. y Nicolson. vol. (1950) ‘Present status of biometry’. Giovannetti. J. S. Arora. New York. vol. y Bethlenfalvay. L. pp. 35. J. R. Fogel. 1–76. D. in D. 73.. Biometrics. R. G. P. Gerdemann. vol. B. y Fish. Oliver and Boyd. Australian Journal of Botany. 9. J. vol. Journal of Ecology. vol. J. (1979) ‘A key to the Endogonaceae’. Bever. B. pp. Mycol ogi a. Advances in Microbial Ecology. pp . pp. K. M. pp. A. Rai. Antonovics. D. Jasper.

D. pp. y Walker. Bentivenga. (1985) ‘Species of Gigaspora (Endogonaceae) with roughened outer walls’. (1997) ‘Soil carbon. N. 234 Manual de biología de suelos tropicales . F. D. 100. with two new genera Archaeospora and Paraglomus. pp. 702–720. New Phytologist. E. Ecological Applications. M. (1970) ‘Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection’. J. Mycologia. S25–S32. 55. (1981) ‘Ecology of mycorrhizae and mycorrhizal fungi’. 158–161. D. with an emendation of Glomaceae’. 471–491. Glomales. in D. B. C. (1982) ‘Quantification of vesicular-arbuscular mycorrhizae in plant roots’. St. N. A. (1995) ‘Discovery. B. Advances in Microbial Ecology. D. A. vol. F. in N. Paul. Mycological Research. Mycotaxon. J. L. pp. Kormanik.Johnson. Acaulosporaceae and Gigasporaceae. 7. P. Archaeosporaceae and Paraglomaceae. O. y Benny. y Bever.. 92. y Gemma. 137–210. J. D. y Sieverding E. J. vol. Stribley. 77. C. Koske. F. Mason. D. Zygomycetes)’. y Walker. Koske.. (1985) ‘Mycorrhizal fungi at eighteen apple rootstocks plantings in the United States’. pp. G. 37. (2004) ‘Pacispora. (1989) ‘A modified procedure for staining roots to detect VA mycorrhizas’. B. Journal of Applied Botany. vol. P. pp. Moorman. B. y Last. 171–182. (2001) ‘Two new families of Glomales. 78. Fitter and I. T. Mycologia. y Wedin. 5. S. Oehl. and interpretation of diversity in arbuscular endomycorrhizal fungi (Glomales. vol. CAB International Wallingford. vol. 181–195 Morton. H. Transactions of the British mycological Society. Domoto. y Reeves. 66. R. D. vol. 93. vol. Lewis. B. P. A. vol. y Le Tacon. American Journal of Botany. 73 (suppl. Alexander (eds) Mycorrhizas in Ecosystems. y Hayman. J. II: A bioassay to determine the effect of land disturbance on endomycorrhizal populations’. pp. a new vesicular-arbuscular mycorrhizal fungal genus in the Glomeromycetes’. C. based on concordant molecular and morphological characters’. pp. 14–18. Glomineae and Gigasporineae. (1979) ‘The role of endomycorrhizae in revegetation practices in the semi-arid West. and two new families. Morton. y McGraw. Schenck (ed) Methods and Principles of Mycorrhizal Research. 379–391. E. Philips. 1). 486–505.. y Redecker. Mosse. A. T. H. 261–267. vol. vol. Canadian Journal of Botany. J. (1990) ‘Revised classification of arbuscular mycorrhizal fungi (Zygomycetes): A new order. vol. measurement. E. pp. Miller. R. pp. American Phytopathological Society. two new suborders. pp. Read. J.. P. pp. nutrients and mycorrhizae during conversion of dry tropical forest to grassland’. M. C. P. Morton. Musoko. S. P. pp. 72–82. D. A. (1992) ‘Short-term changes in vesicular-arbuscular mycorrhizal spore populations in Terminalia plantations in Cameroon’. J. C.

L. 17. 105. Spain. D. vol. 163-182. 734–750. 2006. vol. C. C. USA. Appendicispora: a new genius in the arbuscular micorrhiza-forming Glomeromycetes. E. pp.. 74. Schübler. Schenck. D. 1413–1421. W. Canadian Journal of Botany. 282–285. 1883–1889. J. Mycological Research. N. Synergistic Publications. vol. Morton. Y. y Walker. (2000) ‘Diversity and abundance of arbuscular-mycorrhizal fungus spores in tropical forest and pasture’. pp.Picone. Mycotaxon vol 97. (1990) Manual for Identification of VA Mycorrhizal Fungi. B. y Bruns. J. pp. 92. Trappe. H ongos micorrizógenos arbusculares 235 . Phytopathology. B. M. Porter.. 3rd Edition. Stutz. vol. (1996) ‘Successive pot cultures reveal high species richness of arbuscular endomycorrhizal fungi in arid ecosystems’. pp515–519. Mycologia. D. Sieverding. (2001) ‘A new fungal phylum. C. A. Australian Journal of Soil Research. pp. y Morton. (1982) ‘Synoptic key to the genera and species of Zygomycetous mycorrhizal fungi’. J. 1102–1108. J. 32. pp. Gainesville. J. y Oehl. Schwarzott. pp.. C. vol. with a discussion of the genus Archaeospora. T. y Pérez. 72. (1979) ‘Most Probable Number method for enumerating infective propagules of vesicular arbuscular mycorrhizal fungi in soil’. (2000) ‘Molecular phylogeny of the arbuscular mycorrhizal fungi Glomus sinuosum and Sclerocystis coremioides’. F. Redecker. the Glomeromycota: Phylogeny and evolution’. Biotropica. M. vol.

. y Broome) Redecker y Morton G. mortonii Bentivenga y Hetrick G. y Trappe G. manihotis Howeler.) Trappe y Gerd. multisubstensum Mukerji. género Glomus Género/Especies Glomus G. aurantium Blaszkowski. australe (Berkeley) Berch G.) Gerd. Blanke. delhiense Mukerji. corymbiforme Blaszkowski G. przelewicensis Blaszkowski G. y Trappe G. magnicaule Hall G. Bhattacharjee y Tewari G. cerebriforme McGee G. caledonium (Nicol. G. pallidum Hall G. y Schenck G. Tadych y Madej G. antarticum Cabello G.Apéndice 7. clarum Nicol. aggregatum Schenck y Smith G. coronatum Giovannetti G. albidum Walker y Rhodes G. boreale (Thaxter) Trappe y Gerd. Especies de HMA de la familia Glomeraceae. nanolumen Koske y Gemma G. macrocarpum Tulasne y Tulasne G. clavisporum (Trappe) Almeida y Schenck G. G. lacteum Rose y Trappe G. monosporum Gerdemann y Trappe G. coremioides (Berk. melanosporum Gerd. multicaule Gerd. canadense (Thaxter) Trappe y Gerd. citricola Tang y Zang G. pubescens (Sacc. convolutum Gerd. callosum Sieverding G. G. claroideum Schenck y Smith G. laccatum Blaszkowski G. Renker y Buscot G. minutum Blaszk.1. mosseae (Nicol. y Gerd. Gemma y Olexia G. Sieverding y Schenck G. botryoides Rothwell y Victor G. Bhattacharjee y Tewari G. y Trappe G. invermaium Hall G. microaggregatum Koske. y Gerd. y Ellis) Trappe y Gerdemann 236 Manual de biología de suelos tropicales . proliferum Dalpe y Declerck G. constrictum Trappe G. y Bakshi G. arborense McGee G. ambisporum Smith y Schenck G. maculosum Miller y Walker G. pansihalos Berch y Koske G. liquidambaris (Wu y Chen) Almeida y Schenck G. microcarpum Tulasne y Tulasne G.

fasciculatum (Thaxter) Gerd. diaphanum Morton y Walker G. fuegianum (Spegazzini) Trappe y Gerdemann G. Friese. globiferum Koske y Walker G.caf. tubiforme Tandy G. Bloss y Menge G. tortuosum Schenck y Smith G. heterosporum Smith y Schenck G. taiwananse (Wu y Chen) Almeida y Schenck G. G. G. hoi Berch y Trappe G. radiatum (Thaxter) Trappe y Gerd. fragilistratum Skou y Jakobsen G. etunicatum Becker y Gerdemann G. tenebrosum (Thaxter) Berch G. tenerum Tandy emend. sterilum Mehrotra y Baijal G. Blanke. G. Continúa Género/Especies G. y Trappe) Almeida y Schenck G. formosanum Wu y Chen G. dimorphicum Boyetchko y Tewari G.Apéndice 7. G. Renker y Buscot G. rubiforme (Gerd. pustulatum Koske. sinuosum (Gerd. Walker y Dalpe G. geosporum (Nicol.edu. insculptum Blaszkowski G.1. glomerulatum Sieverding G.) Walker G. deserticola Trappe. reticulatum Bhattacharjee y Mukerji G. Walker y Koske G. intraradices Schenck y Smith Fuente: tomado de http://invam. fulvum (Berk. vesiculiferum (Thaxter) Gerd.) Trappe y Gerdemann G. G. trimurales Koske y Halvorson G. warcupii McGee H ongos micorrizógenos arbusculares 237 . viscosum Nicol. fragile (Berk. tenue (Greenhall) Hall G.. Spooner y Ivory G. pulvinatum (Henn. halonatum Rose y Trappe G. McGee G. y Bakshi) Almeida y Schenck G. y Broome) Trappe y Gerd. G. y Trappe G. versiforme (Karsten) Berch G. dominikii Blaszkowski G. y Broome) Trappe y Gerd. y Trappe emend. flavisporum (Lange y Lund) Trappe y Gerd. y Gerd.wvu. segmentatum Trappe. xanthium Blaszk.

bireticulata Rothwell y Trappe A. Chaverri y Rojas A. rugosa Morton A.edu. splendida Sieverding. laevis Gerdemann y Trappe A. excavata Ingleby y Walker A. lacunosa Morton A. denticulata Sieverding y Toro A. myriocarpa Spain.Apéndice 7. spinosa Walker y Trappe A. Reed y Sanders A. thomii Blaszkowski A. Pfeiffer y Bloss A. baltica Blaszkowski E. tuberculata Janos y Trappe A. longula Spain y Schenck A. Sieverding y Schenck A. sporocarpia Berch A. rehmii Sieverding y Toro A. capsicula Blaszkowski A. Especies de HMA de la familia Acaulosporaceae. undulata Sieverding A. géneros Acaulospora y Entrophospora Género /Especies Acaulospora A. mellea Spain y Schenck A. morrowiae Spain y Schenck A. taiwania Hu A. delicata Walker. gedanensis Blaszkowski A. elegans Trappe y Gerdemann A. walkeri Kramadibrata y Hedger Entrophospora E. nicolsonii Walker. koskei Blaszkowski A. schenckii Sieverding y Toro 238 Manual de biología de suelos tropicales . scrobiculata Trappe A.2. paulineae Blaszkowski Fuente: tomado de http://invam. A. polonica Blaszkowski A. dilatata Morton A. cavernata Blaszkowski A. infrequens (Hall) Ames y Schneider4 E.caf.wvu. foveata Trappe y Janos A. colombiana Spain y Schenck E. kentinensis Wu y Liu E.

Especies de HMA de las familias Archaeosporaceae(Género Archaeospora). chimonobambusae Blaszk. boliviana Sieverd. Sieverd. coralloidea Sieverd. y Oehl P.3. occultum (Walker) Morton y Redecker Pacispora P. y Oehl P.Apéndice 7. Daniels y Trappe) Morton y Redecker Ar. trappei (Ames y Linderman) Morton y Redecker Ar. leptoticha (Schenck y Smith) Morton y Redecker Paraglomus P. y Oehl P. robigina Sieverd. franciscana Sieverd. y Oehl P. Paraglomeraceae (Género Paraglomus) y Pacisporaceae (Género Pacispora) Género /Especies Archaeospora Ar. Sieverd. y Oehl Fuente: tomado de Oehl y Sieverding. y Oehl P. y Oehl P. scintillans Rose y Trappe emend.wvu. 2004 y http://invam. gerdemannii (Rose. H ongos micorrizógenos arbusculares 239 .caf. emend.edu. dominikii Sieverd. brasilianum (Spain y Miranda) Morton y Redecker P.

nodosa Blaszkowski S.) Walker y Sanders S. erythropa (Koske y Walker) Walker y Sanders S.) Gerd. nigra (Redhead) Walker y Sanders S. aurigloba (Hall) Walker y Sanders S. Sieverding y Toro S. Gerd. y Herr. pellucida (Nicol. albida Schenck y Smith Gi. y Gerdemann) Walker y Sanders S. alborosea (Ferr. Miller y Walker) Walker y Sanders S. hawaiiensis Koske y Gemma S. géneros Gigaspora y Scutellospora Género /Especies Gigaspora Gi. fulgida Koske y Walker S. y Schenck Scutellospora S. armeniaca Blaszkowski S.) Walker y Sanders S. y Gerd. margarita Becker y Hall Gi. minuta (Ferr. gilmorei (Trappe y Herd. persica (Koske y Walker) Walker y Sanders S. cerradensis Spain y Miranda S. dipurpurascens Morton y Koske S. gigantea (Nicol. decipiens Hall y Abbott Gi. savannicola (Ferr. y Trappe Gi. calospora (Nicol. arenicola Koske y Halvorson S. y Gerd. reticulata (Koske.4. coralloidea (Trappe. y Schenck) Walker y Sanders S. castanea Walker S. Especies de HMA de la familia Gigasporaceae.Apéndice 7.) Walker y Sanders 240 Manual de biología de suelos tropicales .) Walker y Sanders S. y Herr. rosea Nicol. biornata Spain. gregaria (Schenck y Nicol. heterogama (Nicol. dipapillosa (Walker y Koske) Walker y Sanders S. y Ho) Walker y Sanders S.) Walker y Sanders S. y Herr.) Walker y Sanders S.

H ongos micorrizógenos arbusculares 241 .) Walker y Sanders S.wvu.caf.Apéndice 7. spinosissima Walker. verrucosa (Koske y Walker) Walker y Sanders S.4. y Ferr. tricalypta (Herr. Continúa Género /Especies S. scutata Walker y Diederichs S. weresubiae Koske y Walker Fuente: tomado de http://invam. Cuenca y Sanchez S.edu.

.

grupos específicos o un conjunto de predictores. El uso de organismos indicadores. Lodge. 2000). los cuales juegan un importante papel en el reciclaje de nutrientes o son mediadores del equilibrio entre los patógenos y sus antagonistas. podrían ser una alternativa (Hyde. 1988. Pfenning y Lucas Magalhães de Abreu INTRODUCCIÓN Los hongos del suelo juegan un papel clave en los procesos de descomposición que mineralizan y reciclan nutrientes de plantas. En el suelo. La evaluación de la diversidad de hongos en suelos tropicales bajo diferentes usos de suelo es. Los hongos son una parte importante de la cadena alimenticia en el suelo. junto con una metodología precisa. actinomicetos (actinobacterias) y pequeños invertebrados. causando una notable reducción en las cosechas y afectando su calidad. 1997a y b). principalmente para la mesofauna que habita en el suelo (Bonkowski et al. existen dos condiciones básicas. debido al tiempo y la limitación de los recursos. Las investigaciones deben ser diseñadas en forma de estudios a largo plazo donde intervengan especialistas en taxonomía y micología. Cuando un estudio de largo plazo involucra varios especialistas no resulta viable. Las actividades agrícolas pueden afectar la diversidad de organismos presentes en el suelo.. (Wainwright. 1993). por lo 243 . En los ecosistemas agrícolas.Capítulo 8 Hongos del suelo saprófitos y patógenos de plantas Ludwig H. los patógenos de plantas actúan en el suelo y en la rizósfera. los hongos interactúan con una compleja comunidad microbiana que incluye: bacterias. Para poder obtener una evaluación confiable de la diversidad de los hongos del suelo.

. Los métodos estándares aceptados para inventariar la diversidad de hongos o para evaluar su impacto en varias prácticas agrícolas u otras actividades humanas. No obstante. un objetivo del proyecto CSM-BGBD. 1992. 2001). junto con muchos grupos homogéneos como el filum Glomeromycota. y su crecimiento en un medio de cultivo axénico para su posterior identificación y cuantificación... tales como fila de Eubacterias. la mayoría de los hongos que habitan en el suelo pueden ser considerados saprotróficos.. Muyzer et al. Los métodos utilizados para el aislamiento del suelo. medios de cultivo parcialmente selectivos y adictivos que reducen el crecimiento de ciertos grupos de hongos. Bills et al. un grupo monofilético de organismos de hongos obligados asociados a las raíces de las plantas (véase Capítulo 7). 1990. con diferentes medios de cultivos y estrategias de aislamiento. puede no ser representativo de la dinámica de las comunidades del suelo. que cubran las diferentes idiosincrasias de la diversidad taxonómica y grupos fisiológicos de hongos presentes en los ecosistemas del suelo. Davet y Rouxel. Los procedimientos clásicos microbiológicos para estudiar los hongos del suelo se basan en cultivos que implican el aislamiento de propágulos microbianos o hifas activas que crecen en el suelo. 1990. aún no están disponibles. deben ser capaces de crecer en cultivos axénicos. han sido revisados por varios autores (Frankland et al. 2000. 2004). Gams. 2000). rizósfera y hongos rizoplanos. 1993.. Singleton et al. 1996. Incluso el análisis de abundancia relativa de especies cultivables recuperadas del suelo.. Una medida confiable de las comunidades de hongos en el suelo sin prejuicios requiere del seguimiento de un laborioso programa de aislamientos sistemáticos. tales como suelos que muestran limitaciones inherentes debido a la naturaleza de las especies y la inhabilidad de los medios de cultivo para copiar con exactitud los hábitats del suelo (Tsao et al. afirmaciones genéricas de que únicamente el 1% de los “microorganismos” del suelo son cultivables aumentan la dificultad y no tienen en cuenta la inmensa diversidad biológica que realmente representan dichos microorganismos (Rondon et al.. 1997). Sin embargo.. (1992). Una visión global de los métodos para estudiar hongos patógenos de plantas en el suelo fue descrita por Singleton et al. Se ha progresado considerablemente utilizando técnicas de lavado.tanto. Gray. 244 Manual de biología de suelos tropicales . Dentro de este grupo se encuentran grupos filogenéticamente diversos. debido a que los medios de cultivo imponen nuevas condiciones selectivas y pueden introducir un sesgo en los análisis (Liu et al. 1992. por lo tanto. Bridge y Spooner. 1983. Cannon. Las metodologías para aislar y cultivar hongos de ecosistemas complejos.

se deberá tomar en cuenta que el suelo no es un sustrato. 2003. Houston et al. Malosso et al. Aunque este enfoque no es exhaustivo. generalmente aceptados. por sí solos. raíces vivas. También son tomados en cuenta los principios y aplicaciones de herramientas moleculares en los estudios de comunidades de hongos del suelo. esta característica complica las definiciones y la metodología. el suelo alberga una parte considerable de la biodiversidad total de hongos. El objetivo principal es contribuir al establecimiento de una serie de métodos estándares.. 2006).. exudados. además. junto con minerales y agua. Los resultados obtenidos de un estudio de hongos del suelo dependen. Con estos fines. sino un ecosistema compuesto por una mezcla de sustratos más diversos que incluyen partes de las plantas vivas y muertas. se requieren los procesos de aislamiento e identificación tradicionales (Brodie et al. LA IMPORTANCIA ECOLÓGICA DE LOS HONGOS DEL SUELO El suelo es un hábitat o ecosistema. 1973. 1998. respiración del suelo. En este capítulo se hace referencia a algunos de los métodos más comunes y también a algunas técnicas menos conocidas para la evaluación y monitoreo de comunidades de hongos del suelo.Otras metodologías que han sido desarrolladas se enfocan en el análisis de la actividad de los hongos y su papel en los procesos biogeoquímicos que ocurren en el suelo. cada método presenta ciertas preferencias a ciertos grupos específicos de hongos. 2003). No obstante. Por ello. microorganismos. estos métodos proporcionan. pequeños invertebrados y contenidos intestinales.. Brodie et al. animales y otros microorganismos. y no existe ninguna estimaHongos del suelo saprófitos y patógenos de plantas 245 . porque el suelo representa una mezcla compleja de fracciones orgánicas e inorgánicas con agua y organismos vivos. de los métodos utilizados. y no un sustrato. Las fracciones orgánicas se componen de material de plantas en diferentes fases de descomposición. poca información acerca de las especies de hongos involucrados en dichos procesos. por lo tanto. Por esta razón. para un mejor entendimiento de la estructura y función de las comunidades de hongos del suelo.. es necesario adoptar métodos similares dentro de los proyectos cooperativos o multidisciplinarios para garantizar la comparación de los datos en un futuro. intenta ofrecer una visión global de los procedimientos disponibles. principalmente. reciclaje de nitrógeno y contenido de ácidos grasos del hongo o de observaciones directas del crecimiento del micelio en partículas de suelo (Widden y Parkinson. En general. se han aplicado métodos que dependen del análisis de la biomasa microbiana del suelo.

2001). Lodge. aunque la mayoría ataca una amplia gama de plantas hospederas. los patógenos de plantas y sus antagonistas son particularmente importantes. 1997.. 2007. 1991. 2000). beneficiar directamente la agricultura sustentable. mientras los ascomycetes descomponen principalmente celulosa y hemicelulosa (Domsch et al. 1993). En sistemas agrícolas. por tanto. 1997). 1997). mineralizando y reciclando los nutrientes de las plantas (Wainwright. Lodge.ción fidedigna del número de especies de hongos del suelo (Hawksworth. 1980.. Existen evidencias de que las prácticas agrícolas causan más alteraciones cuantitativas que cualitativas en la comunidad de microhongos del suelo (Pfenning. Se ha demostrado experimentalmente que la introducción de antagonistas específicos como Trichoderma spp. Silva et al. por ende. Zak y Visser. 2004). Los saprófitos tienen una especificidad limitada por sustratos.. o Coniothyrium minitans pueden reducir la incidencia de una variedad de enfermedades en el suelo (Whipps et al. una mejor estructura física del suelo y el control de antagonistas de los patógenos de las plantas en el suelo. mediante el suministro de nutrientes. Schneider. Barratt et al. Algunos elementos biológicos han sido identificados como los principales factores de la supresión de enfermedades (Chet y Baker. Los patógenos de plantas actúan en el suelo. Hawksworth y Rossman.. especialmente en el caso de la mesofauna (Bonkowski et al. 2003). El mantenimiento de la diversidad de hongos del suelo debería. 1997). plantas utilizadas como cubierta vegetal y la diversificación de cultivos. 1996. Beare et al. cabe mencionar que los hongos son responsables de la degradación de xenobióticos y contaminantes orgánicos introducidos en el suelo (Bordjiba et al. Con relación al papel de los organismos descomponedores. 1993. Rodrigues-Guzman. 1984. Mazzola. 246 Manual de biología de suelos tropicales . en la rizósfera o infectan tallos. 2001. tales como la incorporación de materia orgánica. 2003. 1988. provocan grandes pérdidas. pero también es posible que se mantenga o incremente con algunas prácticas agrícolas específicas.. los zygomycetes usan carbohidratos simples. La supresión de patógenos de plantas puede resultar intrínseca en los suelos. 2002. por ejemplo. Los hongos del suelo juegan un papel clave en los procesos de descomposición. Éstos pueden ser específicos... causando que las plántulas se marchiten y. Los hongos también constituyen una parte importante de la cadena alimenticia dentro del suelo.

Dentro de este reino se reconocen cinco fila: los géneros que pertenecen al filum Glomeromycota forman micorrizas arbusculares y no crecen en ausencia de su planta hospedera (Schußler et al. 2001). las cuales se presentan en la sesión “Procedimientos basados en cultivos”. aunque también pueden encontrarse en el suelo. Chromista Los hongos que son derivados de algas y que contienen celulosa como el mayor componente en su pared celular pertenecen al reino Chromista Filum Oomycota (Dick. Kirk et al.habitan en restos de plantas.. Dentro del grupo de los Oomycetes del suelo es posible encontrar saprófitos.ASPECTOS DE SISTEMÁTICA MODERNA Protozoa Los organismos conocidos como hongos actualmente se agrupan en tres reinos. 2001. La detección de estos organismos requiere de bioensayos o cebos. 2001. Plasmodiophora brassicae o Polymyxa graminis. como se discutió en el Capítulo 7. Los hongos del reino Protozoa no son numerosos. Hongos del suelo saprófitos y patógenos de plantas 247 . Por sus características biológicas requieren de técnicas específicas para su aislamiento y caracterización. 2002). otros habitan en el suelo. 2001). tales como Spongospora subterranea. aunque algunos de ellos son importantes patógenos de las plantas del suelo. su hábitat e importancia ecológica son variables. Estas especies se clasifican en la clase Plasmodiophoromycetes. con un sistema de clasificación filogenético (Kirk et al. Trabajar con este grupo de simbiontes biotróficos obligados requiere del uso de diferentes técnicas específicas... Los hongos llamados mohos mucosos -un grupo de organismos heterogéneos y polifilético. Glomeromycota Los hongos clasificados en el reino Fungi se caracterizan por tener quitina como el mayor componente en su pared celular. Moreira y Siqueira. así como otros géneros patógenos de plantas. A pesar de que estos hongos representan un grupo delimitado de acuerdo con sus características y filogenia. Mientras que algunos son verdaderos hongos acuáticos asociados con restos de plantas en agua o con patógenos de otros organismos acuáticos.

Para fines prácticos. insectos. en el suelo y en restos de plantas.. Zygomycota Representan el filum Zygomycota y se consideran como hongos de azúcar por su preferencia por carbohidratos simples y por su crecimiento vigoroso en un cultivo axénico. Varias de estas especies se conocen como trasmisores de virus patógenos de plantas (Krik et al. pero normalmente son acuáticos y viven como saprófitos o parásitos de otros organismos como nematodos. La fase asexual de los ascomycetes se llama anamórfica y es la fase más comúnmente encontrada. Mortierella o Rhizopus son muy comunes en el suelo y se encuentran en casi todos los estudios de hongos de suelo.Chytridiomycota El único grupo dentro del reino de los hongos que forma esporas flageladas es el filum Chytridiomycota. una estructura formada durante la fase sexual de su ciclo de vida. distinguir los grupos más importantes. un meiosporangio en el que generalmente se forman cuatro esporas sexuales (Bauer et al. Se caracterizan por la formación de las ascas. Muchos de ellos forman ectomicorrizas en asociación con el sistema de raíces de árboles forestales. Ascomycota El filum Ascomycota representa el grupo más abundante de hongos. Especies de los géneros Absidia.. Gongronella. por lo general. Cunninghamella. La filogenia de este grupo aún es objeto de discusión y de revisión. tales 248 Manual de biología de suelos tropicales .. plantas u otros hongos. Los patógenos de plantas importantes en el suelo son especies de Rhizoctonia y Sclerotium. La evaluación de la diversidad de estos hongos y el monitoreo de su impacto en la comunidad requieren de técnicas específicas (Rossman et al. Basidiomycota El filum Basidiomycota se caracteriza por el basidium. 2008). 2006) y en la mayoría de los casos por la formación de un cuerpo fructífero. algunos de estos hongos habitan en el suelo. 1998) que no son consideradas en este manual. El micelio vegetativo se desarrolla. Mucor.

Cada juego de 12 muestras se homogenizan para formar una muestra compuesta de alrededor de 500 g que se coloca en una bolsa de plástico. ascomycetes que forman un asca en un cuerpo fructífero cleistotecal. preferentemente a 4°C y congelarse lo más pronto posible para su futuro procesamiento. EVALUACIÓN DE LOS HONGOS DEL SUELO: PROCEDIMIENTOS BASADOS EN CULTIVOS Todos los métodos propuestos dependen de muestras del suelo y no contemplan el uso de raíces para aislar hongos del suelo. pyrenomycetes y loculoascomycetes puede ser útil. MUESTREO DE SUELO Utilizando un nucleador se extraen pequeñas cantidades de suelo. De manera alternativa. Todos los materiales de muestreo (nucleador. etc. con el fin de evitar la contaminación entre puntos de muestreo. 2008). Algunos de los ascomycetes como Aspergillus y Penicillium que habitan en el suelo. Probablemente. utilizando plantas altamente susceptibles. espátula. Para la extracción del DNA. La rizósfera también contiene una alta concentración de bacterias que. a pesar del uso de antibióticos en los medios de cultivo. a una profundidad de 20 cm en 12 puntos distribuidos en cada parcela de muestreo de acuerdo con el esquema mostrado en el Capítulo 2. tres o más muestras compuestas podrán colectarse en cada punto de muestreo. debido a que la micobiota de la rizósfera es altamente influenciada por las especies de plantas. azadón. las muestras del suelo deberán trasladarse al laboratorio utilizando un recipiente con aislamiento. También se recogerá una segunda muestra compuesta de alrededor de 200 g. La hojarasca deberá ser removida justo antes de extraer la muestra. el grupo más grande de hongos encontrados en el suelo son los pyrenomycetes anamorfos (Krik et al.. pueden resultar contraproducentes para la recuperación de especies de hongos. en caso de que se haya previsto realizar otros análisis físicos y químicos del suelo. Hongos del suelo saprófitos y patógenos de plantas 249 . la detección y el monitoreo de los hongos de organismos protistas como Spongospora y Plasmodiophora puede llevarse a cabo mediante bioensayos. pertenecen a los plectomycetes. si los recursos lo permiten. discomycetes.) deberán lavarse antes y después de tomar las muestras. Debido a su pequeño tamaño y estructura poco diferenciada.como plectomycetes.

La ilustración A) representa una muestra de suelo con cebo. la C) muestra un cultivo puro en el cebo y en la D) se observa el esporangio de Phytophthora.5 g colocadas en tubos de ensayo de vidrio esterilizado con 3 ml de agua estéril. Este procedimiento deberá continuarse durante varias semanas. Tsao et al.. agar dextrosa y papa (ADP) o agar de papa y zanahoria (en el caso de Pythiaceae) (véase Apéndice 8. en la sección de color de este manual. Gams et al.. en la última ilustración F). El micelio del hongo formado en el sustrato deberá traspasarse a charolas con el medio MP5 (en el caso de Saprolegniaceae) y agar con harina de maíz (AHM). Después de incubar durante tres a cinco días. Especies de Pythium y Phytophthora pueden causar serios daños a plantas cultivadas. 250 Manual de biología de suelos tropicales . después se comprueba la presencia de micelio en el cebo. Se añaden granos de sorgo como cebo y se incuban por cinco días. Otra técnica con sustrato susceptible utiliza muestras de suelo húmedo de 0. Pueden llevarse a cabo ensayos cuantitativos utilizando la frecuencia de la colonización relativa de los tejidos del cebo entre las réplicas de cada muestra de suelo. 2000). El aislamiento de hongos zoospóricos (Oomycetes. 1970. las porciones de agar que contengan micelio serán transferidas a placas con agua estéril destilada y con dos mitades de semillas de sorgo. Las hojas de zacate como cebo pueden ser sustituidas por pedazos de frutas o verduras como pepino. Edena et al. tomate o papa. Las muestras son incubadas durante tres a cinco días a 25°C en la oscuridad. Los tejidos infectados deben transferirse en agua estéril con el antibiótico cloranfenicol durante unas horas.Oomycota: uso de cebos para el aislamiento de Pythium y Phytophthora Para poder recuperar del suelo los oomicetes es aconsejable el uso de plantas susceptibles o tejidos vegetales. Alícuotas de 2 g de suelo se traspasan a cajas Petri que contienen agua estéril destilada. 1983. 1998. finalmente. El micelio en crecimiento se verifica directamente mediante montajes con agua en un microscopio o se transfiere del cebo al medio de aislamiento (AHM) que contiene cloranfenicol (50 mg L-¹) y benomil (10 mg L-¹) (Marks y Mitchell..1 para la composición del medio). Se esterilizan en autoclave fragmentos de hojas de zacate y se añaden a los tubos como tejidos para recuperar el Pythium spp. la B) una muestra de agua con cebo. Chytridiomycetes) de muestras ambientales aparece en la ilustración 6. Al final de dicho procedimiento se deberá observar que se obtiene únicamente un aislamiento para cada placa. mientras que el oogonio y anteridio de Pythium se ilustran en E)”. se observa la liberación de zoosporas de Pythium.

después decantada usando un tamiz de 0.Uso de cebos para el aislamiento de Chytridiomycota Para evaluar los Chytridiomycota se usan las mismas técnicas empleadas para los oomicetos. Basidiomycota – Rhizoctonia: técnica de cebo y aislamiento directo de partículas de suelo Para evaluar este género de basidiomicetes anamórficos del suelo. 1998). Técnica de cebo Se mezcla 1 g de semillas de betabel con 100 g de suelo húmedo en cajas Petri. y pedazos de frutas y verduras (Gams et al. Un método para evaluar la densidad de inóculo de Rhizoctonia spp. El suelo retenido se resuspende y se pasa varias veces por el tamiz. posteriormente. piel de serpiente. Como el aislamiento de colonias individuales en un medio de cultivo axénico es difícil. Para su preservación.5 mm. la caracterización e identificación se hace directamente en el cebo. los cebos pueden transferirse a viales. se describen varios métodos. se verifica el crecimiento típico de Rhizoctonia. se lavan con agua destilada durante Hongos del suelo saprófitos y patógenos de plantas 251 . (1991).. se recuperan las semillas con un tamiz de 1. alas de insectos. se evalúa la frecuencia de la colonización en las partículas del suelo y el micelio se transfiere a ADP para su eventual caracterización (Sneh et al. A continuación. Después de un periodo de incubación de 24 a 48 horas.5 mm.. Las partículas de suelo retenidas se secan con papel absorbente estéril y se transfieren a una caja Petri de 15 cm de diámetro que contenga un medio de agar con agua acidificada (al 2%) con 250 mg L-¹ de cloranfenicol. 1991). Después de un periodo de incubación de 48 horas a 25°C. a 25°C. Los cebos más apropiados incluyen cáscara de camarón. Método de partículas de suelo Una suspensión de 10 g de muestra de suelo y agua de la llave es agitada. en suelos de jardines de eucaliptus clonados fue descrito recientemente por Sanfuentes et al. (2002). se presentan dos métodos de aislamiento útiles. compilados por Sneh et al.

0 mm. 0.7 mm. el sobrenadante se desecha y se repite el procedimiento dos veces.. 2002). en estos suelos. Después de la sedimentación de las partículas del suelo durante 2 minutos. como la amplificación de DNA ribosomal de Rhizoctonia con iniciadores (en inglés. secados con papel absorbente esterilizado y transferidos (7 partículas por placa) a 5 cajas Petri (90 mm) que contienen el medio de aislamiento AHM (30 g L-¹).21 mm usando agua destilada (alrededor de 2 litros) por 2 minutos. fitopatógenas y sus antagonistas. 0. La frecuencia de colonización de partículas de suelo para cada especie de hongos es utilizada en ensayos cuantitativos. que contenga 100 mg L-¹ de cloranfenicol. para la inhibición de hongos de rápido crecimiento. se secan con papel absorbente estéril para ser transferidas a un medio de agar con agua al 2%.20 minutos.5 mm y 0. primers) específicos y su análisis cualitativo e incluso cuantitativo puede resultar idóneo bajo circunstancias específicas (Lees et al. Los coloidales de suelo y granos de arena son removidos del último tamiz. A pesar del uso común de varios métodos para el aislamiento de Rhizoctonia de muestras de suelo agrícola. más estreptomicina plus (50 mg L-¹) para la inhibición de bacterias y ciclosporina (10 mg L-¹) o rosa de Bengala (70 mg L-¹). entomopatógenas. 1975). Cuando se emplea ciclosporina se logra una supresión casi completa 252 Manual de biología de suelos tropicales . Técnica de lavado Una muestra de 10 g de suelo mineral se agita con 200 ml de agua destilada en una centrífuga a 180 rpm durante 10 minutos.. ha mostrado severas limitaciones debido a la continua presencia de Trichoderma spp. su aplicación en el estudio de suelos bajo vegetación natural. El crecimiento de Rhizoctonia se verifica y se transfiere micelio a ADP para su aislamiento y caracterización (Papavizas et al. Todas estas especies exhiben una fase saprotrófica en el suelo y pueden ser aisladas utilizando una metodología con placas de suelo. por el grupo de investigadores involucrados en el proyecto. La técnica de lavado de suelo es un método adecuado para el aislamiento de estas especies. De esta manera. Las partículas de suelo prelavadas son filtradas. utilizando un juego de tamices de 1. el empleo de técnicas de cultivo independiente. Ascomycota: técnica de lavado del suelo y filtración de partículas Éste es el mayor grupo de hongos del suelo que incluye especies saprófitas.

Este método se puede observar en la ilustración 7.. Las alícuotas de la dilución final son distribuidas en cajas Petri que contienen un medio de agar generalmente. Tsao et al. 1994. Un gran número de medios selectivos ha sido desarrollado para el aislaHongos del suelo saprófitos y patógenos de plantas 253 . 1985. éstos pueden contener fuentes de carbono preferiblemente metabolizados por algunos grupos fisiológicos de hongos o pueden modificarse con químicos que inhiben el crecimiento de organismos no deseados. y que tienen poca habilidad de competir con especies de rápido crecimiento en medios axénicos son subestimados por esta técnica (Bååth. se toma 10% de la suspensión. Bills y Polishook. estreptomicina o penicilina para inhibir el crecimiento de bacterias. Kacprzak y Stanczyk-Mazanek. 2003). se debe evitar el uso de ciclosporina (Dhingra y Sinclair. 1988. 1985). Existe una preocupación generalizada porque el método de dilución en placas muestra un sesgo hacia los hongos que son capaces de producir grandes cantidades de esporas y que crecen muy rápido en un medio de cultivo rico. 1998.. una cantidad conocida de suelo es suspendida en agua estéril. rutinariamente se utilizan medios selectivos. Bååth. Se pueden lograr medidas cuantitativas multiplicando el promedio de las unidades formadoras de colonias (UFC) en las placas. 1983). el resultado es una estimación del número de propágulos de hongos por gramo de suelo (Bills et al. hasta lograr la dilución final. la diversidad de hongos que normalmente existen en forma de micelio que crece activamente en el suelo. 1992. Por lo tanto.. modificado con antibióticos como cloranfenicol. 1988. cuando se trata de estudiar este último grupo de hongos. Por lo tanto. la cual se mantiene en agitación durante unos momentos. De esta suspensión se prepara una serie de 10 diluciones. Gams et al. 2004). Gams. por el factor de dilución empleado. Básicamente.de zygomycetes saprotróficos. El método de dilución del suelo en placa Este es el método de uso más común para el aislamiento y estimación cuantitativa de bacterias y hongos. 1986. Un factor final de dilución de 10-4 ó 10-5 se considera adecuado para el aislamiento de hongos (Dhingra y Sinclair. La técnica es muy simple y se han descrito varias modificaciones. Ascomycota: medios selectivos y técnica con cebo Para un aislamiento selectivo de grupos blanco o especies de hongos del suelo. Lang y Jagnow.

el tejido cebo es incubado con una muestra de suelo durante unos días. 1975. para el aislamiento de Rhizoctonia solani se utiliza agua-agar acidificada. 2003). En el laboratorio se utilizan hojas de ricino (Ricinus communis) como cebo para el aislamiento de hongos del complejo Cylindrocladium de manera rutinaria. varios materiales de plantas adecuados para su aislamiento fueron descritos en una monografía reciente (Crous. Papavizas et al. Edel et al... Ejemplos de cebos utilizados para el aislamiento selectivo de hongos del suelo son tejidos de plantas para el caso de patógenos de plantas.. 1998). Sneh et al. especies de Cylindrocladium y de las especies relacionadas Cylindrocladiella y Gliocladiospsis raramente son reportadas en muestras de suelo que emplean el método de dilución del suelo por placas. A pesar de ello. Edena et al. 2000. 2002.. después se transfiere a un medio selectivo de agar para su posterior aislamiento de los hongos deseados. Pettitt et al. 1991.. en particular.. 1998.miento de varios géneros de ascomycetes. deberán aislarse selectivamente usando cebos. Hojas jóvenes y frescas se recogen y se lavan bajo agua de la llave para posteriormente ser sometidas a una desinfección con etanol al 70% durante un minuto. Gams et al. basidiomycetes y oomycetes del suelo.. Gonçalves et al. En la mayoría de los casos. quitina para los productores de quitinasa. utilizando como cebo hojas de Ricinus communis Cylindrocladium es un género conformado por especies saprotrófitas y patógenas de plantas comúnmente encontradas en el suelo.. cabello para las especies queratinofílicas. el medio usado es Komada (Masago et al. Sneh et al. La colonización del cebo por un hongo clave también puede llevarse a cabo mediante la observación directa al microscopio (Gams et al..1987. Wellington et al. Procedimiento para el aislamiento para el aislamiento de Cylindrocladium y géneros afines del suelo. El aislamiento selectivo de los hongos del suelo también puede llevarse a cabo con cebos que son colonizados por grupos fisiológicos específicos de hongos. 2002b).. aquéllos que contienen especies patógenas de plantas. Dackman et al. cuyo protocolo se describe a continuación. 1970.. Como el Cylindrocladium y probablemente otros géneros son sensibles a la ciclosporina... 2001. 1983. Dhingra y Sinclair. mientras que para Fusarium spp. 1977. Barratt et al. 2003. 1991. 1996. Thorn et al. larvas de insectos para los entomopatogénos y nematodos para los hongos nematófagos (Marks y Mitchell. Tsao et al. 254 Manual de biología de suelos tropicales . 2001). por ejemplo... 1985.

durante 30 segundos). bajo un microscopio estereoscópico (Gams et al. Gliocladiospsis y otros géneros relacionados. Cylindrocladiella. después de tres días de incubación se lavan las hojas cuidadosamente con agua destilada y se transfieren a una cámara húmeda.. IDENTIFICACIÓN DE HONGOS DE SUELO La identificación de hongos que habitan el suelo puede causar problemas para aquéllos que no tengan suficientes conocimientos de micología. 2001. 2002b). Después de más de 20 años.. Los tejidos de plántulas infectadas se esterilizan con hipoclorito de sodio (al 2%. este compendio contiene claves para especies de varios géneros importantes y una recopilación de la literatura. (2007) aún sigue siendo una fuente importante para todos los involucrados en el estudio de hongos del suelo. Las hojas enteras se colocan un una caja Petri de 15 cm y se cubren con una capa de suelo húmedo. 1998. Gonçalves et al. incluyendo hongos del suelo. Además de las claves y monografías de alrededor de 250 géneros. utilizando agujas finas de cristal. el amplio trabajo de Domsch et al. síntomas de podredumbre. endófitos y patógenos de plantas.seguida de hipoclorito de sodio al 3%. tal como ADP y AM (agar extracto de malta) que contiene cloranfenicol (250 mg L-¹). por lo tanto. es recomendable para su aislamiento el uso de plántulas de tomate como cebo. El trabajo de Barnett y Hunter (1998) es usado para unos pocos de los muchos saprófitos. Las dificultades de identificar a nivel de especie se ilustran con el género Fusarium. El aislamiento del hongo se logra con la transferencia de esporas a un medio de cultivo. donde diariamente se verifica la esporulación típica de Cylindrocladium. Crous. enseguida se lavan con agua destilada y se secan en papel absorbente esterilizado para ser transferidas a un medio de aislamiento. Técnica de cebo para el aislamiento de patógenos fúngicos de plántulas Una amplia gama de hongos patógenos de plantas en el suelo puede causar la muerte prematura de las plántulas. que es un grupo heterogéneo que incluye saprófitos. Las semillas de tomate se germinan en 100 g de suelo y se verifica si las plántulas manifiestan o no. Las hojas utilizadas sin desinfección previa tienden a ser degradadas con mayor rapidez y a ser colonizadas por bacterias. Hongos del suelo saprófitos y patógenos de plantas 255 . durante dos minutos.

. Muyzer et al... éstos incluyen técnicas específicas de DNA.. Nag Raj. Las secuencias de DNA son amplificadas directamente desde el suelo por medio de la reacción en cadena de 256 Manual de biología de suelos tropicales . Para más instrucciones acerca de cómo identificar hongos o grupos específicos de hongos. sin embargo.Monografías y páginas web se encuentran disponibles para identificar las especies de Aspergillus. 1996). 2004). 1993). Bridge y Spooner. Penicillium (Pitt. 1983.. b. (Klich y Pitt 1988). Existen monografías disponibles para chyrids (Karling 1977) y también para el género Pythium (Waterhouse. 2000). La monografía de Sheh et al.. No obstante. 2006). 1984. 1998a. Samson et al. 1967. (página web). Trichoderma (Bissett.. de mucha utilidad para este tema otras recopilaciones y monografías como la de Ellis y Ellis (1985).. Si se trata de identificar ascomycetes. 2001. 1976) y coelomycetes anamórficos (Sutton.. Una lista de referencias de guías y manuales para la identificación de grupos de hongos de suelo puede consultarse al final de este capítulo. (1998). (2000) o el manual de Gams et al. van der Plaats-Niterink. 1991a. 1980. No son específicas para el caso de hongos del suelo. Samuels et al. b) pueden ser un buen punto de partida. requiere de un laborioso programa de aislamientos sistemáticos con diferentes medios de cultivos y estrategias de aislamiento que reflejen la inmensa diversidad taxonómica y fisiológica de grupos de hongos que habitan en el suelo (Tsao et al. las monografías y claves de Hanlin (1990. 1968. 1983. 1971. c. sí. Bills et al. 1981) y para Phytophthora (Waterhouse. Cylindrocladium (Crous. 2002b). se puede consultar el Dictionary of the Fungi (Kirk et al. Tsao et al. 2001). Fusarium (Leslie et al.. Erwin y Ribeiro. en ensambles de hongos a partir de muestras ambientales. recientemente. (1991) resulta útil para trabajar con Rhizoctonia. Las herramientas moleculares basadas en el análisis del DNA han sido aplicadas con éxito en el estudio de complejos bacterianos y. 1970. hifas anamórficas pigmentadas (Ellis. Se pueden utilizar otras metodologías para complementar los enfoques tradicionales usados para un mejor entendimiento de la diversidad y dinámica de los hongos del suelo. algunos tipos de hongos como Basidiomycota son difíciles de aislar y pueden no esporular en un medio axénico (Thorn et al. 1993. 1996). EVALUACIÓN DE HONGOS DEL SUELO: TÉCNICAS ESPECÍFICAS DE DNA Una medida confiable de las comunidades de hongos del suelo.

en los procesos físicos de macerado asociado con calor y lisis química. 2001). es la extracción del DNA directamente del suelo. Extracción de DNA Un paso crucial antes del PCR. La heterogeneidad encontrada a nivel de micro-escala en el suelo debe ser considerada cuando se selecciona el tamaño de la muestra de suelo sometida a la extracción total de DNA..la polimerasa (PCR) y posteriormente caracterizadas utilizando varios enfoques (Bridge y Spooner. La identificación de secuencias de DNA desconocidas también puede realizarse comparándolas con bases de datos de secuencias de nucleótidos de taxones conocidos. Reacción en cadena de la polimerasa. principalmente. Las células de los hongos presentes en la muestra del suelo. El polimorfismo en la longitud del DNA y la variación en la secuencia de las bases pueden utilizarse para agrupar organismos de acuerdo con su origen y relación evolutiva. incluso como micelio o esporas..8S y 28S se considera que son altamente conservados entre los organismos eucarióticos y normalmente se emplean como marcadores moleculares. El total de DNA obtenido debe estar completamente purificado para eliminar sustancias húmicas y fenólicas que interfieren con el PCR. Las muestras muy pequeñas (menores a un gramo) deben usarse con precaución porque tienen mayor probabilidad de error. El rDNA también contiene espaciadores entre las regiones codificantes conocidos como espaciadores internos de transcripción (ITS) que presentan secuencias de bases menos conservadas y que pueden utilizarse para la diferenciación entre especies relacionadas o para evaluar Hongos del suelo saprófitos y patógenos de plantas 257 . Los protocolos de extracción se basan. Uso de Primers específicos para “hongos” El grupo de genes para las moléculas de RNA Ribosomales 18S. este paso se logra mediante separaciones a través de columnas de separación o con el uso de kits comerciales de purificación de DNA (Liu et al.. 5. tienen que estar correctamente lisadas. Viaud et al. debido a una variabilidad más alta dentro de la muestra (Ranjard et al. 2000. Bridge y Spooner. 2001). facilitando la amplificación de pequeñas muestras de DNA. 1997. Los kits para la extracción de DNA del suelo están comercialmente disponibles. 2001). Varias copias del DNA ribosomal (rDNA) se encuentran en el genoma eurocariota.

son difíciles de detectar por métodos moleculares. El DNA clonado es secuenciado y comparado con las bases de datos que contienen secuencias oligonucleotídicas del rDNA fúngico mediante análisis de software. 2003). han sido desarrollados y compilados por Anderson y Cairney (2004). Para este tipo de investigación se han desarrollado varios iniciadores especie-específicos para una detección directa y el monitoreo de patógenos de estas plantas a partir de muestras del suelo (Cullen et al. 2000. 2002. extraídos de matrices de gel. Borneman y Hartin.. la detección molecular de muestras de suelo puede ser mejorada mediante el uso de técnicas de cebo en conjunto con PCR. consumen tiempo y. los amplicones de tamaño correcto pueden separarse en geles de agarosa.. Por 258 Manual de biología de suelos tropicales . Secuenciación del DNA Para poder conocer las identidades del DNA de los hongos amplificados por PCR. La detección y/o cuantificación de pocas especies específicas de hongos es requerida generalmente en el campo de la fitopatología. conectados a vectores plásmidos y clonados en células bacterianas. utilizando Primers específicos para Géneros y/o especies de interés (Nechwatal et al. ya que el PCR tiende a amplificar moléculas del DNA que son dominantes en el extracto del DNA total. Algunos hongos que están presentes en muy bajas densidades en suelos naturales. Sin embargo. Filion et al. Down.. además. Los Primers permiten la amplificación de una amplia gama de especies de hongos sin perder la especificidad de este grupo clave.. el obtener Primers o iniciadores de rDNA de hongos específicos constituye un paso fundamental en la amplificación del PCR. Como el suelo contiene un gran número de organismos. no son adecuados para la evaluación de muestras ambientales complejas. los Primers que son específicos para amplificar PCR del DNA de hongos de muestras complejas de suelo. En el caso de estos hongos. 2002.divergencias genéticas intraespecíficas (Viaud et al. 2001). Estos procedimientos son caros. 2002). purificados. 2003). Basándose en las secuencias de genes de RNA ribosomal disponibles en bancos de datos especializados para varias especies de hongos. 1999. algunos de estos Primers específicos han mostrado que amplifican DNA no fúngico o muestran preferencia hacia la amplificación de grupos taxonómicos específicos dentro del reino de los hongos (Smit et al.. Anderson et al. Lees et al.. tales como especies de Phytophthora.. 2000.. Baayen et al. 2000.

parcialmente desnaturalizadas debido a las diferencias de la desnaturalización de los dominios menos estables en las moléculas.. contienen un DNA con bases repetitivas de GC que resultan menos propensas a la desnaturalización debido a su alta estabilidad química. Milling et al. el DNA se extiende a la misma longitud (como resultado del PCR). al igual que para monitorear modificaciones o impactos debidos a prácticas agrícolas o actividades industriales (Smit et al. Varias combinaciones de Primers han sido propuestas para amplificar DNA de distintos grupos de hongos como Ascomycota. Basidiomycota. Elsas et al. lo que determina el modo de desnaturalización y la movilidad electroforética al migrar en el gel desnaturalizante... Los patrones de bandeo generados son utilizados para analizar complejas comunidades de hongos del suelo. Las restricciones y limitaciones están representadas en la selección de Primers utilizados en el primer paso de amplificación después de la extracción total del DNA de las muestras. las moléculas 18S DNA amplificadas por PCR son sometidas a una electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) o con un gradiente desnaturalizante (DGGE). Los amplicones tienen exactamente el mismo número de nucleótidos. 2000. Los iniciadores usados en el PCR. 1999. En varios estudios se ha usado esta técnica para evaluar la estructura de la comunidad de hongos y otros microorganismos. moléculas de DNA con diferentes secuencias en sus pares de bases.ello. se han desarrollado técnicas moleculares de huella o rastreo molecular (en inglés fingerprint) para estudiar la diversidad a nivel de comunidad (Borneman y Hartin. 2000. presentan diferentes comportamientos de desnaturalización y migran hacia diferentes puntos en el gel (Muyzer et al. Viaud et al. Gomes et al.. 2000. Vandenkoornhuyse et al. Hongos del suelo saprófitos y patógenos de plantas 259 . y se llaman dominios de fusión. 2004). Por lo tanto.. Método de huella molecular TGGE y DGGE La electroforesis en gel con gradiente de desnaturalización fue introducida en estudios sobre ecología microbiana por Muyzer y Smalla (1998). Anderson et al. pero con diferentes secuencias de pares de bases. pero difieren en su contenido de Guanina-Citosina (GC). Bajo estas condiciones de desnaturalización... 2002. 2003. El gradiente de desnaturalización en DGGE puede variar con el uso de diferentes cantidades de urea y de formamida en la matriz del gel. En esta técnica. 1993). 2003).. generalmente.

el método de huella molecular. No obstante. llamada polimorfismo de longitud de fragmentos de restricción terminal para el análisis (T-RFLP) de comunidades bacterianas de muestras ambientales. Se puede construir una base de datos de TRFs a partir de especies de hongos conocidos y utilizarla en corre260 Manual de biología de suelos tropicales . 2004). son la mejor opción (Malosso et al. 2001). el DNA es amplificado por PCR con uno de los dos Primers marcados con fluorescencia. la restricción enzimática del DNA antes de la electroforesis puede utilizarse en una técnica conocida como polimorfismo de longitud de fragmentos de restricción (RFLP) del DNA amplificado por PCR (Viaud et al. Zygomycota y Oomycota (Nikolcheva y Bärlocher.. Después de la amplificación. la comigración de diferentes moléculas de DNA hacia un mismo punto en el gel. el DNA es tratado con enzimas de restricción y los fragmentos de restricción separados en un gel de acuerdo con su tamaño.. la técnica puede proporcionar un estándar altamente reproducible de un gran número de muestras ambientales durante un periodo de tiempo relativamente corto. tales como TGGE y DGGE. los enfoques polifásicos que incluyen la construcción de bibliotecas de fragmentos clonados. Otra limitante es que el DNA obtenido de organismos filogenéticamente distantes puede producir productos de PCR con una movilidad electroforética idéntica (Gomes et al. Los fragmentos de restricción terminal (TRFs) se marcan con fluorescencia y pueden ser detectados y cuantificados en un secuenciador automático. 2006). Técnica PCR-RFLP La escasa variabilidad de rDNA de hongos puede resultar desventajoso en la técnica de huella molecular. El uso de un PCR anidado puede arrojar aún mejores resultados e incrementar la resolución en la separación de los productos del PCR (Oros-Sichler et al... 2003). Recientemente. Singh et a. después de la amplificación del DNA por PCR directamente extraídos del suelo utilizando Primers género-específicos (Nechwatal et al. T-RFLP Liu et al. 2000). Para incrementar el polimorfismo de la banda y mejorar la resolución.. Las especies de hongos relacionadas pueden identificarse de acuerdo con sus patrones típicos de RFLP. En el T-RFLP. (1997) desarrollaron una versión complementaria del PCR-RFLP. por ejemplo. 2006.Chytridiomycota. 2006). los análisis bioquímicos y las técnicas de aislamiento.l.

Singh et al. Kennedy et al. ARISA El polimorfismo natural de la región ITS del rDNA entre especies de hongos puede utilizarse para la evaluación de comunidades de hongos de suelo.. He et al.. están enfocados en una o en pocas especies de hongos presentes en el suelo.laciones taxonómicas con los haplotipos detectados en el análisis T-RFLP (Brodie et al. 2005. Como consecuencia. Lowell y Klein 2001. En estos esHongos del suelo saprófitos y patógenos de plantas 261 . 1996. SSCP Otro estudio de huella molecular utiliza la migración diferencial de moléculas de una hebra de DNA en un gel para poder estudiar a las comunidades microbianas más complejas... 2006). el polimorfismo intra-específico del ITS puede presentar problemas en la separación de distintas especies filogenéticas (O’Donnell y Cigelnik. En el análisis automatizado del espaciador intergénico ribosomal (ARISA). Después de la amplificación. Edel-Hermann et al. 2001). Viaud et al. 2000. sin embargo. 1997. los diferentes fragmentos de ITS son separados en un gel y posteriormente detectados y cuantificados en un secuenciador automático (Ranjard et al. 2005). el DNA fúngico es extraído del suelo y amplificado por PCR utilizando Primers específicos para la región ITS con uno de los Primers marcados con fluorescencia. 2004. En el polimorfismo de conformación de cadena sencilla (SSCP).. los fragmentos de DNA del mismo largo. especialmente con hongos patógenos de plantas... el DNA amplificado es completamente desnaturalizado antes de ser sometido a una corrida de electroforesis.1 muestra algunos ejemplos de técnicas moleculares empleadas para el estudio de comunidades de hongos del suelo publicadas en años recientes. pero disímiles en su secuencia de pares de bases pueden ser fácilmente separados en SSCP por su diferencial de migración en el gel cuando existe la conformación de una sola hebra (Lee et al. La Tabla 8. 2003.. Kennedy et al. 2005). PCR cuantitativo Algunos estudios. Las moléculas de una sola hebra de DNA adquieren estructuras con dobleces únicos dictados por sus secuencias nucleotídicas y migran hacia puntos específicos en el gel.. El ARISA de hongos es una técnica altamente sensible.

2003). 1992. 2002. No obstante. Una curva estándar puede construirse con cantidades conocidas de DNA e intensidades de fluorescentes. 2002.tudios. Sondas fluorogénicas o colorantes adicionados al PCRs permiten el monitoreo correcto de los productos obtenidos durante la amplificación. Mauchline et al.. Las sondas fluorescentes son capaces de emitir fluorescencia en la presencia de DNA de dos hebras. los distintos productos de PCR son cuantificados por separado de acuerdo con sus intensidades de bandeo relativas en geles de agarosa. el incremento de moléculas de DNA durante la amplificación conlleva un incremento en la intensidad de la emisión fluorescente. Además de la detección molecular. el PCR convencional es inapropiado para enfoques cuantitativos porque cualquier pequeña variación durante la fase exponencial en la reacción de amplificación puede alterar drásticamente las cantidades de los productos del PCR. se deben diseñar Primers de PCR específicos para obtener la amplificación correcta del DNA de la especie clave y otros marcadores moleculares pueden ser empleados como secuencia del gen β-tubulina o el factor de elongación de traducción del gen EF 1-α (Baayen et al. a una cantidad estándar de una muestra de DNA en una serie de PCRs y con el monitoreo de productos PCRs competitivos producidos en cada reacción (Siebert y Larrick. Después de un número definido de ciclos de PCR éstos se usan para cuantificar el DNA directamente de muestras de suelo.. Después de esta amplificación.. han sido desarrolladas modificaciones del PCR convencional como PCR competitivo (cPCR) y PCR en tiempo real. Esta técnica es más rápida y más sencilla que cPCR porque no existe la necesidad de construir un competidor de DNA y no se requiere de ningún análisis post-PCR (Cullen et al. 262 Manual de biología de suelos tropicales . 2003. por lo tanto. lo cual puede calibrarse y medirse con precisión. Otro método empleado en aproximaciones cuantitativas es el de PCR en tiempo real. 2003). En el caso de ensayos cuantitativos.. la cuantificación del DNA de hongos en el suelo es requerida frecuentemente para estudios epidemiológicos y ecológicos.. Filion et al.. fragmentos de DNA que contienen los mismos sitios iniciadores que la muestra de DNA son añadidos en cantidades conocidas a las reacciones del PCR y coamplificados con el DNA específico. 2002. La cantidad de DNA en la muestra puede calcularse con la adición de diferentes cantidades de DNA competitivos. 2002).. Filion et al. En el cPCR. Mauchline et al. Baek y Kenerley. Lees et al. 1998. 2000. Li y Hartman.

Gradiente de suelo desde llanuras hasta bosques de pino escocés. 2006 Hongos del suelo saprófitos y patógenos de plantas 263 .. Gradiente de pastizales semi-naturales a suelos agrícolas mejorados.Tabla 8.. Suelo estepario con pasto corto con o sin presencia de nitrógeno.. Suelos con diferentes propiedades fisicoquímicas.... 2004 Edel-Hermann et al. Una muestra de suelo por métodos de cultivo y molecular.2005 DGGE SSCP y TGGE ARISA y T-RFLP DGGE con iniciadores específicos para Fusarium DGGE y T-RFLP Singh et al... 2005 Yergeau et al.1 Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes. 2001 Ranjard et al. Diferentes horizontes de un suelo de selva. 2004 He et al. 2003 Agnelli et al. 2000 DGGE DGGE y TRFLP DGGE y restricción de DNA amplificado DGGE T-RFLP Anderson et al. 2004 Milling et al. análisis de detección y diversidad de especies de Fusarium. Suelos bajo cultivos de papa transgénica y no transgénica. Técnica* TGGE PCR-RFLP SSCP ARISA DGGE Evaluación de comunidades de hongos en Rizósfera y suelo compuesto con trigo.. seguido por DGGE. Análisis de la dinámica de comunidades de hongos del suelo vía PCR hongoespecíficos del DNA del suelo. 1999 Viaud et al.. Tres diferentes suelos cultivados con Lolium perenne. 2005 Kennedy et al... los efectos de cambiar el suelo al añadir composta o excremento. amplificados del DNA total.. Suelos de bosque natural y plantaciones de pino hoop. Suelos con diferentes propiedades fisicoquímicas. 2001 Elsas et al. 2000 Lowel y Klein. 2003 Gomes et al. Pastizales bajo diferentes tipos de vegetación. Rizósfera de dos cultivos de maíz durante el periodo de ciclo de vida de la planta. 2003 Brodie et al. Campos de espárragos.. Referencias Smit et al.

amplificación y secuenciación de contaminantes de hongos e incluso. Hawksworth. O’Donnell et al. Técnica* DGGE y ARDRA Evaluación de comunidades de hongos en Diversidad de hongos en suelos antárticos que combinan cultivo de aislamiento. pero una mejor caracterización y análisis filogénico de taxas dominantes. este método no se describe para cada ejemplo. sin duda. requieren de una secuenciación y comparación utilizando bancos de datos de DNA al alcance del público. por ejemplo.1 Continúa. 2006 Nota: * la clonación del DNA y la secuenciación fueron usadas por todos los autores para la identificación de haplotipos dominantes amplificados del DNA total.. no se aplica en el caso de hongos saprófitos. 2004b). contienen las mismas limitaciones que las técnicas de cultivos para hongos (Selenska y Klingmüller. pueden presentar algunos problemas debido a que los bancos de datos pueden estar incompletos y puede que las secuencias de DNA se encuentren mal identificadas. Referencias Malosso et al. en la secuenciación de quimeras (Crous. Muchos obstáculos para la identificación basada en cultivos han sido superados con la llegada de técnicas de aislamiento más sofisticadas como. Sin embargo. los métodos de lavado del suelo y la filtración de partículas. en el caso de los hongos el número de especies no cultivables es. generalmente. 1992. 1992. huella molecular y técnicas de clonación. Lo que puede ser verdad para organismos estrictamente simbióticos.. de estudios sobre la diversidad bacteriana y. No obstante. invariablemente. los enfoques taxonómicos de hongos basados únicamente en datos moleculares. Las técnicas de huella molecular en comunidades puede monitorear composiciones complejas de hongos de suelo. 1994). como hongos micorrízicos arbusculares.Tabla 8. Incluso la mayoría de los hongos patógenos de plantas no son parásitos obligados. por lo tanto. CONCLUSIONES Las herramientas moleculares para ensayos de comunidades de hongos del suelo fueron extraídas. tal y como ha sido discutido. exagerado. Tsai y Olson. 2002a.. principalmente. 2003. Otra limitación del enfoque molecular basada en la amplificación del DNA es la falta de conocimientos acerca de la actividad de crecimiento o grupos funcionales 264 Manual de biología de suelos tropicales . Bridge et al. lo que origina errores en identificaciones morfológicas.

2004).. dado que algunos de los datos no tienen una distribución normal. generalmente. otros factores.. La prueba de independencia de Chi cuadrada puede usarse para este análisis. Como se ha discutido. La forma de las curvas indica si el número Hongos del suelo saprófitos y patógenos de plantas 265 . Otra opción consiste en llevar a cabo un análisis de varianza no paramétrico. como parámetros físicos y químicos del suelo bajo análisis. las curvas que se forman con más facilidad. tales como logaritmo o raíz cuadrada pueden aplicarse antes del análisis (Houston et al. haciendo difícil la diferencia del crecimiento activo o grupos funcionales basados únicamente en el producto del análisis del PCR. El conjunto de datos preliminares usualmente no es adecuado para hacer los análisis de ANOVA. 1998). los protocolos de extracción del DNA son capaces de lisar y extraer ácidos nucleicos ya sea de micelio en crecimiento activo o de esporas latentes. además del número de cepas.. un entendimiento más completo sobre las comunidades de hongos del suelo deberá centrarse en enfoques polifásicos con ensayos basados en cultivos y taxonomía molecular en asociación con el estudio de los procesos biogeoquímicos que ocurren en el suelo (Malosso et al. Por el momento. el análisis de Kruskall-Wallis (Rodrigues. por lo tanto. y también dan información sobre el esfuerzo de muestreo empleado en la investigación. donde el número total de cepas de cada muestra se usa en comparaciones pareadas. Las curvas de acumulación de especies o curvas de rarefacción pueden proporcionar comparaciones gráficas de la riqueza de especies entre muestras. 1995). por ejemplo. un enfoque más confiable es realizar un análisis de varianza (ANOVA). fechas de colecta o diferentes tratamientos de suelo. de acuerdo con la acumulación de las cepas muestreadas. constituye el primer conjunto de datos. Adicionalmente. La pendiente de las curvas muestra cuáles son las muestras con mayor riqueza de especies. 1994. ANÁLISIS DE DATOS Una lista de especies o agregados de especies aisladas y su abundancia relativa en cada muestra.de hongos del DNA total extraído del suelo. 2006. resulta ser un análisis robusto y confiable (Sokal y Rolf. Singh et al. Para solucionar ese problema. Cuando están disponibles datos sobre variaciones cuantitativas entre las repeticiones dentro de las muestras. Por medio del ANOVA es posible derivar variaciones entre diferentes muestras y dentro de las muestras (error). 2006). Se verifica el número de cepas de cada muestra y este dato puede ser usado para comparar entre sitios. por ejemplo. 1995). las transformaciones de datos. pueden añadirse al ANOVA para evaluar sus efectos y sus interacciones con otros datos cuantitativos (Setälä y McLean. Sokal y Rohlf.

el análisis multivariado no se lleva a cabo en el total de comunidad debido a la naturaleza “ruidosa” de la frecuencia y a la distribución de especies raras. De manera general. matrices de datos de gran tamaño (llenas de ceros) y datos de distribución no paramétricos. 1988. Muchos índices se han obtenido para evaluar y comparar la diversidad de especies. 1995). análisis de correspondencia sin tendencia.de especies es estable después de la acumulación de todas las cepas. El porcentaje de la varianza total explicada por el primer eje del AC y la contribución de las especies y muestras a la varianza (inercia) de cada eje apoya la designación de especies que ocurren en la comunidad como clave y “casual” (Howard y Robinson. tales como los métodos de ordenación.. Persiani et al. por ejemplo. y existen casos en donde dos comunidades distintas pueden tener el mismo índice de diversidad. común o rara y a la complejidad de los modelos matemáticos que se basan en la distribución de las especies. De esta manera. si las curvas tienden a llegar a una asíntota. por ejemplo. al igual que en otras técnicas de ordenación. basándose en su riqueza o equitatividad o tomando ambas variables y éstos cambian en función de la importancia relativa que se da a la especie dominante.). Grishkan et al. El análisis de correspondencia (AC) y su versión modificada. 1982. El índice Shannon-Wiener se basa en la riqueza y equitatividad de la diversidad de las especies y se encuentra frecuentemente en la literatura (Dighton.. las relaciones multidimensionales entre muestras y especies se reducen a un número reducido de ejes que. son métodos de ordenación adecuados para la clase de datos generados de hongos y de otras comunidades. La información sobre la estructura de la comunidad es mejor si se usa un análisis multivariado. 1998. 1995). Los índices de diversidad son puramente numéricos y no proporcionan información sobre la estructura de la comunidad. Los resultados se muestran gráficamente y permiten el análisis de tendencias generales de la estructura de la comunidad (Gauch. Curvas que no tienden a una asíntota indican que el número de especies podría aumentar si se aumenta el esfuerzo de muestreo (Bills y Polishook. 1995). explican la mayoría de la variabilidad de datos. se elige un límite (por ejem266 Manual de biología de suelos tropicales . 1993. Howard y Robinson. idealmente. datos generados de conteos. 2003). En el caso de AC. Bettucci et al. 1994).. La diversidad de especies de cualquier sistema está compuesta por dos componentes: la riqueza de especies (el número de especies) y la equitatividad o equidad de la frecuencia de especies (Kennedy y Smith. 1994. Los índices de similitud (disimilitud) de diversidad para realizar comparaciones pareadas entre diferentes muestras también son usados con frecuencia (Magurran.

2002). 1996. 2004).. Las colecciones de recursos genéticos hoy en día son solicitadas en todo el mundo. Agradecimientos Al profesor Richard Mibey y a la Dr. Oros-Sichler et al. 1995. en donde las matrices son construidas con datos de presencia o ausencia de bandas distintivas (de manera ideal para especies diferentes) en los geles y la estructura de la comunidad es analizada posteriormente (Fromin et al. con el objetivo de la preservar las especies ex situ y de suministrar a instituciones de investigación e industrias de este material. El estatus actual de las colecciones de recursos genéticos de hongos y los retos para apoyar la necesidad de la genómica de hongos. Hawksworth. 2002. al igual que las aplicaciones prácticas y económicas de las especies (Smith y Waller. por lo que proveen material de trabajo básico para quienes estudian las características y la variación.plo.5%. 2006).. 1982. 1993.. En el futuro. para la preservación a largo plazo de especímenes de resguardo será fundamental validar las entradas de secuencia y bases de datos genómicas. Las colecciones de referencia deberían ser apoyadas por países con una política fuerte en ciencia y tecnología dado que contienen información acerca de la distribución geográfica y de los hospederos. Sheila Okoth por sus comentarios y discusiones durante la preparación del capítulo. Bettucci y Alonso. Ryan y Smith. Kirsop. es necesario que sean recopilados.. la biología molecular y la conservación de hongos han sido revisados recientemente (Hawksworth. 2003). Los métodos de ordenación de análisis de componentes principales y análisis de correspondencia. Hongos del suelo saprófitos y patógenos de plantas 267 . por lo tanto. como en el caso de la publicación de nuevos nombres (Agerer et al. PRESERVACIÓN Y COLECCIÓN DE RECURSOS GENÉTICOS Los inventarios de biodiversidad proporcionan argumentos y algunas bases científicas para la preservación de hábitats y el uso sustentable de suelos. 0. Bettucci et al. son normalmente empleados para derivar resultados procedentes de los métodos de huella molecular. 1% ó 5% del número total de aislamientos) y únicamente aquellas especies con una frecuencia de aislamientos igual o superior a este límite son incluidas en el análisis (Gauch. así como el análisis de conglomerados (cluster). 1992. 1996). 2004a.

C.... 39.. O’Donnell. vol. E. Environmental Microbiology. R. L. G. Canadian Journal of Botany. M. R. Pedobiologia. y Alonso. 41–66. L. Ammirati. K. Journal of Applied Microbiology. Ascher. Gams. forest’. (2004) ‘Distribution of microbial communities in a forest soil profile investigated by microbial biomass. 859–868. A. D.. P. Weiss. (2000) ‘Gene genealogies and AFLP analyses in the Fusarium oxysporum complex identify monophyletic and nonmonophyletic formae speciales causing wilt and rot disease’. Mueller. Horak. Summerbell.E. 95. Sampaio. pp. Cigelnik. T. Applied Soil Ecology. G.. P. y Watling. Korf. y Waalwijk. Tian. vol. y Pietramellar. pp. Anderson. vol. P. Anderson. M. 78–85. C. y Cairney. 419–428. pp. pp. 66.. pp. 36. y Srivastava. 268 Manual de biología de suelos tropicales . C. Baayen. Bauer. M... J. R. 642-644. y Oberwinkler. 1566–1569. M. Kroon... Robson. vol... 470–480. M. D. W. A. D. F. P. Ennos. Campbell.... 25. J. C. Begerow. 5. 6. C. vol. soil respiration’. N. pp. E. y Prosser. D. (2003) ‘Fungi are the predominant micro-organisms responsible for degradation of soil-buried polyester polyurethane over a range of soil water holding capacities’. Hallenberg. G. Mycological Progress. 6. S. pp. Cortia.... R. R. 891–900. J. A.. Bååth. G. R. Baek. vol. 769–779. P. (2003) ‘Potential bias of fungal 18S rDNA and internal transcribed spacer polymerase chain reaction primers for estimating fungal biodiversity in soil’. FEMS Microbiology Ecology. Hawksworth. H... D. vol. (1988) “A critical examination of the soil washing technique with special reference to the effect of the size of the soil particles’. Courtecuisse. Blanz.. R. R. Environmental Microbiology. Rambold. Dejardin. vol. J. G. E. 87–108. Bonants... (2003) ‘Always deposit vouchers’ Mycological Research. Triebel. Roebroeck. pp. Ceccherini. E. vol.P. vol. (2004) ‘Diversity and ecology of soil fungal communities: Increased understanding through the application of molecular techniques’. pp. the role of decomposer organisms’. G. (1998) ‘Detection and enumeration of a genetically modified fungus in soil environments by quantitative competitive polymerase chain reaction’.REFERENCIAS Agerer. J. 36–47. J. vol.. L. (1995) ‘The effect of wildfire on the opportunistic decomposer fungal community of Uruguayan Eucalyptus spp. 90. J.. D. Beare. J. pp. Barratt. Bettucci. S.. R.. 104. Phytopathology. M. P.. (1997) ‘Agricultural intensification. C. pp. (2006) ‘The simpleseptate basidiomycetes: A synopsis’. W. C. M. F. Vikram Reddy. M. I. R. S. I. Oberwinkler. Greenhalgh. y Handley. R.. P. y Kenerley. G. I.. Nannipieri. Soil Biology and Biochemistry.. soil biodiversity and agroecosystem function in the tropics. N. Halling. Agnelli. 5.

(2003) ‘Soil fungal community structure in a temperate upland grassland soil’. J. CAB International. Brodie. 606–623. Foster (eds) Biodiversity of Fungi: Inventory and Monitoring Methods. (2002a) ‘Adhering to good cultural practice’. M. in G. M. pp. 30. y Nordbring-Hertz. B. Spooner. vol. S. B. M. D.. New Phytologist. Olsson. (1996) ‘Filamentous fungi’. pp. 127–145.. pp. 46. 666–676. MN. G. G.. 418–426. Roberts.. P. P. (2003) ‘On the unreliability of published DNA sequences’.. Plant and Soil. H. (2002b) Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. D. F. F. W. Hall (ed) Methods for the Examination of Organismal Diversity in Soils and Sediments. 105–114. P. 232. P. y Hartin. J.. vol. Phytopathology. K. pp994–998. pp. S. C. S. Crous. D. vol. pp. 106. Christensen.. Mycologia.. y Roquebert.. P. y Ritz. y Spooner. vol. N. M. J. 160. F. (2000) ‘PCR primers that amplify fungal rRNA genes from environmental samples’. 44. vol. Semadi. (2000) ‘Food preference of earthworms for soil fungi’. Crous. Pedobiologia. pp. R. Pedobiologia. Rodriguez. I. D. FEMS Microbiology Ecology. vol.. Bury. 43–48. E.. P. Wallingford. Plant Pathology. Elsevier. Bonkowski. vol. I. (1993) ‘Fungal communities of two grazing-land soils in Uruguay’. Kadri. Griffith. y Baker. (1987) ‘Quantification of predatory and endoparasitic nematophagous fungi in soil’. vol. M. A. Edwards. 51. (2001) ‘Soil fungi. M. vol. pp. (2002) “Paraná river delta wetlands soil microfungi’. G. y Polishook. (1980) ‘Induction of suppressiveness to Rhizoctonia solani in soil’. y Indarte. J. Powell. Bills. Microbial Ecology. 271–302. Toth. Cullen. 86. L. (1994) ‘Abundance and diversity of microfungi in leaf litter of a lowland rain forest in Costa Rica’. Lundgren. Chet. 45. F. K. I. M. Mycological Research. G. vol. Borneman. Jansson. C. Bridge. 4356–4360.. Hongos del suelo saprófitos y patógenos de plantas 269 .. Mueller. Cannon. S. y Panchal.W. R. Lees.Bettucci. Applied and Environmental Microbiology. P. vol.. y Thorn. Malvarez. (2002) ‘Detection of Colletotrichum coccodes from soil and potato tubers by conventional and quantitative real-time PCR’. Journal of Environmental Quality. B. A. F. diversity and detection’. 281–292. pp. R. Dupont. pp.. y Guiraud. M. pp. O. J. G. 72–82. F. Bills. 13. in G. vol. vol. pp. L. Bridge.. 70. Amsterdam. B. J. y Duncan... pp. Bills y M. y Clipson. 37. (2004) ‘Saprobic soil fungi’. W. K. Bordjiba. 187–198. St Paul. Pedobiologia. 66. K. Steiman. B. pp1378–1379. Bettucci. APS Press. Dackman. (2001) ‘Removal of herbicides from liquid media by fungi isolated from a contaminated soil’. ppv147–154. M. E. 89–93.

K.. pp. A. C. vol. K. Forestier... Edena. Dreumont.. 43. Norris (eds) Methods in Microbiology.Cuvelle. Steinberg. N. vol. Duarte. Filion. M. 16. G. Hillb. y Anderson. y Rouxel. y Alabouvette. 515–522. S. Domsch. Hamelin. C. F. (2001) Straminipilous Fungi. Tarnawski. V. Edel. y Rossi. FEMS Microbiology Ecology.. G. Kluwer Academic Publishers. vol. 133–151. T. pp. (1990) ‘Methods for studying fungi in soil and forest litter’. 49. M. 2nd edition.. vol. M. Jourdain-Miserez. y Smit. (2001) ‘Genetic diversity of Fusarium oxysporum populations isolated from different soils in France’. y Sinclair. vol. 11.. CRC Press Inc. pp67–76. Down. 397– 404. S. FEMS Microbiology Ecology. W. y Galpoththage. y Jabaji-Hare. Science Publishers. A. y Boddy.. Dighton. C. 796–798. M. (2004) ‘Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils’. pp.. Aragno. Fromin. 98. J. IHW Verlag.. vol. (2002) ‘Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns’. Gautheron. Enfield. Plant Pathology. O. R. Grigorova y J. 36. 47. S.. Recorbet. vol. J. B. Dick. Gams. (2000) ‘Analysis of the dynamics of fungal communities in soil via fungal-specific PCR of soil DNA followed by denaturing gradient gel electrophoresis’. pp. 61–71.. Elsas. H. Frankland. F. 53. Dighton. A... G. (2003) ‘Direct quantification of fungal DNA from soil substrate using real-time PCR’. D. Mycologist. N. J. (2007) Compendium of Soil Fungi.. Environmental Microbiology. 270 Manual de biología de suelos tropicales ... L. E. Dhingra. J. (2000) Detection and Isolation of Soil Fungi. D. pp. St-Arnaud. Academic Press. Boca Raton. M. A. 51–58. y Steinberg. M. vol. Edel-Hermann. (2002) ‘Fungal family trees: Finding relationships from molecular data’. Teyssier. G. 343–404. pp. Dordrecht. (2000) ‘An efficient baiting assay for quantification of Phytophthora cinnamomi in soil’. H. Gillet.. P. Pérez-Piqueres. G. M. London. Journal of Microbiological Methods. W. 22. Eching. pp. pp. F. in R. Mycological Research. The Netherlands. D.Davet. (1985) Basic Plant Pathology Methods. N. Journal Microbiological Methods. V. (1994) ‘Analysis of micromycete communities in soil: A critique of methods’. vol. Roesti. Keijzer-Wolters.. J. R. J. 634–643.

91–100. Winterhoff (ed) Fungi in Vegetation Science. (1998) CBS Course of Mycology. vol. L. C. vol. 641–655. pp. Mycological Research. prophylaxis. FEMS Microbiology Letters. 50. pp13–15.. (1991) ‘The fungal dimension of biodiversity. M. C. Watling y A. 9–18. 95. Applied and Environmental Microbiology. y Crous. Biological Journal of the Linnean Society. D. in R. (2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. Hawksworth. Baarn. Hawksworth. S. Lower Nahal Keziv. C. Hongos del suelo saprófitos y patógenos de plantas 271 . pp. Isaac. London. and prognosis’. A. magnitude. Gray. The Netherlands. D. L. L. (2005) ‘Analyses of soil fungal communities in adjacent natural forest and hoop pine plantation ecosystems of subtropical Australia using molecular approaches based on 18S rRNA genes’. A. pp. Fagbola.. Gomes. (1990) ‘Methods for studying the microbial ecology of soil’.. L. 310–342.Gams. N. H. Academic Press. y Smalla. A. Rumjanek. 247. Hawksworth. S. E. R. J. Studies in Mycology. Costa. J. A. pp. D. W. Grigorova y J. pertinence. Phytopathology. A.. pp. R. L. CBS. Alfenas. vol. (1993) ‘The tropical fungal biota.. J. Mycoscience. pp.. (2003) ‘Adaptive spatiotemporal distribution of soil microfungi in ‘Evolution Canyon’ II. 3758–3766. Dordrecht. W. C. G. Hawksworth. (2004a) ‘Fungal diversity and its implications for genetic resource collections’. 527–539. S. pp. K. 261–264. L. vol. Norris (eds) Methods in Microbiology. significance and conservation’. Israel’. New Phytologist. y Hughes. H.. Stouthamer (eds) Culture Collections to Improve Quality of Life. A.. 183–223. Jr (1982) Multivariate Analysis in Community Ecology. 4th edition. D. Cambridge University Press. R. y Aptroot. vol. Maffia. 161. L. 26–35. D. Mendonça-Hagler. Hawksworth. 78. Baarn. Buchner. P. CBS. census. G. Kluwer Academic Publishers. Gauch. Cambridge. (2004b) ‘“Misidentifications” in fungal DNA sequence databanks’. Cambridge University Press. pp. Hoekstra. western Upper Galilee. vol. in S. van der Mei y A. Samson. (1996) ‘Microbial collections as a tool in biodiversity and biosystematic research’. G. pp. A. P. Gonçalves. T. (2001) ‘Evaluation of bioassays to quantify Cylindrocladium inocula soil’. N. D.. A. (1997) ‘Where are all the undescribed fungi?’. D. Y. in R. y Beharav. J. 22. 41. Gams. O. Whalley (eds) Aspects of Tropical Mycology. New York. Proceedings of the International Congress for Culture Collections. R. (1992) ‘The analysis of communities of saprophytic microfungi with special reference to soil fungi’. E. Wasser. L. Xu. Frankland. I. y Rossman. Stalpers. Z. vol. Grishkan. vol. 87.. 888–891.. R. W. vol.. Nevo. He. G. J. in W. 69. Hawksworth. pp.

M. (2003) ‘Changes in the structure of fungal communities of soil treated with sewage sludge’. vol. Plant and Soil. y Smith. (ed) (1997a) Biodiversity of Tropical Microfungi. S. (1996) ‘Nonradioactive method to study genetic profiles of natural bacterial communities by PCR single-strand-conformation polymorphism’. y Forney. (2002) ‘Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil’. C. F. 52. Zo. Visser. D. N. 3112 –3120. vol. K. E. 37–58. H. L. WFCC. 51. S. Marsh.. P. Hyde. G. Sullivan. Kennedy. S. Kirsop. B. A. D. T.. Microbial Ecology. L. K. J. 630–640. Lees. 76. (1995) ‘The use of correspondence analysis in studies of successions of soil organisms’. y Lautenschlager. L. David. pp. 63. sp. pp. J. Lodge. CAB International. M. Kennedy. pp293–302. vol. pp. (1997) ‘Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16s rRNA’. (2001) Dictionary of the Fungi. 463–473.. A. Wallingford. 74–83. Kacprzak. vol. pp. 39. Cambridge University Press. Lee. y Nicholson. P. Pedobiologia. World Federation of Culture Collections. Cheng. 11.. J. L. vol. 170. 50.. Applied and Environmental Microbiology. 62. (1995) ‘Soil microbial diversity and the sustainability of agricultural soils’. S. pp. Howard. C. y Jagnow. A. y Stalpers. y Clipson. Whalley (eds) Aspects of Tropical Mycology. vol. Hong Kong University Press. K. y Robinson. Kirk. pp. Y.. Li. in S. P. W. 272 Manual de biología de suelos tropicales .Houston. E. (2003) ‘Molecular detection of Fusarium solani f. vol. R. J. y Hartman. 4516–4522. Edwards. Plant Pathology. pp. M. A.. Liu. S. D. H. Mycologist. (1997b) ‘Can we rapidly measure fungal diversity?’. K. 38.. (1986) ‘Fungi of a forest soil nitrifying at low pH values’. pp. Cannon. y Kim. C. P.. Hong Kong. (1993) ‘Nutrient cycling by fungi in wet tropical forests’. D. N. Watling y A. 9th edition. Applied and Environmental Microbiology. pp. 38. 89–95. J. G. FEMS Microbiology Ecology. Cambridge. (2005) ‘Soil bacterial and fungal community structure across a range of unimproved and semi-improved upland grasslands’. pp. y Stanczyk-Mazanek. L. 257–265. Hyde. C. Cullen. W. Canadian Journal of Botany. (1998) ‘Microbial processes and fungal community structure in soils from clear-cut and unharvested areas of two mixed wood forests’. vol. Plant Pathology. D. vol. Isaac. 176–178. Lang. C. (ed) (1996) Access to Ex-situ microbial genetic resources within the framework to the convention on Biological Diversity. pp. R. glycines in soybean roots and soil’. A. vol. 75–86. 518–527. Biology and Fertility of Soils. vol. J. Frankland. A. J.

L. pp. y Nakanishi. 68. 1846–1853. R. pp. y Mitchell. vol. (1977) ‘Selective inhibition of Pythium spp.. Phytopathology. Masago. N. Lavras. vol. (1993) ‘Profiling of complex microbial populations by denaturing gradient electrophoresis analysis of polymerase chain reacHongos del suelo saprófitos y patógenos de plantas 273 . Kerry. Polar Biology. M. pp. vol. E. Moreira. Biodiversity and Conservation. H. isolation and pathogenicity of Phytophthora megasperma from soils and estimation of inoculum levels’.. vol. vol. vol. S. molecular fingerprinting and cloning techniques’.. Malosso. Antonie van Leeuwenhoek.. Mazzola. J. W. pp. (2002) ‘Mechanisms of natural soil suppressiveness to soilborne diseases’.. Fukada. pp. FEMS Microbiology Ecology. G. I. M. G. 42. 67. Waite. 85–92. pp. Phytopathology. (1998) ‘Application of denaturing gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology’. 36. S. G. Princeton. T. 81. E. A. y Smalla. L. Maidl. G. y Hirsch. Hopkins. Editora UFLA. (2002) ‘Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating’. (1970) ‘Detection. A. de Waal. 35–59. y O´Donnell. vol. vol. J. J. G.. y Klein. E. C. vol. (2006) “Fungal diversity in maritime Antarctic soils determined using a combination of culture isolation. D. (1988) Ecological Diversity and its Measurement. Princeton University Press. Milling. 557–564. D. J.. F. F. pp. 29. on a medium for direct isolation of Phytophtora spp. 266.. 6. 127–141. Mazzola. y Siqueira. Muyzer. A. pp.Lodge. C. 1687–1690. J (1997) ‘Factors related to diversity of decomposer fungi in tropical forests’. K. Applied and Environmental Microbiology. (2004) ‘Assessment and management of soil microbial community structure for disease suppression’. O. 681–688 Lowell. Schloter. M. A. M. 60. (2004) ‘Effects of transgenic potatoes with an altered starch composition on the diversity of soil and rhizosphere bacteria and fungi’. C. pp. E.. 552–561. English. K. P. Mauchline. 23–39. A. R. Annual Review of Plant Pathology. 73 pp. Magurran. Marks. y Munch. M. vol. X. Smalla. Yoshikawa. H. from soils and plants’. (2001) ‘Comparative single-strand conformation polymorphism (SSCP) and microscopy-based analysis of nitrogen cultivation interactive effects on the fungal community of a semiarid steppe soil’. 425–428. y Uitterlinden. Muyzer. D. Antonie van Leeuwenhoek. M. Brazil. Plant and Soil. (2002) Microbiologia e bioquímica do solo. B..

376–385. in K. (1997) ‘Soil and rhizosphere microfungi from Brazilian tropical forest ecosystems’. Nechwatal. S. Plant Pathology. pp. Nikolcheva. y Cigelnik. C. Papavizas.. Wakeham. pp. Rodrigues. vol. Hyde (ed) Biodiversity of Tropical Microfungi. E. M. vol. Mycologia. pp. M. 90.. pp.. 6. G. Philosophical Transactions Royal Society London. biological and methodological variability’. L.. A. Thioulouse. Mycologia. C. pp. Hong Kong. Phytopathology. L. M. 59. Jung.. y Osswald. pp. G. vol. Neuber. 3. 7. J. pp. citricola in soil samples from oak stands’. 341–365. F. Lews. C. Applied and Environmental Microbiology. Duncan. M. 67.. J. y White. L. R. Casado. Ayers. (2002) ‘Comparison of serological. Dow. T. D. M. H. Schlenzig. L. T. J. Mouguel.. J. pp. B. 103–116.. O’Donnell. vol. 206–214. and bait methods for detection of Pythium and Phytophthora zoospores in water’. Lata. R. y Nazaret. A. y Kantzer.. 274 Manual de biología de suelos tropicales .. F. Persiani. G. (1994) ‘The foliar fungal endophytes of the Amazonian palm Euterpe oleraceae’. E. A. O´Donnell. 4479–4487. Gomes. Mycological Progress. (1997) ‘Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous’. F. 86.. vol. W. Poly. 65–73. Oros-Sichler. y Pineda. A. F. A. 871–877.. Ranjard. (2001) ‘Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints. Pettitt. y Smalla. G. W. Hong Kong University Press. M.. Adams. L. vol. N. A. D. D. y Hawksworth. Forest Pathology. K. Journal of Microbiological Methods. pp. 345. R. culture. K. G. J. K. L. pp.tion-amplified genes coding for 16S rRNA’. 720–727.. Pfenning. 31. F. vol. J.. (2001) ‘A combination of baiting and PCR techniques for the detection of Phytophthora quercina and P.. G. pp. vol.. D. Molecular Phylogenetics and Evolution. D. J. 695–700. C. (1998) ‘Diversity and variability in soil fungi from a disturbed tropical rain forest’. 51. Maggi. vol. (1994) ‘Theoretical and practical aspects of the quantification of biodiversity among microorganisms’. vol. (2004) “Taxon-specific fungal primers reveal unexpectedly high diversity during leaf decomposition in a stream’. 65. Applied and Environmental Microbiology. Wainwright. 41–49. M. J. Cooke. O. (1975) ‘Ecology and epidemiology of Rhizoctonia solani in field soil’. 63–75. pp. B. and Bärlocher. P. Lomsden. A.. Biological Sciences. Goodfellow... (2006) ‘A new seminested PCR protocol to amplify large 18S rRNA gene fragments for PCR-DGGE analysis of soil fungal communities’. 85–97. vol. F.

17. B. y Waller.. pp. (1984) Suppressive Soils and Plant Disease. Tulloss. (1998) Protocols for an All Taxa Biodiversity Inventory of Fungi in a Costa Rican Conservation Area. their importance in tropical plant pathology’.. y Walker C. R. 1351–1362. pp. Siebert. APS Press.. pp. 177–183. Smith. Smit. J. A. A. Ryan. Canhos. S.. MN. Maffia. 1. vol. (1995) Biometry: The Principles and Practice of Statistics in Biological Research. K. L. (1992) “Direct recovery and molecular analysis of DNA and RNA from soil’. Schuessler. D. y Millard. W. M. Sneh B. Nature. vol. Umbuzeiro. pp. y Rush. J. 3rd edition. pp. 53–78. Alfenas. MN. J. D. pp.Rodrigues-Guzman. W. Rossman. Mihail. Parkway Publishers. St. D. vol. Leeflang. y Esposito. D. M. y Rohlf. F. Boone. APS Press. E. S. Oecologia. (1999) ‘Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes enconding 18S rRNA and temperature gradient gel electrophoresis’. P. Burpee. H. Australasian Plant Pathology. G. Pfenning. pp. L. (2004) ‘Decomposition rate of organic substrates in relation to the species diversity of soil saprophytic fungi’. H. A. (2004) ‘Fungal genetic resource centres and the genomic challenge’. V. A. (2001) “Biodiversidad de los hongos fitopatógenos del suelo de Mexico’. European Journal of Soil Science. S. D. vol. 66. 108. Acta Zoológica Mexicana. Singleton.. P. pp. E. in Eucalyptus clonal garden soils’. T. (2001) ‘A new fungal phylum. H. E. vol. Munro. D. 31. Potts.. M.. J. (1992) Methods for Research on Soilborne Phytopathogenic Fungi.. M. R. P. Paul. 12. the Glomeromycota: Phylogeny and evolution’. R. J. Glandorf. Paul. (1992) ‘Culture collections of microorganisms. vol. Mycological Research. C. G. Setälä. Paterson. Fitopatologia Brasileira. 105. Singh. St Paul. Silva. (2006) ‘Investigating microbial community structure in soils by physiological. St. NC. y McLean. M.. 139. P. y Larrick. New York. C. 98–107. L. Ord. y Thorn. R.. 1413–1421 Selenska. E. special issue no 1... Applied and Environmental Microbiology. (1991) Identification of Rhizoctonia Species. A. E.. vol. 57. y Klingmüller. APS Press. Hongos del suelo saprófitos y patógenos de plantas 275 . (2002) ‘Comparison of baits to quantify inoculum density of Rhizoctonia spp. L.. 2614–2621. y Smith. MN. vol. F. 41–46. Reid. B. B. Soil and Sediment contamination. 345-356. Mycological Research. W. Microbial Releases. E (2003) ‘Filamentous fungi isolated from estuarine sediments contaminated with industrial discharges’. J. pp. R. Schwarzott.. pp. vol. pp. Freeman. 359. O´Dell. E. L. y Ogoshi. y van Elsas. vol.. Y. M. A. M.. P. A. (1992) ‘Competitive PCR’. Schneider. Sokal. 72–82. W. biochemical and molecular fingerprinting methods’. 5–12. J. Sanfuentes. 557–558. y Silveira.

pp. (1991a) ‘A revision of the genus Trichoderma. pp. vol. vol. E. Mycological Research. Ecology and Pathology. Wainwright. Transactions of the British Mycological Society. Berry. Baldauf. 309– 317.. H. C. Applied Environmental Microbiology. C. 4th edition. 4288–4292. S. y Young. P. P.. H. Filion. Canadian Journal of Botany. y Brygoo. (1983) Phytophthora. 5. pp. Biodiversity and Conservation. E. y Olson. Wellington. y Krsek. (1998) Illustrated genera of imperfect fungi. vol. Y. vol. M. M. y St-Arnaud. Current Opinion in Microbiology. St Paul. (1984) ‘A revision of the genus Trichoderma. P. 2357–2372. P. its Biology. C. J. 62. 1027–1032. M. McQuilken. 159–170. Taxonomy. 104. (2002) ‘Extensive fungal diversity in plant roots’.. y Hunter. P. A.. y Visser. A. vol. Pesticide Science. (1996) ‘Isolation of saprophytic basidiomycetes from soil’. pp. S. 69. 295. 924–931. W. 169–183. Zak. I. S. Paul. 62. Tsao. Yergeau. (1988) ‘Metabolic diversity of fungi in relation to growth and mineral cycling in soil: A review’. vol. Whipps.Thorn. 1070–1074. Harris. pp.. y Budge. (2005) ‘A PCR-denaturing gradient gel electrophoresis approach to assess Fusarium diversity in asparagus’. (1996) ‘An appraisal of soil fungal diversity: The crossroads between taxonomic and functional biodiversity’. M. Infrageneric classification’. H. Tsai. E. E. P. Vandenkoornhuyse. 2051. D.. y Paul. B. (2000) ‘Diversity of soil fungi studied by PCR-RFLP of ITS’. pp. 6. (1993) ‘Use of fungal antagonists for biocontrol of damping-off and Sclerotinia disease’. M. vol. J. vol. p. V.. J. M. MN. pp. Manuales para identificación Barnett. M. G. MN. Y. Leyval. Bissett. vol. (2003) ‘Resolving functional diversity in relation to microbial community structure in soil. Canadian Journal of Botany. L. 58. vol. (1992) ‘Rapid method for direct extraction of DNA from soil and sediments’. pp. 60. 295–301. 51. Section Longibrachiatum sect.. exploiting genomics and stable isotope probing’. Pasquier. (1973) ‘Fungi from Canadian coniferous forest soils’. y Parkinson.. APS Press. vol. II. Reddy. A. Viaud. Science. L. Straczek. Applied Environmental Microbiology. pp.’. APS Press. Journal of Microbiological Methods. 276 Manual de biología de suelos tropicales . St. D. Widden.. pp. R. vol. C. Bissett. J. pp. J. 90.. 143– 154. 37. Erwin. Canadian Journal of Botany. 2275–2290. M. J. D. Vujanovic. B. nov. S. y Bartnicki-Garcia. A. H.

‘A revision of the genus Trichoderma. S. C. Wallingford. (1998) CBS Course of Mycology. St Paul. R. London. R. R. 9th edition. S. Ellis. CAB International. R. MA. R. (2000) ‘Cloning the soil meHongos del suelo saprófitos y patógenos de plantas 277 . St Paul MN. K. M.. J. K. American Phytopathological Society. A. (1998a) Illustrated Genera of Ascomycetes. (1985) Microfungi on Land Plants: An Identification Handbook. Ellis. (1971) Dematiaceous Hyphomycetes. Cannon. Australia. Eching. B. I.. P. vols I and II. 1990.. y Ellis. I. y Aptroot. Erwin. B.. (1993) Coelomycetous Anamorphs with Appendage-bearing Conidia. F. J. APS Press. expanded reprint (Richmond Publ. Hanlin. J. A. Crous. 3rd edition. Brady. IV. Co. (1991c). I. Section Pachybasium’. vol.Bissett.. Waterloo. W. Domsch. David. II. D.. London. J. y Bullock. Canadian Journal of Botany. Additional notes on section Longibrachiatum’. Rondon.. August. Kew. CBS. (2000) A Laboratory Guide to Common Penicillium Species. J. M. P. 1997).. Loiacono. D. M. J. Kew. Osburne. Leslie. W. MN. Nag Raj.. Malden. (1976) More Dematiaceous Hyphomycetes... A. (1991b) ‘A revision of the genus Trichoderma. 2nd edition. St Paul. T. S. T.. APS Press. J. pp. P. CMI. y Pitt. M. F.. C. Gams. North Ryde.T. (1977) Chytridiomycetarum Iconographia. S. Minor. MacNeil. y Stalpers. M. M. vol. B. L. Liechtenstein Kirk. (2001) Dictionary of the Fungi. Cramer. M. B. (2002b) Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. pp. J.. H. Canadian Journal of Botany. vol. A. M. C. 4th edition. R. 2418–2420. Clardy. J. I.. MN. CMI. J. Hanlin. Liles. A. London. Gams. B. III. 69. Vaduz. J. S. Hanlin. T. R. L. K. Summerell. Handelsman. 2373–2417. W. Klich. (2006) The Fusarium Laboratory Manual.. P. A. P. Ellis. Bissett. T. American Phytopathological Society. y Goodman. Pitt. (1998b) Combined Keys to Illustrated Genera of Ascomycetes. F. O... C. St Paul. CSIRO. vol. The Netherlands. y Anderson. (2007) Compendium of Soil Fungi. Karling. Illustrated genera of Ascomycetes. Mycologue Publications. (1988) A Laboratory Guide to Common Aspergillus Species and Their Teleomorphs. CSIRO. 69. A. Tiong. Baarn. MN. R.. T. St Paul. Australia. M. J. M. IHW Verlag.. American Phytopathological Society. Croom Helm. Blackwell Publishers. Gilman. MN. North Ryde. Betterman. (1996) Phytophthora diseases worldwide. Grossman. y Ribeiro. H. Hoekstra. A. Lynch. E.

vol. Frisvad. J. Chaverri. 66. 1–59. Mycological Papers. Mycological Papers. C. O. APS Press. J. Seymour. Mycological Papers.. London. The Netherlands. ARS. Applied Environmental Microbiology. B. (1991) Identification of Rhizoctonia species. Burpee. E. P. taxonomy. (1970) ‘The genus Phytophthora de Bary: Diagnoses or descriptions and figures from the original papers’. (1968) ‘The genus Pythium Pringsheim: Diagnoses or descriptions and figures from the original papers’. (2002) ‘Biology and systematics of Saprolegniaceae’. 1–50. y Padgett. vol.. M. accessed November 2002. pp.. Sneh. y McCray. Erwin. S. S. D. Jr. St Paul. B. 278 Manual de biología de suelos tropicales . USDA.. www. Farr. Waterhouse. L. CMI. Waterhouse. Kew. Samuels. D. ecology and pathology. P. 110. G. pp. W. R. y Bartnicki-Garcia. Samson.ars-gring. MN.uncw. St Paul.tagenome: A strategy for accessing the genetic and functional diversity of uncultured microorganisms’. MN. M. 109. pp. (1967) ‘A key to Pythium Pringsheim’. 6th edition. (2000) Introduction to Food and Air-borne Fungi. vol. L. CBS. G. M. R. Hoekstra. G. T. C. Waterhouse. y Ogoshi. Sutton. E. http://nt.edu/people/padgett/book.. pp1–15. E. Sitios web Johnson.. G. C. A. Baarn. APS Press. vol. 2541–2547.gov/ taxadesciptions/keys/Trichodermalndex. (1983) Phytophthora: Its biology. D. Systematic Botany & Mycology Laboratory. A. Tsao. y Filtenborg. B.cfm. 122.. F. (undated) ‘Trichoderma Online’. (1980) The Coelomycetes. H.

0g penicilina 0.0g peptona 1.5g glucosa 0.s zanahoria.p.2g pimaricina 0.2g pimaricina 0.Apéndice 8.02g estreptomicina 0.2g pimaricina 0.1g agar 18g MP5.0g agar 18g Antibióticos.0g agar 18g agua destilada 900 ml PARP harina de maíz 17g pimaricina 10mg ampicilina 250mg rifampicilina 10mg pentacloronitrobenceno 100mg himexazol 50mg AHM + p.02g estreptomicina 0.0g KNO3 1.1g V8 agar V8 100 Ml CaCO3 2.agar extracto de malta extracto de malta 20g agar 18g SNA – agar sintético pobre en nutrientes KH2PO4 1.2g agar 18g OA – agar harina de avena Copos de avena 30g Agar 15g ADP – agar dextrosa y papa papa.5g KCL 0. si es necesario penicilina 0. basados en Gams et al. –agar con harina de maíz harina de maíz 8.1 Medios de cultivo y aditivos: cebos Las recetas son para un litro. cubitos 200g dextrosa 20g agar 18g PCA.agar papa zanahoria papa 20g zanahoria 20g agar 18g CA – agar zanahoria zanahoria.02g estreptomicina 0.p. molida 100g agar 18g penicilina 0.2g sacarosa 0.s.1g Hongos del suelo saprófitos y patógenos de plantas 279 .agar maltosa peptona maltosa 4. (1998) y Erwin y Ribeiro (1996). molida 100g agar 18g CA + p. MA2% .0g MgSO4 x 7H2O 0.

Sustratos queratinosos: cabellos de niños rubios. papel celofán. Los cebos de vegetales pueden ser lavados. trozos de manzana.Cebos El uso de cebos es imprescindible para la recuperación de zoosporas formadas por hongos de sustratos complejos como el suelo. granos de polen de Pinus. epidermis de cebolla. Sustratos celulósicos: semillas de Sorghum. hojas secas de maíz. los de origen animal son esterilizados usando luz UV por una hora. Sustratos quitinosos: piel de serpiente. papa. 280 Manual de biología de suelos tropicales . Dependiendo del tipo de hongo pueden ser utilizados cebos específicos. zanahoria o pepino. exoesqueleto de camarones. alas de insectos.

2000). 1988). Se distinguen cinco géneros importantes de esta plaga: Anastrepha. Se trata de insectos multivoltinos con un potencial biótico relativamente alto y una gran capacidad para infestar diferentes especies de frutos nativos y exóticos.. Bactrocera. que se extienden globalmente. Rhagoletis y Dacus. 1996). con una punta larga y delgada. excepto en la Antártida (White y ElsonHarris. el periodo durante el cual la larva destruye la pulpa de la fruta. Los daños que producen las moscas de la fruta se dan durante la fase inmadura. Su clasificación se basa exclusivamente en los caracteres morfológicos del adulto. y a la familia Tephritidae. enfocados a las fases de pupa y larva (Silva et al. éstas pertenecen al orden Díptera. y su sexo es fácilmente distinguible debido a que las hembras tienen un prominente ovopositor. Las características taxonómicas que permitan distinguir sexos entre pupas y larvas aún no se han determinado (Salles. las moscas de la fruta son consideradas una de las más preocupantes. al final del abdomen. Algunos estudios han acentuado aspectos ecológicos y etológicos de las moscas de la fruta. ya que representan plagas primarias para la mayoría de los cultivos frutales. Las moscas de la fruta muestran un comportamiento y una taxonomía complejos (Bateman. 1972. en su mayor parte.Capítulo 9 Muestreo. 1996. Steck y Wharton. preservación e identificación de moscas de la fruta Neliton Marques da Silva INTRODUCCIÓN Entre las plagas de la fruta de América tropical. debido al gran impacto económico que causan. 1992). Ceratitis.. volviéndola 281 . Zucchi et al.

Después de que la fruta infestada cae. y constituye una de las fases más vulnerables al estrés abiótico y a muchos enemigos naturales. dependiendo de la temperatura y de la humedad. La fase pupal dura de 8 a 10 días. los procedimientos para muestrear varían de acuerdo con la fase y el propósito. de ahí que. Aun cuando las larvas son parasitadas dentro de los frutos. que es diurna y responde a estímulos visuales y olfativos. se puede utilizar jugo de fruta al 10%. De manera alternativa. removidos. Debido a que el ciclo de vida involucra las partes aéreas de la planta hospedera. Esta profundidad varía dependiendo de las condiciones físicas del suelo. sin embargo. en función de la temperatura. durante una parte de su ciclo de vida. esta técnica representa una relación ambigua entre la mosca y su hospedero. el parasitoide adulto puede emerger en el suelo. por lo tanto. Antes de llegar al estado adulto. la mosca de la fruta se puede considerar un organismo del suelo. en su mayor parte depredadores y entomopatógenos como bacterias. 282 Manual de biología de suelos tropicales . azúcar al 10% o jarabe de caña de azúcar al 10%. El desarrollo de la pupa ocurre en el suelo. puesto que ésta sólo se puede establecer usando frutos infectados. sobre todo. pues sólo permanece ahí durante una etapa de su vida.5 y 9). ramas o semillas en donde las larvas de la mosca residían previamente. resulta de suma importancia que en el diseño de la estrategia del manejo integrado de plagas se tome en cuenta la biodiversidad del suelo como un factor fundamental que influye en la mortalidad de larvas y pupas. MUESTREO DE LA MOSCA DE LA FRUTA El muestreo de adultos de moscas de la fruta se lleva a cabo utilizando trampas McPhail (Ilustración 8b) con atrayente alimenticio. junto con el suelo. Los cebos deberán reemplazarse cada semana y los especímenes capturados. la humedad y la textura. la mosca de la fruta es un habitante temporal del suelo. por ello. Estos antagonistas juegan un papel importante en el control biológico de las moscas de la fruta. el uso de trampas con cebos alimenticios es lo más recomendable. normalmente. las larvas migran de la fruta para pupar en el suelo (Ilustración 8a). las larvas se mueven sobre la superficie del suelo buscando condiciones adecuadas para su desarrollo y penetran hasta una profundidad aproximada de 10 cm para entrar en la fase de pupa. 200 ml de proteína hidrolizada de maíz (5% en agua preservada con tetraborato de sodio con un pH entre 8. En el caso de la mosca adulta. hongos y nematodos.inservible para cosecha o consumo. que también forman parte de la biota del suelo (véase Capítulo 10).

El número de trampas por unidad de superficie puede variar de acuerdo con los objetivos del proyecto. la trampa puede utilizar como soporte tres palitos. Hasta cinco trampas por hectárea pueden ser instaladas en áreas con arbustos o árboles (jardines caseros). esto se puede llevar a cabo en el campo o en el laboratorio. es decir. Si el objetivo es monitorear plagas. M. Se anota el sexo y se colocan en frascos de vidrio (de alrededor de 50 ml) etiquetados. Las trampas deberán ser colocadas de manera equidistante.Las trampas se instalan en el centro del dosel de los árboles y su localización será tomada con GPS. con alcohol al 70% para su identificación posterior. el contenido de la trampa deberá pasarse por una malla de nylon de 1. primero será necesario separar las moscas de la fruta de otros especimenes. mientras que. hasta tres por hectárea son las recomendadas para plantaciones herbáceas. Muestreo. La etiqueta deberá incluir la información básica de muestreo y el número de la trampa. dispuestos en forma de trípode. Trampa No 5 • • • • • También deberá ser registrada la identidad de individuos de otros grupos taxonómicos capturados en las trampas. preservación e identificación de moscas de la fruta 283 . Por ejemplo: Manaus-AM Brasil 04° 05`S. o bien. la densidad deberá ser de tres a cinco trampas por hectárea o estar de acuerdo con el tipo de uso de suelo existente en el predio.5 mm para remover las moscas y separarlas de otros grupos taxonómicos utilizando unas pinzas curvas. cada tipo de uso de suelo existente debe ser monitoreado con la misma densidad de trampas. colocarse sobre un árbol adyacente. Cuando el objetivo es el manejo integrado. 60° 04´W 23/Marzo/2006 Silva. COLECCIONANDO LOS ADULTOS CAPTURADOS Debido a la probabilidad de que distintos grupos taxonómicos de insectos sean capturados. una trampa cada cuatro hectáreas resulta suficiente. N. Cuando los cebos son reemplazados. si lo hay. En el caso de plantas herbáceas.

se protegen con bolsas de tela y se transportan en cajas térmicas hasta el laboratorio. se depositan en charolas de plástico con una capa de vermiculita o arena fina como substrato de pupación. se recogen frutos al azar en diferentes agroecosistemas y en diferente estado de de maduración. Las fechas de emergencia. se pesan. las moscas adultas son alimentadas con una solución de miel disuelta en agua al 10% que será cambiada cada día.5 mm. se cuentan y se separan para cada sitio de muestreo. durante 48 horas para permitir el endurecimiento cuticular y la pigmentación completa de los patrones alares (Ilustración 8c): características de gran importancia para la identificación taxonómica. Estas jaulas deberán ser examinadas diariamente. el número y el sexo deberán quedar registrados con relación a las moscas o parasitoides. Finalmente. Después de emergidas. las charolas se cubren con una tela de gasa y se aseguran con ligas de plástico para prevenir que se escapen las moscas adultas al emerger. La determinación de la relación de sexos hembra-macho (SR) para moscas adultas y parasitoides se hace de acuerdo con Silveira-Neto (1976) en función de la siguiente ecuación: Número de hembras SR= Número de hembras + Número de machos IDENTIFICACIÓN DE ESPECIES La identificación taxonómica de especies de Tephritidae se basa en un examen ventral de la región apical. con sus respectivas etiquetas de identificación.MUESTREO DE LA FRUTA Para poder establecer la relación entre las especies Anastrepha con sus plantas hospederas. para permitir la salida de las moscas adultas y/o parasitoides. Finalmente. de 1. el aculeo de la hembra bajo un microscopio estereoscó284 Manual de biología de suelos tropicales . para separar las pupas que posteriormente serán colocadas en jaulas. Posteriormente. OBTENCIÓN DE LAS PUPAS La vermiculita o arena fina deberá pasarse por una malla galvanizada. Los adultos emergidos serán retenidos. los especimenes recuperados son fijados en una solución de alcohol al 70%. Los frutos deberán ser colectados directamente de los árboles o inmediatamente después de caer al suelo. Los frutos muestreados se separan por especie.

in A. R. Muestreo. Malavasi and R. vol. Ribeirão Preto. vol. São Paulo. PhD Thesis. PhD thesis. pp. tergito medio. Ronchi-Teles (2002). Foote (1967). como las de Lima (1934). C. Escola Superior de Agricultura “Luiz de Queiroz”. robusta and schausi species groups of Anastrepha Schiner (Diptera: Tephritidae)’. (1972) ’The ecology of fruit flies’. B. Departamento de Zoologia. A. preservación e identificación de moscas de la fruta 285 . (1967) ‘Family Tephritidae’. Lima. Es recomendable que se depositen ejemplares de referencia en colecciones de museo. Brazil. M. Pennsylvania. Secretaria da Agricultura. (2000) ‘Biologia e ciclo de vida de Anastrepha fraterculus (Wied. (1993) “Levantamento e análise faunística de moscas-das-frutas (Diptera: Tephritidae) em quatro locais do Estado do Amazonas’. Ronchi-Teles. Zucchi (eds) Moscas-das-frutas de importância econômica no Brasil: Conhecimento básico e aplicado. utilizando un microscopio de transmisión (100X). University of São Paulo. pp. Federal University of the Amazon (UFAM) and National Institute for Agricultural Research (INPA). A. L. Silva (1993). 4.pico (40X) o mediante el montaje sobre laminillas para examinar estas estructuras. 17. las características morfológicas del aculeo (Ilustración 8e) con especímenes de museo o usando claves taxonómicas. A. Memórias do Instituto Oswaldo Cruz (Rio de Janeiro).)’. A. no. Manaus. (1934) “Moscas-de-frutas do gênero Anastrepha Schiner. (2002) “Ocorrência e flutuação populacional de espécies de moscasdas-frutas eparasitóides com ênfase para o Gênero Anastrepha (Diptera: Tephritidae) na Amazônia Brasileira’. 1868 (Diptera: Trypetidae)’. N. 493–518. Steyskal (1977). Foote. Vanzolini (ed) A Catalogue of the Diptera of the Americas South of the United States. coloración de cuerpo. es necesario extraer completamente el aculeo de la funda del ovipositor con ayuda de agujas o pinzas (Ilustración 8d). Annual Review Entomology. o que éstas sean incorporadas a la colección institucional del laboratorio. Brazil. REFERENCIAS Bateman. São Paulo. PhD Thesis. La identificación de especies del género Anastrepha se logra para las hembras adultas. H. M. The Pennsylvania State University. Holos. in M. abdomen y. Silva. 28. mesonoto. como lo describe Zucchi (1988). L. daciformis. comparando el patrón alar. Zucchi (1978 y 2000) y Norrbom (1985). Salles. En primer lugar. A. 487–575. Stone (1942). especialmente. Norrbom. (1985) ‘Phylogenetic analysis and taxonomy of the cryptostrepha.

. (1977) Pictorial Key to Species of the Genus Anastrepha (Diptera: Tephritidae). C. J. A. y Wharton. CRC Press. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. D. United States Department of Agriculture Miscellaneous Publications. and A. CRC Press. (1996) ‘Anastrepha species (Diptera: Tephritidae) from the Brazilian Amazon: Distribution. Steyskal.. M. G. R. Zucchi (eds) Moscas-dasfrutas de importância econômica no Brasil: Conhecimento básico e aplicado. Holos Zucchi. CAB International. Ceres. White. A. 6. M. A. Washington DC. and Silveira Neto. R. I.. Steck and B. N. Tephritidae) no Brasil: taxonomia. A. A. M. y Elson-Harris. M. R.. Wallingford. y Silveira Neto. vol. University of São Paulo. São Paulo. (1942) ‘The fruit flies of the genus Anastrepha’. pp. J. 286 Manual de biología de suelos tropicales . Brazil’. Zucchi. Barbin. Boca Raton. hosts and lectotype designations’. V. S. A. pp. A. R. de Souza (ed) Moscas-das-frutas no Brasil. J.. Entomological Society of Washington. S. (1992) Fruit Flies of Economic Significance: Their Identifications and Bionomics. S. Zucchi. Silva. grandis (Diptera: Tephritidae)’. Zucchi. Ribeirão Preto. São Paulo. O. A. Nakano. Malavasi and R. Silveira Neto. R. 439. A. N. in G. vol. Stone. Steck. in A. limae. (1978) “Taxonomia das espécies de Anastrepha Schiner 1868 (Diptera: Tephritidae) assinaladas no Brasil’. M.Silva. (eds) (1976) Manual de Ecologia dos Insetos. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. PhD Thesis. Campinas. Zucchi. 81. in H. Escola Superior de Agricultura ‘Luiz de Queiroz’. 1–112. no. in G. R. L. (1988) ‘Description of immature stages of Anastrepha interrupta. distribuição geográfica e hospedeiros”. Boca Raton. N. M. A. y Nova. A. Fundação Cargill. Steck and B. (2000) ‘Taxonomia’. A. Annals of the Entomological Society of America. 994–1003. (1988) “Moscas-das-frutas (Dip. (1996) ‘The natural hosts plants of Anastrepha (Diptera: Tephritidae) in the State of Amazonas.

o bien. aunque la cifra verdadera de diversidad puede ser mucho mayor (Groombridge. el primero para llevar a cabo el proceso de infección y el segundo. frecuentemente hospedante-específico. con el fin de utilizarlas como mecanismos de control de especies que son plaga. Jr y Ricardo Sousa Cavalcanti INTRODUCCIÓN Existe alrededor de medio millón de especies de insectos descritas en la tierra. el 10% pueden considerarse plagas agrícolas forestales o urbanas. Las enfermedades son procesos dinámicos en donde el patógeno (microorganismo) y el hospedante (insecto) están adaptados morfológica y fisiológicamente.Capítulo 10 Hongos y nematodos entomopatógenos Alcides Moino. prevenir su ocurrencia en insectos benéficos. El control microbiano es una forma de control biológico cuyo principio es el uso racional de entomopatógenos sin que necesariamente se eliminen las poblaciones de plagas. sin intervención humana. aproximadamente. para resistir la enfermedad. Si se asume que cada especie de insectos es susceptible a por lo menos un microorganismo patogénico. pero sí manteniéndolas en niveles por debajo del umbral de daño económico. ello da la idea de la potencial importancia del estudio de estos patógenos de insectos en el contexto de control de plagas y de biodiversidad. 1992). y que han demostrado su 287 . Esto es similar a la dinámica natural que sucede en el campo entre el patógeno y su hospedante. De éstas. La patología de insectos es la ciencia que estudia las enfermedades de insectos. Los principales microorganismos utilizados.

la Sterneinematidae y la Heterorhabditidae que son parásitos obligados de insectos y que son la base de varios plaguicidas biológicos diseñados específicamente para su uso en contra de plagas del suelo como los gorgojos y las larvas de mosca. los virus. baja persistencia e inactividad a bajas temperaturas (en el caso de los nematodos). se producen miles de nuevas esporas que se dispersan y continúan su ciclo de vida en nuevos hospedantes. invadiendo su cuerpo y matándolo de cuatro a diez días posteriores a la infección. La mayoría de los patógenos poseen una estrategia de transmisión de “sentar y esperar” (sensu Ewald. Myers y Rothaman. las bacterias. A pesar del éxito limitado de hongos y nematodos entomopatógenos como productos biocidas. los nematodos y los protozoarios. se han utilizado como biopesticidas para su uso contra poblaciones de plagas. Leger. ambos presentan desventajas debido a su alto costo. los basados en toxinas). y convirtiéndose posteriormente en adultos.5 mm de largo... aunque esta tecnología no se ha adoptado por completo en la práctica. 1995). aparece una nueva generación de estadios infectivos (Kaya y Gaugler. a pesar de ello. 2006). como es el caso de Lecanicillium logisporum. las bacterias que se introducen junto con el parásito se multiplican rápidamente y matan al hospedante. 1993). 1994. Existen dos familias. éstos aparentemente son componentes diversos y universales de las biotas del suelo. con varios grados de especificidad con su hospedante (Hajek y St. Los estadios juveniles parasitan a sus hospedantes. pobre persistencia (especialmente bajo condiciones tropicales) y su baja eficacia cuando se compara con los insecticidas químicos (por ejemplo. Una vez muertos los insectos. Un pequeño número de especies generalistas con capacidad para ser cultivadas y producidas de manera masiva. Los nematodos entomopatógenos miden alrededor de 0.potencial en el control microbiano de insectos son: los hongos. Los hongos producen esporas que germinan al contacto con el hospedante. penetrando directamente la cutícula o a través de las aperturas naturales como los espiráculos. 1995): los organismos producen fases infectivas que son liberadas al ambiente cuando muere el hospedante 288 Manual de biología de suelos tropicales . permitiendo que los nematodos crezcan y maduren sobre el tejido en descomposición. Se conocen cientos de especies de hongos entomopatógenos que atacan una amplia gama de insectos y ácaros. 1997. en donde pueden ser excepcionalmente virulentos (o decir. debido a su alto costo. Roy et al. causar la muerte rápida del hospedante y provocar grandes niveles de mortandad en las poblaciones de éste) y causar epizoóticas periódicas (Chandler et al. Después de una a dos semanas posteriores a la invasión del hospedante.

Aunque los artrópodos que viven por encima del suelo. flavoviride. Las fases de diapausa y latencia reducen la dependencia en la movilidad de su hospedante y pueden complementarse con la capacidad para vivir saprotróficamente en suelo. Los hongos de mayor interés por su potencial como patógenos de insectos son: Beauveria bassiana. 2001). Paecilomyces spp. se producen asexualmente estructuras reproductivas conocidas como esporas o conidias que ayudan a la diseminación del patógeno. Metarhizium anisopliae. En el caso de los hongos entomopatógenos esto se apoya en evidencia molecular que muestra que poblaciones en suelo no son totalmente clonales. son susceptibles a hongos y nematodos... Nomuraea rileyi. Después de la infección exitosa de un hospedante. aunque su eficiencia competitiva en comparación con otros saprótrofos de vida libre puede ser baja. Hirsutella thompsonii. Cordyceps spp. el reservorio de las fases infectivas. Lecanicillium lecanii. y hongos del orden Entomophthorales (Zoophthora. M. debido a que ofrece un microambiente estable con una estructura de poros favorable para nematodos y recursos orgánicos para hongos. Entomophaga. Los hongos poseen una gran variabilidad genética y un amplio rango de hospedantes. Estas estructuras vegetativas son llamadas hifas. sugiriendo de nuevo que los patógenos se distribuyen ampliamente en el suelo. Aschersonia aleyrodis. como los que habitan debajo de éste. H ongos y nematodos entomopatógenos 289 . Esta capacidad es una adaptación a sus hospedantes artrópodos que son más grandes y con patrones de distribución en parches. Neozygites).y tienen la capacidad de entrar en un estado de letargo o diapausa y permanecer latentes hasta que haya nuevos hospedantes disponibles. que constan de células alargadas provistas de una pared que contiene celulosa y quitina.. Entomophthora. además de otros carbohidratos y proteínas. ello a pesar de la ausencia de fases sexuales manifiestas y que el significativo flujo de genes ocurre localmente (Bidochka et al. Con frecuencia no hay correlación entre la densidad del hospedante y la ocurrencia de la enfermedad. lo que les permite mayor distribución geográfica de la población y alta movilidad. sin duda. el suelo es. BIOLOGÍA DE HONGOS Y NEMATODOS ENTOMOPATÓGENOS Hongos Los hongos son microorganismos unicelulares (levaduras) o multicelulares (especies filamentosas).

también pueden obtenerse resultados semejantes y se requerirá de medidas adicionales para identificar patógenos con potencial. La población microbiana en cualquier ambiente natural es muy grande y por lo tanto. Por lo general.. parasitismo obligado y parasitismo facultativo. en el caso de los nematodos. 1998A) Las muestras de suelo se colectan a una profundidad de 0 a 20 cm y se colocan en bolsas de plástico debidamente etiquetadas. bacterias y otros microorganismos saprotróficos que no tienen potencial como agentes específicos para el control de plagas. se basa en caracteres morfológicos del organismo en cultivo y en la estructura de los conidióforos y conidias. METODOLOGÍA PARA EL AISLAMIENTO DE HONGOS ENTOMOPATÓGENOS (Chase et al. en el suelo).. la identificación se fundamenta en medidas hechas a partir de estructuras presentes en los estadios juveniles infectivos. Liud et al. cuando el objetivo del muestreo es evaluar la biodiversidad (por ejemplo. A continuación se describen dos técnicas básicas para el aislamiento de hongos y nematodos entomopatógenos a partir de muestras del suelo. 1993. En cada sitio de muestreo. los nematodos entomopatógenos presentan una estrecha asociación (simbiosis) con bacterias específicas. Estas bacterias se multiplican dentro del insecto y lo matan al causarle septicemia (infección generalizada). De igual manera. cuando un insecto muerto es recogido para el cultivo de inóculo infectivo. aislar poblaciones. en el caso de los hongos.Nematodos Los nematodos entomopatógenos son organismos pseudocelomados vermiformes muy similares a los que parasitan plantas y que pueden asociarse con los insectos de tres formas: forecia (adherencia pasiva y transporte). para lograr una buena identificación es necesario aislar el microorganismo en cultivos puros o al menos. Los principales grupos de nematodos de interés pertenecen al orden Rhabditida. 290 Manual de biología de suelos tropicales . Sin embargo. las cuales son los agentes primarios que inician la infección en el hospedante. La identificación correcta de un agente entomopatógeno. y dentro de éste a las familias Steinernematidae y Heterorhabditidae.. 1986. Los nematodos transportan internamente bacterias específicas que son liberadas en el interior del cuerpo del insecto después de que el nematodo penetra a través de aberturas naturales como boca. espiráculos y ano. Alves et al. es muy común encontrar también hongos.

utilizando agua destilada esterilizada hasta alcanzar una dilución 10-4.. H ongos y nematodos entomopatógenos 291 . se añade agua destilada hasta alcanzar el volumen original de 1 litro y posteriormente se añaden 20 g de agar. El crecimiento de los hongos y su esporulación se evalúan de 7 a 15 días posteriores a la inoculación. aunque puede prescindirse de él. En el laboratorio se debe mezclar muy bien la muestra compuesta y tomarse alícuotas de 1g de suelo. Las cajas se incuban a 27°C (Figura 10.0 mg de tetraciclina y 10 mg de cristal violeta.2) y almacenaje de conidios en condiciones de congelación utilizando tubos Eppendorf para tal fin. 20 g de dextrosa. Después de la incubación. De las diluciones 10-3 y 10-4 se toman 0. se esteriliza durante 20 minutos a 120°C y se filtra. El fungicida dodina se añade en pequeñas concentraciones (cerca de 10 mg ml-¹) al medio selectivo con el fin de aislar hongos entomopatógenos a partir del suelo y preservar los aislamientos menos susceptibles al fungicida.) puede llevarse a cabo usando un microscopio compuesto y claves de identificación basadas en caracteres morfológicos de las estructuras reproductivas. la identificación de los cultivos de interés (principalmente Metarhizium anisopliae. tales como conidióforos. Samson et al. con la subsecuente purificación de los cultivos (Figura 10.1ml y se colocan en medio de cultivo selectivo (el cual contiene el fungicida dodina) y en medio ADP (Agar-Dextrosa-Papa). 200 g infusión de papa (preparada a partir de papas rebanadas y hervidas para extraer el almidón).1). El medio selectivo de dodina se prepara de la siguiente manera: 20 g de harina de avena + 1 litro de agua destilada. 1998). Después de este paso se toman 0. Beauveria bassiana y Paecilomyces spp. el volumen añadido se reparte sobre la superficie utilizando una asa de Drigalski (ya sea de acero inoxidable o vidrio). 1998b.1 ml de la última dilución y se colocan sobre la superficie del medio de cultivo contenido en una caja Petri. conidias y fiálides (Alves et al.se toma una muestra compuesta a partir de seis submuestras tomadas en puntos localizados alrededor de un monolito central (véase Capítulo 2). El medio ADP se prepara de la siguiente manera: 15 g de agar. Estas muestras pueden tomarse mediante el método de extracción de núcleos (véase Capítulo 4: Mesofauna). 550 mg de dodina (N-dodecilguanidina acetato). Esto suele ser efectivo especialmente con Metarhizium anisopliae. 5.. y agua destilada hasta completar el volumen total de un litro. A partir de estas alícuotas se preparan diluciones 10-1 sucesivamente.

bajo condiciones de congelación. y transfiriéndola a una caja Petri nueva con medio de cultivo ADP (tres puntos de inoculación por caja).1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) dilución seriada de la suspensión acuosa que contiene al hongo. c) incubación bajo condiciones controladas en una cámara DBO.2 Cultivos purificados de Beauveria bassiana.Figura 10. d) almacenaje de conidios en tubos Eppendorf.1 ml) en una caja petri con medio de cultivo. creciendo en medio ADP. Nota: la separación de contaminantes se logra recogiendo una pequeña porción de cualquiera de las colonias del hongo de interés con una aguja. Figura 10. 292 Manual de biología de suelos tropicales . b) inoculación de la suspensión (alícuota de 0.

0.3M. Una trampa de White se puede construir utilizando dos cajas Petri: una caja de 5 cm de diámetro se coloca invertida dentro de una caja de 9 cm que contiene agua esterilizada o medio “S” esterilizado y cubierta con un círculo de papel filtro de 9 cm. utilizando la técnica de trampas de insectos con cinco larvas de Galleria mellonela (L. Figura 10. la suspensión se lava adicionando una solución de formaldehído (1%) o solución de Ringer para obtener una concentración final de 10.. Na EDTA 0. que contienen las muestras de suelo y se mantienen cerradas a 23°C en oscuridad.4M. y pueden adquirirse comercialmente. 1998b. El medio “S” consiste en un litro de solución madre (0. H ongos y nematodos entomopatógenos 293 . La suspensión se deja reposar para permitir que los nematodos queden en el fondo.. Las larvas se colocan en cajas de plástico de 500 ml.METODOLOGÍA PARA EL AISLAMIENTO DE NEMATODOS ENTOMOPATÓGENOS (Bedding y Arkhurst. 1974) Se recogen las muestras de la misma forma que fue descrita anteriormente. Después de dos días.05M KH2PO4.1mM.6mM. Las larvas de insectos infectadas se colocan en el centro del papel filtro. Los ejemplares de nuevas especies pueden someterse a un análisis molecular para así comparar los patrones de DNA.7H2O 0. Los nematodos se almacenan en envases cerrados de 50 ml a 11°C o cercano a esa temperatura.000 estados infectivos ml-¹.4M. ZnSO4.7H2O 0. 2004. pH 6. el cual cae hasta tocar el líquido en el borde de la caja inferior. si se encuentran estados infectivos en el líquido. Adams y Nguyen. La detección de nematodos se lleva a cabo mediante bioensayos. 2002). FeSO4.) (Lepidoptera: Pyralidae). Las larvas de este lepidóptero son conocidas como mealworms (o gusanos de la harina). MgSO4 0. 1μM colesterol) a la que se le añaden 26 ml de una solución nutritiva fresca que contiene citrato de K 0.1M NaCl. La mortandad de las larvas se evalúa después de cinco a siete días. éstos deben colectarse y colocarse en agua destilada dentro de un frasco Becker. Posteriormente. La identificación se lleva a cabo con base en las claves específicas de identificación para cada familia de nematodos (Steinernematidae y Heterorhabditidae) (Alves et al. Las larvas muertas se colocan en una trampa White (Chen et al.3) para colectar los estadios juveniles infectivos a partir de los cuerpos muertos.3mM. 0. CuSO4 0 1μM. CaCl2 0.

(1998a) “Técnicas de laboratório”.. T. S. CAB International. in S. Deckoning. Alves. Gaugler (ed) Entomopathogenic Nematology. B. pp. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. Alves. N. R. M. Alves (ed) Controle Microbiano de Insetos. B. A. Gaugler. C. Wallingford. A. Nematologica. E. REFERENCIAS Adams. Lavender. y Akhurst. F.. Almeida. 109–110. FEALQ.. Bedding. Fotos: R. 2nd edition. B. vol.. Ferraz. 2nd edition.Figura 10. S. in S. J. in R. (1998b) “Chaves para identificação de patógenos de insetos”.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). B. Bidochka. y Nguyen. (2001) ‘Habitat association in two genetic groups of the insect-pathogenic fungus Metarhi294 Manual de biología de suelos tropicales . A. M. A. c) larvas que muestran la patología típica de infección por nematodos.. M. Alves (ed) Controle Microbiano de Insetos. A. Moino Junior. (2002) ‘Taxonomy and Systematics’. K. B. J. y Castello Branco Jr. Piracicaba Brazil. A. L. Kamp. FEALQ. y Alves. B. M. J. C.. y De Croos. L. B. Piracicaba Brazil. J. d) emergencia de juveniles infectivos en la trampa White. J. (1974) ‘A simple technique for the detection of insect parasitic nematodes in soil’. R. J. 21.

M. H. E. Meyers. y Gaugler. J. P. Springer-Verlag. 285–292. D. J. H. vol.. (1993) ‘Entomopathogenic nematodes’. 69. Milner. pp. 194–198. Evans. D. Liu. C. H. y Pell. 67. L. New York. R. y Dickson. (ed) (1992) Global Biodiversity: Status of the Earth’s Living Resources. (1988) Atlas for Entomopathogenic Fungi. W.. 51. B.. E. y Latgé. H. E. Journal of Invertebrate Pathology. S. F. K. McRae. Leger. Osborne. Applied Soil Ecology.. E. 133-141. y Read. y Lutton. D. R. y Rothaman. 10. 39. (1997) ‘Sampling and occurrence of enomopathogenic fungi and nematodes in UK soils’. A. L. J. A. D. 293–322. London. Chen. Chase.zium anisopilae: Uncovering cryptic species’.. Roy. vol. pp. World Conservation Monitoring Centre. Chapman and Hall. Applied and Environmental Microbiology. A. H ongos y nematodos entomopatógenos 295 .P. Z. Steinkraus. A. (1994) ‘Interactions between fungal pathogens and insect hosts’. P. pp. V. Eilenberg. X. Y. R. 1335–1342. Annual Review of Entomology. 181–206. (2006) ‘Bizarre interactions and endgames: Entomopathogenic fungi and their arthropod hosts’. Kaya.. Annual Review of Entomology. Hay.. (1995) ‘The evolution of virulence: A unifying link between parasitology and ecology’. R. pp. 248–251. R. Groombridge. CAB International. pp. pp. 5. vol. 81. (1993) ‘The use of Dodine in selective media for the isolation of Metarhizium spp. G. vol. pp. 62. J. Samson.. y St. Hajek. A. C. Annual Review of Entomology. (1995) ‘Virulence and transmission of infectious diseases in humans and insects: Evolutionary and demographic patterns’. Journal of Parasitology. vol. 659–669. Trends in Ecology and Evolution. (1986) ‘Selective isolation of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium’. from soil’. Chen. vol. y Ferguson. vol. 38. Hajek. Wallingford. J. Ewald. Chandler. vol. pp. Y. 331–357. J. Advances and Perspectives. pp. S.. vol. Florida Entomologist. W. K. C. G. Z. (2004) Nematology.

.

En la mayoría de los casos. en función del propósito y del contexto de la clasificación misma. Cuántas clases de uso de suelo pueden ser definidas con respecto a la intensidad de usos de suelo se ilustra a continuación. pero las clases finales de uso de suelo dependerán de la selección de dichos atributos a considerar para la clasificación. en los puntos de muestreo. La clasificación de uso de suelo se facilita por una estructura jerárquica donde se ordenan los atributos. Jeroen Huising RESUMEN DE LA METODOLOGÍA PARA LA DESCRIPCIÓN DE USO DE SUELO Este capítulo muestra una lista estructurada de atributos de uso de suelo que sirve como guía para la observación de características de uso de suelo en el campo. los dominios de los valores de los atributos se especifican. se necesitarán mediciones reales. 297 . cuando se precise un alto nivel de detalle. Solamente en algunos casos. Esto se lleva a cabo mediante la observación directa. Este método ofrece varios niveles de detalle que describen las características. lo cual requiere solamente el valor adecuado por evaluar en el campo. dependiendo de los datos disponibles.Capítulo 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo E. entrevistas o preguntas.

y en particular la intensidad de su uso. se considera uno de los factores determinantes de la abundancia y riqueza de poblaciones de organismos del suelo. Los procesos dominantes que determinan la presencia e incidencia de la biota del suelo y la escala espacial donde éstos se manifiestan no se conocen completamente. Las clases de uso de suelo predefinidas no son necesariamente aplicables o relevantes para todas las áreas involucradas porque será muy difícil definir un grupo estándar de clases de usos de suelo. a través de puntos de referencia de los países tropicales involucrados. Para comprobar esta hipótesis. razón por la cual fue adoptado un sistema regular en cuadrícula para muestrear la biodiversidad del suelo con un inventario detallado de su uso y cobertura en los lugares de muestreo. especialmente en las regiones tropicales.ANTECEDENTES Y PRINCIPIOS DE DISEÑO Propósito de la clasificación del uso de suelo y de su cobertura vegetal El uso de suelo. pero dependen de los clasificadores o atributos seleccionados para la asignación de la clase de usos de suelo a cualquier observación particular. 2005). la hipótesis central del proyecto CSM-BGBD (Giller et al. en cuanto al uso de varios recursos como fotos aéreas o imágenes satelitales para el propósito de la clasificación. de manera que se puedan definir las clases de uso de suelo. Dicha estructura necesita ser flexible. la historia de uso de suelo y las prácticas de manejo de los mismos. implica que las clases de uso de suelo no están definidas a priori. el enfoque que se describe a continuación se aleja de la idea de que las clases de uso de suelo sean definidas de acuerdo con la identificación de las características relevantes de uso de suelo (atributos) que permiten una 298 Manual de biología de suelos tropicales . 1975). dada la variación en los cultivos y sus posibles combinaciones. proporciona una estructura para la clasificación de usos de suelo. basadas en un común denominador en todas las áreas bajo estudio. y al mismo tiempo. de modo que se puedan reflejar las diferencias en la intensidad de uso de suelo. lo que facilita el análisis de los factores determinantes actuales y una clasificación a posteriori. En lugar de utilizar clases predefinidas de uso de suelo.. La idea general es que el contenido de un estudio depende de la naturaleza de la región (Vink. Este capítulo presenta una estructura que provee el registro sistemático de las características de uso de suelo. se requiere de un sistema que permita el registro de las características de uso de suelo en las parcelas de muestreo y su clasificación posterior. Lo último. y es por lo tanto.

discriminación entre clases de usos de suelo. El método que se presenta pretende ser de utilidad para la descripción de uso de suelo a nivel parcela. La descripción detallada de uso y la cobertura de suelo deberán formar parte del inventario. Para la clasificación y descripción de las áreas de vegetación (semi) natural se puede seguir el LCCS. El sistema de clasificación de uso y cobertura del suelo ayuda a la armonización de los procedimientos para la recolección de datos y al manejo de los mismos. es diferente al monitoreo usado con frecuencia que incluye en la descripción de uso de suelo y el estudio de las condiciones naturales y socioeconómicas del suelo como un primer objetivo (Vink. sin incluir elementos relacionados con el manejo de ganaD escripción y clasificación de uso de suelo en puntos de muestreo 299 . etc.. ej. No obstante. 1975). El enfoque del inventario de uso de suelo aquí descrito se apoya principalmente en ese sistema de clasificación. Un segundo objetivo para los inventarios de uso de suelo es proveer información básica para definir los usos de suelo alternativos y las prácticas de manejo que mejoran la sustentabilidad de la producción agrícola y conservan la biodiversidad del suelo. sistemas acuáticos y principalmente áreas sin vegetación. los métodos descritos en este capítulo se aplican únicamente en paisajes agrícolas terrestres (p. El objetivo del inventario para proveer datos que permitan evaluar cambios en la biodiversidad del suelo en relación con el uso del suelo. el manejo de los cultivos y del suelo) son de particular importancia porque impactarán notablemente sobre la distribución de los organismos del suelo. ej. aunque atributos relacionados con la historia del uso de suelo o condiciones ambientales podrían ser adicionados o modificados del sistema de clasificación. generalmente se traduce en el registro de la ocurrencia de cultivos. aunque contiene elementos añadidos relacionados con el manejo de suelo y cultivos. El método no incluye una estructura para la descripción de los atributos ambientales. áreas cultivadas y manejadas) mientras que el marco del LCCS incluye sistemas terrestres vegetales (semi) naturales. La estructura de las descripciones del uso de suelo actual no ha sido hecha para registrar el uso de suelo histórico. forma del paisaje. Las clases de usos de suelo obtenidas de esta manera pueden ser utilizadas para la extrapolación de los resultados más allá de los lugares de estudio. Los objetivos mencionados arriba fueron también citados en el programa Africover. como clima. que desarrollaron el Sistema de Clasificación de Cobertura de Suelo (LCCS) por Di Gregorio y Jansen (2000). para el propósito actual. Asimismo. Lo anterior. especialmente en su intensidad. los fenómenos relacionados con la forma en que se está utilizando el suelo (p.

porque esto no está particularmente relacionado a nivel de parcela. descrita por Lillesand y Kiefer (1987). resultarían de gran utilidad. Nivel 5: Características de uso de suelo del área directamente circundante a Manual de biología de suelos tropicales 300 . Existen cinco niveles en la jerarquía de clasificación: Nivel 1: Características relacionadas principalmente con el cultivo y el campo Nivel 2: Características relacionadas con la combinación de cultivos. La jerarquía de clases es construida sobre un conjunto de clasificadores. son rígidos y de capacidad limitada para incorporar nuevas clases. representan un subconjunto de un rango de posibles usos y coberturas de suelo) y debido a que no existe un sistema de clasificación de referencia. Cuantos más clasificadores se añaden. Estos “sistemas” de clasificación básicamente representan leyendas. El principio básico se apoya en el uso de clasificadores que refieren a criterios de diagnósticos o atributos independientes. donde cada jerarquía se relaciona con diferentes niveles de detalle temático y espacial. más detallado queda el nivel de clasificación. Nivel 3: Características relacionadas con aspectos culturales como irrigación y cultivo de temporada. Concepto y principios de diseño Los conceptos y principios de diseño del LCCS adoptados utilizan criterios diagnósticos ordenados de manera jerárquica para permitir un sistema de clasificación consistente con límites claros para las clases. no resulta apropiado para la descripción y mapeo de áreas más grandes. por lo tanto. ni incluye elementos relacionados con el sistema de cultivo. Obsérvese. son limitados cuando se les compara con otros sistemas. basada en la interpretación de fotografías aéreas con el propósito de elaborar mapas de uso y cobertura del suelo. por lo tanto. dispuestos en un sistema jerárquico. Muchos sistemas de clasificación utilizan a priori definiciones descriptivas de uso de suelo y clases de cobertura del suelo. Dicho sistema a menudo carece de una definición clara de los límites de clases. el sistema de clasificación de uso de suelo y de su cobertura del US Geological Survey. Nivel 4: Características relacionadas con el manejo de prácticas del suelo. no son exhaustivos (es decir. utilizados para definir una clase. El método que se describe a continuación. aunque se reconoce que para los estudios a una escala mayor o para considerar opciones alternativas de uso de suelo. a no ser la cobertura del suelo per se. por ejemplo.do.

Estos elementos de vegetación se relacionan con características permanentes en el paisaje. Esta información puede ayudar a determinar si la parcela bajo consideración representa una característica (o patrones) del uso de suelo o tipo de cobertura. lo que sirve para D escripción y clasificación de uso de suelo en puntos de muestreo 301 . patrones de campo) y los cultivos asociados. junto con el tamaño de las áreas de los campos. 1993).la parcela de muestreo. “cultivo de árboles” para un sistema basado en árboles). el deshierbe y la fertilización del mismo. En el siguiente nivel de la clasificación jerárquica se consideran las prácticas culturales relacionadas con el suministro de agua y factores de cultivos de temporada. un sistema de barbecho o un sistema de cultivo permanente. son características que no se evalúan en los primeros niveles de clasificación. Otros aspectos que se deben considerar son la distribución. normalmente. se han añadido clasificadores que relacionan el manejo del suelo y cultivos que permiten la determinación del nivel de intensidad de uso. se refieren a las operaciones realizadas en una parcela en particular. Las características no siempre son fácilmente observables. Por ejemplo. Las subclases pueden definirse basándose en otros cultivos que forman parte del sistema del cultivo general. cercas vivas. Estos tres primeros niveles forman la base para la clasificación de uso de suelo y la colecta de datos en relación con dichas características se sugiere representan los datos mínimos requeridos. pero con algunos antecedentes de uso de suelo y de los sistemas de cultivo habituales. como setos. Esto puede ser señal de cultivos simultáneos o. tales como la preparación del suelo. Las características de rotación de cultivos se consideran en otros estudios. especialmente en relación con elementos leñosos de la vegetación que no se reconocen como cultivo y en relación con cultivos en campos adyacentes. Este último determina si el campo forma parte de un sistema de cultivo migratorio. pero que se consideran importantes en relación a la intensidad del uso y pueden tener un impacto directo sobre la biodiversidad del suelo. El quinto nivel en los sistemas de clasificación se relaciona con elementos de vegetación leñosa (semi) permanentes dentro de la parcela y en los campos aledaños. incluyendo arreglos espaciales de los campos agrícolas. que muchas veces es referencia de la clase social y del tipo de manejo (Huising. Asimismo. la clase mayor es definida por el tipo de cultivo principal (p. en secuencia. éstos pueden ser evaluados. El tamaño del campo generalmente es indicador del tamaño de la finca. ej. Dichos clasificadores. el manejo de los campos agrícolas (es decir. barreras de viento y otras estructuras semipermanentes. o basados en los datos proporcionados por el agricultor.

Por otro lado. pueden añadirse sin mayores consecuencias para el sistema de clasificación. sirven para trazar la cartografía del uso de suelo (mediante la interpolación de puntos de observación que complementan un mapa). Los atributos técnicos específicos permiten una definición más precisa de clases de uso de suelo asociados. Además. Los valores de datos posibles (dominios de valor) para la mayoría de los atributos son dados para proporcionar una descripción estándar de las características de uso de suelo. la descripción cuantitativa de la intensidad del uso del suelo. Si se conoce el valor de clase a un nivel más específico. por lo tanto. Éstas sirven para guiar las observaciones en el campo en los puntos de muestreo y sus áreas circundantes. por ejemplo. no son independientes y pueden involucrar algún tipo de medición con un nivel más alto de detalle. En el caso de algunos de estos atributos. Los niveles de clasificación definen un eje de la clasificación jerárquica en donde atributos adicionales (conjuntos de ellos) en cada nivel subsecuente definen las subclases (que representan un mayor nivel de detalle). Estos atributos técnicos específicos. a su vez. el valor de clase a un nivel más detallado de generalización puede ser inferido. los dominios de valor no son específicos para permitir la definición de 302 Manual de biología de suelos tropicales . por ejemplo. Los principios de las clasificaciones jerárquicas son explicados por Molenaar (1991. el cultivo principal se puede describir como maíz (Zea mays). La transformación de las listas de atributos a formatos para registrar los datos en el campo resulta fácil. el cultivo principal puede describirse a un nivel más general (de género) como Zea o a un nivel de familia como Gramineae (pastos). como los refiere el LCCS. que pueden incluir. 1998) y Huising (1993). son consideradas observaciones a nivel de parcela. Los atributos.identificar posibles asociaciones de usos de suelo que. por lo tanto. información más específica se remite a variedades y esto representaría un mayor nivel de detalle (especificidad). Registro de datos en campo y observaciones adicionales En las siguientes secciones se presenta la lista de atributos para la descripción de usos de suelo. Estos nuevos atributos ofrecen información más específica sobre el objeto de observación. el patrón del campo ofrece información sobre la fragmentación del suelo y constituye otro aspecto de la intensidad de uso de suelo que puede impactar directamente sobre la biodiversidad del suelo. Además de este eje existe uno más en la clasificación jerárquica que hace referencia al nivel de precisión con que se describen las características de uso o añade información específica (detalles técnicos) de las características de uso de suelo descritas.

sus fuentes no son totalmente confiables. Sin embargo. media o alta. relacionada con el manejo. El sistema para describir el uso de suelo muestra varios niveles de detalle. clases de tamaño estándar definidas en campo con límites fijos no podrán ser significativas por esa razón.valores de datos en los rangos de observación y distribución de los valores de datos. junto con la información relacionada con el tercer nivel (es decir. basados en la definición de la clase adoptada (ver Tabla 11. Sin embargo. pero éstos deberán añadirse a los niveles más bajos de la clasificación jerárquica para evitar que interfieran con la estructura de la misma. Si éste no es el caso. Las observaciones para los tres primeros niveles del sistema de clasificación se pueden hacer directamente en el campo. con los conocimientos de un sistema habitual de cultivo y las prácticas de manejo en el área. A menudo. los datos relacionados con niveles muy detallados de observación son muy difíciles de obtener. La información en el cuarto nivel. Los atributos pueden agregarse para facilitar la descripción de características específicas de un área en particular. si la información sobre la tasa de aplicación de un fertilizante inorgánico en particular no se considera confiable o correcta. simplemente. basada en observaciones secundarias. características culturales) obtenida de un informante o derivada de la información general de las prácticas culturales en el área. El nivel de detalle al cual la información es reunida depende del propósito del inventario de uso de suelo y de la posibilidad de obtener D escripción y clasificación de uso de suelo en puntos de muestreo 303 . la información puede generalizarse para la clase de “fertilizante aplicado” (implicando el uso de fertilizante inorgánico). media o alta) puede ser asumida. esto no es prescriptivo en el sentido de que los datos necesitan ser colectados en todos los niveles de detalle. o bien. utilizando otros recursos. a partir de la observación directa en el campo. pero ello se compensa con la aplicación de la jerarquía en la precisión de los datos (referidos anteriormente como el segundo eje en el sistema de clasificación).6b). o bien. una tasa particular de aplicación (baja. A priori. Por ejemplo. no se obtiene a través de observaciones directas en el campo. como documentos). Las clases de datos deben indicar una discriminación relevante (significativa) de objetos y el subconjunto de clases debe ser extensivo (no exclusivo). sino que requiere del acceso a fuentes adicionales de información (a través de entrevistas a los agricultores. La información de estas fuentes de datos puede resultar incorrecta. es aceptable clasificar la tasa de aplicación como baja. a personas externas. se debería poder inferir información sobre el manejo de la parcela en particular. La situación contraria sería con el conocimiento de la práctica común en el área.

Para este propósito. el segundo. El sistema para la descripción de uso de suelo requiere de una estructura que pueda implementarse a detalle y que se considere viable bajo las condiciones reales. no se incluyen en las listas de atributos que se detallan a continuación. la información sobre el tipo de lindero se debe registrar. al mismo tiempo. por lo tanto. será siempre una ventaja. Estas observaciones secundarias sirven. El hecho de que el encargado del proyecto se encuentre familiarizado con el uso de suelo y con las prácticas de manejo en el área.la información requerida. Si bien estas observaciones no se incluyen en la clasificación del uso de suelo. dependiendo de la experiencia del encargado del proyecto. Observaciones secundarias pueden relacionarse con el estatus del cultivo o con la presencia de maleza. Se recomienda revisar el trabajo de Stocking y Murnaghan (2001) para los indicadores relevantes de observaciones en el campo. sin embargo. Se deberá registrar la localización específica del punto de muestreo dentro del campo (por ejemplo. (por ejemplo. Estas observaciones no se consideran como clasificadores y. ya que puede tener un efecto en la distribución de la biodiversidad del suelo. como un mecanismo para la validación de los datos en atributos y clasificadores e incluso para los resultados de clasificación finales. como el elemento de vegetación más dominante. siempre y cuando la cobertura del suelo no se clasifique como escasa. OBSERVACIONES DE USO DE SUELO: CLASIFICADORES Y ATRIBUTOS Observaciones respecto del cultivo principal y tamaño del campo El primer nivel del sistema de clasificación se reserva para las observaciones del cultivo principal. pueden ser incorporadas fácilmente a las libretas de campo en caso necesario. sí pueden aportar información para el análisis de datos. donde el cultivo de árboles se considera como el principal. además de los datos administrativos como hora. el centro o los linderos). nombre del encargado del proyecto y nombre de la persona que toma los datos. para la selección entre un cultivo de árboles y un cultivo anual en el mismo campo. El uso de una cuadrícula regular para el muestreo permite que se tomen puntos de muestreo en cualquier lugar dentro de la parcela y posibles efectos de borde deben tomarse en cuenta. la cobertura del dosel deberá clasificarse como “abierta” o “cerrada”. fecha. la explicación de posibles datos atípicos). Si la selección se realiza entre dos 304 Manual de biología de suelos tropicales . Este tipo de información deberá registrarse en la libreta de campo.

de la edad de la plantación. nueces y otros. Cuando se considera relevante. para madera o leña). entre 1 y 3 años. 1 año. En el caso de un cultivo de árboles o arbustos se puede añadir información sobre el aspecto (es decir. cosecha de toda la planta (p. por ejemplo. En el caso de cultivos herbáceos. La categoría de cultivo herbáceo representa un nivel adicional en la clasificación jerárquica (nivel de especificación) y. Los atributos técnicos son específicos para cada una de las diferentes formas de vida. proporcionando una mayor especificación de la forma de vida a nivel de detalle. cosecha de frutas. “forrajes o fibras”. ej. o gramíneas] Atributo técnico 1 Atributo técnico 2 Cultivo de árboles o arbusto Tipo de cultivo (especies y Fenología de la hoja [siem. dependiendo. pero en lugar de dejarlo abierto.1.variedades) pre verde. se puede añadir un cuarto nivel que ofrezca información sobre la variedad específica del cultivo.1 los valores posibles (clasificadores o atributos) se enlistan entre corchetes. más de 10 años] 305 D escripción y clasificación de uso de suelo en puntos de muestreo . no se enlista bajo el título “Atributos técnicos 1” en la Tabla 11. entre 3 – 10 años. En la Tabla 11. “leguminosas o vegetales”. El valor de dominio no se especifica aquí. porque su apariencia (características de vegetación) puede ser muy distinta. una especificación con más detalle indica si el cultivo pertenece a la categoría de “raíces o tubérculos”. ancha] Propósito [vivero. Generalmente. hierba. arbusto. por lo tanto. La clasificación se basa en la forma de vida del cultivo.o más cultivos de la misma forma de vida. deciduo] Tipo de hoja [aguda. Se prevé para una descripción de un segundo y tercer cultivo. árboles de sombra] Duración del cultivo [Estación (parte del año). es mejor definir una lista de Tabla 11. el propósito) y duración del cultivo. es conocido el tipo de cultivo. La información más concreta sería entonces el tipo específico de cultivo. el cultivo con el mayor porcentaje de cobertura califica como el cultivo principal.1 Clasificadores y atributos técnicos para el cultivo principal Nivel 1a – Clasificador Forma de vida [árbol.

es mejor definir clases significativas basadas en un estudio piloto del rango de tamaño de campo presentes en el área de estudio (Huising. La cobertura del cultivo se usa generalmente como un parámetro para la interpretación de 306 Manual de biología de suelos tropicales . ésta queda fuera del marco de este capítulo. no obstante. La definición de clases de tamaño de campo “pequeña”.1 Continúa Nivel 1a – Clasificador Atributo técnico 1 Gramíneas Tipo [bambú. Aquí se incluye la “cobertura de los cultivos”. sirve como indicador del grado de organización y mecanización de las prácticas de manejo.lúpulo y otras enredaderas perennes] Herbáceas Categoría de cultivos [raíces y tubérculos. a manera de ejemplo. con el propósito de evitar cualquier confusión. caña. La forma del campo se añade principalmente como una preocupación respecto a posibles efectos de borde y. aunque está más relacionada con las características del cultivo que con las características del campo. puesto que ello dependerá del contexto de estudio. véase la lista LCCS (Di Gregorio y Janssen. con las características de campo. III-cultivos de cobertura. “mediana” o “grande” no aparece. 1993) con la opción de utilizar diferentes definiciones para cada una de las distintas regiones en donde se esté llevando a cabo el estudio. II. cereales.herbáceas.2).plátanos y otras plantas herbáceas arbóreas. fibras] (si se conoce. especificar el tipo de cultivo) Atributo técnico 2 Tipo de cultivo (especies o variedades) Tipo de cultivo Tipo de cultivo nombres permitidos para los tipos de cultivo. pero manteniendo la distinción conceptual entre pequeño. pastos] Si no son gramíneas Categoría del cultivo [I. forrajes. 2000). El siguiente nivel en la clasificación jerárquica se determina por las características espaciales de la parcela en observación (Tabla 11. además. aunque esto se relaciona más con las características del cultivo que. arroz. IV. legumbres y vegetales. mediano y grande. La cobertura del cultivo se anexa aquí.Tabla 11.

pero dependería mucho del tipo de cultivo. se refiere a que se produce un empalme entre las copas. Nivel 1b -Clasificador Atributo técnico 1 Tamaño de campo o parce. el tipo de cobertura “cerrada”. En el caso de formas de vida permanentes. Una cubierta “abierta” significa que la distancia entre los perímetros de las copas puede ser hasta dos veces mayor que el diámetro medio del dosel. multiangular. En el caso de cultivos anuales. la cobertura del cultivo puede resultar difícil de interpretar debido a la variación en la arquitectura de las plantas. su densidad puede medirse directamente en términos del número de plantas por unidad de medida (m² o ha) o en términos de espacio entre plantas (el espacio entre surcos y la distancia entre las plantas). abierta (70-60 – 20-10%). En el caso de un segundo o tercer cultivos. grande] lar. Esto puede servir para entender la importancia relativa del cultivo en sistemas de cultivos múltiples. Por lo tanto. y especialmente en el caso de los cultivos anuales. esto se refiere a que en una misma parcela y durante una sola temporada se realizan uno o varios cultivos.imágenes de percepción remota. baja (30 -15%)] Cobertura permanente: [cerrada (> 70-60%). Se pueden hacer distinciones de acuerdo con el número de cultivos y con su secuencia. los límites de clases son ligeramente diferentes (ver Di Gregorio y Janssen. Tabla 11. Para coberturas no permanentes. escasa (20-10%)] Observaciones relacionadas a combinación de cultivos y prácticas culturales Las combinaciones de cultivos se consideran el segundo nivel. la distribución espacial en el campo puede especificarse. circular. Las clases de densidad podrían especificarse. a las diferencias en las etapas de crecimiento y otros factores. mediana. El segundo y tercer cultivo pueden describirse por los mismos D escripción y clasificación de uso de suelo en puntos de muestreo 307 .Forma [cuadrada. 2000).2 Tamaño del campo y características de la cobertura del cultivo. generalmente. proporciona información acerca de la densidad del cultivo y es un indicador útil de la intensidad del uso de suelo. en tira o irregular] Tamaño del campo (metros cuadrados) Atributo técnico 2 Cobertura del cultivo Cobertura no permanente: [alta (> 60%). mediana (60 – 30%). rectangula [chica. en los casos donde un clasificador de segundo nivel “combinación de cultivos” indica que existe un segundo o tercer cultivo creciendo en el campo. Además.

El segundo (o tercer) cultivo o elemento de la vegetación puede incorporarse en la descripción de clase del sistema de uso de suelo como elemento descriptivo o como atributo. irrigación] Atributo técnico 1 Irrigación Tipo de irrigación [superficial. definidas como características de suministro de agua y características relacionadas con el barbecho. serían suficientes.atributos. franjas alternas. El nivel tres en el sistema de clasificación se refiere a las prácticas culturales. La descripción para las características del suministro de agua es muy sencilla (ver Tabla 11. por ejemplo. Se realizan previsiones al tercer nivel de clasificación. junto con la fenología y tipo de hoja. múltiple (intercalado)] Atributo técnico 1 Cultivos múltiples No. de cultivos adicionales [1. no habría un arreglo especial.3 Atributos de cultivos combiandos. también en estos casos. El segundo tipo de cultivo se añade como un segundo atributo técnico. con un sotobosque herbáceo cerrado. la totalidad de su cobertura (es decir. el porcentaje de cobertura del cultivo adicional o añadido) puede alcanzar fácilmente el 100%. los cultivos de árboles (hule) en un campo grande (plantación). en donde la especificación de la forma de vida. traslapar. 2 o más] Secuencia [simultáneo. aspersión o goteo] Atributo técnico 2 Demanda de agua por irrigación [mm de agua suministrada por temporada de crecimiento o cultivo] 308 Manual de biología de suelos tropicales . igual que para el cultivo principal. postinundaciones. en los varios niveles de especificación. secuencial] Atributo técnico 2 (Segundo tipo de cultivo) Simultáneo o traslapado Arreglo espacial [una o dos filas intercaladas. relacionadas con el “factor de tiempo del cultivo” para especificar esta información. La vegetación del sotobosque también puede referirse a vegetación (semi) natural. Es necesario registrar cuando se practica una rotación de cultivo en particular.4). como por ejemplo. Nivel 2 – Clasificador Combinación de cultivos [simple (monocultivo). plantaciones. Tabla 11. fragmentadas o dispersas] Tabla 11. en cuyo caso.4 Características del suministro de agua Nivel 3a – Clasificador Suministro de agua [lluvia. Un segundo tipo de cultivo puede referirse a un cultivo de sotobosque como el cardamomo.

de acuerdo con el LCCS. u otro tipo) Índice de cultivo (valor del índice de cultivo Ruthenberg) Intermitente No. Se hace una distinción entre cultivos migratorios. 1980).El cultivo post inundación se define.5.. al empleo de técnicas de cosecha de agua (tratado por separado en la sección relacionada con el manejo de suelos y cultivos). mejorado] Duración del barbecho[corto. o largo plazo] Barbecho Tipo de barbecho[suelo desnudo. Los atributos técnicos se especifican en la Tabla 11. Nivel 3b . permanente] Atributo técnico 1 Cultivo migratorio Período de barbecho [corto. El barbecho se refiere al periodo (estación de crecimiento) durante el cual se deja descansar el suelo.5 Factor tiempo de cultivo. largo] Permanente Permanente [continuo o intermitente] Atributo técnico 2 Índice de cultivo (valor del índice de cultivo Ruthenberg) Si es mejorado: Tipo de cobertura (ej. aunque no lo mismo. la lluvia infiltrada en el suelo se usa intencionalmente como reserva para los cultivos”. y debido a que no trae consecuencias en la intensidad del uso de suelo. Leguminosas. natural. mientras que en el sistema de barbecho Tabla 11. El factor de tiempo del cultivo indica la fracción de tiempo durante la cual el suelo es usado para el cultivo. sin embargo. El cultivo migratorio se define como suelo cultivado durante menos del 33% del tiempo (Ruthemberg et al. en términos prácticos. se debe hacer la distinción entre si esto se hace con el objetivo de restaurar la fertilidad del suelo o debido a que las condiciones no permiten cultivar (bajas temperaturas o disponibilidad de agua limitada). Esto es similar. mediano. de la siguiente forma: “después de que un campo ha sido inundado con agua de lluvia. Los cultivos migratorios típicamente se refieren a situaciones donde los agricultores abren nuevas parcelas para el cultivo.Clasificador Factor tiempo de cultivo [cultivo migratorio. el suelo está cultivado por más de 66% del tiempo. barbechos y cultivos permanentes. mediano. de cultivos en dos años D escripción y clasificación de uso de suelo en puntos de muestreo 309 . Los sistemas de barbecho se definen como suelo cultivado entre el 33% y el 66% del tiempo y en los cultivos permanentes. esta distinción no se mantiene. barbecho. en principio.

Barbecho largo. En el caso de cultivos migratorios. pero < 8–10 años. La definición de estos límites de clases se basa en la experiencia en el campo. No se hace ninguna distinción referida al tipo de cultivo o propósito. El periodo largo de barbecho es la situación típica en donde el suelo se deja en barbecho durante un año o más. éstos se pue310 Manual de biología de suelos tropicales . forrajes. el periodo de barbecho típicamente tiende a reducirse. Periodo largo: > 8–9 meses El barbecho de periodo corto se refiere a situaciones donde normalmente existen dos temporadas de cultivo en un año y el suelo se deja descansar durante el resto del periodo. lo cual es muy común en algunos lugares donde uno o dos cultivos “cortos” ocurren durante un año o donde el agricultor deja un periodo de barbecho más largo. resulta relevante anotar la duración de dicho periodo. durante el segundo año. Estas son evaluaciones parcialmente cualitativas y. Para sistemas de barbecho. con un periodo de > 8–10 años. Los barbechos se consideran como “mejorados” en el momento en que se planta o se siembra para cambiar la composición de la vegetación de barbecho o para mejorar su calidad. con un periodo de > 1–2 años. Si se requiere de datos más precisos. con un periodo de < 1–2 años. Barbecho medio. El barbecho medio refleja la situación donde el suelo descansa durante seis a siete meses. por ello. se hace una distinción entre la duración del periodo de barbecho: Barbecho corto. por lo tanto. Bajo la presión de una población en aumento. pero necesita confirmarse y puede ajustarse con base en los datos reales sobre la duración de los periodos de barbecho en el área en cuestión. dejándola descansar durante diferentes periodos de tiempo para restaurar la fertilidad del suelo. la clasificación del periodo de barbecho es la siguiente: Periodo corto: < 4–5 meses. por ejemplo.cultivan la misma parcela o área de suelo. pero eso no resulta lo suficientemente largo para clasificarlo como cultivo migratorio. Periodo medio: 4–5 meses. pero < 8–9 meses. se sobreponen los límites de clases y se especifican para cubrir la variación específica de un periodo de barbecho para cualquier área que probablemente sea dependiente de las condiciones socioeconómicas y biofísicas habituales.

5. el mejor momento para incluir una descripción de las secuencias de los cultivos sería en el segundo nivel de la clasificación jerárquica donde “la combinación de cultivos” puede describirse como “secuencial”. Tf = duración del barbecho o duración del tiempo en el que no se cultiva el suelo. se podría prever. Hasta este momento no se han considerado las rotaciones de cultivo.den calcular utilizando el índice de cultivos de Ruthenberg. puesto que el barbecho a menudo forma parte de un sistema de rotación de un cultivo en particular. De manera alternativa. la cosecha. es un factor que deberá tomarse en cuenta en relación con la biodiversidad del suelo. Si se practica una rotación de cultivos. Características de manejo del suelo y de cultivos Las prácticas culturales mencionadas incluyen: “manejo de agua” como una operación de manejo.. donde potencialmente existe un alto impacto en la biodiversidad del suelo. el principal aspecto que se debe considerar sería si esto se realiza por medios mecánicos o no. Alternativamente. fertilización y cosecha. sin embargo. el “factor tiempo de cultivo”. una opción para combinar ambos clasificadores dentro de uno que describa el grado de mecanización. el manejo de las malas hierbas. 1980): CIr = Tc/(Tc + Tf) En donde: Tc = duración del cultivo (tiempo). por lo tanto. el manejo del suelo y de los cultivos se consideran representativos de un nivel separado en el sistema de clasificación (Tabla 11. Se añade la “preparación del suelo” por su relevancia en los márgenes de la selva en los trópicos. Los datos deberán especificar el número de años del ciclo de rotación de cultivos y la secuencia de los cultivos en el ciclo. como un clasificador podría ser excluida de la clasificación porque la preparación del suelo es generalmente la D escripción y clasificación de uso de suelo en puntos de muestreo 311 .6a). plagas y enfermedades. tal y como se muestra en la siguiente fórmula (Ruthenberg et al. Los mayores componentes de las prácticas de manejo discutidas se refieren a técnicas para la preparación del suelo o su cultivo. En cuanto a la preparación del suelo y la cosecha. tal y como se observa en la Tabla 11. por lo que no han sido incluidas en el sistema de clasificación. Esto es.

Una distinción más detallada de acuerdo con los requerimientos reales de poder o capacidad en términos de caballos de fuerza no se considera relevante. el suelo (y otras condiciones ambientales) afectarán la eficiencia de la operación. La eficiencia se refiere más a lo económico que a lo ambiental. se basa en el tipo de tracción utilizada: animal o mecánica. por ejemplo. porque esto dependerá de las condiciones locales. las opciones son: arado de vertedera. en caso afirmativo. arado de disco. la profundidad del arado. plagas y enfermedades es el uso de agroquímicos. aquí se incluye su compatibilidad con los métodos que incorporan el uso de combustibles fósiles en los cálculos de la intensidad del uso de suelo. Por lo tanto. tipo de equipo y tipo de tracción. estos arados se presentan desde el menos eficiente en remover el suelo y dejará más estructura intacta en el suelo. el uso de combustibles debería añadirse como atributo en el siguiente nivel más alto de especificación. tales como tipo de suelo. refiriendo su capacidad. en el sentido de que una mayor o menor eficiencia no causará mayor o menor impacto en el suelo y los organismos que se encuentran en él. La principal preocupación relacionada con el control de las malezas. tomando en cuenta el impacto directo del peso del animal o la maquinaria y el impacto generado por los diferentes tipos de equipo operados por maquinaria o animales de diferentes capacidades. La “eficiencia” en términos de horas por hectárea requerida para la operación se añade como un atributo opcional. Se presume que animales “pesados” o maquinaria pesada causan un mayor impacto en el suelo. tales como la unidad de sembrado directo (ripper-planter) utilizada en la agricultura de conservación (de Freitas. Se hace una distinción basada en si el suelo ha sido labrado o no. El uso de combustibles puede fácilmente estimarse si se conoce su eficiencia. sería más sencillo 312 Manual de biología de suelos tropicales . 2000). De acuerdo con el orden mencionado. comparado con animales “ligeros” o maquinaria de igual consideración. La labranza mínima se refiere a aquellos sistemas donde el arado y la siembra son típicamente una combinación de una sola operación. o arado de cincel. sin embargo. Se debe mencionar aquí si se practica la labranza mínima. pero al contrario. se podría considerar combinar ambos (mecánica y química) dentro de un clasificador que describa el uso de agroquímicos (excluyendo fertilizantes orgánicos).primera operación para ser mecanizada y tiene un profundo efecto en la biodiversidad del suelo. Se añade un atributo técnico que describe el tipo de arado usado. donde la labranza del suelo se restringe a hacer agujeros para sembrar. ya que no resultará un indicador directo del grado de perturbación del suelo. en lugar de labrar el campo entero o donde el grado de perturbación se minimiza con el uso de equipos especializados. El tipo de animal o el tipo de maquinaria empleada es indicado en el siguiente nivel de detalle. Opcionalmente.

disco. no se incluyen en el valor de dominio. biológico o cultural. reducida o mínima] Eficiencia (horas/ha) Tipo de arado [vertedera. buey. manual (azadón). cincel.[vertedera. el barbecho. estas han sido registradas de las prácticas de uso de suelo en los niveles previos del sistema de clasificación y. caballo. manual. química] Atributo técnico 1 Manual Modo [desmontar y quemar. cuatro rue. Respecto al deshierbe manual se hace una distinción Tabla 11. “No quitar malezas” puede atender a situaciones donde no existe la extracción real de las malezas. desmontar y cubrir con abono verde] Mecánica Grado [limpieza moderada. a Deshierbe a mano Eficiencia (horas/ha) mano. mecánico. por ello. mecánica..disco. por ejemplo. tracción animal. labranza y deshierbe. Tracción animal Tipo (y número) de anima. la rotación de cultivos. mula/burro] Eficiencia (horas/ha) Mecánico Tipo de arado Clase de maquinaria [dos ruedas (ligera). químico] Tipo de deshierbe [con azadón.6a Clasificadores y atributos relacionados con la limpieza de la parcela. labranza mínima/unidad de das (pesada)] sembrado directo (ripperplanter)] Eficiencia (horas/ha) Deshierbe [Sin deshierbe. directo (ripper-planter)] vaca. El clasificador para el control de malezas especifica el modo de mecanismos de control. mecánico. labranza mínima/unidad de sembrado les usados [búfalo.y práctico manejarlas por separado. sea por el método de herbicidas. mecánica] Alcance de la labranza [labranza completa. con la mano] D escripción y clasificación de uso de suelo en puntos de muestreo 313 . intermedia e intensa] Manual Atributo técnico 2 Labranza [Sin labranza. En el caso de medidas de control culturales (y biológicas). etc. cincel. Nivel 4 – Clasificador Limpieza [Sin limpiar.

VI mochila.ippc. junto con la cantidad en gramos del ingrediente activo por hectárea.iastate. o cualquier otro tipo de herbicida. 2005). si se requiere información más detallada acerca del Roundup. cultivo para el control de malezas] Atributo técnico 2 Eficiencia (horas/ha) Tipo de equipo (ej. azadón rotatorio) Eficiencia (horas/ha) Químico Volumen de aplicación Tipo de equipo [aspersor de [VB (< 850 g ia/ha). se debería especificar el ingrediente activo (ia). VA (> 2500 g ia/ha)] Herbicida. dado que el Roundup es. weeds.6a Continúa.edu/pnw/weeds). la distinción se hace acorde con su aplicación: el uso de aspersor de mochila es el más común. el herbicida más usado en los trópicos (www. por lo 314 Manual de biología de suelos tropicales . se basa en el volumen de la aplicación que resulta no viable. Una diferencia más. basadas en recomendaciones generales para su aplicación en diferentes cultivos.edu/mgmt/2004) por la cantidad de aplicaciones especificada en gramos equivalentes de ácido (ea) por hectárea de glifosato. los diferentes tipos de ingredientes activos y las fórmulas que existen (Oregon State University. por mucho. otros mecanismos] (entre 850 y 2500 g ia/ ha). Nivel 4 – Clasificador Atributo técnico 1 Mecánico Tipo de deshierbe [labranza frecuente.Tabla 11. Las especificaciones son asignadas de manera arbitraria. ingrediente activo y tasa de aplicación entre si esto se lleva a la práctica con el uso del azadón o mediante la extracción totalmente manual. los cuales se convierten de libras por acre a gramos por hectárea (weeds. Las especificaciones de manejo de malezas no cubren todas las medidas de control de malezas. se recomienda implementar un sistema de clasificación para la aplicación de volumen de herbicidas que sea relevante para el área en cuestión. Si se considera de vital importancia. se considera un volumen alto (VA). azadón de presión. si se considera el gran número de herbicidas que se encuentran disponibles en el mercado. que es la sustancia activa del Roundup. Una tasa de aplicación de (ea) menos de 850 gha-1 se considera un volumen bajo (VB) de aplicación. orst. Sin embargo. mientras que una aplicación (ea) de más de 2500 gha-1. En cuanto al uso de químicos en el control de malezas.

P2O5 para el fósforo y K2O para el potasio) El índice toma D escripción y clasificación de uso de suelo en puntos de muestreo 315 . se podrían especificar cantidades reales de aplicación. Respecto al uso de pesticidas. Generalmente. Tasas de aplicación bajas de menos de una tonelada por hectárea por año se consideran insuficientes para mantener los niveles de humus y de materia orgánica en el suelo. La frecuencia de la aplicación puede variar y en la tabla que se observa a continuación. En este punto. en caso de considerarse relevante. se prevén especificaciones para la tasa de aplicación. Eso se hace para poder acomodar los diferentes grados de fertilizantes. sin considerar las disoluciones hechas antes de la aplicación. (2002) y son usadas en caso de aspersión aérea. dentro del rango especificado. Dos toneladas por hectárea por año se consideran suficientes para todo tipo de cultivo. se definen clases similares: control natural o medidas culturales. estas cantidades se suministran una vez cada cuatro a seis años (ILACO. Las clases de volúmenes para aplicar pesticidas se obtienen de Craig et al. En cuanto a los fertilizantes orgánicos e inorgánicos. estos se basan en asumir un contenido de materia orgánica del 30%. se deberán tomar en cuenta los valores más altos. se presume que se requieren entre 5 y 10 toneladas por hectárea para poder mantener los niveles de humus en el suelo. fungicidas u otros químicos. Los fertilizantes de bajo grado tienen menos del 25% de nutrientes para las plantas. Los elementos nutritivos pueden referirse a un solo elemento (por ejemplo N) en los fertilizantes simples o la combinación de elementos en mezclas incompletas o mezclas completas (el porcentaje de peso se relaciona al N para el nitrógeno. Cuando se utilicen fertilizantes de bajo grado. las cifras se convierten en tasas de aplicación por año. y las mismas clases de volumen se consideran relevantes. mientras que los fertilizantes de alto grado contienen hasta el 50% de elementos nutritivos. Los volúmenes especificados se refieren a la forma líquida en la cual el pesticida o el fungicida se obtienen. en lugar de usar un valor en particular. Con relación a las medidas de control de plagas y enfermedades. 1985). los rangos de tasas de aplicación se especifican para los límites superiores e inferiores de las clases. Se presume que el modo de aplicación no traerá muchas consecuencias para la tasa de aplicación. control biológico o mecanismos de control químico (Tabla 11. Con respecto a la aplicación de fertilizantes inorgánicos. se hace una distinción basada en si éstos son ampliamente aplicados en todo el campo o si la aplicación se restringe a puntos específicos y también al tipo de equipo utilizado.6b).que la libreta de campo es un buen complemento para la observación relacionada con cualquier medida específica de control de malezas. sin tomar en cuenta su modo de empleo. Para abonos.

“Sin limpieza” (ver Tabla 11. La manera en que se prepara la parcela puede tener un profundo impacto en la biodiversidad del suelo. será relevante en el caso de tasas bajas o muy bajas de aplicación. La aplicación del fertilizante. La limpieza también es importante en sistemas de barbecho. se hace una distinción entre sistemas de “desmontar y quema” y “desmontar y cubrir con abonos verdes”. Las otras clases se derivan de estas cifras. en donde los árboles se cortan a mano o con sierra de cadena y los troncos se remueven utilizando tractores u otra maquinaria más ligera. En todos los sistemas es importante registrar si la quema se lleva a cabo para eliminar la vegetación muerta o si esta vegetación se queda como abono orgánico.75 kg ha-1 de N como punto de referencia para la aplicación de N. Esto sería particularmente relevante donde se practican cultivos migratorios o donde las selvas han sido convertidas recientemente en suelo agrícola. lo que ha ocurrido en algunos márgenes de selvas en donde opera el proyecto CSMBGBD. Sin embargo. Esto sería la aplicación recomendada para un suelo moderadamente fértil que produce alrededor de cuatro toneladas de maíz (grano). estos valores se toman como el límite superior de la clase de “tasa de aplicación de fertilizante medio”. cuando incluyen quemas. cualquier incidencia de fue316 Manual de biología de suelos tropicales . ya sea en o alrededor del hoyo de plantación. “La limpieza moderada” está indicada cuando se utilizan medios manuales y mecánicos. lo cual coincide más o menos con la duración máxima de barbecho bajo sistemas de cultivos migratorios. se podría considerar añadir una clase para las tasas muy altas que serían aplicaciones de 300 kg ha-1 o más. por lo tanto. 6a) se enlista cuando el campo ha sido convertido a partir de bosque o vegetación secundaria desde hace más de 20 años. Si las tasas de aplicación son generalmente altas. o si las tasas de aplicación altas son de particular interés. especialmente. por lo tanto. para alrededor de tres toneladas de trigo en suelos relativamente fértiles y 25 toneladas de mandioca en suelos moderadamente fértiles. La conversión puede incluir operaciones para nivelar el suelo. Otra distinción se hace basada en el tipo de equipo usado. de un fertilizante de alto grado y de 700 kg ha-1 o más de un fertilizante de bajo grado. en donde una tasa muy baja de aplicación representa alrededor de 10 a 15% de esta cantidad de referencia. Una aplicación de 75 kg ha-1 de N requerirá 150 kg ha-1 de un fertilizante con N de alto grado y alrededor de 350 kg ha-1 de un fertilizante de bajo grado. La “limpieza intensa” significa que la tierra se limpia completamente con el uso de tractores oruga y otra maquinaria pesada. se incluye como clasificador separado. Actualmente.

VI (entre 100 y 200L/ha).go como parte de las prácticas de manejo deberá registrarse en esta sección como fenómeno importante. abono verde. control químico y biológico] Atributo técnico 1 Control químico Aspersión [aspersión focalizada. estiércol de corral] Aplicación [hoyos. baja (entre 25–60 y 75–175 kg/ha). alta (>2 t/ha/año)] Fertilizantes [sin fertilizante. fertilizantes y cosecha. media (entre 1–2 t/ha/año). mecánica] Eficiencia (Horas/ha) D escripción y clasificación de uso de suelo en puntos de muestreo 317 . Tabla 11. alta (>150–350 kg/ha) Aplicación [hoyos. aspersor de motor. combinación de fertilizantes químicos y orgánicos] Equipo usado [aspersor de mochila. mezclas incompletas. composta. o de manera homogénea en la parcela] Cosecha [manual. vehículos. aspersión en toda la parcela] Atributo técnico 2 Volumen de aplicación [UVB (<10L/ha). media (entre 75– 175 y 150–350 kg/ha). abonos. VB (entre 10-100L/ha). (VA >200L/ha)] Tipo de químico y tasa de aplicación Tasa de aplicación [baja (<1t/ha/año). franjas. franjas. Nivel 4 – Clasificador Manejo de plagas y enfermedades [medidas preventivas y control natural. fertilizantes químicos. o de manera homogénea en la parcela] Inorgánico Clases de fertilizantes [simple. aviones] Fertilizantes orgánicos Tipo de fertilizantes [residuos de cultivos. mezclas completas] Tasa de aplicación [muy baja (<20 – 60 kg/ha).6b Clasificadores y atributos para el manejo de plagas y enfermedades.

Las observaciones del estatus de los cultivos podrían ser útiles para corroborar los resultados anteriores (o resultados de clasificación).Otras observaciones sobre el manejo de suelo y cultivos Aparte de registrar las características del manejo de suelo y de cultivos como se describió en las tablas anteriores. Estos datos proporcionan información adicional sobre el cultivo principal tal y como se especifica en el primer nivel del sistema de clasificación. De manera general. la mejor manera de categorizarlas es determinar si incluyen medidas agronómicas (como cultivos mixtos. hondonadas y otras.). construcciones y empalizadas. pero no como base de clasificación. wocat. La información de las medidas de conservación no se captura directamente en el registro de los atributos enlistados arriba. Probablemente. al igual que las del estatus del cultivo. lo que aumenta la capacidad de retención y reduce la pérdida de suelo. si se conoce la técnica con un nombre en particular (por ejemplo “Zai”. barreras de setos. cultivos en curvas de nivel. cuando se relacionan con su manejo. el uso de elementos de vegetación (referido a tiras de pastizales. El registro debe contener la descripción de las medidas de conservación del suelo y el agua. De manera alternativa.net). Las técnicas de recolección de agua como cavar zanjas. entre otras. incluyendo las relacionadas con técnicas de recolección de agua. corta vientos y otros) o medidas estructurales que incluyen terrazas. el crecimiento puede clasificarse como: crecimiento retardado. El rendimiento del cultivo como indicador integra muchos factores. La World Overview of Conservation Approaches and Technologies (WOCAT). especialmente. sean incluidas. por lo que es difícil obtener cifras confiables y del todo correctas. en donde se observa que la altura del cultivo es menor. Las evaluaciones del rendimiento basadas en campo deberán incluir lo siguiente: población de plantas por metro cuadrado. Las medidas de conservación de suelo y agua afectarán las poblaciones de organismos del suelo indirectamente por el almacenamiento de agua mejorada. muros de contención. La información sobre el rendimiento de la cosecha es igual de útil. que se practica en el Níger). acolchonado. 2001). se incluyen como medidas estructurales. etc. esta información deberá adjuntarse. bancos. se recomienda que las observaciones de las prácticas de conservación de suelo y agua. número de macollos por planta de cereal. provee una visión general en su página web de muchas técnicas existentes (www. cuando se compara con un cultivo de 318 Manual de biología de suelos tropicales . las características del crecimiento del cultivo pueden utilizarse como una medida representativa del rendimiento. altura y diámetro relativos del cultivo en crecimiento (ver Stocking y Murnaghan.

un importante aspecto de la intensidad del uso del suelo. La fragmentación del uso de suelo que puede ser evaluada a partir de estas observaciones resulta ser. están disD escripción y clasificación de uso de suelo en puntos de muestreo 319 . el factor Ruthenberg se establece. frijol y col. por sí misma. Además. plantas de menor vigor. Las observaciones del estatus del cultivo deberán acompañarse de observaciones acerca de la incidencia de plagas y enfermedades e incluir el porcentaje del cultivo afectado. Este es el caso cuando la cobertura de árboles es escasa (menos de 10 a 20%). Patrones de distribución en el campo y árboles en la finca Las observaciones relacionadas con el tipo de campo y con los elementos de vegetación leñosa dentro de la parcela bajo observación y sus alrededores están incluidas. lo cual puede ocurrir cuando los árboles están dispersos dentro de la parcela. permite una evaluación del uso del suelo en un punto de muestreo particular. enfermedades y sus clasificaciones. y cultivo de crecimiento vigoroso. cercas vivas y otros elementos de vegetación importantes. permite la validación y la verificación de las observaciones en el lugar del muestreo. 2001) por signos de déficit de nutrientes en maíz. dentro de una proporción espacial entre barbecho y el suelo cultivado en el uso de suelo actual. lo que resulta importante para un mapeo del uso de suelo. la primera distinción se hace en función de si éstos son continuos. todos a nivel parcela o paisaje. Existen guías disponibles para registrar deficiencias específicas de nutrientes en cultivos (ver Stocking y Murnaghan. en principio. Queda fuera del marco de este capítulo proporcionar información más detallada sobre plagas.crecimiento vigoroso. se esperaría encontrar barbecho como parte del patrón de uso de suelo. Esto permite la inclusión de elementos de vegetación leñosa en la descripción que no están capturados en el sistema de descripción de uso de suelo. en el caso de cultivos migratorios o sistemas de barbecho. por ejemplo. dentro del contexto del uso de suelo en las áreas de los alrededores (esto ayuda a establecer si el uso de suelo en la parcela en observación es representativo o no). El uso de suelo en el área circundante del punto de muestreo tendrá una notable influencia sobre la biodiversidad del suelo de la parcela en observación. deberá enlistarse su nombre. y la severidad de la infección en términos del grado en el cual la planta es afectada. Respecto a la distribución de los campos (evaluación del patrón de distribución). con un diámetro del cultivo menor y una decoloración generalizada en sus hojas. Si se conoce la plaga o enfermedad específica. y finalmente.

industrial.7 Características de la parcela y distribución del uso de suelo. queda una opción para especificar los porcentajes del área usando varias categorías: tierras cultivadas y áreas manejadas. Los distintos componentes de uso del suelo pueden describirse con mayor detalle. forma y patrón de los campos y finalmente. lo que parece relevante especialmente en el caso de áreas cultivadas terrestres. El patrón del campo se relaciona a la forma del lugar y al arreglo espacial del mismo. Clasificador espacial Distribución espacial de la parcela [continua. La segunda distinción se refiere al tamaño. mediana.tribuidos en forma de racimos o dispersos (ver Tabla 11. son las características del suministro de agua y la permanencia del cultivo. Residencial. vegetación acuática (semi) natural. etc. irregular] Patrón de la parcela [regular. dispersa] Atributo técnico 1 Continuo Distribución del tamaño de la parcela [uniforme. agrupada.) 320 Manual de biología de suelos tropicales . áreas terrestres seminaturales. utilizando las clases mayores de cobertura de suelo del LCCS. irregular] No continuo Parte de las tierras cultivadas [% de cultivo y área de manejo] Parte de la cobertura vegetal [% de área (semi) natual] Parte del área acuática cultivada [% de área acuática cultivada] Parte acuática no cultivada [% de área acuática no cultivada] Área urbanizada [% de superficie artificial] Atributo técnico 2 Uniforme clases de tamaño (mayoría del campo) [pequeña. Tabla 11. grande] Cultivo principal (lista de los cultivos de cuatro parcelas vecinas ) Cultivo principal (lista de cultivos de cuatro parcelas vecinas) Cobertura del suelo (cobertura dominante de áreas no cultivadas) Tipo de cultivo o actividad Tipo de área acuática Tipo de área urbanizada (ej. áreas acuáticas cultivadas o de inundación regular. en donde se especifican los cultivos principales.7). áreas vacías o cuerpos de agua artificiales y cuerpos de agua naturales (hielo y nieve). superficies artificiales.

En el caso de porcentajes bajos de cobertura de árboles y árboles dispersos dentro del campo o alineados en forma de cerca viva. Más información trata de la cobertura o densidad del componente árbol. Es importante derivar las clases de manera sistemática. si es posible)] El último elemento que debe ser registrado es la presencia de elementos permanentes de vegetación leñosa en el paisaje. Se hace referencia a éstos como árboles en una finca (TROF). Las “zonas verdes” se refieren a árboles espaciados en filas dispuestas como empalizadas. La información sobre los árboles pertenecientes a la familia leguminosa es útil en relación con la ocurrencia de las bacterias formadoras de nódulos. es importante registrar la localización del punto de muestreo respecto al lindero del campo. La Tabla 11. El primer atributo describe la distribución espacial de los árboles.7 Continúa.8 especifica los atributos utilizados para describir los TROF. para leña o material de construcción). nueces. para cosechar frutas.Tabla 11. a partir de los claD escripción y clasificación de uso de suelo en puntos de muestreo 321 . DESCRIPCIÓN Y CLASIFICACIÓN DE USO DE SUELO Definición y descripción de clases de uso de suelo No es el propósito de este capítulo describir cómo las clases de uso de suelo se definen. este podría no ser el caso. Se entiende que los tramos de bosque y otra vegetación leñosa fueron ya cubiertos por el método de clasificación para uso de suelo. aunque estos elementos pueden ser característicos del uso y cobertura del suelo y tener mayor influencia sobre la presencia de la biota específica del suelo. presas. Clasificador espacial Atributo técnico 1 Atributo técnico 2 Suelo desnudo [% de áreas desnudas] Cuerpos de agua [% de Tipo de cuerpos de agua [arcuerpos de agua] tificial. para madera. Los atributos técnicos permiten una descripción del tipo de árbol (ya sea por especie u otro nivel taxonómico) y el propósito de tener árboles (por ejemplo. como estanques. Como se ha mencionado. natural (especificar tipo. pantanos. especificado en términos del número de árboles por hectárea o longitud de los elementos lineales de la vegetación leñosa.

distintos grados de cobertura de árboles pueden observarse dentro de la clase “plantación de árboles” (o aun dentro de las plantaciones de teca). una clase de uso de suelo podría ser definida en función de los siguientes valores de atributos: “cultivo de árboles”. “cultivo de temporada” y “cultivo permanente”. pero esto pue322 Manual de biología de suelos tropicales . zonas verdes] Atributo técnico 1 Cercas vivas: especies de árboles Árboles dispersos dentro de la parcela Propósito [principalmente frutas y nueces. son explicados a continuación. el diseño de la clasificación jerárquica y el atributo de los valores de clase. lo que determina el nivel de detalle con que se definen las clases. cuando se toman en cuenta atributos técnicos adicionales. tipo de cultivo). Si únicamente se consideran los primeros tres niveles en la clasificación jerárquica. Nivel 5 Clasificador Tipo de TROF [sin TROF. cercas vivas. Esto se traduce en “plantación de árboles”. Si se contemplan atributos adicionales del cultivo principal (por ejemplo. por ejemplo. utilizando reglas de decisión. de manera que un conjunto de clases definido para un área en particular puede ser fácilmente mapeado en el conjunto de clases utilizados para otra área y viceversa. relacionados con observaciones de campo. principalmente árboles de sombra. otros] Barreras contra el viento u otros arreglos lineales: especies de árboles Empalizadas: tipo o especie dominante Atributo técnico 2 Cobertura (% de linderos que constituyen cercas vivas) Densidad (número de árboles por ha) Longitud total por ha (m/ha) sificadores y atributos presentados aquí. Las clases se definen por la combinación particular de clasificadores y atributos (determinados por el valor de los mismos). No todos los atributos o clasificadores tendrán que tomarse en cuenta.Tabla 11. es posible distinguir entre una plantación de teca y otra de hule. principalmente madera. “cultivo único”. árboles dispersos dentro de la parcela. no necesariamente tienen que implicar una definición de un conjunto adicional de clases en el siguiente nivel de la clasificación jerárquica. Los principios de la definición de usos de clase de suelo. “parcela de tamaño grande”.8 Características de los árboles en la finca (TROF). Por otra parte. barreras contra el viento u otros elementos leñosos.

O. lo que D escripción y clasificación de uso de suelo en puntos de muestreo 323 . el factor “tiempo de cultivo” puede tener prioridad sobre el cultivo principal como la característica dominante. la jerarquía considera el cultivo principal como la puerta de entrada. hay que tomar en cuenta los valores especificados para los diferentes clasificadores y atributos técnicos. esta característica es general en áreas grandes y no en parcelas. combinados a través de operadores Booleanos (es decir. se retiene la información sobre el porcentaje de cobertura como un valor de atributo en particular para cada observación individual (instancia u ocurrencia) del objeto clase (es decir. Una clasificación jerárquica se establece de manera similar. un “campo grande”. y “un cultivo permanente”. Los clasificadores especifican un “cultivo de árboles”.9 contiene una vista global de la estructura de la clasificación principal. Esto se refiere a los niveles de la clasificación jerárquica.10. sin embargo. decidiendo la presencia de un clasificador sobre otro. tal y como se observa en la Tabla 11. como han sido presentados arriba. No obstante. Para una explicación de clasificación y jerarquías agregadas. en donde el factor “tiempo de cultivo” sería el parámetro en la jerarquía agregada y no.8. La Tabla 11. Y. en la jerarquía de clasificación para observaciones en parcela. XO y NO). y por ello podría usarse para realizar ejercicios de mapeo a pequeña escala. Las reglas de decisión generalmente toman la forma de un conjunto de condiciones SI – ENTONCES que aplica los atributos. en áreas donde los cultivos migratorios o permanentes se practican uno al lado del otro. ver Huising (1993). no todos los atributos pueden ser fácilmente organizados en una tabla. Más bien. La Tabla 11.9 proporciona una lista generalizada de los clasificadores y atributos de clases de acuerdo con el nivel la clasificación jerárquica.1 a la 11. “sin irrigación”. Por ejemplo: SI (<forma de vida> igual a ‘árbol’ y <tamaño de parcela> igual a ‘grande’ y <combinación de cultivos> igual a ‘único’ y <factor tiempo de cultivo> igual a ‘permanente’) ENTONCES <clase> = ‘plantación de árboles’. plantación de árboles). Las clases se asignan de acuerdo con las reglas de decisión y al mismo tiempo las clases se definen. Para información precisa habrá que referirse a las Tablas 11.de no ser relevante para definir clases separadas de plantaciones de árboles. Debido a la estructura anidada. Para ilustrar la definición y descripción de la clase. y no a los niveles de generalización (el segundo eje en el sistema de clasificación). Debido a que el sistema que se presenta trata de áreas cultivadas y manejadas.

De manera alternativa. el tercer nivel. podría basarse en la clase de atributo nivel 1 “densidad de árboles” o en el atributo nivel 2 “combinación de cultivo de árboles”.000 m² por tamaño de la parcela). se pueden distinguir plantaciones de árboles destinadas a la producción de madera para tablas o para otros fines y si se utiliza la información sobre el propósito. frecuentemente no son relevantes para cultivos de plantación. con 100 árboles por hectárea y que recibe 1. se podría definir una subclase añadiendo la descripción “intercalada con un cultivo de leguminosas” para distinguirla del maíz como único cultivo. se pueden distinguir plantaciones de frutales. porque la preparación del campo. Si se utiliza la información sobre la especie de árbol. Posteriormente.significa una plantación grande de árboles. por ejemplo. lo cual únicamente tendrá sentido si existe una gran variación de dichas características dentro del área y si éstas reflejan diferentes regímenes de manejo. Tomando en cuenta la información del cultivo principal (clasificadores del nivel 1) se describirá la parcela como grande (con 10. 2002) o en lugares donde se cultivan únicamente árboles de hule. por ejemplo. una plantación de más de 10 años de teca (que forma un dosel cerrado). el segundo nivel indica que entre el maíz se encuentran otros cultivos y. si la información es correcta y se considera importante en el contexto de la clasifica324 Manual de biología de suelos tropicales . si la plantación de árboles bajo estudio es un pequeño bosque aislado dentro de un ambiente dominado por cultivos anuales. que la parcela es cultivada de manera permanente con un pequeño periodo de barbecho cada dos años.200 mm de lluvia por año. de cacao y otras. se clasificará como “extensivo”. En cuanto a los clasificadores del nivel 5. el manejo de plagas. La Tabla 11. El manejo de estas plantaciones. a un sistema agroforestal en donde los árboles de hule (Hervea brasiliensis) crecen dentro de la selva (Joshi et al. Algunos de los clasificadores de suelo y atributos de suelo y cultivos. El primer nivel especifica que se trata de una pequeña parcela cuyo cultivo principal es el maíz. La principal categoría de uso de suelo a la que esta parcela en particular pertenecerá puede definirse como “cultivos permanentes a pequeña escala con maíz como cultivo principal”. con relación a la variedad de plantaciones. permitirá una distinción entre hule de “jungla”. Esto. es importante informar sobre el uso del suelo circundante. Las diferencias entre la intensidad de uso de suelo. enfermedades y la fertilización del suelo no tienen lugar. por lo tanto. o si forma parte de un paisaje dominado por plantaciones de cultivos de árboles. Se pueden tomar en cuenta medidas para el control de malezas mediante corte o también el uso de químicos..11 muestra los datos para una parcela imaginaria de maíz.

9 Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo. Nivel 2 cultivo combinado Cultivos simples o múltiples Suministro de agua Factor tiempo de cultivo Nivel 3 prácticas culturales Cobertura del cultivo Nivel 1 características del cultivo y el campo Clasificador Forma de vida del cultivo principal Tamaño del campo Segundo Densidad o espacio entre tipo de cultivo plantas Tercer tipo de cultivo Cantidad de agua suministrada Número de Clase de cobertura del cultivos cultivo Tiempo de secuencia Arreglo espacial Tipo de irrigación Duración del período de barbecho Índice Ruthenberg Clase de tamaño del campo D escripción Modo de preparación del campo Tipo de tracción Frecuencia Tipo de operación Alcance de la operación Frecuencia Modo de deshierbe Manejo de plagas y enfermedades Prácticas de fertilización Tipo de fertilizante Volumen aplicado Atributos Nivel de especie 1 Tipo de cultivo (categoría) Forma del campo Tipo de barbecho Tipo especifico de barbecho Atributos Nivel de especie 2 Cultivo especifico (categoría o especies) Atributos Nivel de especie 3 Cultivo variedad (especie o variedad.Tabla 11.) Nivel 4 manejo Modo de cosecha y clasificación de uso de suelo en puntos de muestreo Clasificador Medios de limpieza Atributos Nivel de especie 1 Grado de limpieza Modo de limpieza 325 .

9 Continúa. Modo de equipamiento Aplicación Nivel 3 prácticas culturales Tipo de arado Alcance de la operación Eficiencia Clasificación de la aplicación Tipo de fertilizante Tipo de químicos Tipo de herbicida Volumen Volumen aplicado Volumen aplicado aplicado Patrones de distribución del campo Cobertura de árboles (copa) Densidad de árboles o longitud de barreras Patrones de distribución del tamaño del campo Partes del área terrestre cultivadas y manejadas Partes terrestres no cultivadas Arreglo espacial del campo Forma de vida del cultivo principal Otros tipos de uso o cobertura Clasificación de la aplicación Clasificafión de la aplicación Tipo de equipo 326 Eficiencia Nivel 1 características del cultivo y el campo Atributos Nivel de especie 2 Manual de biología de suelos tropicales Atributos Nivel de especie.Tabla 11. 3 Atributos Nivel de especie 4 Nivel 5 Configuración espacial del campo y árboles en la finca Clasificador Configuración espacial de los árboles en la finca Atributos nivel 1 Propósito de los árboles en la finca Atributos nivel 2 Tipo de especies de árboles dominantes . Nivel 2 cultivo combinado Tipo de equipo Ubicación.

9 Continúa.Tabla 11. Tamaño o clases de tamaño del campo Tipo de cultivo principal % cobertura Nivel 5 Configuración espacial del campo y árboles en la finca Atributos nivel 3 Especies de árboles D escripción y clasificación de uso de suelo en puntos de muestreo 327 .

10 Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca. de hoja ancha leñoso >10 años Manual de biología de suelos tropicales Atributo téc.000 m2 100 árboles/ ha n/a n/a 1.200 mm** n/a n/a Nivel 1 Características del cultivo y el campo Clasificador Árboles Atributos técnicos Nivel 1 Perenes.Tectona grandis nico nivel 3 * En este caso. se puede describir las plantas debajo de los árboles y estas plantas pertenecerán a la categoría de vegetación (semi) natural. ** En el caso de sistemas de temporada de ser posible debe especificarse la cantidad de lluvia. Nivel 2 Combinación de cultivos Único 328 Nivel 3 Prácticas culturales De temporada n/a n/a n/a n/a Permanente n/a Grande Regular Cerrado Vegetación natural* 10. si es relevante. para lo cual se utilizan otros parametros.Teca nico nivel 2 Atributo téc.Tabla 11. aunque esto por lo general se describe en las características del sitio. . aunque no se discuten en este capítulo.

000 m2 Mediano a grande 75 x 25 cm Frijoles NA 0.infraestructura 329 n/a . Nivel 2 Combinación de cultivos Múltiple 2. maíz 10% n/a n/a n/a n/a Ninguno Fertilizante químico Directamente hoyos Manual VMB (muy bajo) 50 kg CAN/ha n/a Atributos nivel de especie 2 Maíz Mucuna (abono verde) Atributos nivel de especie 3 Nivel de manejo 4 n/a Tracción animal n/a 2 bueyes n/a Arado de vertedera n/a Nivel 5 Configuración espacial del campo y árboles en la finca No TROF y clasificación de uso de suelo en puntos de muestreo n/a n/a Caminos .16 1 cultivo adicional Simultaneo 2 filas alternadas NA Intermitente De temporada Permanente Mejorado Nivel 1 Características del cultivo y el campo Nivel 3 Prácticas culturales Clasificador Gramíneas Pequeño Atributos nivel de especie 1 Cereales Cuadrada D escripción Mecánica y química Labranza frecuente (2x) y fumigación una vez (1x) Aspersor de mochila VB (Roundup) Continuo n/a n/a Pequeño Uniforme 90% Regular Hierbas y gramíneas Chícharos.11 Ejemplo de clasificadores y valores de atributos para parcelas de maíz.Tabla 11. habas.

Esta sección pretende demostrar cómo un conjunto de clases podrá definirse y organizarse en una estructura jerárquica y que el sistema es bastante flexible en cuanto a la selección de clasificadores y atributos considerados para su clasificación. más intenso será su uso). principalmente. El grado de interferencia con (perturbación o alteración) el ecosistema natural sería una buena medida de la intensidad del uso de suelo. Manejo y nivel de insumos: la información en el manejo del cultivo y el suelo habla de que el nivel de perturbación del suelo se considera intermedio (habiendo sido arado dos veces con el uso de tracción animal) y que el insumo de químicos ha sido bajo. sin que esto quede reflejado en la definición de las clases. en “un manejo caracterizado por el uso de tracción animal y bajo insumos agroquímicos”. La norma general es que los sistemas culturales y manejados son más intensivos que los naturales (cuanto más insumos de manejo se requieran para mantener los sistemas. que las parcelas son generalmente pequeñas. el manejo tiene por objetivo modificar o establecer condiciones que propicien la producción de un cultivo. (1997) definieron un índice de intensidad de uso de suelo que considera la frecuencia de la ocupación de suelo (según lo expresado en el índice Ruthenberg). uso de nutrientes. Un esquema de clasificación estándar no funcionará porque la definición de un conjunto de clases depende del contexto y del propósito específico de la clasificación. Giller et al. Los clasificadores de nivel 5 y los atributos describen que el suelo es cultivado de manera continua.ción. con cultivos anuales. Ordenamiento de las clases de uso de suelo respecto a la intensidad de su uso En sistemas agrícolas. insumos de ener330 Manual de biología de suelos tropicales . el criterio para mejorar el barbecho podría considerarse en la definición de las subclases. que indica patrones de uso de suelo fragmentados y un uso intensivo del suelo. manejo de plagas. pero una definición de un índice o medida de la intensidad de uso de suelo no es fácil. Parece que existe un consenso sobre los factores que determinan la intensidad del uso de suelo. con un bajo volumen de herbicidas. Esto podría traducirse. La información específica se refiere a la densidad de la planta. con escasa o sin presencia de árboles. al arreglo específico de la combinación del cultivo y a qué especie es utilizada para mejorar el barbecho. dependiendo de las reglas de clasificación.. sin el uso de fungicidas o pesticidas y únicamente con muy baja cantidad de fertilizantes.

El primer gradiente representa la presencia (proporción en el espacio o tiempo) de vegetación seminatural. que en el entorno de márgenes de selva se traduce en elementos de vegetación leñosa. Existen dos principales ejes a lo largo de los cuales se mide la intensidad del uso: el primero.gía y manejo de agua. Lo anterior permite un arreglo de los componentes de la vegetación (objetos) a lo largo de dos gradientes. puesto que es difícil asignar un peso adecuado a las variables explicativas. se requieren categorías de clases de uso de suelo en términos de la intensidad de uso de suelo (o alternativamente una definición de clases de uso de suelo que reflejen diferentes niveles de la intensidad de uso de suelo). Esto se hace considerando aquellos atributos (y clasificadores) que expresen un aspecto en particular de la intensidad de uso de suelo. Han existido varios intentos por definir una medida de intensidad de uso de suelo. En ambos casos. se traduce directamente en la frecuencia del cultivo. en el caso de cultivos migratorios. indicando que el sistema con una proporción mayor de vegetación permanente (ya sea como elementos de vegetación natural o cultivada) representa una intensidad menor de uso o un grado menor de perturbación. La presencia de vegetación permanente en el sistema de cultivo limitará las posibilidades para cultivar el suelo o la proporción del suelo que puede ser cultivado. Es decir. puesto que cada índice es una expresión particular de la intensidad del uso de suelo. la proporción del tiempo durante el cual la vegetación del suelo se restablece de manera semipermanente. También. de la misma manera como lo ilustran Kuechler y Zoonneveld (1988). el componente de la cobertura de la vegetación (semi) permanente es un indicador útil. con la relevancia de que un índice en particular dependiente del contexto o propósito para el cual se está desarrollando. a la intensidad (o amplitud) de las operaciones. El segundo gradiente D escripción y clasificación de uso de suelo en puntos de muestreo 331 . la presencia de vegetación permanente disminuirá la influencia de la variación climática en el ecosistema del suelo. se refiere a la permanencia (o frecuencia) de operaciones y el segundo. Además. aunque no directamente relacionado con la influencia de la operación del manejo. los esfuerzos para crear un índice universal o una medida de la intensidad de uso de suelo serán inútiles. pero éstos no han sido del todo exitosos. Para los propósitos de investigar tendencias en la pérdida de la diversidad del suelo en relación con un incremento en la intensidad de su uso. reflejando el grado en el que estos factores tienen un efecto en los ecosistemas (el grado en el que se altera o perturba el ecosistema natural) y debido a que algunas veces los datos requeridos para una evaluación cuantitativa de la intensidad del uso de suelo no son accesibles. como factores relevantes.

sólo de árboles plantados (plantación) o sólo de cultivos anuales o pastizales. este eje también expresa una partición en el espacio entre los elementos de vegetación natural y cultivada. lo que resulta relevante en el caso de sistemas particulares de uso de suelo. Además de servir como una partición en el tiempo. El continuo puede representarse gráficamente con un triángulo en donde los tres ángulos representan los valores extremos de la cobertura del suelo que solo pueden estar constituidos por árboles naturales (es decir. los objetos de uso de suelo son ordenados a lo largo del segundo gradiente de intensidad de uso de suelo. como se ha especificado en el atributo técnico 1. Los objetos se refieren a árboles que existen en la naturaleza (en el caso de vegetación natural). de acuerdo con el componente Figura 11. como en el sistema de “hule de la selva” mencionado arriba. dentro del sistema de cultivo. en el siguiente nivel de especificación. y presencia o ausencia del componente arbóreo. dentro de cada una de las clases definidas. la permanencia se expresa con el factor “tiempo de cultivo” y el sistema de clasificación permite un arreglo de clases de uso de suelo.“sistemas de barbecho”-“cultivos permanentes” (véase Tabla 11. a árboles plantados o cultivados (árboles cultivados) o elementos de vegetación no leñosos (por ejemplo. se determina basándose en los clasificadores y atributos del sistema de clasificación. La localización a lo largo de los dos ejes.representa la cobertura de vegetación leñosa. para el sistema de cultivo permanente. selva). pero sobre todo.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. cultivos anuales y pastizales) en el caso de elementos de vegetación cultivados.5). Se puede hacer una subdivisión adicional basándose en la duración del periodo de barbecho. En segundo lugar. En primer lugar.“cultivos migratorios”. Cultivos anuales-campo Componente de le vegetación leñosa y semileñosa (natural) Componente de la vegetación leñosa cultivada Componente de la vegetación leñosa no cultivada Componente árbol Selva Tiempo de cultivo-permanencia Plantación 332 Manual de biología de suelos tropicales . de acuerdo con el incremento en la intensidad: “sin cultivar”.

“plátano y otras plantas herbáceas similares”.3). En el tercer paso. Los clasificadores y atributos del nivel 4 (especialmente relacionados con las operaciones de cultivo.1) junto con las características de la cobertura del cultivo (es decir. manual. Si únicamente se toma en cuenta la forma de vida del cultivo principal.5). como un nivel más de intensidad. A un nivel más general.2.1). el rango se lleva a cabo basado en las características de manejo (el cuarto nivel en el sistema de clasificación). En el caso de cultivos de árboles (sistema basado en árboles) se puede considerar el número de estratos de la vegetación y el porcentaje de cobertura del suelo para una categoría posterior. tiene que considerarse la información relacionada con los árboles en la finca (Tabla 11. “cereales” y “arroz” (ver Tabla 11. Tabla 11.árbol o arbusto en el sistema de cultivo (referido a las proporciones en el espacio o en el tiempo). la clase “bambú” aparece antes que las clases de “pastos”. Las clases se ordenan de acuerdo con este gradiente utilizando las características del cultivo principal (Tabla 11. las cuatro clases de intensidad se definen de acuerdo con el grado de mecanización (es decir. dentro de las clases resultado de los dos pasos explicados arriba. También se podrían considerar operaciones de deshierbe con “deshierbe mecánico”. D escripción y clasificación de uso de suelo en puntos de muestreo 333 . los cultivos de árboles se consideran menos intensivos cuando se comparan con cultivos de arbustos. Respecto al tipo de cultivo de gramíneas. como se ve reflejado en la información sobre la categoría del cultivo (ver atributo técnico 1. el orden de intensidad de uso sería el siguiente: “cultivo herbáceo”. Una vez más. Una diferenciación adicional para cultivos que no son árboles se basa en la permanencia o duración del cultivo. de gramíneas y con formas de vida herbáceas. deshierbe y de manejo de plagas y enfermedades) son utilizados para definir las clases de intensidad. “lúpulo y otras enredaderas perenes herbáceas” y “cultivo de cobertura”. porcentaje de la cobertura del cultivo. Si la cobertura de los árboles es escasa. Por ejemplo. tracción animal o medios mecánicos). las plantaciones de árboles se consideran menos intensivas que cuando se trata de arbustos pequeños como el del café o té.1). Existen dos aspectos que deben ser considerados en relación al manejo: uno se relaciona con el grado de perturbación física debida a las operaciones de manejo y el otro se relaciona con el grado de interferencia química con el sistema (uso de agroquímicos). Una asignación de la intensidad de clases se basa en el valor del clasificador en las operaciones de cultivo (es decir. se deberá considerar la intensidad de las operaciones. sin cultivo. Tabla 11. operación de cultivo) y con el grado de uso de agroquímicos (para el control de malezas y manejo de plagas y enfermedades) tal y como se indica en la Figura 11. Respecto a los cultivos sin gramíneas.2) y combinaciones de cultivo (Tabla 11.

ALTO NIVEL DE INSUMOS QUIMICOS Grado de disturbio físico INTENSIDAD BAJA: BAJO GRADO DE MECANIZACIÓN. en el primer paso de la clasificación. por último.3. son considerados de manera conjunta. INTENSIDAD MEDIA: BAJO GRADO DE MECANIZACIÓN. el arado de cincel y. que representa el nivel más bajo de perturbación. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. Como se ilustra en la figura 11. Al final.2. El procedimiento jerárquico descrito arriba producirá ramificaciones claramente separadas en la clasificación del árbol. pero una diferencia más. una evaluación por pares de clases de uso de suelo individuales en la región de superposición dará la clasificación final en términos de la intensidad de uso de suelo.3. la clase de uso de suelo más intensiva pertenece a “cultivos migra334 Manual de biología de suelos tropicales . ver Tabla 11. BAJO NIVEL DE INSUMOS QUIMICOS Otra diferencia podría establecerse en función del tipo de animales o maquinaria usada (de acuerdo con los caballos de fuerza) y el tipo de arado empleado. estas clases tienen que relacionarse entre sí. considerando una plantación de árboles (cultivo permanente bajo manejo extensivo) representará un sistema menos intensivo que un cultivo manejado intensivamente bajo un sistema de barbecho corto. los clasificadores para el control de malezas y manejo de plagas y enfermedades. BAJO NIVEL DE INSUMOS QUIMICOS INTENSIDAD MEDIA: ALTO GRADO DE MECANIZACIÓN. A nivel más general. Esto se puede observar en la figura 11. únicamente se considera el “uso” o el “no uso” de agroquímicos. tipo de equipo o maquinaria usada en el caso de plagas y enfermedades y el volumen de aplicación. el arado escarificado. ALTO NIVEL DE INSUMOS QUIMICOS Uso de agroquimicos INTENSIDAD ALTA: ALTO GRADO DE MECANIZACIÓN. En cuanto al orden de categoría respecto del uso de agroquímicos. y no reconoce que puede haber una superposición considerable en términos de intensidad de uso de suelo entre las clases. seguido por el arado de disco. La superposición será considerable entre las clases de sistemas de barbecho y sistemas de cultivos permanentes. El arado de vertedera tiene un efecto más profundo en el suelo (remoción completa).Figura 11. podría basarse en el volumen de aplicación (aplicación selectiva o localizada. Para poder llegar a una clasificación final de clases de uso de suelo en términos de intensidad de uso.6b).

Donde: Fn: selva natural Fl: selva explorada Slce: cultivo extensivo. bajo cultivo migratorio (periodo de barbecho > 8-10 años) Smce: cultivo extensivo. cultivo permanente Pgi: pastizales intensivos. en esta fase. Para establecer una comparación de clases de uso de suelo individual. bajo cultivo migratorio (1-2 años < barbecho < 8-10 años) Ssce: cultivo extensivo. sin distinguir. cultivo migratorio (barbecho < 1–2 años) Flce: cultivo extensivo. sistema de barbecho (barbecho 4-5 meses) Pte: cultivo de árboles extensivo. que corresponde al 66% del tiempo que la tierra no es cultivada. considerando que la cobertura de árboles en plantaciones puede ser entre el 60% al 70% de la intensidad de uso.Figura 11. lo que se toma como el límite superior para la clase “cultivos migratorios”. en primera instancia. se aplican los mismos criterios que en el segundo y tercer pasos de la clasificación.3 Clasificación del uso del suelo en términos de la intensidad de uso. Esto quiere decir. cultivo permanente Pti: cultivo de árboles intensivo. en las regiones superpuestas entre la categoría mayor de uso de suelo. cultivo permanente Pge: pastizales extensivos. sistema de barbecho (barbecho > 8-9 meses) Fmcm: cultivo de intensidad media. cultivo permanente Pchi: cultivo intensivo. cultivo permanente Pcmi: cultivo de intensidad media. este pasto se considera el tipo de vegeD escripción y clasificación de uso de suelo en puntos de muestreo 335 . cultivo permanente torios” y es seguida por el de menos intensidad de uso “cultivo permanente”. sistema de barbecho (4-5 meses < barbecho < 8-9 meses) Fsci: cultivo intensivo. si proviene de orígenes culturales o (semi) naturales (por ejemplo. si el suelo está en barbecho el 60% del tiempo y la vegetación de ese suelo es pasto. que se considera la forma de vida de la vegetación dominante o cultivo. donde se determina el orden a lo largo del gradiente de intensidad de uso de suelo descrito anteriormente.

De Freitas. New York. REFERENCIAS Bignell. V. Vosti. Rome. (2000) Land Cover Classification System (LCCS): Classification Concepts and User Manual. y Swift. 336 Manual de biología de suelos tropicales . Pashanasi. FAO. de acuerdo con los sistemas de uso de suelo en el trópico húmedo a diferencia del proyecto ASB (Bignell et al. Sanchez and P.. Palm. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. Agradecimientos Al profesor Ken Giller por sus comentarios y al Dr. En el segundo ejemplo se considera la intensidad de manejo (en relación con el cultivo más demandante del sistema.. y Jansen. B. más que al barbecho en sí) para permitir a la clase bajo consideración subir una o dos posiciones en el orden de clasificación.. F.. 2005).. Management and Conservation Service. D. y Dorr. Techniques and Equipment. J. G. J. Rome. I. S. (2002) ‘Aerial application’. GCP/RA/287/ITA Africover – East Africa Project and Soil Resources. S. N. con la introducción de una noción de que la extracción de productos de la selva sirve como un indicador para la intensidad de uso.. Peter Okoth por las discusiones en la preparación de este capítulo. A. L. De esta manera. es decir.New York. Igualmente. A. in C. se hace una distinción entre selva natural. Tondoh.tación dominante).. J. Pimentel (ed) Encyclopaedia of Pest Management. A. Dibog. Woods. si se compara con un área de cultivo permanente bajo manejo intermedio o bajo (Pcmi). J. F.. Columbia University Press. H. M. P. Di Gregorio. si se compara con un cultivo anual con un sistema de barbecho corto (Fsc).. D. M. “sistemas de barbecho” refiriéndose al componente de cultivo. Nwaga. Susilo. FAO Soils Bulletin 77. Moreira. Craig. in D. un cultivo con un manejo intensivo bajo un sistema de barbecho corto (Fsci) puede subir una posición. L. (2005) ‘Belowground diversity assessment: Developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. Strategies and Methods of Introduction.-X. P. FAO. Respecto a la selva. selva manejada y selva explotada. A. (2002) Soil Management and Conservation for Small Farms. los pastizales permanentes. P. Huang. aun en el caso de que sean manejados intensivamente (Pgi) tendrán una clasificación más baja en términos de intensidad de uso de suelo. E. Marcel Dekker Inc.

.. World Overview of Conservation Approaches and Techniques. M. G. object dynamics and consistency rules’...edu/mgmt/2004/ world. D.. y Collinsons. Ph. E.. Lavelle. Wibawa. Barrios. A.. A. W. (2002) Jungle Rubber: A Traditional Agroforestry System Under Pressure.V. Huising. R. P.weeds. vol. M. M. L. P. 6. (1991) ‘Formal data structures. ILACO (1985) Compendium for Agricultural Development in the Tropics and Sub-Tropics. Indonesia. W.. Usher. www. Cambridge University Press. London. London. Boutin. Karanja. Joshi. Applied Soil Ecology. Heipke (eds) Digital Photogrammetric Systems.edu/pnw/weeds. Bardgett and D. Swift.shtml. P. S. A pattern recognition approach to land use inventory at the sub-regional scale using remote sensing and GIS applying an object oriented and data-driven approach’. Akiefnawati. The Netherlands.. Oregon State University (2005) Pacific Northwest Weed Management Handbook. Wichman Verlag. 3rd edition.. N. (1987) Remote Sensing and Image Interpretation.D. y Kiefer. M. I. Kluwer Academic. Springer Verlag. K. K.. Clarendon Press. vol. Lillesand. Manurung. Stocking. Iowa State University (2004) ‘Weed Science’. (1997) ‘Agricultural intensification. M.. J. Baere. The Netherlands. ippc. www. Barois. W. G. Moreira. I. J. R. Molenaar. 10. (1975) Land Use in Advancing Agriculture. Lavelle. Elsevier Science Publishers B. Hopkins (eds) Biological Diversity and Function in Soils. (eds) (1988) Vegetation Mapping. Amsterdam. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. Bignell. www. Dordrecht. Molenaar. The Netherlands. M. MacArthur. G. van Noordwijk. E. Wageningen Agricultural University. ICRAF-Southeast Asia Regional Research Programme.-M. R. Earthscan Publications Ltd. y Zonneveld. in H. Fritsch and C.. 3–16. D. Handbook of Vegetation Science.iastate. Ruthenberg. Karlsruhe. D. H.org/swcmeas. M. J. P.. D. M. and Murnaghan. Taylor & Francis Ltd. (2001) Handbook for the Field Assessment of Land Degradation. soil biodiversity and ecosystem function’.. van Noordwijk. Vink. S. New York. M.Giller.. M. N.. Izac. Bogor. J. (1998) An introduction to the Theory of Spatial Object Modelling for GIS. Berlin WOCAT.wocat. A.asp. (2005) ‘Soil biodiversity in rapidly changing tropical landscapes: Scaling down and scaling up’. Ebner. John Wiley & Sons. in M. y Huising. B.. E. Zandstra. N. y Williams. H. (1980) Farming Systems in the Tropics. Giller..orst. y Swift. A. F. Thesis. T. E. pp. D escripción y clasificación de uso de suelo en puntos de muestreo 337 .. D. Cambridge. E. J. Kuechler. Vincent.. Oxford. H.

.

GKVK Campus. Cx Postal 478. D. Bagyaraj. J. Gigiri.br. E. Abreu. CEP 70. H-1088 Budapest. Instituto de Ciencias Biológicas. constant@unb. Bignell. Departamento de Zoología. Universidade Federal de Minas Gerais. Instituto Nacional de Pesquisas da Amazõnia (National Institute for Amazonian Research-INPA). AM. India. Brasilia. Cares. J. Universidade de Brasilia. CEP 70910-900 Brasilia. csuzdi-alef@nhmus. Universidade de Brasilia (UNB). D. (finado). 13. University of Agricultural Sciences. cares@unb.org. CEP 70.hu. 339 . Systematic Zoology Research Group of Hungarian Academy of Sciences and Hungarian Natural History Museum. World Agroforestry Centre (ICRAF).904-979.com. Belo Horizonte MG. R.coe@ criar. Departament of Agricultural Microbiology. Kenya. Bangalore. Csuzdi. Coe.gov. Campus Universitario Darcy Ribeiro.br. Brasilia. C. Departamento de Fitopatología. Coordenação de pesquisas em Entomologia.bignell@qmul. PO Box 30677-00100.uk. Cx Postal 4457. R. P. r. Nairobi. S.904-970.ac. 88999 Kota Kinabalu. Brazil. E. Institute for Tropical Biology and Conservation. Departamento de Fitopatología. Instituto de Ciências Biológicas. E. Sabah. Cx Postal 4457. Brazil. DF.Colaboradores L. Hungary. Universidade de Brasilia (UNB). Constantino. DF. United Nation Avenue.com. Brazil. Franklin. dbagyaraj@vsnl. Manaus. beth@inpa. Malaysia. DF. Barross str. Brazil. Instituto de Química. Huang.br. d. CEP 69011-970. Universiti Malaysia Sabah. M. Brazil. lmabreu@gmail.

Louzada. Bandar Lampung 35145. Gigiri. Jalan Sumantri Brojonegoro nº 1. Jr. Universidade Federal de Lavras. jlouzada@gmail. X. CEP 69070-000 Manaus. Universitas Lampung. Cx Postal 3037. Pfenning. Brazil. Indonesia. Côte d’Ivoire. Huising. UFR des Sciences et de la Nature. tondohj@ yahoo. Instituto Nacional de Pesquisas da Amazônia (Nationale Institute for Amazonian Research-INPA). J.. Moreira. Bandar Lampung 35145. 46.com. Departamento de Ciência do Solo (Soil Science Department). Indonesia. Cibinong. Abidjan 02. SC. Cx Postal 1507. W. A.id. alcmoino@ufla. Faculdade de Ciências Agrárias. J.org. CEP 37200-000 Lavras MG. M. Indonesia. Raya Jakarta-Bogor Km. fmoreira@ufla. Departamento de Entomología. 16001 Indonesia. CEP. Departamento de Ciências Naturais. Universidade Federal de Lavras. PO Box 161. c/o ICRAF. University of Lampung. Universidade Federal de Lavras. N. Universidade Federal doAmazonas. M. Coordenação de Pesquisas en Entomnologia. Cx Postal 3037. Jalan Suantri Brojonegoro nº1. Université d’Abobo-Adjamé. CEP 89010-971. C.br. Université d’Abobo-Adjamé. Universidade Federal de Lavras. Tropical Soil Biology and Fertility Institute of CIAT. Cx Postal 3037.van-noordwijk@cgiar.br. H. Lavras . PO Box 30677-00100 Nairobi.huising@cgiar. 340 Manual de biología de suelos tropicales .rahmadi@lipi. Kenya. AM. C. N. Cx Postal 3037. J. Bogor. Brazil. Konaté.edu. Lavras. nmarques@ufam.E. L. AM Brazil. E. MG.br. Faculty of Agriculture. Brazil. Cx Postal 478. F. Skonate2@yahoo. World Agroforestry Centre SE Asia.br. United Nations Avenue. Stürmer. Gigiri. 69011-970. RC Biology. F. CEP 37200-000.com. fxsusilo@tlkom. Tondoh. Zoology Division. Blumenau.com.net. B. PO Box 30677-00100. S. J. S. sturmer@furb. 801. CEP 37200-000.P.com. Swift. 02 BP 801. Faculty of Agriculture.gov. Departamento de Fitopatologia. Rahmadi. Abidjan. Côte d’Ivoire. Lavras. Brazil. M. Brazil. j. Brazil. LIPI JI. cahyo. Kenya. J. van Noordwijk. MG. asgknila@yahoo. United Nations Avenue. L. Universidade Regional de Blumenau.fr. Nairobi. morais@inpa.br. M. ludwig@ufla. Moino. Karyanto. Centre de Recherche en Ecologie.go. Department of Plant Protection. A. Tropical Soil Biology and Fertillity (FSBF) Institute of CIAT.com. Morais. Susilo. Silva. S. swiftmj2003@ yahoo. Manaus. CEP 37200-000. Departamento de Biología (Biology Department).br. m. c/o ICRAF.

R. Cx Postal 37. zanetti@ufla. C olaboradores 341 . Departamento de Entomologia (Enthomology Department). Brazil. MG. Universidade Federal de Lavras. Lavras. Zanetti.br. CEP 37200-000.

.

40. Véase atributos atributos técnicos específicos. 126. 151. Véase análisis de correspondencia ácaros oribátidos 150 ácaros 149-159 acceso a puntos de muestreo 84. 251-252 bienes y servicios. 177-214. 217. 290-294 alimentación especializada o incidental 111 almacenamiento de las muestras 78. 191. 132 mesofauna 159.85 ácido láctico 156 aditivos 279.164. 247–248 arado 311.160 nematodos 171-172 AC. 252-153 Asia 140–141 atributos 297. 290 bacterias fijadoras de nitrógeno (BFNFNL) 177-213 Basidiomycota 248. 334 aislamiento 190. 288. 99.314. de uso de suelo 302 B bacteria 39. 246 agroquímicos 313. 291 análisis automatizado del espaciador intergénico ribosomal (ARISA) 261. Véase servicios ecosistémicos biomasa 127. 280 África 141–142 agroecosistemas 43. 243. 132 343 . 93. 263 análisis de conglomerados (cluster) 267 análisis de correspondencia (AC) 266 análisis de varianza (ANOVA) 265 análisis filogenéticos198.Índice analítico A abundancia macrofauna 98.127. 302-329 atributos de tamaño de unidades de muestreo campo o parcela 304-307 cuadrícula 81-82 atributos técnico. 194-197. 334 Ascomycota 248.

301. 171-172 cercas vivas y otros elementos de vegetación 319-321. Véase colonizadores cálculo. 243. 319-320. 317 cPCR. 331-332 Chromista 247 Chytridiomycota 248. 298. 101. 158-160. Véase enumeración cobertura. Véase taxonómica clasificación. 325-329 colecciones de recursos genéticos 267 Collembola 123. 194 HMA 219-222. 246 descriptores genéricos 194 desmonte de la tierra 311. 197. 304307. 254-255 D D. 251 ciclo de nutrientes 34 clasificación de uso de suelo 332. 58. 304-324. 226-232 hongos 244. Véase disturbio datos requeridos y análisis 49-50. 164 descomposición 29-35. 58 . 325-329 conjunto mínimo de datos 129-132 contaminación 78 control microbiano 287 cosecha 311. 265 curvas de rarefacción 265 Cylindrocladium spp. 302. cultivo 305. 94. Véase PCR competitivo CSM-BGBD. 110 nematodos 171-172 uso de suelo 42-43. jerarquía 323 clasificadores 297. 325-329 caracterización cultural 189. 125-132. 188. 245. 190 caracterización de sitios 87-88 caracterización genética 197 cartografía. 129. 124. 97. Véase electroforesis en gel con gradiente de desnaturalización diapausa 289 disección 157 diseños multiescala 64 diversidad BFNFNL 178-182. Véase Proyecto. 149-162 colonización 219-224 colonizadores (c) 172-174 combinación de cultivos 308-311. 310. 300. 313-315 determinación a priori 65. 37-38. 307 características del cultivo 301. 316 cultivos puros 198 cultivos secundarios 307 cultivos trampa 231-232 curvas de acumulación de especies 113. 334335 clasificación de procesos 93. conservación y manejo sostenible de la biodiversidad del suelo 344 Manual de biología de suelos tropicales cuadrícula estratificada 84-85 cultivo post inundación 308 cultivos de sotobosque 308 cultivos migratorios 309. 265-267. 302-304 densidad. uso de suelo 81 categorías tróficas 110-112. 102 clasificación.biopesticidas 288 bioturbación 34 C C. 96. cultivo 305-307 depredadores 37. 302. 303 DGGE. 265-267 macrofauna 98-100.

113. 322-323. 263 embudo de extracción 149. 163-165 grupos funcionales de la biota del suelo 38-41 H herbívoros 37 hidróxido de potasio (KOH) 156 hipótesis de CSM-BGBD 57 Í ndice analítico 345 . 189. 98 estándares para BFNFNL descripción de especies 194-196 estatus de los cultivos 318 estratificación en el muestreo 55-57. 190. 283 extracción DNA 197. 114-118. 229-231. 193 equidad 266 ERA. 130. 104.E eficiencia en la labranza 312-314 electroforesis en gel con gradiente de desnaturalización (DGGE) 259-260. 192 . 162. 115-117. 116-125. 312. 315. 71 etiqueta 97. 257 esporas de HMA 226-228 método de Berlese 152-154 método de extracción Winkler 92. 287. 128 especies trampa 185-186 esporas 88. 218. 94-100 esquemas de puntos de muestreo 72-75 estacionalidad 88. 36. 110-111. 152-155 enfermedad 35.99-100. 288 esquemas de muestreo alternativos 5789. 128 fertilizantes 314-316. 70. 317. 330-333 familia Acaulosporaceae 238 familia Archaeosporaceae 239 familia Gigasporaceae 240 familia Glomeraceae 236 familia Pacisporaceae 239 familia Paraglomeraceae 239 fase de pupa 284 fauna de la hojarasca 37. 132 nematodos 165-166 extracciones núcleo por núcleo 154 F factor tiempo de cultivo 309. 226-228. 317 fertilizantes inorgánicos 315 fijación de nematodos 165-169 G glomerales 220 Glomeromycota 247 gradientes. 319 enfoque sesgado 65 enfoques transversales 57 ensamble de especies 110 ensayo de reducción de acetileno (ERA) 185. 128 especies clave 129 especies endógenas 99. 191 enumeración 168.6567. muestreo 80-81 gremios 114-115 grupos funcionales 29-41. 128 especies epigeas 78. 85-86 escarabajos 100-113. 112125. 99. 140 especies anécicas 100. Véase ensayo de reducción de acetileno escala 62 escalas espaciales de muestreo 42-50.

317 J jarras de Leonard 186.173 índice de riqueza de género 171 índice de Shannon–Wiener 266 infiltración de glicerina 168 ingenieros del ecosistema 34. 330-336 inventarios 41-50. 140 hospederos promiscuos 178-185. 301. 243-280 hongos saprofitos 41. 243-280 hongos antagonistas 41 hongos del suelo. 91. 306 índice de diversidad de Shannon 171 346 Manual de biología de suelos tropicales L labranza 312. muestreo de 63. 44. Véase también taxonomía IM. 37. 140-144 mesofauna 156-159 moscas de la fruta 284-285 nematodos 163-165. 100-113. 310 limpieza de malezas 313-315 listas de especies 107-109 lombrices de tierra 40. 305-306. Véase hongos micorrizógenos arbusculares hongos entomopatógenos 287-294 esquema de medición por puntos 74 grupos funcionales 39.HMA. 100–113 . 53. 41 HMA 217–241 patógenos de plantas y saprofitos 41. 297-336 investigaciones piloto 60 irrigación308. Véase índice de madurez imágenes satelitales 67. 114-118. 229-230 hongos 255-256 lombrices de tierra 98-100 macrofauna 105-110. 313. 187. 217-241 hormigas 40. 64. 304. patógenos de plantas 41. Véase Sistema de clasificación de cobertura de suelo límites. 166-168 organismos entomopatógenos 290. 243-280 hongos fitopatógenos 41 hongos micorrizógenos 217-241 hongos micorrizógenos arbusculares (HMA) 41. 193 insectos 287-294 intensidad de uso de suelo agrícola 42. 334 labranza mínima 312 LCCS. 87-88. 302-304 manejo de la biota del suelo 47-49 muestreo 79-80 replicación y tamaño de muestra 60–65 I identificación grupos funcionales en macrofauna 112-113 HMA 226-228. 193 jerarquía clasificación 323 clasificación de uso de suelo 300-302.93–100. 263-264 índice fitoparasítico (IFP) 172-174 índice de madurez (IM) 172. 293. 217. 91-92. 185–187 huella molecular 196-198. 91. 129 inoculación 47. 259-260. 46 datos requeridos 48-50 descripción y clasificación 299.

98-100. 39.M macrofauna 39. 40.149-160 método de Berlese 149-160 método de Berlese modificado 154-155 método de centrifugación en azúcar 166 método de de extracción 190. 75-77. 193 muestras control 193. 54.256–259. 118. 126. 67-68 muestreo sistemático 67-68 N nematodos 163–176. 261. 40. 334 media poblacional 25 medidas de conservación 318 “medio 79” 214 medio “S” 293 medio selectivo. 82–83. 73. 290 método de filtración de partículas 252– 254. 214 muestreo dentro de una parcela 65 muestreo animales 39 BFNFNL185–189. 131 monolitos complementarios para lombrices de tierra 97 moscas de la fruta 281-286 muestras compuestas 61–65. 263-264 método de la cuadrícula de intersección 227-228 método de partículas de suelo251–253 método de reacción en cadena de la polimerasa (PCR) 196. 321-330 materia orgánica 29-35 materia orgánica del suelo (MSO) 34. 73 microhabitat 47. 114-118.118125. para hongos 252-255 mesofauna 39. 287–295 nematodos bacteriófagos 164 nematodos omnívoros 164 Í ndice analítico 347 . 260. 91-148 manejo 311-319.114–118. 40. 193–195 clasificación de usos de suelo 297-336 diseño y estrategias 53-90 hongos 249 inventarios de biodiversidad 42-47 macrofauna 91-148 mesofauna 149-162 moscas de la fruta 282-285 muestreo adaptativo 64. 249. 73. 131 número de muestras 81–83 esquema de puntos de muestreo 72–75 muestreo estratificado 67. 48-49 monolitos 94–100. 130 métodos de extrapolación 105 métodos de montaje 157–158. 97 muestreo no aleatorio 67 muestreo secuencial 64 muestreo simple aleatorio (MSA) 55. 197. 229–230 métodos TSBF 93–94 microfauna 37-38.84–85 nematodos 165 punto de muestreo 62-63 muestreo aleatorio 55–56 muestreo en cuadrícula clasificación de uso de suelo 304 CSM-BGBD 79–80. 263 método de Seinhorst 168 método de Seinhorst modificado 169 método Winkler 92. 58 mecanismos de control 313-315 mecanización 311. 56.84–85 paisajes 61-63 aleatorio y sistemático 67-68 muestreo en transectos monolitos para lombrices de tierra 97 macrofauna 75.

219224 O observación directa 302 observaciones secundarias 303 Oomycota 250 organismos entomopatógenos 287–295 organismos mutualistas 39 P p. 48. 314 Phytophthora spp. 165. 85–86. 219 población. 38. 328. 263 prácticas culturales 301. 7980. 184–186.218. 57. 263 polimorfismo de longitud de fragmentos de restricción (RFLP) 260 polimorfismo de longitud de fragmentos de restricción terminal (T-RFLP) 260.185–198. 102 nivel de parche 46–47. 126 número más probable (NMP) 218.79–89. 250 plagas 35. 298 prueba de hipótesis 55–57. 244. 300–336 patógenos fúngicos de plántulas 255 perturbación (P) 56. 132 Pythium spp. 49 nivel neotropical 142. 41 procedimientos basados en cultura 333–245. 126. 174 pesticidas 286.140–144 nomenclatura 106. 325. 329 preparación de la tierra 311-312 primers específicos para “hongos” 257258 principales grupos funcionales 35-38.147–148 nivel regional 44. 78. 83–84. muestreo 60-62 polimorfismo de conformación de cadena única (SSCP) 261. 191 nivel de nicho 47. Conservación y manejo sostenible de la biodiversidad del suelo (CSMBGBD) 45–47. 64-65. 49. subparcela o microhabitat 47. Véase persistencia paisajes 44–47. muestreo 81. 81. separación de 85-86 puntos. 315. 330 PCR competitivo (cPCR) 262 PCR cuantitativo 261-262 PCR.61-62 parcelas de muestreo y clasificación de uso de suelo 46–47. 249–255 proceso de aclarado 156-157 procesos de degradación 44 procesos de rehabilitación 44 productores primarios 37 programa Africover 299 propágulos infectivos 219-224 protozoa 247 proyecto. Véase Método de reacción en cadena de la polimerasa permanencia de la vegetación 330–332 persistencia (p) 172. 48-49. 317. 250 . 307–311.nematodos parásitos de plantas 164 nematos micofagos 164 nicho. 145. 63 prueba piloto 60 pseudo-replicas 62 puntos de medición 53 puntos de muestreo 74 puntos de muestreo. 49 nitrogenasa 184. 319 plantaciones 322–324 348 Manual de biología de suelos tropicales plantaciones de teca 328 plantas hospederas 178–182.

30–33. 41. 123. 329 sitios de muestreo 60-63. 317 taxonomía BFNFNL 177–182 HMA 219-222. 126.124. Véase electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) 259–260. 103105. cultivos 310-311 roundup 314 T tasas de aplicación 303. 285 respuestas multivariadas de interés 63-64 RFLP ver polimorfismo de longitud de fragmentos de restricción rhizobia 177-183 Rhizoctonia spp. 251 Ricinius communis 254–255 riqueza de especies 265–267. 140. 93-95. 304–319. 82. 149 trampa White 293 Í ndice analítico S secuencia de cultivos 107 secuenciación 16S rDNA 196 selección subjetiva 67 servicios ecosistémicos 29–36. 130-132. 149 trampa 118-125. 335–336 sistemas de cultivo 42. 155158 técnicas específicas de DNA 197.279–280 técnicas de lavado para partículas del suelo 252. 227 tipos de anidación 112-113 trampa de especies múltiples 185.267 técnicas de procesamiento de muestras 78. 147 termitas que se alimentan de madera 111 termitas que se alimentan del suelo 110 TGGE. 124. 163 sistema de clasificación de cobertura de suelo (LCCS) 299 sistemas de barbecho 309–310. 91. 103.249–252. 229-230 macrofauna 105 mesofauna 158-159 moscas de la fruta 281. 284 neotropical 145 Véase también identificación visión general 29. 130-132. 328. 253-255. 256–265 termitas 40. 300–302. 188189 técnicas de cebo 119. 314–316. 334. 297–299 rizosfera 249 rotación. 325. 263 tinción de raíces 224–226. 79 solución de nutrientes Jensen’s 215 solución Nesbitt 158 SSCP. 263 técnicas de preservación 267 técnicas de preservación 93-94.187 trampas McPhail 282 BFNFNL 190 pitfall 118-125.R reactivo de Melzer 230-231 reglas de decisión para la clasificación de usos del suelo 323 rendimiento. Véase Polimorfismo de conformación de cadena única sustancias químicas 156-158 349 . 145. medición del estatus de los cultivos 318-319 resguardo de especímenes 192-193. 36-41 técnica de infección de plantas 178. 100–113.

64. 58 hongos 243 inventarios 87-88 muestreo 65-67. 320–322 vegetación semi-permanente 331 vegetación. 83. 83-84 Véase también intensidad de uso de suelo área de uso de suelo 46. 159-160 transformadores procariotas 38 T-RFLP. 132 U uso de suelo a priori definición de clases descriptivas 65. 87 variabilidad intragrupo 51 vegetación leñosa 319. 303 BFNFNL 186 cartografía 81 definición de clases 321–324 descripción y clasificación 297–336 diversidad 42.trampas sin cebo 118 transecto de entrenamiento 102 transformación de datos 126. 61–62. efectos de mitigación 301. 331–333 ventanas para muestreo 60. 300.7981. 70–72. 298. Véase polimorfismo de longitud de fragmentos de restricción terminal trituradores 260 V valores cp 171-174 variabilidad 70-72 variabilidad de datos 44. 48 W WOCAT World Overview of Conservation Approaches and Technologies 318 Z Zygomycota 248 350 Manual de biología de suelos tropicales .

Xalapa. Moreira. E. Bignell se terminó de imprimir durante el mes de mayo de 2012 en los talleres gráficos PROAGRAF. editado por Fátima M.Manual de biología de suelos tropicales. Col. S. 91190. C. Muestreo y caracterización de la biodiversidad bajo suelo . P.com. Av.000 ejemplares .proagraf. S.A. Veracruz.mx Se tiraron 1. 20 de Noviembre No 649. Badillo.V. de C. Jeroen Huising y David E. México. Tel/FAX (228) 890 6204/815 1876 www.

Sign up to vote on this title
UsefulNot useful