Manual de biología
de suelos tropicales

Esta publicación presenta parte de los resultados del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity”, implementado en siete países tropicales: México, Brasil, Costa de Marfil, Kenia, Uganda, India e Indonesia. El proyecto es coordinado por el Tropical Soil Biology and Fertility Institute del CIAT (TSBF-CIAT) con co-financiamiento del Global Environment Facility (GEF), y con apoyo para su implementación del Programa de Naciones Unidas para el Medio Ambiente (PNUMA-UNEP). Las opiniones expresadas en esta publicación pertenecen a los autores del libro y no necesariamente concuerdan con las de PNUMA-UNEP o GEF. La traducción y publicación de este libro en español fue posible gracias al apoyo financiero del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity” y al Instituto Nacional de Ecología (INE). También queremos agradecer todas las facilidades proporcionadas por Tiberious Brian Etyang del Tropical Soil Biology and Fertility Research Area of CIAT (TSBFCIAT) Nairobi, Kenia, a Teotonio Soares de Carvalho de la Universidade Federal de Lavras, Brazil, al Dr. José Antonio García Pérez por sus valiosos consejos y sugerencias, y a Caridad González Lerma por cuidar los últimos detalles.

Manual de biología de suelos tropicales
Muestreo y caracterización de la biodiversidad bajo suelo
Fátima M. S. Moreira, E. Jeroen Huising y David E. Bignell (editores )

Secretaría de Medio Ambiente y Recursos Naturales (S emarnat) Instituto Nacional de Ecología (INE)

Título original de la obra: A Handbook of Tropical Soil Biology Sampling and Characterization of Below-Ground Biodiversity © Earthscan en el Reino Unido y Estados Unidos en 2008 Hardcover ISBN: 978-1-84407-621-5 Paperback ISBN: 978-1-84407-593-5

Revisión de capítulos por especialistas en el tema: Dra. Isabelle Barois Boullard, Instituto de Ecología, A.C. Dra. Simoneta Negrete Yankelevich, Instituto de Ecología, A.C. Dra. Rocío Vega Frutis , Instituto de Ecología, A.C. M.C. José Antonio Gómez Anaya , Instituto de Ecología, A.C. M.C. Francisco Franco Navarro, Colegio de Posgraduados Dra. Esperanza Martínez-Romero, Centro de Ciencias Genómicas, UNAM Dra. Lucia Varela Fregoso, Hongos y Derivados, S.A. de C.V. Dr. Juan Rull Gabayet, Instituto de Ecología A.C. Dra. Dora Trejo Aguilar, Universidad Veracruzana

Primera edición: 2012
D.R. © Instituto Nacional de Ecología

Periférico Sur 5000. Col. Insurgentes Cuicuilco, Deleg. Coyoacán, 04530, México, D.F. www.ine.gob.mx

Coordinación General de la Publicación en Español: Isabelle Barois Boullard Coordinación editorial y formación: Raúl Marcó del Pont Lalli Corrección de estilo: Adriana Victoria Arcos Méndez Revisión y preparación de originales: Martín De Los Santos Bailón Colaboradora en la traducción al español: Judy Shirley Adaptación del texto: Mariluz Pérez Lorenzo Diseño portada: Álvaro Figueroa Foto de la portada: Claudio Contreras Edición para internet: Susana Escobar Maravillas Forma sugerida de citar el libro: Moreira, F., E. J. Huising y D. E. Bignell. 2012. Manual de biología de suelos tropicales. Muestreo y caracterización de la biodiversidad bajo suelo. Instituto Nacional de Ecología, México, 337 pp., México.
Ninguna parte de esta publicación, incluyendo el diseño de la portada, puede ser reproducida, traducida, almacenada o transmitida de forma alguna ni por ningún medio, ya sea electrónico, químico, mecánico, óptico, de grabación o de fotocopia sin permiso previo de los editores. Pequeños párrafos, tablas o figuras, pueden reproducirse dentro de lo estipulado en la Ley Federal de Derecho de Autor y el Convenio de Berna, o previa autorización por escrito de la editorial. ISBN: 978-607-7908-31-9 Impreso y hecho en México

Índice

1 2 3 4

Listado de tablas Listado de figuras Prólogo a la edición en español Prólogo Prefacio Lista de acrónimos y abreviaturas El inventario de la biodiversidad biológica del suelo: conceptos y guía general Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo Macrofauna Collembola, acari y otra mesofauna del suelo: el método Berlese

9 10 13 17 21 25 29 53 91 149

preservación e identificación de moscas de la fruta 163 177 217 243 281 287 10 Hongos y nematodos entomopatógenos 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo Colaboradores Índice analítico 297 339 343 .5 6 7 8 9 Nematodos del suelo Bacterias formadoras de nódulos en leguminosas Hongos micorrizógenos arbusculares (HMA) Hongos del suelo saprófitos y patógenos de plantas Muestreo.

1 3.5 11.1 1.Listado de tablas 1.1 5.2 1. unidades de referencia. Familia. procesos asociados de cambio y componentes relevantes de la biodiversidad Grupos de organismos del suelo colectados utilizando diferentes métodos de captura Ejemplo de lista de especies Densidad numérica (individuos m-2) de termitas en siete localidades.3 11.1 5. amplificados del DNA total Clasificadores y atributos técnicos para el cultivo principal Tamaño del campo y características de la cobertura del cultivo Atributos de cultivos combiandos Características del suministro de agua Factor tiempo de cultivo Clasificadores y atributos relacionados con la limpieza de la parcela.6a 11.3 2.2 4.8 11.4 11.10 11. a través de una gradiente de perturbación de la selva.9 11.2 11.11 Número de especies descritas en las principales categorías taxonómicas de plantas. fertilizantes y cosecha Características de la parcela y distribución del uso de suelo Características de los árboles en la finca (TROF) Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca Ejemplo de clasificadores y valores de atributos para parcelas de maíz 26 33 44 72 103 122 154 167 168 169 174 210 253 295 297 298 298 299 303 307 310 312 315 318 319 . Especie de bacterias formadoras de nódulos en leguminosas Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes.1 3. Género.3 6. biota del suelo y principales grupos funcionales a los que pertenecen Principales grupos funcionales de la biota del suelo Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo.1 7.1 8.1 11.2 5.7 11. en la provincia de Jambi del centro de Sumatra Composición química para aclarar y montar especímenes Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina Familias y valores cp utilizados para el índice de madurez Familias y valores cp utilizados para el índice fitoparasítico Filum/Orden.1 11. labranza y deshierbe Clasificadores y atributos para el manejo de plagas y enfermedades.6b 11.

dispuestas a lo largo del gradiente. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. 32 Principales grupos funcionales. utilizando permutaciones de datos al azar. arañas y otros artrópodos.7 4. hormigas y escarabajos. clasificados de acuerdo con dominios y reinos. b) tres cuadrículas que muestrean tres diferentes parches de selva.2 3. hecha con un vaso. 81 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). para muestrear la mesofauna en la hojarasca y en el suelo mineral. 70 Esquema alternativo para muestrear macrofauna. 54 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. 71 Ejemplos de diferentes configuraciones de ventanas de muestreo. tres y dos ventanas. tamaños y procesos de ecosistemas relacionados.1 3.2 2. 91 Esquema de alineación de monolitos complementarios de lombrices de tierra. 94 Extracción de termitas de una muestra de suelo en una charola de aluminio.Listado de figuras 1. cuatro palitos pequeños y una cubierta de celofán.5 2. b) se utilizan guantes como precaución contra enredaderas.2 2. b) ilustración de la división de una cuadrícula entre seis.3 2. por estratificación.4 2. 148 . hormigas.3 3. El muestreo se puede ampliar si se usa uno o dos transectos para termitas. según se requiera. 59 Esquema de muestreo por puntos para toda la biota. utilizando una pequeña cuchara o cuchillo de campo. 93 Separación a mano de lombrices de tierra en charolas de plástico.6 3.5 3. con puntos de muestreo adicionales.4 3. estudiados en el proyecto CSM-BGBD. c) incrementando la replicación. b) si se incluyen de manera deliberada valores de MOS más extremos. 77 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. 115 Trampa pitfall improvisada. d) reconociendo los límites como otra categoría. mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra. 35 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula.6 3.1 1.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. 99 Ejemplo de curva de acumulación de especies con una desviación estándar. dando un estimado pobre de la pendiente. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. 109 Esquema de una trampa pitfall con cebo. a) cuadrícula completa.1 2. esto aumentará la precisión de la estimación de la pendiente. 116 Sacabocados de metal. utilizando un transecto de 50 m.

3 Embudos Berlese llenos de suelo y hojarasca.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos.4 Embudo Berlese modificado. d) almacenaje de conidios en tubos Eppendorf. d) emergencia de juveniles infectivos en la trampa White.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. 163 5. 151 4.3 Producción de acetileno en campo o laboratorio. fijadoras de nitrógeno en diversos sistemas de uso de suelo. bajo condiciones de congelación. 284 .2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos. 180 6. Las cajas Petri no deben contener más de una tercera parte de líquido.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. c) larvas que muestran la patología típica de infección por nematodos. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa. 184 6. b) sistema Berlese– Tullgren en operación.4. 166 6. 165 5. b) muerte de nematodos en agua caliente. 282 10. 163 5. 187 6.5 Equipo básico requerido para extracciones núcleo por núcleo Berlese-Tullgren.1 Evaluación de bacterias formadoras de nódulos en leguminosas. 216 10. 162 5.1 A la izquierda. creciendo en medio ADP. juego de tamices de metal (de malla de 45 arriba y de 400 abajo).7 Charola con montajes permanentes de especímenes de nematodos.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). con embudo superior de 40 cm de diámetro. resumida en seis pasos.3 a) Nematodos recuperados mediante el lavado de malla de 400. c) incubación bajo condiciones controladas en una cámara DBO.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina.2 a) contenedor de apoyo para embudos Berlese–Tullgren. 166 5.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos 165 5.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. suspensión de suelo en reposo.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) disolución seriada de la suspensión acuosa que contiene al hongo. 149 4. de 50cm de altura.1 ml) en una caja Petri con medio de cultivo.2 Cultivos purificados de Beauveria bassiana. hecho de aluminio. 152 5. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. b) inoculación de la suspensión (alícuota de 0. 282 10. 189 7. 151 4. y a la derecha.

Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. 11. 322 324 325 . y presencia o ausencia del componente arbóreo. 11.3 Clasificación del uso del suelo en términos de la intensidad de uso.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural.11.2.

pero ahora sabemos que interviene y participa ampliamente en los servicios ambientales que brinda el suelo: por una parte. el ciclaje de nutrientes. hormigas. José Sarukhán. La biodiversidad del suelo alberga más del 25 % de la que existe en todo el planeta y. la fijación de nitrógeno. hongos y protozoarios y los reguladores biológicos como los ácaros. fundador de la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad de México. la regulación de la dinámica de la materia orgánica del suelo. Por otra parte. que pueden incorporar y asimilar estos conocimientos en beneficio de la biodiversidad del suelo. N2O. las bacterias. El conocimiento de esta biodiversidad se ha dejado de lado durante mucho tiempo por la dificultad para abordarla. que son las lombrices de tierra.Prólogo a la edición en español Este prólogo es el segundo elaborado para esta misma obra y se presenta para su versión en español. Cabe mencionar que un tipo de organismo puede participar en varios grupos funcionales. en términos generales. es decir. la sostenibilidad y el desarrollo de sus comunidades rurales. “¡Se sabe más de las estrellas que de los organismos del suelo!”. es la que menos se conoce. termitas. la elaboración de la estructura del suelo y el mantenimiento del régimen hídrico la desarrollan los ingenieros del ecosistema. colémbolos y nematodos. la captura de carbono y la reducción de emisiones de gases traza (CO2. Como lo afirmó el Dr. CH4) son realizados principalmente por el grupo funcional de los ingenieros químicos del ecosistema. escarabajos y pequeños mamíferos. por la importancia que reviste su divulgación en un idioma que puede ser leído por un amplio grupo de países de América Latina. 13 .

actualizada y rápida. pues permitirán diseñar y establecer estrategias para mantener la sustentabilidad. silvícolas y ganaderas en el mundo. con repercusiones a nivel global. combinada con las necesidades alimenticias de una población humana en continuo crecimiento. contribuye a nuestro alimento. son grandes pero se desconocen en buena medida los mecanismos y procesos que se afectan. fibra y combustible. Ante este panorama. se requieren muchos años más de investigación taxonómica y funcional para comprender y manejar los procesos edáficos. las técnicas de muestreo y estudio de la materia orgánica y los organismos del suelo que permitan obtener información veraz. La pérdida de la fertilidad. permite el control de plagas y fomenta la producción de las plantas y de los animales. En este sentido. el uso de fertilizantes. esta biodiversidad le da estabilidad al paisaje. pesticidas y técnicas mecánicas de cultivo modifican fuertemente las condiciones originales del suelo. Durante años los estudios del suelo fueron enfocados al conocimiento de la física y química del suelo. su biodiversidad. conocer y aprender a manejar dicha biodiversidad resulta fundamental para conservar o restaurar la fertilidad del suelo. lo que visto desde el punto de vista antropogénico.De manera global. Y si bien se ha avanzado mucho al respecto. particularmente en las regiones tropicales. reduciendo la materia orgánica contenida y alterando gravemente sus redes biológicas y funcionales. que se encuentran entre los más afectados por la deforestación y el 14 Manual de biología de suelos tropicales . y se dejó de lado el estudio de la biología del suelo y. tanto del punto de vista morfométrico como molecular para lograrlo. Este manual reúne técnicas de muestreo en campo. entendidas ahora bajo el concepto de calentamiento global. particularmente en los ecosistemas tropicales. generan y provocan el avance de la frontera agrícola y la intensificación productiva. así como preservar y restaurar la fertilidad natural de los suelos. Mientras leemos estas líneas. más aun. conservación y equilibrio del ecosistema. son fundamentales. las condiciones de la biota del suelo continúan alterándose aceleradamente en todo el mundo debido a las actividades humanas. el equilibrio y la funcionalidad de los suelos modificados por las prácticas agrícolas. que han sido desarrolladas y probadas en siete países y tres continentes. sobre el verdadero impacto que están teniendo las prácticas de manejo. pero su impacto y repercusiones sobre los procesos de funcionamiento. se reconoce la necesidad de estimular la formación de profesionales en taxonomía y sistemática de la biodiversidad del suelo. Y aunque es difícil cuantificar el valor económico de estos servicios. que se estiman en miles de millones de euros anuales.

Cabe mencionar que la mayoría de los autores que colaboraron para desarrollar este manual residen justamente en países tropicales. mientras que al final se encuentra un capítulo integrador que permite relacionar los inventarios de los organismos del suelo con una clasificación del uso de suelo para estimar el impacto del manejo del suelo sobre su biodiversidad. La información de este manual se ha organizado de acuerdo con la funcionalidad de los grupos del suelo.C. Su elaboración tiene como finalidad no sólo ser una herramienta de utilidad en el trabajo técnico. sino constituir un apoyo en el camino hacia la sustentabilidad y la relación armónica entre el hombre y la naturaleza. mejorados y actualizados durante el desarrollo del proyecto Conservación y manejo sostenible de la biodiversidad debajo del suelo (CMS. Fondo para el medio ambiente. Al inicio del manual se incluyen dos capítulos que ofrecen una guía para establecer un método de muestreo representativo que permita evaluar y comparar la biodiversidad del suelo en diferentes sitios. permitiendo llevar a cabo evaluaciones sobre la diversidad y salud del ecosistema que sirvan como base para el diseño de prácticas de manejo sustentables. portugués y español. Estas técnicas de muestreo básicas han demostrado ser poderosas herramientas para llevar a cabo investigación básica y aplicada. en México. generando información útil no sólo para investigadores o especialistas sino para toda persona interesada en el estudio de la conservación y la productividad del suelo. pues en este caso fueron probados.BGBD. Esto es así porque. Las técnicas y métodos de muestreo presentados en este manual no constituyen sólo una recopilación de los procedimientos originales ya conocidos. por sus siglas en inglés) . inglés. financiado por el GEF. Agradecemos a todos los especialistas que revisaron la traducción de los textos que correspondían a su especialidad y competencia. las consecuencias de un mal manejo de suelos pueden provocar consecuencias dramáticas. ahora este manual se encuentra disponible en tres idiomas. lo que demuestra la mayor presencia y formación de especialistas nacionales preocupados por sus recursos naturales. para que su alcance e impacto sea más amplio. incluso en plantaciones agrícolas con manejo de bajo insumos. La información contenida en este manual es útil para investigadores. estudiantes.cambio en el uso del suelo. De manera especial queremos P rólogo a la edición en español 15 . implementado por el PNUMA y ejecutado por el TSBF a nivel internacional y por el Instituto de Ecología A. profesores y profesionales involucrados en el manejo productivo de los suelos y también en su conservación. Con esta versión en español.

agradecer al Instituto Nacional de Ecología. Isabelle Barois Boullard Coordinadora de la traducción y del proyecto CSM-BGBD en México 16 Manual de biología de suelos tropicales . y en particular a Raúl Marcó del Pont y su equipo. por su trabajo editorial y su paciencia ejemplar.

sin embargo. Ante esta situación. los suelos en todo el mundo enfrentan una grave crisis. sin lugar a dudas. la regulación biológica del suelo se verá afectada e incluso sustituida por fertilizantes y cultivos mecánicos. sin embargo. Dicha intensificación es necesaria para asegurar el suministro global de alimentos. Sea como fuere. sólo en tiempos recientes se ha planteado que los suelos contienen un componente biológicamente activo. Esto. tiene como consecuencia 17 . la mejor muestra –y la más actual– para poder evaluar la biodiversidad del suelo en ecosistemas que están siendo rápidamente alterados como consecuencia de los cambios en el uso del suelo. Una línea de investigación surgida a partir de entonces es la de cómo evaluar y manejar diversidad bajo suelo en sistemas de agricultura que faciliten la productividad agrícola y sustentabilidad de suelo a largo plazo. Un aspecto a destacar del cambio global en las regiones tropicales. en la medida que esto ocurra. celebrada en el año 2006. a su vez. se enfatizó la importancia de la diversidad bajo suelo y se exhortó a abrir nuevas líneas de investigación multidisciplinaria. surge la gran necesidad de aplicar los conocimientos referentes al papel que desempeña la biodiversidad bajo suelo para su sustentabilidad.Prólogo Durante mucho tiempo la sociedad ha reconocido su dependencia respecto del suelo. es el cambio de uso de suelo asociado a la intensificación agrícola. Mediante la aprobación de la Iniciativa Internacional para la Conservación y el Uso Sustentable de la Biodiversidad del suelo en la Convención sobre Biodiversidad Biológica. Este manual es.

Un metro cuadrado de bosque templado puede contener hasta mil especies de invertebrados y. El propósito de este manual es proveer de métodos estándares internacionales para el inventario de comunidades bajo suelo y la caracterización del uso de suelo en el trópico húmedo. así como la conservación de la biodiversidad en todo el mundo y no. en los trópicos.una reducción de la biodiversidad del suelo. desde luego. La biodiversidad tropical ha sido subestimada y es posible que las verdaderas densidades de especies sean mayores que en otras latitudes. la capacidad de retención de agua del mismo. manejar la biodiversidad del suelo para poder incrementar la productividad agrícola en regiones que están siendo degradadas? La respuesta a esta pregunta atañe a toda la humanidad porque la tierra está siendo degradada. vitales para poder alcanzar la meta: productividad agrícola sustentable. problema cuya solución implica un gran reto: ¿es posible. el mantenimiento de la estructura física del suelo. La relación entre la diversidad de especies y la diversidad funcional de la biota del suelo sigue siendo incierta. estas herramientas pueden ser utilizadas para aprovechar los organismos del suelo en el manejo de los ecosistemas. quizás. las relaciones entre la biodiversidad del suelo y la ocurrencia y magnitud de los procesos ecológicos son inciertas. la provisión de nutrientes en las plantas y el control de patógenos en plantas como contribuciones específicas de los organismos del suelo a la fertilidad de éste. En última instancia. en bioprospección y para promover mejoras sustentables en la pro18 Manual de biología de suelos tropicales . Del mismo modo. asociada a la deforestación y al proceso de Intensificación agrícola en los márgenes de los bosques. entonces. desde los invertebrados más grandes hasta las bacterias. sino también en países de primer mundo. tanto en el laboratorio como en el campo. Dichos conocimientos son. cubre casi la totalidad de la gama de biodiversidad biológica. un número mayor de diferentes tipos de microorganismos. Durante mucho tiempo los ecologistas han debatido sobre la importancia de la diversidad biótica del suelo: el secuestro de carbono en suelos. El objeto explícito en este caso es práctico: proveer de una herramienta definitiva para establecer una línea de base y luego documentar la pérdida de biodiversidad de suelo. además. no solamente en regiones en vías de desarrollo. únicamente. pero constituye uno de los principales objetos de investigación en todos los niveles. la reducción de las emisiones de gas invernadero. por lo que representa el resultado publicado de más de una década de intensa discusión y un amplio trabajo de campo por parte de un gran número de expertos investigadores de muchos países.

el presente manual contiene notables diferencias respecto de los anteriores. a muchos servicios ambientales que los suelos proveen. no obstante. Otro aspecto notable de este manual es que la biota del suelo está agrupada en ocho categorías. por lo que algunos taxa han sido excluidos. El proceso responde a una necesidad selectiva. esto implica la reconciliación de los intereses y preocupaciones de los agricultores pobres. Tal selección es inevitable cuando se trata del suelo. especialistas en agricultura y empleados técnicos de todos los niveles. manuales metodológicos de muestreo para organismos del suelo. dentro del alcance de la población que se encuentra relacionada con su productividad. los autores han incluido la revolución en metodología molecular que ha incursionado en las ciencias biológicas durante los últimos diez años. si es que aún estamos a tiempo de parar la pérdida de la biodiversidad tropical. En segundo lugar. ofrece la ventaja de traer consigo los medios para poder hacer una evaluación aproximada de la salud del suelo. especialmente en el caso de los pueblos más pobres del mundo. sin embargo. sino también para biólogos en general. los objetivos nacionales de desarrollo y calidad de nuestro ambiente. Muchas de las técnicas asociadas con una evaluación de diversidad dentro de grupos específicos microbianos han surgido a partir de P rólogo 19 . tanto nacionales como extranjeros. con cierta frecuencia. Finalmente. En la medida de lo posible esto aplica a la identificación: las claves recomendadas son los más funcionales. Una de las más importantes es que la mayoría de los colaboradores pertenece a los países que se encuentran más afectados por la deforestación y el cambio en el uso de suelo. considerado importante o esencial en la función del suelo y. son de interés no sólo para expertos en taxonomía. en doce localidades como puntos de referencia. no obstante. pero que también corresponde a un grupo funcional mayor. por lo tanto. consecuentemente. también donde es necesario. distribuidos en siete países y tres continentes. porque la verdadera biodiversidad es tan amplia que queda fuera del marco de cualquier sistema científico para que se pueda documentar totalmente. representan a instituciones académicas y gubernamentales en las que se requiere poner en práctica nuevas políticas para el manejo del suelo que han de ser validadas. Durante los últimos cincuenta años se han publicado. los métodos han sido desarrollados y monitoreados en condiciones de campo. Inevitablemente. cada una con amplia identidad taxonómica.ducción agrícola. los métodos presentados en este manual contemplan también los ecosistemas terrestres en general. se aconseja referir los especímenes a especialistas.

discusiones entre colaboradores y durante talleres específicamente pensados para la publicación del presente manual. Diana H. Wall Natural Resource Ecology Laboratory Colorado State University Mayo de 2008 20 Manual de biología de suelos tropicales .

recibe apoyo para su financiamiento del Fondo Global del Medio Ambiente (GEF por sus siglas en inglés). Costa de Marfil. Uganda. que permitan la comparación de resultados de inventario en áreas específicas de países tropicales con validez científica y estadística. sobre todo. al (TIGER). El proyecto se lleva a cabo en México. al NERC por el Reino Unido (UK). India e Indonesia. Brasil. El proyecto se inició en 2002 con el objeto de generar información y conocimientos que puedan ser utilizados para un mejor manejo y conservación de la BGBD en espacios de agricultura tropical. constituye una actualización de los métodos y protocolos que fueron inicialmente propuestos por investigadores afiliados al Instituto de Biología y Fertilidad del Suelo Tropical del CIAT. y. El manual describe métodos de muestreo y laboratorio para evaluar la biodiversidad de una gama de grupos funcionales básicos de biota de suelo. Este proyecto es ejecutado por el Instituto de Biología y Fertilidad del Suelo Tropical (TSBF). para mantener la productividad agrícola y reducir la extensión de la agricultura en paisajes naturales. institución que pertenece al Centro Internacional de Agricultura Tropical (CIAT).Prefacio Este manual es uno de los resultados del proyecto PNUMA/GEF “Conservación y Manejo Sostenible de Biodiversidad Bajo Suelo” (CSM-BGBD) que surge como respuesta a la necesidad de crear métodos estándares e instrucción práctica para el inventario de la biodiversidad bajo suelo. del Programa de Naciones para el Medio Ambiente (PNUMA/UNEP). y para su puesta en marcha. asimismo. a la Red de Macrofauna financiada por la Unión Europea (EU). al PNUD/ 21 . Kenia.

por parte de la UNESCO. y en varios talleres llevados a cabo desde el inicio del proyecto. al programa DIVERSITAS. Manaus. al igual que métodos que no han sido considerados en las publicaciones mencionadas. en donde también se habla del principio de grupos funcionales del inventario de organismos de suelo. la gama completa -geográfica y biogeográfica. Ésta fue la contribución. hongos entomopatógenos. al igual que en varios talleres temáticos de taxonomía específica (técnicas moleculares con énfasis en T-RFLP. Dado que muchas especies aún son desconocidas o no se han descrito. Kenia. termitas. cuya evolución se muestra en los reportes de 2002 (Wageningen. en especial. una evaluación de la diversidad de especies resulta un proceso poco práctico.UNDP-GEF con el apoyo financiero destinado al Proyecto Alternativas de RozaTumba-Quema (ASB). HMA y Ectomycorrhiza. agosto 2004. S. Países Bajos). Colombia. Los métodos estándares propuestos contienen avances tecnológicos recientes en genética molecular. saprófitos y patógenos y una amplia gama de artrópodos mayores. Un manual formal de técnicas para organismos de suelo y organismos que viven en agua dulce y sedimentos marinos fue publicado en 1996. editado por Swift y Bignell (2001). en términos de grupos funcionales. Los métodos fueron discutidos y posteriormente perfeccionados en reuniones anuales celebradas entre los años 2002 y 2005. Hall. 2003 (Sumberjaya. Indonesia) y. o la actualización de métodos para evaluar la diversidad de nematodos. Kenia). Nairobi. bacterias formadoras de nódulos en leguminosas (BFNFNL) y sus plantas hospederas. Los métodos para una evaluación de biodiversidad de suelo fueron descritos en el ASB (Nota de Lectura 6B). Bangalore. La definición de métodos estándares aprovecha la experiencia obtenida con la implementación de los métodos utilizados en los siete países participantes en el proyecto. termitas y hormigas. dentro del alcance de laboratorios nacionales. Londrina. además. Los métodos para algunos de los grupos funcionales de organismos de suelo fueron incluidos en un manual pionero. elaborado por Anderson e Ingram (1993). lombrices de tierra. provee detalles adicionales en el caso de grupos funcionales específicos: como el uso de trampas Winkler para hormigas y trampas Pitfalls para escarabajos en muestras de hojarasca. octubre 2003). También cubre. en su caso. tales como el registro de huellas genéticas del BFNFNL. diciembre 2004. Brasil. en el de 2004 (Embu. India 2005. Una 22 Manual de biología de suelos tropicales . Brasil mayo/2004 y Nairobi. ampliamente. Cali. febrero 2005. editado por G.dentro del trópico húmedo. Los métodos que se describen en este manual reflejan una amplia gama de actividades del proyecto CSM-BGBD. como es el caso de aquéllos que se refieren a la mesofauna.

Además de estos efectos. Para responder a algunas de las preguntas mencionadas se requiere: P refacio 23 . tenga implicaciones en la BGBD. Aun si se pudiera regresar a sus condiciones originales. Quedan muchas interrogantes en cuanto al manejo de BGBD. Al mismo tiempo. de manera que causará un impacto inmediato en la BGBD que fácilmente se antepondrá al efecto combinado de todos los factores mencionados. esto se traduce en una alteración del suelo como hábitat. que se espera. sin embargo. llega a influir sobre la abundancia y diversidad de dichos organismos. La conversión de uso de suelo y la intensificación de su uso. la erosión del suelo significa la más catastrófica de las alteraciones. la erosión puede llegar a nulificar todos los demás procesos degenerativos. no necesariamente se lograría restaurar la BGBD. La hipótesis actual es que una intensificación en el uso de suelo trae consigo una reducción de la biodiversidad del suelo y a su vez. Los efectos en BGBD son condiciones compuestas por el medio ambiente y por características físicas y químicas del suelo (por ejemplo: pH. interpretar esos procesos en el contexto ecológico. frecuentemente provocan una reducción de materia orgánica del suelo que forma el sustrato básico para la mayoría de los organismos que en él habitan y. en contra de una productividad sustentable. La mayoría de los organismos del suelo se encuentran en los primeros 20 centímetros de su perfil. como consecuencia del labrado o del creciente uso directo de agroquímicos. Es por esto que el control de la erosión y la rehabilitación de suelos fuertemente erosionados deberá considerarse parte de las estrategias para conservar y sustentar un buen manejo de la BGBD. así. provoca una pérdida de servicios del ecosistema. hay otros asociados con un incremento en la intensidad del uso de suelo. Además. por lo tanto. así se podrían entender las consecuencias de una pérdida en el BGBD y. nivel de nutrientes y densidad). generalmente.mejor opción sería investigar la pérdida de grupos funcionales básicos dentro de la BGBD que muestran un cambio en el uso de suelo o una intensidad del mismo. van acompañadas por reducciones drásticas en la diversidad de plantas. restablecer la BGBD no implica precisamente devolver los servicios del ecosistema. estos cambios de uso de suelo. poco se sabe de las relaciones entre ambos factores o sobre los mecanismos por los cuales ocurren cambios en la BGBD. La premisa es que la diversificación agrícola (en varios niveles) genera biodiversidad en el suelo y que la producción agrícola sustentable (en los márgenes de la selva tropical) se mejora significativamente. dejándolo como estaba antes de ser alterado. por lo tanto.

• Establecer una relación entre la biodiversidad de la superficie y bajo del suelo en los actuales y alternativos sistemas de uso de suelo. • Identificar “puntos de entrada” para mejorar el manejo de la tierra. Wallingford. Swift. J. ASB Lecture Note 6B. Bogor.pdf. CAB International. desde bosque natural hasta agricultura de monocultivo. desde una parcela (agrícola. South East Asian Regional Research Programme. S. M. e Ingram. Bignell ReFERENCIAS Anderson. J. G. Wallingford. S. Se espera que los métodos descritos en este manual sean útiles para el diseño y la ejecución de estudios para inventario y monitoreo de la BGBD en todos los niveles. caracterizada por un cultivo continuo y un elevado uso de químicos y mecanización. (ed) (1996) Methods for the Examination of Organismal Diversity in Soils and Sediments. E. 24 Manual de biología de suelos tropicales . Moreira. Indonesia. un conocimiento más amplio de prácticas existentes y un uso más efectivo de tecnologías disponibles que no requieran altos insumos. 2nd edition. mediante la introducción y/o manejo de biota de suelo (se experimenta con varios manejos alternativos).fao. International Centre for Research in Agroforestry. CAB International. S. y Bignell. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. I. D. E.• Una caracterización de la biodiversidad del suelo en un amplio rango de uso de suelo de varias intensidades. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. y observar cómo esta relación se modifica y se altera por las condiciones prevalecientes en el medio ambiente (incluyendo condiciones de suelo). Estos “puntos de entrada” pueden incluir un mejor entendimiento del uso de prácticas indígenas. Fátima M.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. Jeroen Huising y David. experimental o de muestreo) hasta un paisaje natural. M. Hall. www.

formadoras de nódulos en leguminosas Reacción en cadena de la polimerasa competitiva Conservación y Manejo Sustentable de Biodiversidad Bajo Suelo Biodiversidad Bajo Suelo Electroforesis en gel con gradiente de desnaturalización Equivalente de ácido European Bioinformatics Institute Ensayo de reducción de acetileno Detector de ionización de flama Universidade Regional de Blumenau Global Environment Facililty 25 .Lista de acrónimos y abreviaturas AC ADP AFLP AHM AM ANOVA ARISA B BFNFNL cPCR CSM-BGBD BGBD DGGE ea EBI ERA FID FURB GEF Análisis de correspondencia Agar dextrosa y papa Polimorfismo en el tamaño de fragmentos amplificados Agar con harina de maíz Agar extracto de malta Análisis de varianza Análisis automatizado del espaciador intergénico ribosomal Bacteriófagos Bacterias fijadoras de nitrógeno.

GF HMA ia ICRAF IFP IM INPA ITS KOH LCCS M MAS MOS NCBI Nd NMP P Pc PCA PCR PFGE PNUMA PP RAPD Rep-PCR RFLP RIA SR SSCP TGGE TRF T-RFLP TROF TSBF-CIAT 26 Grupo funcional Hongos micorrizógenos arbusculares Ingrediente activo World Agroforestry Centre Índice fitoparasítico Índice de madurez National Institute for Amazonian Research (Instituto Nacional de Pesquisas da Amazônia) Espaciadores de trascripción interna Hidróxido de potasio Sistema de clasificación de cobertura de suelo Micófagos Muestreo aleatorio simple Materia orgánica del suelo National Center for Biotechnology Information Nivel de dilución Número más probable Perturbación Porcentaje de colonización Análisis de componentes principales Reacción en cadena de la polímerasa Electrofóresis en campos pulsados Programa de las Naciones Unidas para el Medio Ambiente Parásitos de plantas DNA polimórfico amplificado al azar De fragmentos repetidos palindrómicos-éxtragenicos Polimorfismo de longitud de fragmentos de restricción Resistencia intrínseca a los antibióticos Sensores remotos (imagen) Polimorfismo de conformación de cadena sencilla Electroforesis en gel con gradiente de temperatura Fragmentos de restricción terminal Polimorfismo terminal de la longitud del fragmento de la restricción Árboles en finca Tropical Soil Biology and Fertility Institute of the International- Manual de biología de suelos tropicales .

UC UFAM UFC UFLA UFMG UnB VA VB Center for Tropical Agriculture Unidad de colonización Universidad Federal de Amazonas Unidades formadoras de colonias Universidad Federal de Lavras Universidad Federal de Minas Gerais Universidad de Brasilia Volumen alto Volumen bajo A crónimos y abreviaturas 27 .

.

. 2004.2004). 1998. Sin embargo. Jeroen Huising Organismos y servicios del ecosistema del suelo El suelo es un hábitat que alberga una amplia gama de organismos dentro de los tres dominios taxonómicos (sensu Woese et al. Cavalier-Smith.Estos procesos apoyan a los servicios del ecosistema.. contri29 . Bardgett. la biota (relativa a agentes no bióticos y entre ellos mismos) será evaluada por su contribución relativa a los procesos del ecosistema (sensu Daily. 1996. S. especialmente cuando se trata de los taxa a ser creados en altos niveles y los números de tales categorías altas (como reinos) a ser consideradas. 2004).. Wall.000 en el caso de procariontes. Lavelle. 1997. Wall. Bignell. Ya que no es ni práctico ni coherente tomar en cuenta todos los organismos presentes. La clasificación taxonómica de organismos vivos aún se encuentra en una situación polémica (Margulis y Schwartz. Moreira et al. cualquiera que sea el sistema de clasificación utilizado. 1979. 2005. 1998.1 se enlistan los principales fila de organismos eucariontes y procariontes que son o pueden ser representativos en la comunidad del suelo. Moreira y E. 1998). David E.5 millones de especies de eucariontes y con una riqueza de especies estimada muy por encima de 10. Fátima M. En la Tabla 1. 1997. 2006). Swift. 1990) y muchos fila. con más de 1. la diversidad de la biota del suelo es elevada en todos los niveles de análisis (véase Swift et al.. cuando se hace una evaluación biológica de la salud de los suelos (Lawton et al..Capítulo 1 El inventario de la biodiversidad biológica del suelo: conceptos y guía general Mike J. Brussaard et al.

1 Número de especies descritas en las principales categorías taxonómicas de plantas.000 Filum Crustacead [>6 clases] 25. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Dominio Eucarionte 255.000 Clase Malacostracad (incluye orden Decapoda con un esqueleto externo calcificado) Orden Isopoda (ácaros de la madera y >11.000 Dicotiledoneas 130. biota del suelo y principales grupos funcionales a los que pertenecen.4 2.000 Monocotiledoneas 65.000 Filum Hepatophyta (plantas 6.000–40.800 y Enchytraeidae) Clase Hirudinea (sanguijuelas) 500 45.Tabla 1.000 Filum Annelidad (lombrices segmentadas) Clase Polychaeta 9.000 Clase Oligochaeta(lombrices de tierra 8.000 Reino Plantae [12 fila] Filum Bryophyta (musgos) 10.000 cochinillas) Filum Mandibulata (Artropoda) Grupo funcionalb 1 1 1 1 1 1 1 1 1 2.000 hepáticas) Filum Filicinophyta (helechos) 12.000 Clase Gastropodad (incluye babosas y caracoles) 18.000 Filum Cycadophyta (gimnospermas) 185 Filum Coniferophyta (gimnospermas) 550 Filum Gnetophyta 70 Filum Anthophyta (angiospermas) 235.000 Filum Mollusca 35.000 >10 millones Reino Animalia [37 fila] 750 Filum Tardigradad (osos de agua) d 99.4 muy raro en el suelo 3. 4 4 común localmente 5 - 30 Manual de biología de suelos tropicales .

9 2. 9 2. 4. 115. 4 2. 6. 6 2.1 Continúa.000 Orden Collembola (colémbolos) 7.000 Orden Dermaptera (tijerillas) 1. 4.500 Orden Diplura (doble cola) 659 Orden Protura 500 Subfilum Myriapoda (milpiés y 15. 9 4. abejorros) Familia Formicidae (hormigas) 11.000 langostas) Orden Thysanoptera (trips) 6. pulgones.000 gegenes. 4. 6 4. 9 3.9 Sólo en la rivera 4. 23. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Subfilum Hexapoda (Insectos) >900. 6 2.000 Clase Chilopoda (ciempiés) 2.162 ciempiés) Clase Diplopoda (milpiés) 10.500 Clase Symphyla 200 Clase Pauropoda 700 El Grupo funcionalb 4 4. 9 6 2.000 etc.000 Suborden Homoptera (cigarras. 9 2. 9 2. 6. 7 4. >125. mosquitos. 9 2.800 Orden Orthoptera (saltamontes.000 Orden Archaeognatha (pececillos de 350 cobre ó bristetails) Orden Thysanura 700 Orden Blattoptera (cucarachas) 4.000 abejas.) Orden Trichoptera 12.000 Orden Coleoptera (escarabajos) >350.000 Orden Diptera (moscas. afidos.826 Orden Lepidoptera (mariposas.000 quitos. 7 31 inventario de la biodiversidad biológica del suelo .Tabla 1. mosquitos pequeños) Orden Hymenoptera (hormigas. polillas. escamas) Suborden Heteroptera 25. 3. peri55. avispas. 7. grillos. 9 2.6 4 2. 7 2.000 Orden Isoptera (termitas) 2.800 Orden Hemiptera (chinches) >80. 180.

lom15.000 briz redonda.235 (Pseudoescorpiones) Orden Araneae (arañas) 40. 6.000 Filum Discomitochondria (flagelados 800 y zooflagelados) 10. 7 1 5. 6. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos critas en el taxón (todos de organismos de suelo/nombre los hábitats) común Subfilum Cheliceratad [3 clases] >100.1 Continúa. 7. 9 6 6 6 7 Parásitos artrópodos 4.000 Clase Arachnida [11 órdenes] 93.000 Orden Pseudoscorpionida 3. lombrices enterobius.7 7 1.100 Grupo funcionalb 6 2.6 7 1.000 Order Scorpionida (escorpiones) 2000 400 Filum Gastrotrichad (gastrotricha) d 1000 Filum Acanthocephala (lombrices con cabeza espinuda) 2000 Filum Rotiferad (animales de ruedas) 900 Filum Nemertinad (gusanos planos) Filum Nematoda (nematodos. alfilerillos) 25. garrapatas) 45. 9 2. 7.000 Filum Diatomacead (diátomos) Filum Oomycota (Oomycetes) Cientos Filum Rhodophyta (alga roja) 4. 9 1 32 Manual de biología de suelos tropicales .000 Filum Plathyheminthesd (Helmintos. incluidas planarias) Número sin Reino Protoctistac [30 fila] determinar Filum Rhizopoda (amibas) Número sin determinar 4000 Filum Dinomastigotad (dinoflagelados) Filum Ciliophora (ciliados) 10. 7 Muy raros en suelo 2. 4.455 Orden Palpigradi (micro-escorpiones) 80 Orden Acari (ácaros.Tabla 1.

nih.250 >30. Procariotas (Dominio Archaea y Bacteria). 9. de acuerdo con Woese et al. sin cultivo y no especificados.500 1. filum.. 8. cuando éstos se incluyen. 8 10 1. desde el más bajo hasta el más alto nivel: dominio.000 >70.000 1. excluyendo organismos no clasificados. e) Rappé y Giovannoni (2003). 8 5. clase.000 >344f >8. Reinos de Eucariotas clasificadas de acuerdo con Margulis y Schwartz. Kibblewhite et al. b) Grupos funcionales.1 Continúa. (1990). 1998. 1997. reino. 5. consultado el 13 de mayo de 2007). 2006.2 (de este capítulo).000 1. respectivamente. (2006). Hongos de acuerdo con James et al.gov. 1996. Categorías taxonómicasa (número total de fila existentes) ejemplos de organismos de suelo/nombre común Filum Chlorophyta (alga verde) Reino Fungi [6 fila] Filum Microsporídia Filum Chytridiomycota (Hongos quitridios) Filum Zygomycota (mohos) Filum Glomeromycota (hongos micorrízicos arbusculares) Filum Basidiomycota (incluidos hongos y algunas levaduras) Filum Ascomycota (incluidas levaduras) Dominio Archaead [4 fila] Dominio Bacteriad [52 fila]e Número de especies des. Dichos procesos pueden ser agrupados de acuerdo a cuatro funciones agregadas del ecosistema: El inventario de la biodiversidad biológica del suelo 33 . 2008). género y especies..342. 8 5.9 5 5. f) National Center for Biotechnology Information: (www.. familia. Brussard et al. buyendo al mantenimiento y a la productividad de los mismos.. Fuente: Moreira et al. c) Considerados por algunos autores como Protistas o Protozoos y Chromistas.Tabla 1. Clasificación. orden.ncbi.nlm. por su influencia en la calidad y salud del suelo (Hoavelle. la riqueza correspondiente arrojará 3090 y 79.100 204 >22.398f 1 sólo parásitos 5. 10 Nota: a) Considerando las categorías taxonómicas.Grupo funcionalb critas en el taxón (todos los hábitats) 16. de acuerdo con la Tabla 1. d) Incluye organismos acuáticos y del suelo.

y dispersan los propágulos microbianos. mediante la formación de asociaciones simbióticas como las micorrizas y la fijación de N2 en nódulos de raíces. La descomposición de materia orgánica. el paso que marca la operación del proceso se determina mediante micropredadores. Juntos. por la biota del suelo. lo que controla el resto de la biota. Estos procesos de “bioturbación” influyen y determinan la estructura física del suelo y la distribución de materia orgánica del suelo. se mantienen físicamente activos dentro del suelo formando canales. Estas fracciones de MOS varían en su estabilidad y longevidad. crean y modifican microhábitats para otros organismos más pequeños y determinan propiedades del suelo como aireación. drenaje. Animales más grandes mejoran algunos procesos porque proveen nichos para un crecimiento microbiano dentro de sus intestinos o excremento. lombrices de tierra y termitas. principalmente como CO2 o CH4. agregados y montículos. colémbolos y ácaros. 3. Las raíces de plantas. Como resultado de la descomposición. Ciclo de nutrientes. Así. hormigas y algunos otros de la macrofauna del suelo. estos grupos son afectados indirectamente por factores como el contenido de agua. los microorganismos y los animales involucrados se llaman “descomponedores”. aunque el atributo “transformadores de hojarasca” es el más utilizado hoy en día para describirlos. estabilidad del suelo. El ciclo de nutrientes. pero también es incorporado en diferentes reservorios en forma de materia orgánica (MOS). porosidad y contenido de carbono. en gran parte realizada por animales del suelo como ácaros. sin embargo. estrechamente asociado con la descomposición orgánica. estabilidad de agregados 34 Manual de biología de suelos tropicales . aunque en un tipo de suelo y medioambiente determinados existe un equilibrio entre el contenido del MOS y las entradas y salidas de carbono en el sistema. tales como protoctistas. es decir. es esencial para todo tipo de agricultura y silvicultura. milpiés. el carbono orgánico es liberado en la atmósfera. que ocurre principalmente por actividad enzimática de bacterias y hongos. nematodos. Bioturbación. Aquí también los microorganismos son mediadores de la mayor parte de las transformaciones. lombrices de tierra. que no dependen directamente de la materia orgánica como fuente de alimento. sin embargo. los cuales trituran los residuos de plantas y animales. y moviendo partículas de un horizonte a otro. 2. siempre que no se incluya a los ingenieros del ecosistema (véase más abajo). Algunos grupos de bacterias del suelo están involucrados en transformaciones elementales autotróficas. Microorganismos específicos del suelo también incrementan la cantidad y eficiencia de absorción de nutrientes por la vegetación.1. termitas. poros.

La estructura y las propiedades del suelo también están influenciadas por la producción de excretas de animales. En ecosistemas naturales. Grupos funcionales de la biota del suelo En principio. La biota del suelo incluye un amplio rango de virus. capacidad de almacenaje y drenaje) y tiene una fuerte influencia sobre la susceptibilidad a la erosión. basándose en la función particular que desempeñan o en el proceso específico del suelo del que son mediadores. respectivamente. por tanto. Enfermedades y control de plagas. bioturbación y ciclo de nutrientes determinará el equilibrio entre la cantidad de carbono secuestrado en el suelo (véase arriba) y entre las emisiones de gases invernadero (principalmente CO2.. 1997). Los organismos del suelo juegan un papel importante en la regulación de la composición atmosférica y. Especialmente. Lavelle et al. 1997).y capacidad de retención de agua. y también una amplia variedad de interacciones antagonistas microbianas. incluyendo complejos organominerales estables durante meses o periodos más largos (Lavelle et al. que incluyen microbívoros y micropredadores que se alimentan de las plagas microbianas y de animales. y hasta humanos. brotes intensivos de enfermedades en el suelo y plagas. En los agroecosistemas.1 muestra la contribución de la biota del suelo a servicios ambientales. Jones et al. por lo tanto. 1994. este rango de interacciones puede encontrarse reducido. pueden ser asignados dentro de una o más de las cuatro categorías funcionales genéricas descritas. todos los organismos enlistados. debe hacerse notar que la interacción entre la descomposición de materia orgánica. las actividades de plagas potenciales y patógenas son reguladas por interacciones con otros miembros de la biota del suelo. 4.. A este conjunto de organismos. hongos y animales invertebrados capaces de invadir plantas y animales. como miembros de la comunidad del suelo. se le ha denominado “ingenieros del ecosistema del suelo” (Stork y Eggleton. En suelos saludables. N2O). debido a una diversidad biológica disminuida y/o en cambios ambientales del suelo. Para poder interrelacionar El inventario de la biodiversidad biológica del suelo 35 . tales como los causados por un contenido de MOS más bajo. bacterias. en el cambio climático. 1992.. como resultado de los procesos anteriores. pero tales epidemias sí son comunes en la agricultura. La Figura 1. La bioturbación juega un importante papel en la regulación del equilibrio del agua en el suelo (infiltración. son relativamente raros. CH4. NOX. y de causar enfermedades y muerte.

Mantenimiento de estructura del suelo 2. Transformaciones C Ensamblaje funcional Descomponedores: Hongos Bacterias Microherbívoros Detrívoros Procesos de entrega basados en el suelo Mantenimiento de la estructura del suelo Ciclaje de nutrientes Mantenimiento de la estructura del suelo Dinámica de la MOS Descomposición Ciclaje de nutrientes Regulación de población biológica Provisión de hábitat Regulación de población biológica 4. Regulación de la población biológica 3.36 Funciones agregadas del ecosistema 1.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. Fuente: Kibblewhite et al. 2008 Servicios agrícolas Procesos de entrega basados en el suelo Alimentos y fibras Captura y ciclaje de nutrientes Descomposición de la MO adicionada Dinámica de MOS Mantenimiento de la estructura del suelo Regulación de la población biológica Manual de biología de suelos tropicales Servicios no agrícolas Calidad y suministro de agua Control de erosión Regulación de la composición atmosférica y del clima Degradación y disminución de contaminantes Control de enfermedades y plagas no agrícolas Conservación de la biodiversidad . Ciclaje de nutrientes Transformadores de nutrientes: Descomponedores Transformadores de elementos Fijadores de nitrógeno Micorrizas Ingenieros del ecosistema: Megafauna Macrofauna Hongos Bacteria Biocontroladores: Predadores Microherbívoros Hiperparásitos Figura 1..

2. El inventario de la biodiversidad biológica del suelo 37 . 8. translocando compuestos orgánicos sintetizados arriba del suelo.organismos específicos del suelo (biodiversidad colectiva) con las categorías genéricas funcionales y. 4. haciéndolo más accesible para los descomponedores o favoreciendo el crecimiento microbiano de excretas en forma de gránulos. también de acuerdo con sus características taxonómicas. de alguna manera. el Tabla 1. Ingenieros del ecosistema (macrofauna como termitas y lombrices de tierra): organismos que causan un impacto físico mayor en el suelo mediante su transporte. descomponedores y microrreguladores por depredación.2 Principales grupos funcionales de la biota del suelo. Productores primarios (plantas superiores e inferiores): organismos fotosintéticos que asimilan bióxido de carbono del aire y penetran en el suelo mediante sistemas de raíces. Transformadoras de hojarasca (mucha macrofauna y mesofauna. Pueden incluir predadores. ingenieros del ecosistema. Esta actividad puede ocurrir a varias escalas espaciales. 6. morfológica. normalmente definido por criterio trófico (Brussaard. transformadores de hojarasca. que incluyen minadores de hojas y de tallos. 5. incluyendo el ciclaje de nutrientes. de comportamiento bioquímico o ambiental y. rizobia): microorganismos asociados con raíces que facilitan la absorción de nutrientes. No existe acuerdo preciso en la definición de grupos funcionales. por ejemplo. 1998) es necesario tomar en cuenta el concepto de grupos funcionales básicos. 3. con los servicios del ecosistema (Setäla et al. por lo tanto. Predadores (mucha macrofauna y mesofauna): animales que regulan a los herbívoros. en última instancia. y chupadores de sabia. Microrreguladores (microfauna como nemátodos): animales que regulan ciclos de nutrientes mediante forrajeo y otras interacciones con los microorganismos descomponedores. Microsimbiontes (hongos micorrícicos. alguna microfauna): invertebrados que se alimentan de desechos orgánicos originados por microbios y por trituradores de este material. Herbívoros: animales que consumen y parcialmente digieren tejidos vivientes de plantas. 7. 1. 1998) pero también calificado en función de la respuesta fisiológica. muchas hormigas. construcción de estructuras agregadas y formación de poros.. Descomponedores (hongos o bacterias degradadores de la celulosa): microorganismos que poseen las enzimas polímero-degradadoras. y que son los responsables de la mayor parte del flujo de energía en la red alimenticia de los descomponedores. ni de cuántos de estos grupos deberán definirse dentro de un ambiente de suelo típico.

Éstas están representadas formalmente en la Tabla 1. probablemente se relaciona con su abundancia relativa y con la biomasa. enlistadas en la Tabla 1. cuyos métodos de inventario y caracterización se describen en los siguientes capítulos.2 y se usan para anotar las categorías taxonómicas. plagas) especies de control biológico también pueden incluirse (ej. existe un argumento válido que establece por lo menos diez categorías. no relacionados. también es importante buscar dentro de los grupos funcionales para descubrir los taxa que alcancen el criterio de ser considerados como ingenieros del ecosistema (sensu Jones et al. (razón por la cual se emplea el término “taxa seleccionado”) y por su facilidad relativa a ser muestreado. no obstante. La importancia funcional de cualquier especie o de grupos de especies. invertebrados. en donde el espectro taxonómico completo ha sido objeto de un muestreo representativo en el mismo lugar y al mismo tiempo (Bignell et al. Los grupos taxonómicos propuestos a continuación son seleccionados de acuerdo con su significado funcional diverso. existen pocos estudios sobre la salud del suelo agrícola. 2003).: depredadores. Por esta razón y porque muchos componentes de biota de suelo son taxonómicamente difíciles de identificar. no obstante. 9. S o P (nitrificación y fijación de nitrógeno). 38 Manual de biología de suelos tropicales . Plagas y enfermedades del suelo (hongos patógenos. uno de los principales desafíos es seleccionar un subgrupo de la biota del suelo que refleje adecuadamente el espectro taxonómico anticipado y que. 2005). concepto es heurístico y puede modificarse en función del propósito analítico necesario.. aislado e identificado (Figura 1.2 Continúa. 1994) y especies clave (sensu Davic. 10. Éstos son grupos taxonómicos que fueron tomados en cuenta en el proyecto Conservation and Sustainable Management of Below-Ground Biodiversity (CSM-BGBD). a veces.Tabla 1. mientras que otros son muy específicos en cuanto a su taxonomía. Grupos selectivos de biota de suelo En el diseño de trabajo de campo. parasitoides e hiperparásitos de plagas y enfermedades)..2). Transformadores procariontes: Archaea y bacterias que transforman de manera específica el carbono (metanotrofa) o elementos nutricionales como N. al mismo tiempo. Véase que algunos grupos funcionales incluyen una amplia gama de taxa relacionados y. incluya todos los grupos funcionales considerados como importantes. en cuanto a la fertilidad y calidad del suelo.1.

Por su parte. promotores de crecimiento Nota: la fauna se clasifica de acuerdo con el ancho de cuerpo: macrofauna >2. especialmente protoctistas Archaea y Bacteria El inventario de la biodiversidad biológica del suelo 39 .MACROFAUNA Lombrices de tierra I Escarabajos Otros Hormigas Termitas Diversidad y biomasa alta Diversidad alta Ingenieros del ecosistema. macropredadores ANIMALES. un grupo que incluye muchos organismos con papeles especiales y una diversidad de descomponedores genéricos MICROBIOTA GENERAL Microfauna.0 mm. tamaños y procesos de ecosistemas ANIMALES. trituradores de hojarasca. patogénos y antagonistas IV Omnipresentes con diversidad alta indeterminada Descomponedores. parásitos de Micropredadores. nematodos y protoctistas pueden considerarse como componentes de la microbiota general. y microfauna <0.1 mm.0 mm. estudiados en el proyecto CSM-BGBD.Figura 1.transformadores de hojarasca plantas HONGOS Y BACTERIAS MUTUALISTAS Hongos micorrizógenos Bacterias formadoras de nódulos en leguminosas Omnipresentes con especificaciones típicas de variedad de hospederos (a varios grados) III Omnipresentes Microsimbiontes mejoran la absorción por la raíz y la fijación de nitrógeno Hongos saprotróficos. trituradores de hojarasca.2 Principales grupos funcionales.MICROFAUNA Y MESOFAUNA Nematodos Ácaros Colémbolos Otros Biomasa alta II Alta diversidad y biomasa Micropredadores. clasificados de acuerdo con dominios y reinos. transformadores procarióticos. patógenos. antagonistas. transformadores de hojarasca.1-2. mesofauna 0.

Además. varios de estos grupos taxonómicos son muy importantes por sí mismos como contribuidores a la diversidad biótica en general. ácaros. y la pérdida de especies endémicas. 5 Microfauna: nematodos y protoctistas que. también actúan como reguladores de las poblaciones de biota del suelo. a escala pequeña. Algunas especies también resultan perjudiciales porque se convierten en plaga. arañas. Los grupos incluidos en la selección son: 1 Macrofauna: lombrices de tierra. por ejemplo. nematodos y. al cavar sus túneles y mediante la ingestión de materia mineral y orgánica. probablemente. al compararse con otros grupos taxonómicos superiores (Tabla 1. hormigas y escarabajos que intervienen en: a) la porosidad y la textura del suelo. la distribución geográfica. protoctistas. 4 Mesofauna: colémbolos y ácaros que actúan como transformadores de hojarasca y micropredadores (forrajeros de hongos. b) ocupan espacios que existen en pequeños poros. microfauna y microsimbiontes. omnívoros y depredadores. 2 Macrofauna: termitas. En este contexto. 3 Otra macrofauna: cochinillas (Isópoda). de la mesofauna. mediante el transporte. milpiés (Diplópoda) y otros tipos de larvas de insectos que actúan como transformadores de hojarasca con una importante acción trituradora sobre el tejido de plantas muertas y sus depredadores (ciempiés. la introducción de especies exóticas e invasivas. Enchytraeidae. Algunas especies de ácaros y formas de larvas de muchos artrópodos de suelo son lo suficientemente pequeñas como para clasificarse dentro de la microfauna. c) el control biológico como depredadores. lombrices de tierra. a) influyen en la tasa de recambio por su papel como forrajeros de raíces (parásitos de plantas). micófagos. la trituración y digestión de materia orgánica. también representan factores de interés y preocupación. que intervienen en la porosidad del suelo y en sus nutrientes. arácnidos grandes y otros tipos de insectos). hormigas. c) normalmente representan una riqueza genérica y de especies muy alta d) juegan un papel importante en la regulación de abundancia y actividad microbiana. bacteriófagos. b) el ciclo de nutrientes. escarabajos. por ejemplo. todos ellos conforman un gran número de especies. e) 40 Manual de biología de suelos tropicales . bacterias y depredadores de otros animales del suelo). en los que viven dependientes de películas de agua. de esta manera contribuyen en procesos orgánicos de trituración a pequeña escala y ejercen un importante papel regulatorio dentro de la biota del suelo. al construir galerías y al cavar túneles e ingerir suelo.1).

7 Bacterias formadoras de nódulos en leguminosas y. Los métodos empleados para la extracción de diferentes grupos de organismos del suelo también son muy diferentes de un grupo a otro. requieren de un enfoque selectivo para llevar a cabo un inventario de la biodiversidad bajo suelo. en NH3.2). otros fijadores de nitrógeno microsimbiontes que transforman el nitrógeno atmosférico N2. que es asimilable para las plantas. composición funcional (la naturaleza de los grupos funcionales) y ocurrencia e intensidad de los procesos ecológicos. por ejemplo. aunados a la inmensa escala de diversidad encontrada en el suelo. que dependen de grupos funcionales. sean los más vulnerables ante situaciones de estrés y perturbación que afectan a dichos grupos funcionales. bacterias involucradas con el compuesto El inventario de la biodiversidad biológica del suelo 41 . entre bacterias. Aún sigue siendo una pregunta sin respuesta la relación existente entre diversidad de especies. lo anterior aplica para los trituradores de materia orgánica (véase transformadores de hojarasca en Tabla 1. rotación de carbono orgánico en descomposición. de esta manera. y contribuyen al potencial control biológico de plagas y enfermedades. representan un importante control biológico. la mayoría de las especies aún son desconocidas. reducen ataques patógenos en plantas y mejoran la tolerancia al estrés del medio ambiente. 6 Hongos micorrizógenos arbusculares: se asocian con las raíces de las plantas y mejoran la disponibilidad de nutrientes. diversidad funcional (el número de grupos funcionales). En los casos de Archaea y bacteria. el concepto de especies también es muy variable. en ocasiones. En la biota del suelo.como insectos patógenos. y enfermedades de las plantas. Hasta donde se conoce. 8 Hongos fitopatógenos. Se espera que los servicios de ecosistema. Estos factores. hongos y animales invertebrados. saprotróficos y antagonistas: que determinan o median (en diferentes casos) la viabilidad de cultivos. compuestos por relativamente pocas especies y/o especies altamente especializadas. En muchos Fila. utilizando el concepto de grupos funcionales clave como los descritos anteriormente. la caracterización molecular y bioquímica reemplaza al enfoque de identificación tradicional. bacterias que nitrifican y denitrifican (como parte de los transformadores procariotas). Métodos para inventario de la biodiversidad bajo suelo: principios generales La metodología actual no permite la identificación de todas las especies en el suelo.

Los métodos estándar son necesarios para describir los ecosistemas de manera consistente. Por lo tanto. Esto debería servir como respuesta a un gran número de preguntas en contextos similares. y en relación con que “especies clave (si existen) en los grupos funcionales?. centrándose en los grupos funcionales que permitan la evaluación de la diversidad. las consecuencias pueden ser negativas. En el prefacio se plantea una breve descripción del proyecto. lo que exige un alto nivel de conocimientos taxonómicos. de manera que sea posible evaluar. cobre y azufre quimiolitotrofos. Los métodos han sido desarrollados. para su aplicación en paisajes con diferentes usos de suelo. preguntas como las anteriores deberían ser consideradas en la definición del propósito del objetivo de la investigación de la biodiversidad bajo suelo. deforestación. Este manual aborda métodos para el inventario y caracterización de la biodiversidad del suelo. abundancia y composición de las especies. el impacto que provoca la intensificación agrícola. hongos micorrizogenos (entre los microsimbiontes) y bioturbadores (ingenieros del ecosistema). que para algunos grupos y en algunos países es un desafío importante. especialmente. aunque se dan referencias de claves para la identificación de especies de varios grupos funcionales.C1 y en las transformaciones de hidrógeno (metanogénicas y metilotróficas). la fragmentación de hábitat y el manejo de cultivos en la diversidad biológica del suelo. En este manual no se abordan problemas taxonómicos. escogidos y modificados. puesto que se reflejarán en los métodos a utilizarse. La evaluación de la composición de la comunidad biótica depende de la identificación de los especímenes recolectados. Si éste es el caso. cuando se adopta el concepto de los grupos funcionales principales. para el cual se han desarrollado y probado los métodos. Inventario de biodiversidad bajo suelo en escalas de espacio y tiempo Cambio de uso de suelo como la causa principal del cambio de diversidad biológica del suelo Un inventario puede demostrar si la biota del suelo responde a intervenciones humanas como prácticas agrícolas. contaminación y cambio climático. esto conlleva a una serie de interrogantes como ¿cuál es el número mínimo de especies dentro de los grupos funcionales que garanticen la resistencia del suelo contra el estrés del ecosistema natural y antropogénico. en términos de una dis42 Manual de biología de suelos tropicales . hierro. por ejemplo.

debido a cambios en la fertilidad del suelo y/o incrementos de enfermedades en el mismo. El mantenimiento de una variedad de cultivos y otras plantas es aceptado como una práctica que protege al agricultor contra los riesgos a corto plazo. la biodiversidad arriba del suelo se verá reducida. 2008). en la medida de lo posible.minución de los servicios del ecosistema. Este hecho puede considerarse tanto a nivel de campo como de paisaje. para mejorar la complejidad estructural y diversidad funcional. si se acompaña de la extinción de especies individuales. en la medida que proceda la intensificación. los procesos de disturbio -y recuperación. especialmente en suelos degradados. tales como cultivo mecánico. muchas veces enlazadas entre sí. incluso puede producirse la pérdida de la productividad primaria. por ende. Para qué muestrear. debería reflejar un consenso de la teoría ecológica y del pensamiento actual sobre estructuras de la comunidad en diferentes escalas espaciales y temporales. la complejidad de los agroecosistemas ha sido drásticamente reducida. Una solución alternativa sería intensificar y. especialmente. retener una buena cantidad de diversidad sobre el suelo. puede causar pérdidas de función y reducir la habilidad de los sistemas agrícolas para soportar periodos inesperados de estrés. El suministro global de alimentos depende de la agricultura intensiva. de los que puedan realizar las funciones biológicas esenciales.. la biodiversidad y complejidad arriba del suelo favorecen el restablecimiento o protección de la diversidad de organismos bajo suelo. a pesar de que la producción se ha intensificado. varias frecuencias). al mismo tiempo. El principio central es que el significado funcional de la diversidad biológica cambia de acuerdo con las escalas de El inventario de la biodiversidad biológica del suelo 43 . Dichas funciones regulatorias frecuentemente se describen como “sustitutos” por insumos. Sin embargo. produciendo efectos indeseables. un gran número de agricultores tienen acceso limitado a insumos. lo cual implica una reducción de la biodiversidad bajo suelo y. En los trópicos.que afectan la biodiversidad bajo suelo. pérdida del potencial para la limpieza de los residuos y contaminantes. fertilizantes químicos y pesticidas (Kibblewite et al. también se manifiestan en diferentes escalas espaciales y temporales (por ejemplo. interrupción de los ciclos elementales globales y respuesta ante los efectos de los gases invernadero y de la erosión. dónde y cuándo Aunque éste es un manual de instrucción práctica. escalas que determinan la predicción de servicios ecosistémicos. además. la regulación biológica de los servicios de ecosistema basados en el suelo. Se presume que de esa forma se reducirá la diversidad bajo suelo y que.

esto quiere decir qué se mide. con el propósito de lograr lo anterior. en número y diversidad de lombrices de tierra al moverse de un lugar a otro. Las escalas temporales son importantes en los procesos de degradación. entonces. Lavelle et al. probablemente es cuestión de saber cuáles microorganismos existen en cada una. la erosión de finas partículas de suelo y la reducción al mínimo de materia orgánica compleja que. mientras que en el caso de la zona de uso de suelo. incluso. destruir la capacidad productiva. en caso de rehabilitación. dónde y cuándo se mide. Asimismo. puede quedarse corto en relación con el propósito de evaluación de la diversidad de toda el área. del campo hacia setos que delimitan el terreno. mientras se mantuviera en un paisaje mixto. si uno o más grupos funcionales importantes estuvieran ausentes o permanecieran en baja presencia en una de las localidades o si el ecosistema original de bosque se hubiera reducido a una presencia mínima en uno de los lugares. 2004). El objetivo debería ser reducir la variabilidad intragrupo y maximizar la variabilidad entre grupos. o bien. se pensaría que el material parental y el clima fueran los factores determinantes en el proceso de formación del suelo. 2002. Por ejemplo. El mayor reto. De la misma manera. a los servicios del ecosistema en diferentes tipos de comparaciones. constituye uno de los servicios del ecosistema que integra procesos en todas las escalas. Esto quiere decir que. En términos generales. espaciales y temporales. por ejemplo. el inventario de especies de lombrices de tierra. no obstante. los ciclos de vida de diferentes 44 Manual de biología de suelos tropicales . si el objetivo del inventario es conservar la biodiversidad bajo suelo.. La formación del suelo. en última instancia podría. los materiales parentales y los suelos serán los principales determinantes de todos los servicios del ecosistema a nivel paisaje. la pérdida progresiva de macroporos. como se podría esperar. los números o diversidad pueden mantenerse estables. en un mismo paisaje. o bien. a la existencia de termitas o cualquier otro ingeniero del ecosistema que haya presentado mayor actividad en un lugar que en otro. puede haber una influencia biótica significativa. tomando en cuenta los aspectos de la biodiversidad que puedan afectar. Entre dos paisajes o dos regiones. El clima. a escala regional. en otro lugar. es cómo definir estos “grupos” en relación con niveles de escala.espacio y tiempo (Swift et al. de manera general. al punto de llegar a hacerla ser irrecuperable. que combina estos elementos dentro de un sistema de uso de suelo.. pero en el caso de dos campos colindantes. puede que se deba al drenaje o manejo previo del lugar. se puede esperar una variación grande. en un lugar específico. la diferencia que puede ocurrir en la descomposición o la fijación de nitrógeno simbiótico entre dos paladas de suelo del mismo campo.

tamaño y forma de estos gradientes y fragmentaciones. comparado con los efectos que produce la vegetación misma.3 muestra un resumen de niveles jerárquicos modificados a partir de los propuestos por Lavelle et al. como puede ser dentro de los bosques). (2006). también será diferente de un organismo a otro. ampliamente discutidos. como se indica más adelante. No obstante. al igual que los procesos de cambio relacionados. deberá capturar la distribución. En el nivel más alto. El patrón de uso de suelo superpuesto en función de dichos efectos de clima. mientras que las fecundidades también varían y. al igual que en los protocolos de medición. 1. El impacto en el diseño de muestreo. será un determinante más de dicho nivel. también tendrán una importante influencia en la biodiversidad. A nivel paisaje es difícil evaluar el efecto de la biodiversidad bajo suelo sobre algunos servicios del ecosistema. La Tabla 1. la distribución espacial de la biodiversidad bajo suelo estará fuertemente influenciada por los gradientes de altitud y temperatura. Paisaje. incluyendo el descubrimiento de especies invasivas exóticas es. como calidad y suministro de agua o control de erosión y no parece que éste juegue un papel importante. de gran relevancia en ese nivel. La protección y conservación de los principales agroecosistemas y hábitats representa la mejor El inventario de la biodiversidad biológica del suelo 45 . más útil como indicador de la respuesta del suelo al manejo. el tiempo requerido para que una población creciente alcance un tamaño crítico mínimo donde es autosuficiente. en el caso del ecosistema de suelo y sedimentos (Wall. por lo tanto. Los principales conceptos teóricos que corresponden a estos criterios son: apertura y conectividad. 2004). en este caso. cada proyecto necesitará determinar su propia escala en función de sus objetivos. vegetación y tipo de suelo. Los cuatro niveles de escala espacial en muestreo. se enfatiza en el capítulo 2 de este manual. que afectan a la biodiversidad bajo suelo (y servicios ambientales asociados) y el componente de la biodiversidad bajo suelo. geología. por los gradientes o transiciones de las condiciones de humedad o por los gradientes de las propiedades del suelo. a escala de paisaje. El inventario de biodiversidad bajo suelo. para explicar las posibles variaciones en la biodiversidad bajo suelo. La biodiversidad bajo suelo.taxa de biota varían de horas a años y pueden incorporar estados obligados de inactividad. Las características espaciales de la distribución de uso de suelo (“parches” de uso de suelo. son usados en el proyecto CSM-BGBD (véase prefacio) y están considerados como ejemplo. derivados de la base mineral y vegetal.

. cuando se trata de agrosilvicultura. En este nivel. también lo es la abundancia de especies relativas. Las áreas de uso de suelo se definen en función de su uso y régimen de manejo (Huising. 2006 y Tittonell et al. la estructura comunitaria y sus interacciones son reguladas por la arquitectura del suelo del lugar en específico (Lavelle et al.opción para dicha intervención. incluyendo a las raíces de suelo.. Las interacciones laterales son componentes muy importantes para la biodiversidad bajo suelo. por ejemplo. si no es demasiado grande. una combinación específica de tipos de cobertura. Estas áreas muestran. tramos de bosque y otros elementos de manejo de paisajes. La escala de tiempo de estos procesos (cambio de la composición de uso de suelo y configuración de paisaje) para ser observable necesitaría de varios o. respecto al cambio de uso de suelo. A este nivel. describen los gradientes de la fertilidad del suelo en función de los recursos destinados al terreno. Cambios en la arquitectura del suelo. Parcela o parche. tal es el caso de un área con plantaciones comerciales de té o la caracterizada por la agricultura de autoconsumo. por lo tanto. aunque sean provocados por cambios en la composición funcional y actividad de los ingenieros del ecosistema o del arado del suelo. queda dentro de los dominios funcionales de los ingenieros del ecosistema. El terreno o parche. 2. sobre todo. 1993). la composición y actividades funcionales de la biota son de gran interés y. tendrán un 46 Manual de biología de suelos tropicales . que implican una pérdida de sus aportes e impactos. en el caso del inventario de biodiversidad bajo suelo. 2006). Los gradientes de las propiedades de suelo sí ocurren en este nivel. éste es el caso de algunos árboles donde ciertos organismos de suelo hacen uso de sus nichos. de manera que la relación entre el patrón de distribución espacial de la biota sobre el suelo con la de bajo suelo son particularmente interesantes. rompevientos.. son visibles en escalas de tiempo más cortas que pueden abarcar desde pocos años hasta varias décadas. incluso. 2007. La biodiversidad sobre el suelo se determina por la variedad de cultivos encontrados en el área y por los elementos vegetales asociados con barbechos. de cientos de años. 3. La intensificación de uso de suelo. típicamente. pero son asociados con el manejo. se asocia con la extracción de elementos vegetales como árboles. y para la manera en cómo funciona el sistema. Área de uso de suelo. normalmente. pertenecientes a varios niveles tróficos y grupos funcionales que gobiernan la estabilidad de redes alimenticias y la provisión de funciones de apoyo. los cambios relacionados con el uso y cobertura del suelo. Vanlauwe et al. A nivel de parcela. cercos vivos. es en este nivel donde la biodiversidad bajo suelo debería estudiarse de manera minuciosa.

Las “intervenciones” enlistadas en la Tabla 1.efecto sobre las interacciones tróficas y. pero un entendimiento de los procesos e interacciones es vital. reflejándose la dependencia de los organismos más pequeños en los ingenieros del suelo para el suministro de sus sustratos (véase Lavelle y Spain. principalmente. la inoculación con especies microbianas. dado que ésta es la unidad fundamental de la función del suelo. el grado de diversidad genética. por ende. 2001. para mayores detalles y terminología). El manejo de materia orgánica y el uso de agroquímicos causarán un mayor impacto en la estructura de la red alimenticia. La lista de intervenciones y mediciones correspondiente a la biodiversidad bajo suelo. composición funcional) pueden necesitar de varios años. drilósferas. los procesos involucrados. tienen escalas de tiempo relativamente cortas y mostrarán variaciones estacionales. pertenecientes a grupos funcionales definidos o a niveles tróficos dentro de la cadena alimenticia. no es necesariamente exhaustiva. sino más bien ilustrativa. Cualquier tipo de inoculación causará un impacto directo sobre la diversidad bajo suelo y.3 son parcialmente derivadas del concepto “el manejo jerárquico de la biota del suelo”. en la estructura de la red alimenticia. subparcela o microhabitat. Cambios estructurales en la comunidad biótica (conexiones en la cadena alimenticia. Éstos existen en la escala de los horizontes de suelo. también despiertan gran interés. 4. termitósferas. Tal intervención debería apoyarse en el inventario y la abundancia relativa de especies. dentro de los microorganismos. la introducción de depredadores para el control de una enfermedad en particular. Nicho. como en la cadena alimenticia. condicionados por los organismos de suelo en la producción de servicios de apoyo tales como mantenimiento de la estructura de suelo y la descomposición de materia orgánica introducida. por lo tanto. en relación con esto. Las opciones para intervenciones de manejo en una escala de subparcela son actualmente limitadas. El inventario de la biodiversidad biológica del suelo 47 . son segregados en los dominios funcionales: rizósferas. La redundancia funcional entre los transformadores primarios (especies o familias diferentes que cumplen una misma función). puede servir para corregir desequilibrios en la composición funcional o para mejorar algunas funciones en particular. del agregado individual y de la partícula individual. etc. la competencia y la eficiencia son de particular relevancia y.. Este nivel se refiere a los microhábitats que alojan a los microbios y a los componentes de la microfauna del sistema de suelo que los regulan. A nivel parcela. según lo describe Swift (1998).

Número de cla. 3–20 tipos de Intensificación Diversidad Área con uso de áreas de uso de de uso de suelo. de relevancia específica para la biodiversidad y mantenimiento de la provisión de servicios de ecosistema. cuenca mayor. procesos asociados de cambio y componentes relevantes de la biodiversidad. mancífico (depentenimiento de de especies y régimen de especialmente diente del nivel áreas de refugio manejo. Capa de nivel de agregación Paisaje Tipo de unidad Medida/ parámetro de biodiversidad Área caracterizada Sin especificar: Cambio de uso de Diversidad biopor un mosaico de tal vez.existiendo una superposición entre niveles de escala dentro de los parámetros a medir. varias suelo: protección lógica de suelo: uso de suelo y de por bioma o por de usos de suelo y especies exótiecosistemas como región dentro elementos de pai. unidades de referencia. saje.relacionada con diversidad arriba ingenieros de clasificación). funcional. parches de selva. de detalle de la biológicas y bio.3 Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. corredores biológicos. y prácticas de conservación del suelo. de un país. manejo ecosistemas: integrado de patrón de distrirecursos naturales bución espacial. Tabla 1.Proceso/ ses o unidades intervención Área de uso de suelo 48 Manual de biología de suelos tropicales .cas e invasoras. del suelo. suelo caracteríssuelo. dentro de degradación diversidad y tico y patrón de composición cobertura de suelo un paisaje espe. por ejemplo.de suelo.

Tabla 1.3 Continúa. que consisten en el uso oportuno de tiempo y recursos. Biomasa y actiManejo de vidad microbiabiota clave. o a nivel más alto o más bajo (por ejemplo. provee los siguientes datos e información. para lo cual se indican en los capítulos 3 y 9 los mejores métodos. materia orgánica. 10 a 100 por Área con un uso particular y mane. na. utilizando los métodos previstos en este manual. composición labranza mínima. selva. • Abundancia y biomasa de los grupos funcionales (GF). etc. Nicho Por ejemplo. los datos tendrán que ser acumulados en cada punto de muestreo. erosión. el inventario bajo suelo de la biodiversidad. Sin tomar en cuenta los objetivos específicos y el diseño experimental de cualquier estudio. Datos requeridos Los métodos expuestos en este manual. dentro mejoramiento de y entre grupos funcionales y sistemas de cultivo y manejo de niveles tróficos. campo agrícola. • Proporciones relativas de GF. cepas para microsimbiontes). • Abundancia (total) y biomasa (en el caso de animales) de taxa. por suelo. parcelas de vegetación. inoculación con microsimbiontes. parche Tipo de unidad Número de cla. de agentes de control biológico. inoculación. rizósfera. microhábitat horizontes de suelo. etc. proveen un gran número de parámetros para la evaluación de la biodiversidad bajo suelo. dependiendo del tipo de análisis realizado: En cuanto a la biodiversidad: • Riqueza taxonómica a nivel de especie. especies. Capa de nivel de agregación Parcela. El inventario de la biodiversidad biológica del suelo 49 . diversidad introducción genética.Proceso/ ses o unidades intervención Medida/ parámetro de biodiversidad Intensificación de Abundancia manejo de suelo y relativa de cultivos. Por regla general.área de uso de jo particular. drilósfera. ejemplo. funcional.

• Índices cuantitativos generales de riqueza y equitatividad. D. (2005) ‘Belowground diversity assessment: developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. Prácticas actuales de manejo de suelo y cultivos.. J. Pashanasi. V... 563–570.Ecology. Bignell. A. Washington DC. B. vol 7. M. Columbia University Press. y Virginia. S. L.. J. En cuanto al suelo. Hole. 1251–1262. (2004) ‘Only six kingdoms of life’. Vosti. T. R.. E. Historia precisa del uso de suelo desde su estado de selva no perturbada hasta otro tipo de vegetación pre-cultural. pp. Hattori. Huang. E. (ed) (1997) Nature’s Services. Geoderma. Klopatek. Moreira. pp. Cavalier-Smith. uso del suelo. Características de vegetación.. Fragoso. Conservation Ecology. response 11. Sanchez. pp. (2005) The Biology of Soil. in C. L. R. 203–266. New York. Soderstrøm. Brussaard. vol 73. A.Rusek. B. P. P. Malloch. intensidad de uso y cobertura de suelo: • • • • • • Cultivo aparente o uso de barbecho. Applied Soil.. (1981) ‘Effects of animals on soil’. F. Bignell.. (2003) ‘Linking keystone species and functional groups: A new operational definition of the keystone species concept’. vol 5. functional groups and ecosystem processes’. Susilo.. pp.. (1998) ‘Soil fauna. vol 9. T. D. Oxford University Press. P.. F. D. Huising. S. 123–135. P. pp. Daily. A. guilds. Behan-Pelletier. D.. R. J. Hawksworth. (1997) ‘Biodiversity and ecosystem functioning in soil’. Oxford.. Tondoh. C. vol 271. G. y Swift. Folgarait. Palm. D. P. Gupta.. C. Nwaga. vol 26. Dibog. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. Tiedje.. Referencias Bardgett. D.. Cavalier-Smith. Lavelle. V.. F.. D. Proceedings of the Royal Society of London Series B. Biological Reviews. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica.. (1998) ‘A revised six-kingdom system of life’. L... J. Promedio de datos climáticos y precipitación real hasta la fecha de muestra. A pattern recognition approach to land use inventory at the sub-regional scale 50 Manual de biología de suelos tropicales . Didden. C. 75–112.. Propiedades físicas y químicas básicas: pendiente y aspecto del suelo. W. issue 1. Freckman. T.. J.. Ambio. X. D. V. Davic. Brown. Brussaard. D. Island Press.

D. C. Y. y Shachak. G. J. N.. Freeman. Bignell. W. D. E. The Netherlands. Lawton. J. pp. M. W. (2001) Soil Ecology. E. S. T.. J. Hawkins. S. (1998) Five Kingdoms – An Illustrated Guide to the Phyla of Life on Earth. Ritz. vol 98. Mora. vol 42. E. Moreira. Higashi (eds) Biodiversity. Boulton. R. Bignell. P. vol 33. E. M. y Paul. Eggleton. Behan-Pelletier. D. M.. Longcore. y Swift.. 3rd edition. M.. S. K. y Brussaard. Lavelle. Spain. pp.. in D. Lawton. The Inventory of Soil Biological Diversity 15ES_HTSB_11-6 13/6/08 18:14 Page 15 European Journal of Soil Biology. Jones. V. Garey.. M.. pp. Abe. D. H. 72–76. Aubert. 860–871. Lavelle. M. P. Dordrecht Lavelle. Brown. J. B. Stork. P. an Ecological Perspective. W. J. A. M. J.. Blouin. S. E. S3–S15. European Journal of Soil Biology. L. P. Oikos. Porter. Lavelle. S. pp. A. P. M. G.. CAB International. vol 33. Powell.. M... Austen. V. y Watt.. O. Wall (ed) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. P.. P. G.. M. P. Roger. J.using remote sensing and GIS applying an object oriented and data-driven approach’. Thesis. P. y Rossi.. Larsen. P... V.D. F. H. Hammond. Mozley-Standridge.. Hodda. (1994) ‘Organisms as ecosystem engineers’. y Dillion. Mycologia.. D. St John. Levin y M. J-P... Mawdsley. 159–193.. (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems.pp. G. M. y Vilgalys. Heal. T. Brown... K. pp. H.Griffith. Hunt. H. Decaëns.. Washington.. Bignell. Philosophical Transactions of the Royal Society Series B. pp.. D.. D. J. (1996) ‘The role of species in ecosystems: Aspects of ecological complexity and biological diversity’. Kibblewhite. Island Press. P. indicator taxa and effects of habitat modification in tropical forest’. C. 685–701. vol 363. 373–386. Bureau. (1996) ‘Diversity of soil fauna and ecosystem function’.. Springer. P. N. F. M.. Lawton. Ineson. Ph. V.. vol 391. Biology International. Margulis. G.. DC Lavelle. Srivastava. Barot. y Schwartz. Letcher. A... R.vol 69. A. (1998) ‘Biodiversity inventories. S.. Siqueira.. (2006) ‘A molecular phylogeny of the flagellated fungi (Chytridiomycota) and a proposal for a new phylum (Blastocladiomycota)’. James. K. H.. H. (1997) ‘Soil function in a changing world: The role of invertebrate ecosystem engineers’. R. T. Giller. Bloemers. B. Kluwer Academic Publishers..J. E. Berlin. E. New York.. A. G. (2006) ‘Soil invertebrates and ecosystems services’. V.S. Margerie. El inventario de la biodiversidad biológica del suelo 51 . Wageningen Agricultural University. in T. 3–16. F. S. (2004) ‘Connecting soil and sediment biodiversity: The role of scale and implications for management’. W. (2008) ‘Soil health in agricultural systems’. Lepage. Volters. Holt. M. Wallingford. L.. P. Nature (Lond)..

vol 104. Blackwell. V. vol 76. SBCS/UFLA/DCS. (1979) Decomposition in Terrestrial Ecosystems. P. F. K. pp. Kandler. Vanlauwe B. N. O. y Wheelis. (ed) (2004) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. N. E.. 171–182. pp. y Giller. Heal. 376–390. Moreira. Applied Soil Ecology. M. J. y Anderson. Wall. pp. J. vol 94. Mikola. (1998) ‘Towards the second paradigm: Integrated biological management of soil’. S. pp. Tittonell. Carvalho (eds) Soil Fertility. M. L. (1992) ‘Invertebrates as determinants and indicators of soil quality’.. Woese. S. J. Proceedings of the National Academy of Sciences USA. Vanlauwe. vol 57. C. (2006) ‘Within-farm soil fertility gradients affect response of maize to fertilizer application in western Kenya’. vol 7. and Eucarya’. E. 4576–4579.. M. R. E. (2007) ‘Heterogeneity of crop productivity and resource use efficiency within smallholder Kenyan farms: Soil fertility gradients or management intensity gradients’.Rappé. Bacteria. S. inJ. W. y Eggleton. M. R. vol 87. J. M. Furtini Neto y J. Laakso. A. Guilherme. y Mukalama. de Ridder. H. Washington. J. N. (1990) ‘Towards a natural system of organisms: Proposal for the domains Archaea. Annual Review of Microbiology. (2003) ‘The uncultured microbial majority’. pp. Island Press. 23–32 Swift. B. Oxford. 369–394. 113–134. Agricultural systems. N. pp. 25–31.. Siqueira. vol 9.. G. G. Brazil. Izac. Lavras. pp.. A. P. J. D. A. O. pp. H. M.. Lopes. (2002) ‘Biodiversity and ecosystem services in agricultural landscapes – are we asking the right questions?’ Agriculture. 52 Manual de biología de suelos tropicales . Tittonell. M. M. Setäla. y Huhta. Swift. Faquin. V. y Van Noorwidjk. J. Ecosystems and Environment. y Giovannoni. Swift. Nutrient Cycling and Agroecosystems. S. O. M.. P. Stork. 11–24. (1998) ‘Functional diversity of decomposer organisms in relation to primary production’. J. American Journal of Alternative Agriculture. Soil Biology and Plant Nutrition interrelationships. L.

El problema de localizar los puntos de muestreo se presenta a diferentes escalas. Además. Ronald Zanetti. Southwood y Henderson. se necesita determinar en dónde va a estar localizado todo el estudio. Julio N. Huang (†) INTRODUCCIÓN Gran parte de este manual contiene instrucciones de cómo tomar mediciones una vez que se tiene un sitio de muestreo. Richard Coe. Moreira. Existe una larga tradición de muestreo en la ecología de campo y. En una primera escala. Francis-X. por tanto. una gran experiencia al respecto. que aplica en todos los casos (Cochran. también incluye cómo determinar la localización de estos sitios de muestreo: lo que se discutirá más abajo. Jeroen Huising. Entonces ¿para qué se necesita otro capítulo que discuta las técnicas de muestreo de la biodiversidad del suelo? A pesar de los conocimientos y experiencias en rela53 . La base del problema radica en el muestreo. se cuenta con una teoría de muestreo bien establecida. 1977). en un punto predeterminado del paisaje. En cuanto al argumento es más complicado que una mera elección al azar. en otra. el problema gira en torno a cómo escoger el número y localización de los puntos de muestreo en el paisaje en cuestión. es necesario escoger el lugar dónde se tomarán las muestras de suelo para los análisis químicos. Juvenil E. En algún punto entre estos dos. Hay numerosos textos que describen la teoría y su aplicación (ej. Cares. mismos que se describirán en los siguientes capítulos. 2007).Capítulo 2 Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo E. Fátima M. S. Gregoire y Valentine. se encuentra el problema de la elección de los sitios. Susilo. 2000. Louzada. Souleymane Konaté. Meine van Noordwijk y Shiou P. en los cuales se llevarán a cabo los protocolos de medición.

Muchos de los debates sobre los métodos apropiados de muestreo se deben a diferencias de opinión en cuanto a los objetivos exactos del estudio. Ford (2000) hace referencia a una amplia discusión de los objetivos de investigación en ecología. 54 Manual de biología de suelos tropicales . En este capítulo se describen algunas opciones para muestrear la biodiversidad del suelo y las ventajas o desventajas de los diferentes enfoques. (1989) lo explican con detalle en el contexto de muestreo ecológico. Son varias las razones para ello: 1 La aplicación de una teoría completa o de métodos tan extensivos como los utilizados en otros estudios. Sin embargo. 2 La aplicación de una teoría de muestreo puede requerir de información con la que no se cuenta hasta que los datos han sido colectados. Comúnmente hay malos entendidos de algunos de los principios básicos. pueden discrepar en lo referente al carácter práctico del estudio que está siendo diseñado. A continuación. debido al tiempo y al costo. en cualquier proyecto habrá desacuerdos y discusiones en cuanto a las estrategias de muestreo. el acceso a sitios de muestreo ideales puede ser restrictivo. OBJETIVOS DEL ESTUDIO Y BASES DEL MUESTREO La mayoría de los autores que escriben sobre diseños de investigación puntualizan que el diseño se determina en función de los objetivos. entonces esta variación es desconocida. Kenkel et al. 5 Los investigadores toman diferentes posturas filosóficas relacionadas con el enfoque de muestreo. el tamaño de muestra requerido depende de la variación entre las muestras. se presenta un ejemplo del enfoque utilizado en el proyecto CSM-BGBD. o qué es una réplica. Por ejemplo. tales como por qué el trabajo de muestreo debe ser de manera aleatoria. o bien. Por ejemplo. es posible que no sea fácil tomar tantas muestras como se desearía. entonces tratan de entenderlo” y aquéllos que “empiezan con una hipótesis y tratan de probarla”. están los que “Ven lo que está ahí. estos podrían no estar completamente desarrollados o los objetivos múltiples podrían sugerir diferentes enfoques para el muestreo. 3 Puede haber límites en cuanto a la teoría. Si datos similares no han sido colectados antes.ción con el tema. 4 Los objetivos del estudio determinan el diseño.

Si el objetivo del estudio es estimar la biomasa media de escarabajos en general. y luego diseñar un estudio cuyo objetivo específico sea probar estas hipótesis. Piense en un nicho raro en el paisaje (por ejemplo. Por supuesto. incluyendo los del proyecto CSM-BGBD. Otra alternativa al MAS consiste en usar un muestreo sistemático usando una cuadrícula. situado en el lindero entre el bosque y la pradera. intentando describir patrones (por ejemplo. a través de la estratificación (es decir. el caso de las orillas de un estanque. no importará si los nichos raros son omitidos o no. análisis de conglomerados y ordenación) y luego explicarlos (por ejemplo. su imaginación y descubrimientos potenciales podrían estar restringidos. y su error estándar puede ser estimado sin hacer supuestos acerca de la variación dentro de la población (técnicamente. y en cada estrato tomar una muestra aleatoria). No obstante. lo que se discutirá en la sección de muestreo aleatorio y sistemático. entonces.El muestreo aleatorio simple (MAS) constituye el punto de partida para la discusión sobre cómo muestrear. argumentando que si se empieza partiendo de un objetivo limitado. Otra alternativa es formular algunas hipótesis predictivas para explicar los patrones en la biodiversidad. esto es atractivo. Si el objetivo es estimar la media poblacional (la biomasa media de escarabajos por m2 dentro del área de estudio. existen pocos estudios ecológicos cuyo objetivo sea estimar la media poblacional. y la precisión aumenta con un tamaño de muestra fijo. Cuando el objetivo es identificar todas las especies de un grupo dado en el área de estudio entonces el MAS resulta inapropiado. o el número promedio de especies de hongos en 1 cm3) el MAS adquiere propiedades relevantes. La teoría. Un enfoque de muestreo consiste en colectar datos usando el método de MAS o mediante una cuadrícula. dividir la población en sub-poblaciones o estratos. pero si el propósito es realizar un inventario de especies. en ecología. Intuitivamente. Los seguidores del primer enfoque pueden argumentar que no quieren ser prejuiciados por hipótesis previas. por lo que prefieren mantener la mente abierta y partir de la observación. La mayoría de los estudios. indica cómo la precisión de la estimación puede ser controlada mediante la elección de la muestra. existe una estimación del error de muestreo basada en el diseño). Un ejemplo de un objetivo que requiere diferentes enfoques de muestreo son los inventarios. La media de la muestra es una estimación imparcial de la media poblacional. intentan entender los patrones en la biodiversidad. se han hecho imD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 55 . encontrando correlaciones con variables ambientales). entonces los nichos raros deben ser incluidos. existirá solamente una pequeña porción del área de estudio ocupada por este tipo de nichos.

deberían ser medidos en los sitios de muestreo. pocos puntos con valores altos o bajos. existen tres razones para tratar de diseñar un estudio con objetivos específicos que incluyan hipótesis comprobables: 1 Los descubrimientos inesperados usualmente tienen la naturaleza de formulación de hipótesis observacionales que sugieren explicaciones. 56 Manual de biología de suelos tropicales . entonces es probable que: • La mayoría de los sitios de muestreo tengan valores de P y MOS alrededor de la media con. • La MOS y la P pueden estar correlacionadas. separar los efectos de las dos variables. No obstante. Entonces es difícil y hasta imposible. además. Por ejemplo. frecuentemente. Si suponemos la hipótesis de que la biodiversidad del suelo en parcelas agrícolas. es imposible elegir cuáles. frecuentemente. es posible mejorar el diseño del estudio. está determinada por el nivel de Perturbación (P) y el nivel de Materia Orgánica del Suelo (MOS) y se colectan los datos por medio del MAS o por muestreo de cuadrícula. los que proponen el enfoque “no hipotético” en realidad parten de alguna forma de hipótesis. Se requiere de estudios minuciosamente planeados para poder probar dichas explicaciones. Si las hipótesis implícitas se hacen explícitas el diseño de los estudios pueden ser mejorado. si se trata de entender la relación entre la biodiversidad del suelo y la MOS o la P. no obstante.1). aunque ésta sea implícita. son los puntos más extremos los que proporcionan más información (Figura 2. 2 De hecho. entre un número infinito de factores. 3 Si se parte de hipótesis específicas. por ejemplo. tienen valores bajos de MOS. el estudio podría ser diseñado para incluir específicamente algunas muestras con valores altos de P y de MOS y otras muestras con valores bajos de P y de MOS. sin alguna noción de los factores ambientales que puedan controlar la biodiversidad. La estratificación puede usarse para incrementar el número de puntos con MOS más extremos y mejorar la estimación de la relación sin incrementar el número de muestras. sin seguir estudios planeados. haciéndolo más eficiente. relativamente. Este último punto subraya o enfatiza gran parte de lo que sigue en este capítulo. parcelas con un valor alto de P. cada investigador debería estar abierto a la posibilidad de observaciones no anticipadas y explicaciones verdaderamente nuevas. Sin embargo.portantes descubrimientos por casualidad.

pero aún puede resultar útil cuando se enfoca con un diseño de muestreo. sin embargo. se utiliza una aproximación transversal. Este planteamiento es muy amplio. considerando un rango de usos de suelo en un momento específico de tiempo. sin embargo. muchas veces es la única opción disponible. que indiquen lo que pasaría con la biodiversidad del suelo si los usos de suelo cambian en el futuro. como en muchos otros. generalmente. Si éstas se seleccionan explícitamente. Se espera que las correlaciones entre la intensidad de usos de suelo y la biodiversidad del suelo reflejen alguna conexión causal. en lugar del experimental. es hacer justamente el cambio y esto precisamente constituye la base de un enfoque experimental.1 y las relaciones pueden ser más complejas que el caso de dos líneas rectas. se aplican los mismos principios de diseño. no siempre resulta viable. señala una pérdida de biodiversidad del suelo). el investigador hace una selección de las escalas importantes para su estudio. En términos ideales. puede que sea imposible o inútil producir un solo índice de biodiversidad del suelo. Cuando se determina la distancia entre los sitios de muestreo y el tamaño total del área de estudio. entonces se abren nuevos debates con una probabilidad de mejorar el diseño del estudio. Otro ejemplo de una hipótesis implícita en muchos de los estudios es la escala espacial en la que ocurren los patrones interesantes. Lo anterior. Las discusiones en este capítulo sólo consideran esquemas alternativos de muestreo para datos colectados por el método transversal. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 57 . El objetivo global del proyecto CSM-BGBD fue comprobar la hipótesis de que un incremento en la intensidad del uso del suelo cambia la biodiversidad del suelo (más específicamente. como el que se observa en la Figura 2. Si tenemos que utilizar un diseño de estudio observacional. en donde las parcelas sean monitoreadas a través del tiempo para observar si los cambios en la biodiversidad del suelo pueden ser correlacionados con cambios en el uso del suelo. Aunque la validez de este enfoque puede ser cuestionable. y sus efectos combinados pueden ser estimados. En la práctica. En el presente estudio. puesto que se desconoce el tiempo necesario para el monitoreo. La única manera cierta para determinar el efecto de un cambio.Entonces. dicha investigación iría acompañada de un experimento. tampoco es viable en un proyecto de duración fija y corta. los efectos de ambas variables. lo ideal sería llevar a cabo un estudio longitudinal.

Requiere de un entendimiento profundo. la necesidad de transportar con rapidez las muestras desde el campo hasta el laboratorio. los objetivos determinan todos los aspectos del diseño. el acceso limitado a localidades deseadas para muestrear. podría surgir una serie de restricciones adicionales. esto aumentará la precisión de la estimación de la pendiente. Sin embargo. b) si se incluyen de manera deliberada valores de MOS más extremos. no obstante. es necesario que se combine con las restricciones prácticas impuestas por costos. Los detalles de cómo dichos factores prácticos y teóricos pueden mezclarse. Asimismo. serán diferentes para cada estudio y darán a cada investigación un aspecto único. desde un principio deberán ser expresados de manera clara y precisa. Escríbalos y compártalos con otros para 58 Manual de biología de suelos tropicales . por lo tanto. es posible que se especifiquen algunos pasos del proceso en general que se deben seguir en cualquier estudio. o bien. tiempos y disponibilidad de expertos.1 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. por ejemplo.Figura 2. por estratificación. con base científica y de las propiedades que ofrecen los diversos métodos. dando un estimado pobre de la pendiente. Paso 1: Defina objetivos Como se indicó en la sección de objetivos del estudio y bases de muestreo. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. ENFOQUES PRÁCTICOS El diseño de un esquema de muestreo exitoso y práctico es todo un arte.

datos meteorológicos (ej.. indican la estratificación por altitud o nos permiten entender los problemas de acceso). Paso 2: Consulte otros estudios Consulte los estudios relacionados con su investigación. Consiga el mayor número de comentarios y sugerencias de los expertos en la materia. mapas de uso de suelo (ej.. o bien. Estos incluyen: mapas topográficos (ej. siempre deberá plantear un proyecto realista. Después deberá comprobar con cuidado que: a) los resultados realmente logren los objetivos y b) que el diseño de muestreo simulado realmente pueda mostrar estos resultados. Anote específicamente el tamaño de las muestras utilizadas y la variación de los resultados. anótelas y numérelas. Cada estudio cuenta con aspectos únicos y siempre habrá estudios previos de los cuales puede aprender: ésto le permitirá entender qué aspectos de los métodos utilizados han tenido éxito y cuáles limitan la eficiencia y calidad de los resultados. otros que tienen experiencia en los métodos que va a utilizar.1 es un ejemplo simple. diseños utilizados en otros estudios y su imaginación.. Escriba el diseño con tantos detalles como sea posible. Una herramienta que ayuda a refinar los objetivos es la presentación de resultados simulados. mapas de cobertura del terreno). D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 59 . Paso 4: Elabore un diseño Elabore un diseño tentativo utilizando una combinación de principios generales. su propia experiencia. para identificar los principales usos del suelo que se incluirán en el estudio). Imagínese que ha finalizado el estudio y ha obtenido resultados ¿Qué tablas y gráficas le gustaría presentar?. Paso 3: Reúna datos relacionados Reúna información o antecedentes que serán necesarios para diseñar los detalles del muestreo. imágenes de detección remota (ej.. ¿Cuáles cumplen con sus objetivos y proveen evidencia para su hipótesis?. para ayudar a decidir cuáles son las temporadas idóneas para el muestreo de campo). otros que han trabajado en el mismo sitio. Estos expertos pueden ser investigadores que trabajan sobre temas similares en otros lugares. Si bien puede haber aspectos sobre los cuales tenga poca idea. La Figura 2.que pueda discutir algunas sugerencias.

puesto que involucra varios países. esto dará una indicación de la variabilidad. procese algunos datos hasta llegar a un análisis estadístico. también permita estimar el tiempo del muestreo y el procesamiento de las muestras. permita probar y refinar los protocolos de medición. De nuevo. un error común es obtener información que sugiere que los objetivos son inalcanzables.. revise los objetivos a la luz de nueva información. que han usado métodos similares o que han trabajado en la localidad o simplemente. REPLICACIÓN Y TAMAÑO DE MUESTRA La mayoría de los diseños de estudio son jerárquicos y el problema de muestreo no sólo consiste en seleccionar el sitio de muestreo dentro del área de estudio. De ser posible. pero deberás seguir adelante. Paso 6: Realice una prueba piloto Pruebe su enfoque. Trate de incluir un estadista con experiencia en investigación en ecología. éstos pueden ser personas que han trabajado con temas similares. Dentro de cada sitio de estudio alrededor de 100 puntos de muestreo fue60 Manual de biología de suelos tropicales . procedimientos de manejo de datos. lo que puede ser útil para ayudar a decidir el tamaño final de la muestra. que expresan su opinión acerca de su tema. Una investigación piloto abre la posibilidad de evaluar el aspecto práctico del esquema de muestreo. fueron seleccionadas una o más áreas de estudio. Asimismo. considerará algunos aspectos que pueden pasar desapercibidos por el ecólogo. Un buen estadista. probablemente. En particular. Dentro de cada país. etc. puede ser que tenga que retroceder a un paso anterior para volver a intentar. uno o más sitios de estudio (etiquetadas como “ventanas”) fueron seleccionados. El proyecto CSM-BGBD es un buen ejemplo. JERARQUÍA.Paso 5: Revise su diseño Comparta su diseño con otros investigadores para que expresen su punto de vista y sus comentarios. Paso 7: Revise los pasos En cualquier paso. En cada área.

se plantean las mismas preguntas: ¿cuántas unidades deberían de ser seleccionadas?. La selección de algunos países puede estar basada en función de su política o de los intereses de algunas agencias financiadoras e investigadores que dirigen el proyecto. La terminología es confusa y no tiene nada que ver con una población biológica. estrictaD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 61 . El muestreo implica que el conjunto sobre el que nosotros queremos hacer inferencias (“la población”) necesita ser delimitado antes de que un esquema de muestreo pueda ser planteado. entonces también se necesitará una muestra de otros bosques. Suponga que cuenta con diez muestras tomadas de un bosque y diez en las cercanías de campos cultivados y que las muestras de bosque tienen consistentemente una alta biodiversidad del suelo ¿qué podría concluir? Si las muestras fueron seleccionadas de manera apropiada. relacionados con los usos de suelo. Lo primero es centrarse en la idea de una teoría de muestreo de una “población”. El objetivo de la investigación es encontrar algunos patrones. pero. puede concluir (con un grado conocido de incertidumbre. La segunda idea es la de replicación. Sin eso. evaluada mediante un análisis estadístico) que las muestras de bosque contienen mayor diversidad que las de los campos cultivados. Si se desean resultados que apliquen a los límites del bosque de África del Este en general. ¿cuáles son? En los niveles más altos. Como ejemplo. en algún nivel. Por lo tanto. es necesario repetir observaciones con el fin de determinar si los patrones son realmente consistentes.ron seleccionados y en cada punto se tomaron muestras (el protocolo de medición determina más capas en la jerarquía. sólo podemos hacer afirmaciones sobre el monte Kenia con base en los datos obtenidos y no es posible extrapolarlos a otros lugares. Los patrones de interés son los que mantienen una consistencia a través de un número de casos. En cada capa jerárquica. tales como los patrones de la diversidad del suelo. La intención es saber a qué se refieren sus resultados. se podría estudiar la biodiversidad del suelo en fincas alrededor de los límites del bosque en el monte Kenia. ya que estos patrones pueden utilizarse para hacer predicciones y pueden reflejar algunas reglas o procesos. dicha selección se deberá basar en los objetivos del estudio y en la aplicación de algunos principios. que trata de mantener la consistencia de patrones y relaciones. lo que requerirá de una muestra de fincas pertenecientes a esta localidad. aunque. como consecuencia de la extracción de cuatro muestras tomadas para la caracterización del suelo y sub-muestras de éstas para los análisis químicos). las respuestas no necesariamente estarán basadas en la ciencia.

como los sitios de estudio pueden proveer un nivel de replicación. etiquetados como: “bosque” y “agricultura”. representan una “regla” aplicable ampliamente. ha sido construida una cuadrícula de tal manera que incluya los dos usos de suelo.2b se pueden observar tres ventanas más pequeñas para muestrear tres diferentes parches de bosque y no uno solo. Si busca una conclusión válida para los bosques. para poder examinar las diferencias en la biodiversidad del suelo. 1998). sólo podrá concluir que ese bosque en particular es más diverso y no. muestras múltiples de un mismo bosque no sirven al mismo propósito. En la Figura 2.mente hablando. Dentro de cada sitio de estudio se podrán establecer conclusiones más contundentes si por ejemplo. la 62 Manual de biología de suelos tropicales . El que muestras repetidas dentro de un bosque sirvan para ser interpretadas de igual manera que las muestras de diferentes bosques depende de las propiedades de los datos y no. La replicación puede aumentarse y abarcar más área total observada. entonces en algún momento se perderán las ventajas posibles de muestrear por cuadrícula y se terminará con un diseño que podría parecer un muestreo aleatorio de sitios individuales. varios bosques son muestreados.2a. determina el nivel jerárquico donde se requiere tener réplicas. Un enfoque más certero es asegurar una replicación válida y algunos resultados genéricos. deberá buscar una consistencia en varias de ellos. patrones consistentes entre sitios. Algunas de las implicaciones de estas ideas en el muestreo de cuadrícula son ilustradas a través de un ejemplo simplificado que se muestra en la Figura 2. puesto que representan “pseudo-réplicas”. utilizando más ventanas y más pequeñas (Figura 2. Dicha cuadrícula es una “ventana” con 77 puntos de muestreo (intersecciones) definidos. Sin embargo. pero queda claro que la escala en que se anticipan o hipotetizan los patrones.2. Una respuesta a esto es definir una nueva categoría de “límites de bosque” y asegurar ventanas en los tres sitios de muestreo (Figura 2. Si este proceso de reducir el tamaño de las ventanas mientras se incrementa su número se continúa. El objetivo es muestrear un paisaje con dos usos de suelo. del diseño de muestreo. probablemente. La palabra “escala” es confusa y controversial en la ecología (Peterson y Parker. a través de un diseño que replique bosques y otros elementos de uso de suelo.2d). los bosques en general.2c). En la Figura 2. por lo tanto. por lo que no pueden ser considerados representativos del uso de suelo. Dentro de un estudio jerárquico. Nótese que no es necesario muestrear todos los usos de suelo en cada ventana. Por ejemplo. las unidades de nivel más alto. Una crítica a este tercer tipo de diseño es que todos los sitios de muestreo en tierras agrícolas quedan cerca de un límite de bosque.

La réplica dentro de la unidad es importante para determinar la precisión con que la biodiversidad del suelo es medida para cada unidad. con varios niveles de cobertura de bosque.Figura 2. Lo anterior. En este caso. hipótesis puede ser “la biodiversidad del suelo en parcelas agrícolas decrece con el aumento a la distancia del límite del bosque”. por lo tanto. En otras áreas de la ecología. datos en el nivel de unidades de 1 km². se necesita definir el significado de “en el paisaje”. con la definición de algunos sitios dentro de cada unidad. utiliza datos en el nivel de parcela y el otro. d) reconociendo los límites como otra categoría. Una hipótesis diferente sería “la biodiversidad del suelo en parcelas agrícolas decrece con la reducción de la cobertura del bosque en el paisaje”. sin embargo. pero no es relevante para afirmar la consistencia del patrón a través de la unidad de 1 km² necesaria para examinar las hipótesis. Los dos ejemplos del párrafo anterior son análisis que utilizan factores del paisaje. c) incrementando la replicación. puede ser investigado con parcelas (sitios de muestreo) en un intervalo de distancias. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 63 . selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. suponiendo que fue definida como áreas de 1 km². afectan los procesos. no queda claro el diseño de muestreo que se necesita. se basan en datos de diferentes niveles jerárquicos: uno.2 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. con réplicas en cada distancia. la escala espacial en que se evaluó la cobertura del bosque. se requerirá de más muestras. El mensaje es claro: “el nivel de paisaje” no está bien definido y. los objetivos de un proyecto de biodiversidad del suelo pueden incluir “análisis del paisaje”. Para poder evaluar la biodiversidad del suelo dentro de un 1 km². factores del paisaje como la fragmentación del bosque. Ahora es la réplica quien determina la necesidad de varias áreas en cada nivel de cobertura de bosque. Entonces la hipótesis necesita una muestra de una unidad de 1 km². es decir. b) tres cuadrículas que muestrean tres diferentes parches de selva. si se intenta hacer un “análisis en el nivel de paisaje”.

El muestreo adaptativo (Thompson y Seber. y la variabilidad entre réplicas del mismo uso de suelo. ningún estudio real ha multiplicado las respuestas de interés. y estudios previos similares y pilotos. Una variedad de diseños a multi-escala han sido utilizados en estudios ecológicos.Una vez que se sepa lo que hay que replicar. en la práctica. Patrones a escala más grande. puedan ser investigados. la respuesta de un cultivo a un fertilizante) entonces es viable especificar la respuesta mínima que es importante detectar. con muchas mediciones que sólo están disponibles después de un largo periodo de muestreo en campo. No obstante. la diversidad del suelo entre dos usos de suelo) que es importante detectar. Queda claro que la decisión sobre el tamaño de muestra depende de esto. el tamaño de muestra se ha basado en una combinación de información de métodos formales (lo que puede indicar los órdenes de magnitud requeridos). Aunque sean teóricamente atractivos. Si bien existe cierta atracción por esta idea. Los métodos requieren conocimiento de dos cosas: de la magnitud de las diferencias (por ejemplo. Enfoques secuenciales (Pedigo y Buntin. Los métodos estándares presumen que existe una respuesta medible de la biodiversidad del suelo que se puede utilizar para obtener el tamaño de muestra. medida de diferente manera. Otra complicación surge a partir de las respuestas multivariadas de interés. números. pero normalmente resulta difícil especificarlos. La idea de estos diseños es elegir posiciones de muestreo. se incluyen ambos 64 Manual de biología de suelos tropicales . etc. cuando el objetivo de la investigación es detectar y entender algunos procesos. requieren puntos más lejanos. como la diversidad de diferentes grupos funcionales. Una estimación aproximada de la varianza puede ser obtenida de estudios previos. Cuando la investigación es dirigida a medir respuestas económicas para decisiones de manejo (por ejemplo. dada la necesidad de planear campañas de campo por adelantado. Los patrones a escala fina requieren puntos muy cercanos. 1993) permiten continuar con el muestreo hasta que algunos criterios se cumplan. es improbable que sean prácticos para los estudios de biodiversidad del suelo porque el trabajo necesita planearse en distintas fases de campo y de laboratorio. Por lo tanto. sin embargo. 1996) permite que el diseño responda a patrones que se detecten. muchas veces no es posible especificar un tamaño de muestra que resulte importante. los métodos estándares están disponibles para ayudar a seleccionar el tamaño de muestra. pero saber qué relevancia tendrá en nuevos ambientes puede ser desconocida. Por lo tanto. biomasas y proporciones de estos grupos funciones o especies. de tal manera que los patrones. es improbable su viabilidad. a diferentes escalas. al igual que el software para iniciar el análisis.

normalmente sólo resulta posible examinar un grupo en una muestra de suelo dada y la extracción de la muestra de un grupo. El objetivo de descubrir y entender los efectos del uso de suelo en la biodiversidad del suelo. de tamaños adecuados. el número promedio de escarabajos por m2) sin tomar en cuenta un diseño. sino de una parcela.. los estratos son áreas con diferentes usos de suelo y la idea es obtener. <10 m) no se han examinado. no en función de un punto. entonces los resultados pueden estar sesgados. podrá alterar otros grupos. simplemente es práctica. todas las mediciones se realizan a nivel de parcela. antes de cuantificar la biodiversidad del suelo. Piense en un lugar seleccionado. dentro de cada parcela se reúnen las muestras. responde a la necesidad de contar con mediciones iguales de diferentes grupos funcionales del suelo. se sugiere que un buen enfoque en los objetivos de un estudio mejorará la eficiencia en su diseño e incrementará la posibilidad de lograrlos. lo que quiere decir que se mezclan varias muestras de suelo. Un buen enfoque para mejorar el diseño de muestreo es el uso de la “estratificación”. Cuando varios grupos de especies están siendo evaluados. Algunas veces se piensa que este enfoque puede estar “sesgado” porque los tipos de uso de suelo para tomar las muestras se determinan a priori. existen dos razones para ello: una. de manera deliberada. se requiere tomar muestras (ver esquema de puntos de medición abajo). seguramente las relaciones entre ellos son importantes. quizá en un área del orden de 100 m². pero únicamente un volumen de suelo muy limitado puede ser examinado en la mayoría de las mediciones de biodiversidad del suelo y se toman varias muestras para poder representar toda la parcela. 2003). En este sentido.y los diseños eficientes tienen una estructura en forma de conglomerado (Urban et al. para cada uso de suelo. 2002. esto significa que la variación y los patrones en la escala dentro de la parcela (por ejemplo. Así. y los diferentes usos de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 65 . muestras de cada uno de ellos. Stein y Ettema. Si los datos se usan para hacer afirmaciones sobre el área de estudio en general (por ejemplo. Normalmente. requieren establecer comparaciones en diferentes usos de suelo. esto quiere decir que se tiene que medir en el mismo lugar. puesto que habría demasiadas muestras para procesar si no fuera así. lo que asegura que se obtengan muestras realmente representativas. En cada sitio de muestreo seleccionado. Necesitará muestrear dentro de toda esta parcela. la segunda. No obstante. ENFOQUE DE OBJETIVOS: ESTRATIFICACIÓN En la introducción de este capítulo.

rasgos lineales. Con un enfoque de muestreo estratificado. el mejor diseño es tener N/2 en cada uno de los dos grupos. Si los objetivos incluyen investigación en límites entre áreas de diferentes usos de suelo o de nichos raros. Si se cuenta con un total de N muestras para comparar dos usos de suelo entonces. a partir de las cuales no se podrán establecer conclusiones. entonces existen dos prerrequisitos: 1 Se necesita saber cuáles son los usos de suelo a comparar y contar con definiciones precisas de ellos. ni aquellas zonas de transición que puedan ser importantes. las áreas ambiguas pueden ser excluidas del muestreo. El primer aspecto hace que algunos investigadores se sientan incómodos ante la idea de que una predefinición de uso de suelo para la investigación excluya el descubrimiento de patrones potencialmente importantes. ¿dónde se encuentra el límite entre “pastizales con árboles” y “bosque secundario”?. pero si el objetivo es investigar los efectos de uso de suelo. podemos elegir un tamaño idóneo de muestra para cada uso de suelo. La predefinición. por ejemplo. es probable que la muestra incluya únicamente algunas observaciones de estas categorías. al igual que la necesidad de definir con precisión. tiene sentido excluir tales sitios. Sin embargo. puesto que no habrá certeza en cómo clasificarlas. entonces probablemente muchos de los sitios de muestreo seleccionados terminarán siendo posiciones ambiguas en lo que se refiere a la definición de uso de suelo. no es deseable excluir algunos usos de suelo. de no ser así. Por supuesto. si el objetivo es hacer un inventario del paisaje. sin embargo. en ausencia de alguna otra información. Si se emplea este enfoque. Si un diseño de muestreo no toma en cuenta el uso de suelo. tiene que considerarse en algún momento. Por ejemplo. Resulta más eficiente incluirlas en un número 66 Manual de biología de suelos tropicales . Se requiere de un mapa de uso de suelo del área bajo estudio. el diseño no es parcial para el objetivo de comparar los usos de suelo y además es eficiente. ¿cuándo se debe uno de mover a lo largo de un gradiente para incrementar la cobertura de árboles? Aquí tenemos otra ganancia potencial en la eficiencia del pensamiento a través de estos requerimientos en el diseño y no sólo en la etapa de análisis. 2 Las localizaciones de estos usos de suelo deben ser conocidas. En un enfoque estratificado.suelo pueden no estar representados en las muestras. con frecuencias proporcionales a su ocurrencia en el área de estudio. éstos deberán ser incluidos específicamente en el muestreo.

no es una limitante. Ello queda. si los objetivos lo requieren. si los objetivos no lo requieren. excluirlas (dándoles un equivalente de tamaño cero). la limitante de este enfoque es la posible falta de “representatividad” del área de muestreo (la medida en que los resultados pueden razonablemente ser asumidos para aplicarlos a una población más grade) porque ésta depende de la percepción del ejecutor y no. Un enfoque común no aleatorio es una selección subjetiva de los sitios de muestreo. sino variables ambientales. cuando se toman muestras en lugares considerados interesantes o importantes. Si se toma un tamaño de muestra subjetivo igual a 1. abierto al debate cuando los resultados son presentados. Cuando se usan variables como la MOS en la estratificación. tales como la MOS o la frecuencia de fuego. o en imágenes de SR y utilizar esto para definir los estratos. de tal modo que: a) cada punto tenga las mismas posibilidades de ser seleccionado. ya que existe la posibilidad de la interpretación de imágenes por sensores remotos (SR). MUESTREOS ALEATORIO Y SISTEMÁTICO Las razones esenciales para utilizar el muestreo aleatorio simple (MAS) fue descrito anteriormente y son detalladas en textos tales como Cochran (1977). o bien. y seleccionar los sitios de muestreo de manera aleatoria. no son usos de suelo per se. Por ejemplo. esto es equivalente a limitar el área de estudio. por lo tanto. El muestreo aleatorio estratificado requiere hacer lo mismo en cada estrato. que frecuentemente sirven como base para seleccionar unidades de muestreo a niveles jerárquicos más altos. algunas veces por una buena razón. calibrarlo en un mapa de uso de suelo. puede ser útil hacer un monitoreo rápido de la MOS. por ejemplo.suficientemente grande. resultan muy útiles en la práctica. cuando una “ventana” única se coloca en un área. los estudios ecológicos no siempre usan un muestreo aleatorio. y b) la selección de un punto no cambie la probabilidad de incluir cualquier otro punto. influenciadas por el uso de suelo. Nótese que muchos de estos argumentos también aplican cuando los factores hipotéticos que influyen sobre la biodiversidad del suelo. El no contar con un mapa de usos de suelo. El uso de un software para ayudar en la aleatorización y un GPS para localizar los puntos de muestreo en el campo. Para la implementación del MAS es necesario delimitar el área de estudio. entonces dicha área queda representada por esa ventana y el hecho de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 67 . de la propiedad inherente del diseño. Aunque a veces es necesario. el que estos no tengan una resolución idónea. Sin embargo.

que esa área sea o no, representativa dependerá únicamente de la habilidad del ejecutor. El muestreo sistemático tiene muchas aplicaciones en la ecología, usando transectos de una dimensión o cuadrículas de dos dimensiones. En el caso de los transectos, las muestras son seleccionadas en puntos que se encuentran a una distancia fija entre sí, a lo largo de una línea predeterminada. Para un muestreo de cuadrícula, una cuadrícula rectangular (usualmente) es definida en el área y las muestras son tomadas en cada punto de intersección. Las ventajas potenciales de este tipo de muestreo sistemático se derivan de la teoría y de la práctica. Las ventajas de la práctica incluyen:
• La facilidad de localizar puntos de muestreo, describir su ubicación y los medios de llegar a los puntos de muestreo; por ejemplo, el protocolo puede ser algo tan simple como “desde el punto de partida, camino al norte y muestreo cada 50 m”. • La facilidad de planear el trabajo de campo; por ejemplo, de estimar el tiempo requerido para muestrear un número fijo de puntos. La razón estadística para utilizar muestreos sistemáticos es que pueden ser eficientes (Webster y Oliver, 1990). Si se considera un estudio con el propósito de calcular la media o el total de algún parámetro (por ejemplo, el carbono total en el suelo en el área de estudio o la media de escarabajos por m2). Si la cantidad medida no es constante, una muestra que utilice la cuadrícula dará una mejor estimación que una simple muestra al azar del mismo tamaño, lo que frecuentemente es el caso de variables ambientales y biológicas. La eficiencia se basa en el hecho de que puntos cercanos son similares, por tanto, no proporcionan mucha información nueva; mientras que en la cuadrícula las muestras están de manera uniforme en toda el área de estudio. Por razones similares, el enfoque de cuadrícula resultará útil para compilar el inventario de un área bajo estudio, salvo que puede excluir nichos raros (véase abajo). Sin embargo, hay aspectos negativos: • Algunos puntos de la cuadrícula tendrían que ser excluidos del estudio, tales como caminos o cuerpos de agua. • Las cuadrículas incluyen muestras de diferentes usos de suelo, con un tamaño más o menos proporcional en cada tipo de uso de suelo. En particular, tipos de uso de suelo raros pueden ser omitidos, lo que se puede compensar moviendo
68
Manual de biología de suelos tropicales

la ventana y añadiendo puntos, aunque el proceso podría llegar a ser arbitrario y subjetivo. • Algunas veces no es posible caracterizar el uso de suelo claramente en cada punto de muestreo. Estos puntos están relacionados con el problema discutido en la sección “enfoque de objetivos: estratificación”. Si el objetivo del estudio es comparar clases de uso de suelo, entonces el muestreo por cuadrícula, a veces, no los captura de forma óptima, de manera que las cuadrículas y los transectos probablemente son más apropiados para muestrear la biodiversidad del suelo, cuando a) no existe ningún objetivo explícito o hipótesis que involucre comparaciones o relaciones con variables ambientales, o b) la hipótesis se refiere a una unidad espacial de un nivel más alto que la escala en que el muestreo por cuadrícula o por transecto fue hecho. Por ejemplo, Swift y Bignell (2001) recomiendan transectos de 40 m de largo, pero éstos quedan dentro de cada clase de uso de suelo. Cuando se comparan usos de suelo, se hacen réplicas de los transectos y se asignan aleatoriamente los estratos definidos por diferentes usos de suelo. De esta forma, el muestreo sistemático por cuadrícula o transecto, normalmente, es combinado con un muestreo aleatorio. Por ejemplo, puede haber varias cuadrículas definidas como se aprecia en la Figura 2.2d, con una localización y orientación hecha al azar. De manera similar, el punto de inicio y la orientación de los transectos que se repiten pueden ser hechos aleatoriamente. Los transectos también pueden ser útiles cuando se alinean con gradientes ambientales considerados importantes; esto se conoce como “gradsectos” (Wessels et al., 1998). Con la aleatorización en algún nivel en la jerarquía, es posible hacer un análisis estadístico basado en las propiedades aleatorias del diseño; por ejemplo, si un número de cuadrículas pequeñas es colocado aleatoriamente en el área de estudio, entonces contamos con las réplicas necesarias para establecer una consistencia, a través de patrones encontrados. El análisis estadístico elegido para una muestra tomada en un diseño sistemático no puede estar basado en la aleatorización, porque los sitios no fueron seleccionados de manera independiente dentro de cada cuadrícula. Existen dos posibles enfoques para el análisis: el primero asume que los datos se comportan de forma aleatoria (por ejemplo, las propiedades estadísticas son las mismas, como si el punto hubiera sido localizado aleatoriamente); el segundo, es utilizar un modelo explícito de patrones espaciales. En la mayoría de los análisis que buscan relaciones entre variables ambientales y la biodiversidad del suelo se usa el primer análisis,
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

69

principalmente, porque las alternativas son complejas. Las consecuencias de suponer esto son raramente investigadas. Es claro que la distancia y el tamaño total de la cuadrícula determinan la escala de los patrones que pueden ser detectados. No es posible observar patrones (por ejemplo, agregación de la biodiversidad del suelo) a escalas espaciales menores que las distancias entre los puntos de la cuadrícula; de la misma manera, tampoco será posible detectar patrones más grandes que el tamaño total de la cuadrícula. Sólo se pueden reconocer los patrones cuando existen varias repeticiones dentro de la misma cuadrícula. Es este aspecto de escala de patrones, definido por los objetivos del estudio, el que debería determinar los espacios y el tamaño total de la cuadrícula. Algunas veces se sugiere que los espacios deben ser de tal manera que los puntos vecinos no estén correlacionados. Esta noción de correlación espacial es importante, pero también confusa. La correlación entre las mediciones de una determinada distancia, no es una cantidad absoluta, pero es una medida relativa a un promedio (técnicamente, el problema tiene que ver con el recambio). Para poder ver esto, piense en analizar datos de una sola ventana en Kenia, donde los puntos de una distancia de más de 200 m entre sí, pueden no indicar similitud en la biodiversidad del suelo, pero si juntamos los datos con otra base de datos global se esperaría encontrar similitud, no sólo en los puntos que pertenecen a una misma ventana, sino entre todos los puntos dentro de Kenia. HABLANDO DE VARIABILIDAD La experiencia de estudios pasados sugiere que se debería de esperar un alto nivel de variación en muchas de las mediciones principales de la biología del suelo. Aún cuando se trata de distancias cortas, se puede esperar una variación grande en número y diversidad de diferentes grupos funcionales. En paisajes agrícolas tropicales la variación dentro de una categoría de uso de suelo puede ser debida a las prácticas de manejo, la variación en las características de la vegetación, las diferencias históricas en el uso de suelo de la parcela, efectos de borde, posición topográfica y características biofísicas. Si los métodos formales para determinar los requerimientos del tamaño de muestra fueran seguidos, probablemente indicarían un tamaño de muestra mucho más grande de lo es viable o costeable, ¿Qué se debe hacer entonces? Primero, ¡no tiene sentido no hacer nada! Simplemente, si se sigue con un tamaño de muestreo preconcebido, no se alcanzarán los objetivos; si el plan original fue
70
Manual de biología de suelos tropicales

trabajar con diez muestras por cada uso de suelo dentro de un sitio de referencia, y las indicaciones son que se necesitan alrededor de 100 muestras por cada uso de suelo, no tiene sentido continuar, puesto que se terminarán obteniendo resultados vagos y no concluyentes, los cuales se traducirán en errores estándares altos y sin efectos significativos cuando se analizan los datos. Tres son las posibles opciones: 1. Incrementar el tamaño de muestra. 2. Utilizar métodos de muestreo para reducir la variabilidad. 3. Reducir la amplitud del estudio. La primera opción no resulta práctica en la mayoría de los casos, pues siempre hay limitaciones de tiempo, dinero, recursos y experiencia. Existen varios métodos para reducir la variabilidad de las muestras; los más útiles consisten en la estratificación y la congruencia. Nótese que el uso del término “estratificación” se usa para el muestreo, pero es diferente a cómo se aplica en “enfoque de objetivos: estratificación” (arriba). Si algunas fuentes de variabilidad pueden ser previstas, éstas pueden ser usadas para definir estratos y removerlas del análisis. Por ejemplo, si el sitio de estudio cubre un rango de altitudes, se puede esperar una variación en la biodiversidad del suelo dependiendo de la altitud. La estratificación, entonces, divide el sitio de estudio en zonas de altitud y los sitios de muestreo dentro de cada una de ellas. En esta fase del análisis de datos, la variación de los usos de suelo se compara dentro y entre estratos para no oscurecer los resultados. Este enfoque requiere que algunos (no todos) de los diferentes usos de suelo estén localizados dentro de zonas de altitud. Si el uso de suelo únicamente varía con la altitud, entonces los dos factores están confundidos y sus efectos en la biodiversidad del suelo no se distinguen. Dado que existe una variación ambiental, la variabilidad en la biodiversidad del suelo estará en respuesta a la variación ambiental. Consecuentemente, los estratos pueden ser útiles para definir puntos de muestro cercanos geográficamente. Las ventanas en la figura 2.2 pueden ser vistas de esta manera. Comparar conlleva la idea de la estratificación a un extremo. Imagine que si dos de los usos de suelo a comparar son bosque y campos de maíz, se puede esperar que la biodiversidad del suelo dependa de muchas variables ambientales, tales como el clima, topografía, y geología. Estas variables ambientales varían típicamente de manera irregular, con sitios cercanamente similares. De esta manera, si seleccionamos parcelas de bosque y maíz que están cercanas, las diferencias entre ellas, principalmente, se deberán al uso de suelo y no, a otros factores, lo que nos
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

71

permite eliminar las variables que “meten ruido” en el análisis. Entonces, el enfoque sería identificar y muestrear, por ejemplo, diez pares de sitios, donde cada par esté formado por parcelas de bosque y maíz cercanas, situadas a cada lado de un lindero de uso de suelo. Formalmente, cada par constituye un estrato de tamaño 2. Más de dos usos de suelo pueden incluirse en el diseño. Las ideas de diseño para experimentos de bloques incompletos son relevantes para seleccionar pares de usos de suelo similares. Controlar la variabilidad mediante la reducción del área de estudio, muchas veces es la mejor solución. El área podría ser reducida, si se reduce el tamaño del sitio de muestreo, reduciendo naturalmente la heterogeneidad, lo que puede ser insatisfactorio porque también reduce la generalidad de los resultados. Si únicamente tomamos muestras en un área pequeña, entonces no existe una base para asumir que se han encontrado patrones ampliamente aplicables. Otras maneras de reducir el ámbito del sitio de estudio son: No incluir todos los usos de suelo encontrados en el área de estudio, sino una selección que cubra un gradiente de intensidades de uso de suelo o que represente alguna transición típica en el uso de suelo. Ajustarse a la definición de una clase de uso de suelo. Por ejemplo, en lugar de tomar un “campo de maíz” como uso de suelo, se podrá limitar la atención a campos de maíz que han sido cultivados continuamente durante los últimos diez años, que no han sido fertilizados en los últimos tres años y que son trabajados con azadón. Evitar tomar muestras en sitios ambiguos, como aquellas que se encuentren cerca de linderos. Mientras esto ayudará a detectar y medir el efecto de la intensidad de uso de suelo en la biodiversidad del suelo, pueden ser inconsistentes con los objetivos del inventario de las especies. Un compromiso entre los dos objetivos puede ser necesario. Esto es común en el diseño de proyectos y, en resumidas cuentas, no se puede esperar encontrar todo en un tamaño limitado de muestra. ESQUEMA DE MEDICIÓN DE PUNTOS Una vez localizados los puntos de muestreo, tiene que ser definido un protocolo de medición, lo que implica la necesidad de un muestreo adicional. El esquema básico
72
Manual de biología de suelos tropicales

de muestreo por puntos adoptado por el CSM-BGBD se presenta en la Figura 2.3, que a la vez se complementa con la Tabla 2.1. Aunque el esquema de medición utilizado para el muestreo de grupos funcionales que son descritos por los procedimientos del proyecto alternativas de roza, tumba y quema (Swift y Bignell, 2001), es diferente de lo que fue propuesto por Swift y Bignell para adecuarse al enfoque basado en la cuadrícula. Por ejemplo, los pocos monolitos en cada punto de muestreo son compensados por el gran número de puntos de muestreo, que resulta en aproximadamente el mismo número de eventos de muestreo. No obstante, los resultados preliminares han indicado que con un pequeño monolito por punto de muestreo no todas las especies pueden ser capturadas. Si éste es el objetivo para llevar a cabo el muestreo, se prevén opciones adicionales para incluir monolitos más grandes. Macrofauna: un solo monolito, trampas de caída (pitfall) y, por lo menos un transecto de 20 m son colocados en cada sitio de muestreo. El muestreo por transectos se amplía para incluir hormigas y escarabajos, en adición a las termitas. En un esquema alternativo adicional los monolitos pueden ser excavados para mejorar el muestreo de lombrices de tierra y se puede introducir un sistema simple para tomar muestras de termitas. Nótese que en las parcelas pequeñas, los sistemas de cultivo pueden estar altamente disecados o los terrenos son difíciles, por lo tanto, no es necesario que el transecto sea lineal. Un transecto puede tener un ángulo de 90 grados, y muestrear parcelas de forma irregular o para evitar arroyos, fuertes pendientes o rocas. Los árboles caídos deben incluirse en el transecto si estos quedan sobre la línea (Swift y Bignell, 2001). Mesofauna: 12 extracciones de suelo tomadas en círculos concéntricos alrededor de un solo monolito a 3 y 6 metros de radio, y extraídas utilizando el método Berlese. Adicionalmente, las trampas pitfalls sin cebo abiertas durante un periodo de 24 horas sirven para colectar mesofauna y macrofauna que viven en la superficie. Las trampas pitfalls generalmente son apropiadas para hormigas, algunos escarabajos, algunos saltamontes, milpiés y arañas. Muestras de suelo extraídas con sacabocado por el método de Berlese contienen colémbolos, ácaros y en sitios húmedos enquitreidos. Microfauna: muestreos con sacabocado de manera similar en 12 extracciones de suelo de dos círculos concéntricos, a 3 y 6 metros de radio del monolito. La “microfauna”, principalmente se refiere a nematodos, aunque también a pequeños ácaros (y larvas de ácaros) extraídos de las muestras de suelo; por el método Berlese pueden cuantificarse.
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

73

Figura 2.3 Esquema de muestreo por puntos para toda la biota. El muestreo se puede ampliar si se usa uno o dos transectos para termitas, hormigas y escarabajos, mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.

Monolito Núcleo de suelo para mesofauna Núcleo de suelo para nemátodos y microbios Muestras para análisis físicoquimicos Transecto 1 m2 para muestra de hojarasca (Winkler) Trampa pitfall

Microsimbiontes y hongos del suelo: muestreos de manera similar mediante 12 extracciones de suelo con sacabocado, puestas en dos círculos concéntricos alrededor de un solo monolito, a 3 y 6 metros de radio. Parámetros físicos y químicos del suelo: cuatro extracciones de suelo con sacabocado puestas en un círculo de 6 metros de radio de un monolito. En el caso de estudios de co-ubicación, una extracción adicional de suelo puede tomarse de la pared exterior de la zanja del monolito (véase Capítulo 3, muestreo de macrofauna). En un esquema alternativo (Figura 2.4) los usos de suelo pueden ser muestreados por una combinación de monolitos principales y subsidiarios, transectos de 50 metros, cuadrantes de hojarasca espaciadas y trampas pitfalls. El muestreo casual alrededor de los transectos puede ser empleado y también trampas Malaise colocadas para capturar insectos voladores mayores. El protocolo difiere de la propuesta anterior, en lo concerniente a los puntos del transecto, cuadros de hojarasca, trampas pitfalls y monolitos subsidiarios colocados en líneas paralelas de 50 m, con una separación lateral de 10 m. Este protocolo debe ser tomado básicamente como una extensión del propuesto anteriormente y se considera aplicable en donde se le dé más importancia al muestreo de todas las especies que existen dentro del área y en los casos donde la frecuencia de muestreo es baja (número de parcelas muestreadas) por las razones explicadas anteriormente. Estas modificaciones
74
Manual de biología de suelos tropicales

resultan más adecuadas cuando se encuentran diferentes usos de suelo en todos los sitios. CONSIDERACIONES PRÁCTICAS EN LA ORGANIZACIÓN DEL TRABAJO DE CAMPO La colecta de muestras o la medición directa en el campo deberían, en la medida de lo posible, realizarse de forma secuencial y durante una sola salida. En el caso de parámetros físicos y químicos del suelo que permanecen estables en el tiempo, el muestreo puede hacerse en un momento diferente. Lo anterior, por supuesto, no se aplica en el caso de características dinámicas del suelo, por ejemplo, el contenido de agua en el suelo.
Figura 2.4 Esquema alternativo para muestrear macrofauna, utilizando un transecto de 50 m.
Extracción Winkler Transecto Mini-monolito

Trampa pitfall Monolito adicional
12 muestras de suelo (12 x 12 x 10 cm)
MS MS MS MS

Monolito principal 10 m

10 m 10 m 5m 50 m
MS MS MS

MS MS

Monolito adicional

MS MS MS

30 cm Hormigas de hojarasca Hormigas endogeas Termitas

2m

D iseño

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

75

Tabla 2.1 Grupos de organismos del suelo colectados utilizando diferentes métodos de captura.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Manual de biología de suelos tropicales
Suelo Mesofauna Descripción X X X X X X X X

76
Trampas pitfall con cebo* - 3 trampas por punto de muestreo. Las trampas se deben quitar después de 48 horas en campo. Transectos semi-cuantitativos 2 x 20 m uno por punto de muestreo, perpendicular a la pendiente Trampas Winkler para muestras pequeñas de hojarasca (1 x 1 m) a lo largo del transecto, 3 Winkler por punto de muestreo Núcleos de suelo con hojarasca (3.5 x 3.5 x 5 cm),12 submuestras por punto de muestreo (profundidad de 0-5 cm). Para mesofauna se hace una muestra compuesta (1er opción), o 4 muestras compuestas por 3 submuestras de cada cuadrante (segundo opción) o 3 muestras compuestas por 4 submuestras. Núcleos de suelo para microbios de 0-20 cm de profundidad sin hojarasca. En círculos a 3 y 6 m, del punto de muestro, una muestra compuesta de 12 submuestras por punto de muestreo.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

Trampa (pitfall)

X

X

X

Transecto

X

X

Trampa Winkler

X

X

X

Embudo de Berlese

X

X

X

Varios

Tabla 2.1 Continúa.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Monolito X

X

X

X

X

X

X

Mesofauna

D iseño
Suelo Descripción Monolito (25 x 25 x 30 cm), incluyendo hojarasca, una muestra por punto método TSBF. Muestra de suelo, una muestra compuesta de suelo por al menos 4 submuestras para análisis físicos y químicos, profundidad 0-10; 10-20; 20-30 cm.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

*Nota.- El cebo sugerido para las trampas pitfall es excremento de monos o de humanos, el cual es muy efectivo para extraer escarabajos coprófagos (Coleoptera) y, al mismo tiempo, no interfiere con la captura de escarabajos saprofíticos (Scarabaeidae, Aphodidae, Trogidae) y predadores (Sistiridae, Staphilinidae). El excremento de omnívoros, resulta más adecuado, en el caso de áreas de selva tropical porque los omnívoros predominan en estos ambientes

77

La colecta de muestras de los principales grupos funcionales de organismos del suelo, requiere de la colaboración de mucha gente en cada punto de muestreo, con el riesgo de lastimar el cultivo en pie, al igual que afectar el inventario, especialmente de aquellos organismos con alta motilidad o sensibles a la intromisión humana. Por ejemplo, las lombrices de tierra epígeas y algunos tipos de termitas comedoras de tierra son sensibles al disturbio, y especialmente a las pisadas, por lo que se alejarían rápidamente. Por lo tanto, es importante reducir el número de personas involucradas en la colecta de las muestras, aunque se necesita un número suficiente de manos para poder manejar y procesar las muestras. Durante el entrenamiento de técnicos y asistentes de campo, es necesario prestar atención a los riesgos que pudieran surgir en cada grupo específico de organismos de suelo. El riesgo de contaminación cuando se trata de microorganismos debe ser entendido y la importancia de utilizar procedimientos adecuados para evitar la contaminación debe ser enfatizada, especialmente en las personas inexpertas. El mismo principio rige cuando existe la posibilidad de que dichos organismos escapen de los sitios de muestreo, como consecuencia de una severa perturbación. Otra preocupación es el gran volumen de suelo que será colectado durante el muestreo y la necesidad de reducir dicho volumen para transportarlo. Desde este punto de vista, la extracción de especímenes de las muestras se hace mejor en, o cerca, del sitio de muestreo. También, en el sitio de muestreo se deben agrupar todas las muestras y extraer sub-muestras para su posterior análisis. El tiempo y la temperatura a la que se almacenan las muestras juegan un papel importante, dado que muchos organismos del suelo pueden morir a temperatura ambiente, en la superficie del suelo, o cuando son guardados en bolsas o contenedores durante unas cuantas horas. Para poder evitar dichos riesgos es importante identificar una instalación local adecuada antes de colectar las muestras o, hacer la extracción inmediata in situ de los especímenes. En algunas ocasiones, por ejemplo, el embudo de Berlese para la mesofauna y de Winkler para la extracción de hormigas y escarabajos de la hojarasca, pueden instalarse en el campo para su uso inmediato; en otros casos, cuando los organismos necesitan ser cultivados in vitro o cuando las propiedades del suelo necesitan ser determinadas, es necesario disponer de un transporte rápido para su traslado hacia el laboratorio. Bajo ninguna circunstancia las muestras deberán permanecer bajo el sol, ni aun cuando el protocolo de extracción requiera de un secado final de la materia. Otros detalles sobre las precauciones a tomar en cuenta y consejos
78
Manual de biología de suelos tropicales

sobre la logística general, se pueden encontrar en los capítulos que tratan grupos y métodos específicos.

MUESTREO EN EL PROYECTO CSM-BGBD
La jerarquía de muestreo
En el proyecto fueron seleccionadas áreas de siete países tropicales, con el propósito de evaluar la pérdida de biodiversidad del suelo con el incremento en la intensidad del uso de suelo. Los sitios se localizaron en las principales regiones biogeográficas de los trópicos, desde la selva tropical húmeda Amazónica hasta la selva montañosa del Himalaya, en la India; áreas que presentan una biodiversidad global importante. Cada sitio incluyó un intervalo de usos de suelo desde selvas prístinas relativamente no perturbadas, hasta tierras agrícolas sometidas a uso intensivo, para determinar tendencias comunes, que puedan ser observadas en el cambio de la biodiversidad del suelo en relación con la intensidad del uso del suelo. El uso de métodos estándares de muestreo en los países y sitios de estudio, permite hacer comparaciones entre los sitios. Se adoptó un enfoque para el muestreo dentro de los sitios que hace uso del muestreo por medio de ventanas. Una ventana es (usualmente un rectángulo) una parcela de tierra que incluye en el estudio varios usos de suelo locales y se consideran “representativos” de los sitios de estudio. Típicamente, las ventanas miden entre 2 y 5 km²; estas ventanas de muestreo varían en tamaño y número debido a la configuración del uso del suelo en cada sitio, y sólo se presentó un caso donde el acceso fue problemático. Por ejemplo, se utiliza una ventana más grande para incluir los usos de suelo relevantes en el área y hasta seis ventanas más pequeñas se distribuyen dentro del área para los diferentes usos de suelo requeridos. Una cuadrícula regular (con espacios variables, véase a continuación) se utiliza para identificar un conjunto de posibles puntos de muestreo dentro de cada ventana; los puntos corresponden a las intersecciones de las líneas en la cuadrícula. El muestreo de cuadrícula se usó por las razones descritas anteriormente, eficiencia estadística y para racionar el trabajo de campo. Además, el inventario es de naturaleza exploratoria, sin tomar en cuenta la hipótesis general formulada, pues quedan pendientes las siguientes preguntas: ¿cuáles de los factores que determinan las prácticas intensivas de uso de suelo influyen en la distribución y riqueza de la biota del suelo? y, ¿a qué escala los patrones de distribución espacial se manifiestan? Este
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

79

enfoque es similar al usado para el proyecto de BioAssess, financiado por la Unión Europea, cuyo objetivo, similar al de éste proyecto, fue evaluar la biodiversidad en función de la intensidad del uso del suelo en paisajes agrícolas (véase Ponge et al., 2003; Federoff et al., 2005). La biodiversidad del suelo se muestrea en el nivel de parcela (punto de muestreo o sitio). La cuadrícula define una serie de parcelas, con un objetivo de cerca de 100 a 200 parcelas por ventana. La parcela es un área de, por lo menos, 25 x 25 m determinada por el área mínima requerida para colectar todas las muestras necesarias y realizar su medición, tal y como se describió anteriormente. El principio de co-ubicación es adoptado para análisis de muestras físicas y químicas del suelo y para los inventarios de la biodiversidad del suelo. Al mismo tiempo las ventanas permiten comparar la biodiversidad del suelo entre los componentes del paisaje.

Localización y definición de las ventanas de muestreo y cuadrícula
La posición de las ventanas dentro del sitio de estudio se hace de tal modo que abarque los diferentes usos de suelo. Generalmente, una ventana no puede abarcar los diferentes usos del suelo, por lo que son necesarias otras ventanas más pequeñas. La Figura 2.5 describe las distintas configuraciones utilizadas. La Figura 2.5a ilustra el uso de una ventana de 9 x 11 puntos de muestreo (además de algunos puntos adicionales de muestreo). La figura 2.5b ilustra el uso de 6, 3 y 2 ventanas separadas. En el caso donde se usan seis ventanas separadas, una ventana medirá 1 km², dependiendo de la distancia entre los puntos de la cuadrícula. En sitios caracterizados por fuertes pendientes se esperaría que el gradiente del uso del suelo esté orientado en la misma dirección, y las ventanas estarán entonces localizadas a lo largo del gradiente (Figura 2.5b). En los linderos de la selva en los trópicos, frecuentemente se observa que el patrón de distribución de usos de suelo refleja un gradiente de intensidad de uso de suelo, con un uso más intensivo a mayor distancia de la selva. En tales casos, las ventanas de muestreo se localizan a lo largo de tal gradiente. Se necesita, por lo tanto, contar con suficientes conocimientos de la región antes de seleccionar los sitios de muestreo. Cuando algunos gradientes no son obvios, la selección de las ventanas deberá cubrir dos o tres de los usos de suelo más importantes y, por tanto, también las transiciones observadas con mayor frecuencia de un tipo a otro tipo de uso de suelo. Por ejemplo, en los márgenes del bosque puede darse la transición de bosque a pastizal, bosque a tierras de cultivo o bosque a grandes plantaciones, en donde
80
Manual de biología de suelos tropicales

b) ilustración de la división de una cuadrícula entre seis. utilizando un papel traslúcido sobre la fotografía. tres y dos ventanas.una ventana cubre cada transición típica de uso de suelo.5 Ejemplos de diferentes configuraciones de ventanas de muestreo. se hace una selección manual por interpretación visual. Mapas detallados de uso de suelo y de vegetación también son adecuados para este propósito. antes que un cambio de uso de suelo per se. Cuando únicamente están disponibles materiales análogos. Número de parcelas de muestreo y tamaño de la cuadrícula El número total de puntos de muestreo por área de referencia se mantiene fijo entre 100 y 120. según se requiera. dispuestas a lo largo del gradiente. mientras minimiza los cambios en la biodiversidad del suelo que surgen de los diferentes usos. Cuando se encuentran disponibles mapas digitales de uso de suelo. De esta forma. lo que facilitará la selección de las ventanas. con puntos de muestreo adicionales. Esto permitirá un análisis comparativo de transiciones de uso de suelo (por medidas relativas). se introduce un elemento de replicación. dentro de una ventana definida puede ser determinada utilizando software de Sistemas de Información Geográfica (SIG) estándar. Para la selección de las ventanas de muestreo se utilizaron fotos aéreas o imágenes de satélite de alta resolución. variaciones topográficas o climáticas. el área ocupada por cada uso de suelo. Figura 2. a) cuadrícula completa. Lo anterior se obtiene mediante varias configuraciones de ventana(s) D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 81 .

dando un total de 90 a 105 monolitos muestreados (y el mismo número de muestras agrupadas para evaluar los microsimbiontes) aproximadamente igual al número de puntos en la cuadrícula.. el diseño 82 Manual de biología de suelos tropicales . Eggleton et al. En este sentido Swift y Bignell (2001) argumentan. Por ejemplo. En un muestreo basado en transectos la idea de replicación recomendada por Swift y Bignell (tres transectos por cada uso de suelo) casi nunca se logra. Mientras el tamaño de muestra sigue siendo más o menos igual en los transectos y cuadrículas. descritos anteriormente. suponiendo que existan entre seis y siete usos de suelo distintos por cada área de referencia (correspondientes a seis o siete clases de usos de suelo generalmente definidos en el sistema de clasificación de usos de suelo) donde cada uso de suelo es muestreado por tres transectos. con un transecto extendido en el caso de algunos grupos (por ejemplo. en parte por consideraciones logísticas. 2002. 2003) recomienda un número similar de puntos de muestreo. El número total de puntos de muestreo concuerda con otras estrategias de muestreo propuestas en ejercicios similares de evaluación de la biodiversidad. el proyecto BioAssess (Ponge et al. 2001) tendrá un esfuerzo de muestreo comparable. termitas). La principal diferencia con el enfoque de muestreo de cuadrícula. otra opción es ensamblar de una manera sinóptica por combinación de transectos a lo largo de diferentes años o en proyectos no relacionados (ej. 2003).. más puntos en la misma parcela). un transecto de 40 x 5 m. Davies et al. La captura adicional de especies requiere de un esfuerzo de muestreo considerable. Se añaden puntos de muestreo donde el uso de suelo es altamente variable. Los resultados del inventario del proyecto CSM-BGBD indican que es necesario un esfuerzo mínimo de muestreo de 100 a 120 puntos para poder capturar la mayoría de las especies dentro del sitio. y el procedimiento recomendado por el proyecto ASB (Swift y Bignell. el esfuerzo de muestreo promedio probablemente varía.de muestreo y las dimensiones de las cuadrículas. termitas y hormigas). De esta manera. en el caso de por lo menos algunos de los grupos funcionales (ej. por lo menos. En este último. que para incrementar la confiabilidad de los datos del esquema basado en transectos.. del cual un mínimo de cinco monolitos son cavados para muestrear la macrofauna y cinco muestras conjuntas para los microsimbiontes. el número de puntos de muestreo deberá incrementarse de 5 a 8 por transecto (es decir. cada uso de suelo es evaluado en. es que únicamente se toma un monolito y una muestra agrupada para los microsimbiontes por parcela. Con 100 a 200 puntos por área de referencia generalmente se llega al punto donde la curva de acumulación de las especies para grupos de macrofauna es asintótica.

Se le da prioridad al tipo de agricultura de subsistencia a la hora de incrementar el número de muestras porque es precisamente en esta categoría dónde se espera que ocurra una mayor variación debido al manejo. En números pequeños o en una distribución irregular de puntos de muestreo en los diferentes usos de suelo. en lo que concierne a la evaluación de la diversidad de especies. Reducir el número de puntos de muestreo por categoría de uso de suelo mientras se mantiene el número de categorías de uso de uso de suelo investigado puede comprometer el objetivo de obtener resultados estadísticamente verificables. es importante considerar el número mínimo de puntos requeridos para cada categoría de uso de suelo. el número de puntos por categoría de uso de suelo aumenta. Con menos categorías de uso de suelo presentes. La experiencia del proyecto CSM-BGBD indica que el procesamiento de 100 a 120 muestras es viable con los recursos generalmente disponibles. etc. La colecta de muestras rara vez es el paso que limita la evaluación de la biodiversidad porque la extracción.de muestreo se ajusta a los objetivos del inventario del área de estudio. Dado el alto nivel de variación en las medidas de los componentes de la biodiversidad del suelo. 1998). identificación y catalogación de especímenes son los pasos que requieren mayor tiempo en el proceso (Lawton et al. Número de puntos de muestreo por categoría de uso de suelo Con seis o siete tipos de uso de suelo en cada área determinada. historia. basándose en otros datos o en un estudio piloto. Si la capacidad para procesar y analizar esta cantidad de muestras no está disponible. restringir el número de usos de suelo de manera que el esfuerzo total sea compatible con la capacidad de procesamiento. Se aconseja hacer una prueba piloto para informar el diseño de muestreo. pero aun así se requiere de una campaña organizada en el campo y de instalaciones establecidas para poder procesar y analizar las muestras. un promedio alrededor de 15 puntos por clase de cobertura de suelo resultan de muestrear la cuadrícula.. El número de muestras requeridas por uso de suelo deben ser representativas de la biodiversidad del suelo presente y entonces. el procedimiento correcto para reducir el número total de puntos de muestreo deberá ser estimado. si esta prueba confirma alta variabilidad en la biodiversidad del suelo dentro de las D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 83 . normalmente no todas las especies son capturadas y hará más difícil demostrar las diferencias en biodiversidad del suelo entre los tipos de usos de suelo que normalmente se caracterizan por una alta variabilidad en la riqueza de especies.

6. se necesita una 84 Manual de biología de suelos tropicales . Esto implica adoptar un nivel más alto de detalle en el sistema de clasificación de uso de suelo y. se puede partir de una cuadrícula vacía (que únicamente contenga posibles puntos de muestreo). La definición de un sistema de clasificación de uso de suelo se detalla en el Capítulo 11. Aunque la inserción de puntos adicionales es conveniente. donde la distancia mínima entre puntos necesita ser respetada. se define una cuadrícula mayor (resaltando el número de intersecciones). Esta opción se puede observar en la Figura 2.5a. entonces se hace un ajuste de la definición de clases de uso de suelo. El enfoque de la cuadrícula asume un acceso libre al terreno o parcela donde se localizan los puntos de muestreo. La segunda opción es seleccionar puntos adicionales dentro de las ventanas entre los puntos existentes de la cuadrícula para aquellas categorías de uso de suelo que están siendo muestreadas. deberán hacerse algunos intentos para aleatorizar la selección de los puntos originales para ser divididos en dos. seleccionar las clases de uso de suelo que cubren un claro gradiente en intensidad de usos de suelo. posteriormente. De la misma manera. Posteriormente. de acuerdo con los principios detallados en “Hablando de variabilidad” (arriba). Cuando éste no es el caso. se aplica un procedimiento no-sesgado para restar un número de puntos que permitan contrarrestar el incremento en el número total de puntos de muestreo que resulta de ampliar la cuadrícula. Para este propósito. Una estrategia es usar una “cuadrícula estratificada” según lo ilustrado en la Figura 2. de forma separada hasta que se cumpla con el requerimiento del número mínimo de puntos de muestreo. Para poder seleccionar o eliminar sitios de muestreo (parcelas) es necesario conocer los usos de suelo en cada punto de la cuadrícula y se requiere de un inventario de uso de suelo previo al muestreo de la biodiversidad del suelo. Esta estrategia implica incluir ventanas de muestreo irregulares. Este procedimiento permitirá eliminar los puntos que caigan en tipos de uso de suelo no especificados. Adaptación del enfoque de muestreo a condiciones de campo Hay dos estrategias disponibles para asegurar una representación de los usos de suelo y clases de cobertura en el muestreo.categorías de uso de suelo. mientras se cumplen los requerimientos para el número mínimo de puntos de muestreo para cada categoría de uso de suelo. de tal manera que se cumpla el criterio para un mínimo número de puntos de muestreo en cada uno de los tipos de uso de suelo. con el propósito de seleccionar aleatoriamente puntos de muestreo para cada categoría de uso de suelo.

En el área determinada en La Amazonia en Brasil. en lugar de utilizar una cuadrícula regular que cubriera un área mayor. Distancia entre los puntos de muestreo La distribución de los organismos del suelo puede reflejar gradientes. con D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 85 . En este caso las tierras seleccionadas fueron aquéllas que pertenecían a agricultores que sí permitieron el acceso y se adoptó un patrón específico para muestrear dentro de estas tierras. aquéllos de carbono orgánico y prácticas de cultivo. Los patrones de distribución de los organismos del suelo puede correlacionarse con la topografía. de una a tres ventanas fueron colocadas en cada comunidad disponible. por ejemplo. Por ejemplo: en un área determinada en México. debido al aislamiento de las comunidades. colocando una cuadrícula fija dentro de dichas ventanas.Figura 2. el acceso a las tierras de los agricultores estuvo restringida. estrategia de muestreo alterna.6 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada.

Una distancia de 200 m parece aceptable porque permite un área relativamente mayor de muestreo a través de la cuadrícula y es probable que refleje los usos de suelos más dominantes en la muestra. a 100 m. en el caso de paisajes altamente fragmentados. o bien. si las parcelas individuales miden más de dos a cuatro hectáreas. No obstante. reproducción y competencia (Lavelle y Spain. la investigación de la distribución de patrones específicos no representa un objetivo deseado. con parcelas muy pequeñas (menos de 0. se pueden reducir los espacios en la cuadrícula. se debe considerar aumentar la distancia entre los puntos. También se registra una distribución parchada en una escala miniatura de centímetros a metros. en la mayoría de los casos. Al mismo tiempo reduce la dependencia espacial de las observaciones para la mayoría de los principales grupos de organismos del suelo. que las termitas siguen patrones espaciales en un intervalo de hasta 330 m y que la distribución de especies de nematodos muestra tamaños de parches entre 6 a 80 m. los espacios en la cuadrícula fueron reducidos en el área determinada en Brasil. con gradientes de recursos del suelo. anidadas en estructuras más grandes. atravesar de un punto a otro. En la literatura se pueden encontrar varios ejemplos de la estructura espacial de la biota de suelo sobre distancias de menos de un centímetro hasta de cientos de metros en el campo. Sin embargo. Existen varias teorías para explicar la riqueza extremadamente alta de las comunidades del suelo y el bajo grado de especialización en recursos. con muchos grupos diferentes de organismos del suelo estudiados.los parches de vegetación. En el caso del proyecto de la biodiversidad del suelo. dependiendo de los organismos implicados. vegetación secundaria muy densa dentro de parcelas barbechadas). tales como las lombrices de tierra. Por estas razones. 2001). al mismo tiempo permite. Por otro lado. razón por la que no fueron considerados esquemas de muestreo adecuados para llevar a cabo un análisis de la distribución espacial. con la ubicación de árboles individuales. el muestreo en cuadrícula permite examinar patrones espaciales a escalas entre la distancia inter-muestra y el tamaño de la cuadrícula.5 ha) y donde no es posible atravesar (ej. en la Amazonia. Ettema y Wardle (2002) mencionan que la biomasa microbiana y los colémbolos son espacialmente dependientes en intervalos de más de 200 m. la distribución y agrupación de organismos de suelo también son gobernadas por fuerzas intrínsecas de procesos poblacionales tales como dispersión. 86 Manual de biología de suelos tropicales .

etc. Sin embargo. días de lluvia. materia orgánica del suelo) y características de manejo (tipo de labranza. La definición de clases de uso de suelo resulta importante y se discute en el Capítulo 11 de este manual. El conjunto básico de las propiedades físicas y químicas del suelo debería incluir densidad aparente. y de las características del suelo. diversidad de plantas.) que afectan la distribución de organismos del suelo y se asume que las principales categorías de uso de suelo proporcionan una diferencia significativa. descrita a nivel de las principales categorías de uso de suelo. uso de químicos.Inventario de uso del suelo y caracterización del sitio La hipótesis central plantea que la mayor variación en la biodiversidad del suelo está asociada con la diferencia en la intensidad de usos de suelo. pH. así como las características de uso y manejo del suelo pueden variar considerablemente entre regiones. junto con la altitud. especialmente en sistemas tan diversos como los representados en los trópicos. asumir que una categoría de uso del suelo está en una escala correcta para acomodar su variación puede ser incorrecto. en términos de los factores que determinan la biodiversidad del suelo. duración de secas y la precipitación acumulada hasta la fecha de muestreo. a fin de permitir un análisis completo de los datos para identificar los parámetros que explican la variabilidad en la biodiversidad del suelo. con referencia especial al uso del suelo también es importante de conocer (aunque no siempre se cuenta con este dato). Debido a que se sabe muy poco sobre la importancia relativa de los factores antes mencionados. temperatura y humedad media. la información sobre la precipitación anual. cationes D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 87 . y debido a que las características completas del sitio no pueden ser obtenidas solamente por la apariencia del uso del suelo. lo indicado será incluir una descripción detallada de uso y cobertura del suelo. deberían registrarse para la ventana e incluso para el área seleccionada. Por lo tanto. Existn un número de factores interrelacionados: bióticos y abióticos (ej. Al mismo tiempo. las condiciones bióticas y abióticas. La historia del sitio. pendiente y aspecto. pF (tensión de humedad del suelo). la diversidad del suelo es inventariada independientemente a lo largo de un gradiente de intensidades de usos de suelo para cada área seleccionada. Es posible que la variabilidad en abundancia y diversidad de organismos del suelo dentro de una categoría de usos de suelo pueda ser mayor que la variabilidad entre categorías de uso de suelo. como parte del proceso del inventario. C y N total. textura (la proporción arcilla/arena/limo).

1993). ver Anderson e Ingram (1993). cobertura dominante/abundancia de flora en el nivel del suelo. Idealmente. área basal. Respecto de hongos micorrizógenos arbusculares. En los casos de hongos fitopatogénos y hongos ectomicorrízicos. características como la altura media del dosel. lo que puede ser diferente. dependiendo de los métodos utilizados. pero inmediatamente adyacentes a la zanja de cada monolito (la zanja exterior probablemente sea el mejor lugar). Al3+ y H+. Muestras de suelo son tomados de suelos no perturbados. la actividad de las lombrices de tierra es mayor al final de la época de lluvias (Tondoh y Lavelle. La diversidad y abundancia de especies de leguminosas son de particular importancia en relación con la presencia de las bacterias formadoras de nódulos en leguminosas. en áreas de bosque. especies de plantas y la riqueza de géneros. La producción de esporas responde a la fenología de las plantas y. 2005). El Capítulo 11 proporciona más detalles sobre los requerimientos respecto de usos de suelo específicos. y los resultados del inventario de la riqueza de especies y abundancia (relativa) mostrarán marcadas diferencias entre las épocas.intercambiables. no siempre suele ser factible. puesto que de esta manera surge la posibilidad de correlacionar las propiedades del suelo con la presencia o ausencia de un taxa en particular y grupos funcionales (véase Anderson e Ingram. CIC. la época seca será la más apropiada para muestrear. por esta razón se hace el muestreo al final de la época de lluvias 88 Manual de biología de suelos tropicales . Sin embargo. cuando el método depende del conteo e identificación de esporas. Una descripción de los sitios puede ser completada por el tipo de vegetación. Para el muestreo de otras variables relacionadas con la caracterización del sitio. la evolución de las estructuras y ciclos reproductivos (como la formación de esporocarpos) se sincronizan con los cambios estacionales que ocurren dentro del hospedero y son mejor observados durante y hacia finales de la época de lluvias. acumulación y abundancia de hojarasca. P. Además. También. por ejemplo. en la práctica. el porcentaje de cubierta vegetal. los inventarios deberían elaborarse durante la época de lluvias y también en la época de seca. debido a la senescencia de las raíces. por ejemplo. en el caso de cultivos anuales las esporas son más abundantes durante la época seca. Épocas de muestreo Los organismos del suelo responden a cambios estacionales. ayudan a elegir sitios a lo largo de un gradiente de diversidad botánica que tiene alguna relación con sus posiciones actuales en las cronosecuencias e intensidades de perturbaciones.

B. Nature (Lond). (2003) ‘Evolution of termite functional diversity: Analysis and synthesis of local ecological and regional influences on local species richness’. S. pp. Dubs. G. New York. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 89 . D. vol 90. 195–207. N.. vol 391. London. P. P.. T. CAB International. Agriculture. Dordrecht Lawton. vol 30. REFERENCIAS Anderson. L. (eds) (1998) Ecological Scale: Theory and Applications. D. e Ingram.. Kluwer Academic Publishers. D. P. A. vol 105. Ecosystems and Environment. y Parker. Ford. Kenkel. Eggleton. T. Hauser. G. y Madong. (2007) Sampling Strategies for Natural Resources and the Environment.. T. J-F. E. Columbia University Press. Davies. C. Vegetatio... C. New York. y Hernandez.. L.. Wiley. F. S. New York. (2002) ‘Termite diversity across an anthropogenic disturbance gradient in the humid forest zone of West Africa’. y Podani.. Norgrove. B. L. Bignell. J. Juhfisz-Nagy. D . Larsen. pp. T. P.. (1989) ‘On sampling procedures in population and community ecology’. Fernández-González. R. y Spain.. D. (eds) (1993) Handbook of Sampling Methods for Arthropods in Agriculture. y Wardle. E. Ettema. Bloemers.. Cambridge University Press. 3rd edition. Mawdsley. Jones. Ponge. Boulton. D. (2001) Soil Ecology. Gregoire. N. 847–877. Agriculture. Chapman and Hall/CRC Press.. T.. L. (1998) ‘Biodiversity inventories. 72–76. (2002) ‘Spatial soil ecology’. D. Dibog. M.. F. D. F. P. 283–290. H. Federoff.. y Watt. (2005) “Small-scale response of plant species to land-use intensification”. M. vol 17. J. pp. y Buntin... Pedigo.. P. G. Ecosystems and Environment. Wallingford. (2000) Scientific Method for Ecological Research.. B.E. L. G. P. pp. J. Hodda. y Valentine. I. F. pp177-183. D. Gathorne-Hardy. M. Trends in Ecology and Evolution. 89–202. Stork. y Lavelle. (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. Peterson. N. G. J. (1977) Sampling Techniques. V. R. Hammond. A. P. D... Holt. vol 83. Eggleton. Lavelle. Bignell. 2nd edition. H. Cambridge. A. CRC. Lo último puede realizarse con el objetivo específico de investigar cambios temporales en la biodiversidad del suelo. E. Eggleton. Journal of Biogeography. Srivastava.con la opción de tomar muestras adicionales durante la época de secas. E. indicator taxa and effects of habitat modification in tropical forest’. S. pp. A. Cochran W.

(1996) Adaptive Sampling. (1990) Statistical Methods in Soil and Land Resource Survey. M. R. New York. y Henderson. ASB-Lecture Note 6B . y Seber. S. International Centre for Research in Agroforestry. T. 1093–1121. (1998) ‘An evaluation of the gradsect biological survey method’.. A. 3rd edition. Bogor. A. pp. pp. Soil Biology & Biochemistry.org/SEA/Publications. D. Dubs. y Lavelle. www. Oxford University Press. y Bignell. Ecosystems and Environment. M. Goslee. y Ettema... Urban.. F. P. Tondoh. y Oliver. Ecoscience. S. J. R. (eds) (2001) Standard Methods for the Assessment of Soil Biodiversity and Land-use Practice. L. T.. pp. P. Oxford.. E. (2000) Ecological Methods. F. South East Asian Regional Research Programme. D. K. Gillet. vol 7. Thompson. Biodiversity Conservation. J. (2003) ‘Collembolan communities as bioindicators of land use intensity’. J. P. (2002) ‘Extending community ecology to landscapes’. 31–47. vol 35. Wessels. P. 493–500. J. A. S. Haese. J. Oxford. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. G. F. Eudrilidae) in Ivory Coast’. y Lavelle. Agriculture. (2003) ‘An overview of spatial sampling procedures and experimental design of spatial studies for ecosystem comparison’. vol 94. E. C. 813–826. Indonesia. y Lookingbill. van. Journal of Tropical Ecology. pp.. D. J.. Sousa. K. M. E. S.worldagroforestrycentre. pp. y van der Linde. A. Pierce. Grimbeek. Southwood. vol 21. A. Blackwell Science. Federoff. E. Webster.Ponge. Stein. Jaarsveld. Wiley. K. 90 Manual de biología de suelos tropicales . Swift. 200–202. vol 9.

Bignell. predominan las termitas y las hormigas. en la creación de macroporos y en la transformación y redistribución de materia orgánica. se consideran un componente determinante de la biota del suelo. Agus Karyanto. que habitan especialmente en ambientes tropicales. o que tienen una anchura o diámetro de más de 2 mm. debido a su biomasa. el grupo macrofauna incluye aquellos animales del suelo que miden más de un centímetro de largo. Susilo. e influyen de manera notable en las propiedades físicas y químicas de los suelos. Reginaldo Constantino.Capítulo 3 Macrofauna David E. Csaba Csuzdi. Otros son trituradores que deshacen la materia orgánica y un buen número de estos grupos son macropredadores. sin embargo. los grupos de macrofauna frecuentemente son utilizados o propuestos como indicadores de la calidad biológica del suelo. Mucha macrofauna desempeña un importante papel en los ecosistemas del suelo. Debido a su importante papel en los procesos del ecosistema y a su sensibilidad ante condiciones ambientales. Jérôme Ebagnerin Tondoh y Ronald Zanetti INTRODUCCIÓN Este capítulo describe los métodos para realizar el inventario de la macrofauna del suelo. sobre todo. Julio Louzada. los invertebrados más importantes en el suelo de regiones templadas. termitas. Además. por tanto. aunque éste se concentra en los grupos más significativos: lombrices de tierra. Francis-X. probablemente. Una diversidad de organismos de suelo se incluye en esta categoría (capítulo 1). en ambientes tropicales. Souleymane Konaté. 91 . hormigas y escarabajos. como ingenieros del suelo. Las lombrices de tierra son. indicativos de la biodiversidad de suelo y de los efectos del cambio de uso y prácticas de manejo del mismo.

generalmente alta. 2000). Éstos están basados en monolitos de suelo y. por lo tanto. en el caso de termitas. en un transecto corto (20-40 X 2m) al que ahora han sido añadidas trampas pitfall (principalmente para escarabajos) y otras guías para muestreo casual. en cada una de las siguientes secciones que describe un método en particular. el método de transecto es más adecuado para un inventario de termitas. se requiere de métodos estándares en el muestreo para diversidad. y no simplemente tres páginas que fueron impresas en los métodos originales “TSBF”. Para poder contar con datos de diversidad y abundancia de lombrices de tierra. este capítulo se estructura de acuerdo con el método utilizado y no tanto en función del grupo funcional. Generalmente. Se entiende que los métodos propuestos son aplicados en ambientes tropicales. demuestra cómo ha crecido durante los últimos años nuestra percepción de la importancia de estos organismos. cuyo énfasis se concentra en un grupo específico de organismos asociados y. sin embargo. utilizando cualquiera de los métodos enlistados en el capítulo 2. mientras que las trampas pitfall con cebo son apropiadas para la captura de escarabajos. algunos grupos representativos de macrofauna específica son capturados. No obstante. En este capítulo se describen métodos propuestos para realizar un inventario de macrofauna. podrán ser utilizados más ampliamente. por ende. el punto de partida de desarrollo de los protocolos han sido los procedimientos de Anderson e Ingram (1989. forman un importante componente de la red alimenticia en el suelo. con la extracción de los insectos de los marcos de hojarasca por el método Winkler (Bestelmeyer et al. Nuevos esquemas son propuestos en el diseño de monolitos para mejorar el muestreo de lombrices de tierra. los que generalmente se refieren como métodos “TSBF”. 1993) consolidados y mejorados por Swift y Bignell (2001). En el capítulo 2. en la generalidad de la macrofauna. que sirvan como indicadores para monitorear el cambio de efecto de uso de suelo. y la extracción Winkler es el método más idóneo para la captura y extracción de hormigas de muestras de hojarasca. 92 Manual de biología de suelos tropicales . cada uno de los métodos descritos es idóneo para un grupo en particular: los monolitos son especialmente escogidos para el inventario de lombrices de tierra. Un avance mayor consiste en utilizar el principio de transecto para hormigas y escarabajos. al mismo tiempo. tal y como fueron aplicados en el proyecto CSM-BGBD. abundancia y biomasa. el hecho de que se pueda dedicar un capítulo entero al muestreo de macrofauna. Como en el caso de otros grupos de biota de suelo. se explica que no existe un sólo método para llevar a cabo un inventario de un grupo específico de macrofauna.

excavados de la zanja y la hojarasca pueden ser colectados. Este transecto también puede ser utilizado para hormigas y escarabajos. Se utiliza un transecto adicional de 20 x 2 m para muestrear las termitas.1c y 3.1b). de manera que puedan trabajar varios asistentes en la misma muestra de suelo o en muestras diferentes. en su mayor parte. de 0-10 cm. 10-20 cm y 20-30 cm.50 m². Se revisa manualmente la hojarasca y cada capa de monolito por separado. UTILIZANDO MONOLITOS DE SUELO Macroartrópodos de hojarasca y de suelo. es decir. En una variante del método. Primero se coloca un marco de 25 x 25 cm para marcar la posición del monolito y cualquier hojarasca o madera dentro de él es removida e introducida en una charola (Figura 3. utilizando un machete o parang tomado de forma horizontal y agarrado por ambos lados. con la adición de trampas pitfall (Swift y Bignell. sirve como un buen recipiente para la M acrofauna 93 . serán milpiés y lombrices de tierra con bajas densidades de población. son dictados por Anderson e Ingram (1993). hay que meter la muestra en un bote de 19 L y llevarla al laboratorio. 2000). Se divide el bloque del monolito en tres capas. pero que representan una biomasa importante. preferentemente en el lugar y bajo sombra. esto se puede hacer de manera sencilla.. HOJARASCA Y LOMBRICES DE TIERRA EN PARTICULAR. 2001) y las extracciones con trampas Winkler (Bestelmeyer et al. Para revisar el suelo es conveniente utilizar la superficie de una mesa grande de campo para llevar a cabo la extracción.1d). con un reborde. Para la discusión del número y posicionamiento de monolitos. aunque es mejor si se muestrea la hojarasca delimitada por marcos dispuestos en una línea paralela.INVENTARIO DE MACROARTRÓPODOS DE SUELO. una charola de plástico grande de cocina. En el caso de la hojarasca. véase el capítulo 2. con dimensiones de 50 x 50 x 20 cm de profundidad para lombrices de tierra. Se aísla el monolito utilizando una pala a unos pocos centímetros fuera del marco y luego se cava una zanja a su alrededor de 25 cm de ancho y 30 cm de profundidad. todos los invertebrados mayores de 10cm de largo. Monolito TSBF Los procedimientos generales. éstos. Su abundancia y biomasa podrán ser calculadas con base en las muestras de 0. La muestra de suelo en botes se debe guardar alejada del sol directo y deberá ser revisada antes de 24 horas. Si no hay mucho tiempo o si la luz es insuficiente (colectar en selva cerrada es difícil porque la luz disminuye muy temprano).1a y 3. aislando el monolito como un pilar no perturbado (Figuras 3. la anchura aproximada del monolito más dos anchuras de zanja. junto con monolitos extraídos del suelo.

montículo. pasándolo a través de un tamiz de malla grande.). termitas y escarabajos colectados. madera podrida. Las hormigas pueden ser extraídas tomando un puñado de suelo. generalmente. deberán preservarse en alcohol al 80%.2.revisión. Para evitar confusión en lugares ricos. las etiquetas deberán escribirse en el momento en que los especímenes sean introducidos en los tubos o frascos. 94 Manual de biología de suelos tropicales . hormigas o escarabajos. las pequeñas ramas deberán romperse y ser golpeadas en la charola para que se desprenda cualquier insecto que contengan. Las lombrices de tierra y moluscos. suelo de raíz de árbol. de 5 mm. en el caso de las termitas. como en el caso de un transecto. no usar bolígrafo o pluma): • Fecha y clave de identificación del lugar. Se diseccionarán los pedacitos de madera en diferentes piezas para ver si hay termitas. • El microhábitat en cuestión (madera nueva. sin embargo. Se añadirá una etiqueta dentro del alcohol o formaldehído. hojarasca. En otros casos.3 ó 4). suelo. las etiquetas se pueden hacer cuando se ha completado la extracción en cada sección del transecto. La información es importante para establecer la naturaleza de los organismos encontrados (especialmente la diversidad de grupos funcionales) y para construir una curva de acumulación de especies. Las hormigas. madera seca. se conservan en formol (formaldeído) al 4% para evitar la supuración de la mucosa. • En el caso de transectos o monolitos alineados. Protocolo de muestreo alternativo para evaluar la abundancia y diversidad de lombrices de tierra en ecosistemas tropicales Introducción Este protocolo alternativo combina el llamado monolito de suelo TSBF (25 x 25 x 30 cm) y tres grandes monolitos (50 x 50 x 20 cm) para evaluar la abundancia y diversidad de lombrices de tierra a nivel local y de paisaje en ecosistemas tropicales. se incluirán soldados. cuando se hace la extracción durante un tiempo determinado. el número de la sección en el transecto en donde se encontró el espécimen (1. al igual que obreras. Se deberá utilizar un tubo o frasco por cada especimen o población encontrada (o colonia aparente). en una charola. en la que se anotan los datos siguientes (con lápiz o tinta indeleble. El tamiz retiene las hormigas que pueden ser aspiradas. el periodo destinado deberá incluir el tiempo para el llenado de la etiqueta. etc.

(2000) para Asia y Decaëns et al. 1993) para macroinvertebrados. Por más de una década.1 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). Haymes et al. véase Bhadauria et al. siendo la unidad de muestreo. un monolito cuadrado de suelo de 25x25 cm y de 30 cm de profundidad. antes de muestrear el monolito. por lo menos. Dlamini y Haynes (2004) para el muestreo de lombrices de tierra en África. A B C D Nota: las ilustraciones A y B muestran la colocación de un marco de madera para delimitar el monolito y la limpieza de hojarasca suelta. M acrofauna 95 . (2004). (2002) y Mathieu et al.Figura 3. (1995). satisface el requerimiento de rapidez y la necesidad de tomar en cuenta la heterogeneidad del suelo a nivel parcela. La ilustración C muestra un monolito grande (50 x 50 x 30 cm) y la D un monolito pequeño (25 x 25 x 30 cm) y la excavación de la zanja. 2004). (2003). véase Gilot et al. la mayoría de los estudios sobre lombrices de tierra han sido elaborados utilizando el método TSBF (Anderson e Ingram. para ejemplos de América del Sur. cinco monolitos por parcela bajo estudio. Barrios et al. los monolitos se distribuyen a lo largo de un transecto corto (40 m) con. En todos los casos. (1994.

Lavelle. (1999) y Agosti et al. Se seleccionan cinco puntos de muestreo al azar. Burel et al.. 1997. ha sido reportada para monitorear la dinámica de población de la lombriz peregrina Hyperiodrilus africanus (Tondoh y Lavelle. 1997. en cada punto de muestreo se extrae un pequeño monolito de 25 x 25 x 30 cm que se rebana en tres capas: 0-10 cm. 2001. (2000). pero consumen mucho tiempo y resultan tediosos. Las lombrices de tierra son colectadas a mano. Vincent. permite tomar en cuenta la variación a 96 Manual de biología de suelos tropicales . Tal avance será crucial para desarrollar indicadores de degradación de suelo (Moreno y Halffter. el muestreo debería realizarse al final de la temporada de lluvias. 1998) porque las lombrices de tierra son reconocidas por presentar sensibilidad ante la perturbación antropogénica (Fragoso et al. se estudió la demografía de lombrices de tierra. 2005). utilizando grandes monolitos de suelo de 1 m² x 40 cm de profundidad. que combina pequeños y grandes monolitos. 2002). Este esquema de muestreo estratificado. el reto será desarrollar un protocolo de muestreo rápido para muestrear a nivel paisaje. aunque pequeños monolitos han sido utilizados con éxito para identificar cambios importantes en la diversidad de lombrices de tierra a nivel parcela. 2002). 1969. aunque pocas investigaciones se han enfocado a la evaluación de la abundancia y diversidad de lombrices de tierra en paisajes agrícolas. Fragoso et al. han propuesto protocolos de muestreo más exhaustivos para muestrear termitas y hormigas. Protocolo de muestreo De manera ideal. en cada tipo de uso de suelo. bajo diferentes prácticas de manejo de suelo (Fragoso et al. por ejemplo. Los monolitos de tamaño medio (50 x 50 x 40 cm) fueron utilizados por Ortiz-Ceballos y Fragoso (2004) para evaluar el impacto de una cobertera en poblaciones de lombrices de tierra. Se pueden usar argumentos similares para justificar un muestreo más extensivo de lombrices de tierra. 1978). cubriendo grandes áreas. Como las prácticas agrícolas contemporáneas muestran un mosaico de tipos de uso de suelo. 2005). una combinación más eficiente de 100 x 100 x 40 cm para grandes y de 25 x 25 x 30 cm para monolitos pequeños de suelo. Eggleton et al.A pesar del éxito relativo del método TSBF para estimar la abundancia y diversidad de los macroinvertebrados del suelo.. Originalmente. 1999. debido a su especificidad de grupo funcional. cuando se sabe que las lombrices de tierra son más activas (Tondoh y Lavelle. la carencia relativa de centros de colonias y su distribución altamente parchada. Decaëns y Jiménez.. Decaëns y Jiménez. 10-20 cm y 20-30 cm. Recientemente. respectivamente.

porque la mayoría de los especímenes (57-99%) son localizados en los primeros 20cm durante la temporada de lluvias (Tondoh y Lavelle. con un punto de partida elegido al azar. en intervalos de 5 m. Anderson e Ingram. cuando se considere apropiado (TSBF modificado. Los individuos después son identificados. De manera adicional. El transecto aparece representado esquemáticamente en la Figura 3. contados y pesados. mientras la variación a nivel paisaje se hace con un muestreo en los usos de suelo más representativos. Cada monolito mayor se separa en dos capas (0-10 y 10-20cm) y no en tres.2. las lombrices de tierra son muestreadas.Figura 3. de acuerdo con el procedimiento de TSBF (Anderson e Ingram. perpendicular a la pendiente. 1993). En cada punto seleccionado. M acrofauna 97 .2 Esquema de alineación de monolitos complementarios de lombrices de tierra. 2005). se extraen tres grandes monolitos de 50 x 50 cm y de 20cm de profundidad. como en los pequeños monolitos. 1993). Monolitos adicionales son extraídos para poder tomar en cuenta la heterogeneidad a nivel de la parcela.3) y son almacenadas en una solución de formol al 4% para su posterior identificación. a lo largo de un transecto. Monolitos grandes (50x50x20 cm) Monolito pequeño (25x25x30 cm) nivel parcela de las poblaciones. Las lombrices de tierra se colectan a mano (Figura 3.

se debe consultar la descripción original de especies. Para las especies africanas de Eudrilidae y Acanthodrilidae (Benhamiinae) se pueden utilizar las revisiones de Sims (1980. 1987) y Csuzdi (1996) y. Desgraciadamente. Las especies de lombrices de tierra peregrinas comunes. las especies nativas requieren de la pericia específica del país. Fragoso y Rojas-Fernández. cuando sea necesario. 2001. Zicsi. por lo tanto. Identificación de lombrices de tierra y estimaciones de su abundancia Especímenes de lombrices de tierra. son identificables a nivel especie utilizando las guías y descripciones dadas por Blakemore (2002). sin embargo. La abundancia de lombrices de tierra se estima 98 Manual de biología de suelos tropicales . 2005) son los principales puntos de referencia. no existen a la fecha monografías disponibles para la identificación de lombrices de tierra de América Central y América del Sur. debido a la carencia de guías comprensivas para su identificación. Sims e Easton (1972). 1971. previamente agrupados como morfoespecies. Easton (1979) y Julka (1988) son las apropiadas. 1995. que se encuentran distribuidas en toda la región tropical.3 Separación a mano de lombrices de tierra en charolas de plástico. utilizando las claves desarrolladas por Blakemore (2005). 1994. las monografías de Gates (1972). Para la identificación de lombrices de tierra de la India y del Sureste de Asia.Figura 3. pueden ser identificados a nivel de familia. la revisión de Eisen (1900) y estudios seleccionados de varios autores (Righi.

1981): 1. 1997 y Lavelle et al. Blanchart et al. 1996). con pigmentación y que viven en la hojarasca. Fragoso et al. en cada tipo de uso de suelo. con este enfoque. M acrofauna 99 . 2. se lleva a cabo mediante la identificación en cada tipo de uso de suelo de especies nativas y exóticas o peregrinas. producen excretas dentro del perfil del suelo y sobre la superficie. no pigmentadas y que viven dentro del suelo. a nivel de la superficie del suelo. 1997.. Como resultado de su actividad. Lavelle 1983. El primer nivel de diversidad taxonómica trata del número y de la identidad de especies de lombrices de tierra. Se pueden utilizar tres categorías de expresión de la riqueza de especies: 1) el número de especies registrado en todos los monolitos.. Dentro de un ecosistema dado.. 1997). introducidas por interferencia humana. El análisis de comunidades de lombrices de tierra. 1977). en casi todos los casos. 2) la diversidad promedio expresada en términos de la media de número de especies por cada tipo de uso de suelo y 3) el índice ShannonWiener de diversidad (Pielou. Especies nativas son las caracterizadas por una distribución restringida a nivel local.. dos grupos de lombrices de tierra pueden ser distinguidos de acuerdo con su origen: especies nativas o exóticas. La estructura de las comunidades de lombrices de tierra puede ser caracterizada por la densidad y biomasa de lombrices nativas y exóticas La importancia de la diversidad funcional en las lombrices de tierra ha sido ampliamente documentada (Lavelle. Desde el punto de vista ecológico. regional y continental. Lavelle. 1977. El aspecto funcional de la diversidad resulta de gran interés para evaluar la relación entre diversidad y servicios del ecosistema. 1983. La diversidad de lombrices de tierra se estudia en dos niveles complementarios: diversidad taxonómica y funcional (Bouché. 1997). El segundo nivel de diversidad taxonómica trata de la biogeografía de lombrices de tierra (Fragoso et al. La relación nativas vs exóticas puede utilizarse como un índice para calcular la extinción de especies nativas o como un claro indicador de la invasión de especies exóticas o peregrinas. 1977. las comunidades de lombrices de tierra pueden dividirse en tres grupos (Bouché. éstas han sido llamadas peregrinas para indicar su amplia distribución a niveles regionales y continentales (Lee...como el número de individuos por m² y la biomasa como g de individuos por m². 1997). Los servicios que proveen las lombrices de tierra al ecosistema se relacionan con el impacto de su actividad en el sistema de suelo (Lavelle et al. Lombrices endógeas: de tamaño medio. Lombrices epígeas: de tamaño pequeño. mientras que las especies exóticas son. 1987). Fragoso et al.

fue desarrollado para bosques o localizaciones recientemente derivadas como en la agricultura de roza. aunque se ha acortado a 20 m en el protocolo estándar. por lo que los transectos se tratan separados de los monolitos y de las trampas pitfall. El método. Equipo requerido Brújula. pero comen en la superficie. Lombrices anecicas: de tamaño grande. Cada persona lleva un machete o parang afilado. Swift y Bignell (2001). La mayoría de las lombrices de tierra que pertenecen a los tipos endógeos y anecicos son destacados ingenieros del ecosistema (Lavelle et al. 1997) porque son activas mezclando y cavando el suelo. marcada en secciones de 5 m. A las lombrices de tierra se les puede asignar una categoría ecológica o grupo funcional y posteriormente comparar dichos grupos con base en su densidad y biomasa. HORMIGAS. Este método se considera de bajo impacto y resulta idóneo para ser usado por aquellos que no son especialistas en termitas y puede ser completado en cada punto de muestreo por dos personas en un día (dos días para un transecto de 100 m). ESCARABAJOS Y LOMBRICES de tierra Introducción Este método utiliza un transecto de 100. sin pigmentación y viven en el suelo.. se basa en un transecto de 100 m. y sigue las descripciones formales de Jones e Eggleton (2000). Sus actividades forman una red densa de túneles dentro del suelo. relativamente. cinta métrica de 30 m o preferiblemente cuerda de nylon o mecate. para el proyecto CSM-BGBD y a 50 m en el esquema alternativo de muestreo (véase Capítulo 2). tal y como se describe y desarrolla más adelante.3. tumba y quema. 50 o 20 x 2m. Los datos obtenidos son cualitativos (identificación y número de especies) y/o semi-cuantitativos (abundancia relativa de especies y/o grupos funcionales específicos). presentan una alta resolución. modificando así las propiedades hídricas y químicas del mismo. utilizando cinta naranja o amarilla fluorescente o a prueba de agua y un palo de 2 m. aunque se considera que. una 100 Manual de biología de suelos tropicales . MÉTODOS DE TRANSECTO PARA TERMITAS.

pueden inclinarse para alcanzar ángulos de hasta 90°. Frecuentemente se necesita evaluar. de manera simultánea. tales como pendientes. Se coloca el transecto de manera que visualmente atraviese los alrededores de manera homogénea. siempre que por lo menos una parte del sistema de raíces quede dentro de la cinta de muestra de dos metros de ancho. En una parcela pequeña. Procedimiento Se traza una línea de transecto de 20. acantilados o caminos en uso que no sean hábitats adecuados para termitas. un transecto puede curvarse sucesivamente por dos ángulos de 90° para que corra hacia atrás hasta su punto de partida. 50 o 100 m junto al monolito. de modo subjetivo. para evitar obstáculos naturales. para poder replicar un monolito) los transectos deberán posicionarse para evitar interferencia mutua y separarse. evitando grandes arroyos. Las líneas de transecto no necesariamente tienen que ser rectas. pero los dos “brazos” principales de la línea del transecto deberán encontrarse. Si se emplean otros transectos en la misma parcela (por ejemplo. de alrededor de 8-10 cm. dirección del transecto con la brújula y cualquier cambio de dirección. cuando se trata de decidir sobre la línea ideal. un cuchillo de campo de hoja fija. a 15m de distancia.cuchara de albañil. con alcohol al 80% (se necesitarán más para hábitats ricos en termitas). No obstante. alrededor de 40 frasquitos de aproximadamente 1 x 5 cm. el transecto se puede desviar hacia un lado. una charola de plástico o metal con reborde alto. en cada sección de 5m. Se debe asegurar que las líneas de pitfall se mantengan sin perturbación en todo momento. sin embargo. se pueden colocar dos transectos de 50m (o de 10 m) para que queden en paralelo. especialmente en los casos de pequeñas parcelas. a una distancia suficiente para evitar cualquier perturbación durante el muestreo. estrechas zanjas con arroyos o cortes en el dosel. El muestreo se estratifica por M acrofauna 101 . siempre que no se crucen con ellas mismas. por lo menos. de área basal muy grande. El tiempo requerido para realizar transectos de 20 m es de 30 minutos de muestreo por dos personas. Si la línea atraviesa un árbol. Alternativamente. dos pares de pinzas. puede ser útil para picar madera o suelo. para evitar pisadas excesivas en un solo lugar. ese tiempo podrá reducirse si se trabaja con varios equipos de dos personas. Un equipo de dos personas será capaz de muestrear entre 8 y 12 secciones por día (2 a 3 transectos). el transecto puede incorporar otros fenómenos naturales del ambiente biótico que contribuyen a su heterogeneidad física. Es necesario anotar el punto de partida. en diferentes secciones.

sin olvidarse de las ramificaciones o de los helechos que pueden acumular suelo que contenga termitas. madera en todas sus etapas de descomposición.4). junto con sus cámaras centrales.nichos. se recomienda completar no más de 12 secciones en un día. o cubierta de pedazos de suelo. También resulta de ayuda descansar unos minutos entre secciones. frecuentemente contiene termitas. lombrices de tierra y. Los pedazos más grandes de madera deberán cortarse tomando en cuenta que pueden estar infectados en alguna parte. un transecto de entrenamiento. En la mayoría de las localizaciones no es necesario colectar cada termita y las especies más comunes podrán ser ignoradas después de muestrearse inicialmente para poder buscar las formas más raras o crípticas o para buscar soldados en especies que tengan una relación relativamente baja de soldado/obrero (tomando en cuenta que algunas especies no tienen soldados). Otras especies pueden habitar montículos y nidos o podrán coexistir con los que están construyéndolos. El suelo. posiblemente. esto ayuda mucho a ver las termitas (Figura 3. Normalmente se requiere de un corto periodo de entrenamiento u orientación para que colectores sin experiencia puedan muestrear con la misma eficiencia que un experto. por ello se permite interrumpir la labor 102 Manual de biología de suelos tropicales . acumulaciones profundas de hojarasca y suelo entre grandes raíces que funcionan como retenedores. El tronco de un árbol vivo puede ser investigado para ver si contiene túneles de termitas a una altura accesible. Es imposible muestrear con lluvia fuerte. incorporada en el suelo de superficie. nidos de termitas o pistas de tierra en troncos de árboles y otra vegetación. la hojarasca y los restos de madera pueden diseccionarse rápidamente en charolas. Idealmente. escarabajos y lombrices de tierra en nichos crípticos o cuando escasea la luz. Los palitos deberán romperse en pedazos y golpearse moderadamente en las charolas para desplazar cualquier termita u hormiga que contengan. de 50 ó 100 m. es aconsejable comprobar la periferia y la base de la estructura. por esta razón y para poder minimizar la necesidad de tener que trabajar con escasa luz. Los colectores deberán trabajar de manera constante (no frenética) en cada uno de los periodos de muestra de 30 minutos y tratar de mantener el mismo nivel de eficiencia de muestreo en cada sección del transecto. debería muestrearse la primera vez bajo la supervisión de un colector experimentado. otros invertebrados. sin necesidad de usar una escalera o tener que trepar (alrededor de 2 m). Los siguientes micronichos son investigados con detalle: hojarasca y la superficie del suelo hasta una profundidad de alrededor de 5 cm. nidos subterráneos epígeos y arbóreos y montículos de una altura de hasta 2 m sobre la superficie del suelo (incluyendo nidos de bolsitas suspendidos en la vegetación). La madera podrida. por lo tanto.

es importante observar el protocolo de muestreo con precisión. En los transectos donde se encuentran pocas termitas. cada persona trabaja en una cinta de un metro de ancho.5 x 2 m. hasta que mejoren las condiciones climatológicas. por ejemplo. contener soldados y obreros. El trabajo puede dividirse entre los colectores. Nota: las pinzas finas son idóneas para atrapar insectos con cuidado. por lo menos. sin dañarlos. Esto dependerá de la naturaleza del lugar y de la topografía. de manera que mientras uno muestrea la madera. se puede usar un pincel de artista humedecido con alcohol para depositar el espécimen en el frasco colector. en lo posible. una docena de lugares separados en cada sección del transecto. en lados opuestos de la línea.4 Extracción de termitas de una muestra de suelo en una charola de aluminio. en el M acrofauna 103 . previo acuerdo. para dividir cada sección en dos subsecciones de 2. Procesamiento de especímenes Los especímenes representativos de las termitas encontradas deberán ser preservadas en alcohol al 80% y. Se debe destinar un tubo de especímenes para cada población (o colonia aparente). sin interrumpir el trabajo. a pesar de que se trate de una pequeña cosecha. Alternativamente. Se recomienda que el suelo se extraiga en.Figura 3. el otro examina el suelo y las raíces de los árboles. sección a sección.

se podrán escribir etiquetas o notas. donde se anotan. los treinta minutos para el trabajo deberían incluir el etiquetado. suelo a raíz de árbol). todas las etiquetas seguirán el mismo patrón. en lugares ricos en termitas. los siguientes datos: • Fecha y clave del transecto. con lápiz o tinta indeleble y no. sin embargo. lo que facilitará el trabajo. para los taxónomos expertos. Todas las notas de campo se guardan en la libreta y. 2. al completar cada sección del transecto. hojarasca. razón para destinar un mínimo de dos días a cada transecto de 100 m (proporcional para transectos más cortos).). en orden secuencial. madera seca. se añade alcohol fresco y se escriben las etiquetas nuevas). Los especímenes pueden resultar dañados o afectados en su color por el suelo o basura contenido en el frasquito. el mismo día en que son colectados o tan pronto como sea posible. Al tratar cada sección de 5 m. con pluma o bolígrafo. por morfoespecies o especies nombradas. reduciendo así las posibilidades de cometer errores en la numeración. La información referente al micronicho en donde se encuentra cada espécimen es importante para poder establecer la naturaleza de la comunidad de termitas (especialmente la diversidad funcional del grupo) y para construir una curva de acumulación de especies. se podrá construir una curva de acumulación por especies basada en especímenes o simplemente por especies.cual se introducirá una etiqueta. razón por la cual deben limpiarse lo antes posible (se separan las termitas del suelo o de la hojarasca. En otros lados. • Número de sección en el transecto donde se encontró el espécimen (1. se podrán imprimir etiquetas numeradas. los números de las etiquetas estarán relacionados. Se generan diez secuencias al azar de las secciones por 104 Manual de biología de suelos tropicales . utilizando una impresora láser. 3. suelo. como una muestra independiente. que se cortarán y pegarán en una libreta de campo. montículo. madera podrida. Las termitas deberán separarse en unidades taxonómicas reconocidas. • El micro hábitat en cuestión (madera fresca. Alternativamente. Lo anterior hace que el procesamiento sea más eficiente. Para evitar la confusión. en el campo únicamente se añaden las etiquetas a los frasquitos y se toma nota en la libreta de campo de los números por sección y del transecto. etc. se deberán escribir las etiquetas (o las notas de campo) tan pronto como se hayan colocado las termitas en los tubos de especímenes. por lo que se podrán leer con mayor facilidad. por lo tanto.

Chao y ACE. o bien. sin reemplazo. 2004) que son implementados por el software libre EstimateS (Colwell. en el lugar 2. dependiendo del lugar y de la región biogeográfica. normalmente requiere una pericia taxonómica alta. entre otros (Magurran. Las especies y morfoespecies encontradas por transecto pueden ser desde sólo unas cuantas hasta más de 50. Identificación El primer paso para compilar una lista de especies y organizar los datos del ensamble de las especies encontradas. También es importante que las morfoespecies “A”. es importante utilizar el mismo esfuerzo de identificación y métodos. Las muestras y los especímenes necesitan ser etiquetados y organizados cuidadosamente. 2000. 2004). género y especie. en un museo. el resto. de manera permanente. indicando que se encontrarían pocas o nuevas especies con transectos adicionales en el área. se separaran en morfoespecies. tales como Jackknife de primer orden y Jackknife de segundo orden. lo que resulta muy laborioso en términos de tiempo. trabajando desde niveles altos como órdenes hasta familia. La colección entera deberá ser preservada durante un tiempo después de la identificación para su posterior confirmación y se debe de depositar. es decir. la identificación consiste en la determinación de la posición de un espécimen en la clasificación existente. debería subir y posteriormente inclinarse. Una curva ideal debería ser asintótica. Cuando se comparan datos de diferentes hábitats o localidades. El número de especies encontradas en cada sección se usa para calcular el número acumulativo de especies. en el lugar 1. M acrofauna 105 . se identificaría a nivel género y. un subjuego en una colección de una institución nacional. finalmente. para cada selección de las diez secuencias. La identificación de organismos de suelo. a nivel especie. pero esto muchas veces no es posible para algunos grupos de organismos de suelo. sean las mismas que “A”. Una taxonomía pobre podría resultar en una baja o sobreestimación de diversidad y similitud de especies y hacernos llegar a establecer conclusiones erróneas. se calcula la media acumulativa de especies de los diez juegos de 20 secciones para cada sección y se construye una curva de acumulación de especies. será identificar cuáles son las que están presentes en la muestra. Una manera más realista sería obtener la lista final. La riqueza específica del lugar puede ser estimada utilizando métodos de extrapolación. Lo ideal sería que todos los especímenes fueran identificados hasta especie. parcialmente compuesta por especies identificadas y.medio de un trazo (en cada secuencia) de 20 secciones al azar.

Termes sp. compare). fueron identificadas plenamente a nivel especie. aunque frecuentemente se recomienda. b) comparaciones con descripciones. lo cual generalmente resulta más práctico que un “orden taxonómico” subjetivo. No obstante. A y Termes sp. El paréntesis que abarca el nombre de los autores indica que la especie fue originalmente descrita en otro género y después se transfirió al género actual. el Código Internacional de Nomenclatura de Bacterias (Sneath. por ejemplo. a modo de rutina. B fueron identificadas únicamente a nivel género y morfoespecie. 2000). tienen un significado y su uso se determina de acuerdo con las reglas de nomenclatura. los Códigos de Nomenclatura contemplan reglas muy estrictas de formato para nombrar autores. La abreviación “cf” en el caso de Coatitermes y Armitermes. Se trata de una lista organizada en orden alfabético. será el Código Internacional de Nomenclatura Zoológica (Comisión Internacional de Nomenclatura Zoológica. similis. c) comparaciones con colecciones de referencia y d) envío de especímenes a un experto taxónomo. La Tabla 3. pero no es obligatorio. Tal abreviación se usa para indicar que la identificación es incierta. para grupos de organismos diversos o poco conocidos. por lo tanto. 1992). que deberán ser respetadas: los géneros y especies se imprimen en cursiva. hormigas y escarabajos en el apéndice 1 y listas más especializadas en las publicaciones 106 Manual de biología de suelos tropicales . El formato de los nombres deberá seguir el código respectivo de nomenclatura. En el caso de animales. se utilizan con la misma connotación o de manera similar. el Código Internacional de Nomenclatura Botánica (Greuter et al. ocasionalmente. excluyendo animales. si existen. Nota que las abreviaciones “sp” y “cf” no aparecen en cursivas. Se utilizan.Los métodos comunes de identificación de la fauna del suelo incluyen: a) uso de claves de identificación publicadas. de manera particular. Se muestran tres niveles de identificación. para plantas.1 presenta un ejemplo de una lista de especies. N. Los paréntesis. corniger y N. Lista de guías y catálogo de identificación Se puede consultar una lista integrada de claves de identificación para termitas. técnicas moleculares para la identificación de microorganismos. Otras abreviaciones. El dato de autor y año de publicación no forma parte de un nombre de especies y su uso es opcional. y para bacterias. (abreviación del latín confer. nunca se deben utilizar nombres manuscritos no publicados. 1999). Consulta un catálogo taxonómico que te permita comprobar la validez y cómo se deletrean los nombres.

No. 18 Angularitermes sp.Tabla 3. 14 Angularitermes sp. 2 Angularitermes sp. 16 Angularitermes sp. 13 Angularitermes sp. 4 Angularitermes sp. 12 Angularitermes sp. peruanus Caetetermes taquarussu Constrictotermes cavifrons M acrofauna 107 . 6 Angularitermes sp. 5 Angularitermes sp. 15 Angularitermes sp. 19 Araujotermes nanus Armitermes holmgreni Armitermes minutus Armitermes teevani Atlantitermes osborni 1 1 1 13 9 13 46 2 2 1 15 7 1 1 1 1 1 2 2 6 1 7 3 4 1 3 1 2 1 1 5 1 1 1 1 1 4 14 1 6 1 6 25 8 1 1 2 19 20 3 1 9 4 10 71 47 3 10 1 2 16 7 1 3 Armitermes cf. Angularitermes sp. 17 Angularitermes sp. 1 Angularitermes sp. 10 Angularitermes sp. 8 Angularitermes sp. 11 Angularitermes sp. 3 Angularitermes sp.1 Ejemplo de lista de especies. 9 Angularitermes sp. 7 Angularitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Kalotermitidae Angularitermes nasutissimus Angularitermes sp.

A Nasutitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 Coptotermes testaceus Cornicapritermes mucronatus Cornitermes pugnax Cornitermes sp. J Nasutitermes surinamensis Nasutitermes unduliceps 1 Nasutitermes wheeleri Neocapritermes pumilis Neocapritermes sp.1 Continúa. Neocapritermes talpa 1 2 6 1 1 1 108 Manual de biología de suelos tropicales .Tabla 3. I 5 1 10 9 10 1 22 4 1 1 1 3 85 1 6 29 1 35 6 1 89 4 2 8 3 2 7 4 1 10 7 1 18 2 2 3 15 1 12 17 21 1 56 29 6 2 11 1 9 1 5 29 1 1 2 16 1 1 1 37 19 1 Nasutitermes sp. Curvitermes odontognathus Cylindrotermes flangiatus Cylindrotermes parvignathus Embiratermes parvirostris Heterotermes tenuis Labiotermes psilus Microcerotermes strunckii Nasutitermes callimorphus Nasutitermes corniger Nasutitermes gaigei Nasutitermes guayanae Nasutitermes octopilis Nasutitermes sp. No.

41 0.4 M acrofauna 109 . Ruptitermes sp.4 1 5 2 2 1 3 8 7 471 50 39 2.8 203 18 13 2.90 25.1 Continúa. Planicapritermes planiceps Rhinotermes hispidus Rhinotermes marginalis Rotunditermes bragantinus Rugitermes sp. 2 Ruptitermes sp.6 4 Muestras Especies Transectos Índice Shannon(H) Índice Simpson Rarefacción (100 muestras) Estimación de Chao 86.7 Estimación de Jackknife 1 74.90 26.96 34.01 .2 18.1 3 119 15 10 2.81 14.6 81. 3 Subulitermes baileyi Subulitermes microsoma Syntermes molestus Syntermes spinosus Syntermes territus Termes hispaniolae Termes medioculatus Triangularitermes sp.3 50.80 14. 1 Ruptitermes sp.04 . 3 Triangularitermes triangulariceps Velocitermes sp. No.3 52.8 72. 1 6 8 1 1 1 2 1 1 1 2 3 9 3 6 5 1 1 5 1 1 1 9 9 259 52 20 3.91 .3 17. Especie Selva Barbecho Cultivo Agroforestal Pastizales 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Neocapritermes taracua Neocapritermes villosus Obtusitermes sp.Tabla 3.4 3 2 1 229 35 18 2.3 25.80 .1 25.

aparentemente. junto con su calidad. que se centran en una sola región. esto se obtiene como resultado de la anotación del número de especies y morfoespecies. Si los detalles bibliográficos no están incluidos en la tabla. pueden consultarse en la lista de literatura. desde muestreo en campo hasta identificación y análisis de datos.taxonómicas para termitas. en relaciones ecológicas actuales. Los ensambles pueden o no. El mejor enfoque para identificación. es necesario extrapolar de la muestra y utilizar estimaciones comparables de la diversidad local. al final del presente capítulo. cuentan con sus propios manuales. Las termitas distribuidas en el perfil de suelo. otra información puede ser obtenida del transecto. la cual se puede definir y estimar por varios métodos. La caracterización de un ensamble de especies involucra varios pasos. antes de tomar las muestras. Aunque la información básica generada es la de riqueza especifica. en los apéndices 2 y 3. Invariablemente. por ende. varían entre el taxa y entre regiones. por lo que muchos museos o instituciones científicas dedicadas a la taxonomía y conservación de la biodiversidad. Lo más importante es la diversidad funcional del grupo. pero este término no es correcto. Los ensambles de diferentes hábitats o localidades pueden compararse con varias estimaciones o índices y agruparse de acuerdo con sus similitudes. Algunas veces se refieren a “comunidades de especies”. Las termitas pueden colocarse dentro de las siguientes categorías tróficas: • Las que se alimentan del suelo. Existe también una “literatura gris” extensiva de reportes de talleres. conferencias y documentos producidos por proyectos de desarrollo internacional sin una distribución global. con un grado de selección de limos y fracciones de ar110 Manual de biología de suelos tropicales . será el entrenamiento o bien que el procesamiento de especímenes esté a cargo de un taxónomo con experiencia. pues dichos ensambles son delimitados por una clasificación taxonómica basada en historia y filogenia y no. formar un grupo funcional (GF) uniforme y su composición también puede verse afectada por los métodos de muestreo utilizados. Casi siempre la muestra no contiene todas las especies presentes en el hábitat. de un hábitat o área geográfica específica. por lo tanto. los cuales no están disponibles para el público en general. la disponibilidad de claves adecuadas publicadas. Interpretación de resultados Los ensambles de especies son grupos de especies relacionadas taxonómicamente. Una de las principales propiedades de un ensamble es “la diversidad de especies”. la capa de hojarasca orgánica y/o montículos epigeos se alimentan del suelo mineral.

subterráneos o epígeos. pastos vivos o secos y pequeños pedazos de madera. Las que se alimentan de madera. o bien. Este grupo incluye termitas con nidos arbóreos.raíces. Las que se alimentan del suelo y de madera. todos menos los que se encuentran en una fase de descomposición terminal. la cual se ha vuelto fácilmente desmenuzable y que se asemejan al mismo suelo o que predominan dentro del suelo. Las termitas que se alimentan de madera muy podrida. pero que se alimentan en otro lado y muchas Macrotermitinae que cultivan jardines de hongos. El término “madera” incluye ramas muertas. Las termitas de alimentación especializada o incidental. Aunque el material digerido es altamente heterogéneo. Este grupo incluye algunos Macrotermitinae subterráneos y constructoras de montículos y otras Nasutiterminitinae y algunas otras que se alimentan en la superficie del suelo. pero no en la misma categoría de “alimentadores de madera podrida”. Esta categoría sigue la lista de alimentación de termitas de acuerdo con Wood (1978). quedan proporciones más altas de materia orgánica del suelo y sílica. al igual que otros que se han caído y se conservan aún frescos. Este grupo es sinónimo de “alimentadores medios” sensu DeSouza y Brown (1994). debajo de troncos o en suelo adherido a la superficie de troncos en estado de putrefacción. incluye especies que se alimentan de hongos. junto con por lo menos una termita inferior del sur de África Hodotermes mossambicus con un hábito similar. todavía unidas del árbol viviente y árboles muertos en pie. o mezclada con hojas podridas en complejos de limo . Las termitas que se alimentan de madera y que cavan túneles en piezas más grandes de madera. normalmente cortan el material antes de consumirlo o lo llevan a sus nidos. normalmente compuestas por obreros y soldados forrajeros. Hospitalitermes hospitalis en el sureste de Asia. que pueden volverse centros de colonias.• • • • cilla. Este tipo de termita forrajera usualmente es más conspicua que otros tipos alimenticios. hojarasca y superficie del suelo y porque hace agujeros que se abren en la superficie. por razones de las numerosas galerías o placas de suelo que construye encima de la madera. algas.. y menos tejidos de plantas reconocibles que en otros grupos (Sleaford et al. 1996). briofitas y líquenes en la corteza de los árboles (por ejemplo. Las que forrajean la hojarasca (Termitas forrajeras). Ruptitermes y otras especies de Constrictotermes en América del sur que se M acrofauna 111 . provenientes de pasajes subterráneos o la formación de columnas descubiertas de individuos. Las termitas que buscan hojas muertas. reconocida por Collins (1989).

1997.). Las categorías no son mutuamente excluyentes y muchas especies toman sus alimentos de por lo menos dos fuentes diferentes. y “las que no se alimentan de suelo” (todas las demás). aunque ninguna especie es realmente fitófaga. Eggleton y Bignell. etc. en Australia. una aproximación útil se obtiene dividiendo las especies en “alimentadas de suelo” o geófagas (alimentadas de suelo. Las termitas cuyos centros de colonia normalmente se concentran en troncos muertos o árboles en pie.Gay y Calaby. Inquilinitermes. la mayoría de la Apicotermitinae se alimentan de suelo o de suelo y madera). la ausencia de soldados (generalmente indica las que se alimentan del suelo) y la afiliación taxonómica (por ejemplo. Si se dificulta la selección de un grupo funcional. 1970. Algunas termitas también se alimentan de tejido de planta viva. el lugar de su descubrimiento (en madera. pero la perturbación o un periodo de secas. de manera similar. Los centros son pocos definidos y amorfos (especialmente en 112 Manual de biología de suelos tropicales . aunque el excremento se puede considerar como forma de basura descompuesta) y también ciertas habitantes secundarias de montículos de termitas que se alimentan de los forros hechos de rica materia orgánica. encontrada en las cámaras interiores como inquilinas obligadas (Por ejemplo: Ahamitermis y Incolitermis. en África oeste y central. es posible comparar ensambles de termitas en base a tipos de nidos. según las siguientes categorías: • Las que anidan en madera. las comunidades de selva son frecuentemente dominadas por las que se alimentan de suelo. La identificación del grupo funcional puede hacerse de acuerdo con el color abdominal en especímenes vivos (las alimentadas de suelo y suelomadera son más oscuras). y suelo y madera) como las definidas arriba. especialmente bajo condiciones desfavorables. La forma de distribución de dichas categorías indica la estructura de la comunidad de termitas. Termitas cuyos centros de colonia quedan bajo el suelo. Ophiotermes y Tuberculitermes.alimentan de líquenes). Algunas veces la madera muerta es gradualmente reemplazada por material acartonado o por panales de hongos. • Las que anidan de manera hipogea. las Macrotermitinae no se alimentan del suelo. generalmente. suelo. incrementa las proporciones de otros grupos funcionales. que habitan dentro de los nidos de Constrictotermes). otros aspectos biológicos como el lugar donde anidan (las que anidan en árboles normalmente no se alimentan de suelo). las que se alimentan de excrementos o las carroñeras de cuerpos de vertebrados (probablemente consumidos oportunamente.

pero excluyen montículos arbóreos. con estructura interna poco obvia. M acrofauna 113 . hechas de acuerdo con especificaciones típicas de la especie. • Montículos epigeos. adiciones y ocupación por parte de habitantes secundarios. usualmente construidos con material de apariencia acartonada (cartón).los Apicoterminotenae que no tienen soldados). normalmente están bien definidos y constituyen estructuras altamente complejas. utilizando permutaciones de datos al azar. Termitas cuyos centros de colonia se sitúan arriba del suelo. pero con una tendencia a volverse más irregulares con el paso del tiempo por razones de erosión. que se forman por sí solos o que se asocian con los contrafuertes de los árboles. En la mayoría de los casos. Este grupo incluye especies que son habitantes secundarias facultativas de montículos epigeos. Figura 3. Estos montículos. • Montículos arbóreos.5 Ejemplo de curva de acumulación de especies con una desviación estándar. aunque algunas forman nidos subterráneos complejos (por ejemplo Marcotermitinae). estos nidos están conectados con el suelo mediante pistas cubiertas que pueden ayudar a distinguir algunos nidos de termitas arbóreas de los de hormigas. Nidos que se sujetan a árboles y que se localizan en diferentes alturas.

el de correspondencia (AC) y el de co-inercia pueden ser útiles para determinar factores que afectan la densidad y la diversidad de lombrices de tierra. Los análisis de multivariados. en todos los paisajes agrícolas (Thioulouse et al. El esfuerzo de muestreo puede ser medido por espécimen. producción de excretas por cada tipo de uso de suelo. UTILIZANDO EL MÉTODO WINKLER Introducción Las hormigas pueden clasificarse en grupos funcionales o gremios. OTRA MACROFAUNA Y MESOFAUNA EN HOJARASCA. mediante la prueba Fisher. es únicamente una gráfica del número de especies acumuladas. 2000). Otro método será normalizar la densidad y la biomasa de las lombrices de tierra antes de llevar a cabo el análisis paramétrico de varianza (ANOVA). en relación con el número de unidades de muestreo. La relación entre abundancia de lombrices de tierra y el índice de uso de suelo se comprueba utilizando regresiones. Para más análisis estadísticos. Las curvas de acumulación de especies pueden ser obtenidas reiterativamente mediante remuestreo al azar de los monolitos de suelo o por secciones de transectos. utilizando el software de EstimateS versión 6. número de especies y. tiempo (o persona por tiempo).5) u otros métodos que normalmente requieren de programas computacionales especializados. HORMIGAS. tienen diferentes sig114 Manual de biología de suelos tropicales . Las curvas más sofisticadas. con desviaciones estándar. trampa. En el caso de un esfuerzo de colecta grande. se pueden obtener utilizando permutaciones (reiteraciones) de los datos al azar (Figura 3. muestra.0b1 (Colwell. La prueba Kruskal-Wallis ANOVA puede utilizarse para probar si existe un efecto significativo de los tipos de uso de suelo en relación con la abundancia de lombrices de tierra. La forma más simple de estas curvas es conocida como la curva del colector.. en el caso de lombrices de tierra.Curvas de acumulación de especies Las curvas de acumulación de especies son gráficas que representan la relación entre el esfuerzo de muestreo y el descubrimiento de las especies en un hábitat o región. se establece la comparación de la media del índice Shannon-Wiener. en la secuencia en que fueron anotadas en el campo. con un 5% de nivel de probabilidad. hasta 500 veces. la curva es asintótica y tiende a inclinarse. o área. tales como el de componentes principales (PCA). 1997). Aunque algunos autores consideran estos nombres como sinónimos.

pues es la más usada en diferentes paises. originalmente diseñado para hormigas australianas. no especialistas y altamente competitivas.. • Especies oportunistas: escasamente competitivas. Meranoplus spp. de modo que minimizan el contacto con otras hormigas que no ocupan este hábitat (Brachyponera spp. que pueden coexistir con la dominante Iridomyrmex spp. Eurhopalothrix spp. • Especies generalistas myrmicines: especies que pertenecen al género Monomorium.. en su mayoría. Paratrechina spp.. Crematogaster y Pheidole. Bothroponera y Odontomachus). • Especies crípticas: especies de hormigas forrajeras que normalmente anidan bajo el suelo (en la capa de suelo y hojarasca). Ejemplo: Iridomyrmex spp. mientras que los grupos funcionales se refieren a especies que utilizan estrategias similares para explotar el recurso y pueden estar formados por más de un gremio.) muestran adaptaciones fisiológicas.nificados: los gremios son un grupo de especies que utiliza el mismo tipo de recurso para su supervivencia (Terborgh y Robinson. Los siguientes son ejemplos de gremios en la selva brasileña de la Costa Atlántica (Delabie et al. las pertenecientes al género Camponotus. 2000). M acrofauna 115 . • Especies subordinadas asociadas: incluyen. • Especies especialistas en clima y suelo: estas especies (Melophorus spp.). • Especies forrajeras solitarias de tamaño relativamente grande: predadoras solitarias que manifiestan muy poca interacción con otras especies de hormigas (especies dentro de los géneros Myrmecia.). Aphaenogaster spp. hormigas no especialistas que frecuentemente viven en ambientes perturbados (Rhytidoponera spp. • Especies dominantes: especies muy abundantes y agresivas que influyen sobre la distribución y el comportamiento de otras especies de hormigas. morfológicas y de comportamiento que reducen su interacción con la dominante Iridomyrmex spp. 1986). Aunque han sido varias las propuestas de esquemas de clasificación de grupos funcionales... son cosmopolitas.. se recomienda utilizar el de Andersen (1997). y Notoncus spp. debido al tamaño relativamente grande de su cuerpo y a su comportamiento sumiso.

ejemplos: Eciton. También existen otras clasificaciones funcionales. predadoras especialistas que comen otras hormigas. forrajean toda la vegetación arriba de la superficie y en la hojarasca. • Especies predadoras especialistas: especies que se alimentan de un solo tipo de presa. • Especies de hormigas arbóreas dominantes: especies omnívoras que anidan en árboles. Pachycondyla y Centromyrmex (inquilinas de nidos de termitas). donde son forrajeras. • Especies predadoras generalistas: especies que se alimentan de diferentes tipos de presas. Mycocepurus. normalmente miembros de Attini. • Especies de hormigas subterráneas: dependen de gotitas de aguamiel y comen secreciones de azúcar de otros insectos. Pheidole y Solenopsis. son altamente agresivas y presentan una influencia competitiva sobre otras especies. Cyphormyrmex. Atta. probablemente comedoras de larvas de termitas del género Syntermes (Delabie. ejemplo: Odontomachus y Ectatomma. Sericomyrmes y Trachymyrmex. Apterostigma. • Especies de hormigas legionarias: también conocidas como “formigas da correição”.• Especies omnívoras: especies que se alimentan de varias fuentes. Solenopsis (especies grandes) y Wasmannia. se subdividen en dos grupos: a) predadoras generalistas grandes. Paratrechina. ejemplo: Amblyopone (predadoras de termitas) y Thaumatomyrmex (predadoras de miriápodos) y Strumigenys (predadoras de colémbolos). carroña y restos de plantas para cultivar sus hongos. 1995). Campanotus. la empleada en el taller CSM-BGBD (2005): 116 Manual de biología de suelos tropicales . para trabajo de campo práctico. ejemplo: Acropyga. Utilizan hojas frescas. ejemplos: Acromyrmex. ejemplo: Azteca y Crematogaster. por ejemplo. Anochetus e Hypoponera. incluyendo los restos de animales muertos. Myrmicocrypta. ejemplo: Megalomyrmex. son generalistas o especialistas dentro de las especies predadoras. Labidus (predadoras generalistas) y Neivamyrmex y Normamyrmex. por ejemplo. • Especies cultivadoras de hongos: especies que utilizan hongos simbióticos. es conveniente escoger las clasificaciones más cortas. ejemplos: Gnamptogenys (hormigas y otros insectos depredadores). • Especies predadoras de suelo: especies que se establecen en el suelo y en la hojarasca. b) verdaderas omnívoras: Brachymyrmex. • Especies de hormigas dominantes en suelo u hojarasca: hormigas forrajeras de hojarasca y suelo o de la superficie.

por lo menos. Se utiliza un marco para delimitar un área de un 1 m2 y se remueve la hojarasca a mano. La fracción fina queda en el fondo de la bolsa del tamiz. cerrado pero ventilado. de manera que se puedan separar los fragmentos más gruesos. tres cuadrantes de 1 m2. Se recoge primero la hojarasca. • Herbívoras. con un centro de colonia subterránea. Una vez en el laboratorio.• Carnívoras (especialistas o generalistas). 1999). con el centro de colonia epigeo o arbóreo. trabajando desde el borde hacia el centro. el contenido de las bolsas de campo se transfiere a redes. Se tamiza cada muestra de hojarasca para remover pedazos grandes. de manera que no escape ningún insecto. junto a la coordenada GPS y al monolito (Ilustración 1. Procedimiento de muestreo El procedimiento completo se lleva a cabo en tres fases: a) tamizar en campo para separa la hojarasca fina (con hormigas) de la materia más gruesa. realizando movimientos laterales. sobre una sábana blanca. preferentemente colocados a lo largo de la línea de transecto. con el fin de maximizar la recuperación de los especímenes (Delabie. b) transportar al laboratorio dentro de una bolsa segura. • Carnívoras (especialistas o generalistas). Esto debe hacerse con suficiente habilidad. hacia arriba. estas redes se fijan dentro de la trampa Winkler. conforme se seque la hojarasca. Se almacenan los especímenes en tubos cerrados y etiquetados. con guantes de cuero. como complemento o alternativa. en alcohol al 70%. se puede pasar la hojarasca burda por una malla de 2 mm. • Herbívoras. • Herbívoras. c) extraer las hormigas dentro de la trampa Winkler. con un centro de colonia subterráneo. posteriormente. ventilado y bajo condiciones ambientales. junto con las hormigas y se transfiere a bolsas en campo. véase también el Capítulo 2). • Carnívoras (especialistas o generalistas). con un centro de colonia epigeo o arbóreo. lentamente las hormigas y otros insectos migran hacia afuera y se caen en el alcohol. se mantiene la trampa durante por lo menos 72 horas. Este procedimiento permite separar la macrofauna pequeña y alguna de la mesofauna M acrofauna 117 . con un centro de colonia en las capas superficiales de hojarasca. con el centro de su colonia en las capas superficiales de hojarasca. los cuales son colgados en un lugar cubierto. que se encuentra en. cuando los Winklers no se encuentren disponibles. Se coloca un frasco con alcohol al 70% en la base de la trampa Winkler.

que entre dentro de una bolsa resistente de nylon o tergal. • Redes. en este caso. Como variación de este método. que se entierran de manera que la parte superior del envase quede exactamente al ras del suelo. • La trampa Winkler consiste en una bolsa porosa de algodón o nylon. plástico o aluminio para delimitar el área de muestreo. 25 cm de ancho y 20 cm de profundidad central. se marca un límite de búsqueda de 30 minutos por cada metro cuadrado de hojarasca muestreada. contenida en la trampa Winkler. tarros. 2000) es la siguiente: • Marco con una medida de 1 x 1 m de madera. una por cada trampa. tazas. de aproximadamente 1. se pueden recolectar los especímenes de la sábana. de 25 cm de ancho y 37 cm de largo. de aproximadamente 34 cm de ancho x 55 cm de largo. La lista completa de los materiales para la extracción con trampas Winkler (Bestelmeyer et al. Se achica el fondo de la bolsa para que se pueda colocar un frasco de aproximadamente 200 ml de capacidad. las cuales serán llenadas holgadamente con la hojarasca trasportada en las bolsas del campo y se colocaran en el centro de la trampa Winkler para dar paso a los invertebrados. deberá ser pesada al final de la extracción. • Bolsas de nylon. La hojarasca seca.5 m de largo. el cual contiene alcohol al 70%. las cuales se usarán en campo para transportar el material tamizado.del material orgánico y. ESCARABAJOS. a prueba de insectos y mide 1. vasos. hasta el lugar donde se encuentren las trampas Winkler.50 m de largo. botellas de plástico. utilizando un aspirador manual (pooter). la parte superior del envase puede situarse a 1 cm más arriba de 118 Manual de biología de suelos tropicales . por ejemplo. de esta manera. OTRA MACROFAUNA Y MESOFAUNA QUE SE ENCUENTRAN EN LA HOJARASCA: TRAMPAS PITFALL CON Y SIN CEBO Introducción Las trampas pitfall o de caída constituyen un método efectivo de recolección de muestras de los invertebrados meso y macro que viven en la hojarasca. de alrededor de 5 mm.. después de limpiar la hojarasca suelta en el punto donde se va a colocar la trampa. • Tamiz de malla grande. latas. dichas trampas están hechas de envases profundos relativamente pequeños.

El diámetro más pequeño ofrece la ventaja de sufrir menos perturbación al momento de insertar la trampa. hormigas. Las trampas normalmente se limpian y se recolocan una vez al día. miriápodos. arañas y otros arácnidos grandes tienden a dominar. normalmente. se encuentran dispuestas de manera lineal (para facilitar la instalación y el retiro) sufren la misma desventaja que los transectos. pero la trampa debe ser lo suficientemente amplia como para poder colectar un número razonable de especímenes y suficientemente profunda Figura 3. Las pitfall son baratas. mientras que los insectos alados se escapan). puesto que en ambas existe un alto grado de autocorrelación entre muestras adjuntas. por lo que se utilizan frecuentemente en los trabajos de inventario de la biodiversidad. presentan algunas desventajas: sobre todo que no muestrean todos los grupos taxonómicos con la misma eficiencia (escarabajos. Además. las pitfall son proclives a sufrir daños ocasionados por mamíferos y aves.6 Esquema de una trampa pitfall con cebo. Una típica trampa pitfall puede observarse en la Figura 3.6. las dimensiones no son fundamentales. de manera simultánea. de fácil instalación. ortópteros juveniles. al igual que a actos de vandalismo. M acrofauna 119 .la superficie y se construye una rampa de suelo suelto a su alrededor. Nota: frascos con diámetro de 10 a 20 cm generalmente son efectivos. No obstante. Las trampas se colocan bajo cubierta para evitar que entre la lluvia y funcionan como colectores de artrópodos que viven en el suelo y que caen en el envase. la macrofauna y parte de la mesofauna (especialmente. ahogándose en agua contenida en el fondo de la trampa. colémbolos). Las trampas pitfall no son cuantitativas y dado que. éstas ofrecen ventajas adicionales: se puede muestrear. se pueden utilizar específicamente para atrapar animales nocturnos.

éstos pueden ser improvisados en el campo.para impedir la fuga. hecha con un vaso. Entre 1 o 2 cm de agua en el fondo y un poquito de detergente serán suficientes para ahogar o inmovilizar a la mayoría de los animales y el detergente contrarrestará las propiedades hidrofóbicas de muchas cutículas de artrópodos.7 Trampa pitfall improvisada. 120 Manual de biología de suelos tropicales . sin embargo. es lo ideal. una caja Petri de vidrio invertida. Los clavos galvanizados o de madera son la mejor opción para elevar el techo hasta dos Figura 3. Un aditamento usual a las trampas es un techo inclinado para protegerlas de la lluvia. ésta descansará sobre palitos o clavos. cuatro palitos pequeños y una cubierta de celofán.

dentro de un rango de unidades vegetales. 2001). las pitfall normalmente se colocan en paralelo y M acrofauna 121 . madera podrida y turba. Colocación de trampas Mientras las pitfall son estrictamente no cuantitativas. hojarasca. El vidrio pesa más que el plástico. Se puede argumentar que cuando se trata de sol directo. éste deberá ser gris claro. Pueden emplearse para muestrear artrópodos en madrigueras. En algunas variaciones de este procedimiento se añade sal como conservador. El número de réplicas puede basarse en curvas de acumulación de especies y ha de ser seleccionado para lograr un 85% o más de las especies buscadas. una solución de hidrato de cloruro al 5% o una mezcla de ácido láctico/ácido acético (10% de cada uno de ellos. Las trampas pitfall pueden usarse en cualquier sustrato a nivel del suelo. con una respuesta negativa a la luz.o tres centímetros. de manera que permitan el acceso a las trampas.7). por lo que el techo se mantendrá más estable. ¿cuál sería el número apropiado de trampas pitfall requeridas para colectar el 85% o más de las especies capturables en una unidad vegetal dada? En el muestreo basado en transectos (Swift y Bignell. pero se puede utilizar. plástico. de manera alternativa. el techo debería ser opaco para evitar un efecto invernadero dentro de la trampa. En estudios referidos a riqueza de especies. con la excepción de agua y roca. también crea un microhábitat como si fuera una cueva. Estudios que se enfocan a la abundancia. En otras palabras. al mismo tiempo que ayuda a mantener el contenido fresco. El uso de envases de color fuerte o con dibujos puede mejorar la captura de parasitoides u otros insectos voladores que serán atraídos por los colores. el número de especies obtenidas por medio de las trampas pitfall se incrementa cuando éstas son colocadas en un máximo de unidades vegetales. combinados con un poco de glicerina) para mejorar su conservación. pero deberán evitarse siempre que se pueda. aunque su aplicación más común es en un sustrato de suelo para la fauna de artrópodos activa en la superficie del suelo (Figura 3. pueden ser útiles para la estimación de la diversidad alfa. de manera que no atraiga insectos voladores. muestran que un nivel de captura aproximada puede obtenerse mediante la replicación de trampas pitfall. madera u otro material lo suficientemente pesado como para que no lo eleve el viento o que pueda ser afectado por la lluvia o el sol y que además no sea comestible para las termitas. El techo puede hacerse también de loseta de cerámica. retardando así la descomposición. lo que resulta atractivo para los artrópodos diurnos activos en la superficie. ajenos a la fauna del suelo.

ordenar el lugar entero. en forma de “V” o de embudo. cualquier microhábitat de interés podrá ser investigado. se aplana con cuidado para mantener el mismo nivel que el borde de la trampa. Se debe tener especial cuidado para evitar remover suelo y raíces. Se muestrea. colocados en la superficie del suelo. 122 Manual de biología de suelos tropicales . donde se puede colocar una colección de pitfall de manera cercana (véase "cercas movibles”). 2 Se coloca la trampa pitfall en el hoyo y el borde externo se llena de tierra procedente de la excavación. Se usa el relleno para construir una rampa.a cada lado. extracciones de núcleos de mesofauna y de microsimbiontes y. 3 El suelo fino. La colecta de las pitfall es sensible a la perturbación. deberán ser extraídas a mano. una precaución sensata sería. El número recomendado es de 3 a 5 trampas por cada punto de muestreo. de manera que se minimice al máximo la perturbación del microhábitat adjunto. capítulo 2. según el orden de vulnerabilidad decreciente: primero las pitfall (de un día para otro) seguidas por los transectos. especialmente a pisadas. pero esto no trata de ser prescriptivo. puede soplarse hacia afuera. a una distancia de alrededor de 5 m. Cuando una parcela es botánicamente compleja y varias unidades vegetales pueden ser reconocidas. con el fin de hacer un hoyo del tamaño del vaso a introducir. 1 Se utiliza una cuchara de albañil para cortar y sacar las raíces y suelo. podrá hacerse en cualquier momento. que cae en la trampa durante su colocación. fuera del área principal de actividad. por lo tanto. Un esquema variable de muestreo con pitfall. De esta manera. finalmente. En el sistema de muestreo recomendado para el proyecto CSM-BGBD. se canalizan los animales móviles hacia la base de la “V” o embudo. el monolito. las pitfall pueden ser distribuidas de la misma manera que en el muestreo casual para hormigas y termitas. las partículas más grandes. Un muestreo ocasional. Instalaciones de las trampas pitfall Las trampas pitfall deben ser introducidas en el suelo con el borde superior del envase al ras del mismo o de la superficie de la hojarasca. de manera que los animales caminen sin obstáculos hacia el borde de la trampa. sugerido por Southwood (1978) hace uso de tablas de madera o de algunos obstáculos similares de hasta 30 cm de alto. ello depende del largo del transecto. es decir. se sugiere que las pitfall sean colocadas a lo largo de la línea de transecto y a un lado de los cuadrantes de 1 m² del muestreo para hojarasca. No se especifica el número.

a no ser que la frecuencia de mantenimiento sea de 24 horas o menos. Se añade un poquito de detergente como agente tensoactivo. situado en su parte superior. con el fin de remover la suciedad.5 cm de cada soporte visible. siempre se necesitará sal u otro tipo de conservador en climas tropicales. se utiliza por separado un colador de 53 µm. si se les introduce directamente en alcohol.4 Se insertan tres soportes de techo en el suelo alrededor de la trampa. se agita suavemente el contenido restante del vaso para levantar los especímenes del fondo y se filtra con una red de acuario. esta película es difícil o hasta imposible retirar una vez que los ejemplares quedan conservados. Se transfieren los especímenes en bolsas de plástico o frascos desde la red. El mantenimiento y el procesamiento de especímenes El mantenimiento de las trampas se lleva a cabo de la siguiente forma: se quita el techo y se levanta el vaso interior que contiene el cebo (en el caso de que lo contenga. Para poder retener los colémbolos. El lavado de ejemplares en agua fresca es esencial porque el detergente y la suciedad forman una película sobre los insectos. resulta útil para identificar la localización de la trampa y para prevenir pisadas accidentales. El detergente facilitará la inmovilización por ahogamiento de animales activos. utilizando un flujo suave de agua. lo que dificulta que sean manipulables y visibles bajo M acrofauna 123 . enjuagando el contenido de cada bolsa en la red. arriba del substrato. que hayan caído en la trampa. dejando así 2. 7 Se coloca un indicador con el número de lugar y trampa (en tinta indeleble o lápiz) cerca de la trampa. utilizando un frasco para enjuague o pipeta de agua. Los especímenes deberán procesarse el mismo día en laboratorio o la base de campo. palitos. ver abajo). trampa y fecha de recolección. etc. Se extraen los elementos grandes. animales más grandes. la sal y el detergente. 6 Se coloca el techo sobre los soportes. Cada trampa se debe procesar de manera separada y se coloca en la bolsa o frasco una etiqueta con la identificación del lugar. un palito. tales como hojas. Se retira cualquier basura grande restante y se trata de retirar al máximo la tierra u otra basura orgánica. lo que servirá para separar los últimos ejemplares. colocado verticalmente con un pedazo de cinta o banderín amarillo o naranja. durante varios minutos. 5 Se llenan las trampas hasta alrededor de ¼ de su capacidad con agua y suficiente sal como para lograr una solución saturada (en caso de escoger una solución salina).

porque la capacidad de captura de las pitfall está en función del tamaño de su circunferencia. el porcentaje de todas las trampas estará ocupado por una sola especie) porque no se puede determinar 124 Manual de biología de suelos tropicales . se lava suavemente el contenido de la red y los lados de la bolsa o frasco con el fin de que los ejemplares caigan hasta el fondo. o sustancias sintéticas atractivas (por ejemplo.microscopio. Se pueden preparar trampas pitfall adicionales (opcional) con un contenido de 120 ml de etanol al 95% + glicerina (9:1) que se dejan en campo durante 72 horas. Se recomiendan dos trampas de este tipo más tres de diseño convencional por cada punto de muestreo. se invierte el contenido de la red en una bolsa de especímenes y con un atomizador o piseta. Para mejorar la capacidad de captura con trampas pitfall Es posible mejorar la capacidad de captura con las trampas pitfall haciendo varios cambios en el diseño de la trampa o usando cebo atractivo para artrópodos. Después de este lavado. Para el procesamiento de ejemplares de colémbolos véase Capítulo 4 (Mesofauna). El excremento humano fresco también es apetecible para una gran variedad de escarabajos y. por supuesto. en espera de futuros procedimientos. frutos caídos u hongos en descomposición que resultan indistintamente atractivos para los detritívoros y algunos otros tipos de artrópodos. La principal modificación en el diseño consiste en agrandar su diámetro. Una variante de este proceso es usar dos filtros para colémbolos (malla 53 µm y 38 µm) se utilizan para separar estos animales de la otra fauna (ver Capítulo 4). se usa alcohol al 95% en el caso de colémbolos y al 70% para otros especímenes. carroña. Las muestras almacenadas deberán quedarse en una bolsa doble o frasco. se encuentra fácilmente disponible. esto se lleva a cabo con la suspensión del cebo en un pequeño bote colocado en la boca del envase principal. Se cubre con alcohol la muestra hasta la altura de los ejemplares que se encuentran dentro de la muestra. Después de siete días se debe cambiar el alcohol y. rojo o azul) para atraer moscas o parasitoides. y se introducen las etiquetas (escritas con tinta indeleble o con lápiz). feromonas). El uso de cebos resulta controversial porque el muestreo se sesga hacia los animales con un marcado olfato. si es posible. se refrigeran o se congelan las muestras. El cebo puede ser estiércol. cebos de color (amarillo. lleno de alcohol. El cebo deberá separarse del líquido conservador. Las trampas con cebo no podrán utilizarse en una evaluación semi-cuantitativa como medio de captura (por ejemplo. El hecho de usar cebos atractivos implica un mejoramiento general para la captura de una gran variedad de artrópodos.

sino también de la movilidad relativa. trampas Winkler. transectos. se puede estimar el peso fresco para ejemplares conservados. • Sal. esto es aplicable para las lista de especies de la localidad. Si no se cuenta con una balanza disponible en el campo. se combinan los resultados de los monolitos. REGUISTRO E INTERPRETACIÓN DE DATOS Parámetros Registre el número y peso fresco de todos los organismos e identifique. • Red de acuario o similar (de malla fina). se hace una lista de especies. • Lápiz de grafito (ej. hasta el nivel de determinación taxonómica y funcional más alta posible. siempre que sea posible agruparlas en familias o subfamilias. Lista de materiales requeridos • Trampas pitfall: vasos de plástico de 1000 ml (con dimensiones de 180 mm de diámetro superior x 120 mm de profundidad). • Indicadores de plástico o de madera. • Techo de 200 x 200 mm (uno por trampa).el área en donde se llevó a cabo el muestreo y la captura no sólo depende de la abundancia de animales. pesados después de un secado con papel absorbente. 2 o 6B) • Etiquetas tipo tarjeta. • Detergente puro: detergente líquido no perfumado para platos. • Alcohol al 70 al 90%. M acrofauna 125 . no. La presencia y el peso de hongos cultivados por las termitas (si los hay) también deberán anotarse. por lo menos. Para completar la lista. sin embargo. utilizando el nombre genérico y por orden alfabético. • Soportes del techo: clavos de madera o galvanizados de 152 mm (seis pulgadas). • Bolsas de plástico para muestreo con sello (tipo ziplock son las más convenientes para el almacenamiento de especímenes de campo) o frascos. trampas pitfall junto con un muestreo casual. loseta de color gris claro. • Cubeta o envase para agua. • Agua: agua de la llave o de una fuente natural.

Incorpore la lista de especies en una tabla que muestre las localidades donde fue encontrada cada una. la especie A es la misma especie en toda el área de muestreo. Selva primaria 2. Fuente: datos de especies de Jones et al. Árboles talados 163 BS6..827 22-977 5-16. los cuales se muestrean en el mo126 Manual de biología de suelos tropicales . Paraserianthes 512 BS8. Cassava 26 Media aritmética Nivel del estrato (Promedio de todas individuos m-2 (n=5) las localidades) 46 0–10 cm 106 10–20 cm 55 20–30 cm 49 Media geométrica individuos m-2 (n=5)* 971 65 47 11 25 2 10 Media geométrica individuos m-2 (n=5)* 15 80 44 4 95% de confianza 347-12. La abundancia se estima como número o individuos por m2. Tabla 3.2 Densidad numérica (individuos m2) de termitas en siete localidades. Por ejemplo. Selva de hule 211 BS12.Las especies plenamente identificadas deberán enlistarse con su nomenclatura binomial (género y especie) y la autoridad que las describió completas: Ejemplo Dorylus laevigatus Smith. A.892 BS3. con la excepción de las lombrices de tierra y milpiés. Hule 128 BS10. Es importante que la designación de letra sea consistente entre las localidades.445 2-1. Las especies identificadas únicamente a nivel género. B. Alang-alang 3 BS14. de cada monolito y de cada estrato. a través de un gradiente de perturbación de la selva. deberán enlistarse sin letras: Ejemplo Colobobsis sp. Las morfoespecies deberán enlistarse por letra: Ejemplo Crematogaster sp. 2003. en la provincia Jambi del centro de Sumatra.046 2-9. se multiplica el número crudo de cada monolito x 16. y Crematogaster sp. Sitio Media aritmética individuos m-2 (n=5) BS1.772 0-20 2-534 95% de confianza 3-64 43-148 24-78 1-50 * Datos retrotransformados.

El peso de los desconocidos puede entonces estimarse desde la curva. (2005). junto con las medias geométricas. etc. se calculan las medias aritméticas. finalmente.. Eggleton et al. por lo tanto. o sea. Woodcock (2005) y Jones et al. es posible asignar dominancia y. incluyendo el 95% de los límites de confianza y con los datos transformados se obtiene una media geométrica. También partiendo de que un transecto completo representa una muestra única y grande.). tal y como se muestra en la tabla 3. Se aplican estadísticas descriptivas al juego de datos transformados. Donde se dispone de especímenes de insectos de varios tamaños. (1997). datos transformados y los límites de confianza para log10(x+1). En el caso de transformaciones a log de los datos. Cuando no hay demasiados ceros (muestras sin organismos) este procedimiento debería normalizar los datos y producir varianzas homogéneas de grupo a grupo.nolito y la zanja (véase monolitos arriba). Para la información completa obtenida de transectos. Se estima la biomasa en g. y prepare una tabla resumida. si es posible. número de pitfall respecto al total. Para poder estimar el 95% de límite de confianza. se puede probar una transformación loglog. Se citan las medias para datos no transformados. Se evita el uso del peso seco debido a las diferentes temperaturas de los hornos que usan algunos investigadores y por el contenido variable de agua de los diferentes tipos de organismos. se determina la abundancia para cada taxón. el número de veces que se descubren colonias separadas en el caso de hormigas o termitas. Algunos indicadores de la abundancia relativa se pueden obtener a partir de la frecuencia de encuentro de diferentes especies (número de secciones de un transecto en donde se localizó la especie con respecto al número total muestreado. Jones e Eggleton (2000). 1996). también para cada grupo taxonómico superior y se combinan los datos de todas las especies. resulta más conveniente M acrofauna 127 . o para otros grupos individuos separados a lo largo del transecto completo. se utiliza peso fresco o la masa de un espécimen parcialmente seco. puedan ser parámetros útiles de población. también es posible que el número total de encuentros. derivar en índices de diversidad de especies y de equitatividad. Este concepto no se puede aplicar de la misma manera para las pitfall. Los datos transformados pueden usarse para histogramas y comparaciones de lugar a lugar (Eggleton et al.2). En casos difíciles. véanse las discusiones en Eggleton y Bignell (1995).m-2 de manera similar a como se calcula la abundancia. existe un método alternativo que consiste en calibrar la biomasa viva con el ancho de cabeza. los datos primarios deberán transformarse en log10(x+1). en especímenes representativos que cubren todo el rango de tamaños.

en su mayoría. la clasificación de lombrices de tierra (ya mencionada) puede aplicarse a todos los invertebrados del suelo. Se prepara una tabla resumida. definido por su hábito alimenticio y su distribución en el perfil del suelo. caracoles y pequeñas lombrices de tierra completamente pigmentadas. Especies endógeas que viven en el suelo y se alimentan de materia orgánica y de raíces muertas.trabajar en (mg+1) y luego se transforman y se expresa en gramos. muchas tasas de procesos en el ecosistema son proporcionales a la biomasa y no a la abundancia. milpiés. abundancia y biomasa en forma gráfica. como arriba. pero no redistribuyen activamente materiales de las plantas (aunque el material despedazado sea más fácilmente transportado por el viento o el agua que el material de donde deriva). pero también algunos arácnidos. ciempiés. Este grupo incluye. Especies epigeas que viven y se alimentan en la superficie del suelo. Especies anécicas son las que retiran hojarasca de la superficie del suelo a través de su actividad alimenticia. una variedad de artrópodos (hormigas. por tanto. y liberar nutrientes. Las lombrices de tierra y las termitas que no se alimentan de suelo constituyen los principales grupos dentro de esta categoría. La macrofauna activa en la superficie incluirá a los organismos muestreados en las trampas pitfall. Análisis Los análisis se deben llevar a cabo por grupo funcional. Ensambles pueden ser comparados por la proporción relativa de especies o unidades taxonómicas (morfoespecies). Cantidades considerables de suelo. menos informativa. ingiriendo grandes cantidades de materia mineral. Para poder establecer una comparación. Los dos grupos principales son las lombrices de tierra y las termitas que se alimentan del suelo. es decir. sin embargo. de manera que monitorear datos sin estimaciones de biomasa proporciona información incompleta y. elementos minerales y materia orgánica se redistribuyen con esta actividad y también se acompañan de efectos físicos sobre la estructura del suelo y las propiedades hídricas. Nota: determinar solamente la abundancia resulta fácil. cochinillas y grillos). cucarachas. Se debe mostrar riqueza de especies/morfoespecies. las cuales pueden ser incluidas en una o más 128 Manual de biología de suelos tropicales . el efecto de estos invertebrados es fraccionar y despedazar la hojarasca. escarabajos. puesto que no implica pesar especímenes individuales o hacer otras medidas para estimar la biomasa.

Jacquard y Sorensen (véase Southwood.2 cm. según se explica a continuación. 1978 y Krebs. ICE y EstimateS. que son complejos organominerales. pero ocasionalmente más pequeños) ingieren una mezcla de materia orgánica y minerales. La riqueza de especies actual puede ser estimada por medio de Sob. pero algunos animales más pequeños (varios ácaros) pueden tener funciones análogas. Los índices de diversidad y de similaridad útiles incluyen: ShannonWiener. 1998). Nota: los términos “ingeniero de ecosistema y especies claves” con frecuencia son utilizados. Jackknife. Simpson. ACE. de forma incorrecta. Transformadores de hojarasca (normalmente artrópodos no sociales o semisociales.2 a 1cm). CONJUNTO mínimo DE DATOS El conjunto mínimo de datos puede ser expresado por cada punto de muestreo. lombrices epigeas y ácaros grandes) ingieren una mezcla de materia orgánica y biomasa microbiana y forman heces holorgánicas de corta vida. Lista por familia de los otros escarabajos. Este grupo incluye invertebrados grandes (> 1cm) y medianos (0. como sinónimos. Macropredadores (especies predadoras >0. normalmente procedentes de varios grupos de artrópodos). M acrofauna 129 . termitas y lombrices anécicas y endógeas). Los grandes invertebrados (> 1cm.categorías funcionales. por categoría de uso de suelo y por ventana de muestreo. termitas y escarabajos capturados con cebo. Se recomienda probar la clasificación de un grupo funcional (GF) adicional para la macrofauna. y forman heces longevas y estables. Conjunto mínimo de datos por punto muestreado De todo el muestreo Lista de especies/morfoespecies para hormigas. Las especies clave (termitas y posiblemente algunos transformadores de hojarasca) proveen oportunidades físicas de nichos para organismos de nivel más bajo y determinan la estructura de la comunidad de estos organismos. utilizando las siguientes categorías: Los ingenieros del ecosistema (normalmente hormigas.

Para cada taxón se indica el método de muestreo empleado: C = casual T = transecto W = Winkler P = pitfalls M= monolito (Para el monolito no observar estratificaciones de 3 x 10 cm. etc. GF2. el número de encuentros. De las trampas Winkler Frecuencia de especies por muestra. La abundancia relativa para cada GF está dada por el número de encuentros de divididos entre el número total de encuentros de todos los GFs. etc. Nótese que un encuentro es un evento en una sección de 5 m del transecto. GF 2.) también pueden estimarse. etc. utilizando todas las secciones de transectos disponibles para el muestreo. Se pueden juntar los datos obtenidos de diferentes transectos en puntos de muestreo separados.. Todas las termitas (y por GF 1. varía de 0 a 4 para transectos de 20 m y de 0 a 20 para transectos de 100 m.). Todas las lombrices de tierra (además por GF 1. Desde el transecto o los transectos Abundancia relativa de termitas. números totales por cada grupo funcional (GF1. Abundancia total en número m2 de forma separada para: Todas las hormigas (y por grupo funcional GF1. etc. en su defecto las que se alimentan de madera o de suelo).Lista de los otros invertebrados en la resolución taxonómica la más alta posible. En el caso de las hormigas. con la excepción de lombrices de tierra). GF2. Todos los escarabajos Otros invertebrados Todos los invertebrados.). GF 2. por lo tanto. Datos de abundancia para hormigas y escarabajos (número de individuos m²). 130 Manual de biología de suelos tropicales . Se hace un cálculo para cada GF.

otros invertebrados y todos los invertebrados (igual a lo indicado para datos mínimos por punto de muestreo). lombrices de tierra y escarabajos capturados con cebos. Lista de familias para los demás escarabajos Lista de invertebrados en la resolución taxonómica la más alta posible Para cada taxón se indica el método de muestreo empleado. GF 2. etc. todos los escarabajos. GF 2. Conjunto mínimo de datos por uso de suelo Las categorías de uso de suelo son anotadas y cuando esto no es posible se clasifican de acuerdo con la intensidad de uso de suelo. todas las termitas (y para los grupos GF 1. T = Transecto. donde n = número de puntos por uso de suelo. etc. todas las lombrices de tierra (y por grupos GF 1.De las trampas pitfall Se desglosa los taxa no muestreados por otros medios (únicamente). M acrofauna 131 . P= Pitfalls y M= Monolito De los monolitos Es necesario proveer la abundancia media como: a) Número de individuos m² ±SD b) Media geométrica ± 95% de intervalo de confianza c) Media aritmética ± 95% de intervalo de confianza donde n = número de puntos por uso de suelo. etc.). De todo el muestreo Listas de especies/morfoespecies para hormigas. De los transectos Abundancia relativa media de termitas GF 1. etc.). utilizando las mismas claves que las especificadas anteriormente: C= Casual. como % ± SD. termitas. o en su defecto las que se alimentan de madera o de suelo). separado para hormigas (y para grupos funcionales GF1. GF 2. GF 2.. W= Winkler.

Lawton et al. la escala del esfuerzo requerida para poder evaluar la biomasa es enorme (véase Eggleton y Bignell.De las trampas Winkler Abundancia media de hormigas (y como GF 1. en base de lugar a lugar. existen contra argumentos de que los insectos sociales pueden evaluarse correctamente en cuanto a su abundancia y biomasa. será sobreestimada (Colwell y Coddington.) como individuos m² ± SD. Desafortunadamente. muestreo anidado y estratificado ejemplo Eggleton et al. si el régimen de muestreo es suficientemente robusto (incluyendo réplicas adecuadas. 1994). Conjunto mínimo de datos por ventana de muestreo De todos los métodos de muestreo Recambio de especies a lo largo del gradiente como la β de Whittaker. incluyendo los resultados de intensificación de uso de suelo. Por ejemplo. 132 Manual de biología de suelos tropicales . el cálculo retrospectivo hasta llegar a la densidad numérica. La frecuencia de especies por muestreo presenta un parámetro alternativo. El uso de datos crudos de abundancia y de biomasa en la interpretación de la función del ecosistema resulta controversial. cuando su abundancia o biomasa lo justifique. se argumenta que los organismos se deben asignar únicamente como ingenieros del ecosistema. Para todas las abundancias medias totales y las abundancias medias relativas de los GF Correlación con parámetros individuales del gradiente. ejemplo Diversidad β.. 1995. se dice que la abundancia de individuos no se debe usar en el caso de hormigas porque son insectos sociales que se organizan en colonias formadas por miles de individuos que se alimentan en grupos. De manera similar. si el muestreo se hace en una colonia. no obstante. 1996) y que la biomasa es tan importante para la determinación del impacto ecológico que no se puede prescindir de ella o sustituirla. etc. GF 2. Abundancia media de escarabajos como individuos m² ± SD. donde n = número de puntos por uso de suelo..

Smithsonian Institution.. J. Brown. Kippax. y Saha. 122–132. J. 433–460. y Schultz T. 3. J. Blakemore. 32. y Lavelle. P. Majer. pp.. C. D.. R.htm. M. Washington. Blakemore. Halder. A. Standard Methods for Ground-living Ants.. K. F. e Ingram. 2nd edition. C.. C. S. Bouché. Wallingford.jp/eng/index. B. Y. (2002) Cosmopolitan Earthworms – An Eco-Taxonomic Guide to the Peregrine Species of the World. M acrofauna 133 . India’. REFERENCIAS Agosti. Soil Biology and Biochemistry. DC. y Valentin. W. Wallingford. J. (2005) ‘Introductory key to revised earthworm families of the world’. H. Persson (eds) Soil Organisms as Components of Ecosystems. Lebissonnais. 431–439. I. N. e Ingram. CAB International. vol.. Ecology and Systematics from Various Regions of the World. M. P. 35. (eds) (1989) Tropical Soil Biology and Fertility: A Handbook of Methods. I.. 24. R..ac. M.. in U. vol. pp. COE Soil Ecology Research Group. Anderson. (1997) ‘Functional groups and patterns of organization in North American ant communities: A comparison with Australia’. E. (eds) (2000) Measuring and Monitoring Biological Diversity. 2045–2054. Ito (eds) A Series of Searchable Texts on Earthworm Biodiversity. R. vol. lo que compromete la caracterización de la heterogeneidad del paisaje porque restringe el número de puntos de muestreo que pueden ser utilizados. www. 1st edition. vol. 29. T. Bhadauria T. D. Bhattacharya. Soil Biology and Biochemistry.. J. (1997) ‘Regulation of soil structure by geophagous earthworm activities in humid savanna of Côte d’Ivoire’. Barrios. (2000) ‘Soil microarthropods of a rubber plantation and a natural forest’. CAB International. G.. y Srivastava.. K. J.ynu. pp. 143–147. Blanchart. S. Pashanasi. Delabie.. Japan.bio-eco. D. N. T. Leeanne. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. (2000) ‘Diversity and distribution of endemic and exotic earthworms in natural and regenerating ecosystems in the central Himalayas. in N. Agosti. L.338–347. (1977) ‘Stratégies lombriciennes’. B. E. M.eis. J. Environmental & Ecology. S. P. Australia. Ecological Bulletins. Brandão. J. Braudeau. Bestelmeyer. vol.. R. pp.1998). Ramakrishnan. E. Alonso L. VermEcology. Alonso.T. Kaneko and M. T. Constantino.. Andersen. Lohm and T. R. Biology and Fertility of Soils. Lavelle. pp. T. E. (2002) ‘Effects of land-use system on the soil macrofauna in western Brazilian Amazonia’. Yokohama National University. Anderson.. 25. pp. Journal of Biogeography. vol.

J. vol. J. in H.-C.. J. Fragoso. Decaëns. Escobar. Formicidae. G. 347–367. vol. J.ucon. T. http://viceroy. J. Amsterdam. Kenya. J. Le Coeur. Software and User’s Guide’. Feira De Santana.. 47–60. Acta Oecologia.. A.. 605–609. Petit. Agriculture. Chauvel. pp. CSM-BGBD (2005) Global workshop on ant and termite sampling and identification. 345. H. pp. Leith and M. J. N. J.. J. Mitteilungen aus dem Zoologischen Museum in Berlin. F. H. C. J. Lavelle. Ecosystems and Environment. A. vol. vol. S.edu/estimates. 12. 103. (1999) ‘Comunidades de formigas (Hymenoptera: Formicidae): Métodos de estudo e estudos de casos na Mata Atlântica’. Delabie. uconn. C. Philosophical Transactions of the Royal Society (Series B). J. y Nascimento. Revista Brasileira De Entomologia. Tropical Soil Biology and Fertility Institute of CIAT. E. Nairobi. Blanchart. P.. Thenail. and Rippstein. Alonso and T. A.. pp. Delabie. H. C. Sociedade Nordestina De Zoologia. G. (2000) ‘Statistical Estimate of Species Richness and Shared Species from Samples. Barros. Werger (eds) Tropical Rain Forest Ecosystems. Nasutermitinae)’. pp. Colwell. (Isoptera. Y.Burel.. (2000) ‘Litter ant communities of the Brazilian Atlantic rain forest region’. Brunel. (1996) ‘Revision der Unterfamilie Benhamiinae MICHAELSEN. T. I.. C. http://viceroy. Ponerinae) em cupinzeiros de Syntermes sp. T. R. 240. São Paulo. M.eeb. 58–68. E. P. T. (1995) ‘Inquilismo simultâneo de duas eespécies de Centromyrmex (Hymenoptera.. vol. K. (1989) ‘Termites’. vol. 301–312 Decaëns. Jiménez. y Jiménez. 157–168. (1994) ‘Impact of land management on soil macrofauna in the Oriental Llanos of Colombia’. (1998) ‘Comparative biodiversity along a gradient of agricultural landscapes’. Termitidae. K... 1897 (Oligochaeta: Acanthodrilidae)’. Delettre. Resumos Feira De Santana.eeb.edu/EstimateS. (1994) ‘Estimating terrestrial biodiversity through extrapolation’. C. K. y Coddington. Jiménez.. Agosti. S. Butet. Decaëns. (2005) ‘EstimateS.. vol. Colwell. J. 101–118. P. Baudry.5: Statistical Estimation of Species Richness and Shared Species from Samples. A. pp. Paillat. pp. Version 6. F.. Colwell. Morvan. in D. Plant and Soil. Delabie.. European Journal of Soil Biology. 30. D. D. G. J. J. 39. C. E. pp133-143.. R. Schultz 134 Manual de biología de suelos tropicales . 72. vol. Csuzdi. (2002) ‘Earthworm communities under an agricultural intensification gradient in Colombia’. Dubs. L. pp. C.. N.. y Lavelle.0b1’. D. Encontro De Zoologia Do Nordeste. Elsevier Science Publishers. Version 7.. 19. Collins. Agosti. Majer. y Lefeuvre. Clergeau. (2004)‚‘Soil macrofauna communities in permanent pastures derived from tropical forest or savannas’. R.

P. Southern Cameroon. 1–128. D. E. (1996) ‘The diversity. Planapheretima. N. (1995) ‘Monitoring the response of tropical insects to changes in the environment: troubles with termites’. and its biological significance’. J. M.. Megadrilogica. Eggleton. pp. O. pp. 27. vol. Davies. R. vol. (1997) ‘The incidence of secondary occupation of epigeal termite (Isoptera) mounds by other termites in the Mbalmayo Forest Reserve. G. Ecotropica. F. DC. Eggleton. Haynes. 77–88. vol.. pp. Smithsonian Institution. Eggleton. (1997) ‘The species richness and composition of termites (Isoptera) in primary and regenerating lowland dipterocarp forest in Sabah.(eds) Measuring and Monitoring Biological Diversity: Standard Methods For Groundliving Ants. 354. Journal of Tropical Ecology. M acrofauna 135 . Jeeva. Metapheretima. R. y Brown. Pleinogaster and Polypheretima’.. Mawdsley. D. Easton. G.. Bignell. y Maryati. pp. forest disturbance and greenhouse gas fluxes in Sabah. D. vol. pp. 6. P. D. Stork (eds) Insects in a Changing Environment. East Malaysia’.. P. Eggleton. vol. Oligochaeta)’. (1994) ‘Earthworms from Southeastern Mexico. C.. P. y Bignell. (2004) ‘Influence of agricultural land use on the size and composition of earthworm communities in northern KwaZulu-Natal. (1999) ‘Termite assemblages.. Harrington and N. R. vol. Jeeva. A. D. J. 197–206. D. G. T. Sands. C. R. Series B. V.. 1791–1802. M. 87–276. DeSouza. W. Davies. MacDonald. Philosophical Transactions of the Royal Society of London. (1994) ‘Effects of habitat fragmentation on Amazonian termite communities’. G. 35. D. vol. y Bignell. vol. 489–498. Eisen. G.. New Acanthodriline genera and species (Megascolecidae. E. Dlamini. London. Lawton. 351. Bulletin of the British Museum (Natural History) Zoology. A. pp. Fragoso. 51–68.. (1979) ‘A revision of the ‘acaecate’ earthworms of the Pheretima group (Megascolecidae: Oligochaeta): Archipheretima.. Academic Press. vol. P. Journal of African Zoology. South Africa’. A. 111. pp.. E. Southern Cameroon’. T. Wood. y Maryati. F. K. Applied Soil Ecology. pp. T. R. Jones. Jones. N. P. in R. East Malaysia’. 3.. 10. 2. E.. Bignell. E. y Bignell. Homathevi. abundance and biomass of termites under differing levels of disturbance in the Mbalmayo Forest Reserve. Eggleton. D. pp. Philosophical Transactions of the Royal Society of London. E. Series B. Proceedings of the Californian Academy of Sciences. H. (1900) ‘Researches in American Oligochaeta with especial reference to those of the Pacific Coast and adjacent islands’.. 119–128. J. Homathevi. Washington.. C. 1–12. y Rojas-Fernandez.

soil biodiversity and agroecosystem function in the tropics: The role of earthworms’. Dominy. M. J. Turland N.. E..-X.. C. Blackwell. Trehane. vol. vol. P. New York. pp. 136 Manual de biología de suelos tropicales . A. Jones.. 95. C. Senapati. Patron. (1997) ‘Agricultural intensification. T. y Tondoh.. L. (2003) ‘Termite assemblage collapses along a land-use intensification gradient in lowland central Sumatra. 40. C. y Eggleton. R. Megadrile Oligochaeta (Earthworms) Family Octochaetidae. W. International Trust for Zoological Nomenclature. pp.Fragoso. C. B. E.. W. Gillison. J. P. H. Blanchart. L.. (1970) ‘Termites of the Australian region’. 1–326. y Eggleton. E. Brussard and P. D. an introduction to the systematics and biology of Megadrile oligochaetes with special reference to South-East Asia’. Oxford. C. F. Haynes. Journal of Applied Ecology.. vol. Academic Press. (1972) ‘Burmese earthworms. Wallingford.. Blanchart. P. T. y Guillaume. y Calaby. P. 196. E. McNeill.. Blanchart. Lavelle. 62. Koeltz Scientific Books. F. M. Ecosystems and Environment. in P. J. y Graham. Bignell. F. Hendrix (eds) Earthworm Management in Tropical Agroecosystems. Gates. P.. Suryo. C. Brown. Demoulin. Skog.. Verkerk.. 37. Indonesia’. 4th edition. Fragoso. B. P.-M. Silva. Kouassi. (1988) The Fauna of India and the Adjacent Countries. Zoological Survey of India. Barrie. D. pp. pp. S. E. Gay. D. (2000) ‘Sampling termite assemblages in tropical forests: Testing a rapid biodiversity assessment protocol’. y Eggleton.. Leather (ed) Insect Sampling in Forest Ecosystems. Keli. G.. D. Gilot. M. 191–203.. structure and influence of management pratices’. Journal of Applied Ecology. (2005) ‘Methods for sampling termites’. B.. Senapati. Decaëns. J. Lavelle. Jones. H. F. pp. T.. T. H. Jiménez.. V. K. Burdet. J. D. T. CAB International.. Filgueiras. Agriculture. G. (2003) ‘Effect of agricultural land use on soil organic matter status and the composition of earthworm communities in KwaZuluNatal.. in K. Greuter. vol. M. E.. (1995) ‘Biological activity of soil under rubber plantation in Côte d’Ivoire’. 380–391. Lavelle. H.. 6. J.. P. J. J. Acta Zoologica Fenica. R. P. vol.. J. Nicolson... H. 453–464 International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature.. in S. D. London. S.. T. J. pp. (2000) International Code of Botanical Nomenclature (St Louis Code). vol. y Hawksworth. Konigstein. E. South Africa’. Martinez. Susilo. (1999) ‘Earthworm communities of tropical agroecosystems: Origin. Weesner (eds) Biology of Termites. 186–189. R... Applied Soil Ecology. Lavelle. Krishna and F. Calcutta. J. Jones. G. G.. Pashanasi. 17–35. P.. J. A. J. Julka. y Kumar. Transactions of the American Philosophical Society.

. vol. Righi. Pearson Education. (1996) ‘The measurement of diversity in different types of biological collections’. Lawton. M.Krebs. y Watt. France. Lavelle. E. vol. P. Modena. (1987) ‘Peregrine species of earthworms’. (2000) ‘Assessing the completeness of bat biodiversity inventories using species accumulation curves’. P. C. Oxford. C. G. Mora.. F. pp. and Fragoso. D. pp367–382 Ortiz-Ceballos. Lepage. Righi. Blackwell Science. E. Heal. D. Biology and Fertility of Soils. (1978) ‘Les vers de terres de la savane de Lamto (Côte d’Ivoire): Peuplements. Thèse de Doctorat. (1995) ‘Colombian earthworms’. pp. S. A. E. Journal of Theoretical Biology. P. M acrofauna 137 . P. indicator taxa and effects of habitat modification in tropical forest’. Bonvicini and P. London.. Moreno.. G. 117–133. Omodeo (eds) On Earthworms: Selected Symposia and Monographs. Hodda. in F. Boulton. J. Université Paris VI. Amsterdam. Lee. pp. C.. (1983) ‘The soil fauna of tropical savannas. vol. and diversities of bats in a fragmented landscape’. D. 39. 33. D. Roger. J. Biology and Fertility of Soils. Stork.. 1–95. P.. A. y Dhillion.. G. 2nd edition. A. Nature (Lond). 37. G. pp. M. vol. vol. vol.. Mawdsley. Moreno. E.. S. Arquivos de Zoologia. Mucchi. C. Holt.. Srivastava. H. 72–76. European Journal of Soil Biology. pp. 40. E. 4. II The earthworms’. Journal of Applied Ecology. M. pp. y Halffter. (2004) Measuring Biological Diversity. Lavelle.. 159–193. 485–607. Wolters. Pielou. vol. J.. Elsevier Publishing Company. (1997) ‘Soil function in a changing world: The role of the invertebrate ecosystem engineers’. Studies on Tropical Andean Ecosystems. Acta Oecologia – Oecologia Generalis. 13. T. C. N. y Halffter.. Eggleton. Biodiversity and Conservation. (2001) ‘Spatial and temporal analysis of. Bourlière (ed) Tropical Savannas. 2. Hammond. M. 213–226. (1981) ‘Strategies de reproduction chez les vers de terre’. 20. M. 300–305. D. (1998) ‘Biodiversity inventories. Lavelle. Bloemers. P. Unione Zoologica Italiana 2. O. Magurran. pp. E.. B.. (2004) ‘Earthworm populations under tropical maize cultivation: The effect of mulching with velvet bean’. G.. Laboratoire de Zoologie. populations et fonction dans l’écosystème’. B. R. Lavelle. Larsen. Lavelle. pp. Bignell. E. N. 10.-P... vol. 438–445. A. I. 391. vol. P. C. Ecole Normale Supérieure 12. (1998) Ecological Methodology. 149–158. P.. Grimaldi. y Rouland-Lefèvre. J. in A. (1971) ‘Sobre a familia Glossoscolecidae (Oligochaeta) no Brasil’. Bignell. vol. V. Mathieu. K. P. (2004) ‘A multi-scale study of soil macrofauna biodiversity in Amazonia pastures’. pp. Rossi.

Biological Journal of the Linnean Society. ASM Press. G. Cambridge University Press. selected symposia and monographs’. (1986) ‘Guilds and their utility in ecology’.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. 138 Manual de biología de suelos tropicales . Oxford. Blackwell. pp. Dolédec. Sleaford. Opuscula Zoologica Budapest. P. D.fao. J. 75–83. Université Paris VI. vol. pp. E. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. E.pdf.. y Lavelle. Vincent. France. Oxford. Chapman and Hall. vol. Terborgh. Zicsi. Kikkawa and D. 493–500. 21. (2005) ‘Pitfall sampling in ecological studies’. in M. M. (2001) ‘Revision der Untergattung Martiodrilus (Maipure Righi. Indonesia. South East Asian Regional Research Programme. vol. D. (1978) Ecological Methods with Particular Reference to the Study of Insect Populations. Omodeo (eds) ‘On earthworms. Unione Zoologica Italiana 2.. Cameroon’. (1992) International Code of Nomenclature of Bacteria: Bacteriological Code. E. Sims. pp. R. (1969) ‘Recherche sur le peuplement en Oligochète de la savane de Lamto (Côte d’Ivoire)’. in S. A. Bignell. Eudrilidae) in Ivory Coast’. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition’. R. Mucchi. y Robinson. (1997) ‘ADE: A multivariate analysis and graphical display software’. vol. 103–124. y Easton. 169–268.Sims. Cambridge. A. 113–131. London. W. T.. Pagliani and P. y Olivier. pp. P. T. (1978) ‘Food and feeding habits of termites’. 1995) (Oligochaeta: Glossoscolecidae). Anderson (eds) Community Ecology. Sims. y Eggleton. G. vol. pp. (1996) ‘A pilot analysis of gut contents in termites from the Mbalmayo Forest Reserve. pp. E. Sneath. International Centre for Research in Agroforestry. S. J. S. Pattern and Process. 21. Thioulouse. E. 1990 Revision. W. Regenwürmer aus Südamerika’. (1972) ‘A numerical revision of the earthworm genus Pheretima auct. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. M. Herndon. 33. A. B. (1987) ‘A review of the Central African earthworm family Eudrilidae (Oligochaeta)’. in J. Ecological Entomology. Wood. 7. V. www. VA.. Swift. F. (1980) ‘A classification and the distribution of earthworms. Brian (ed) Production Ecology of Ants and Termites. J. J. 2nd edition. Chessel. Bogor. Southwood. D. Statistics and Computing. H. R. 279–288. Blackwell Science. vol. ASB Lecture Note 6B. M. R. y Bignell. W. P. suborder Lumbricina (Haplotaxida: Oligochaeta)’. in A. R. P. Bulletin of the British Museum (Natural History) Zoology. Leather (ed) Insect Sampling in Forest Ecosystems. Thèse de 3e cycle. Journal of Tropical Ecology. 4. 39. Modena. Tondoh. Woodcock.

Regenwürmer aus Südamerika 39. 95–130.Zicsi. (2005) ‘Über den heutigen Stand der Regenwurmfauna (Oligochaeta) Ekuadors mit einem Bestimmungsschlüssel der Glossoscoleciden-Arten’. A. M acrofauna 139 . vol. 92. pp. Berichte des Naturwissenschaftlicher-Medizinischer Vereins in Innsbruck.

Borneo Java y Sulawesi.R. 1-374. Título y referencias ‘Manual for Bornean Ant (Formicidae) Identification’. 140 Manual de biología de suelos tropicales . vol. ‘Introducción a las hormigas de la región Neotropical’ Instituto de Investigaciones de Recursos Biológicos. Kepong. 65-87. Tho. Bien ilustrada con sinopsis genérica. F. Notas Clave de géneros de hormigas de Borneo (útil en el S. E. Bogota. pp. de Asia.E. Incluye una revisión de la biología ecología. incluyendo Indonesia). vol. Clave un poco obsoleta de géneros de termitas del Norte de Borneo. útil para Sumatra. Colombia. Kirton (ed) Malaysian Forest Records. y Homathevi. Y. protocolos de muestreo por región. Forest Research Institute of Malaysia. (2003) Termitas del S. 1-398. Y. 2003. Fácil de usar. de fácil manejo. pp. vol. (2 003). (2001). Disponible y económica. pp1-244. escarabajos y hormigas. XXVI. Preparado por “Tools for Monitoring Soil Biodiversity in the ASEAN Region”. 1485-1506. S. (1992) ‘Termites of peninsular Malaysia’ en L. 36.G. M. pp. 35 pp. pero no cubre toda la diversidad de animales que se alimentan del suelo. Gathorne-Hardy. F. de Asia Thapa. ‘The termites (Isoptera) of Gunung Mulu National Park with a key to the genera know from Sarawak’. 30. P. with descriptions of one new genus and new species and including a key to genera’ Journal of Natural History. Clave moderna y de fácil interpretación. Claves de identificación de termitas. (1984) Collins. pp 95162. Sarawak Museum Journal. dentro del clado Termes.Apéndice 1. Bien ilustrada clave de fácil identificación para los soldados. Hormigas Neotropicales Fernández. 12-26 octubre. de Asia Hashimoto. Universidad Malasis Sabah. taxonomía y la importancia económica de las hormigas.E. ‘Termites of Sabah’ Forest Record 12. Región y autor Hormigas del S. Trabajo estándar. Alexander von Humboldt. N. ‘A review of the South-east Asian Nasutitermitinae (Isoptera Temitidae). Publicación clave para géneros de la región Neotropical. R. (1984).

C. Bulletin of the British Museum (Natural History). R. ‘A revision of the termite subfamily Nasutitermitinae (Isoptera. Adaptación de Chung. C. pp. W. Webb. R. Hormathevi. 18-22 Septiembre. L. Y. Booth. Sands W. 1-28. Sabah Forest Record 12 pp. Explicación detallada de la IIE Guides to insects of importance morfología y agrupaciones de to Man. ‘A review of the termites of the genus' Antitermes the Ethiopian region. Un poco anticuado. pp. (1965). 12–26 Octubre 2003. Coleoptera. preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. 36 p. Región y autor Homathevi. Termitas africanas Sands. Coleoptera.E. Clave moderna. R. Escarabajos en general. A. pp. fácil de usar. International Institute of Entomology (and Institute of escarabajos. Universiti Malasia Sabah. “Termites of Sabah”. (2006). G. (1961). M. (1981).. Supplement 4. con muchas referencias que incorporan descripciones taxonómicas recientes. Ibadan University Press. G. (2003) Título y referencias ‘Manual for Bornean Termites (Isoptera)’ preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’.Cox. incluyendo Indonesia. Clave de géneros de imagos y soldados. Universiti Malaysia Sabah. The Natural History Museum. corta y bien ilustrada de familias con una sinopsis diagnóstica de más de 100 familias y casi 50 subfamilias. Nigeria. Termitidae) from the Ethiopian region’. de Asia. Clave bien ilustrada a nivel género de soldados. Universiti Malaysia Sabah. R. La autoridad estándar del momento para este genero. (2003). 2–38. A. 2003. Thapa. vol 8. 1–172. 1-374. Claves hasta especies. pp. Lo que opera actualmente sobre esta subfamilia en África. Notas Clave inédita de géneros de termitas en el S. 2006. 12–26. y Madge R. 129-156 Keys to the Genera of the African Termites. M acrofauna 141 . A. 1–384. Trabajo estándar. tanto para imagos como soldados. (1990). Training course on Arthropod preservation. Continúa. CAB International). Bulletin of the British Museum (Natural History). Octubre 2003. London pp. S. de fácil manejo. Bien ilustrada. Escarabajos de Asia Chung. 3. ‘Manual for Bornean beetle (Coleoptera) family identification’. curation and data management. (1959). B.Apéndice 1.

‘Report on a survey of the termites of Zimbabwe’. (1980). pp. y Eggleton P. Clave de especies para imagos. más 32 referencias. L. Termitas neotropicales Constantino. Estudio comprensivo que incluye claves hasta géneros de soldados. (1966). “The Identification of Worker Castes of Termite Genera from Soils of Africa and the Middle East”. soldados mayores y soldados menores. 365–444. Natural Science 6. Clave corta. Sociality. Sands. 187–323. 24. Clave completa muy ilustrada y detallada. (2002). Lo que opera actualmente este género. 142 Manual de biología de suelos tropicales . (1971). Kambhampati. obreros y soldados. ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. Región y autor Bouillon. (1970) A revision of the termites of the genus Macrotermes from the Ethiopean (Isoptera: Termitidae) Bulletin of the British Museum (Natural History) Entomology vol. ‘Taxonomy and phylogeny of termites’. Bignell and M. E. Ruelle. A. Mitchell B. Higashi (eds) Termites: Evolution. CAB International. R. pero recomendada para formarse. 1–115. vol 67. J. Continúa. Series B. no muy útil como clave. W. Título y referencias Quel est ce termite Africain? Zooleo. Their Recognition and Control. 1–40. Abe. E. G. Wallingford. 500 pp. pp. pp. vol. A. Notas Clave a nivel familia de imagos y soldados. (1998). únicamente para géneros principalmente en el contexto africano. pp 1–23. Estudio prestigiado. de difícil manejo.Apéndice 1.. en: T. Symbioses Ecology. Harris W. muy útil para termitas subterráneas crípticas. Incluye una sinopsis de familias y subfamilias en forma de clave con notas e identifica caracteres diagnósticos. y Mathot. Termites. pp. Longman. Clave hasta género para soldados y muchos géneros ilustrados de manera detallada a nivel de especies (en francés). (2000). 1. Zootaxa. S. pero útil para confirmaciones. Occasional Papers of the National Museums of Rhodesia. Kluwer Academic Publishers. especialmente Apicotermitinae y todas las que se alimentan del suelo. incluye detalles del enrollamiento del intestino y de cómo está conformada la válvula entérica para identificar algunas Apicotermitinae. D. anticuada. utilizando imagos. V. London.

Centre for Overseas para géneros de África del Oeste y Central. Darlington. (Family Termitidae) Zoological survey of do Sri Lanka. incluyenCountries: Isoptera (Termites). (1997). E. Excelente para entrenaPest Research. Continúa. (sin fecha).Apéndice 1. vol. The Fauna of India and Adjacent Countries: Isoptera (Termites). P. O. reporte detallado con definiciones de características morfológicas. y Chhotani. Clave detallada y de fácil manejo A Key to the Genera of the Termitinae by the Soldier Caste. B. M acrofauna 143 . S. (2003). L.Uganda. Región y autor Claves inéditas de termitas y listas de comprobación Wanyoni. con una amplia bibliografía. B. K. géneros y especies para imagos y soldados. B. ed) International Centre of Insect Physiology and Ecology. Fisher. Fisher. Título y referencias Notas No es una clave. (1989). Chhotani. Department of Entomology. (sin fecha). Documentos variados Roowal. P. Documento de base. ‘Taxonomy of Termites’. Bibliografía completa. Calcutta. imagos y soldados. Williams R. No publicado. Harvard University. R. Listas de material requerido para un muestreo de hormigas con precios en $US del 2001. (J. (1983). C. Harvard University. Entomology department. 672 pp. Los volúmenes I y II cubren todo el The Fauna of India and Adjacent subcontinente de la India. Zoological Survey of India. 801 pp. Los volúmenes I y II contienen claves hasta familias. M. Guías para caracterización del sitio y anotaciones relacionadas con el muestreo de hormigas. eje de muchas claves privadas de museos nacionales. I. O. II. A. 'Ant subfamilies’. No publicado. 'Guidelines for data collection for ants’. incluye claves hasta familias y subfamilias. C. M. Tanzania y Zanzibar. pero sí un listado Checklist of the Species of Termites que identifica la distribución entre (Isoptera) Recorded from East Africa. (2001). subfamilias. Sinopsis ilustrada de subfamilias y su distribución. (2001). B. Centre for Overseas Pest Research. vol. ‘Equipment specifications’ Department of Entomology. Calcutta. India. Ward. Kenia. y Williams. Sands W. C. utilizadas en taxonomía. M. miento avanzado. UC Davis.

lectura obligatoria. Región y autor Jones. Harvard University Entomology. Universiti Malaysia Sabah. Continúa. T. termitas. prepared for ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Título y referencias ‘Tools for the Rapid Assessment of Soil Invertebrate Biodiversity in the ASEAN Region’. (Anónimos. D. pero sin ilustraciones. Harvard University 144 Manual de biología de suelos tropicales . “Glossary of morphological characters used in ant taxonomy”. Isópteros y arañas (Araneae). (ed) 2003. Completo. No publicado. Bibliografía amplia y actual. Notas Revisión moderna y completa de la naturaleza de la biodiversidad del suelo y métodos de evaluación rápidos para hormigas. Department of Entomology. pp. 12–26 October. lombrices de tierra diplópodos. sin fecha).Apéndice 1. 2003. escarabajos del suelo. 1–39.

Scheffrahn y Krecek (2001). Revisión y claves. 2002). Referencia Contenido RHINOTERMITIDAE Heterotermes TERMITIDAE Amitermes Anoplotermes Atlantitermes Cornitermes Cyranotermes Cyrilliotermes Labiotermes Light (1932). M acrofauna 145 . Constantino et al. Revisión de mapas de distribución de especies del Nuevo Mundo con clave de soldados y alados. Cancello (1986). Emerson y Banks (1965). Revisión de Labiotermes sensu stricto. Revisión y claves. Trabajos taxonómicos con claves de especies de algunos géneros neotropicales. Fontes (1985). Clave de soldados. Constantino (1990). Clave de soldados. Revisión y claves de soldados (en portugués). Las claves hasta género son dadas en Krishna (1961. con claves. Claves de soldados de especies de Las Antillas (anticuado). Constantino (2001). (2006). Constantino y DeSouza (1997). Emerson (1952). Scheffrahn and Krecek (1993). Revisión y claves.Apéndice 2. Clave de alados (anticuado). Araujo (1954). Clave de soldados. Scheffrahn y Krecek. Neocapritermes Parvitermes Krishna y Araujo (1968). Clave de soldados de Paracomitermes (anticuado). Claves de soldados de especies de Las Antillas (anticuado). Revisión y claves (anticuado). Revisión y claves. únicamente Kalotermitidae). Emerson (1952). Nasutitermes Parvitermes Procornitermes Holmgren (1910). Clave de soldados de América del Sur. Revisión mundial con revisión de claves de las especies antillanas con claves hasta la diagnosis de los soldados. Revisión y claves (anticuado y en alemán). Mill (1983) y Constantino (1999. Constantino (1997). Género KALOTERMITIDAE Cryptotermes Eucryptotermes Procryptotermes Bacchus (1987) Scheffrahn y Krecek (1999). Snyder (1926).

Continúa. Claves de soldados. Contenido Revisión y claves. 146 Manual de biología de suelos tropicales . Fontes y Bandeira (1979). Revisión y claves (anticuado). Cancello (1986). Género Procornitermes Referencia Emerson (1952). Revisión y claves. Claves de soldados (anticuado). Emerson (1945) .Apéndice 2. Rhynchotermes Rotunditermes Syntermes Fontes (1985). Revisión y claves de soldados (en portugués). Constantino (1995).

427–472. Constantino. R. (1995) ‘Revision of the Neotropical termite genus Syntermes Holmgren (Isoptera: Termitidae)’. Cancello. Tropical Zoology. 55. distribution and ecology (Isoptera. Constantino. vol. N. pp. pp. (2006) ‘A taxonomic revision of the Neotropical termite genera Labiotermes Holmgren and Paracornitermes Emerson (Isoptera: Termitidae: Nasutitermitinae)’. pp. with a new species from Brazil (Isoptera: Termitidae: Nasutitermitinae)’. Emerson. Nasutitermitinae)’. Carvalho. vol. pp. E. vol. pp. S. vol. Constantino. 30... A. Bulletin of the American Museum of Natural History. y Vasconcellos. vol. 1. (1987) ‘A taxonomic and biometric study of the genus Cryptotermes (Isoptera: Kalotermitidae)’. pp. pp. (2001) ‘Key to the soldiers of South American Heterotermes with a new species from Brazil (Isoptera: Rhinotermitidae)’. Nasutitermitinae)’. Zootaxa. R. 10. C. (2002) ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. no 2208. 83. Termitidae. Goeldiana Zoologi. 189–236. K. pp. M. Emerson. O. University of Kansas Science Bulletin. E. A. (1997) ‘Key to the soldiers of Atlantitermes Fontes 1979. pp. paper 67. Literatura especializada en termitas neotropicales Araujo. Termitidae. Emerson. 31. (1965) ‘The Neotropical genus Labiotermes (Holmgren): Its phylogeny. 7. vol. F. S. paper 1340. Constantino. Tropical Pest Bulletin.. H. (1954) ‘Notes on the genus Paracornitermes Emerson 1949 with description of two new species (Isoptera. Papéis Avulsos de Zoologia (São Paulo). (1990) ‘Notes on Cyranotermes Araujo with description of a new species (Isoptera. F. pp. vol. 36. (1997) ‘Notes on Eucryptotermes with a new species from central Amazonia (Isoptera: Kalotermitidae)’. (1986) ‘Revisão de Procornitermes Emerson (Isoptera. L. (1952) ‘The Neotropical genera Procornitermes and Cornitermes (Isoptera. R. 475– 540. 1–91. R. Nasutitermitinae)’. Schmidt. A. y Banks. 181–189. A. 1–44. vol. R. Sociobiology. Bulletin of the American Museum of Natural History. pp. pp. 99. E. 2. R. Termitidae)’. Termitidae. pp. Insect Systematics and Evolution. Acioli. vol.. M acrofauna 147 . Zootaxa. A. 463–472. 205–213. A. 1–11. 455–518. American Museum Novitates. y DeSouza. Termitidae. 125–131. Nasutitermitinae)’. 1–40. (1945) ‘The Neotropical genus Syntermes (Isoptera: Termitidae)’. R. A. Constantino. R. F. 1–33.Apéndice 3. Cuezzo. vol. Revista Brasileira de Entomologi. E. Bacchus. Constantino. Constantino.

(1999) ‘Termites of the genus Cryptotermes Banks (Isoptera: Kalotermitidae) from the West Indies’. Termitidae. R. 94. 9. R. J. 138. 603–607. K. y Krecek. vol. pp. vol. Termitidae. University of California Publications in Entomology. pp. vol. Nasutitermitinae)’. L. G. L. (1979) ‘Redescription and comments on the Neotropical genus Rotunditermes (Isoptera. y Araujo. L. vol. Annals of the Entomological Society of America. R. Fontes. S. pp. 76. Scheffrahn. 303–408. Krishna. vol. pp. Proceedings of the US National Museum. Holmgren. vol. Bulletin of the American Museum of Natural History. (1932) ‘Contribution toward a revision of the American species of Amitermes Silvestri’. A. (1910) ‘Versuch einer Monographie der amerikanische Eutermes – Arten’. vol. pp. 68. pp. E. K. Bulletin of the American Museum of Natural History. 27. pp. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten. H. (1983) ‘Generic keys to the soldier caste of New World Termitidae (Isoptera: Insecta)’. (2001) ‘New world revision of the termite genus Procryptotermes (Isoptera : Kalotermitidae)’. 148 Manual de biología de suelos tropicales . vol. Krishna. pp. 84–138. T. Scheffrahn. Mill. (1961) ‘A generic revision and phylogenetic study of the family Kalotermitidae (Isoptera)’. Nasutitermitinae)’. vol. 179–190. vol. 23. Scheffrahn. Florida Entomologist. H. vol. 111–171. (1985) ‘New genera and new species of Nasutitermitinae from the Neotropical region (Isoptera. Light. (1926) ‘Termites collected on the Mulford Biological Exploration to the Amazon Basin 1921–1922’. Systematic Entomology. 7–25.Fontes. R. Snyder. R. R. N. (1968) ‘A revision of the Neotropical genus Neocapritermes (Isoptera. A. F. 107–110. y Krecek. (1993) ‘Parvitermes subtilis. E. J. 122. 13. Termitidae)’. 1–76. 3. pp. 530–539. y Bandeira. H. Insecta Mundi. 335–414. Revista Brasileira de Entomologia. J. pp. y Krecek. a new subterranean termite (Isoptera: Termitidae) from Cuba and the Dominican Republic’. Revista Brasileira de Zoologia. pp. 171–325. 5.

Enchytraeidae. La mesofauna se colecta utilizando dos métodos de muestreo: a) una muestra compuesta que contiene varios núcleos de suelo y hojarasca extraída de la superficie. El muestreo de la mesofauna (y otra biota del suelo) se encuentra integrado como parte de la estrategia global del inventario de la biodiversidad bajo del suelo. En cada punto de muestreo. y cuya abundancia no puede ser evaluada con exactitud por medio de la selección manual del suelo. a 3 m y 6 m de radio del monolito. en principio. Protura. sirven para colectar mesofauna que habita en el suelo mineral. Collembola (colémbolos). Pauropoda y otros Nematodos son típicos representantes de la mesofauna. acari y otra mesofauna del suelo: el método Berlese Agus Karyanto. mientras las trampas pitfall se utilizan para colectar los que habitan en la superficie del suelo. descrito en el Capítulo 2.Capítulo 4 Collembola. Los núcleos de suelo. b) del contenido líquido de las trampas pitfall. 149 . Elizabeth Franklin. y se complementan con pitfall. Cahyo Rahmadi. los núcleos de suelo se localizan en dos círculos concéntricos.2 y 2. Francis-X. por debajo de la hojarasca de la superficie y en la hojarasca en sí. localizadas a por lo menos 14 m del centro del monolito.0 mm. Acari (ácaros). bien por el método Berlese-Tullgren o por el de Berlese modificado. Susilo y Jose Wellington de Morais INTRODUCCIÓN La mesofauna está conformada por animales cuyo tamaño de cuerpo oscila entre 0. respectivamente. formas de larvas de especies de macrofauna también caen dentro del rango de tamaño de mesofauna. sin embargo.

composición de especies y diversidad en un hábitat específico son buenos indicadores de un suelo “sano” (Minor. En 1918. de manera que la muestra se seca lentamente. 2004). fue desarrollado por Antonio Berlese. constituyen un componente integral de la estructura del suelo. no resulta útil para colectar ácaros oribátidos (Acari: Oribatida) porque estos animales. Debido a su papel regulador en la descomposición y el reciclaje de nutrientes. se alimentan de nematodos vivos (Siepel. su abundancia. El método pitfall (Capítulo 3. su densidad puede alcanzar cientos de miles de individuos por m². 1990). se convierten en un importante desecho nitrogenado. a finales del siglo XIX. En este sistema circula agua caliente entre las paredes dobles de latón del embudo (o embudos). en suelos no perturbados. se pueden encontrar entre 50 y 100 especies (Norton. al igual que en la formación de la estructura de suelo. reemplazando la envoltura de agua por un foco de luz eléctrica. Sus heces fecales proporcionan una amplia superficie para la descomposición primaria por hongos y bacterias y. con una diversidad de especies también muy alta y. normalmente. Se sugiere que para un muestreo normal ambas extracciones de embudo y pitfall deben emplearse de manera conjunta. por ejemplo. Estos ácaros se alimentan de materia de plantas vivas o muertas y de carroña. son sedentarios (con la excepción de algunas familias como Galumnidae y Scheloribatidae).) es suficientemente eficaz como para poder capturar colémbolos que viven en la superficie del suelo (edáficos). El principio es colectar pequeños núcleos o bloques y combinarlos para hacer una sola muestra compues150 Manual de biología de suelos tropicales . después de muertos. y algunos son predadores. en contraste con los grupos más oportunistas como los colémbolos. forrajean en hongos y algas. MÉTODOS DE MUESTREO Los protocolos aquí descritos abordan principalmente los de los ácaros y colémbolos presentes en los horizontes minerales y en la hojarasca. asimismo. Los ácaros oribátidos (también conocidos como Cryptstigmata a los que se refieren como ácaros escarabajos o ácaros de caja) son artrópodos numéricamente dominantes en los horizontes orgánicos de la mayoría de los suelos. sin embargo. 1990).El método Berlese es un sistema de extracción por embudo para separar los pequeños artrópodos del suelo. Lo anterior es aplicable para los grupos mayores de microartrópodos del suelo o a partir de las proporciones de abundancia y diversidad entre los grupos de mesofauna del suelo. Tullgren modificó el método Berlese. a su vez.

Dichas muestras deben permanecer alejadas del calor del motor del vehículo y de su sistema de escape. C ollembola . se etiquetan y se transfieren a un costal de tela de 30 x 35 cm de tamaño. la fauna también puede morir. y toma muestras a una profundidad de hasta 5cm que posteriormente se transfieren a un recipiente de plástico de 300 ml de volumen (Figuras 4. Una vez en el laboratorio. Si se transporta la muestra sin aire acondicionado. se colocan todos los costales de tela bajo techo. Ahora las muestras estarán listas para su traslado al laboratorio.1a y b).5 x 3. Enseguida se empacan las muestras en una caja de cartón. De manera alternativa. tanto la luz solar como el calor del motor. Este aparato mide 3. Las muestras de suelo. se utilizan tres o cuatro muestras compuestas y no sólo una.5 cm de ancho y 10 cm de alto. con una capa de papel para mantener un ambiente de humedad estable dentro de la caja. La muestra compuesta de suelo se divide en 10 bolsas de nylon. con un promedio de un kilo por bolsa. acari y otra mesofauna del suelo 151 .5 x 5 cm de profundidad. No se debe usar un costal de plástico porque la temperatura del suelo puede aumentar sustancialmente. Así. son dañinos para los animales que se encuentran en la muestra. utilizando un sacabocados.5 x 3. utilizando una pequeña cuchara que tome un volumen constante de aproximadamente 100 ml. de acuerdo con su localidad de muestreo. lo que provocaría la muerte de la mesofauna antes de su extracción. con o sin hojarasca. las muestras del suelo pueden ser colectadas en muestras de 3. la cual es entonces sub-muestreada por extracción por el método de BerleseTullgren. para evitar que la mesofauna muera. se colectan en el campo. porque la tela permite que circule el aire. para ello es recomendable utilizar un vehículo con aire acondicionado. El siguiente paso es almacenar las muestras en cajas grandes para transportarlas hasta el laboratorio.ta. evitando que la temperatura se eleve. donde serán identificadas. el suelo deberá someterse de inmediato a su extracción. el suelo de 12 sub-muestras se coloca entonces en una bolsa de 5 kg como una muestra compuesta. De la misma manera. De manera alternativa. ésta deberá situarse en el asiento del pasajero. también se deben proteger de la lluvia durante el traslado. porque si éstas se mojan o humedecen demasiado. Al llegar al campo de base o laboratorio. Se ha observado que los costales de tela son muy eficientes para almacenar temporalmente y transportar las muestras durante largas distancias y tiempos. se debe evitar que la muestra se exponga a sol directo durante el encostalado en el campo.

1 Sacabocados de metal para muestrear la mesofauna en la hojarasca y en el suelo mineral. A B EXTRACCIÓN Método Berlese-Tullgren El aparato Berlese-Tullgren (Figura 4.5 mm. éstos se suspenderán a 14 cm por encima del tamiz. aunque también se podrían usar los de 40 W. para evitar que otros insectos voladores pasen a formar parte de la muestra. El tamaño de malla del tamiz. Morais y E. hormigas. utilizando una pequeña cuchara o cuchillo de campo. utilizando para ello focos eléctricos (los de 25 W son ideales). Franklin. dividido en compartimentos superiores e inferiores. se debe incrementar el calentamiento de manera gradual cada día. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. La manera ideal es utilizar un contenedor de madera de alrededor de 160 x 50 cm. se mantiene el aparato en el laboratorio del campo de base. de 1. cerca del área de referencia. arañas y otros artrópodos.2 a) al igual que puertas.W. deberá contener cuatro agujeros de 4 mm de diámetro para permitir que animales mayores escapen hacia abajo. cada compartimento contará con un marco para sostener los embudos de plástico (Figura 4. Se coloca un tamiz (de 8 cm de diámetro y 5 cm de altura) con muestras de suelo y hojarascas encima del embudo. b) se utilizan guantes como precaución contra enredaderas.2) es utilizado para extraer la mesofauna activa que habita en las muestras de suelo y en la hojarasca. dejando los focos encendidos cada vez 152 Manual de biología de suelos tropicales .Figura 4. Cortesía de: J. Se calientan ligeramente los embudos.

para evitar que el material de la muestra se seque demasiado rápido. Se ajusta la posición de la lámpara para asegurar que la temperatura del suelo suba gradualmente. si se dejan durante más tiempo nacen los C ollembola . Figura 4.durante mayor tiempo. por lo tanto. acari y otra mesofauna del suelo 153 .W. la cual contiene un conservador. por un periodo de hasta 8 días. la temperatura de la muestra se aumenta gradualmente de 27°C hasta aproximadamente 40-45°C. esto inmovilizará a la mesofauna antes de que se escape. evitando así que las especies que se mueven con mayor lentitud queden atrapadas en las capas secas y duras del suelo. Las muestras se quedan en el aparato hasta que estén completamente secas. de modo que los animales que caen por la malla lo hagan de manera rápida hasta llegar a la botella que los recibe. Cortesía de: J. b) sistema Berlese–Tullgren en operación. Típicamente. Morais y E. Franklin. el embudo deberá presentar una superficie lisa y una fuerte pendiente. para una mayor efectividad. hasta que mantengan un peso seco constante que generalmente tarda unos 8 días. El principio básico del aparato Berlese-Tullgren es que los organismos de suelo responden al incremento de temperatura o sequedad en el suelo migrando hacia abajo hasta que finalmente caen a través de la malla. Nota: nótese que las patas están sumergidas en agua para evitar la invasión de hormigas y de otros insectos. es decir. en una botella que los recibe hasta la base del embudo.2 a) contenedor de apoyo para embudos Berlese–Tullgren.

el tiempo de incubación (tiempo necesario para extraer la fauna del suelo) es aproximadamente de 4 a 5 días. aun en regiones remotas (Frankin y Morais. se utiliza formol al 4% o etanol. el sistema Berlese-Tullgren y. en donde se coloca un tamiz con una malla de 2 x 2 mm (malla 13). cuando se compara con otros métodos de muestreo. especialmente si el embudo Berlese no está perfectamente cerrado. 2006). El envase receptor se llena con etanol al 96% para su conservación y durante intervalos de 4 a 5 días se cambia el envase receptor. dependiendo de las condiciones de humedad inicial del suelo. Para evitar lo anterior.5). el agujero de ventilación de la tapa deberá cerrarse durante la noche.3. arriba de las muestras de suelo.. que se muestra en la figura 4. El uso de un foco puede atraer insectos nocturnos. al 96%. con la colocación de una bombilla de 10 a 40W. Como líquido conservador. Son baratos y sencillos.huevos y las formas inmaduras se vuelven adultos. por lo que las muestras serán menos representativas. al tiempo que utilizan el mismo principio para extraer un solo núcleo o una muestra conglomerada mayor. El aparato Berlese sensu stricto puede transformarse en un modelo Berlese-Tullgren. Una ventaja de dichos sistemas es que se pueden operar a diferentes escalas. 154 Manual de biología de suelos tropicales . éste se cerrará con una tapa para prevenir la entrada de otros insectos. un embudo de aluminio modificado de Berlese. generalmente. Un sistema Berlese que opera sin luz muchas veces permite una mejor extracción. El método Berlese modificado Cuando no se cuenta con electricidad. en cierta manera. A pesar de una eficiencia menor. lo único que se requiere es un embudo más grande y un tiempo de secado más largo. Asimismo. el equipo completo requerido es barato y puede ser fácilmente improvisado (Figura 4. En la presencia de luz. en este caso. aunque tomará más tiempo. es uno de los más usuales para la extracción en la evaluación de la diversidad y densidad de microartrópodos del suelo (André et al. pueden moverse con facilidad desde el lugar del muestreo y ser ajustados para acomodar un gran número de muestras. el embudo se coloca sin luz y el proceso de calentamiento-secado se lleva a cabo simplemente a temperatura ambiente. es el adecuado para el secado sin electricidad. el tiempo de espera será de 7 a 14 días. el de Berlese. 2002).

PROCESOS DE ACLARADO Y MONTAJE DE ESPECÍMENES Para su identificación. con embudo superior de 40 cm de diámetro. Suhardjono LIPI Bogor. R. acari y otra mesofauna del suelo 155 . los especímenes de mesofauna son montados sobre laminillas. Fuente: cortesía del Dr. hecho de aluminio.Figura 4.3 Embudos Berlese llenos de suelo y hojarasca. después de su aclarado. Y. Figura 4. El proceso de montaje debe realizarse bajo un microsC ollembola .4 Embudo Berlese modificado. de 50cm de altura.

hasta neutralizar la reacción. requiere de un microscopio compuesto. aunque el hidróxido de potasio (KOH) y el ácido láctico son alternativas efectivas. como algu156 Manual de biología de suelos tropicales . copio de disección. dependiendo del tamaño. aunque Greenslade et al. y da buenos resultados (Greenslade et al.R.Figura 4. 2008). normalmente. Proceso de aclarado El aclarado consiste en volver más transparente el tejido de los especímenes. Un método más simple de aclarado es utilizando ácido láctico. (2008) propusieron una solución de KOH 10% durante 1 a 5 minutos. con o sin calentamiento. normalmente se usa una solución de Nesbitt (su composición se describe a continuación). Los taxa con cutículas delicadas. Los especímenes pueden ser aclarados con un 15% de KOH. Coelho. durante dos a cinco minutos. en donde se sumergen y calientan durante los diferentes periodos de tiempo. durante unos minutos. este método es más barato. mediante el lavado y removido de las grasas y pigmentos del cuerpo.. Después de la inmersión en KOH. dependiendo del pigmento y de la grasa del cuerpo del animal. se transfieren los especímenes a una solución de cloral fenol. Cortesía de: M. la observación de la morfología. Para ello. fácil y seguro.5 Equipo básico requerido para llevar a cabo extracciones Berlese-Tullgren núcleo por núcleo..

en proporciones 50:25:25) o simplemente con ácido láctico (frío o caliente). porque el ácido láctico continúa aclarándolos y ablandándolos. por ejemplo. en el C ollembola . Protura y Pauropoda no deben meterse en una solución concentrada de ácido. patas. abdomen grande (látero-lateral). mientras que las partes del cuerpo de los Symphypleona grandes se montarán de la siguiente manera: cabeza (dorsoventral). Para un almacenaje permanente. muchos ácaros oribátidos se guardan en viales etiquetados.. los especímenes deben transferirse a otro medio. utilizando el ejemplo de los colémbolos. la posición indicada es látero-lateral. estos especímenes deberán sumergirse en una mezcla de 50% de ácido láctico/etanol durante unas horas. por lo menos. es aconsejable montar todas las partes del cuerpo en una sola preparación. también pueden usarse para el proceso de montaje (Tabla 4. La posición de los especímenes sobre el portaobjetos difiere entre los órdenes: por ejemplo. Symphypleona y Neelipleona. tubo ventral y en los segmentos V y VI abdominales. los especímenes pueden destruirse o desarticularse. siete días. se recomienda la disección en el caso de Symphypleona y de las Paronellidae y Entomobrydae mayores (6 a 8mm). sin calentamiento. abdomen pequeño y fúrcula (dorsoventral). el medio líquido Hoyer. mientras que para los Entromobrymorpha. tales como cabeza. Las partes diseccionadas del cuerpo de los Entromobrymorpha deberán colocarse de forma dorso-ventral sobre el portaobjetos.nos Diplura. Montaje No existen métodos totalmente satisfactorios para el montaje (Greenslade et al. si no se hace. La disección se realiza en varias partes del cuerpo. acari y otra mesofauna del suelo 157 . como característica clave. los colémbolos Poduromorpha se deben colocar en posición dorso-ventral. Después de su identificación. al que se añade un 5% de glicerina. cristales de fenol y agua destilada. En cada caso se debe regular y controlar el tiempo. Para dicho montaje se requiere de una solución Berlese. De nuevo. Otras soluciones. 2008). En el caso de especímenes mutilados. Normalmente. para que puedan ser bien identificados. Las especímenes son montados en laminillas y secadas en el horno a 70°C durante. Los ácaros esclerotizados pueden ser aclarados con lactofenol (compuesto por ácido láctico.1). con el propósito de identificarlos viendo la quetotaxia de cada parte. fúrcula. con alcohol 70%. Algunos grupos necesitan ser disecados o disectados antes del montaje. Los ácaros también pueden aclararse y conservarse trasladándolos del alcohol a un medio de Hoyer.

Montaje de especimenes: medio líquido de Hoyer Nota: montaje Berlese: calentar a 70°C durante 7 días. Trave (1965). 50 ml de agua destilada. sin embargo.cals.caso de ácaros de suelo.htm o http://soilbugs. la pericia taxonómica quizás sea el factor determinante en la selección de una taxa para su estudio posterior. resulta difícil.1 Composición química para aclarar y montar especímenes. 10 g de glucosa y 5 ml de ácido acético glacial.nz/key. tales como los de Bachelier (1978) y Dindal (1990). de donde se pueden obtener guías de ayuda para la identificación. una identificación más allá de este nivel. aunque también se puede usar para otros grupos de mesofauna.php. hacia el borde de la depresión.5 ml de ácido hidroclórico 20 ml de agua destilada. El espécimen se traslada a unas gotas de ácido láctico o glicerina en un portaobjetos excavado. 15 g de goma arábiga. 30 g de goma arábiga. 50 g de hidrato de cloro. A nivel de especies. en el caso de la mayoría de los grupos de artrópodos de suelo.ncsu. IDENTIFICACIÓN DE ESPECÍMENES Y ANÁLISIS DE DATOS Identificación La mayoría de los invertebrados del suelo pueden identificarse hasta orden o familia con la ayuda de trabajos estándares de referencia. El espécimen puede rodarse suavemente hasta conseguir la orientación deseada. esta última dirección también concentra la literatura principal. Krantz (1978) y Norton (1990). donde se indican las características distintivas de varios grupos de invertebrados. ofrecen una buena discusión de fondo acerca de cómo aclarar y montar ácaros. www. El medio líquido de Hoyer es un agente temporal y no se endurece con calentamiento. pero las preparaciones pueden hacerse semipermanentes sellando el recubrimiento con barniz de uñas transparente. se hace un montaje temporal. Se coloca de manera parcial un cubreobjetos sobre la depresión y se empuja el espécimen por debajo del recubrimiento. 40 g de hidrato de cloro y 2. Para aclarar especimenes solución Nesbitt’s 10% KOH ó NaOH Montaje de especimenes : medio líquido de Berlese 25 ml de agua destilada. Por ejemplo. 200 g de hidrato de cloro y 20ml de glicerina.edu/course/ent591k/kwikey1.ac. 158 Manual de biología de suelos tropicales . 5 ml de glicerina.massey. Tabla 4. Se encuentran disponibles varias páginas en la web.

1981b.. es utilizado para estimar su abundancia. Scorpiones. Un estudio completo de la biología. se encuentra disponible en Greenslade et al. 1999). ya que contiene guías de identificación ilustradas. por ejemplo. Isóptera. hasta nivel de familia y. Mites. Symphyla. órdenes. La base de identificación y clasificación se encuentra resumida en las referencias que se citan a continuación. taxonomía y ecología de grupos de la biota del suelo. son escasas las guías específicas para este grupo en los trópicos.1982b y 1983) pueden utilizarse para identificar colémbolos a nivel especies. Chilopoda. familias. Balogh y Balogh (1990) ofrecen una breve caracterización y claves de identificación para ácaros oribátidos que habitan en la región neotropical. Pseudoscorpionida. Enchytraeidae. utilizando pequeños núcleos o bloques. El libro se escribió para un fácil manejo. acari y otra mesofauna del suelo 159 . Araneae.permitiendo así. quienes ofrecen guías y figuras a nivel genérico para ácaros que pertenecen a la suborden Oribatida. Los subórdenes de ácaros y muchas familias de colémbolos son de fácil identificación. al igual que una lista de comprobación y bibliografía de especies descritas en esta área. Pauropoda. algunos géneros y listas de especies terrestres conocidas. Las muestras colectadas. Análisis de datos El número de individuos en cada orden y en cada lugar. de especies para algunos grupos como Nematoda. 1982a. algunas veces. Diplura. Los recursos para la identificación de ácaros. a nivel familia. por lo menos. están disponibles en Kranz (1978) y Dindal (1990). al igual que referencias de la taxonomía actual de estos grupos. Isopoda. son combinadas para crear una muestra compuesta que se somete a extracción. Protura. Publicaciones de Yoshii (1981a. por lo que es recomendable tanto para principiantes como para profesionales. Desafortunadamente. la identificación a nivel género y/o especies. Coleoptera. la identificación de colémbolos. El libro contiene claves de identificación para todas las clases. Balogh (1972). C ollembola . Diptera y Hymenoptera. Asimismo. es mostrado en Dindal (1999). una vez conocida su morfología y características básicas (Crossley y Coleman. Opiliones. en las familias Entomobryidae y Paronellidae. 2008. Balogh y Mahunka (1983) y Balogh y Balogh (1992). Adis (2002) ofrece guías ilustradas para principiantes y cualquier persona interesada en Arachnida y Myriapoda Neurotropicales. Bachelier (1978) ofrece buena información de fondo dentro de las amplias unidades taxonómicas de artrópodos del suelo e incluye guías ilustradas para varios grupos. a nivel genérico. Collembola.

El número de individuos normalmente se transforma de forma logarítmica log: x’=log10 (x+1) para evitar dar mayor peso a las especies dominantes en el análisis de datos (Ludwig y Reynolds. también pueden detectar los efectos de la perturbación con poca pérdida de información y llegar a ser una herramienta preliminar para describir patrones y sucesiones en ecosistemas del suelo perturbado por humanos (Caruso y Migliorini. vol. El programa DIVERS. etc. junto con otros índices de diversidad.). 2006). reality or conning?” Oikos. Paris. fitofagos. (1978) “La faune des sols. Este índice resulta especialmente útil para eliminar invertebrados hiper-diversos. incluir la riqueza de especies en el caso de los taxa seleccionada para la identificación a nivel especies. tales como colémbolos.. son écologie et son action“. basada en la correspondencia estadística entre combinaciones de singletons y de otras especies raras (estimador de abundancia Chao-SØrensen) fue desarrollada por Chao et al. puede usarse para calcular los índices de riqueza de especies. 2003). M. J. André.. X. 3–24. del paquete de metodología ecológica para Windows. ejemplo: ácaros oribátidos. Los datos obtenidos deben. 96. (2002) Amazonian Arachnida and Myriapoda. Este estimador. de acuerdo con su función ecológica mayor (detritivoros. pueden ser calculados utilizando el programa EstimateS (Colwell. También puede llevarse a cabo un análisis adicional como rarefacción y estadística multivariada. 2005. Ducarme. y Lebrun. ORSTOM. Pensoft. Se ha demostrado que datos a nivel género y familia. Initiations et Documents Techniques. H. (2002) “Soil biodiversity: Myth. Ph. 2006). 2006. Dado que los grupos de lugares similares ofrecen una fauna similar y que la mayoría de animales del suelo pueden distribuirse en los grupos funcionales básicos (Ruf et al. REFERENCIAS Adis. Este procedimiento mejora la eficiencia de la extracción porque maximiza las posibilidades de captura de grupos o especies representativos. 160 Manual de biología de suelos tropicales . no 38.utilizando el método Berlese-Tullgren. pp. un nuevo estimador estadístico que toma en cuenta especies compartidas no detectadas.. 1988). los taxa escasamente conocidos también se pueden clasificar a niveles taxonómicos más altos (orden o familia). ácaros oribátidos y hormigas. Sofia-Moscow. Bachelier. por lo tanto. o bien. G. predadores. La comparación de la composición de taxa entre usos de suelo debería llevarse a cabo utilizando un análisis jerárquico de agrupación y la unión promedio de agrupaciones de los datos transformados. con numerosas especies raras.

in M. Y. John Wiley and Sons. Colwell. Akadémiai Kiadó.eeb. www. Chazdon. L. J. F. (1983) Primitive Oribatids of the Palaearctic Region. Brill. in D.nz/~maminor/mites. (2006) ‘Soil Mesofauna in Central Amazon’. Amsterdam. J. R. Budapest. vol. Dindal. Caruso. pp. Leiden (in press). Dindal (ed) Soil Biology Guide.Balogh. pp. A. Hungarian Natural History Museum Press. uconn. Biometrics. y Reynolds.edu/estimates. 148–159. M. in F. J. in J.. y Suhardjono. Brussaard (eds) Soil Biodiversity in Amazonian and Other Brazilian Ecosystems.. (2006) ‘Micro-arthropod communities under human disturbance: Is taxonomic aggregation a valuable tool for detecting multivariate change? Evidence from Mediterranean soil oribatid coenoses’. T-J. P. Ecology Letters. (1990) ‘Oribatid Mites of the Neotropical Region II’. G. Siqueira and L. Boca Raton. John Wiley and Sons. (1972) The Oribatid Genera of the World. Norton. 46–53. Sumner (ed) Handbook of Soil Science. (2005) ‘A new statistical approach for assessing compositional similarity based on incidence and abundance data’. L. S Moreira. y Balogh. W. html. pp.. y Balogh. Balogh. New York. E. (1992) The Oribatid Mite Genera of the World. K. Chazdon. vols 1 and 2. O. J. y Shen. A. 142–162. M. L. no 1. CRC Press. http://viceroy. K. R.ac. Crossley. A.. y Shen. (1999) ‘Microarthropods’. Greenslade. T. R. accessed 10 January 2008. J.. Version 8 User’s Guide and Application’. 2. A.. E. 59–65. Bedos. Mahunka (eds) The Soil Mites of the World. (2008) Handbook to Collembola of Indonesia. Wallingford. Franklin. y Migliorini. y Mahunka. J. Krantz. L. T-J. Budapest. Amsterdam. pp. S. Colwell. New York. John Wiley & Sons. Ludwig. 30.massey. P. D. y Coleman. Elsevier. 62. vol. (1988) Statistical Ecology: A Primer on Methods and Computing. 361–371. Fauna Malesiana. D. R. (1978) A Manual of Acarology. 8. P.. R. 779–803. K. pp. (2006) ‘Abundance-based similarity indices and their estimation when there are unseen species in samples’. acari y otra mesofauna del suelo 161 . Colwell. D. Chao. Chao. Elsevier. CABI Publishing. vol. W. y Morais. Oregon State University Book Store Inc. Balogh. pp. L. Acta Oecologica. Minor. New York. M. 2. Balogh and S. Oregon. Deharveng. (1990) ‘Acarina: Oribatida’. (1990) Soil Biology Guide. J. no. (2006) ‘EstimateS: Statistical estimation of species richness and shared species from sample. no. (2004) ‘Soil mites and other animals’. Balogh. J. A. R. R. C ollembola .

81-12. 98. A. 1–70. pp. Nothridae) and Platynothrus peltifer (Koch) (Acari. Oribatida. d’observation et de conservation des Oribates (Acariens) et autres microathropodes”. pp. Japan International Cooperation Agency. (1982a) ‘Lepidocyrtid Collembola of Sabah’. Hund-Rinke. Beck. R. Fert. 6. R. y Spelda. Entomological Report from the Sabah Forest Research Centre No. Biol. 7. L. P. 1–28. Entomological Report from the Sabah Forest Research Centre No. 1–3.. 3. R. pp.. pp. (2003) “A biological classification concept for the assessment of soil quality: “Biological soil classification scheme” (BBSK)’. 23–47.. R. Japan International Cooperation Agency. 4. Travè. H. no. (1990) ‘Niche relationships between two panphytophagous soil mites. J. (1981a) ‘Paronellid Collembola of Sabah’. Japan International Cooperation Agency. 162 Manual de biología de suelos tropicales . (1983) ‘Studies on Paronellid Collembola of East Asia’. Yoshii. Siepel. 8112. (1982b) ‘Studies on the Collembolan Genera Callyntrura and Dicranocentroides’. pp. Entomological Report from the Sabah Forest Research Centre No. pp. vol. K. 1–70. Nothrus silvestris Nicolet (Acari. R. de triage. 1–38. pp1–38. Camisiidae)’. Japan International Cooperation Agency. Japan International Cooperation Agency. Ecosystems and Environment. Römbke. 139–144. Oribatida.Ruf. pp. 9. J. Entomological Report from the Sabah Forest Research Centre No. EX-1 JR. J. Yoshii. (1981b) ‘Neanurid Collembola of Sabah’. vol. Soils. (1965) “Quelques techniques de récolte. no. Yoshii. 5. vol. EX-1 JR. 2. Agriculture. Yoshii. Entomological Report from the Sabah Forest Research Centre No. Revue d’Écologie et de Biologie du Sol.. 263–271. Dreher. Yoshii. 2.

ya que poseen un cuerpo alargado y cilíndrico. Petersen. 1980. 1982). Cares y Shiou P. además de estos bene163 . 1990). Derivado de su evolución. Los nematodos en una primera aproximación. en todas las latitudes del planeta y desde fondo del mar hasta la cima de las montañas. los nematodos se adaptaron a la exploración de una amplia variedad de fuentes de alimento. son conocidos como una amenaza para la salud humana. La palabra nematodo deriva del griego “nema” que significa “forma de un hilo”.Capítulo 5 Nematodos del suelo Juvenil E. protozoarios. los nematodos están presentes en cualquier lugar donde exista carbono orgánico. otros nematodos y microinvertebrados. ellos son responsables del 10 a 15% de la respiración de los animales del suelo (Sohlenius. los cuales se consideran uno de los grupos de animales más abundantes y más diversos en el planeta. ellos juegan un papel importante como agentes de ciclado de nutrientes y como reguladores de la fertilidad del suelo mediante el flujo de energía y la movilización y utilización de nutrimentos (Procter. mientras que las formas de vida libre se alimentan de microorganismos (bacterias y hongos). Huang (†) INTRODUCCIÓN Los nematodos del suelo son pequeños invertebrados dependientes del agua. animal y de plantas. Debido a su gran capacidad de adaptación. algas. sin embargo. Aunque la biomasa de nematodos en el suelo es pequeña (10¹ a 104 mg peso seco m-2). los nematodos parásitos tienen la capacidad de colonizar y alimentarse de tejidos de plantas y animales. De esta manera.

tal es el caso de los nematodos entomofílicos Deladenus siricidicola o los entomopatógenos Steinernema carpocapsae y Heterorhabditis bacteriophora. Su omnipresencia y abundancia en todo tipo de suelos y hábitats acuáticos. los nematodos bacteriófagos pueden incrementar su población ante cualquier perturbación del suelo o bien. Los omnívoros tienen la cavidad bucal armada con un estilete hueco (Ilustración 2e). Se distinguen también entre ellos mismos por su 164 Manual de biología de suelos tropicales . micófagos. mismos que carecen de estilete (Ilustración 2c).ficios para el ecosistema. equipados en su mayoría con un estilete pequeño y delicado (Ilustración 2b). en algunos casos. Por tal motivo. bacteriófagos. Los nematodos depredadores tienen la cavidad bucal equipada con una o más estructuras en forma de dientes (Ilustración 2d). depredadores y omnívoros (Ilustración 2). con la capacidad de alimentarse de cualquier fuente. 2006). mediante el cual puede causar pérdidas significativas en varios cultivos. poseen un estilete que les permite alimentarse de otros nematodos. los nematodos están bien representados a lo largo de la red trófica del suelo. En el caso de nematodos parásitos de plantas. se alimentan de las hifas de hongos saprofíticos. bacteriófagos. en la mayoría de los casos la identificación de los diferentes grupos funcionales puede lograrse en base a la morfología de su aparato bucal. patogénicos. influir en la nodulación por parte de bacterias tipo Rhizobium. microinvertebrados y protozoarios. son polífagos. los califican como poderosos bioindicadores de condiciones ecológicas (Huang y Cares. benéficos y micorrízicos. así como alimentarse y diseminar bacterias benéficas y fitopatógenas. mientras otros ocupan áreas más restringidas. bajo condiciones de enriquecimiento de nutrimentos. una condición que puede interpretarse como indicador de la fertilidad del suelo (Ferris et al. Los nematodos bacteriófagos. Aunque la identificación de estos organismos requiere de intenso entrenamiento. pueden regular el nitrógeno y el fósforo disponible para las plantas. algunos nematodos micófagos son pueden comportarse como parásitos facultativos de plantas. herbívoros y también como depredadores al alimentarse de otros nematodos. o en algunos casos. también participan en importantes servicios del agroecosistema al fungir como agentes de control biológico de plagas de insectos. por lo que pueden fungir como micófagos. Algunos nematodos viven en un amplio rango de ambientes. Los micófagos. Los nematodos del suelo viven en grupos o gremios. el aparato bucal incluye un estilete tipo aguja (lustración 2a). así como su ciclo de vida corto y sensibilidad ante alteraciones ambientales. compuestos por lo general de cinco grupos funcionales principales: parásitos de plantas. 2001). pueden alimentarse de bacterias y esporas de hongos. Como típicos estrategas r.

poseen una baja movilidad. por tal motivo. además son los más resistentes a la perturbación del suelo y a contaminantes químicos. Las muestras son transportadas al laboratorio en una caja aislada y almacenadas a 4° C hasta su extracción. puede presentar un índice de sistemas de uso de suelo y cambios de uso de suelo y medir los niveles de perturbación provocados por contaminantes y otros factores. se trazan dos círculos concéntricos. pero más grandes. se agita durante 30 segundos y se deja reposar otros 2 minutos para que las partículas del suelo se sedimenten. abundancia y estructura de comunidad. Según lo propuesto por Bongers (1990) y Bongers y Borgers (1998). los nematodos colonizadores (similares a los estrategas r) típicamente poseen un tiempo de generación corto. respectivamente. tomando en cuenta su diversidad. producen pocos huevillos. los nematodos persistentes (similares a estrategas k) se caracterizan por necesitar un largo tiempo de generación. un análisis apropiado de la comunidad de nematodos. todos los núcleos de suelo se deben tomar a una profundidad de 20 cm. y ocho puntos en el círculo grande. muestran la presencia de dauerlarva e incrementan sus poblaciones cuando existen condiciones ricas en alimentación. MUESTREO DE SUELO En cada punto de muestreo dentro de un sistema de cuadrícula (véase Capítulo 2). EXTRACCIÓN DE NEMATODOS La muestra de suelo se mezcla completamente y se toma una submuestra de 300 ml. la cual se vacía a una cubeta con 2 litros de agua.sensibilidad a la perturbación del suelo y a los contaminantes químicos. Esta suspensión se pasa a través de tamices de 40 a 60 mallas (tamaño de malla de 250 a 350 µm.1). A esta última suspensión de nematodos se le pueden eliminar aún más partículas de N ematodos del suelo 165 . y los nematodos se colectan directamente en un tamiz de 400 mallas (tamaño de malla de 37 µm) (Figura 5. lo cual deberá hacerse con la mayor rapidez posible. una ausencia de dauerlarva y sensibilidad ante contaminantes y otros factores de perturbación. Para colectar el suelo se utiliza un nucleador de acero y las muestras se toman en cuatro puntos equidistantes en el círculo pequeño. respectivamente). Por otra parte. Los doce núcleos de suelo se depositan en una bolsa de plástico que deberá sellarse para evitar su desecación y además protegerla de la luz solar. con un radio de 3 m y 6 m. producen muchos huevecillos pequeños.

1 A la izquierda. En este procedimiento. contenida en el vaso. Posteriormente. Una vez calentados los tubos.3a). se distribuye en tubos de ensayo para su fijación. la suspensión acuosa se centrifuga primero a 3. juego de tamices de metal (de tamaño de malla 45 arriba y 400 abajo). se añade un volumen igual de solución Golden Figura 5. La suspensión.3b) y. FIJACIÓN Y CONTEO DE NEMATODOS Los nematodos extraídos se matan con agua caliente a 50-60°C durante un máximo de un minuto (Figura 5.2a) y se centrifuga de nuevo a 1. suspensión de suelo en reposo.suelo mediante un método modificado de centrifugación con flotación de azúcar (Jenkins.000 rpm durante uno a dos minutos. éstos se dejan reposar durante 30 minutos y se remueve el exceso de sobrenadante utilizando una pipeta o por medio de succión al vacío (preferentemente).500 rpm durante 5 minutos y el sobrenadante se descarta. dejando así una suspensión de nematodos de 10 a 20 ml. 1970). y a la derecha. Posteriormente. para luego colectarse en un vaso de precipitados (Figura 5.2b). 1964). 166 Manual de biología de suelos tropicales . el sedimento o botón dentro del tubo de centrífuga se resuspenden en solución de sacarosa (456g L-1) (Figura 5. posteriormente se fijan con solución Golden 2X (Hooper. Los especímenes que se hallan sobre la malla se lavan y arrastran con agua. los nematodos se colectan a partir del sobrenadante utilizando un cernidor con tamaño de malla de 37 µm (Figura 5.

con lo que se obtiene una concentración final de formol 3. N ematodos del suelo 167 .2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos. b) muerte de nematodos en agua caliente.3 a) Nematodos recuperados mediante el lavado de malla de 400. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. a b Figura 5.2%.Figura 5. de alícuotas de 1 ml. 2X. La suspensión resultante se ajusta a un volumen de 15 ml y se cuenta el total de nematodos en la población mediante la toma al azar. el número total se obtiene de multiplicar la media de tres conteos de manera que el número total representará el número medio de 3 conteos de submuestras x 15. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa.

El volumen de la caja se reestablece con solución Seinhorst II. utilizando un microscopio compuesto (se requiere un aumento de 400 a 1. en esas condiciones se retira la tapa de la caja para que se reduzca por lo menos a la mitad de su volumen. al final. la caja se retira del desecador y se deja evaporar a la misma temperatura durante un mínimo de cuatro horas. 1988. La identificación de nematodos por caracteres morfológicos se basa en la literatura taxonómica especializada (Goodey. Smart Jr y Nguyen. Loof. Anderson y Potter. 1959) suele modificarse para evitar la laboriosa tarea de pescar individualmente cada nematodo y elaborar numerosas preparaciones permanentes. se coloca una tira de cinta adhesiva para evitar que el cubreobjetos aplaste a las especímenes. Raski.5.7). 1991. Nickle y Hooper. Smart Jr y Nguyen. 1983. 1991. 1994. 1991.1974. Después de este proceso. 2001). 1991. Thorne. 1991. Fortuner.6). Geraert. la preparación se sella utilizando bálsamo de Canadá (Huang et al. La modificación consiste en reducir a 3 ml el volumen de la suspensión (Figura 5. Estos pasos se repiten tres veces. 1996. Hunt. Maggenti. utilizando una gota de glicerina deshidratada como medio de montaje.. Baldwin y Mundo-Ocampo. los nematodos de la caja se montan en laminillas. 1988. 1993. El procedimiento se ilustra en la Figura 5. Se hace una selección al azar de aproximadamente 100 nematodos montados para su identificación a nivel de género. 1991. 1991. Tabla 5. 1992. aunque en la última ocasión no es necesario añadir solución Seinhorst II pero sí incubar a la misma temperatura durante otras 48 horas para evaporar todo el alcohol. 2000. 1991. 168 Manual de biología de suelos tropicales . 1961.1) y el volumen resultante se vacía por completo en una caja Petri de 5 cm de diámetro. Jairajpuri y Ahmad.INFILTRACIÓN CON GLICERINA Y OBSERVACIÓN DE NEMATODOS El método de Seinhorst (Seinhorst. Cares y Huang. Decraemer. 1984) (Figura 5. luego se añaden 7 ml de la solución Seinhorst I (Figura 5. Al segundo día. 1991. mientras que la composición de las soluciones se puede observar en la Tabla 5.1. 1951. Goseco et al.4). la caja se coloca en un desecador a 43°C durante la noche (Figura 5.5. se tapa la caja y se deja nuevamente en el desecador durante la noche. Bongers. Andrássy. May et al.. 1991. Antes de colocar el cubreobjetos de vidrio sobre la gota.000 x).

Nematodos en: Golden (3 ml) + Seinhorst I (7 ml) Evaporación a 43°C durante 4h para reducir el volumen a la mitad Completar volumen con Seinhorst II Desecador a 43°C durante la noche Desecador a 43°C durante la noche Desecador a 43°C durante la noche Evaporación a 43°C durante 48 horas.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos Figura 5.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos.Figura 5. Las cajas Petri no deben contener más de una tercera parte de líquido. Evaporación a 43°C durante 4 hrs para reducir a la mitad del volumen Completar volumen con Seinhorst II Evaporación a 43°C durante 4h para reducir el volumen a la mitad Desecador a 43°C durante la noche N ematodos del suelo 169 .

170 Manual de biología de suelos tropicales .7 Charola con montajes permanentes de especímenes de nematodos.Figura 5. Foto: Marcella A. Teixeira. Foto Francisco Franco. Nota: el fondo del contenedor se mantiene a 43°C.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. Figura 5.

su número poblacional se divide entre dos para cada hábito. Golden X Formol (+ 40% formaldehído) Glicerina Agua destilada Alcohol 96% Glicerina Agua destilada 8 partes 2 partes 90 partes Seinhorst I 20 partes 2 partes 78 partes Golden 2X 16 partes 4 partes 80 partes Seinhorst II 95 partes 5 partes ÍNDICES Y PARÁMETROS PARA LA CARACTERIZACIÓN DE POBLACIONES DE NEMATODOS Los nematodos identificados a nivel de género pueden dividirse en cinco grupos tróficos: parásitos de plantas. todos ellos basados en los criterios de Yeates et al. pueden utilizarse para calcular índices de diversidad y equitatividad. (1993). Si un nematodo posee dos tipos de hábito alimenticio. Los datos de frecuencia y abundancia de los diferentes grupos tróficos se usan para calcular el Índice de Diversidad Trófica y varios cocientes que consideran la abundancia relativa de los grupos tróficos. micófagos. depredadores y omnívoros.1 Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina. donde pi = porcentaje de género ‘i’ en la abundancia total]. empleando las fórmulas que se mencionan líneas adelante. Índice de Diversidad de Simpson [Ds = 1 – Σ(pi)². Los datos sobre frecuencia absoluta.Tabla 5. cuando un nematodo tiene dos tipos de hábitos alimenticios. Equitatividad del Índice de Diversidad de Simpson [Es = Ds/Ds max’ donde Dsmax = 1 – 1/S Equitatividad del Índice de Diversidad de Shannon (J’= H’/H’max’ donde H’max = Log2 S]. N ematodos del suelo 171 . Índice de Riqueza de Género [d = (S – 1)/log N. Índice de Diversidad de Shannon [H’ = .Σpi log2 pi]. bacteriófagos. abundancia total y abundancia relativa de cada uno de los géneros. donde S = número de géneros y N = número total de nematodos].

Σ(vi x fi) (donde vi = valor c-p de 1 a 5 para el género ‘i’. 1988. 1994].3). baja movilidad. los persistentes cp5 se distinguen por tiempos generacionales largos. véase Norton. Por el contrario. y el cociente IFP /IM como un indicador de fertilidad del suelo. producen muchos huevecillos pequeños. la producción de pocos huevecillos pero muy grandes. Para medir el nivel de perturbación del suelo (Bongers. Bongers y Bongers (1998) propusieron IM2–5 (igual que IM. Índice de Diversidad Trófica [T = 1/ Σ(pi)². La relación micófagos/bacteriófagos (M/B) y (micófagos+bacteriófagos)/parásitos de plantas [(M+B)/PP]. Los colonizadores cp1 se caracterizan por tener tiempos generacionales cortos. respectivamente). Magurran. Yeates (1994) amplió el Índice de Madurez para incluir a todos los nematodos del suelo (mIM). presentan dauerlarvae o estadios de sobrevivencia y crecen bajo condiciones de riqueza de alimento. En base a estos conceptos.2) y el Índice Fitoparasítico (IFP) (que incluye únicamente parásitos de plantas) (Tabla 5. el Índice de Madurez (IM) (que incluye únicamente nematodos de vida libre) (Tabla 5. donde pi = abundancia relativa de un grupo trófico . 1998). 1978. ausencia de dauerlavae y elevada sensibilidad ante la presencia de contaminantes y otros factores de perturbación (Bongers y Bongers.2 Familias y valores cp utilizados para el índice de madurez* Familia Neotylenchidae Anguinidae Aphelenchidae Aphelenchoididae Rhabditidae 172 valor cp 2 2 2 2 1 Familia Achromadoridae Ethmolaimidae Cyatholaimidae Desmodoridae Microlaimidae valor cp 3 3 3 3 3 Manual de biología de suelos tropicales . Tabla 5. se han utilizado varios índices para la evaluación del suelo. 1990). Porcentajes de criconematidos y de dorylaimidos en la población. Krebs. asignándoles un “valor cp” en una escala de 1 a 5. siempre están activos. pero excluyendo a los nematodos cp1) para evaluar factores de estrés inducidos por contaminación. Bongers (1990) dividió a los nematodos del suelo en una serie desde los colonizadores (c) hasta los persistentes (p) (similar a los estrategas r y k. y fi = frecuencia relativa del género ‘i’).

Tabla 5.Tabla 5.3 Familias y valores cp utilizados para el índice fitoparasítico cp2 Tylenchidae Psilenchidae Tylodoridae cp3 Dolichodoridae Hoplolaimidae Pratylenchidae cp4 Trichodoridae cp5 Longidoridae N ematodos del suelo 173 Nota:*modificado de Bongers (1990). .2 Familias y valores cp utilizados para el índice de madurez* Familia Alloionematidae Diploscapteridae Bunonematidae Cephalobidae Ostellidae Panagrolaimidae Myolaimidae Teratocephalidae Diplogasteridae Neodiplogasteridae Diplogasteroididae Tylopharyngidae Odontopharyngidae Monhysteridae Xyalidae Linhomoeidae Plectidae Leptolaimidae Halaphanolaimidae Diplopeltidae Rhabdolaimidae Chromadoridae Hypodontolaimidae Choanolaimidae valor cp 1 1 1 2 2 1 2 2 1 1 1 1 1 1 2 3 2 3 3 3 3 3 3 4 Familia Odontolaimidae Aulolaimidae Bastianiidae Prismatolaimidae Ironidae Tobrilidae Onchulidae Tripylidae Alaimidae Bathyodontidae Mononchidae Anatonchidae Nygolaimidae Dorylaimidae Chrysonematidae Thornenematidae Nordiidae Qudsianematidae Aporcelaimidae Belondiridae Actinolaimidae Discolaimidae Leptonchidae Diphtherophoridae valor cp 3 3 3 3 4 3 3 3 4 4 4 4 5 4 5 5 4 4 5 5 5 5 4 3 Nota: *Bongers (1990).

pp. Koninklijke Nederlandse Natuurhistorische Vereniging. 8. M. vol. 177–235. (1998) ‘Functional diversity of nematodes’. (1991) ‘Stunt nematodes: Tylenchorhynchus. 14–19. (1983) A taxonomic review of the suborder Rhabditina (Nematoda Secernentia). J. T. J. Andrássy. 174 Manual de biología de suelos tropicales . M. 10. (1991) ‘Heteroderinae cyst. pp. (2001) “Taxonomia de fitonematóides. J. Bibliotheekuitgave no. Bongers. S. vol. Revisão Anual de Patologia de Plantas. y Huang. P. W. Marcel Dekker. Applied Soil Ecology. y Potter. Cares.Tabla 5. O. 46. y Bongers. J.and non-cyst-forming nematodes’. (1990) ‘The maturity index: An ecological measure of environmental disturbance based on nematode species composition’. E. (eds) (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. 83. pp. S. Koninklijke Nederlandse Natuurhistorische Vereniging. Nickle (ed) Manual of Agricultural Nematology. New York. Bongers. Baldwin. R.3 Continúa cp2 Ecphyadophoridae Paratylenchidae Anguinidae cp3 Heteroderidae Hemicycliophoridae cp4 cp5 Nota: * modificado de Bongers (1990). CABI Publishing. Schoorl. Oecologia. Cares. in W. REFERENCIAS Anderson. London. pp. Pirola. The Netherlands. G. vol. 2nd edition. 9. in W. L. Revisão Anual de Patologia de Plantas. R. Marcell Dekker. 185–223. P. pp. in F. vol. Bibliotheekuitgave no 46. Chave sistemática simplificada para gêneros Parte II”. y Huang. V. pp. 529–586. Nickle (ed) Manual of Agricultural Nematology. and related genera’. T. T. Bongers. Budapest. 163–183. J. y Mundo-Ocampo. Chave sistemática simplificada para gêneros Parte I”. Schoorl. 275–362. (1994) De Nematoden van Nederland. 3. E. R. J. P. I. no. New York. (2000) “Taxonomia atual de fitonematóides. pp. S. Siqueiera and Brussaard. Cares. T. Bongers. E. M. The Netherlands. (1988) De Nematoden van Nederland. 239–251. Pirola. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian amazon and savanna vegetation’. Eötvös Lorand University. Merlinius. y Huang. Moreira.

Nickle (ed) Manual of Agricultural Nematology. D. Fisheries and Food.. N ematodos del suelo 175 . 669–720. Indiana. and Ahmad. R. vol. no 3. Marcel Dekker. y Goede. Bongers. 13–29. 662–665. A. G. pp. (1964) ‘A rapid centrifugal flotation technique for separating nematodes from soil’. (1991) ‘Tylenchidae in agricultural soils’. R. Plant Disease Reporter. Ferris. J. in W. (2001) ‘A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept’. F. J. Goodey. M. 147–190. 587–626. J.. J. Applied Soil Ecology. T. 18. no 1. Bittencourt. C. M. 363–422. (1991) ‘Nemata: Higher classification’. in W. 163–183. Fortuner. Marcel Dekker. F. in W. London. R. West Lafayette.. S. P. V. Harper Collins College Publishers. R. Hunt. M. Longidoridae. O. E. Jairajpuri. A. 48. Allotrichodorus. pp. S. (1991) ‘Stubby root and virus vector nematodes: Trichodorus. J. R. pp. R. Ltd. Maggenti. Brill. W. pp. W. Wallingford. y Silva. Purdue Nematode Collection Department of Entomology. (1951) Soil and freshwater nematodes. and Trichodoridae: Their systematics and bionomics. Nickle (ed) Manual of Agricultural Nematology. Marcel Dekker. 1949’. E. R. P. vol. Nickle (ed) Manual of Agricultural Nematology. y Cares. CAB International.Decraemer. staining and mounting nematodes’. Brussaard (eds) Soil biodiversity in Amazonian and other Brazilian ecosystems. in J. Nickle (ed) Manual of Agricultural Nematology. pp. and Monotrichodorus’. H. Goseco. C. C. J. fixing. Loof. y Ferris. New York. in F. vol. Krebs. Technical Bulletin No 2. in W. pp. F. E. New York. (1984) ‘Preparing nematode permanent mounts with adhesive tapes’. 795–826. C. W. D. Nickle (ed) Manual of Agricultural Nematology. CAB International. (1994) Ecology: The Experimental Analysis of Distribution and Abundance. Journal of Nematology. New York. pp. Southey (ed) Laboratory Methods for Work with Plant and Soil Nematodes. Purdue University. E. Hooper. 4th edition. (1992) Dorylaimida: Free-living. in W. 16. pp. Huang. (1974) Revision in Leptonchoidea (Nematoda: Dorylaimida). Geraert. (1991) ‘The family Pratylenchidae Thorne. Paratrichodorus. New York. (1970) ‘Handling. S. S. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian Amazon and savanna vegetation’. Moreira. Siqueira and L. Methuen and Co. pp. no 9. R. R. Ministry of Agriculture. pp. M. Jenkins. (1993) Aphelenchida. New York. Predaceous and Plant Parasitic Nematodes. Huang. T. 341–342. Marcell Dekker. Leiden. 1st edition. (1991) ‘The Hoplolaimidae’. R. M. Marcel Dekker. Ferris. Wallingford. New York. 34–39. G.

vol. (1990) ‘Global overview of the functional roles of soil-living nematodes in terrestrial communities and ecosystem’. and Dolichodorus spp. 4. B. Cornell University Press. G. pp. vol. pp. Gainesville. (1988) Illustrated Key for Identification of Common Nematodes in Florida. W. S. Nickle (ed) Manual of Agricultural Nematology. 465–508. in W. New York Petersen. 1–7. Mullin. Oikos. A. pp. R. (1982) ‘Structure and size of soil animal populations’. pp. H. Yeates. J. G.Magurran. M. P. Nickle. 1. Marcel Dekker. de Goede. Cambridge University Press. R. Nickle (ed) Manual of Agricultural Nematology. Journal of Nematology. 22. pp. (1991) ‘Sting and awl nematodes: Belonolaimus spp. McGraw Hill Co. Marcell Dekker. (1996) Pictorial Key to Genera of Plant Parasitic Nematodes. vol. May. 38. y Hooper.. New York.. L. C. University of Florida. Norton. R. J. G. D. (1959) ‘A rapid method for the transfer of nematodes from fixative to anhydrous glycerin’. (1991) ‘Tylenchulidae in agricultural soils’. (1980) ‘Abundance. 761–794. Sohlenius. Freckman.. R. W.. vol. (1988) Ecological Diversity and its Measurement. (1993) ‘Feeding habits in soil nematode families and genera . vol. 176 Manual de biología de suelos tropicales . W. New York. and insect nematodes’. D. Nickle (ed) Manual of Agricultural Nematology. (1991) ‘The Aphelenchina: Bud. C. Thorne. C. K. R. 627–668. Pedobiologia.. pp. New York. H. biomass and contribution to energy flow by soil nematodes in terrestrial ecosystems’. Smart Jr. F. K. Nematologica. New York. John Wiley and Sons. Journal of Nematology. E. no. (1994) ‘Modification and quantification of the nematode maturity index’. H. 2. S. Smart Jr. leaf. pp. Yeates. Raski. (1961) Principles of Nematology. 34. D. 186–194. Lyon. Seinhorst. Bongers. T. B. (1978) Ecology of Plant Parasitic Nematodes. 315–331. Marcel Dekker. in W. K. W. in W. G. pp. 25. G. y Nguyen. Procter.an outline for soil ecologists’. vol. pp. 67–69. 39. W. New York. 3. y Georgieva. J. Oikos. D. G. Cambridge. and Nguyen. 5th edition. B. 97–101.. C. W. D.’. y Loeffer. no. no. 306–329. G.

b) Colecta de la hojarasca utilizando guantes de cuero. Sistema de extracción de hormigas y escarabajos con trampas Winkler a) Delimitación de un metro cuadrado de hojarasca. i . que contiene alcohol al 70%. desde el borde hacia el centro. por un marco.Ilustración 1. d) Transferencia del material tamizado a bolsas de nylon en campo. f y g) Se fijan las redes al interior de la trampa Winkler previamente colgadas en un espacio bien aireado con un frasco colocado en el fondo. c) Introducción de la hojarasca en un tamiz para separar los fragmentos más gruesos. e) Cada muestra de hojarasca tamizada se transfiere a una red.

Fotos: Juvenil Cares. B) micófago. C) bacteriófago. D) depredador. A y B: Estoma con estilete C: Estoma sin estilete D: Diente dorsal E: Odonto estilete ii Manual de biología de suelos tropicales . Fotomicrografías de la región anterior en las que se muestra el aparato bucal (flechas) de nematodos de suelo pertenecientes a diferentes grupos funcionales: A) parásito de plantas. E) omnívoro.Ilustración 2.

I lustraciones a color iii . PAB vol 319. en gel de poliacrilamida. a) Siratro en bolsa de plástico con solución de nutrientes Pheseolus vulgaris c) Pruebas en plantas de Pheseolus vulgaris para ver la eficiencia de aislamientos en Jarras de Leonard. Moreira excepto e) de Lima et al.. tropici (CR crecimiento rápido) creciendo en YMA f) Perfiles de Rep-PCR de e) Perfiles de proteínas totales obtenidos por electroforesis diferentes cepas. 2009.Ilustración 3. Pasos de la metodología para caracterizar a las bacterias fijadoras de nitrógeno y formadoras de nódulos en leguminosas (BFNFNL) aplicada en el proyecto CSMBGBD. cr CL CL d) Características de dos aislamientos de Bradyrhizobium (CL de crecimiento lento) y de R. Fotos: F. b) Plantas de Prosopis juliflora en agar inclinado con solución de nutrientes.

Esporas y estructuras producidas por especies de HMA de la familia Acaulosporaceae: e) espora de Entrophospora colombiana mostrando la pared de la espora. g) espora de Acaulospora scrobiculata mostrando la cicatriz (flecha) que queda en la espora después de que se suelta el sáculo esporífero. Esporas y estructuras producidas por especies de hongos micorrizógenos arbusculares de la familia Gigasporaceae: a) espora de Gigaspora albida mostrando la célula suspensora bulbosa (flecha). típica de la familia. d) células auxiliares nudosas diferencias por miembros del género Scutellospora. iv Manual de biología de suelos tropicales . pared germinal 1 (gw1) y pared germinal 2 (gw2) con su capa más interna en reacción con el reactivo Melzer. b) espora de Scutellospora scutata con la célula suspensora bulbosa (flecha). h) esporas de Acaulospora sp. f) espora de Entrophospora colombiana mostrando las dos cicatrices (flecha). Fotos: Sidney Stümer. mostrando algunos sáculos esporíferos todavía fijados a la espora (flecha).Ilustración 4. c) detalle de la ornamentación de la pared de la espora (verrugas) de Scutellospora coralloidea. obsérvese el escudo redondo de germinación de color café que contrasta con el color hialino de la espora.

L2 y L3). brasilianum que fueron tomadas de http:// invam. b) Espora de Glomus sp. obsérvese que la capa más profunda de la pared de la espora se separa y se asemeja a la pared germinal. h) Espora de Paraglomus brasilianum mostrando la estructura de la pared de la espora formada por tres capas (L1.edu.caf. Fotos: Sidney Stümer. Esporas y estructuras producidas por especies de HMA de la familia Archaeosporaceae (e y f) y Paraglomeraceae (g y h): e) espora de Archaeospora Leptoticha con sáculo esporífero.Ilustración 5. d) Esporocarpo de Glomus sp. L2 y L3) (obsérvese que la capa L2 está ornamentada con pequeñas crestas). mostrando la pared de la hifa de sostén de manera continua con la pared de la espora. excepto de Paraglomus occultum y P. Esporas y estructuras producidas por especies de HMA de la familia Glomeraceae: a) Espora de Glomus clarum mostrando la hifa de sostén.wvu. f) Detalle de Archaeospora Leptoticha mostrando salientes y depresiones en las capas 2 y 3 de la pared de la espora (flecha). c) Esporocarpo de Glomus clavispora. g) Espora de Paraglomus occultum mostrando la estructura de la pared de la espora formada por tres capas (L1. I lustraciones a color v .

d) esporangio de Phytophthora. c) cultivo puro en cebo. e) Oogonio y anteridio de Pythium. b) muestra de agua con cebo. f) Pythium liberando zooesporas. Aislamientos de hongos zoospóricos de muestras del ambiente (Oomycota y Chytridiomycota): a) muestra de suelo con cebo.Ilustración 6. vi Manual de biología de suelos tropicales .

e) partículas de suelo lavado. g) placa con partículas de suelo para su incubación. Fotos: Lucas M. d) continuando con el procedimiento de lavado. c) suelo pre-lavado. h) colonias de hongos en medio de cultivo para retardar el crecimiento. b) tamices con diferentes mallas. f) medio de cultivo en placas. Abreu. Técnica de lavado del suelo para el aislamiento de microhongos del suelo: a) Pre-lavado.Ilustración 7. I lustraciones a color vii .

A) Larvas y pupas de la mosca de la fruta en el suelo.Ilustración 8. E) Adulto de mosca de la fruta y detalle del aculeo. B) Trampa MacPhail con cebo. D) Extracción del aculeo. A C Banda costal Banda “s” Banda “s” D B E Cabeza Punta del oviducto Mesonoto Aculeo Mediotergio Abdomen Terminalia viii Manual de biología de suelos tropicales . C) Patrones alares típicos con bandas.

al mismo tiempo. Las cepas. se ahorraron alrededor de US$ 3.Capítulo 6 Bacterias formadoras de nódulos en leguminosas Fátima M. En el año 2006. S. por lo tanto. usadas para la inoculación. 1975). en el caso de la soya. La inoculación con cepas de BFNFNL altamente eficientes y adaptadas a las condiciones ambientales dominantes. pues proporciona alrededor del 70% de todo el nitrógeno requerido en los ecosistemas naturales y agroecosistemas (Burns y Hardy. considerando un área de 21 millones de hectáreas. manteniendo así la armonía con el medio ambiente.3 billones de gastos en fertilizantes mediante la aplicación de esta biotecnología. donde se cosecharon cerca de 57 millones de toneladas de soya. la inoculación con cepas de Bradyrhizobium reemplaza completamente la aplicación de fertilizantes sintéticos. provienen de una diversidad que se encuentra en el suelo. Moreira LA IMPORTANCIA ECONÓMICA Y ECOLÓGICA DE LA SIMBIOSIS DE BACTERIAS FORMADORAS DE NÓDULOS EN LEGUMINOSAS (BFNFNL) La fijación biológica de nitrógeno es uno de los procesos más importantes para mantener la vida en el planeta. 177 . un conocimiento de la diversidad de BFNFNL en el suelo deberá ser el primer paso para el manejo y la conservación de este recurso genético de tanto valor. se utiliza en algunos países con un pequeño y selecto grupo de leguminosas con el propósito de reemplazar el uso de fertilizantes químicos de nitrógeno. debido a las múltiples interacciones que se dan entre organismos del suelo y plantas. la biodiversidad del suelo puede afectar el comportamiento de la formación de nódulos de manera positiva o negativa. En Brasil.

. trifolii. una taxa a nivel familia de bacterias creada expresamente para acomodar organismos que pueden formar nódulos en leguminosas. 1989 Martinez-Romero et al. giardinii R. conocidas anteriormente como rizobios. 1997 Chen et al. viceae R. 1999a . (Ulmaceae).. forman nódulos en las raíces (y algunas veces en los tallos) de algunas especies de leguminosas y en las raíces de Parasponia spp. 2003) (Tabla 6.1 Filum/Orden. huautlense R. gallicum R. Methylobacterium Methylobacteriaceae y Dovosia Hyphomicrobiaceae) también pueden formar nódulos en leguminosas (Moulin et al. etli biovar mimosae 178 Manual de biología de suelos tropicales Frank. 1984 Lindström. 1991 Segovia et al. 2001. El término rhizobia se deriva de Rhizobiaceae (Conn. galegae R. 1998 Wang et al. giardinii biovars phaseoli. 2001. Filum/Orden. Jordan. mongolense R. 1998 Wang et al. el nombre ”rhizobia” ya no resulta idóneo para describir bacterias formadoras de nódulos. Especie de bacterias formadoras de nódulos en leguminosas.. por esta razón. Tabla 6. 1879.. Chen et al. tropici R. 1889. 1997 Amarger et al. Familia. etli R. 2004 Rivas et al. Las citas referidas describen a las especies y/o comprueban su capacidad de nodulación. Género. 1938). aunque se continúa usando en alguna literatura. Una extensión reciente de conocimientos acerca de las bacterias formadoras de nódulos en leguminosas fue el descubrimiento que estableció que las bacterias pertenecientes al β-proteobacteria (género Burkholderia y Ralstonia/Cupriavidus) y a otras familias de la α. Sy et al. 1993 Amarger et al.1).proteobacteria (por ejemplo.. Jourand et al.TAXONOMÍA ACTUAL DE BFNFNL Las bacterias fijadoras de nitrógeno. leguminosarum biovars phaseoli. 1997 van Berkun et al.Familia/Género/Especie α-Proteobacteria-Orden Rhizobiales Referencia Rhizobiaceae Rhizobium R. hainanense R. 2001. 2002.

1994 de Lajudie et al. 2009 Hou et al. 1988. 1984. tubonense Ensifer (Sinorhizobium) E. 2002 Wang et al. multihospitium R. teranga E. 2003 B acterias formadoras de nódulos en leguminosas 179 . 1994. saheli E. 2006 Hunter et al. 2011 Dangeard. indigoferae R. Chen et al. Chen et al. 2008 Peng et al. de Lajudie et al. 1999 Wei et al. 2005 Valverde et al. Young. 2002 Wei et al. oryzae R. fabae R. de Lajudie et al.Tabla 6. lusitanum R. 2001 Squartini et al.Familia/ Género/Especie R. 2009 Li et al.1 Continúa. 1996 Nick et al. 1988 de Lajudie et al. 1988. mesosinicum R. miluonense R. 2007 Gu et al. americanum Referencia Tan et al. 2003 Quan et al. Filum/Orden. morelense E. 1999 Nick et al. 2003 Scholla & Elkan. kummerowiae E. 2008 Berge et al. pisi R. loessense R. 2009 Lin et al. 1926. yanglingense R. 1994 Chen et al. 2008 Ramirez-Bahena et al. selenireducens R. medicae E. sullae R. tibeticum R. 2002 Wei et al. 2008 Ren et al. alkalisoli R. kostiense E. Jordan et al. 2011 Zhang et al. vignae R. alamii R. xinjiangense E. meliloti E. 2008 Han et al. 2009 Tian et al. 1994 Rome et al. fredii E. daejeonense R. arboris E. 1984. 2002 Toledo et al.

2006** Dreyfus et al. 1988 Moreira et al. 1991. 2006 Jordan et al. elkanii B. 1997 Manual de biología de suelos tropicales . Young. Young et al. 2007 Rincon-Rosales et al. Jarvis et al. 1992 Xu et al. 2009 Merabet et al. 1995 Yao et al. Jarvis et al.1 Continúa. jicamae B. adhaerens E. 2002. 1998a. 2009 Lin et al. mexicanus E. kummerowieae Bradyrhizobiaceae Bradyrhizobium B. iriomotense Bradyrhizobium (Blastobacter) B. liaoningense B. Filum/Orden. 2003. numidicus Allorhizobium* A. 1997 Chen et al. doebereinerae Phyllobacteriaceae Mesorhizobium M. japonicum B. denitrificans** Xanthobacteraceae Azorhizobium A. 1984 Kuykendall et al. pachyrhizi B.canariense B. loti M. yuanmingense B. 1984. huakuii 180 Referencia Casida. (2010) Merabet et al. Willems et al. 2008 Jordan. 2008 van Berkun & Eardly. garamanticus E. 2003 Lloret et al. 2001 Cummings et al.adiobacter/ tumefasciens Shinella S. van Berkun et al.Tabla 6. caulinodans A. Jarvis et al. 2009 Islam et al. chiapanecum E. 1982. 2002 Vinuesa et al.Familia/Género/ Especie E. 2005a Ramírez-Bahena et al. 1982. (Rhizobium) undicola Agrobacterium* A (Rhizobium). (2010) de Lajudie et al. 2009 Ramírez-Bahena et al.

opportunistum M.1 Continúa. 2009 Nandasena et al. Jourand et al. ifriqiyense*** P. albiziae M. 2002. 1999b Velásquez et al. 2010 Rivas et al. 2008 Han et al.alhagi Phyllobacterium P. 2009 Vidal et al. 2010 Valverde et al. temperatum M. 2008 Li et al. 2004 Trujillo et al. 2006 Mantelin et al. ciceri Hyphomicrobiaceae Devosia D. 2009 Chen et al. shangrilense M. Jarvis et al. australicum M. septentrionale M.Tabla 6. nodulans Brucellaceae Ochrobactrum O.Familia/Género/ Especie M. 1997 Chen et al. Jarvis et al. mediterraneum M. 1997 De Lajudie et al. 1995. Filum/Orden. 2001. tarimense M. 1997 Nour et al. 2007 Gu et al. 2005 Mantelin et al. metallidurans M. lupini O. 1995. trifolii P. 1998b Wang et al. cytisi O. caraganae M. tianshanense M. 2005 Zurdo-Pineiro et al. gobiense M. 2006 Sy et al. 2001 Gao et al. ciceri M. 2003 B acterias formadoras de nódulos en leguminosas 181 . 2009 Nandasena et al. chacoense M. neptuniea Referencia Nour et al. Jarvis et al. leguminum*** Methylobacteriaceae Methylobacterium M. 2004 Gao et al. 2008 Han et al. 2007 Imran et al. 1994. plurifarium M. 2004 Wang et al. amorphae M.

2001. 2002 Vandamme et al. 2004) y más tarde del género Cupriavidus (Vandamme y Conye. Arubi y A. nodosa B. del trópico. pero descubrieron que pueden formar nódulos en leguminosas y la propusieron para que se incluyera en el género Bradyrhizobium. 2006 Chen et al. 2008 Chen et al. sabie Cupriavidus (Ralstonia) C. 2010 Moulin et al. Mimosoideae (3270 spp. A. Vandamme & Conye 2004 Notas: * Se propuso incluir a las especies Agrobacterium como A. **** Estos autores no describieron el género. 2005). larrimoorei (Young 2004) en Rhizobium. Hasta 1989.800 spp. en su mayoría plantas tropicales leñosas).Familia/Género/ Especie D. yakushimensis β-Proteobacteria Orden Burkholderiales Burkolderiaceae Burkholderia **** B. en su mayoría herbáceas) (Lewis et al.. Vermis et al. 2002. El alcance de la simbiosis con BFNFNL entre leguminosas queda todavía sujeta a investigación. 2007 Chen et al. tuberum B. pero descubrieron que pueden formar nódulos en leguminosas ***** El género Wautersia (Vaneechoutte et al. phymatum B. *** Fueron aislados de nódulos. 2001 Vandamme et al. Las leguminosas contienen alrededor de 20 mil especies. ** Estos autores no describieron estas especies. subtrópico y zona templada) y Papilionoidae (13... 2002 Vandamme et al. (Ralstonia) taiwanensis ***** Referencia Bautista et al. tumetaciens (syn. distribuidas en las subfamilias Caesalpinoideae (2250 spp. únicamente el 57% del género y el 20% de las espe182 Manual de biología de suelos tropicales . 2004) fueron propuestos para acomodar dichas especies de Ralstonia.Tabla 6. vitis y (Young et al. pero su capacidad de nodular no fue comprobada. 2001) y A. A. Filum/Orden. 2004 Chen et al.. rhizogenes. caribensis B.cepacia genomovar VI) B. 1999. mimosarum B. Vandamme et al. plantas leñosas. dolosa (B.1 Continúa. adiobacter).. 2002 Achouak et al.

tradicionalmente. Para poder aislar o enumerar BFNFNL en una población microbiana diversa. Bradyrhizobium betae (Rivas et al. ha ocurrido una revolución en la taxonomía con 90 especies y 10 géneros adicionadas a las 4 especies y a los 2 géneros originales enlistados por Jordan. muestran una B acterias formadoras de nódulos en leguminosas 183 . 1995). Faria et al.cies habían sido examinadas por la formación de nódulos y los porcentajes de las especies que sí podían formar nódulos se encontraron en porcentajes de 23. 1989). ahora que se encuentran disponibles las que han sido aisladas de otras especies y regiones. 2007). El proceso de infección de la planta es el resultado de la formación de nódulos en sí. en ecosistemas naturales (por ejemplo. Moreira et al. 1992. Tres especies de los géneros descritos de BFNFNL no fueron incluidas en la tabla porque no fueron aisladas de nódulos ni la capacidad de nodulación se comprobó hasta el momento: Rhizobium cellulosilyticum (García-Fraile et al. puede proveer información sobre la composición taxonómica de poblaciones de BFNFNL y determinar el grado de especificidad entre cepas específicas y candidatos hospederos. se estima que hoy en día. y que han sido desarrolladas nuevas técnicas de genética molecular. la taxonomía del BFNFNL estaba basada en cepas aisladas de cultivos de zonas templadas. los nódulos pueden muestrearse en plantas cultivadas en el campo (colecciones in situ). 2004) y Mesorhizobium thiogangeticum (Ghosh et al. Mimosoideae y Papilionoidae.. 1982. únicamente el 25% de las especies existentes han sido examinadas. 1992). en 1984 (véase Tabla 6. 90 y 97% entre Caesalpinoideae.1). De esta manera. se requiere de un método que separe claramente BFNFNL de otras especies bacterianas y que permita un muestreo fácil y sistemático de los nódulos. es posible que nuevas simbiosis se identifiquen en el futuro... Aunque algunas plantas hospederas se consideran muy promiscuas. Odee et al.... respectivamente (Faria et al. especialmente en Brasil (Magalhães et al. y se esperan más revisiones en un futuro. para poder estimar la población de BFNFNL en el suelo... como la que surge en el suelo. Sin embargo. por ejemplo.. de leguminosas hospederas. aunque este método puede resultar difícil en el caso de hospederas perennes o leñosas (Moreira et al. Aunque se han llevado a cabo búsquedas extensivas para nuevos géneros y especies formadoras de nódulos. en selvas tropicales). 1989. El cultivo posterior y caracterización de BFNFNL y de los nódulos. 2006) EVALUACIÓN DE DIVERSIDAD DE BFNFNL EN EL SUELO Los estudios sobre poblaciones y diversidad de BFNFNL dependen de un aislamiento exitoso de nódulos de raíces y ocasionalmente de tallos.

.. ningún hospedero promiscuo puede ser nodulado por todas las especies o cepas existentes de BFNFNL y..baja especificidad.. donde sea posible. Resultados obtenidos en Brasil (Alto río Solimões) muestran que caupí (Vigna unguiculata) captura más especies que M. de manera natural. Antes de escoger las plantas hospederas para realizar un bioensayo. 1988a). por Bradyrhizobium spp. de manera contraria. en la mayoría de los casos. Pereira. 1987 demostraron que Vigna unguiculata. 2009). punto de referencia CSM-BGBD. únicamente. atropurpureum y que el frijol Phaseolus vulgaris. Para poder evaluar la diversidad de BFNFNL en el suelo. También reduce. de rápido crecimiento. El bioensayo para BFNFNL puede hacer uso de hospederos promiscuos. Lima. de hecho. La nitrogenasa es la enzima responsable de la reducción del gas nitrógeno a amoniaco. 1997. siratro (Macroptilium atropurpureum) atrapa BFNFNL en los 98 puntos de muestreo del proyecto CSM-BGBD (Lima et al. y. representa una comprobación útil de la exactitud del procedimiento en el laboratorio. aisladas de nódulos formados de manera natural. no existe ninguna cepa de BFNFNL que sea lo suficientemente promiscua como para nodular a todas las especies leguminosas. también cabe la posibilidad de que sea nodulado por especies de rápido crecimiento como Rhizobium (Pereira. es deseable hacer uso de una variedad de especies de plantas hospederas candidatas y cuantas más sean empleadas. Lewin et al. debería incluirse una especie leguminosa nativa como trampa hospedera. acetileno a etileno (Dilworth.. en la mayoría de los casos.. Lima et al. Aunque algunas de las asociaciones mencionadas pueden ser relativamente específicas. se recomienda llevar a cabo experimentos preliminares para cada tipo de suelo. normalmente considerada como hospedero de Badyrhizobium. indican que M. Odee et al. Moreira. Por lo anterior. atropurpureum fue nodulado. 2000. la comparación de BFNFNL. más variedad resultará de cepas de BFNFNL.. 1993. Las especies encontradas posteriormente deberían compararse con las especies que forman nódulos en el lugar. 2007) y Burkholderia. Resultados preliminares de Taita. 2006 y 2008. en Kenia. 2000). cultivados en muestras de suelo tomadas del campo o inoculadas con suspensiones del suelo (Moreira et al.. pero.. de crecimiento lento. aisladas e identificadas. 2009). se reporta que suele estar nodulado por la especie Bradyrhizobium (Woomer et al. entre otros sustratos. con los que se muestrea con el bioensayo. 1966. 184 Manual de biología de suelos tropicales . De manera similar. tiene una especificidad muy baja y puede ser nodulada por Rhizobium spp. 2002. entre otras (Moreira et al. por ejemplo: Macroptilium atropurpureum es uno de los hospederos ampliamente conocido (Vicent. 1970).

el personal que no posee la suficiente experiencia podrá confundirlos con estructuras no inducidas por BFNFNL. puesto que deben quedarse intactos para su aislamiento posterior o secarse cuando requieran ser almacenados durante un largo periodo. como trampas para aislar las BFNFNL de las muestras del suelo. deben utilizarse semillas de la misma procedencia. Una descripción previa fue hecha por Moreira en 2004. es barato y fácil de realizar aun en condiciones de campo. el uso de especies múltiples no es viable con un gran número de puntos de referencia (por ejemplo 100). tal y como se describe a continuación. Esta reacción se utiliza como técnica para medir la actividad de la nitrogenasa. aplicados en el proyecto CSM-BGBD. 1987). Bajo estas circunstancias. con esto se B acterias formadoras de nódulos en leguminosas 185 .Schollhorn Burris.1. Es por ello que se emplea una única especie promiscua como trampa. Aunque el uso de ERA para obtener estimaciones cuantitativas de fijación de nitrógeno a la nutrición de la planta ha sido ampliamente discutido (Boddey.. Cuando se llevan a cabo varios experimentos. dado que la anatomía de los nódulos varía ampliamente en forma y en tamaño. dado lo afanoso del procedimiento. Giller. METODOLOGÍA APLICADA EN EL PROYECTO CSM-BGBD: UNA REVISIÓN GENERAL Los pasos utilizados en la metodología para la caracterización de BFNFNL. se encuentran resumidos en la Figura 6. 1966). sin embargo. Paso 2A: para el proyecto se utiliza el método convencional de uso de especies promiscuas. con una solución nutritiva. resulta idóneo Macroptilium atropurpureum (siratro). la gran ventaja de un ensayo de reducción de acetileno (ERA). dentro de cámaras de crecimiento o invernadero. El ensayo también puede usarse para confirmar una nueva simbiosis de BFNFNL o en el caso de nódulos no usuales (Moreira et al. ya que posee pequeñas semillas y resulta fácil de manipular bajo condiciones controladas en bolsas de plástico y jarras de Leonard. Por ejemplo. Los nódulos sin actividad de la nitrogenasa pueden estar senescentes o ser inefectivos. es que destaca por su gran sensibilidad y velocidad. 1992). Paso 1A: recoger muestras de suelo del campo. y estará limitado por el tiempo disponible y las facilidades que ofrezca el laboratorio. resulta muy útil para la detección simple de fijadores de nitrógeno. 1987. cuyos seis pasos a seguir se muestran en la ilustración 3a hasta la 3f. La actividad de la nitrogenasa constituye una información invaluable porque en muchos casos es imposible verificar que los nódulos aún son efectivos y viables (color interior rojo).

resumida en seis pasos. Frijol (opcional) 4. agar inclinado (Ilustración 3. Almacenaje en frascos con gel de sílice o CaCl2 4.Figura 6. Especies nativas (opcional) Bolsas de plástico (Ilustración 3.1 Evaluación de bacterias formadoras de nódulos en leguminosas. Capítulo 2). (Ilustración 3. secuencia del gen (16S rRNA para todos los géneros. Eficiencia de poblaciones nativas: número de nódulos. índices de diversidad. capturadas con suspensiones de suelo 1:1. Claves de identificación de plantas. Aislamiento de NLB de nódulos ** en YMA/79 con azul de bromotimol (Ilustración 3. Ensayo de reducción con acetileno (opcional) 3 B. 6. solución de nutriente de suelo o NaCl a 0. tamizar según características de cultivo y REP-PCR o perfiles de proteína (Ilustración 3. Jarra de Leonard. más un control de una cepa conocida. Caracterización de cultivos (son necesarios los experimentos preliminares con suelo de selvas y cultivos de leguminosas para determinar el número de aislamientos requeridos para caracterizar las comunidades de simbiontes en su conjunto. Origen del hospedero. d) caracterización de cultivo 3 A. f (ii). * Puede usarse para conteo NMP (opcional). Siratro* 2. Captura de BFN. La eficiencia de poblaciones nativas es evaluada con la floración. peso seco de materia aérea de planta. basados en una 186 Manual de biología de suelos tropicales . c) 2 B. colectadas bajo condiciones asépticas Área de referencia /Uso del suelo/ Puntos de muestreo 1B. otros genes. 2e) 1C.55% 1. eficiente. fijadoras de nitrógeno en diversos sistemas de uso de suelo. con la muestra de suelo. peso de materia seca y peso seco de planta (contenido N). tales como dnaK. ** Algunos nódulos pueden guardarse en gel de sílice para su aislamiento. Nódulos de especies de plantas locales 5. Bioensayos con aislados: verificación (postulados de Koch) y propiedades simbióticas (número de nódulos y peso seco de materia). a). 3A. Doce muestras en cada punto de muestreo (véase esquema global CSM-BDBG. 1A. representativos de grupos previos. b). 12 muestras compuestas de suelo por punto. Caupí (opcional) 3. cuando se aprecian diferencias significativas entre tratamientos 4. capturando BFN: técnica de infección de planta: inoculación de especies promiscuas. especialmente para Bradyrhizobium). Dos controles sin inoculación (con o sin mineral N) más un control con un tipo eficiente (Ilustración 3. 2A. en caso necesario. 2A. Nota: 1A. utilizando la técnica de infección de planta. Caracterización de aislados verificados. dos controles sin inoculación (con o sin mineral N). contenido de N por planta (opcional).

Los suelos con un alto contenido de N deberán evitarse. aunque sería imposible estandarizar esta selección. por supuesto. Incluye características de cultivos obtenidos en el paso número 4. sobre poblaciones de BFNFNL donde se utiliza el frijol común como especie-trampa. debido a diferentes relaciones simbióticas (diferentes especies de plantas) y condiciones ambientales. Se selecciona Phaseolus vulgaris con base en que en varios países existen datos. Para poder capturar BFNFNL. B acterias formadoras de nódulos en leguminosas 187 . pueden cultivarse especiestrampas en bolsas de plástico. El criterio para la selección debe basarse en que la especie-trampa sea ecológica y económicamente relevante para el país. Las muestras de suelo en macetas pueden usarse únicamente cuando haya disponibilidad en los laboratorios y se deben seguir todas las técnicas asépticas normales de la microbiología. aunque también se puede aplicar a otros géneros). Cuando un equipo puede manejar más de una trampa de especies. Bradyrhizobium. aún dispersos. incluyendo algunas especies nativas que. Después de las tres especies mencionadas (siratro. en el tamizado de la colección entera de aislamientos (para conseguir racimos) y elementos repetitivos extragénicos palindrómicos/secuencias de DNA (REP-PCR) (u otros métodos como perfiles de proteínas por electroforesis con SDS-PAFE/poliacrilamida gel puede ser complementario). esto puede servir como un punto de referencia. jarras de Leonard o en macetas que contengan las muestras de suelo. ni forma parte de la metodología estándar. Las dos especies fueron escogidas por ser bastante promiscuas y porque se cultivan en muchos países. Paso 3 A: aunque la eficiencia bajo condiciones controladas no refleja lo que está pasando in situ.evita cualquier variación de NFNLB debida a las plantas. Dada la complejidad del primer ejercicio. éste no es obligatorio. pueden ser diferentes en cada país. incluso puede indi- curva de extinción de especies). Representantes de racimos. basados en características de cultivo (si este es el caso) y/u otro método deben ser secuenciados para 16SrRNA y otros genes como dnaK (por ejemplo. las cuales se describen a continuación. otros factores limitantes como deficiencias de macro y micronutrientes. deberán corregirse para los ensayos. es fácil de medir y proporciona información útil sobre la variabilidad y eficiencia de las poblaciones nativas. para trampas promiscuas adicionales se recomienda usar Vigna unguiculata (como segunda especie) y Phaseolus vulgaris (frijol) como tercera especie. acidez y un alto contenido de Al. Las especies-trampas pueden usarse para capturar y contar BFNFNL o simplemente para capturarlas. caupí y frijol) se pueden seleccionar otras. Las semillas que se encuentren disponibles en la localidad proveerán información útil para agricultores del lugar.

Se necesitará aplicar las curvas de muestreo a todos los aislados. para una especie hospedera en particular. a los del bioensayo y a los nódulos colectados en campo. Cuando se usa la técnica de infección por planta. en condiciones de laboratorio (Bala et al. cultivadas en una serie de diluciones de suelo. los nódulos deberán muestrearse a partir de plantas que nodulen y representen niveles secuenciales de diluciones (Moreira y Pereira. 188 Manual de biología de suelos tropicales .. y los de plantas.. de esta forma estarán disponibles para futuros aislamientos. en caso de no alcanzarlo. Considerando que estas curvas se obtienen con base en el número de diferentes cultivos que todavía pueden mostrar características genéticas variables. formados en el campo. Las curvas de muestreo (acumulación o escasez) pueden revelar el número de aislados requeridos para evaluar correctamente la diversidad. 2005). en los diferentes sistemas de uso de suelo.. con una inoculación de suspensiones de suelo. Este número se encuentra en el punto (asíntota) donde la curva alcanza su mayor nivel. Paso 4: después de la aparición y crecimiento de nódulos.car la existencia de cepas eficientes en las poblaciones del suelo. proporcionarán los datos de la diversidad. 2001). En la literatura se ha discutido que. Paso 1B/2B. 2001) porque los tipos de BFNFNL capturadas pueden variar también con la dilución (Bala et al. 2001). tal y como se explicó anteriormente. 3B: se recomienda también que las BFNFNL sean aisladas de especies leguminosas (nativas e introducidas) que nodulan naturalmente. por ejemplo. lo que permite la construcción de curvas de muestreo para evaluar si la diversidad en un lugar ya ha sido completamente caracterizada. se necesitarán más aislamientos para obtener una buena resolución. Los nódulos se almacenan en sílica gel (Figura 6. y quizá más de 100 por uso del suelo (Jesús et al. esto indica que no se han detectado todas las especies y que muestras adicionales (aisladas de nódulos) deberán ser analizadas. se necesitan entre 30 y 50 nódulos. junto con los de nódulos recogidos de plantas nativas que naturalmente forman nódulos. hará posible la mejor evaluación de diversidad y de eficiencia de la especie-trampa. deben ser inventariadas para que las relaciones con poblaciones naturales de BFNFNL puedan determinarse. los aislados de estos nódulos.2). Se sabe que la diversidad genética en poblaciones naturales de las NFNLB del mismo lugar puede presentar diferencias entre los aislados de nódulos. es decir. Una comparación de BFNFNL aisladas de nódulos del campo y de nódulos introducidos en una especie-trampa. las BFNFNL deben ser aisladas. Paso 1C: las especies de leguminosas en un área específica. de ocho metros de radio alrededor de cada punto de muestreo. por lo menos. pertenecientes a los diferentes sistemas de uso de suelo en cuestión.

El aislamiento de BFNFNL de nódulos deberá hacerse en el medio 79 con azul de bromotimol (Fred y Waksman, 1928). El medio 79 se conoce también como YMA (Vincent, 1970) (anexo 6.1); esto permite la caracterización completa del cultivo (tasa de crecimiento, cambio de pH, producción de exo-polisacáridos, morfología de colonia, color, tamaño, etc.). Para obtener grupos a partir de estas características de cultivo. La diversidad genética de poblaciones de BFNFNL puede evaluarse al agrupar los perfiles que resultan de rep-PCR, utilizando un software como Gelcompar (Brujin et al., 1997) o mediante el uso de otra técnica: perfiles de proteínas por electroforesis con gel de SDS-Poliacrilamida; que dan una buena resolución a nivel cepa (Paso 6); sin embargo, esto puede ser opcional, de acuerdo con los recursos disponibles en cada país y debe llevarse a cabo después del paso 5 para evitar perder el tiempo con contaminantes. Finalmente, los representantes de cultivos de los clados generados mediante el agrupamiento por Rep-PCR u obtenidos mediante otros métodos se secuenciarán para obtener el gen 16SrRNA (Paso 6). Cuando existen recursos suficientes, dnaK u otros genes involucrados en el mantenimiento de la bacteria, tales como atpD, rpoB, recA, glnII (Parker, 2004; Vinuesa et al., 2005b; Gaunt et al., 2001), pueden ser probados para algunas cepas de género que no hayan sido bien discriminadas por 16 SrRNA, como en el caso de Bradyrhizobium.
Figura 6.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. Fuente: Moreira y Pereira, 2001.
1 ml de C2H2 Muestra de gas Tapón de goma (a) Vial (10 ml) 30 minutos a 1 hora Tapón de goma Tubo al vacío

Nódulo Nódulo efectivo Nase C2H2+2H++2e 2C2H4 Tubo de ensayo 8.5 ml (b)

Tapón de rosca Tapón de rosca, nódulo, algodón y sílica gel o CaCl2

B acterias

formadoras de nódulos en leguminosas

189

REQUERIMIENTO DE MATERIALES PARA TRABAJO DE CAMPO Y LABORATORIO Trabajo de campo: para muestrear suelo: alcohol al 95%, agua para eliminar el suelo del equipo de muestreo antes de la esterilización con alcohol, caja refrigeradora, bolsas de plástico esterilizadas (300 ml), espátula, bolsas grandes de plástico (5 l) y un pequeño sacabocados. Para muestrear nódulos: tijera pequeña, cuchara, azada y azadón, pinzas, pala, tubos de tapón de rosca, sílica gel o CaCl2 anhidro. Para resguardo de plantas: alcohol, prensa y periódico. Trabajo de laboratorio para aislar y enumerar BFNFNL: pipetas de 1 ml y 5 ml, solución para dilución, matraces Erlenmeyer de 1 L y 125 ml, agitador orbital, bolsas esterilizadas de plástico (125 ml) para crecimiento, tubos de ensayo (150 x 20 ml ó 200 x 30 mm), o botellas de cerveza recicladas, rejillas para bolsas de crecimiento o tubos, solución de nutrientes, semillas de plantas leguminosas hospederas promiscuas o nativas, temperatura ambiente controlada de luz y humedad. Trabajo de laboratorio para aislamiento de BFNFNL y caracterización de cultivos: cajas Petri, alcohol al 95%, HgCl2 al 0.1% (acidificado con HCl concentrado a 5ml/L) (Hipoclorito de Na o Ca; puede usarse H2O2 para sustituir al HgCl2), agua esterilizada, pinzas, medio de cultivo que contiene levaduras, manitol y sales minerales (hipoclorito de sodio o calcio, o H2O2 (pueden sustituir al HgCl2), agua esterilizada, pinzas, medio de agar con sales, levadura-manitol-mineral, pH6.8. Para la actividad de nitrogenasa mediante reducción de acetileno: matraces Kitasato Erlenmeyer, globo de hule, jeringas de 1 ml a prueba de gas, tubos de vacío de 5 ml, frascos de 10 ml o de mayor capacidad con tapones de goma, carburo de calcio CaC2, cromatógrafo de gases equipado con un detector de ionización de flama (FID) y columna RN Poropak para determinaciones de acetileno/etileno. Nota: los ensayos de nitrogenasa pueden llevarse a cabo en campo. MÉTODOS DETALLADOS Muestreo del suelo. Se saca una muestra de suelo a una profundidad de 20 cm, en 12 puntos, distribuidos alrededor de cada parcela de muestreo (véase Capítulo 2, Figura 2.3). Se utiliza el mismo esquema de extracción del núcleo para el muestreo en todos los grupos microbianos, incluyendo el BFNFNL. Se junta cada juego de 12 muestras, para formar una muestra compuesta de alrededor de 300 g que, posteriormente, se introduce en una bolsa plástica esterilizada. De manera alter190
Manual de biología de suelos tropicales

nativa, cuando lo permitan los recursos, se pueden obtener tres o más muestras compuestas en cada punto. Todas las herramientas: sacabocados, espátulas, azadón, etc. deberán lavarse muy bien con agua para remover partículas de suelo y ser esterilizadas mediante alcohol y flama antes y después de cada muestreo, con el fin de evitar la introducción de BFNFNL exóticas. Se deben minimizar las pisadas cerca de los puntos de extracción y la hojarasca deberá ser removida justo antes de que se lleve a cabo el muestreo. Las muestras de suelo se trasladan al laboratorio lo antes posible, utilizando un envase con aislamiento (preferiblemente debe permanecer a 4° C). Una segunda muestra compuesta de alrededor de 200 g será recogida en una bolsa de plástico no estéril para su análisis físico-químico. Muestreo de nódulos. Se deberán identificar plantas leguminosas dentro de un radio de 8 m (lo mismo que para un inventario de vegetación) en el punto de muestreo y se recogerá el material vegetal resultante. Será de gran ayuda contar con información previa acerca de cuáles son las especies que pueden nodular, de manera que se confine el muestreo a estas especies en concreto; sin embargo, hay que aclarar que existe un enorme potencial para el descubrimiento de nuevas especies de leguminosas de este tipo. En el caso de plantas herbáceas, se puede extraer todo el sistema de raíces del suelo, utilizando una azada, un azadón o una pala, cuidando no romper nódulos de manera accidental. Los nódulos de plantas leñosas deberán descubrirse extrayendo las raíces y poniendo gran atención para no dañar las ramificaciones delgadas en donde éstos normalmente se encuentran. Se debe verificar, con extremo cuidado, que las raíces delgadas pertenezcan a la planta leguminosa identificada; por este motivo, se recomienda empezar la excavación junto al tallo; se extirpan los nódulos (dejando un pedazo de raíz para facilitar la manipulación) y se guardan en tubos de tapón de rosca con un desecador (Figura 6.2b). Antes del almacenaje, las partículas de suelo deberán removerse, bien por sacudido o bien mediante lavado, retirando el exceso de agua con una servilleta. Por lo menos se recogerán 50 nódulos por cada punto de muestreo y la muestra será representativa de todas las especies nodulantes existentes en la parcela de muestreo. En ocasiones, algunos nódulos pueden ser demasiado grandes para los tubos normales de rosca: deberán ser almacenados en un recipiente de mayor capacidad. Actividad nitrogenasa. La actividad de nitrogenasa puede medirse en el campo o a partir de cada nódulo, justo después del muestreo o en el laboratorio (Figura 6.2). Se introduce el nódulo en un frasco de tapa de goma de 10 ml o de mayor capacidad, en caso necesario. Se produce acetileno en un matraz Kitasato Erlenmeyer
B acterias
formadoras de nódulos en leguminosas

191

por la reacción de CaC2 con agua (Figura 6.3). Si se lleva a cabo el trabajo en laboratorio, se obtiene acetileno de cilindros de gas comerciales. Se inyecta 1 ml de este gas en el frasco que contiene el nódulo. Después de una hora aproximadamente, se remueve 1 ml de gas de la superficie y se transfiere a un tubo al vacío para su posterior análisis de etileno por cromatografía de gases (Figura 6.2a). Especímenes de resguardos de plantas. Los especímenes de resguardos de plantas nodulantes, deberán recogerse en el área que se encuentra alrededor del punto de muestreo (radio de 8 m). Se debe poner especial atención en el etiquetado (véase a continuación) y si es posible, incluya flores y frutas. Enseguida, los especímenes se mandan al herbario para su identificación junto con una tarjeta de identificación de las mismas: Proyecto: CSM-BGBD Colector: Fátima Moreira Fecha: 2 de abril de 2005 Localidad: Benjamin Constant Altitud: 500 m Nombre vulgar de la especie: faveira Nombre científico de la especie: ¿? Número de vale: 05 Características del nódulo: crecimiento medio, tamaño 0.5 a 1.5 cm Descripción del lugar: pastizales abiertos con ganado y troncos de madera Tipo de suelo: limo arenoso
Figura 6.3 Producción de acetileno en campo o laboratorio.
Agua Globo de hule CaH2

Tubo de goma

CaC2

CaC2 + H2O ⇒ C2H2 + Ca (OH)2 Sólido Gas Sólido

192

Manual de biología de suelos tropicales

Características de la planta: herbácea con frutos maduros Otros comentarios: se recogieron semillas; flores amarillas. El conteo de BFNFNL. Se someten muestras de suelo a una serie de diluciones antes de la inoculación de las plantas hospederas candidatas (Figura 6.4). La correlación de diluciones varía entre 2.0 (1:2) y 14.5 (1:14.5), según la concentración de células esperada en la muestra. Esto significa una mayor dilución para suelos con más BFNFNL; sin embargo, aún es necesario inocular plantas hospederas en todas sus diluciones (véase a continuación). Asimismo, en cada dilución se debe emplear una réplica del bioensayo (2 a 5 veces). Las plantas se cultivan en condiciones controladas (Vicent, 1970) y después de 15 días, se les examina para ver si han formado nódulos. Las poblaciones de BFNFNL se estiman por el método del Número más Probable (Cochran 1950; Woomer et al., 1988b, 1999). En el caso de inocular las plantas únicamente para capturar las BFNFNL, las muestras de suelo deberán resuspenderse en agua esterilizada o en una solución de nutrientes (la misma que se utiliza para un medio de cultivo o crecimiento de plantas) (véase anexo 6.1 y 6.2) en una correspondencia 1:1. Las plantas pueden cultivarse en bolsas de plástico, jarras de Leonard u otro tipo de frasco. Se deben utilizar tres tipos de controles sin inoculante de suelo: el primero comprueba la presencia de contaminación durante los procedimientos experimentales. Si no se mantienen de manera correcta las condiciones axénicas, este control resultará en nódulos y el experimento se invalidará (aún cuando nódulos ocurren en una sola réplica). Se recomienda que el número de réplicas dentro de este control sea mayor que las réplicas de tratamientos de inoculación y el control debe localizarse dentro de diferentes posiciones en el protocolo. Los otros dos controles permitirán comprobar la eficiencia de las comunidades de BFN. Las comunidades que nodulan la planta hospedera indican si las condiciones del experimento (temperatura, concentraciones de nutrientes) son adecuadas para que se lleven a cabo la nodulación y la fijación de nitrógeno en las plantas y su crecimiento. El primero de los controles se complementa con nitrógeno mineral (para jarras de Leonard, 70 mg N-NH4NO3) cada semana desde la tercera hasta la penúltima, pero no se inocula. Para bolsas de plástico o recipientes de pequeños volúmenes, se utiliza una sola aplicación de 70 mg N-NH4NO3). De esta manera el caupí, que alcanza su nivel de floración en dos meses, con el uso de jarras de Leonard recibirán un total de 350 mg N-NH4NO3, mientras que los frijoles con un periodo de crecimiento de mes y medio, en jarras de Leonard, recibirán 280 mg de N-NH4NO3. El otro control se inoculará con un inoculante recomendado para esta
B acterias
formadoras de nódulos en leguminosas

193

especie de planta; por ejemplo, CIAT 899 para Phaseolus vulgaris en Brasil, pero no se añade nitrógeno. Aislamiento y caracterización de BFNFNL. Las BFNFNL son aisladas de los nódulos recogidos en campo y por bioensayo en el laboratorio. En el último caso, los nódulos obtenidos en cada dilución sucesiva pueden indicar cuáles son las cepas menos frecuentes en la muestra de suelo y cuáles, las más comunes. El primer paso será esterilizar la superficie de los nódulos con una breve inmersión en 95% de alcohol, seguida de una inmersión más larga de tres a cuatro minutos en HgCl2 (hipoclorito de Na o Ca, o H2O2 pueden usarse como sustitutos) y lavado mediante varios enjuagues con agua estéril (Vicent, 1970). A continuación se aplasta el nódulo dentro de unas gotas de agua estéril, utilizando pinzas y esto se vierte sobre un medio de agar. En el caso de los nódulos disecados, éstos deben remojarse en una solución de agua esterilizada para mejorar la absorción de la solución desinfectante. Los tiempos de inmersión en HgCl2 u otros desinfectantes, deberían ajustarse al tamaño del nódulo (más corto para nódulos pequeños). En la composición del medio de agar: levadura-manitol-sales minerales (Fred y Waksman, 1928) (Anexo 6.1), especialmente el pH y la fuente de carbohidrato pueden variarse, tomando en cuenta las condiciones específicas del suelo (Date y Halliday, 1979; Souza et al., 1984; Elkan y Bunn, 1991). Puede incluirse azul de bromotimol como indicador porque los cambios en el pH, causados por la formación de BFNFNL, pueden resultar útiles en la identificación de género. Otros caracteres incluyen: la tasa de crecimiento (tiempo TAIC de aparición de colonias aisladas), la cantidad de polisacáridos celulares, forma y tamaño de colonia, diámetro y color según lo descrito por Moreira et al. (1993) y Jesús et al. (2005). Los principales descriptores de cada género son: Allorhizobium, Rhizobium y Sinorhizobium: colonias circulares, de 2 a 4 mm de diámetro, normalmente unidas debido a la copiosa producción de polisacáridos extracelulares, convexas, semitraslúcidas, elevadas y mucilaginosas, la mayoría con el centro de color amarillo (debido al indicador de pH), de crecimiento rápido (TAIC: de 2 a 3 días). Mesorhizobium: igual que Rhizobium, pero normalmente de crecimiento más lento (TAIC: de 4 a 5 días). Bradyhizobium: colonias circulares que no exceden de un milímetro de diámetro, producción extracelular de polisacáridos de abundante a escasa (esto último, generalmente en el caso de los tipos que toman más de diez días para su crecimiento), opacas, raramente traslúcidas, blancas y convexas, granulares en textura y que producen un cambio de pH a alcalino, de crecimiento lento o muy lento (TAIC: de 6 a más días).
194
Manual de biología de suelos tropicales

Figura 6.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.

Paso de dilución

Nivel de dilución

El porcentaje base de la dilución (Nd) puede variar de 1:2 hasta 1:14.5 y el numero de replicas por dilución (N) de 2 a 5. Fuente: adaptado de Woomer, 1993 y Vincent, 1970 por Moreira y Pereira, 2001.
B acterias
formadoras de nódulos en leguminosas

195

5 mm de diámetro. Burkholderia: con características de crecimiento muy similares a las de crecimiento rápido.1 se pueden observar referencias que ofrecen amplios detalles de las características de especies de NFNLB. crecimiento en diferentes fuentes de carbono (Dreyfus et al. 1988. Moreira et al. a veces. producen un cambio de pH a alcalino. 1988). donde incluyeron serología (Dudman y Belbin.. también conocidas como huellas 196 Manual de biología de suelos tropicales . composición de bases de DNA (%C + G).. generalmente. por ejemplo Rhizobium. con un poco más de producción extracelular de polisacáridos. Las BFNFNL son bastoncillos Gram negativos que no forman esporas y que. con la excepción de modificación de pH porque pueden producir una reacción ácida o alcalina (dependiendo de la edad). lipopolisacáridos celulares (De Maagd et al. Estas técnicas. Las cepas aisladas deben reconfirmarse como BFNFNL.. secuencia de la subunidad pequeña del RNA ribosomal (Young y Haukka. 1993). 1988). por lo tanto. 1989). patrones totales de proteína por SDS-PAGE (Dreyfus et al. morfológicas y fisiológicas. 1983).. en sus características simbióticas. Cupriavidus: similar a Azorhizobium. al mismo tiempo. contienen gránulos refráctiles de poly-β-hidroxibutirato en microscopio de contraste de fases. de acuerdo con los postulados de Koch. se han descrito nuevas técnicas para la caracterización de los procariotes. hibridación DNA:DNA. de crecimiento rápido a medio (TAIC: de 3 a 4 días).. muy poca producción extracelular de polisacáridos (mucho menos que en el caso de Bradyhizobium).Azorhizobium: colonias circulares. por ejemplo. Graham et al. de color cremoso. electroforesis de enzimas metabólicas (Selander et al. dentro de la especie puede ser genéticamente y fenotípicamente alta. resistencia intrínseca a los antibióticos (RIA) (Kingsley y Bohlool. 1996).. La diversidad de cepas. (1991) aportaron estándares mínimos para la descripción de nuevos géneros y especies. de 0. 1986). En la Tabla 6. bajo condiciones bacteriológicas controladas. perfiles de plásmidos (Giller et al. será necesario definir el nivel apropiado de diversidad que permita caracterizar géneros y especies específicos. Recientemente. lo que puede ser muy útil para numerosos estudios. 1988).. mediante una demostración en la que formen nuevos nódulos en una planta hospedera de prueba. sino también la capacidad de discriminación dentro de diferentes taxas: cada una tiene un nivel específico de resolución para la clasificación bacteriana. hibridación rRNA-DNA y polimorfismos en los tamaños de fragmentos de restricción del DNA. lo que mejora no sólo la clasificación bacteriana.

Los costos y beneficios de una caracterización previa y secuenciación de representantes versus una secuenciación directa de un número mayor de aislados. tales como ARDRA (Análisis de Restricción del rDNA Amplificado). El número total de placas de 96 muestras cuesta alrededor de US $350 para la secuenciación. Los costos de la secuenciación de DNA se han reducido notablemente durante los últimos años y. dependiendo de la tasa de crecimiento específica para cada cepa (de 2 a 10 días). tRNA-PCR o ITS (Amplificación y Análisis del tRNA y de Regiones Intergénicas del 16S-23S rRNA). La caracterización genética de DNA (secuencia del 16S. en la actualidad. Bruijn et al. si existe disponibilidad de recursos. Por ejemplo. la secuenciación directa de 16S rARN u otros genes puede ofrecer ventajas económicas. 1997). 23S rARN u otras secuencias de genes. para cada tipo se suspende una azada con bacterias de una colonia aislada en 1 ml de agua B acterias formadoras de nódulos en leguminosas 197 . homología DNA:DNA) requiere de mucho tiempo y de equipo especializado y. AFLP (Polimorfismo de Tamaño de Fragmentos Amplificados) para el análisis de todo el genoma. normalmente. si se piden las placas completas de 96 muestras. Empresas privadas dan buenos servicios para productos PCR y su purificación y secuenciación. se restringe únicamente a representantes de grupos. Los métodos basados en la reacción de Polimerasa en Cadena (PCR). Extracción de DNA: el DNA genómico es aislado de cultivos de fases log en 79/YMA durante diferentes periodos de incubación. en algunos casos. puede costar alrededor de US $6.. 1997. Se pueden utilizar el kit “Ultraclean” para el aislamiento de DNA de suelo de los laboratorios MOBIO o cualquier otro kit recomendado por el productor.) (Rademaker y Bruijn.genómicas. la purificación y secuenciación de un fragmento de genes (una muestra) ya amplificada por PCR. RAPD (DNA polimórfico amplificado al azar): AP-PCR (PCR Con Arimers Arbitrarios). deben tomarse en cuenta. Se cuantifica el DNA a A260 nm con un espectrofotómetro o se estima por comparación con diferentes estándares de concentraciones de DNA en geles de agarosa. REP-PCR (Huellas Genómicas de Elementos Genómicos Repetidos de DNA. Los análisis numéricos con un número adecuado de cepas y la comparación con las cepas de BFNFNL permiten la caracterización de grandes poblaciones. la secuenciación de genes específicos puede aplicarse directamente a un número de cepas determinado por las curvas de rarefacción o acumulación. incluyen: la digestión de DNA genómico con endonucleasas que cortan sitios (de restricción) poco frecuentes seguido por PFGE (Electroforesis en Gel en Campos Pulsados) y otros métodos de RFLP. Alternativamente. por otro lado.

se utiliza un volumen de esta suspensión como templado para el PCR. 0. Sin embargo.nih. 2. Secuenciación 16S rDNA. Análisis filogenético. Los genes casi completos del 16S rDNA se amplifican con un par de oligonucleótidos 27F (pA: 5`AGAGTTTGATCCTGGCTCAG) y 1492R (5´GGTTACCTTGTTACGACTT). durante 7 minutos.5 mm MgCl2. o bien.esterilizada. seguido por 30 ciclos de desnaturalización a 94°C durante 40 segundos.msu. lo que produce una suspensión ligeramente turbia que posteriormente se hierve durante cinco minutos para lisar las células.. Un paso de secuenciación del PCR amplificado se obtiene con el primer 27F. La purificación de los productos PCR se hace con filtros Microcon™ (Millipore) o mediante otros métodos de purificación. usando los aislamientos representativos de diferentes grupos (obtenidos bien por caracterización de cultivo.gov/). respectivamente. pero también con el primer reverso 1492R. el European Bioinformatics Institute (EBI) secuenciación de base de datos (www.nlm.uk) y el Ribossomal Database Project (RDP) (http://rdp. la viabilidad de dichos cultivos no es larga: los métodos como liofilización y almacenaje en un congelador (–80°C) garantizan una larga conservación de las células viables.ac. del gen 16S del RNA ribosomal de Escherichia coli (Wilson et al. Las concentraciones finales en las mezclas de reacción (100 ml) son: 1 x PCR Buffer. con extensión a 72°C durante 90 segundos.2. 1990). Se comparan las secuencias con otras conocidas contenidas en las bases de datos.edu/index. por otras técnicas). El programa para PCR incluye un paso inicial: desnaturalizar a 94°C durante 5 minutos.jsp). 0.cme. apareamiento a la temperatura de 55°C. tales como la del National Center for Biotechnology Information (NCBI) (www. durante 40 segundos.ebi. similares a los presentados en la Figura 6.2 μm de cada oligonucleótido y dos unidades de la enzima Taq polimerasa (DNA extraído o cultivos líquidos): 6 μl.2 mm de cada dNTP. Cuando se requiere la secuencia de todo el gen se deben elegir otros primers internos y usarse para amplificar y secuenciar el fragmento del gen que falte después de utilizar 27F y 1492R. Estos pares de oligonucléotidos corresponden a posiciones 8-27 y 1507-1492.ncbi. los cultivos puros se mantienen en agar inclinado dentro de tubos de tapa rosca en el mismo medio de cultivo. MANTENIMIENTO Y COLECCIÓN DE CULTIVOS PUROS Normalmente. 198 Manual de biología de suelos tropicales . perfiles REP-PCR. Otros oligonucleótidos pueden utilizarse si permiten la síntesis de un gen 16S rARN casi completo. La extensión final se lleva a cabo a 72°C.

M. W. A.V. C. N. J. (2009) ´Rhizobium alamii sp. (2010) ´Devosia yakushimensis sp. R. M. (1997) ‘Rhizobium gallicum sp. M.. G. nov.. nov. from Phaseolus vulgaris nodules’.W y Vandamme. J.. M. Sheu. Critical Reviews in Plant Sciences.. De Faria. nov. Chou. Chen. K. E. J.. C.. Soil Biology and Biochemistry. Casida Jr.) Ohwi´ International Journal of Systematic and Evolutionary Microbiology vol 60. pp. Santealla. Chen. isolated from root nodules of Mimosa caesalpiniifolia´ International Journal of Systematic and Evolutionary Microbiology vol 58. M. V.. Boddey. y Achouak.. De Faria.H. W. S.. James.. N. nov. pp2174-2179. an exopolysaccharide-producing species isolated from legume and non-legume rhizospheres´ International Journal of Systematic and Evolutionary Microbiology vol 59. R. pp841–843.. P. Roncato. pp627-632.. R. Amarger. New York.. Brandelet.. Sprent. Monsalud. E..AGRADECIMIENTOS Agradecimientos especiales por sus comentarios y revisiones a los Drs. nov.. y Laguerre. vol 33. nov. J. Lodhi.. Bala. REFERENCIAS Achouak. y Hardy.H. K..G.. K. R. F. Murphy. pp339–345. G. and Rhizobium giardinii sp. Lin. Chou.. R. M. vol 32. Sprent. O. Bautista. y Vandamme.. Esperanza Martínez. V.. nov..P. Christien. (1999) ‘Burkholderia caribensis sp. (1987) ‘Methods for quantification of nitrogen fixation associated with Graminae’. Christen. T. K. James.. P. Elliot. y Heulint. W. B acterias formadoras de nódulos en leguminosas 199 . Heulin. nov. Springer-Verlag.pp367-372.. E. L.. E. International Journal of Systematic and Evolutionary Microbiology vol 49. J. (2001) ‘Genetic diversity of rhizobia varies from natural populations with the soil dilution sampled’.. I. Y. (1982) ‘Ensifer adhaerens gen. J. (1975) Nitrogen Fixation in Bacteria and Higher Plants. an exopolysaccharide-producing bacterium isolated from vertisol microaggregates in Martinique‘. Y.: A bacterial predator of bacteria in soil’. W.. C. W.. Giller. sp. T. A. S. .. Cnockaert. Elliot.787-749. vol 16. International Journal of Systematic Bacteriology. Macheret. M. M. R. N. (2007)´ Burkholderia nodosa sp. I. pp209–266. G... Marlet. David Odee y Nancy Karanja. A. vol 47. (2008) ´Burkholderia sabiae sp. Burns. nov.. isoled from root nodules of Pueraria lobata (Willd. Young. Bontemps. International Journal of Systematic Bacteriology. P. Barakat. M. pp996–1006... Berge. G... S. y Yakta.

. (1995) ‘Characteristics of Rhizobium tianshanense sp. Lee. pp153–159. P. y Li. James. Yuan. P. pp870–873. pp2510-2525. Sprent. nov. Y. 200 Manual de biología de suelos tropicales . isolated from nodules of Mimosa spp.isolated from root nodules of the woody Brazilian legumes Mimosa bimucronata and Mimosa scabrella´ International Journal of Systematic Bacteriology. M.. Wang. (2010) ´Mesorhizobium alhagi sp. (1991) ‘Rhizobiumhuakuii sp. Cummings.. vol 11.W. Mergeay. Chen. a moderately and slowly growing root nodule bacterium isolated from an arid saline environment in Xinjiang...P. S.. y Li. J. vol 41. C. (1950) Estimation of bacterial densities by names of the “most probable number”. (1926) ‘Recherches sur les tubercles radicaux des légumineuses’. H. Wang. T. Humphry.. G. Coenye. International Journal of Systematic Bacteriology. T.M. Moreira. L. (2009) ´Nodulation of Sebania species by Rhizobium (Agrobacterium) strain IRBG74 and other rhizobia´Environmental Microbiology. Shen. Yan. E.. Chen. Li. Chen. S. L. Bontemps. nov.. P.. G. Young. Gyaneshwar.T. I. W.. International Journal of Systematic and Evolutionary Microbiology vol 51.. L. J. (1988) ‘Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned to Sinorhizobium gen. y Vandamme. y Vandamme.. y Wang. pp1729–1735..F. nov. F.. Vos. M.S.. E. G. Z. vol. W. Chen.. W. Young. X.. T. vol 16. M. W.W y Wei. X. S. nov. L.. Zhu. (1997) ‘Rhizobium hainanense sp. T. vol 45. Chen. isolated from wild Alhagi sparsifolia in north-western China´.. vol 38. (2006) ‘Burkholderia mimosarum sp. vol 47. W. nov.. M. isolated from nodules of Mimosa species and sputum of a cystic fibrosis patient’. J. pp1–275. X. J.M. pp105-116. J. from Taiwan and South America’. Gao. J. W.. Chou.. F. E.. J. Wang. X. W. y Li. Chen. M. L. E. Y. pp392–397. Y. Chen.. S... E. International Journal of Systematic Bacteriology. Y. G.I. K.K. Cochran. D. J. Odee. T. nov. E. International Journal of Systematic and Evolutionary Microbiology vol 60 pp958962.P.. isolated from the root nodules of Astragalus sinicus’. Dangeard. Tan. People’s Republic of China’. H. Laevens. Andrews.G. N.. Sprent. W. isolated from tropical legumes’.. Elliot.. (2001) ‘Ralstonia taiwanensis sp. S. Chen. pp10551059. Biometrics. pp1847–1851. International Journal of Systematic and Evolutionary Microbiology. Qi.’. Barrios. Viniesa. Botaniste (Paris). pp275–280. Li. P. M... P.. vol 57. X. A. M. Li. D.. Faria. P. W. vol 56. Farruggia.. nov. Y. Coenye.. International Journal of Systematic Bacteriology. S. y James..P. 6. International Journal of Systematic Bacteriology..

sp.. pp62–64.. New York. Millcamps. The Prokaryotes. (1997) ‘Molecular approaches in microbial ecology to assess genomic diversity and stress-induced gene expression in plantassociated diazotrophs’.. A. M. G. H. J. Schultz. Collins.’. nov.. D. Kluwer Academic Publishers. M. M. G... Moreira. nov. and Sinorhizobium teranga sp. De Lajudie. y Lugtenberg. Coopman. Neyra. y Halliday. De Maagd. D. (1988) ‘Numerical taxonomic analysis of some strains of Rhizobium spp. P.. W. Balows. P. (1991) ‘The Rhizobia’. E. Collins. (1994) ‘Polyphasic taxonomy of rhizobia: Emendation of the genus Sinorhizobium and description of Sinorhizobium meliloti com. Date. A. Davey. Springer-Verlag. cultivation and maintenance of rhizobia’ . P. y Halliday. Kersters. A. Dreyfus. nov. (1987) ‘Collection.. M.. J. International Journal of Systematic Bacteriology.. Ragatz. L. in G. vol 44. (1988) ‘Characterization of Azorhizobium caulinodans gen.. R. y Bunn. Kondorosi and W.Date. De Lajudie. J. B. (1998a) ‘Allorhizobium undicola gen. Neyra. De Lajudie. B. Dworkin.. Berlin.. pp369–382.. A. D.. R. nov.. R.. Struffi... Dewettinck. Garcia. F. Biochemica et Bioophysica Acta.. H. Elkan. Willems.. Sinorhizobium saheli sp. (1979) ‘Selecting Rhizobium for acid.. (1998b) ‘Characterization of tropical tree rhizobia and description of Mesorhizobium plurifarium sp. F. H.. pp3782–3785. B. M. Kersters. Dudman. B acterias formadoras de nódulos en leguminosas 201 . M. y Gillis.. Elkan (ed) Symbiotic Nitrogen Fixation Technology. Pot. Torck. isolation. M. Elmerich.. F.. M. F. D. A.. International Journal of Systematic Bacteriology. W.... Nature. Schlegel and H. pp285–294. sp. Laurent-Fulele. U. L. that uses a qualitative coding of immunodiffusion reactions’. van Rossum. J. K. D. a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata’. Marcel Dekker Inc. M. McSpadden-Gardener. Rademaker. C.. G. vol 54. B. B. y Gillis. E. Dreyfus. vol 48. pp715–733. Collins. J. nov. Journal of Bacteriology. vol 38. 2nd Edition. K. Newton (eds) Biological Nitrogen Fixation for the 21st Century. International Journal of Systematic Bacteriology. R. vol 48. B.. J. y Gillis.. B. E. Torck. M. y Gilles. L. A. Nick.. nov. International Journal of Systematic Bacteriology. K.. (1988) ‘Recognition of individual strains of fast-growing rhizobia by using profiles of membrane proteins and lipopolysaccharides’.. vol 277. y Stoltzfus. J. J. Dordrecht.. G. Dreyfus. A. Dilworth. Truper (eds). pp1825–1830. M. De Bruijn. Dreyfus. in C.. Lindstrom. Willems. nov. vol 127.. M. P. nov. L. C. A. Applied and Environmental Microbiology.’. U. Willems. in A. Hoste. infertile soils of the tropics’. pp1277–1290. nitrogenfixing bacteria that efficiently nodulate Neptunia natans in Senegal’. Maestrojuan. R. (1966) ‘Acetylene reduction by nitrogen fixing preparations of Clostridium pasteurianum’. vol 170. M. Molouba. y Belbin. pp89–98.

. Lindstrom. Wang. S. pp2037–2048. C. vol 37.. Martínez-Molina. vol 51. D. Y. Chen. Wang. Gaunt.. W. Turner.. Peix. J.. E. H.. X.. Turner. New York and London. J.. y Chen.T.X. nov.nov. McGrath.Faria. (2008) Rhizobium miluonense sp. J. pp783–784. A. y Hirsch..X. pp376–387.. Sui. Berichte der Deutschen Botanischem Gesellschaft. J.. B. Qiu. Frank. Fred. Y. W. (2004) ‘Mesorhizobium septentrionale sp. a symbiotic bacterium isolated from Lespedeza root 202 Manual de biología de suelos tropicales . S. H. International Journal of Systematic and Evolutionary Microbiology. I.. M.. P. T.. Barnet. R. S. Han. M...F. Y. International Journal of Systematicand Evolutionary Microbiology. H. M.F. Terefework. R. Lewis... Sprent. Gao.P. de Ley.. A. vol 19.. E.. K. y Velázquez. W. X. vol 41. F. P.. Z.. nov. Willems. Mateos. B. P.. W. (1989) ‘Occurrence of nodulation in the Leguminosae’.. vol 111. Tan... International Journal of Systematic and Evolutionary Microbiology. L. Botanik Zeitung. E. H. Keyser. P. New Phytologist. pp2003–2012. isolated from Astragalus adsurgens growing in the northernregions of China’. vol5.. P. nov. E. pp 582–587. E. (1989) ‘Absence of nitrogen fixation in clover grown on soil subject to long-term contamination with heavy metals is due to survival of only ineffective Rhizobium’. M. R. K. J. S. Bradley.and stem-nodulating bacteria’. E. W.F. 394–399. Giller. Young. a novel sulfur-oxidizing chemolithoautotroph from rhizosphere soil of an Indian tropical leguminous plant´. y Waksman. y Young. Soil Biology and Biochemistry. Cooper. pp332–346. T. isolated from sawdust of Populus alba’. S. P. vol 57.. pp 841–848. Soil Biology and Biochemistry. (2006) ´Mesorhizobium thiogangeticum sp. and Mesorhizobium temperatum sp. Kan.. International Journal of Systematic Bacteriology. E.. International Journal of Systematic and Evolutionary Microbiology.. K. Ghosh. y Roy. Martens. Frank. McGraw-Hill Book Company. B. W. L. J. P. B. M. S. R. (1928) Laboratory Manual of General Microbiology.. pp91-97. Jarvis. E. (1987) ‘Use and abuse of the acetylene reduction assay for measurement of “associative” nitrogen fixation’. A. Sadowsky. P. Strijdom. J. S.. J. y Sutherly. Lloyd-Macgilp. y Young. C. E. Tian. A. L. G. García-Fraile. W. B.. W. Inc. Roslycky. vol 21.M.. pp 844-848. pp 607–619. J. L. (2007) Rhizobium cellulosilyticum sp. nov. vol 7.T. Rigottier-Gois. vol 56.. B. Giller. (1879) ‘Ueber die Parasiten in den Wurzelan-schwillungen der Papilionaceen’.. Gu. Rivas.H. (1991) ‘Proposed minimum styards for the description of new genera and species of root. Z. W. y Chen. (1889) ‘Ueber die Pilzsymbiose der Leguminosen’. (2001) ‘Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia’. W. Graham. L.

Nakagaka. W.X. Chen. Florentino. Hunter. 895–898... F. nov..Z. S. (1997) ‘Transfer of Rhizobium loti.. (2010)´Ochrobactrum ciceri sp.International Journal of Systematic and Evolutionary Microbiology. y Gillis.. Biosci. Malik...F. Gu. vol58. X. nov. Rhizobuim huakuii.. Kuykendall. Wang.K. W. International Journal of Systematic Bacteriology. Chen. L.G. Chen. y Chen.F. X. Mesorhizobium caraganae sp. P. K. Zhang. C. Rodrigues.B.nodules‘.. T. pp2610-2618. Han.T. vol 58. nov. L.T.. M. T.. nov. Hafeez. M. Gu. Wang. E. Han.H. Wu. Dong... J.) Vassilcz´.X. A.. E. vol58.. Biotechnol. International Journal of Systematic Bacteriology. Fernyez. B. China‘. Lu. pp1364-1368. van Berkum. a symbiotic bacterium isolated from Trigonella archiducis-nicolai (irj. W. B.J. E. Guan. pp1693-1699. Oliveira.vol 59.: a selenite-reducing (alpha)-Protobacteria isolated from a bioreactor´Current Microbiology. vol 60: 1548 . L.. E. y Patel.F. Cleyet-Marel. W.R..1553. in China ‘.I.C.. Jarvis. Gu. and Mesorhizobium tarimense sp. R. W. pp455-460.. (2008).. W. L.. W.X.G. (2008) Mesorhizobium gobiense sp. M.... C. Tian C. International Journal of Systematic and Evolutionary Microbiology. a novel rhizobial species nodulated with Caragana spp.. Nour.. Islam. Y. D. Sui. X.F. Y. C. J. J. E.. vol 58. B.F.J. vol 32. Y. Frühling. Wang. W.. Chen. isolated from wild legumes growing in desert soils of Xinjiang. Jarvis. W.T. T. Rhizobium ciceri. X.. M. P.. L. (2009) ´Rhizobium tibeticum sp. y Moreira.. (2007) ´ Rhizobium selenireducens so. Isolated from a Tumor-Like Root of the Legume Entada koshunensis from Iriomote Island in Japan‘. S. International Journal of Systematic and Evolutionary Microbiology.. Chen. nov. Yan.. y Chen. China‘. Wu.X. vol 47.. (2005) ‘Leguminosae nodulating bacteria diversity from three different land use B acterias formadoras de nódulos en leguminosas 203 . a new species of legume root nodule bacteria’. International Journal of Systematic and Evolutionary Microbiology.(2008) ‘Rhizobium multihospitium sp. Biochem vol 72. Muramatsu. Y. Gao. J. H. International Journal of Systematic and Evolutionary Microbiology. A. Hou. nov.. W.. pp378–380. nov... isolated from nodules of Cicer arietinum´.T. Imran.. Schumann.H. y Stackebrandt. C. vol 55.. Han. M. Kawasaki. (2008) ‘Bradyrhizobium iriomotense sp. I. International Journal of Systematic and Evolutionary Microbiology. Y. W.X. Jesus. nov. A. M. Jia. Rhizobium mediterraneum and Rhizobium tianshanense to Mesorhizobium gen.. Pankhurst. A..L.s. nov. R. F. e Seky. Wang. E.’. Li..X.pp3051-3057. y Chen. pp2646-2653.. P. D. isolated from multiple legume species native of Xinjiang. pp1416-1429. Y. W.X. (1982) ‘Rhizobium loti.J. M. D... J.T. y Chen. y Manter D. E. S.J.

Wang E. (1992) ‘Genetic diversity in Bradyrhizobium japonicum and a proposal for Bradyrhizobium elkanii sp. Wang E. Rosenberg. y de Lajudie. F. W. B.Q. Bena...X...F. pp1409-1413. E. N. International Journal of Systematic and Evolutionary Microbiology.systems in Brazilian Western Amazon’. C. (2009)´Rhizobium mesosinicum sp. He.. Chen. isolated from root nodules of Caragana species ‘. Willems. W. in N.. Lewin. Giraud. Royal Botanic Gardens. Jourand. vol 59. L. y Lock. B. S. Devine. vol 29..F. Chen. W.T. E. International Journal of Systematic and Evolutionary Microbiology. Canadian Journal of Microbiology. Kingsley. L. Han. Y. Sui.F.X.H. P. D. nov. pp769–776. X. Hu.. L. y Broughton. nov. for a group of aerobic facultatively methylotrophic. immunodiffusion and intrinsic antibiotic resistance’. International Journal of Systematic and Evolutionary Microbiology. A. Nelson. W.. M.Q.. y Bohlool. D. (1984) ‘Rhizobiaceae Conn 1938’.. y Chen. Plant Molecular Biology.’. (2009) ´ Mesorhizobium shangrilense sp. pp3006-3011.. NGR234 selected using the widely compatible legume Vigna unguiculata’. International Journal of Systematic and Evolutionary Microbiology. Li. London.X. D. X.. vol 59: 1919 .1923. Stanley. Wang. 204 Manual de biología de suelos tropicales . J. Lewis.Y. Meyer. F. M. pp501–505. H. vol 54. (2009)´Rhizobium alkalisoli sp.X. nov. y Udell.. Hu. pp447–459. vol 40. Pesquisa agropecuária Brasileira.T. B. Li. isolated from root nodules of three different legume´. (1987) ‘Multiple host-specificity loci of the broad host-range Rhizobium sp. J.T. S. nov. Saxena. pp518–526. J.R. M. Schrire. (2004) ‘Methylobacterium nodulans sp. Chen. Sui. Dénarie. pp2269–2273.. J. vol 59.. vol 58. Canadian Journal of Microbiology. E. C. y Chen. legume root-nodule-forming and nitrogen fixing bacteria’. G. D..) by immunofluorescence.H. (1983) ‘Characterization of Rhizobium sp. B... F. (Cicer arietinum L.L. W.. W.. D. Mackinder.. D. Lin. Holt (eds) Bergey’s Manual of Systematic Bacteriology. (2008) ´ Shinella kummerowiae sp. isolated from Caragana intermedia growing in saline-alkaline soils in the north of China´. Lin.... Wong. Guan.. Sy. G. Dowling. a symbiotic bacterium isolated from root nodules of the herbal legume Kummerowia stipulacea ‘. D. vol 8. T. Krieg and J.X. H. W.... H. nov. Gillis. T.. Dreyfus.. A.. Wang.X.Y. W.X.. pp30123018. Tang. Han. A.. D..T. T. R. P.. B. Kuykendall. Wang. International Journal of Systematic and Evolutionary Microbiology.. (2005) Legumes of the world. Wang E. L.. Williams and Wilkins. Manen.nov.. vol 38..H. Kew.L.. C. B. y Chen. y Chen. Jordan.

L. and Phyllobacterium brassicacearum sp. P. F.. vol 12.. S. M. a new specie nodulating Acacia angustissima (Mill. Sy. M. A. J. Lima. G.. M. E. y Cleyet-Marel. D. M. J. nov´.. Ferreira. Argyrolobium uniflorum and Medicago sativa (Tunisia) and description of Ensifer numidicus sp. Magalhães. E. M. (2007)´Ensifer mexicanus sp.´. Martens. de Lajudie... F. vol 41.. M.. M. Barberi. A. F. S. International Journal of Systematic and Evolutionary Microbiology. (2009) ´Nitrogen-fixing bacteria communities occurring in soils under different uses in the Western Amazon Region as indicated by nodulation of siratro (Macroptilium atropurpureum)´ Plant and Soil. A. L. Oliveira. Coopman. Lindström. J.. Rogel-Hernández. Magalhães. F.. Merabet. Minas Gerais. PP. y Martínez-Romero.... Zakhia.127-145. nov. Mercante.. International Journal of Systematic Bacteriology.F.S. K.. S.. E.M. Zakhia. Lotus creticus.Lima.S. B acterias formadoras de nódulos en leguminosas 205 . O. Systematic and Applied Microbiology. beans and Leucaena trees’.. A. Segovia. Domergue. F. Brasil. (2010) Multilocus sequence analysis of root nodule isolates from Lotus arabicus (Senegal). pp365–367.A. A. Fischer-Le Saux. nov. nov. Bonneau.) Kuntze in Mexico. (2006) ´Emended description of the genus Phyllobacterium and description of four novel species associated with plant roots: Phyllobacterium bourgognense sp. vol 30. International Journal of Systematic Bacteriology. R. nov. (2007) ‘Densidade. International Journal of Systematic and Evolutionary Microbiology. Annual meeting report 4. Mahdhi.A.R.. Phyllobacterium leguminum sp. y Pardo. y Moreira.. eficiência e diversidade de bactérias fixadoras de N2 que nodulam o siratro (Macroptilium atropurpureum) de solos sob diferentes usos na Amazônia Ocidental’. vol 319. and Ensifer garamanticus sp... nov. Martínez-Romero. pp417– 426. vol 56. y Döbereiner.. L.M.A. L. Willems. R. P. vol 60: 664 .. S. Kenya. A. Le Roux. a new species of legume root nodule bacteria’. F. C. Llorente. K.. vol 39..674.S. (1991) ‘Rhizobium tropici. P. a new species nodulating Phaseolus vulgaris L. A. (1989) ‘Rhizobium galegae. pp280-290. PhD Thesis. Acta Amazônica. Rincon. Nairobi.. pp509-514. Phyllobacterium ifriqiyense sp. Jeder. Graham. Moreira. pp827-839. (2004) ‘Methodology for the inventory of nitrogen-fixing Leguminosae nodulating bacteria’. Ormeno-Orrillo. B..S..M. Silva. Franco. y de Lajudie. (1982) ´Ocurrência de nodulacão en leguminosas florestais notivas de terra firme da região de ManausAM´. Bekki. C. H. Mantelin.C. nov... A. A. Nóbrega.M. Conservation and Sustainable Management of Below-ground Biodiversity CSM-BGBD.. Béna. Mars. Martínez-Romero. Universidade Federal de Lavras.

Pedrosa. B.nov. A. Tiedje. in F.. y Howieson. Munive. M. M.G. pp197–206.. International Journal of Systematic Microbiology. Moreira. Bignell (eds) Standard Methods for Assessment of Soil Biodiversity and Land Use Practice.. y Lidstrom. de Lajudie. Nour. Cruz. Gillis. J. Kersters. Zhang. M. L. F.)’. J.. Moreira... y Fernandez. y Faria. K.. Pot. in Australia´. Tiwari.. A. microsymbiont of Sesbania virgata (Caz. vol 411. C. E. M. G... New Phytologist. CAB International. S. 768pp. (2002) ‘Burkholderia spp. y Franco. M. Swift and D.. Wallingford... UFLA. R. Gillis. pp135–146. in M. P. S. O. Memorias da XXI Reunión Latinoamericana de rhizobiologia.. Martínez-Romero. P. Moreira. Siqueira and L. O’Hara. Systematic and Applied Microbiology. Paulin. W..G.. O. Suomalainen. 280pp. isolated from Biserrula pelecinus L. International Journal of Systematic and Evolutionary Microbiology. J. T. B. S. F. y Bolvin-Masson. pp948–950. S. M. M. Moreira. Indonesia (available at http://fao. (1994) ‘Genotypic y phenotypic diversity of Rhizobium isolated from chickpea (Cicer arietnum L. F. F.. M. pp2140-2147. Dreyfus. (2008) ‘Bactérias fixadoras de nitrogênio que nodulam Leguminosae’.. K.. and Sinorhizobium kostiense sp. (2001) ‘Nodulation of legumes by members of the b sub-class of Proteobacteri’.. J. Nick. nov. F. C. M. J. vol 16.) Pers. Brussaard (eds) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. Beck. Moulin. J. vol 29. G. T. Moreira. Eardly.org/AG/agl/agll/soilbiod/docs/manual-soil%2). F. B. Willems.. X. Effosse. Brussaard (eds) Biodiversidade do solo em ecossistemas brasileiros.. (2006) ‘Nitrogen-fixing Leguminosae nodulating bacteria’. vol 40. vol 59.P. M. M. isolated from leguminous trees in Sudan and Kenya’. S. (2001) ‘Microsymbionts: rhizobia’.. M. S. y Pereira.. D. Cleyet-Marel. International Centre for Research in Agroforestry. Faria. K. pp1359–1368. S. L. F. S. Moreira. M. P. vol 121. A. (1992) ‘Occurrence of nodulation in legume species in the Amazon region of Brazil’..W. y Young. Siqueira and L. Canadian Journal of Microbiology. Systematic and Applied Microbiology. S. México. (2009) Mesorhizobium australicum sp. 206 Manual de biología de suelos tropicales . Moreira. vol 49. E. M. Bogor.Moreira. nov. (2006) ‘Azorhizobium doebereinerae sp. (1999) ‘Sinorhizobium arboris sp. in F. A. M.. (1993) ‘Characterization of rhizobia isolated from different divergence groups of tropical Leguminosae by comparative polyacrylamide gel electrophoresis of their total proteins. M.. M. R. G. pp345–354. S. pp563–570. are among fast growing symbiotic diazotrophs isolated from diverse land use systems in Amazônia and from Brazilian Leguminosae forest species’. L. nov. A.. Silva. Cocoyoacan. Marsh. y Marsh. nov. S. Nature. and Mesorhizobium opportunistum sp.’. F. D. Editora. S. L. F. O. Lavras. Pitard. Nandasena. S. Moreira.

M. G.. pp2543–2549. J.. (2005) ‘Rhizobium daejeonense sp. M. E. J. A. Rademaker. leguminosarum.. y Velázquez. F. M. A. pp2158-2163.. I. E.F. nov. Pereira. isolated from effective nodules B acterias formadoras de nódulos en leguminosas 207 . Zhang. vol 45. M.H. pp211–224. in G. vol 58. Z. (1997) ‘Characterization and classification of microbes by rep-PCR genomic fingerprinting and computer-assisted pattern analysis’.. J. nodule bacteria from four Papilionoid legume trees in Costa Rica’. Makatiani. R.’. M. A. S.) and description of Rhizobium mediterraneum sp. pp65–75..N. T. Valverde. PhD Thesis. Ramírez-Bahena. pp334–342.. D. H. H. G.. M. y Velázquez. Mateos. Ramírez-Bahena.M. Lavras. Bae. Kimiti. International Journal of Systematic Bacteriology. y Fernandez. leguminosarum DSM 30132 (=NCIMB 11478) as Rhizobium pisi sp. P. McInroy. S. nov. J.. y Sprent. International Journal of Systematic and Evolutionary Microbiology. P. vol 173. E. Martínez-Molina. C.. Systematic and Applied Microbiology. Z.. M... vol 55. S. J. E.. Universidade Federal de Lavras. Odee. Sutherland.nov. (2008)´Revision of the taxonomic status of the species Rhizobium leguminosarum (Frank 1879) Frank 1889AL. pp640–648. Plant and Soil. Gresshoff (eds) DNA Markers: Protocols. isolated from the wild rice Oryza alta´. Martínez-Molina. and Overviews. G. Parker. R. P... E. nov. Peng. J. Brazil. John Wiley and Sons Inc. y Lee. W. Baek.Nour. Igual. P. J. M.. W. (1997) ‘Phenotypic characteristics and composition of rhizobia associated with woody legumes growing in diverse Kenyan conditions’. R. D. Im.. J. A. Q. pp2484-2490. Camacho. M. vol 188. nov. García-Fraile. (1995) ‘Genomic heterogeneity of strains nodulating chickpea (Cicer arietnum L. y Tan. Rivas. Rivas. (2000) ‘Diversity of rhizobia isolated from different land use systems in Amazon region’. Mateos. Peix. I. Odee.. International Journal of Systematic and Evolutionary Microbiology. Sutherland. Caetano-Anollés. vol 27.. Applications. Cleyet-Marel. M.. Li.. vol 58. (2004) ‘rRNA and dnaK relationships of Bradyrhizobium sp. isolated from a cyanide treatment bioreactor’. Reclassification of the strain R. J.H. Willems. L. (2009)´ Bradyrhizobium pachyrhizi sp. (1995) ‘Natural rhizobial populations and nodulation status of woody legumes growing in diverse Kenyan conditions’. Quan. D. Normy. nov. W.. New York. E. Chen.. W... P. (2008) ´Rhizobium oryzae sp. Plant and Soil. W. and P. Rodríguez-Navarro. y de Bruijn.. Rhizobium phaseoli Dangeard 1926AL and Rhizobium trifolii Dangeard 1926AL.F.. A. D. International Journal of Systematic and Evolutionary Microbiology... trifolii is a later synonym of R.. and Bradyrhizobium jicamae sp. y Sprent. Peix. W. Yuan.

Ochman. Mateos. pp580-586. H. Martínez-Molina.. (1993) ‘Reclassification of American Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp. E. N. D. Ponce. International Journal of Systematic Bacteriology. a fast-growing species that effectively nodulates soybeans’. N. H. an aquatic legume from India’. y Cleyet-Marel. Rome. E. P. S.. Velázquez. Dazzo. Llorente.. 208 Manual de biología de suelos tropicales . M. y Martinez-Molina. Willems.. y Vizcaíno. E. International Journal of Systematic Bacteriology. International Journal of Systematic and Evolutionary Microbiology.T. nov.. pp5217-5222. International Journal of Systematic and Evolutionary Microbiology. X. J. pp873–884.... FEMS Microbiology Ecology Vol 68.nov. pp5217–5222. D. pp972–980.. R. P. García-Benavides... nov..F. Schollhorn. Young.. Mateos.. nov. which has common symbiotic genes with Sinorhizobium mexicanum´. Ren.L. vol 24. R. Applied and Environmental Microbiology. that nodulates and fix nitrogen in symbiosis with Neptunia natans. Gillis. a symbiotic bacterium isolated from multiple legume species´. L. (2003) ‘Description of Devosia neptuniae sp. Willems. Scholla. including Sinorhizobium chiapanecum sp. Mateos. vol 51. A. vol 26. E.. vol 68. Rivas. (2004) Bradyrhizobium betae sp. y Burris. y Chen. G... (1984) ‘Rhizobium fredii sp. y Martínez-Romero. Brunel... Rivas. Fernadez. Willems. N. Palomo. Kroppenstedt. (2011)´Rhizobium vignae sp. pp1271-1275. M. M. Chen.. E.F. D. Martinez-Molina. R. (2002) ‘A new species of Devosia that forms a unique nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (L. nov.) Druce’. R. M.. Gillis. Wang. C. W. W.. vol 46. P..H. Caugant. E. R. vol 34. vol 43. y Velázquez. pp255. Dazzo.. (1996) ‘Sinorhizobium medicae sp. Gillis.’. International Journal of Systematic Bacteriology. Gilmour. R. J. F.. J. E. Proceedings of the Federation of American Societies for Experimental Biology. R. nov. E.. N. Subba-Rao. Subba-Rao. A. L. A. M.f. p710 Segovia. Sui. M. F.. (1966) ‘Study of intermediates in nitrogen fixation’. (1986) ‘Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics’. pp47–53. B.’. P. Rincón-Rosales.of Pachyrhizus erosus’. pp484–486. vol 59. P. Musser. y Martínez-Romero.. E.. vol 61. F.. T. P. R. D. Rivas. Applied and Environmental Microbiology.. Normy. y Whittam. F. K. H. P. (2009)´ Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico. isolated from annual Medicago spp. nov. W. A... N.X. Systematic and Applied Microbiology. S.. H.. y Elkan. Vizcaíno. Selyer.W. M. M.. pp374–377. isolated from roots of Beta vulgaris affected by tumour-like deformations´ International Journal of Systematic and Evolutionary Microbiology. J. vol 54.

Applied and Environmental Microbiology. Y. C.. Sy. Y. A. E. G. Boivin-Masson. y Velazquez. nov.. Casella.T.F. Willems. M. Cervantes. a new Sinorhizobium species nodulating Acacia spp. A. (2008) ‘Rhizobium favae sp. Mateos. W. B. Trujíllo. Gu.. P. in Mexico’... de Lajudie. pp54–64. the root-nodule microsymbiont of Hedysarum coronarium L. (2001) ‘Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes’. R. Fernández-Santos. Lloret. pp1132–1136.. L. Kan. Bao.. A. (2006) ‘Rhizobium lusitanum sp. y Martínez-Romero. G.. Tola. Mateos....Souza. E. International Journal of Systematic and Evolutionary Microbiology. A.nov.. Reinhold-Hurek. vol 71. T. Igual. Velázquez. pp214–220. pp1267–1276. Ludeña. B. J. D. (2001) ‘Rhizobium yanglingense sp. nov. A.. I. (2002) ‘The aquatic budding bacterium Blastobacter denitrificans is a nitrogen-fixing symbiont of Aeschinomene indica’. E. Abril. F.. Gillis. P. Giacomini. E. Planchuelo. vol 55. y Oliveira.G.. A. L. 2631-2637.. (2002) ‘Rhizobium sullae sp. vol 68. F. P.F.X. Valverde. D. P. D. E. B. Van Berkum. E. Beyene. C. G. (2005) ‘Nodulation of Lupinus albus by strains of Ochrobactrum lupine sp. nov. Rivas.X. pp1318–1327. W. a bacterium that nodules Phaseolus vulgaris´.. S.. E. Selnska-Pobell. International Journal of Systematic and Evolutionary Microbiology‘.. P. pp1985– 1989. A. International Journal of Systematic and Evolutionary Microbiology.. H. P. y Chen. Peix. a bacterium that nodulates Vicia faba. Squartini.. y Martínez-Molina.. Gu.. E. B. Rivas. (formely ‘Rhizobium hedysari’). nov. y Nuti. Döring. M.. A. A.. A. Toledo. Vizcaíno. E. Velázquez. International Journal of Systematic Bacteriology..M. F... is one of three rhizobial genotypes identified which nodulate and form B acterias formadoras de nódulos en leguminosas 209 . Wu. Chen. nov. R.’.. M.. T. y Mateos. y Eardly... s/n. Struffi. Z... Journal of Bacteriology. isolated from arid and semi-arid regions in China’. Applied and Environmental Microbiology. nodulating Trifolium and Lupinus in Spanish soils’. N. Prin.G. S. Van Berkum. Neyra.. B.. A.’. (1998) ‘Rhizobium mongolense sp. vol 56. Valverde. vol 183.. Garcia. Giraud. pp901–914.. Campbell.. Wang. C. (2003) ‘Sinorhizobium americanum sp. 58: pp 2871-2875. A. P. Vendramin. W. X... L. Joury... vol 51. Matínez-Molina. Wang. y Dreyfus... M. M. F. X. Dazzo. Magalhaes. International Journal of Systematic Bacteriology.nov. M. N. y Chen..T. J. E. vol 52. nov. vol 26. F. pp. Willens.. (1984) ‘Avaliaçao do crescimento de rhizobium de leguminosas florestais tropicais em diferentes meios do culura’. E. P. (2005) ‘Phylobacterium trifolii sp. Systematic and Applied Microbiology.. Pesquisa Agropecuária Brasileira – Ediçao Especial 19. Tian. F. A. Tan. E. y Eardly. P. Han. E.J. L.

B. nov. G. Van Berkum. M. and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al. pp689691. Blackwell Scientific Publications. nov.. C. Willems... A. E. pp1011–1021. Mateos. R. P. A.. H. vol 54. J. pp850-855. P. A. Normy. Abril. E.) Ledebour]’. J.. P. Kamfer. nodulate the roots of tropical legumes’. Vandamme. (2005a) ‘Bradyrhizobium canariense sp. D. P. Pérez-Galdona. y Martínez-Romero. P. Béna. Werner. J.. Toro. Chantreuil. International Journal of Systematic and Evolutionary Microbiology. L. an acid tolerant endosymbiont that nodulates endemic genistoid legumes 210 Manual de biología de suelos tropicales . Igual. vol 54. M. C. E. nov.. and Burkholderia phymatum sp. Coenye. (2004) Proposal to accommodate Burkholderia cepacia genomovar VI as Burkholderia dolosa sp. Vincent. E.. (1970) A Manual for the Practical Study of Root-Nodule Bacteria. Goris. y Willems. Munoz.. International Journal of Systematic Bacteriology vol 54... (2001) ‘Mesorhizobium chacoense sp. J. pp13–22.. (2002) ‘Burkholderia tuberum sp. Leibold. J. Fernyez. vol 51. T. Oxford. pp507–512. K. LiPuma. (Aeschynomene indica) with Blastobacter denitricans and to transfer Blastobacter denitrificans (Hirsh and Muller. 1985) to the genus Bradyrhizobium as Bradyrhizobium denitrificans (comb. W. C. nov.... International Journal of Systematic and Evolutionary Microbiology. P. Escarré.. Chen. y Martinez-Molina.J... a new genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species. M. M.. A. y CleyetMarel. G.-M. France´. pp2285–2289..... (2009)´Mesorhizobium metallidurans sp..J.’. Vinuesa. nov... P. Cervantes. P. Systematic and Applied Microbiology. y Vandamme. B.nitrogen fixing symbioses with Medicago ruthenica [(L. Vermis.. Vandamme.. M. vol 25. de Vos.. vol 48. T. M. E. (2006) ‘Proposal for combining Bradyrhizobium spp. Vaneechoutte. Vidal.C. M. a novel species that nodulates Prosopis alba in the Chaco Arido region (Argentina)’. N. nov. D. J. International Journal of Systematic Bacteriology. M. Falsen. vol 29. Léon-Barrios. Jarabo-Lorenzo. vol 59.. Systematic and Applied Microbiology. P. Velazquez. (2004) ‘Wautersia gen.. Silva. (2004) ‘Taxonomy of the genus Cupriavidus: A tale of lost and found’. pp317–327. Mahenthiralingam.. Nelis. F. Willems. nov. a metal-resistant symbiont of Anthyllis vulneraria growing on metallicolous soil in Languedoc.. Gillis... Berge. pp207–215. sp.. de Baere. A. y Verschraegen. International Journal of Systematic and Evolutionary Microbiology. O.)’. T... 1990) comb. Brunel. y Eardly. P. nov. J. nov. y Conye. Mauré. nov. International Journal of Systematic and Evolutionary Microbiology. E.

Liu.. a symbiont of Sesbania herbacea that has a close phylogenetic relationship with Rhizobium galegae’. International Journal of Systematic and Evolutionary Microbiology. (2003) ‘Characterization of rhizobia isolated from legume species within the genera Astragalus and Lespedeza grown in Loess Plateau region of China and description of Rhizobium loessense sp. H. y Chen. Sui. y MartínezRomero. E. (1998) ‘Rhizobium huautlense sp.. Chen.. P. Beyene. Bradyrhizobium genospecies a and Bradyrhizobium genospecies b’. T. pp29–54.. W. and Sinorhizobium kummerowieae sp.. E.H. M. y Chen. a Leucena leucocephala-associated bacterium that is highly resistant to multiple antibiotics’. B. X. Wang. Rinhold-Hurek.. Molecular Phylogenetics and Evolution. nov.. E. Tan. Sui. vol 49.Q. genistearum. pp569–575. T. International Journal of Systematic Bacteriology. Wei. D. International Journal of Systematic and Evolutionary Microbiology.. Z. M. vol 52.. Fernández-López.. Chen. M. International Journal of Systematic Bacteriology. E. G. and Kummerowia stipulacea’. a novel bacterium that nodulates Albizia kalkora in a subtropical region of China´.. D. (1999a) ‘Rhizobium etli bv. Dorado. nov’.. W. Wang. Silva. Han. Santos. P. Rogel-Hernández.’. H. W.. Wang. International Journal of Systematic Bacteriology. y Martínez-Romero. (2002) ‘Sinorhizobium morelense sp. (1999b) ‘Diversity of rhizobia associated with Amorpha fruticosa isolated from Chinese soils and description of Mesorhizobium amorphae sp. F. nov. A. T. X. T. E. Zhu. T. O. Q. Werner. E.. E. pp2231–2239. E. Sui. International Journal of Systematic and Evolutionary Microbiology. nov. (2002) ‘Rhizobium indigoferae sp.. mimosae. E. E. X. W. M. pp1687–1693. pp1192-1199. J. Z. D. Wei. vol 48..F. pp687–699. Wang. Chen. pp51–65. T.X. E. y Chen. vol 57. E... Tan. pp1575–1583 B acterias formadoras de nódulos en leguminosas 211 .. a novel biovar isolated from Mimosa affinis’. J. nov. (2005b) ‘Population genetics and phylogentic inference in bacterial molecular systematics: The roles of migration and recombination in Bradyrhizobium species cohesion and delineation’. nov. van Berkum.... pp1479–1491. Cevallos. Wang.. Willems. nov. A. International Journal of Systematic and Evolutionary Microbiology. Y. T.. Zhu. International Journal of Systematic Microbiology.. W. vol 55.. y MartínezRomero. A. Martínez-Romero. Wang. Wang. H.. G. van Berkum.. G. P. vol 53.. H. A. W. X. y Martínez-Romero.. vol 34. X. X.. E.. E. Beyene. E. C.(Papilionoideae:Genisteae) from Canary Islands.. y Martínez-Romero. Wang. S. Chen.. along with Bradyrhizobium japonicum bv. vol 49. Vinuesa. Wang.T. respectively isolated from Indigofera spp. vol 52. (2007)´Mesorhizobium albiziae sp. X. M. E...

in J. Wilson. (1988a) ‘Ecological indicators of native rhizobia in tropical soils’. I.. MartínezRomero. L. vol 28. Journal of Clinical Microbiology.. X. Singleton. nov. (1990) ‘Agroclimatology and modeling – overcoming the inflexibility of most-probable-number procedures’. Cui. P. R. Fernández-Lopez. L. (1988b) ‘Reliability of the most-probable technique for enumerating rhizobia in tropical soils’. Ingram (eds) Tropical Soil Biology and Fertility: A Handbook of Methods. Li. W. Ge. International Journal of Systematic Bacteriology. B. (2004) Renaming of Agrobacterium larrymoorei Bouzar and Jones 2001 as Rhizobium larrymoorei (Bouzar and Jones 2001) comb. Is the combination “Sinorhizobium adhaerens” (Casida 1982) Willems et al 2002 legitimate? Request for an opinion’. vol 54. (2003) ‘Description of new Ensifer strains from nodules and proposal transfer Ensifer adhaerens Cassida 1982 to Sinorhizobium as Sinorhizobium adhaerens comb. J.Willems. K. (2002) ‘Characterization of rhizobia that nodulate legume species within the genus Lespedeza and description of Bradyrhizobium yuanmigense sp. T. Request for an opinion’. Applied and Environmental Microbiology. (1990) ‘Amplification of bacterial 16S ribossomal DNA with polymerase chain reaction’. Wallingford. pp172–178... Woomer. Goris. pp706–711. nov. CAB International. Applied and Environmental Microbiology. International Journal of Systematic Bacteriology. W. (1993) ‘Most Probable Number Counts of Rhizobia in Soils’. nov. B. (1995) ‘Bradyrhizobium liaoningense sp. pp349–353. pp1494–1497. B. pp1112– 1116. International Journal of Systematic and Evolutionary Microbiology. Woomer.’. P. B. Yerson and J. Y. 212 Manual de biología de suelos tropicales . vol 82. S. vol 52. J. pp2107–2110. y Fan.. Yao. Bennet. H. H. M. (2003) ‘The genus name Ensifer Casida 1982 takes priority over Sinorhizobium Chen et al 1988 and Sinorhizobium morelense Wang et al 2002 is a junior synonym of Ensifer adhaerens Casida 1982. Woomer. Z. M. P. M. y Gillis. Z. M. y Bohlool.. C.. E. M. A. pp1207–1217. P.. P.. Kan. y Chen. M. vol 53. Wang.. R. W. Blitchngton. E. E. vol 54 pp149. pp2219–2230. P.. C. J. y Green. R. J. isolated from the root nodules of soybeans’. P. J. N. y Yost. y Bohlool. Woomer. Young... Toro.. F. pp1942–1946. B. Young. Xu. Muñoz-Adelantado. vol 54. vol 53. International Journal of Systematic and Evolutionary Microbiology.´ International Journal of Systematic Evolutionary Microbiology.. Singleton. nov.. Vos. vol 45. Agronomy Journal.

. W. A. R.. R. pp512-517.C. (2001) ‘A revision of Rhizobium Frank 1889. E. Zhang. E. E. Kerr..X.A. W. vol 61. rhizogenes. E. M. y Sawada. vitis’. E. J. Martínez-Molina. P. New Phytologist. J. H. 1998 as new combinations: Rhizobium radiobacter.. L. Palomares.. D. Wang. .. rubi. y Haukka. isolated from nodules of Cytisus scoparius in Spain´ International Journal of Systematic Evolutionary Microbiology. Y. X. M.F. (1996) ‘Diversity and phylogeny of rhizobia’. Vizcaíno. vol 51... pp784-788.T. (2011)´Rhizobium tubonense sp. A. R... Young J.. nov. P.J.. (2007)´Ochrobactrum cytisi sp. Kuykendall. y Velázquez. Hou.vol 133. isolated from root nodules of Oxytropis glabra´International Journal of Systematic Evolutionary Microbiology.. pp89–103. Zurdo-Piñeiro.E. Chamber. pp87–94. y Chen. undicola and R.. and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al.. K. International Journal of Systematic Evolutionary Microbiology. J. nov. Carrasco. B acterias formadoras de nódulos en leguminosas 213 . R. Rivas.. B. with an emended description of the genus. R.X. M. vol 57. Martínez-Romero.Young. Zhang. Li.L. N. Mateos. Trujillo..

7H2O (10%) (o 0. 0.1 gl–1) 100ml extracto de levadura (o polvo 0.2 N KOH.0 se reemplaza azul por Azul de Bromotimol por Verde de Bromocresol y se aumenta agar hasta 20 gl–1.75g Agar Autoclave a 120°C durante 15 minutos.4 gl–1) 2ml sol. K2HPO4 (10%) (o 0. 1928) (similar a medio YMA – Vincent.1 Composición de medio 79 para el crecimiento de Bfn Medio 79 (Fred y Waksman.1 gl–1) 4ml sol. MgSO4. 214 Manual de biología de suelos tropicales . Medio sólido: 15g Agar Medio semisólido: 1.4 gl–1) 5ml sol.0.5% azul de bromotimol en 0.APÉNDICE 6. para hacer 1000 ml con agua destilada pH 6. 1970): 10g manitol o sacarosa 1ml sol. NaCl (10%) (o 0.2 gl–1) 1ml sol. Cuando pH <5. KH2PO4 (10%) (o 0.8–7.

22 g CuSO4..........7 % o FeCl3 1% Solución de micronutrientes* Agua destilada (completar a) Volumen 10 ml 10 ml 10 ml 10 ml 10 ml 1 ml 1. Normalmente......... los controles absolutos..08 g Na2MoO4...2 Solución de nutrientes Jensen’s para el crecimiento de espe- cies de leguminosas en bolsas de plástico y jarras de Leonard Componentes K2HPO4 (2%) MgSO4... entonces la concentración puede aumentar o hacer una suplementación dividida. las concentraciones más altas (>0.... 0.000 ml pH = 6.. 2... H3BO3 ........APÉNDICE 6..7...09 g El mismo protocolo que para agar con semillitas.86 g MnSO4.H2O .. o entre 7 a 10 días después de plantar. 0.. es decir....... Diluir solución a 1:4....05% KN03 o NH4 NO3). por lo tanto. 0....5H2O .. También después se usa la solución con sirato en bolsas de plástico. diluida de la misma manera. los controles nitrogenados no presentan nódulos... Si al final del experimento esto resulta insuficiente para el crecimiento sostenido y el color verde de las plantas control.. pues las dosis elevadas inhiben la nodulacíon... Control Se proveen los controles con nitrógeno a una concentración final de aproximadamente 70 ppm N (0.4H2O . ajustar con KOH.. 2.7% KNO3) pueden ser tóxicas. Sin embargo.7H2O .. * Solución de micronutrientes (para 1 l de agua).....6H2O 1....7H2O (2%) NaCl (2%) CaHPO4(10%) FeCl3..... Esto puede añadirse a la solución de nutrientes al principio del experimento...03 g ZnSO4........ Vicent (1970) recomienda la mezcla para una solución de nutrientes.. sin inoculación del suelo B acterias formadoras de nódulos en leguminosas 215 ..

Otro control importante. es el uso de una cepa eficiente como un control positivo para la nodulación y la fijación de nitrógeno.son necesarios para comprobar las condiciones asépticas del experimento. no mencionado por Vincent. 216 Manual de biología de suelos tropicales . éstas deberán utilizarse. Si existe la disponibilidad de las cepas recomendadas.

patógenos de la raíz. 1990. sequía. En la mayoría de los suelos tropicales. provee una mayor superficie de absorción que los pelos radiculares y.Capítulo 7 Hongos micorrizógenos arbusculares (HMA) Joseph D. Bagyaraj y Sidney L. hortícola y forestal. cobre y zinc. dunas de arena. altas temperaturas. Stürmer INTRODUCCIÓN Actualmente. Los HMA han sido registrados en ecosistemas naturales como desiertos.. selvas tropicales. Además. En los trópicos. Bagyaraj and Varma. Bagyaraj. salinidad. se encuentra bien documentado que los hongos micorrizógenos arbusculares (HMA) mejoran la salud y el crecimiento de las plantas de importancia agrícola. 1991). aumenta significativamente la captación de iones relativamente inmóviles. 1995). La red de hifas producidas por los HMA en el suelo durante su asociación con la planta huésped. La conversión de estos dos ecosistemas en agro-ecosistemas ya sea para agricultura de subsistencia. esto limita el desarrollo de las plantas. producción de cultivos redituables o plantaciones forestales industriales provoca cambios en las características quí217 . por lo tanto. salinas y sistemas manejados como praderas. el fósforo disponible es muy bajo. la agricultura se practica en áreas previamente ocupadas por dos principales ecosistemas naturales ricos en especies vegetales: bosques tropicales y sabanas. tales como fosfato. pH desfavorable del suelo y al choque por trasplante que sufren las plantas no micorrizadas (Mosse et al. 1981. se ha demostrado que las plantas micorrizadas tienen mayor tolerancia a metales tóxicos. huertos y cultivos agrícolas (Brundrett.

1996) y también en desiertos (Stutz and Morton. usualmente. las medidas de diversidad taxonómica deberían estar acompañadas de algunas evaluaciones de la actividad de la comunidad micorrízica. estas determinaciones no detectan a las especies crípticas de HMA que no están esporulando en el momento del muestreo (pero que están asociadas con las plantas hospederas) e impiden la adecuada identificación de algunas especies. Aunque comúnmente no es reportado. en donde se detectaron 28 morfotipos de HMA con Glomus aggregatum y dos especies de Glomus no descritas. 218 Manual de biología de suelos tropicales . La medición de la diversidad taxonómica de HMA se ha hecho. pastizales (Bever et al. No obstante. 1979) y la determinación de las unidades de colonización (UC) (Franson y Benthlenfalvay..micas. La medición del porcentaje de colonización (PC) (Moorman y Reeves. La infectividad micorrízica se determina fácilmente por el método del número más probable (NMP) y puede servir para propósitos comparativos (Porter. La conversión de los ecosistemas naturales para distintos usos de suelo influye en la abundancia de esporas y composición de especies de HMA. a través de una cuenta directa y de la identificación de esporas recuperadas del campo. encontraron una riqueza similar de especies en la selva tropical seca y en praderas con dominio de una especie. por lo general. se siembran con una sola especie de la misma edad. (1992) encontraron que el número de esporas de HMA en una plantación de Terminalia ivoriensis en Camerún disminuyó notablemente después de tres meses de una desforestación. 1979). como los hongos dominantes. generalmente. 1989) son también adecuadas. Johnson y Wedin (1997). 1985). En estos sitios. especialmente de los géneros Glomus y Gigaspora. Las macetas trampa preparadas con suelo de campo han sido usadas exitosamente para detectar y recobrar especies crípticas durante estudios de diversidad en huertos de manzano en regiones templadas (Miller et al. Picone (2000) demostró que la densidad de esporas y la comunidad fúngica disponible para la formación de micorrizas eran relativamente similares entre praderas y bosque tropical lluvioso. sin embargo.. se eliminan muchas especies vegetales de todas las edades y. De igual forma. Jasper et al. Mason et al. 1996). (1987) observaron un descenso en el número de esporas y un cambio en la composición de especies después del disturbio en algunos lugares de Australia. Asimismo. También notaron un cambio en la composición de especies. físicas y biológicas del ambiente edáfico.

También incluyeron en el Nuevo esquema de clasificación tres nuevos órdenes y varias familias.. cuando se requieren comparaciones entre los sistemas de uso de suelo. Morton y Benny (1990) transfirieron todas las especies de HMA al orden Glomerales (División Zygomycota) con tres familias y seis géneros. colocando a este grupo de hongos en el mismo nivel que Basidiomycota y Ascomycota. Datos moleculares y morfológicos fueron usados para transferir a los miembros del género Sclerocystis a Glomus (Almeida y Schenck. 1990. El método del Número Más Probable se ha utilizado para estimar el número de propágulos infectivos de HMA en varios suelos. Aunque se han aplicado técnicas moleculares para aclarar la clasificación filogenética entre las especies de HMA. especialmente. la identificación de especies está basada principalmente en las características morfológicas de las esporas.. La formación de esporas en este género es similar a la de Glomus pero éste diferencia paredes germinales internas. se propone un esquema de clasificación para estudios de diversidad que surge de los esquemas de Morton y Benny (1990).1). Schüßler et al. (2001) (Tabla 7. Se basa en una serie de diluciones decimales H ongos micorrizógenos arbusculares 219 . con aquellos de Morton y Redecker (2001) y Schüßler et al. Redecker et al.. MÉTODOS PARA EVALUAR PROPÁGULOS INFECTIVOS DE HMA Y COLONIZACIÓN MICORRÍZICA Número más probable (NMP) El protocolo propuesto para estimar la diversidad de HMA (descrito en el Capítulo 2) es el mismo que se sigue para todos los microorganismos y no será discutido aquí. La taxonomía y clasificación de los hongos micorrizógenos han cambiado radicalmente en los últimos años. Por lo tanto. Recientemente. (2001). un género nuevo llamado Pacispora fue propuesto por Oehl y Sieverding (2004). Gerdemann y Trappe (1974) incluyeron todas las especies de HMA dentro del orden Endogonales en la familia Endogonaceae (División Zygomycota). 2001). (2001) transfirieron todas las especies de HMA a una nueva división monofilética: Glomeromycota. Este género es incluido en el orden Diversisporales en la filogenia molecular propuesta por Schüßler et al.TAXONOMÍA Y CLASIFICACIÓN DE HMA Debe establecerse un esquema taxonómico antes de cualquier estudio de diversidad. 2000) y para erigir dos nuevos géneros en dos familias distintas (Morton and Redecker.

Germinación a través del lumen de la hifa de sostén o a través de la pared de la espora. arbúsculos. Se presentan especies dimórficas formando esporas acaulosporoides y glomoides. Esporas con la pared esporal formada por dos capas. Familia Acaulosporaceae Morton y Benny Acaulospora Gerd. La pared germinal más interna tiene una superficie con excrecencias. No se observan paredes germinales diferenciadas. en agregados laxos o en esporocarpos. Vesículas. La micorriza se tiñe muy obscuro. conectada a una hifa ramificada. flexible. Scharzott y Walker Orden Glomerales Morton y Benny Suborden Glomineae Morton y Benny Familia Glomeraceae Pirozysnki y Dalpé Glomus Tulasne y Tulasne (85 especies) Esporas formadas blásticamente sobre una hifa de sostén. Familia Archaeosporaceae Morton y Redecker Archaeospora Morton y Redecker (una especie) Esporas formadas terminalmente de una hifa de sostén o como una ramificación de una estructura que semeja un sáculo esporífero. Otras estructuras subcelulares de la espora y germinación idéntica a la de Acaulospora. solitarias. Hifas intrarradicales rectas o enrolladas cerca de los puntos de entrada. plana. 220 Manual de biología de suelos tropicales . Las vesículas varían en forma con protuberancias y concavidades. La pared de la espora esta formada por tres o cuatro capas y no se forma una verdadera bicapa germina. Hifas intrarradicales raramente enrolladas. hifas intrarradicales y micorriza se tiñen como en Acaulospora. Vesículas de pared delgada y elipsoides. Las vesículas y células auxiliares no están diferenciadas. Los arbúsculos e hifas intrarradicales se tiñen débilmente.Tabla 7. Esporas con la pared esporal formada por un número variable de capas todas originadas a partir de la hifa de sostén.1 Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales. Germinación a través de una estructura de germinación esférica. Entrophospora Ames y Schneider (cinco especies) Esporas formadas dentro de un cuello de un sáculo esporífero el cual deja dos cicatrices sobre la superficie de la espora. Arbúsculos con troncos aplanados o cilindricos adelgazándose sucesivamente en las ramificaciones. y Trappe emend. La micorriza se tiñe débilmente. División Glomeromycota Schüßler. Berch (31 especies) Esporas formadas a los lados del cuello de un sáculo esporífero el cual deja una cicatriz en la superficie de la espora.

Esporos glomoides de forma aislada en el suelo o agregados en racimos. se diferencia una capa delgada con verrugas esparcidas y crece un tubo germinativo a través de la pared esporal. Vestberg & Schüßler (ocho especies) Especies generalmente dimórficas con asociaciones micorrizicas produciendo morfotipos acaulosporoide y glomoides. y Trappe (cinco especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. La segunda capa de la pared germinal generalmente reacciona con el reactivo de Melzer. especialmente. No se forman vesículas. Suborden Gigasporineae Morton y Benny Familia Gigasporaceae Morton y Benny Gigaspora Gerd.1 Continúa Familia Ambisporaceae Walter. Las vesículas y células auxiliares no están diferenciadas. Los arbúsculos y las hifas intrarradicales se tiñen débilmente. Blaszkowski. Familia Pacisporaceae Walker. Arbúsculos con troncos hinchados angostándose abruptamente en las ramificaciones. Esporos acaulosporoide formado un apéndice hifal emergiendo lateralmente del cuello de un sáculo esporífero. células auxiliares finamente papiladas o equinuladas. y germinan atreves de hifa suspensora. Las paredes de la hifa de sostén son continuas con la primera y segunda capa de la pared esporal. no se diferencian paredes germinales. Pared de la espora generalmente formada por tres capas distintas y la pared germinal compuesta también por tres capas. Las estructuras subcelulares de la espora y la germinación como en Glomus. cerca de los puntos de entrada.Tabla 7. Arbúsculos e hifas intrarradicales similares en morfología a las de H ongos micorrizógenos arbusculares 221 . Esporas con la pared esporal formada por dos capas permanentes. Scutellospora Walker y Sanders (30 especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. Hifas intrarradicales frecuentemente enrolladas. Schüßler y Schwarzott Pacispora Sieverding y Oehl (siete species) Esporas formadas terminalmente de una hifa de sostén (como en Glomus). Al germinar. Vesículas y arbúsculos las raíces teñidas en azul franco con azul tripano. Vestberg & Schüßler Ambispora Walter. No se forman vesículas. Familia Paraglomeraceae Morton and Redecker Paraglomus Morton y Redecker (dos especies) Esporas formadas terminalmente de una hifa de sostén como en Glomus. a menudo nodosas o con proyecciones. células auxiliaries que van de casi lisas a nodosas. Germinación de la espora directamente de la pared germinal a través de la pared de la espora.

1 Continúa Gigaspora. 2006 y http://invam.. La ventaja es que. que se diferencia sobre la superficie de la última pared germinal. Oehl y Sieverding. pero el número calculado tiene hasta un 95 por ciento del nivel de confianza (Adelman y Morton. se pueden utilizar gramíneas C4. Si no contamos con semillas de cebolla. Esporas con una pared formada por dos capas permanentes y de una a tres paredes germinales internas.edu. de suelo en donde la presencia o ausencia de colonización micorrízica se registra y da como resultado el número más probable de propágulos infectivos. Materiales necesarios • • • • tubetes para plantas (150 X 2. y puede llevarse a cabo por cualquiera que esté familiarizado con la morfología de la micorriza. 1986).5 cm) y gradillas bolsas de plástico (30 X 20 cm) diluyente esterilizado (arena: mezcla de suelo 1:1) semillas de cebolla.caf. 2004. La planta hospedera recomendada para el ensayo del NMP es la cebolla. se puede utilizar cualquier otro hospedero. 222 Manual de biología de suelos tropicales . Fuente: compilado de Morton y Benny.Tabla 7. el análisis de las raíces de las plantas trampa para comprobar la colonización es fácil y rápido. el método es apropiado para comparaciones entre sistemas con diferente uso del suelo si los ensayos del NMP se establecen de forma simultánea. Como el resultado es un solo número. Spain et al. si tiene cierta dependencia micorrízica. Una de las desventajas de esta prueba es que se requiere mucho tiempo para la preparación del bioensayo. Sin embargo. 1990.wvu. basándose en una tabla estadística. ya que es dependiente de la micorriza y las raíces son fáciles de teñir. cada una con dos capas. como el sorgo y el Paspalum. El tubo de germinación crece a partir de un escudo flexible plano.

5. Agitar bien para obtener una dilución 10-1. Bajo un microscopio de disección. 7. Los otros dos números (N2 y N3) son los correspondientes a las próximas dos diluciones. tres réplicas fueron positivas en la dilución 10-3 y dos réplicas fueron positivas en la dilución 10-4. se ilustra con el siguiente ejemplo. 10-3 y 10-4). hacer cinco replicas por cada dilución. considerando las cinco réplicas (tubetes) para cada una de los cuatro diluciones (10-1. 2. El número de tubetes positivos (los que contienen colonización) en diluciones diferentes se utilizan para calcular los valores de NMP. Para el cálculo del NMP.Procedimiento 1. 5. El primer número (N1) corresponde al número de tubetes positivos para la colonización micorrízica en la dilución que muestra el mayor número de tubetes positivos (se toma la serie menos concentrada. En este ejemplo. sólo tres números de una secuencia dada son necesarios. Retirar 30 g de la dilución anterior y colocarlo en otra bolsa que contiene 270 g del diluyente estéril. Distribuir el suelo de cada dilución en los tubetes para plantas. 3. 10-2. hacer más diluciones decimales hasta la dilución 10-4 (o más. 6. Utilice las tablas de Cochran (1950). lavar el suelo de las raíces y teñirlas con azul de tripán (véase más abajo). si no se dispone de las semillas de cebolla puede utilizar cualquier otro hospedero (ver arriba). 3. dejar una sola planta por tubete y dejarlas crecer en un invernadero o en una cámara de crecimiento durante seis semanas. N2 = 3 y N3 = 2. 2. Al cosechar. la combinación sería: N1 = 5. Pesar 30 g de suelo de campo en una bolsa de plástico y añadirle 270 g del diluyente esterilizado. El procedimiento para el cálculo del NMP. Agitar bien para obtener una dilución decimal. se obtiene la siguiente secuencia de números de tubetes positivos: 5. Después de emerger. Supongamos que. Esto significa que las cinco réplicas fueron positivas para la colonización micorrízica en las diluciones 10-1 y 10-2. 4. si el número de tubetes positivos es el mismo en diluciones posteriores). determinar la presencia o ausencia de colonización micorrízica en cada réplica. Sembrar las semillas de cebolla en cada tubete. de Fisher y Yates (1963) o Alexander (1965). H ongos micorrizógenos arbusculares 223 . si es necesario).

30 ml de H2O2 al 3%. Por lo tanto.Usando la tabla del NMP el valor dado para esta combinación de tubetes positivos es 1. Teniendo en cuenta el costo de los productos químicos y el ahorro al reducir el número de productos químicos sin interferir con la calidad de la tinción.4.4 X 10-3 propágulos infectivos g–1. Kormanik y McGraw (1982) eliminan el fenol en las soluciones para tinción y decoloración. Tinción de raíces para observar la colonización micorrízica La colonización de las células corticales de la raíz por HMA. Procedimiento 1. Materiales necesarios • solución de KOH al 10% (hidróxido de potasio) • solución de HCl al 1% (ácido clorhídrico) • solución acidificada de glicerol. el suelo tiene 1. se propone para la tinción de raíces el método de Philips y Hayman (1970) modificado por Koske y Gemma (1989). no altera la morfología de la raíz. 50 ml de de HCl al 1%) • azul de tripano 0. las raíces son sometidas a un procedimiento de clareo y tinción. mientras que Koske y Gemma (1989) modificaron el procedimiento mediante la eliminación de ácido láctico de estas soluciones sin interferir con la intensidad de la tinción.5 g/l) • H2O2 alcalinizada (3 ml NH4OH al 20%. en contraste con las asociaciones ectomicorrízicas. Por lo tanto. 567ml de agua). Para obtener el NMP de propágulos infectivos de HMA en la muestra. El método más ampliamente utilizado es el descrito por Philips y Hayman (1970). Lavar las raíces para eliminar residuos de suelo y enjuagar con varios cambios de agua. 2. 450 ml de H2O. para detectar y medir la colonización micorrízica. este valor debe de ser multiplicado por la dilución media. (500 ml de glicerol.05 % en solución de glicerol (0. Sumergir las raíces en KOH a 90°C por una hora o a 120°C por 15 minutos en autoclave. 224 Manual de biología de suelos tropicales . (en este caso 10-3).

4. 40ml de glicerol y 40 ml de agua destilada). Para los pasos 2 y 7. Elimine el HCl. 7. Tiña las raíces en una solución de glicerol ácido con azul de tripano a 90°C por una hora o a 120 °C por cinco minutos.01%. 6. Esta medida estima el crecimiento de un aislamiento de un hongo o de una comunidad fúngica dentro de la corteza de la raíz. crecidas bajo condiciones del invernadero. la solución de agua oxigenada alcalinizada debe de prepararse justo antes de su uso. H ongos micorrizógenos arbusculares 225 . El método de intersección de cuadrante (Giovannetti y Mosse. es usado comúnmente para medir la longitud de la raíz y el porcentaje de la colonización micorrízica.3. El paso 4 puede ser omitido si las raíces no están muy pigmentadas. Enjuagar nuevamente las raíces con agua. Si las raíces están demasiado pigmentadas se deben sumergir en agua oxigenada alcalinizada durante 10-30 minutos.1 cm. 1980) que se presenta a continuación. Sumerga las raíces en HCL al 1% por cinco minutos. 5. Para almacenar por un tiempo largo. la solución de glicerol acidificada puede ser reemplazada por una solución de lactoglicerol (20 ml de ácido láctico.1 x 1. Descargue la solución colorante y mantenga las raíces en glicerol acidificado (sin azul de tripano) o agua a temperatura ambiente o 4°C. Comentarios: si lo desea. Eliminar el KOH y enjuagar las raíces con agua (dos o tres veces) para quitar el exceso de KOH. 8. un baño de agua a 90°C es apropiado para mantener las muestras. las raíces pueden guardarse en agua adicionada con unas gotas de azida de sodio al 0. Material necesario • Cajas de Petri cuadriculadas en la base con cuadrados de 1. • Agujas de disección. No enjuague las raíces en esta paso ya que éstas deben estar acidificadas para una tinción adecuada. Medición de la colonización micorrízica La determinación de la colonización micorrízica de la raíz. se realiza con frecuencia en raíces colectadas de campo (sacadas directamente del suelo o de plantas individuales) o en plantas experimentales.

En una caja de Petri extienda al azar las raíces teñidas.. Registre: a) el número total de intersecciones de las raíces y las líneas de la cuadricula y b) el número de intersecciones con raíces micorrizadas. De esta manera. 3. La morfología del micelio interno y externo durante la asociación micorrízica es prácticamente indistinguible entre las especies del mismo género y entre géneros. 1963).caf. representan la longitud total de la raíz en cm. Es posible calcular la longitud total de la raíz y la longitud de la raíz micorrízada de la planta completa. En contraste. 2.Procedimiento 1.edu/ methods/mycorrhizae/rootlengths. seguido por centrifugación en un gradiente de sacarosa.1 cm.htm. el número total de raíces que interceptan las líneas de la cuadricula. Para más detalles ver http://invam. las estructuras subcelulares de las esporas están altamente conservadas y son fenotípicamente estables independientemente del ambiente y la planta huésped (Morton et al. Calcule el porcentaje de colonización micorrízica (% CM) utilizando la siguiente fórmula: % CM = (Número total de intersecciones con raíces micorrizadas/ Número total de intersecciones entre la raíz y las líneas de la cuadrícula) X 100. el total de la longitud de la raíz micorrizada será el número de intersecciones. Las esporas se extraen del suelo mediante un tamizado húmedo (Gerdemann y Nicolson. 226 Manual de biología de suelos tropicales .wvu. usando la relación entre el peso seco de la planta y la submuestra. 4. Si se toma una muestra pequeña de toda la raíz. Bajo el microscopio de disección explore las líneas horizontales y verticales de la cuadrícula. 1995). con estructuras micorrízicas. las esporas son la única parte del organismo del hongo que puede utilizarse para delimitar las especies. Por lo tanto. Métodos para evaluar la diversidad de HMA Extracción de esporas del campo La Identificación de las especies de HMA está basada en el análisis de estructuras subcelulares de las esporas asexuales. Comentarios: los datos obtenidos en el paso 3. también se pueden utilizar para determinar las longitudes tanto de la raíz completa como de la raíz micorrizada. se teñirá y se medirá en el microscopio con este método. Si toda la raíz se extiende en la caja de Petri. con las líneas de la cuadricula separadas en 1.

cajas de Petri.Figura 7. después de expander las raíces. el largo de la raíz = 43 cm (25 + 18) y el largo de la raíz micorrizada=12 cm (Seis intersecciones positivas sobre líneas horizontales y seis intersecciones positivas sobre líneas verticales). • Tubos para centrífuga y centrífuga.9%. • Cubeta de plástico o un vaso de precipitados grande. En el diagrama las infecciones de micorrizas son representadas con puntos negros. H ongos micorrizógenos arbusculares 227 .1 provee una ilustración del método de intersección de línea. vidrio de reloj. Figura 7. Nota. Ejemplo. el numero de intersecciones entre una raíz y las líneas horizontales y verticales tendríamos: • 25 intersecciones (Línea horizontal) • 18 intersecciones (Línea vertical) y • 12 intersecciones (Puntos negros) presentando colonización micorrizica. • Por lo tanto. Materiales necesarios • Un juego de tamices anidados que tengan al menos 710 µm y 45 µm de abertura de malla. • El porcentaje de colonización micorrízica= (12/43) x 100=27. • Soluciones de sacarosa (20 % y 60%).1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. • Vasos de precipitados.

500 ml de agua.000 rpm durante 60 segundos. Las esporas pueden separarse de los residuos orgánicos y recogerse de la caja de Petri usando unas pinzas finas o una pipeta Pasteur adelgazada en la punta. ya que el tamaño de las esporas de HMA para la mayoría de las especies está en un intervalo de 40 a 600 μm. se pueden anidar otros tamices entre los dos recomendados. en el fondo. las esporas se pueden separar por morfotipos de acuerdo con su color y tamaño y si las esporas están en buen estado se pueden identificar hasta género y especie.Procedimiento 1. 1979) para dispersar las partículas de arcilla y liberar las aberturas del tamiz. 6. Coloque el material retenido en el tamiz de 710 µm en una caja de Petri grande y observe bajo el microscopio de disección para observar esporas grandes (esporas de Gigaspora y Scutellospora) y esporocarpos. Los suelos con alto contenido de arcilla pueden obstruir los tamices. Esto separa a las esporas por tamaños pero incrementa la cantidad de trabajo ya que el material retenido en cada tamiz debe centrifugarse por separado. Agitar hasta que las esporas queden suspendidas y dejar reposar 30 segundos . Los tamices recomendados (con mallas de 710 µm y 45 µm) son adecuados para recuperar la mayoría de especies. Vacíe el sobrenadante en el tamiz de 45 µm y lave con agua corriente para quitar el exceso de sacarosa. Comentarios: en el paso 3. 4. 228 Manual de biología de suelos tropicales .1M (Fogel y Hunt. Transferir las esporas y el material retenido en el tamiz 45 µm a una caja de Petri y bajo el microscopio colecte las esporas en un vidrio de reloj limpio. 7. agregue otros 15 ml de la solución al 60% . es preferible vaciar la suspensión de suelo a través de un tamiz de 1 mm antes de pasar por el tamiz de 710 μm. se puede agregar una pequeña cantidad de pirofosfato de sodio a 0. después transfiera este material a un tubo de centrífuga que contenga un gradiente de sacarosa de 20–60%. 5. 8. Pasar la suspensión repetidamente a través de dos tamices anidados con abertura de malla de 710 µm y 45 µm. Colocar 100 g de la muestra de suelo en la cubeta /vaso de precipitados y suspender en. Para preparar el gradiente de la sacarosa. si hay demasiados pedazos de raíz y otros desechos. 2. En este momento. comprada en el supermercado. Sin embargo. 3. al menos. Coloque el material retenido en el tamiz de 45 µm en una vaso de precipitados con una pequeña cantidad de agua. Centrifugue a 2. La solución de sacarosa se hace con azúcar comercial. agregue 15 ml de la solución de sacarosa al 20% en un tubo de centrífuga de 50 ml y después.

Identificación de especies y montaje de preparaciones En la mayoría de los casos. Janusz Blaszkowski (Department of Plant Pathology of the Agricultural University of Szczecin. West Virginia University. a la vez que Bentivenga y Morton (1995) proponen una clave para identificar las cinco especies de Gigaspora.. b) espora de Scutellospora scutata con la hifa de sostén bulbosa (note el escudo de germinación redondo. de 160 especies de HMA descritas en total. en estos sitios web se describen 79 y 55 especies respectivamente. y h). falta de buenas fotografías para las comparaciones y las descripciones están hechas con esporas extraídas del suelo de campo por lo cual pueden no incluir características taxonómicas importantes). 3 y 4 se proporcionan los nombres de las especies y los autores. 1990) y comparando con las descripciones e ilustraciones de las especies proporcionadas por el Dr. W. Koske y Walker (1985) proponen una clave para algunas especies de Scutellospora con esporas con paredes ornamentadas.szczecin. c) un detalle de la ornamentación de H ongos micorrizógenos arbusculares 229 .V. café. Joseph Morton en la INVAM (Colección Internacional de hongos micorrizógenos arbusculares. La ilustración 4 muestra las esporas y las estructuras producidas por las especies de la familia Gigasporaceae (fotografías a. este manual incorpora en un solo volumen toda la descripción de las especies hasta 1990. c y d) y Acaulosporaceae (e. b.caf. La fotografia a) muestran una espora de Gigaspora albida con la hifa de sostén bulbosa típica de esta familia. usando como referencia al Manual para la identificación de HMA (Schenck y Pérez. las esporas extraídas del campo no son identificables bajo el microscopio de disección. Algunas claves de identificación para HMA (por ejemplo Hall y Fish. El manual de Schenck y Pérez es una copia de las descripciones originales de las especies y por lo tanto. Sin embargo. el tamaño de las esporas y una descripción estandarizada de las especies de HMA.wvu. la INVAM y el sitio de Blaszkowski poseen excelentes fotografías con detalles de la estructura subcelular de las esporas.ar.edu) y por Dr.agro. g. 1979. Por otro lado. La identificación de especies de HMA se puede hacer por comparación con la descripción original de la especie. En los anexos 1.pl/~jblaszkowski. alberga todos los problemas inherentes a esas descripciones (falta de estandarización de las estructuras subcelulares de las esporas. Fotografías de esporas de especies representativas de diferentes géneros se muestran en las ilustraciones 4 y 5. f. Poland) en http://www. USA) sitio web (http://invam. 1982) se publicaron antes de algunas revisiones de taxonomía recientes e importantes. Trappe. contrastando con el color hialino de las esporas). y por consiguiente. 2. deben ser montadas en portaobjetos y observadas en un microscopio compuesto.

c. la foto g) ejemplifica la estructura de la pared formada por tres capas (L1. La foto e) muestra un espora de Archaeospora leptoticha con el sáculo esporífero. la pared germinal 1 (gw1) y la pared germinal 2 (gw2) con su capa más interna reaccionando al reactivo de Melzer. En la foto e) se muestra una espora de Entrophospora colombiana (familia Acaulosporaceae) con la pared de la espora. b. esporas de Acaulospora sp. La foto b) muestra la pared de la hifa de sostén continua con la pared de la espora de un Glomus sp. forma. y d) células auxiliares nodosas que diferencian a los miembros de Scutellospora. finalmente. d).la pared de las esporas (verrugas) de Scutellospora coralloidea. cubreobjetos y etiquetas • Agujas de disección 230 Manual de biología de suelos tropicales . Las características taxonómicas importantes que pueden observarse bajo el microscopio de disección son tamaño de las esporas. Un esporocarpo de Glomus clavispora se observa en la foto c) y un esporocarpo de Glomus sp. L2 y L3) (la capa L2 está ornamentada con pequeñas crestas). mostrando algunos sáculos esporíferos adheridos a las esporas. En el microscopio compuesto pueden observarse algunas características taxonómicas importantes como son la presencia y tipo de ornamentación sobre la pared de la espora. La ilustración 6 muestra a las esporas y estructuras producidas por especies de la familia Glomeraceae (a. Materiales necesarios • Portaobjetos. Una espora de Entrophospora colombiana mostrando las dos cicatrices características se ve en la foto f). número de paredes germinales y grosor de la pared de la espora. presencia de hifa de sostén. Las esporas necesitan montarse en líquidos de montar permanentes como son el PVLG (alcohol polivínilico lactoglicerol) y PVLG mezclado con reactivo de Melzer. también con la pared formada por tres capas (L1. L2 y L3) de Paraglomus occultum y en la foto h) se muestra una espora de Paraglomus brasilianum. de células suspensoras y del sáculo esporífero (raramente observado en esporas recolectadas directamente del campo). en la foto h). se observan. La fotografía g) representa una espora de Acaulospora scrobiculata que muestra la cicatriz que queda en la espora después de que el sáculo esporifero se desprende. color. Archaeosporaceae (e y f) y Paraglomeraceae (g y h). en la foto d). Foto a): espora de Glomus clarum indicando la hifa de sostén (note que la capa más interna de la pared de la espora se desprende y se ve parecida a la pared germinal. la foto f) muestra un detalle de Archaeospora leptoticha en donde se observan protuberancias y depresiones de las capas 2 y 3 de la pared esporal (indicada con flechas). reacción al Melzer.

Comentarios: el paso 2 es crucial para el montaje de las esporas sobre el portaobjetos. Mezclar el reactivo de Melzer con el PVLG (1:1) para preparar la solución de PVLG + Melzer. H ongos micorrizógenos arbusculares 231 . 7. tenga cuidado de no agregar demasiada agua). y fecha. En un porta objetos. mezcle las esporas en la solución de PVLG y de PVLG + Solución de Melzer y deje secar la superficie de la gota por lo menos cinco minutos. 100 ml de ácido láctico. Además. El método propuesto se basa en los protocolos de Stutz y Morton (1996). ofrecen esporas nuevas y saludables que pueden ser utilizadas para establecer cultivos puros de HMA. Con una aguja de disección. rompa cada espora individualmente bajo el microscopio de disección. colocar una gota de PVLG y una gota de la solución de PVLG + Melzer. 5. durante dos días para endurecer el medio de montaje. Procedimiento 1.• Solución de PVLG (100 ml de agua destilada. Usando una aguja de disección. 1. 6. 100 ml de agua destilada. Guardar las preparaciones a temperatura ambiente durante cinco días y luego incubar a 40-60ºC.5 g Iodo. Coloque suavemente un cubre objeto sobre la gota de PVLG y otro cubreobjetos sobre la gota de PVLG + Solución de Melzer. Establecimiento de cultivos trampa Los cultivos trampa se utilizan con más frecuencia en estudios de diversidad de HMA porque revelan las especies que no están esporulando en el campo. género y especie (si se conoce). Colocar las esporas al centro de cada gota usando un pinza fina o una micropipeta (en este caso. Etiquetar las preparaciones incluyendo número de muestra. las esporas se deslizan hasta los bordes cuando se coloca el cubreobjetos en la parte superior de cada gota. 5 g de yoduro de potasio. 16. 3. 10 ml de glicerol. 2. 4. Este paso es importante para exponer las paredes germinales y sus capas. si se agrega demasiada agua. en el momento del muestreo.6 g de alcohol polivínilico (PVA) • Reactivo de Melzer (100 g de hidrato de cloral.

18. (1990) ‘A Revision of the Genus Sclerocystis (Glomaceae. vol. in A. pp. Bever et al. Alexander. N. Glomales)’. bajo condiciones del invernadero. Se recomienda cualquier gramínea C4 y/o leguminosa como hospederas. otras plantas hospederas pueden utilizarse. M. pp. Almeida. Madison. (1965) ‘Most-Probable-Number Method for Microbial Populations’. B.5 kg y sembrar abundantemente con una mezcla de semillas de sorgo y frijol (40-50 semillas por maceta). 232 Manual de biología de suelos tropicales . En el paso 2. 3. 703–714. durante el muestreo de suelo de campo. J. se incluyan las raíces de las plantas ya que también sirven como propágulos para iniciar los cultivos trampa. REFERENCIAS Adelman. Part 2: Chemical and Microbiological Methods. J. Después de tres a cuatro meses.5 kg Bandejas o bolsas de plástico Semillas de Sorghum sudanense (Sorgo) y Vigna unguiculata (Frijol) Procedimiento 1 En una bandeja de plástico (o en una bolsa de plástico).Materiales necesarios • • • • Arena estéril Macetas de plástico de 1. Soil ScienceSociety of America.Soil Biology and Biochemistry. 82. colecte uno o dos núcleos de suelo de 50 ml de cada maceta. donde las plantas intactas colectadas del campo se trasplantan a una maceta con un sustrato libre de HMA y se evalúa la esporulación después de tres a cuatro meses. si el sorgo y frijol no están disponibles. y Schenck. 7–13. Cubrir las semillas con la mezcla de suelo y arena. según lo explicado arriba. llamado “cultivos trampa de trasplante”. 2 Colocar esta mezcla en macetas de plástico de 1. Comentarios: es importante que. Wisconsin. (1996) utilizan un procedimiento diferente para establecer cultivos trampa. y Morton. T. T. extraer las esporas e identificarlas. R. 1467–1472. vol. (1986) ‘Infectivity of vesicular-arbuscular mycorrhizal fungi: Influence of host-soil diluent combinations on MPN estimates and percentage colonization’. M. Klute (ed) Methods of Soil Analysis. Mycologia. homogeneizar el suelo de campo con arena estéril (50% de suelo de campo y 50% de arena). pp .

J. vol. J. vol. Jasper. D. Transactions of the British mycological Society. 75–78. (1963) ‘Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting’. J. pp. Canadian Journal of Forest Research. Gerdemann. J. y Morton. C. pp. pp. Giovannetti. pp. vol. K. Knudsen (eds) Handbook of Applied Mycology: Soil and Plants. vol. pp. M. K. R. D. (1987) ‘The effect of surface mining on the infectivity of vesicular-arbuscular mycorrhizal fungi’. A. S. 119–142. A. 84. 46. y Mosse. Soil Science Society of America Journal. 754–756. vol. J. 245–256. Advances in Microbial Ecology. G. vol. B. (1974) ‘Endogonaceae in the Pacific Northwest’. Gerdemann. 261–270. Mycologia Memoir. D. Journal of Ecology. (1991) ‘Mycorrhizas in natural ecosystems’. J. (1979) ‘Fungal and arboreal biomass in a Western Oregon Douglas-fir ecosystem: Distribution pattern and turnover’. H ongos micorrizógenos arbusculares 233 . pp. Biometrics. P. Advances in Ecological Research. Mukerjii and G. R. y Fish. (1990) ‘Ecology of vesicular-arbuscular mycorrhizae’. Transactions of the British Mycological Society. Hall. R. 87. 84. New Phytologist. pp. G. (1995) ‘Interaction between arbuscular mycorrhizal fungi and plants: Their importance in sustainable agriculture and in arid and semiarid tropics’. M. 235–244. Agricultural and Medical Research. Cochran. (1950) ‘Present status of biometry’. W. vol. G. A. A. pp. pp. 171–213. vol. New York. D. y Nicolson. A. 73. y Abbott. L. (eds) (1963) Statistical Tables for Biological. 14. 720–732. H. Rai. Morton J. 35. y Yates. M. Antonovics. Mycol ogi a. W. y Trappe. (1980) ‘An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots’. B. 53. (1979) ‘A key to the Endogonaceae’. R. vol. Brundrett.Bagyaraj. 6. y Bethlenfalvay. Fogel. T. Oliver and Boyd. B. (1989) ‘Infection unit method of vesicular-arbuscular mycorrhizal propagule determination’. G. 489– 500. 21. 9.. pp. Bentivenga. Marcel Dekker Inc. L. 641–652. vol. Fisher. Edinburgh. vol. 1–76. (1995) ‘A monograph of the genus Gigaspora. Bever. 71–82. I. Arora. K. J.. Robson. J. J. pp. (1996) ‘Host-dependent sporulation and species diversity of arbuscular mycorrhizal fungi in a mown grassland’. R. D. in D. Franson.. y Schultz. vol.. Australian Journal of Botany. incorporating developmental patterns of morphological characters’. y Varma. P. pp . Bagyaraj. F. 5. J. W. B. y Hunt.

pp. R. D. with two new genera Archaeospora and Paraglomus. 1). N. J. vol. Koske. 78. T. y Wedin. O. J. G. Paul. Mycotaxon. Glomales. y Gemma. (1989) ‘A modified procedure for staining roots to detect VA mycorrhizas’. American Journal of Botany. 471–491. D. D. 702–720. y Benny. P. pp. Stribley. pp. Acaulosporaceae and Gigasporaceae. and two new families. M. Morton. a new vesicular-arbuscular mycorrhizal fungal genus in the Glomeromycetes’. pp. E. J. II: A bioassay to determine the effect of land disturbance on endomycorrhizal populations’. Zygomycetes)’. y Reeves. Transactions of the British mycological Society. Philips. C. in N.Johnson. A. M. (1985) ‘Species of Gigaspora (Endogonaceae) with roughened outer walls’. J. 14–18. with an emendation of Glomaceae’. F. S25–S32. pp. American Phytopathological Society. P. vol. Read. S. 55. Musoko. C. A. Bentivenga. P. (2004) ‘Pacispora. pp. Lewis. P. pp. 379–391. New Phytologist. 7. Schenck (ed) Methods and Principles of Mycorrhizal Research. vol. Koske. Advances in Microbial Ecology. pp. pp. Mason. 486–505. y Bever. 92. vol. Fitter and I. C. 66. (1979) ‘The role of endomycorrhizae in revegetation practices in the semi-arid West. Ecological Applications. (1992) ‘Short-term changes in vesicular-arbuscular mycorrhizal spore populations in Terminalia plantations in Cameroon’. A. H. T. P. 93.. vol. A. 137–210. based on concordant molecular and morphological characters’. D. Mycological Research. Kormanik. in D. Canadian Journal of Botany.. CAB International Wallingford. (1997) ‘Soil carbon. vol.. Archaeosporaceae and Paraglomaceae. 234 Manual de biología de suelos tropicales . Mycologia. D. B. (1985) ‘Mycorrhizal fungi at eighteen apple rootstocks plantings in the United States’. B. H. D. E. 37. C. 171–182. Oehl. Moorman.. Mycologia. (1981) ‘Ecology of mycorrhizae and mycorrhizal fungi’. 261–267. 72–82. Miller. S. vol. J. 73 (suppl. 100. pp. (1982) ‘Quantification of vesicular-arbuscular mycorrhizae in plant roots’. y Hayman. B. pp. J. 158–161. y Redecker. Mosse. F. L. y Walker. Glomineae and Gigasporineae. (1995) ‘Discovery. vol. y Sieverding E. 77. measurement. J. Domoto. (2001) ‘Two new families of Glomales. vol. Alexander (eds) Mycorrhizas in Ecosystems. y Le Tacon. C. nutrients and mycorrhizae during conversion of dry tropical forest to grassland’. vol. R. vol. 181–195 Morton. (1990) ‘Revised classification of arbuscular mycorrhizal fungi (Zygomycetes): A new order. 5. F. Morton. y Last. B. pp. y McGraw. N. St. D. E. J. P. (1970) ‘Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection’. B. and interpretation of diversity in arbuscular endomycorrhizal fungi (Glomales. Journal of Applied Botany. two new suborders. y Walker. A. D.

(2000) ‘Molecular phylogeny of the arbuscular mycorrhizal fungi Glomus sinuosum and Sclerocystis coremioides’. vol. 1102–1108. y Oehl. Canadian Journal of Botany. Biotropica. pp. C. D. with a discussion of the genus Archaeospora. J. y Pérez. Stutz. J. (1982) ‘Synoptic key to the genera and species of Zygomycetous mycorrhizal fungi’. 17. Mycologia.. (1979) ‘Most Probable Number method for enumerating infective propagules of vesicular arbuscular mycorrhizal fungi in soil’. 32.Picone. M. E. W. Sieverding. 74. USA. A. Redecker. 1413–1421. y Walker. pp515–519. Spain. D. Trappe. Morton. Phytopathology. Schwarzott. B. Mycological Research. pp. 282–285. C. 2006. y Bruns. y Morton. Y. M. 163-182. vol. Appendicispora: a new genius in the arbuscular micorrhiza-forming Glomeromycetes. 3rd Edition. pp. 734–750.L. C. 92. C. 1883–1889. B.. the Glomeromycota: Phylogeny and evolution’. 72. Schübler. Mycotaxon vol 97. J. N. Schenck. pp. vol. pp. vol. D. vol. F. vol. (1990) Manual for Identification of VA Mycorrhizal Fungi. H ongos micorrizógenos arbusculares 235 . T. (2000) ‘Diversity and abundance of arbuscular-mycorrhizal fungus spores in tropical forest and pasture’. (1996) ‘Successive pot cultures reveal high species richness of arbuscular endomycorrhizal fungi in arid ecosystems’. pp. J. Porter. Gainesville. 105. (2001) ‘A new fungal phylum. Australian Journal of Soil Research.. J. Synergistic Publications.

mortonii Bentivenga y Hetrick G. antarticum Cabello G. lacteum Rose y Trappe G. microcarpum Tulasne y Tulasne G. y Trappe G. aurantium Blaszkowski. multicaule Gerd. monosporum Gerdemann y Trappe G.Apéndice 7. coremioides (Berk. caledonium (Nicol. nanolumen Koske y Gemma G. pansihalos Berch y Koske G. clarum Nicol. invermaium Hall G. Renker y Buscot G. pubescens (Sacc. claroideum Schenck y Smith G. G. microaggregatum Koske. macrocarpum Tulasne y Tulasne G. género Glomus Género/Especies Glomus G. G.) Trappe y Gerd. Especies de HMA de la familia Glomeraceae. mosseae (Nicol. melanosporum Gerd. Bhattacharjee y Tewari G. multisubstensum Mukerji. boreale (Thaxter) Trappe y Gerd. cerebriforme McGee G.) Gerd. y Trappe G. Tadych y Madej G. corymbiforme Blaszkowski G. ambisporum Smith y Schenck G. albidum Walker y Rhodes G. arborense McGee G. convolutum Gerd. y Broome) Redecker y Morton G. constrictum Trappe G. aggregatum Schenck y Smith G. y Gerd. callosum Sieverding G. Blanke.1. y Trappe G. citricola Tang y Zang G. y Schenck G. G. australe (Berkeley) Berch G. clavisporum (Trappe) Almeida y Schenck G. y Bakshi G. minutum Blaszk. laccatum Blaszkowski G. proliferum Dalpe y Declerck G. y Gerd.. coronatum Giovannetti G. delhiense Mukerji. maculosum Miller y Walker G. Sieverding y Schenck G. przelewicensis Blaszkowski G. canadense (Thaxter) Trappe y Gerd. botryoides Rothwell y Victor G. liquidambaris (Wu y Chen) Almeida y Schenck G. Bhattacharjee y Tewari G. pallidum Hall G. manihotis Howeler. y Ellis) Trappe y Gerdemann 236 Manual de biología de suelos tropicales . magnicaule Hall G. Gemma y Olexia G.

sterilum Mehrotra y Baijal G. dimorphicum Boyetchko y Tewari G. tenerum Tandy emend. globiferum Koske y Walker G.Apéndice 7. Walker y Dalpe G. halonatum Rose y Trappe G. formosanum Wu y Chen G. G.1. fragile (Berk. taiwananse (Wu y Chen) Almeida y Schenck G. fasciculatum (Thaxter) Gerd. pustulatum Koske. segmentatum Trappe. G. tubiforme Tandy G. heterosporum Smith y Schenck G. G. y Broome) Trappe y Gerd. tenue (Greenhall) Hall G. warcupii McGee H ongos micorrizógenos arbusculares 237 . fragilistratum Skou y Jakobsen G. G. y Gerd. xanthium Blaszk. Bloss y Menge G. rubiforme (Gerd. reticulatum Bhattacharjee y Mukerji G. McGee G. y Trappe) Almeida y Schenck G. tortuosum Schenck y Smith G. Friese. intraradices Schenck y Smith Fuente: tomado de http://invam.caf. radiatum (Thaxter) Trappe y Gerd. viscosum Nicol.edu. diaphanum Morton y Walker G. vesiculiferum (Thaxter) Gerd. y Trappe G. y Trappe emend. etunicatum Becker y Gerdemann G. geosporum (Nicol.. y Bakshi) Almeida y Schenck G. hoi Berch y Trappe G. y Broome) Trappe y Gerd. glomerulatum Sieverding G. Continúa Género/Especies G. fulvum (Berk. versiforme (Karsten) Berch G. fuegianum (Spegazzini) Trappe y Gerdemann G. insculptum Blaszkowski G. trimurales Koske y Halvorson G.wvu. deserticola Trappe.) Walker G. sinuosum (Gerd. dominikii Blaszkowski G. flavisporum (Lange y Lund) Trappe y Gerd.) Trappe y Gerdemann G. Blanke. tenebrosum (Thaxter) Berch G. G. G. Walker y Koske G. pulvinatum (Henn. Renker y Buscot G. Spooner y Ivory G.

Especies de HMA de la familia Acaulosporaceae. spinosa Walker y Trappe A. koskei Blaszkowski A. cavernata Blaszkowski A. tuberculata Janos y Trappe A. Pfeiffer y Bloss A. rugosa Morton A. rehmii Sieverding y Toro A. bireticulata Rothwell y Trappe A.2.Apéndice 7. Reed y Sanders A. denticulata Sieverding y Toro A.wvu. lacunosa Morton A. polonica Blaszkowski A. foveata Trappe y Janos A. kentinensis Wu y Liu E. thomii Blaszkowski A. longula Spain y Schenck A. colombiana Spain y Schenck E. paulineae Blaszkowski Fuente: tomado de http://invam. sporocarpia Berch A. undulata Sieverding A. baltica Blaszkowski E. infrequens (Hall) Ames y Schneider4 E. schenckii Sieverding y Toro 238 Manual de biología de suelos tropicales . A. excavata Ingleby y Walker A. dilatata Morton A. Chaverri y Rojas A. elegans Trappe y Gerdemann A. nicolsonii Walker. géneros Acaulospora y Entrophospora Género /Especies Acaulospora A.caf. capsicula Blaszkowski A. Sieverding y Schenck A. myriocarpa Spain. gedanensis Blaszkowski A. mellea Spain y Schenck A. splendida Sieverding. walkeri Kramadibrata y Hedger Entrophospora E. taiwania Hu A. morrowiae Spain y Schenck A. laevis Gerdemann y Trappe A. delicata Walker.edu. scrobiculata Trappe A.

coralloidea Sieverd. boliviana Sieverd. occultum (Walker) Morton y Redecker Pacispora P. Sieverd. dominikii Sieverd. emend.edu. y Oehl P. gerdemannii (Rose.caf. Daniels y Trappe) Morton y Redecker Ar. y Oehl P. y Oehl P. trappei (Ames y Linderman) Morton y Redecker Ar. franciscana Sieverd. y Oehl P.Apéndice 7. leptoticha (Schenck y Smith) Morton y Redecker Paraglomus P. y Oehl P. scintillans Rose y Trappe emend. robigina Sieverd. Sieverd. 2004 y http://invam. y Oehl Fuente: tomado de Oehl y Sieverding.wvu. Especies de HMA de las familias Archaeosporaceae(Género Archaeospora). chimonobambusae Blaszk. y Oehl P. Paraglomeraceae (Género Paraglomus) y Pacisporaceae (Género Pacispora) Género /Especies Archaeospora Ar. H ongos micorrizógenos arbusculares 239 . brasilianum (Spain y Miranda) Morton y Redecker P.3.

Miller y Walker) Walker y Sanders S. Gerd. calospora (Nicol. erythropa (Koske y Walker) Walker y Sanders S. dipapillosa (Walker y Koske) Walker y Sanders S. y Trappe Gi. y Herr. y Gerdemann) Walker y Sanders S. nodosa Blaszkowski S. aurigloba (Hall) Walker y Sanders S.) Walker y Sanders S. y Gerd. y Schenck) Walker y Sanders S. pellucida (Nicol. y Herr. Especies de HMA de la familia Gigasporaceae. reticulata (Koske. gigantea (Nicol.) Walker y Sanders S. Sieverding y Toro S. nigra (Redhead) Walker y Sanders S. rosea Nicol. armeniaca Blaszkowski S. savannicola (Ferr. minuta (Ferr. dipurpurascens Morton y Koske S. persica (Koske y Walker) Walker y Sanders S. y Herr. hawaiiensis Koske y Gemma S. y Ho) Walker y Sanders S. alborosea (Ferr.) Walker y Sanders S. biornata Spain. coralloidea (Trappe. cerradensis Spain y Miranda S. albida Schenck y Smith Gi. castanea Walker S.) Walker y Sanders 240 Manual de biología de suelos tropicales . fulgida Koske y Walker S. arenicola Koske y Halvorson S. y Schenck Scutellospora S.4. gilmorei (Trappe y Herd. heterogama (Nicol.) Gerd. y Gerd.) Walker y Sanders S. margarita Becker y Hall Gi. géneros Gigaspora y Scutellospora Género /Especies Gigaspora Gi. decipiens Hall y Abbott Gi.Apéndice 7.) Walker y Sanders S. gregaria (Schenck y Nicol.

4.caf.edu. y Ferr. Continúa Género /Especies S. verrucosa (Koske y Walker) Walker y Sanders S.Apéndice 7. H ongos micorrizógenos arbusculares 241 . Cuenca y Sanchez S. tricalypta (Herr. scutata Walker y Diederichs S.) Walker y Sanders S. spinosissima Walker. weresubiae Koske y Walker Fuente: tomado de http://invam.wvu.

.

los patógenos de plantas actúan en el suelo y en la rizósfera. Las actividades agrícolas pueden afectar la diversidad de organismos presentes en el suelo. causando una notable reducción en las cosechas y afectando su calidad. 1988. los cuales juegan un importante papel en el reciclaje de nutrientes o son mediadores del equilibrio entre los patógenos y sus antagonistas.Capítulo 8 Hongos del suelo saprófitos y patógenos de plantas Ludwig H. Lodge. los hongos interactúan con una compleja comunidad microbiana que incluye: bacterias. 2000). debido al tiempo y la limitación de los recursos. El uso de organismos indicadores. Para poder obtener una evaluación confiable de la diversidad de los hongos del suelo. En el suelo. Las investigaciones deben ser diseñadas en forma de estudios a largo plazo donde intervengan especialistas en taxonomía y micología. En los ecosistemas agrícolas. existen dos condiciones básicas. actinomicetos (actinobacterias) y pequeños invertebrados. La evaluación de la diversidad de hongos en suelos tropicales bajo diferentes usos de suelo es. grupos específicos o un conjunto de predictores. podrían ser una alternativa (Hyde. Cuando un estudio de largo plazo involucra varios especialistas no resulta viable. (Wainwright. junto con una metodología precisa. principalmente para la mesofauna que habita en el suelo (Bonkowski et al. 1993). Pfenning y Lucas Magalhães de Abreu INTRODUCCIÓN Los hongos del suelo juegan un papel clave en los procesos de descomposición que mineralizan y reciclan nutrientes de plantas. por lo 243 .. 1997a y b). Los hongos son una parte importante de la cadena alimenticia en el suelo.

1993. Dentro de este grupo se encuentran grupos filogenéticamente diversos. por lo tanto. Las metodologías para aislar y cultivar hongos de ecosistemas complejos. tales como fila de Eubacterias. medios de cultivo parcialmente selectivos y adictivos que reducen el crecimiento de ciertos grupos de hongos. Incluso el análisis de abundancia relativa de especies cultivables recuperadas del suelo. un grupo monofilético de organismos de hongos obligados asociados a las raíces de las plantas (véase Capítulo 7). 2001)... que cubran las diferentes idiosincrasias de la diversidad taxonómica y grupos fisiológicos de hongos presentes en los ecosistemas del suelo. 1990. Los procedimientos clásicos microbiológicos para estudiar los hongos del suelo se basan en cultivos que implican el aislamiento de propágulos microbianos o hifas activas que crecen en el suelo. Se ha progresado considerablemente utilizando técnicas de lavado. Bills et al. No obstante. (1992). con diferentes medios de cultivos y estrategias de aislamiento.. Davet y Rouxel. Sin embargo. un objetivo del proyecto CSM-BGBD. Una medida confiable de las comunidades de hongos en el suelo sin prejuicios requiere del seguimiento de un laborioso programa de aislamientos sistemáticos. y su crecimiento en un medio de cultivo axénico para su posterior identificación y cuantificación. 1996. 1992. 2004). tales como suelos que muestran limitaciones inherentes debido a la naturaleza de las especies y la inhabilidad de los medios de cultivo para copiar con exactitud los hábitats del suelo (Tsao et al. debido a que los medios de cultivo imponen nuevas condiciones selectivas y pueden introducir un sesgo en los análisis (Liu et al. Singleton et al. deben ser capaces de crecer en cultivos axénicos. 1992. 2000). han sido revisados por varios autores (Frankland et al. 1983. Gray. Muyzer et al. 1990. Los métodos utilizados para el aislamiento del suelo. la mayoría de los hongos que habitan en el suelo pueden ser considerados saprotróficos.. junto con muchos grupos homogéneos como el filum Glomeromycota.. Gams. 2000. aún no están disponibles.. Una visión global de los métodos para estudiar hongos patógenos de plantas en el suelo fue descrita por Singleton et al.. rizósfera y hongos rizoplanos.. afirmaciones genéricas de que únicamente el 1% de los “microorganismos” del suelo son cultivables aumentan la dificultad y no tienen en cuenta la inmensa diversidad biológica que realmente representan dichos microorganismos (Rondon et al. puede no ser representativo de la dinámica de las comunidades del suelo.tanto. Bridge y Spooner. 244 Manual de biología de suelos tropicales . Los métodos estándares aceptados para inventariar la diversidad de hongos o para evaluar su impacto en varias prácticas agrícolas u otras actividades humanas. 1997). Cannon.

animales y otros microorganismos. de los métodos utilizados.. Por esta razón. para un mejor entendimiento de la estructura y función de las comunidades de hongos del suelo. El objetivo principal es contribuir al establecimiento de una serie de métodos estándares.. Los resultados obtenidos de un estudio de hongos del suelo dependen. y no un sustrato. 2006). además. Por ello. Houston et al. se deberá tomar en cuenta que el suelo no es un sustrato. generalmente aceptados. En general. porque el suelo representa una mezcla compleja de fracciones orgánicas e inorgánicas con agua y organismos vivos. microorganismos.. 2003). No obstante. reciclaje de nitrógeno y contenido de ácidos grasos del hongo o de observaciones directas del crecimiento del micelio en partículas de suelo (Widden y Parkinson. También son tomados en cuenta los principios y aplicaciones de herramientas moleculares en los estudios de comunidades de hongos del suelo. intenta ofrecer una visión global de los procedimientos disponibles. raíces vivas.. respiración del suelo. En este capítulo se hace referencia a algunos de los métodos más comunes y también a algunas técnicas menos conocidas para la evaluación y monitoreo de comunidades de hongos del suelo. Con estos fines. 1998. pequeños invertebrados y contenidos intestinales. por sí solos. y no existe ninguna estimaHongos del suelo saprófitos y patógenos de plantas 245 . por lo tanto. junto con minerales y agua. es necesario adoptar métodos similares dentro de los proyectos cooperativos o multidisciplinarios para garantizar la comparación de los datos en un futuro. esta característica complica las definiciones y la metodología. se han aplicado métodos que dependen del análisis de la biomasa microbiana del suelo. poca información acerca de las especies de hongos involucrados en dichos procesos. principalmente. LA IMPORTANCIA ECOLÓGICA DE LOS HONGOS DEL SUELO El suelo es un hábitat o ecosistema. Aunque este enfoque no es exhaustivo. se requieren los procesos de aislamiento e identificación tradicionales (Brodie et al. exudados. el suelo alberga una parte considerable de la biodiversidad total de hongos. 1973. sino un ecosistema compuesto por una mezcla de sustratos más diversos que incluyen partes de las plantas vivas y muertas. Las fracciones orgánicas se componen de material de plantas en diferentes fases de descomposición. cada método presenta ciertas preferencias a ciertos grupos específicos de hongos.Otras metodologías que han sido desarrolladas se enfocan en el análisis de la actividad de los hongos y su papel en los procesos biogeoquímicos que ocurren en el suelo. Malosso et al. 2003. Brodie et al. estos métodos proporcionan.

los patógenos de plantas y sus antagonistas son particularmente importantes. 1997). 1988. una mejor estructura física del suelo y el control de antagonistas de los patógenos de las plantas en el suelo. plantas utilizadas como cubierta vegetal y la diversificación de cultivos. 2003).. 1997. 1980. Zak y Visser. tales como la incorporación de materia orgánica. en la rizósfera o infectan tallos. 1997). provocan grandes pérdidas. 246 Manual de biología de suelos tropicales . Rodrigues-Guzman. o Coniothyrium minitans pueden reducir la incidencia de una variedad de enfermedades en el suelo (Whipps et al. Mazzola. Los hongos del suelo juegan un papel clave en los procesos de descomposición. Lodge. por ende. 2004).. causando que las plántulas se marchiten y. 2003. Se ha demostrado experimentalmente que la introducción de antagonistas específicos como Trichoderma spp. La supresión de patógenos de plantas puede resultar intrínseca en los suelos. 1993). cabe mencionar que los hongos son responsables de la degradación de xenobióticos y contaminantes orgánicos introducidos en el suelo (Bordjiba et al. 1996. Con relación al papel de los organismos descomponedores. Éstos pueden ser específicos. Los saprófitos tienen una especificidad limitada por sustratos.ción fidedigna del número de especies de hongos del suelo (Hawksworth. 1991. especialmente en el caso de la mesofauna (Bonkowski et al. 1993. 2002. 2007. por tanto. El mantenimiento de la diversidad de hongos del suelo debería.. Hawksworth y Rossman. por ejemplo. mediante el suministro de nutrientes.. 2001. Silva et al. Algunos elementos biológicos han sido identificados como los principales factores de la supresión de enfermedades (Chet y Baker... 1984. mientras los ascomycetes descomponen principalmente celulosa y hemicelulosa (Domsch et al. Barratt et al. 1997). mineralizando y reciclando los nutrientes de las plantas (Wainwright. Los hongos también constituyen una parte importante de la cadena alimenticia dentro del suelo. Schneider. aunque la mayoría ataca una amplia gama de plantas hospederas. Existen evidencias de que las prácticas agrícolas causan más alteraciones cuantitativas que cualitativas en la comunidad de microhongos del suelo (Pfenning. Los patógenos de plantas actúan en el suelo. En sistemas agrícolas. Beare et al. 2001).. Lodge. los zygomycetes usan carbohidratos simples. pero también es posible que se mantenga o incremente con algunas prácticas agrícolas específicas. 2000). beneficiar directamente la agricultura sustentable.

Moreira y Siqueira. 2001. Dentro del grupo de los Oomycetes del suelo es posible encontrar saprófitos. como se discutió en el Capítulo 7. Plasmodiophora brassicae o Polymyxa graminis. con un sistema de clasificación filogenético (Kirk et al. 2001). Estas especies se clasifican en la clase Plasmodiophoromycetes. las cuales se presentan en la sesión “Procedimientos basados en cultivos”. Hongos del suelo saprófitos y patógenos de plantas 247 . La detección de estos organismos requiere de bioensayos o cebos. Los hongos llamados mohos mucosos -un grupo de organismos heterogéneos y polifilético.. 2001). Kirk et al.. tales como Spongospora subterranea.. Dentro de este reino se reconocen cinco fila: los géneros que pertenecen al filum Glomeromycota forman micorrizas arbusculares y no crecen en ausencia de su planta hospedera (Schußler et al. 2001. su hábitat e importancia ecológica son variables. Chromista Los hongos que son derivados de algas y que contienen celulosa como el mayor componente en su pared celular pertenecen al reino Chromista Filum Oomycota (Dick. otros habitan en el suelo. Trabajar con este grupo de simbiontes biotróficos obligados requiere del uso de diferentes técnicas específicas. Los hongos del reino Protozoa no son numerosos. 2002). aunque algunos de ellos son importantes patógenos de las plantas del suelo. Mientras que algunos son verdaderos hongos acuáticos asociados con restos de plantas en agua o con patógenos de otros organismos acuáticos. aunque también pueden encontrarse en el suelo. A pesar de que estos hongos representan un grupo delimitado de acuerdo con sus características y filogenia. así como otros géneros patógenos de plantas. Por sus características biológicas requieren de técnicas específicas para su aislamiento y caracterización. Glomeromycota Los hongos clasificados en el reino Fungi se caracterizan por tener quitina como el mayor componente en su pared celular.habitan en restos de plantas.ASPECTOS DE SISTEMÁTICA MODERNA Protozoa Los organismos conocidos como hongos actualmente se agrupan en tres reinos.

Varias de estas especies se conocen como trasmisores de virus patógenos de plantas (Krik et al. Gongronella. 2008). plantas u otros hongos. en el suelo y en restos de plantas. Se caracterizan por la formación de las ascas. Basidiomycota El filum Basidiomycota se caracteriza por el basidium. algunos de estos hongos habitan en el suelo.Chytridiomycota El único grupo dentro del reino de los hongos que forma esporas flageladas es el filum Chytridiomycota. Los patógenos de plantas importantes en el suelo son especies de Rhizoctonia y Sclerotium. Cunninghamella. Ascomycota El filum Ascomycota representa el grupo más abundante de hongos.. un meiosporangio en el que generalmente se forman cuatro esporas sexuales (Bauer et al. tales 248 Manual de biología de suelos tropicales . Especies de los géneros Absidia. Mucor. La filogenia de este grupo aún es objeto de discusión y de revisión. El micelio vegetativo se desarrolla. La evaluación de la diversidad de estos hongos y el monitoreo de su impacto en la comunidad requieren de técnicas específicas (Rossman et al. por lo general. distinguir los grupos más importantes. 2006) y en la mayoría de los casos por la formación de un cuerpo fructífero.. una estructura formada durante la fase sexual de su ciclo de vida. Muchos de ellos forman ectomicorrizas en asociación con el sistema de raíces de árboles forestales. Para fines prácticos. Mortierella o Rhizopus son muy comunes en el suelo y se encuentran en casi todos los estudios de hongos de suelo. 1998) que no son consideradas en este manual. pero normalmente son acuáticos y viven como saprófitos o parásitos de otros organismos como nematodos. Zygomycota Representan el filum Zygomycota y se consideran como hongos de azúcar por su preferencia por carbohidratos simples y por su crecimiento vigoroso en un cultivo axénico.. La fase asexual de los ascomycetes se llama anamórfica y es la fase más comúnmente encontrada. insectos.

Algunos de los ascomycetes como Aspergillus y Penicillium que habitan en el suelo. utilizando plantas altamente susceptibles. pueden resultar contraproducentes para la recuperación de especies de hongos. tres o más muestras compuestas podrán colectarse en cada punto de muestreo. con el fin de evitar la contaminación entre puntos de muestreo. De manera alternativa. Debido a su pequeño tamaño y estructura poco diferenciada. ascomycetes que forman un asca en un cuerpo fructífero cleistotecal. las muestras del suelo deberán trasladarse al laboratorio utilizando un recipiente con aislamiento. 2008). Probablemente. discomycetes. si los recursos lo permiten. La hojarasca deberá ser removida justo antes de extraer la muestra. en caso de que se haya previsto realizar otros análisis físicos y químicos del suelo.como plectomycetes. pertenecen a los plectomycetes. También se recogerá una segunda muestra compuesta de alrededor de 200 g. a pesar del uso de antibióticos en los medios de cultivo. el grupo más grande de hongos encontrados en el suelo son los pyrenomycetes anamorfos (Krik et al. MUESTREO DE SUELO Utilizando un nucleador se extraen pequeñas cantidades de suelo. preferentemente a 4°C y congelarse lo más pronto posible para su futuro procesamiento. Cada juego de 12 muestras se homogenizan para formar una muestra compuesta de alrededor de 500 g que se coloca en una bolsa de plástico. Para la extracción del DNA.. debido a que la micobiota de la rizósfera es altamente influenciada por las especies de plantas. pyrenomycetes y loculoascomycetes puede ser útil. La rizósfera también contiene una alta concentración de bacterias que. Todos los materiales de muestreo (nucleador. espátula. Hongos del suelo saprófitos y patógenos de plantas 249 . etc. EVALUACIÓN DE LOS HONGOS DEL SUELO: PROCEDIMIENTOS BASADOS EN CULTIVOS Todos los métodos propuestos dependen de muestras del suelo y no contemplan el uso de raíces para aislar hongos del suelo.) deberán lavarse antes y después de tomar las muestras. a una profundidad de 20 cm en 12 puntos distribuidos en cada parcela de muestreo de acuerdo con el esquema mostrado en el Capítulo 2. la detección y el monitoreo de los hongos de organismos protistas como Spongospora y Plasmodiophora puede llevarse a cabo mediante bioensayos. azadón.

Especies de Pythium y Phytophthora pueden causar serios daños a plantas cultivadas. 2000). El micelio del hongo formado en el sustrato deberá traspasarse a charolas con el medio MP5 (en el caso de Saprolegniaceae) y agar con harina de maíz (AHM). Chytridiomycetes) de muestras ambientales aparece en la ilustración 6. 250 Manual de biología de suelos tropicales . Se añaden granos de sorgo como cebo y se incuban por cinco días.1 para la composición del medio). Al final de dicho procedimiento se deberá observar que se obtiene únicamente un aislamiento para cada placa. Edena et al... El micelio en crecimiento se verifica directamente mediante montajes con agua en un microscopio o se transfiere del cebo al medio de aislamiento (AHM) que contiene cloranfenicol (50 mg L-¹) y benomil (10 mg L-¹) (Marks y Mitchell.. finalmente. después se comprueba la presencia de micelio en el cebo. El aislamiento de hongos zoospóricos (Oomycetes. Pueden llevarse a cabo ensayos cuantitativos utilizando la frecuencia de la colonización relativa de los tejidos del cebo entre las réplicas de cada muestra de suelo. Se esterilizan en autoclave fragmentos de hojas de zacate y se añaden a los tubos como tejidos para recuperar el Pythium spp. en la sección de color de este manual. 1998. Gams et al. Este procedimiento deberá continuarse durante varias semanas. la B) una muestra de agua con cebo.5 g colocadas en tubos de ensayo de vidrio esterilizado con 3 ml de agua estéril. tomate o papa. la C) muestra un cultivo puro en el cebo y en la D) se observa el esporangio de Phytophthora. mientras que el oogonio y anteridio de Pythium se ilustran en E)”. 1970. La ilustración A) representa una muestra de suelo con cebo. 1983. Los tejidos infectados deben transferirse en agua estéril con el antibiótico cloranfenicol durante unas horas. las porciones de agar que contengan micelio serán transferidas a placas con agua estéril destilada y con dos mitades de semillas de sorgo. Las muestras son incubadas durante tres a cinco días a 25°C en la oscuridad. Otra técnica con sustrato susceptible utiliza muestras de suelo húmedo de 0. Después de incubar durante tres a cinco días. Tsao et al. agar dextrosa y papa (ADP) o agar de papa y zanahoria (en el caso de Pythiaceae) (véase Apéndice 8. Alícuotas de 2 g de suelo se traspasan a cajas Petri que contienen agua estéril destilada. en la última ilustración F).Oomycota: uso de cebos para el aislamiento de Pythium y Phytophthora Para poder recuperar del suelo los oomicetes es aconsejable el uso de plantas susceptibles o tejidos vegetales. se observa la liberación de zoosporas de Pythium. Las hojas de zacate como cebo pueden ser sustituidas por pedazos de frutas o verduras como pepino.

1991). (2002). y pedazos de frutas y verduras (Gams et al. posteriormente. se describen varios métodos. se recuperan las semillas con un tamiz de 1. Método de partículas de suelo Una suspensión de 10 g de muestra de suelo y agua de la llave es agitada. Como el aislamiento de colonias individuales en un medio de cultivo axénico es difícil. Las partículas de suelo retenidas se secan con papel absorbente estéril y se transfieren a una caja Petri de 15 cm de diámetro que contenga un medio de agar con agua acidificada (al 2%) con 250 mg L-¹ de cloranfenicol. Después de un periodo de incubación de 48 horas a 25°C.5 mm. Basidiomycota – Rhizoctonia: técnica de cebo y aislamiento directo de partículas de suelo Para evaluar este género de basidiomicetes anamórficos del suelo. los cebos pueden transferirse a viales. Técnica de cebo Se mezcla 1 g de semillas de betabel con 100 g de suelo húmedo en cajas Petri. compilados por Sneh et al. Los cebos más apropiados incluyen cáscara de camarón. en suelos de jardines de eucaliptus clonados fue descrito recientemente por Sanfuentes et al. Después de un periodo de incubación de 24 a 48 horas. (1991). a 25°C. se lavan con agua destilada durante Hongos del suelo saprófitos y patógenos de plantas 251 . se evalúa la frecuencia de la colonización en las partículas del suelo y el micelio se transfiere a ADP para su eventual caracterización (Sneh et al.Uso de cebos para el aislamiento de Chytridiomycota Para evaluar los Chytridiomycota se usan las mismas técnicas empleadas para los oomicetos. 1998). piel de serpiente. alas de insectos. se presentan dos métodos de aislamiento útiles. Un método para evaluar la densidad de inóculo de Rhizoctonia spp. la caracterización e identificación se hace directamente en el cebo. El suelo retenido se resuspende y se pasa varias veces por el tamiz. después decantada usando un tamiz de 0. A continuación... Para su preservación. se verifica el crecimiento típico de Rhizoctonia.5 mm.

. más estreptomicina plus (50 mg L-¹) para la inhibición de bacterias y ciclosporina (10 mg L-¹) o rosa de Bengala (70 mg L-¹). El crecimiento de Rhizoctonia se verifica y se transfiere micelio a ADP para su aislamiento y caracterización (Papavizas et al. en estos suelos. como la amplificación de DNA ribosomal de Rhizoctonia con iniciadores (en inglés.0 mm. utilizando un juego de tamices de 1. ha mostrado severas limitaciones debido a la continua presencia de Trichoderma spp.. que contenga 100 mg L-¹ de cloranfenicol.5 mm y 0. Las partículas de suelo prelavadas son filtradas. para la inhibición de hongos de rápido crecimiento. Los coloidales de suelo y granos de arena son removidos del último tamiz. fitopatógenas y sus antagonistas. A pesar del uso común de varios métodos para el aislamiento de Rhizoctonia de muestras de suelo agrícola. La frecuencia de colonización de partículas de suelo para cada especie de hongos es utilizada en ensayos cuantitativos. se secan con papel absorbente estéril para ser transferidas a un medio de agar con agua al 2%. el empleo de técnicas de cultivo independiente. Ascomycota: técnica de lavado del suelo y filtración de partículas Éste es el mayor grupo de hongos del suelo que incluye especies saprófitas. 0. 0. De esta manera.21 mm usando agua destilada (alrededor de 2 litros) por 2 minutos. Después de la sedimentación de las partículas del suelo durante 2 minutos. Técnica de lavado Una muestra de 10 g de suelo mineral se agita con 200 ml de agua destilada en una centrífuga a 180 rpm durante 10 minutos. su aplicación en el estudio de suelos bajo vegetación natural.7 mm.20 minutos. el sobrenadante se desecha y se repite el procedimiento dos veces. Todas estas especies exhiben una fase saprotrófica en el suelo y pueden ser aisladas utilizando una metodología con placas de suelo. por el grupo de investigadores involucrados en el proyecto. secados con papel absorbente esterilizado y transferidos (7 partículas por placa) a 5 cajas Petri (90 mm) que contienen el medio de aislamiento AHM (30 g L-¹). Cuando se emplea ciclosporina se logra una supresión casi completa 252 Manual de biología de suelos tropicales . La técnica de lavado de suelo es un método adecuado para el aislamiento de estas especies. entomopatógenas. primers) específicos y su análisis cualitativo e incluso cuantitativo puede resultar idóneo bajo circunstancias específicas (Lees et al. 1975). 2002).

cuando se trata de estudiar este último grupo de hongos. La técnica es muy simple y se han descrito varias modificaciones. Las alícuotas de la dilución final son distribuidas en cajas Petri que contienen un medio de agar generalmente. Por lo tanto. éstos pueden contener fuentes de carbono preferiblemente metabolizados por algunos grupos fisiológicos de hongos o pueden modificarse con químicos que inhiben el crecimiento de organismos no deseados. Tsao et al.de zygomycetes saprotróficos. Por lo tanto. 1992. rutinariamente se utilizan medios selectivos. por el factor de dilución empleado. El método de dilución del suelo en placa Este es el método de uso más común para el aislamiento y estimación cuantitativa de bacterias y hongos. 1985). el resultado es una estimación del número de propágulos de hongos por gramo de suelo (Bills et al. Se pueden lograr medidas cuantitativas multiplicando el promedio de las unidades formadoras de colonias (UFC) en las placas. 1988. se debe evitar el uso de ciclosporina (Dhingra y Sinclair. hasta lograr la dilución final.. Este método se puede observar en la ilustración 7. modificado con antibióticos como cloranfenicol. Lang y Jagnow. 1985. Un factor final de dilución de 10-4 ó 10-5 se considera adecuado para el aislamiento de hongos (Dhingra y Sinclair. Kacprzak y Stanczyk-Mazanek. De esta suspensión se prepara una serie de 10 diluciones. Ascomycota: medios selectivos y técnica con cebo Para un aislamiento selectivo de grupos blanco o especies de hongos del suelo. estreptomicina o penicilina para inhibir el crecimiento de bacterias. Gams et al. 1983)... y que tienen poca habilidad de competir con especies de rápido crecimiento en medios axénicos son subestimados por esta técnica (Bååth. Bååth. 1998. 1988. se toma 10% de la suspensión. Un gran número de medios selectivos ha sido desarrollado para el aislaHongos del suelo saprófitos y patógenos de plantas 253 . la cual se mantiene en agitación durante unos momentos. Bills y Polishook. Gams. Básicamente. Existe una preocupación generalizada porque el método de dilución en placas muestra un sesgo hacia los hongos que son capaces de producir grandes cantidades de esporas y que crecen muy rápido en un medio de cultivo rico. 1994. una cantidad conocida de suelo es suspendida en agua estéril. 2003). 1986. 2004). la diversidad de hongos que normalmente existen en forma de micelio que crece activamente en el suelo.

Papavizas et al. El aislamiento selectivo de los hongos del suelo también puede llevarse a cabo con cebos que son colonizados por grupos fisiológicos específicos de hongos. Barratt et al... 254 Manual de biología de suelos tropicales .. 2001.. para el aislamiento de Rhizoctonia solani se utiliza agua-agar acidificada. larvas de insectos para los entomopatogénos y nematodos para los hongos nematófagos (Marks y Mitchell. 2001). Gams et al. Gonçalves et al.. Dhingra y Sinclair.. 1983.. 2003). 1985. Dackman et al. mientras que para Fusarium spp. aquéllos que contienen especies patógenas de plantas. 1996. especies de Cylindrocladium y de las especies relacionadas Cylindrocladiella y Gliocladiospsis raramente son reportadas en muestras de suelo que emplean el método de dilución del suelo por placas. 2002. La colonización del cebo por un hongo clave también puede llevarse a cabo mediante la observación directa al microscopio (Gams et al.. en particular. Pettitt et al.1987. el medio usado es Komada (Masago et al. por ejemplo. el tejido cebo es incubado con una muestra de suelo durante unos días.. 1977. Como el Cylindrocladium y probablemente otros géneros son sensibles a la ciclosporina. Thorn et al. En la mayoría de los casos. Hojas jóvenes y frescas se recogen y se lavan bajo agua de la llave para posteriormente ser sometidas a una desinfección con etanol al 70% durante un minuto. 1998.. A pesar de ello. 1991. 1991. cabello para las especies queratinofílicas. 2003. 1998).. 2000. 1970. deberán aislarse selectivamente usando cebos. 1975. después se transfiere a un medio selectivo de agar para su posterior aislamiento de los hongos deseados.. Edena et al. Sneh et al.. Wellington et al. varios materiales de plantas adecuados para su aislamiento fueron descritos en una monografía reciente (Crous. Edel et al. Ejemplos de cebos utilizados para el aislamiento selectivo de hongos del suelo son tejidos de plantas para el caso de patógenos de plantas. Procedimiento para el aislamiento para el aislamiento de Cylindrocladium y géneros afines del suelo. cuyo protocolo se describe a continuación. utilizando como cebo hojas de Ricinus communis Cylindrocladium es un género conformado por especies saprotrófitas y patógenas de plantas comúnmente encontradas en el suelo. basidiomycetes y oomycetes del suelo..miento de varios géneros de ascomycetes.. En el laboratorio se utilizan hojas de ricino (Ricinus communis) como cebo para el aislamiento de hongos del complejo Cylindrocladium de manera rutinaria. Tsao et al. 2002b). quitina para los productores de quitinasa. Sneh et al.

donde diariamente se verifica la esporulación típica de Cylindrocladium.. Técnica de cebo para el aislamiento de patógenos fúngicos de plántulas Una amplia gama de hongos patógenos de plantas en el suelo puede causar la muerte prematura de las plántulas. el amplio trabajo de Domsch et al. que es un grupo heterogéneo que incluye saprófitos. Las hojas enteras se colocan un una caja Petri de 15 cm y se cubren con una capa de suelo húmedo. 1998. bajo un microscopio estereoscópico (Gams et al. por lo tanto. 2001. (2007) aún sigue siendo una fuente importante para todos los involucrados en el estudio de hongos del suelo. 2002b). Después de más de 20 años. El aislamiento del hongo se logra con la transferencia de esporas a un medio de cultivo. incluyendo hongos del suelo. Hongos del suelo saprófitos y patógenos de plantas 255 . síntomas de podredumbre. después de tres días de incubación se lavan las hojas cuidadosamente con agua destilada y se transfieren a una cámara húmeda. tal como ADP y AM (agar extracto de malta) que contiene cloranfenicol (250 mg L-¹). Además de las claves y monografías de alrededor de 250 géneros. durante 30 segundos). IDENTIFICACIÓN DE HONGOS DE SUELO La identificación de hongos que habitan el suelo puede causar problemas para aquéllos que no tengan suficientes conocimientos de micología. Las dificultades de identificar a nivel de especie se ilustran con el género Fusarium. Los tejidos de plántulas infectadas se esterilizan con hipoclorito de sodio (al 2%. Las semillas de tomate se germinan en 100 g de suelo y se verifica si las plántulas manifiestan o no. Gliocladiospsis y otros géneros relacionados.seguida de hipoclorito de sodio al 3%. Crous. enseguida se lavan con agua destilada y se secan en papel absorbente esterilizado para ser transferidas a un medio de aislamiento. durante dos minutos. es recomendable para su aislamiento el uso de plántulas de tomate como cebo. Gonçalves et al. El trabajo de Barnett y Hunter (1998) es usado para unos pocos de los muchos saprófitos. Las hojas utilizadas sin desinfección previa tienden a ser degradadas con mayor rapidez y a ser colonizadas por bacterias. endófitos y patógenos de plantas.. Cylindrocladiella. este compendio contiene claves para especies de varios géneros importantes y una recopilación de la literatura. utilizando agujas finas de cristal.

1991a. 1996). 2006). algunos tipos de hongos como Basidiomycota son difíciles de aislar y pueden no esporular en un medio axénico (Thorn et al... 1983. Cylindrocladium (Crous.. 1996). La monografía de Sheh et al. 1971. No son específicas para el caso de hongos del suelo.. Muyzer et al. 2002b). (1998). b) pueden ser un buen punto de partida.. (página web). Trichoderma (Bissett. (1991) resulta útil para trabajar con Rhizoctonia. Bills et al. Fusarium (Leslie et al. se puede consultar el Dictionary of the Fungi (Kirk et al. 2001.. 2001). sin embargo. requiere de un laborioso programa de aislamientos sistemáticos con diferentes medios de cultivos y estrategias de aislamiento que reflejen la inmensa diversidad taxonómica y fisiológica de grupos de hongos que habitan en el suelo (Tsao et al. 1993. 1967.Monografías y páginas web se encuentran disponibles para identificar las especies de Aspergillus. van der Plaats-Niterink. Las secuencias de DNA son amplificadas directamente desde el suelo por medio de la reacción en cadena de 256 Manual de biología de suelos tropicales . 1980. (2000) o el manual de Gams et al. recientemente. 1981) y para Phytophthora (Waterhouse. de mucha utilidad para este tema otras recopilaciones y monografías como la de Ellis y Ellis (1985). 2000). éstos incluyen técnicas específicas de DNA. EVALUACIÓN DE HONGOS DEL SUELO: TÉCNICAS ESPECÍFICAS DE DNA Una medida confiable de las comunidades de hongos del suelo. 1976) y coelomycetes anamórficos (Sutton. hifas anamórficas pigmentadas (Ellis. Nag Raj.. Para más instrucciones acerca de cómo identificar hongos o grupos específicos de hongos. 2004). b. 1993). 1998a. 1968. Las herramientas moleculares basadas en el análisis del DNA han sido aplicadas con éxito en el estudio de complejos bacterianos y. las monografías y claves de Hanlin (1990. Bridge y Spooner. Samson et al. Penicillium (Pitt.. (Klich y Pitt 1988).. Si se trata de identificar ascomycetes. en ensambles de hongos a partir de muestras ambientales. c.. Una lista de referencias de guías y manuales para la identificación de grupos de hongos de suelo puede consultarse al final de este capítulo. Erwin y Ribeiro. 1983. Se pueden utilizar otras metodologías para complementar los enfoques tradicionales usados para un mejor entendimiento de la diversidad y dinámica de los hongos del suelo. sí. 1970. No obstante. Samuels et al. 1984. Tsao et al. Existen monografías disponibles para chyrids (Karling 1977) y también para el género Pythium (Waterhouse.

la polimerasa (PCR) y posteriormente caracterizadas utilizando varios enfoques (Bridge y Spooner. principalmente. Las muestras muy pequeñas (menores a un gramo) deben usarse con precaución porque tienen mayor probabilidad de error. La identificación de secuencias de DNA desconocidas también puede realizarse comparándolas con bases de datos de secuencias de nucleótidos de taxones conocidos. es la extracción del DNA directamente del suelo. Los protocolos de extracción se basan. este paso se logra mediante separaciones a través de columnas de separación o con el uso de kits comerciales de purificación de DNA (Liu et al. tienen que estar correctamente lisadas.. Uso de Primers específicos para “hongos” El grupo de genes para las moléculas de RNA Ribosomales 18S. incluso como micelio o esporas. Varias copias del DNA ribosomal (rDNA) se encuentran en el genoma eurocariota. debido a una variabilidad más alta dentro de la muestra (Ranjard et al.. Las células de los hongos presentes en la muestra del suelo. 5. 2001).. Extracción de DNA Un paso crucial antes del PCR. El rDNA también contiene espaciadores entre las regiones codificantes conocidos como espaciadores internos de transcripción (ITS) que presentan secuencias de bases menos conservadas y que pueden utilizarse para la diferenciación entre especies relacionadas o para evaluar Hongos del suelo saprófitos y patógenos de plantas 257 . 2001). facilitando la amplificación de pequeñas muestras de DNA.8S y 28S se considera que son altamente conservados entre los organismos eucarióticos y normalmente se emplean como marcadores moleculares. La heterogeneidad encontrada a nivel de micro-escala en el suelo debe ser considerada cuando se selecciona el tamaño de la muestra de suelo sometida a la extracción total de DNA. El total de DNA obtenido debe estar completamente purificado para eliminar sustancias húmicas y fenólicas que interfieren con el PCR. Los kits para la extracción de DNA del suelo están comercialmente disponibles. Bridge y Spooner. en los procesos físicos de macerado asociado con calor y lisis química. El polimorfismo en la longitud del DNA y la variación en la secuencia de las bases pueden utilizarse para agrupar organismos de acuerdo con su origen y relación evolutiva. 2001). Viaud et al. 1997. 2000. Reacción en cadena de la polimerasa.

2002). purificados. Secuenciación del DNA Para poder conocer las identidades del DNA de los hongos amplificados por PCR. ya que el PCR tiende a amplificar moléculas del DNA que son dominantes en el extracto del DNA total.divergencias genéticas intraespecíficas (Viaud et al. 2003). el obtener Primers o iniciadores de rDNA de hongos específicos constituye un paso fundamental en la amplificación del PCR. 2001).. han sido desarrollados y compilados por Anderson y Cairney (2004).. 2002. los amplicones de tamaño correcto pueden separarse en geles de agarosa. Algunos hongos que están presentes en muy bajas densidades en suelos naturales.. 2000. algunos de estos Primers específicos han mostrado que amplifican DNA no fúngico o muestran preferencia hacia la amplificación de grupos taxonómicos específicos dentro del reino de los hongos (Smit et al. los Primers que son específicos para amplificar PCR del DNA de hongos de muestras complejas de suelo. La detección y/o cuantificación de pocas especies específicas de hongos es requerida generalmente en el campo de la fitopatología.. Estos procedimientos son caros. Anderson et al. la detección molecular de muestras de suelo puede ser mejorada mediante el uso de técnicas de cebo en conjunto con PCR. no son adecuados para la evaluación de muestras ambientales complejas. Borneman y Hartin.... 2000. Como el suelo contiene un gran número de organismos. Filion et al. En el caso de estos hongos.. conectados a vectores plásmidos y clonados en células bacterianas. 1999. consumen tiempo y. además. Para este tipo de investigación se han desarrollado varios iniciadores especie-específicos para una detección directa y el monitoreo de patógenos de estas plantas a partir de muestras del suelo (Cullen et al. Down. Basándose en las secuencias de genes de RNA ribosomal disponibles en bancos de datos especializados para varias especies de hongos. 2000. son difíciles de detectar por métodos moleculares. Lees et al. El DNA clonado es secuenciado y comparado con las bases de datos que contienen secuencias oligonucleotídicas del rDNA fúngico mediante análisis de software. Baayen et al. tales como especies de Phytophthora. 2002. Por 258 Manual de biología de suelos tropicales . 2003). Los Primers permiten la amplificación de una amplia gama de especies de hongos sin perder la especificidad de este grupo clave. extraídos de matrices de gel. Sin embargo. utilizando Primers específicos para Géneros y/o especies de interés (Nechwatal et al.

y se llaman dominios de fusión. al igual que para monitorear modificaciones o impactos debidos a prácticas agrícolas o actividades industriales (Smit et al. El gradiente de desnaturalización en DGGE puede variar con el uso de diferentes cantidades de urea y de formamida en la matriz del gel.. contienen un DNA con bases repetitivas de GC que resultan menos propensas a la desnaturalización debido a su alta estabilidad química. Los iniciadores usados en el PCR. Milling et al. parcialmente desnaturalizadas debido a las diferencias de la desnaturalización de los dominios menos estables en las moléculas. Varias combinaciones de Primers han sido propuestas para amplificar DNA de distintos grupos de hongos como Ascomycota. Basidiomycota.. las moléculas 18S DNA amplificadas por PCR son sometidas a una electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) o con un gradiente desnaturalizante (DGGE). 1999.. Vandenkoornhuyse et al. se han desarrollado técnicas moleculares de huella o rastreo molecular (en inglés fingerprint) para estudiar la diversidad a nivel de comunidad (Borneman y Hartin. 2000. 1993). Hongos del suelo saprófitos y patógenos de plantas 259 . pero difieren en su contenido de Guanina-Citosina (GC). 2003). Los amplicones tienen exactamente el mismo número de nucleótidos. 2000. Gomes et al. Elsas et al. 2003.. Por lo tanto. Las restricciones y limitaciones están representadas en la selección de Primers utilizados en el primer paso de amplificación después de la extracción total del DNA de las muestras. Los patrones de bandeo generados son utilizados para analizar complejas comunidades de hongos del suelo. 2004). presentan diferentes comportamientos de desnaturalización y migran hacia diferentes puntos en el gel (Muyzer et al. 2002. lo que determina el modo de desnaturalización y la movilidad electroforética al migrar en el gel desnaturalizante.ello. Bajo estas condiciones de desnaturalización. En varios estudios se ha usado esta técnica para evaluar la estructura de la comunidad de hongos y otros microorganismos. 2000.. moléculas de DNA con diferentes secuencias en sus pares de bases.. En esta técnica. Anderson et al. el DNA se extiende a la misma longitud (como resultado del PCR). generalmente. Método de huella molecular TGGE y DGGE La electroforesis en gel con gradiente de desnaturalización fue introducida en estudios sobre ecología microbiana por Muyzer y Smalla (1998)... Viaud et al. pero con diferentes secuencias de pares de bases.

l.. Los fragmentos de restricción terminal (TRFs) se marcan con fluorescencia y pueden ser detectados y cuantificados en un secuenciador automático. 2001). después de la amplificación del DNA por PCR directamente extraídos del suelo utilizando Primers género-específicos (Nechwatal et al. Las especies de hongos relacionadas pueden identificarse de acuerdo con sus patrones típicos de RFLP.. Para incrementar el polimorfismo de la banda y mejorar la resolución. son la mejor opción (Malosso et al. 2003). por ejemplo. Después de la amplificación. la comigración de diferentes moléculas de DNA hacia un mismo punto en el gel. 2006). Técnica PCR-RFLP La escasa variabilidad de rDNA de hongos puede resultar desventajoso en la técnica de huella molecular.. 2006. tales como TGGE y DGGE. 2006). Zygomycota y Oomycota (Nikolcheva y Bärlocher. Se puede construir una base de datos de TRFs a partir de especies de hongos conocidos y utilizarla en corre260 Manual de biología de suelos tropicales . llamada polimorfismo de longitud de fragmentos de restricción terminal para el análisis (T-RFLP) de comunidades bacterianas de muestras ambientales. Recientemente. el DNA es amplificado por PCR con uno de los dos Primers marcados con fluorescencia. Otra limitante es que el DNA obtenido de organismos filogenéticamente distantes puede producir productos de PCR con una movilidad electroforética idéntica (Gomes et al. la restricción enzimática del DNA antes de la electroforesis puede utilizarse en una técnica conocida como polimorfismo de longitud de fragmentos de restricción (RFLP) del DNA amplificado por PCR (Viaud et al. Singh et a. 2004). los análisis bioquímicos y las técnicas de aislamiento. El uso de un PCR anidado puede arrojar aún mejores resultados e incrementar la resolución en la separación de los productos del PCR (Oros-Sichler et al. el DNA es tratado con enzimas de restricción y los fragmentos de restricción separados en un gel de acuerdo con su tamaño. el método de huella molecular. No obstante.. la técnica puede proporcionar un estándar altamente reproducible de un gran número de muestras ambientales durante un periodo de tiempo relativamente corto. (1997) desarrollaron una versión complementaria del PCR-RFLP. los enfoques polifásicos que incluyen la construcción de bibliotecas de fragmentos clonados.. 2000).Chytridiomycota. T-RFLP Liu et al. En el T-RFLP.

2004. Singh et al. 2005.. En el análisis automatizado del espaciador intergénico ribosomal (ARISA). Lowell y Klein 2001..1 muestra algunos ejemplos de técnicas moleculares empleadas para el estudio de comunidades de hongos del suelo publicadas en años recientes. especialmente con hongos patógenos de plantas. 2003. sin embargo. Kennedy et al. Como consecuencia. los fragmentos de DNA del mismo largo.. SSCP Otro estudio de huella molecular utiliza la migración diferencial de moléculas de una hebra de DNA en un gel para poder estudiar a las comunidades microbianas más complejas. los diferentes fragmentos de ITS son separados en un gel y posteriormente detectados y cuantificados en un secuenciador automático (Ranjard et al.. 2000. En el polimorfismo de conformación de cadena sencilla (SSCP). 2001). Después de la amplificación. 1996.laciones taxonómicas con los haplotipos detectados en el análisis T-RFLP (Brodie et al. 2006). el polimorfismo intra-específico del ITS puede presentar problemas en la separación de distintas especies filogenéticas (O’Donnell y Cigelnik. el DNA amplificado es completamente desnaturalizado antes de ser sometido a una corrida de electroforesis. El ARISA de hongos es una técnica altamente sensible. están enfocados en una o en pocas especies de hongos presentes en el suelo. Kennedy et al. 2005). ARISA El polimorfismo natural de la región ITS del rDNA entre especies de hongos puede utilizarse para la evaluación de comunidades de hongos de suelo.... Edel-Hermann et al. 2005). Viaud et al. Las moléculas de una sola hebra de DNA adquieren estructuras con dobleces únicos dictados por sus secuencias nucleotídicas y migran hacia puntos específicos en el gel. La Tabla 8. 1997... pero disímiles en su secuencia de pares de bases pueden ser fácilmente separados en SSCP por su diferencial de migración en el gel cuando existe la conformación de una sola hebra (Lee et al. el DNA fúngico es extraído del suelo y amplificado por PCR utilizando Primers específicos para la región ITS con uno de los Primers marcados con fluorescencia. He et al. En estos esHongos del suelo saprófitos y patógenos de plantas 261 . PCR cuantitativo Algunos estudios.

el incremento de moléculas de DNA durante la amplificación conlleva un incremento en la intensidad de la emisión fluorescente. Después de un número definido de ciclos de PCR éstos se usan para cuantificar el DNA directamente de muestras de suelo. han sido desarrolladas modificaciones del PCR convencional como PCR competitivo (cPCR) y PCR en tiempo real. Filion et al..tudios. la cuantificación del DNA de hongos en el suelo es requerida frecuentemente para estudios epidemiológicos y ecológicos. Una curva estándar puede construirse con cantidades conocidas de DNA e intensidades de fluorescentes. Esta técnica es más rápida y más sencilla que cPCR porque no existe la necesidad de construir un competidor de DNA y no se requiere de ningún análisis post-PCR (Cullen et al... En el cPCR.. Otro método empleado en aproximaciones cuantitativas es el de PCR en tiempo real. 2003). 2003). Baek y Kenerley. 2000. 1998.. 2002. Las sondas fluorescentes son capaces de emitir fluorescencia en la presencia de DNA de dos hebras. Sondas fluorogénicas o colorantes adicionados al PCRs permiten el monitoreo correcto de los productos obtenidos durante la amplificación. lo cual puede calibrarse y medirse con precisión. los distintos productos de PCR son cuantificados por separado de acuerdo con sus intensidades de bandeo relativas en geles de agarosa. Filion et al. 2002.. 2002). el PCR convencional es inapropiado para enfoques cuantitativos porque cualquier pequeña variación durante la fase exponencial en la reacción de amplificación puede alterar drásticamente las cantidades de los productos del PCR. Mauchline et al. 262 Manual de biología de suelos tropicales . por lo tanto. 1992. Li y Hartman. Después de esta amplificación. se deben diseñar Primers de PCR específicos para obtener la amplificación correcta del DNA de la especie clave y otros marcadores moleculares pueden ser empleados como secuencia del gen β-tubulina o el factor de elongación de traducción del gen EF 1-α (Baayen et al. Además de la detección molecular.. a una cantidad estándar de una muestra de DNA en una serie de PCRs y con el monitoreo de productos PCRs competitivos producidos en cada reacción (Siebert y Larrick. 2003. En el caso de ensayos cuantitativos. 2002. La cantidad de DNA en la muestra puede calcularse con la adición de diferentes cantidades de DNA competitivos. Lees et al. No obstante. fragmentos de DNA que contienen los mismos sitios iniciadores que la muestra de DNA son añadidos en cantidades conocidas a las reacciones del PCR y coamplificados con el DNA específico. Mauchline et al.

2005 Kennedy et al. Gradiente de pastizales semi-naturales a suelos agrícolas mejorados.. Suelos con diferentes propiedades fisicoquímicas. 2003 Brodie et al. los efectos de cambiar el suelo al añadir composta o excremento. Una muestra de suelo por métodos de cultivo y molecular.2005 DGGE SSCP y TGGE ARISA y T-RFLP DGGE con iniciadores específicos para Fusarium DGGE y T-RFLP Singh et al. Tres diferentes suelos cultivados con Lolium perenne. 2003 Agnelli et al. Pastizales bajo diferentes tipos de vegetación. seguido por DGGE.Tabla 8. Rizósfera de dos cultivos de maíz durante el periodo de ciclo de vida de la planta. Suelos de bosque natural y plantaciones de pino hoop.. 2000 Lowel y Klein. Técnica* TGGE PCR-RFLP SSCP ARISA DGGE Evaluación de comunidades de hongos en Rizósfera y suelo compuesto con trigo. 2005 Yergeau et al. Campos de espárragos. Análisis de la dinámica de comunidades de hongos del suelo vía PCR hongoespecíficos del DNA del suelo. Gradiente de suelo desde llanuras hasta bosques de pino escocés. 2004 Milling et al.. 1999 Viaud et al.. 2004 Edel-Hermann et al.. Diferentes horizontes de un suelo de selva. 2003 Gomes et al... amplificados del DNA total. 2004 He et al. Suelo estepario con pasto corto con o sin presencia de nitrógeno. 2001 Elsas et al.. Referencias Smit et al.1 Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes.. 2000 DGGE DGGE y TRFLP DGGE y restricción de DNA amplificado DGGE T-RFLP Anderson et al.. 2001 Ranjard et al.. análisis de detección y diversidad de especies de Fusarium. Suelos bajo cultivos de papa transgénica y no transgénica... Suelos con diferentes propiedades fisicoquímicas. 2006 Hongos del suelo saprófitos y patógenos de plantas 263 ..

Técnica* DGGE y ARDRA Evaluación de comunidades de hongos en Diversidad de hongos en suelos antárticos que combinan cultivo de aislamiento. Tsai y Olson. CONCLUSIONES Las herramientas moleculares para ensayos de comunidades de hongos del suelo fueron extraídas. los enfoques taxonómicos de hongos basados únicamente en datos moleculares. principalmente. Incluso la mayoría de los hongos patógenos de plantas no son parásitos obligados. sin duda. amplificación y secuenciación de contaminantes de hongos e incluso. no se aplica en el caso de hongos saprófitos. invariablemente. Las técnicas de huella molecular en comunidades puede monitorear composiciones complejas de hongos de suelo. pero una mejor caracterización y análisis filogénico de taxas dominantes. 2003. este método no se describe para cada ejemplo. 1992. exagerado. contienen las mismas limitaciones que las técnicas de cultivos para hongos (Selenska y Klingmüller. como hongos micorrízicos arbusculares. por ejemplo. O’Donnell et al. Hawksworth. 2006 Nota: * la clonación del DNA y la secuenciación fueron usadas por todos los autores para la identificación de haplotipos dominantes amplificados del DNA total. Bridge et al.. Otra limitación del enfoque molecular basada en la amplificación del DNA es la falta de conocimientos acerca de la actividad de crecimiento o grupos funcionales 264 Manual de biología de suelos tropicales . No obstante. por lo tanto. de estudios sobre la diversidad bacteriana y. 1992. los métodos de lavado del suelo y la filtración de partículas. requieren de una secuenciación y comparación utilizando bancos de datos de DNA al alcance del público. 1994).1 Continúa. Sin embargo. pueden presentar algunos problemas debido a que los bancos de datos pueden estar incompletos y puede que las secuencias de DNA se encuentren mal identificadas. 2002a. huella molecular y técnicas de clonación. Lo que puede ser verdad para organismos estrictamente simbióticos. en el caso de los hongos el número de especies no cultivables es. en la secuenciación de quimeras (Crous. lo que origina errores en identificaciones morfológicas. Muchos obstáculos para la identificación basada en cultivos han sido superados con la llegada de técnicas de aislamiento más sofisticadas como. tal y como ha sido discutido. generalmente.Tabla 8... 2004b). Referencias Malosso et al.

1995). además del número de cepas. las curvas que se forman con más facilidad. 2006. Otra opción consiste en llevar a cabo un análisis de varianza no paramétrico.. como parámetros físicos y químicos del suelo bajo análisis. Para solucionar ese problema. resulta ser un análisis robusto y confiable (Sokal y Rolf. las transformaciones de datos. donde el número total de cepas de cada muestra se usa en comparaciones pareadas. dado que algunos de los datos no tienen una distribución normal. 1994. haciendo difícil la diferencia del crecimiento activo o grupos funcionales basados únicamente en el producto del análisis del PCR. Se verifica el número de cepas de cada muestra y este dato puede ser usado para comparar entre sitios. el análisis de Kruskall-Wallis (Rodrigues. Las curvas de acumulación de especies o curvas de rarefacción pueden proporcionar comparaciones gráficas de la riqueza de especies entre muestras. Por el momento. Cuando están disponibles datos sobre variaciones cuantitativas entre las repeticiones dentro de las muestras. 1995). Por medio del ANOVA es posible derivar variaciones entre diferentes muestras y dentro de las muestras (error). un enfoque más confiable es realizar un análisis de varianza (ANOVA). generalmente.. La prueba de independencia de Chi cuadrada puede usarse para este análisis. los protocolos de extracción del DNA son capaces de lisar y extraer ácidos nucleicos ya sea de micelio en crecimiento activo o de esporas latentes.de hongos del DNA total extraído del suelo. La forma de las curvas indica si el número Hongos del suelo saprófitos y patógenos de plantas 265 . Sokal y Rohlf. por ejemplo. 1998). 2004). tales como logaritmo o raíz cuadrada pueden aplicarse antes del análisis (Houston et al. Como se ha discutido. constituye el primer conjunto de datos. Adicionalmente. por ejemplo. y también dan información sobre el esfuerzo de muestreo empleado en la investigación. otros factores. de acuerdo con la acumulación de las cepas muestreadas. 2006). un entendimiento más completo sobre las comunidades de hongos del suelo deberá centrarse en enfoques polifásicos con ensayos basados en cultivos y taxonomía molecular en asociación con el estudio de los procesos biogeoquímicos que ocurren en el suelo (Malosso et al. Singh et al. La pendiente de las curvas muestra cuáles son las muestras con mayor riqueza de especies. pueden añadirse al ANOVA para evaluar sus efectos y sus interacciones con otros datos cuantitativos (Setälä y McLean. fechas de colecta o diferentes tratamientos de suelo. El conjunto de datos preliminares usualmente no es adecuado para hacer los análisis de ANOVA. ANÁLISIS DE DATOS Una lista de especies o agregados de especies aisladas y su abundancia relativa en cada muestra. por lo tanto..

el análisis multivariado no se lleva a cabo en el total de comunidad debido a la naturaleza “ruidosa” de la frecuencia y a la distribución de especies raras.. Los resultados se muestran gráficamente y permiten el análisis de tendencias generales de la estructura de la comunidad (Gauch. Persiani et al. por ejemplo. al igual que en otras técnicas de ordenación. 1988. 1995). La diversidad de especies de cualquier sistema está compuesta por dos componentes: la riqueza de especies (el número de especies) y la equitatividad o equidad de la frecuencia de especies (Kennedy y Smith. 2003). explican la mayoría de la variabilidad de datos. La información sobre la estructura de la comunidad es mejor si se usa un análisis multivariado. 1994. por ejemplo. 1982. 1998. Curvas que no tienden a una asíntota indican que el número de especies podría aumentar si se aumenta el esfuerzo de muestreo (Bills y Polishook. Los índices de similitud (disimilitud) de diversidad para realizar comparaciones pareadas entre diferentes muestras también son usados con frecuencia (Magurran.. Los índices de diversidad son puramente numéricos y no proporcionan información sobre la estructura de la comunidad. Grishkan et al. El porcentaje de la varianza total explicada por el primer eje del AC y la contribución de las especies y muestras a la varianza (inercia) de cada eje apoya la designación de especies que ocurren en la comunidad como clave y “casual” (Howard y Robinson. 1995). De esta manera. El índice Shannon-Wiener se basa en la riqueza y equitatividad de la diversidad de las especies y se encuentra frecuentemente en la literatura (Dighton.de especies es estable después de la acumulación de todas las cepas. Muchos índices se han obtenido para evaluar y comparar la diversidad de especies. tales como los métodos de ordenación. común o rara y a la complejidad de los modelos matemáticos que se basan en la distribución de las especies. Howard y Robinson. 1994). se elige un límite (por ejem266 Manual de biología de suelos tropicales . las relaciones multidimensionales entre muestras y especies se reducen a un número reducido de ejes que. idealmente. basándose en su riqueza o equitatividad o tomando ambas variables y éstos cambian en función de la importancia relativa que se da a la especie dominante. Bettucci et al. De manera general. matrices de datos de gran tamaño (llenas de ceros) y datos de distribución no paramétricos. 1995). datos generados de conteos. y existen casos en donde dos comunidades distintas pueden tener el mismo índice de diversidad. El análisis de correspondencia (AC) y su versión modificada. 1993. análisis de correspondencia sin tendencia. son métodos de ordenación adecuados para la clase de datos generados de hongos y de otras comunidades. si las curvas tienden a llegar a una asíntota.).. En el caso de AC.

en donde las matrices son construidas con datos de presencia o ausencia de bandas distintivas (de manera ideal para especies diferentes) en los geles y la estructura de la comunidad es analizada posteriormente (Fromin et al. El estatus actual de las colecciones de recursos genéticos de hongos y los retos para apoyar la necesidad de la genómica de hongos. 2002.. Sheila Okoth por sus comentarios y discusiones durante la preparación del capítulo. Hawksworth. 1996). así como el análisis de conglomerados (cluster). 1% ó 5% del número total de aislamientos) y únicamente aquellas especies con una frecuencia de aislamientos igual o superior a este límite son incluidas en el análisis (Gauch. Los métodos de ordenación de análisis de componentes principales y análisis de correspondencia. es necesario que sean recopilados. 0. Kirsop. En el futuro. al igual que las aplicaciones prácticas y económicas de las especies (Smith y Waller. por lo tanto. Ryan y Smith. Las colecciones de referencia deberían ser apoyadas por países con una política fuerte en ciencia y tecnología dado que contienen información acerca de la distribución geográfica y de los hospederos. la biología molecular y la conservación de hongos han sido revisados recientemente (Hawksworth. 2003). 2002). Bettucci et al. Las colecciones de recursos genéticos hoy en día son solicitadas en todo el mundo. son normalmente empleados para derivar resultados procedentes de los métodos de huella molecular. 1992.. PRESERVACIÓN Y COLECCIÓN DE RECURSOS GENÉTICOS Los inventarios de biodiversidad proporcionan argumentos y algunas bases científicas para la preservación de hábitats y el uso sustentable de suelos. por lo que proveen material de trabajo básico para quienes estudian las características y la variación. 1996. Agradecimientos Al profesor Richard Mibey y a la Dr.plo.5%. Bettucci y Alonso. 2006). 1982. Oros-Sichler et al. 2004).. para la preservación a largo plazo de especímenes de resguardo será fundamental validar las entradas de secuencia y bases de datos genómicas. Hongos del suelo saprófitos y patógenos de plantas 267 . con el objetivo de la preservar las especies ex situ y de suministrar a instituciones de investigación e industrias de este material. 1995.. 2004a. como en el caso de la publicación de nuevos nombres (Agerer et al. 1993.

G. Applied Soil Ecology. Sampaio.. W. Bauer. Hallenberg. J. F.. pp.. E. 470–480. J. S. 642-644. R. Oberwinkler. FEMS Microbiology Ecology. Triebel. P.. I. vol.. E. Horak.. N. (2004) ‘Distribution of microbial communities in a forest soil profile investigated by microbial biomass. J. D. y Srivastava. R. 41–66. Soil Biology and Biochemistry.. C.E. Ennos. pp. L.. 268 Manual de biología de suelos tropicales . L. I. Begerow. (1998) ‘Detection and enumeration of a genetically modified fungus in soil environments by quantitative competitive polymerase chain reaction’. 5. F. Barratt. 6.. C. Beare. D. Bonants. M. R. D. Greenhalgh. Gams. R. soil biodiversity and agroecosystem function in the tropics. D. H. Hawksworth. pp. E. 769–779.. y Alonso. Mueller. vol. Baayen. R. (2004) ‘Diversity and ecology of soil fungal communities: Increased understanding through the application of molecular techniques’. soil respiration’. vol. 1566–1569. Dejardin. M. I. T. (1995) ‘The effect of wildfire on the opportunistic decomposer fungal community of Uruguayan Eucalyptus spp. M. Agnelli. Nannipieri.. Roebroeck. y Waalwijk. R. S. Tian. (2003) ‘Fungi are the predominant micro-organisms responsible for degradation of soil-buried polyester polyurethane over a range of soil water holding capacities’. P. Vikram Reddy. vol. 891–900. y Watling.. 87–108. A. O’Donnell. vol. vol. P. 6. Korf. M.. 25. G. 859–868. E.. M. M. 39.. y Pietramellar. pp. 78–85. Courtecuisse.. Robson. A. Bååth. 36–47. Anderson. A. (2000) ‘Gene genealogies and AFLP analyses in the Fusarium oxysporum complex identify monophyletic and nonmonophyletic formae speciales causing wilt and rot disease’.. the role of decomposer organisms’. Phytopathology. Canadian Journal of Botany. pp.. W. G. P. Campbell. Summerbell. Ascher. (2003) ‘Potential bias of fungal 18S rDNA and internal transcribed spacer polymerase chain reaction primers for estimating fungal biodiversity in soil’. C. 36.. R.P. P. y Handley. S. y Cairney. Halling. J. Baek. Blanz... pp. Weiss. pp. vol. pp. P. (2003) ‘Always deposit vouchers’ Mycological Research.. y Oberwinkler. J. C. Rambold. Environmental Microbiology.. (2006) ‘The simpleseptate basidiomycetes: A synopsis’.. 90. vol. D. Cigelnik.. Bettucci. 5. D. C. y Prosser. J. G. J. M. Kroon. Cortia. P. vol. 66. vol. N. K. M. G. 419–428. pp. C. R. (1988) “A critical examination of the soil washing technique with special reference to the effect of the size of the soil particles’. G... vol. Mycological Progress. pp. Ceccherini.. Environmental Microbiology. G. R. pp. Pedobiologia. Ammirati.... L. y Kenerley. 104.. Journal of Applied Microbiology. forest’. 95.REFERENCIAS Agerer.. C. R. Anderson. (1997) ‘Agricultural intensification. J. R.

M. M. vol. in G. B.. O. Elsevier. 43–48. K. 418–426. F. pp1378–1379. H. Cannon. G. vol. pp.. Bettucci. B. S. P. Malvarez... M. vol. 271–302. W. Bridge. Bills y M. M. Jansson. (2002b) Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. Lees. Powell. Bordjiba. in G. 160. J. D. (1994) ‘Abundance and diversity of microfungi in leaf litter of a lowland rain forest in Costa Rica’. S.. A. 72–82.. G. F. CAB International. Plant Pathology. 44. I. Mueller. pp. 37. pp. y Duncan. K. R. (2001) ‘Soil fungi. 606–623. Pedobiologia. Applied and Environmental Microbiology. y Ritz. Bury. L. pp.. y Panchal. D. S. (2002) ‘Detection of Colletotrichum coccodes from soil and potato tubers by conventional and quantitative real-time PCR’. J. y Hartin. (2003) ‘Soil fungal community structure in a temperate upland grassland soil’. pp. R. vol. vol. P. pp. B. y Spooner. Edwards. B.Bettucci. Microbial Ecology. I.. Mycological Research. 4356–4360. P. ppv147–154. Pedobiologia. 66. P. pp. 70. Crous. Toth. Griffith. G. y Baker. (1987) ‘Quantification of predatory and endoparasitic nematophagous fungi in soil’. vol. Foster (eds) Biodiversity of Fungi: Inventory and Monitoring Methods. Journal of Environmental Quality. vol. S. F. MN. Dackman. Spooner. Cullen. vol. y Thorn. pp. A. 46. 106. 232. F. 666–676. Phytopathology... y Guiraud. pp. (2002) “Paraná river delta wetlands soil microfungi’. P. Lundgren. pp994–998. (2001) ‘Removal of herbicides from liquid media by fungi isolated from a contaminated soil’. APS Press.. 89–93. Mycologia.. C.. pp. N. E. Amsterdam. vol. Kadri. M. (1980) ‘Induction of suppressiveness to Rhizoctonia solani in soil’.. (1996) ‘Filamentous fungi’. Roberts. W.. y Indarte. Bonkowski. (2000) ‘PCR primers that amplify fungal rRNA genes from environmental samples’.. F. Semadi. Rodriguez. Hall (ed) Methods for the Examination of Organismal Diversity in Soils and Sediments. New Phytologist. Bridge. Borneman. E. 187–198. B.. (2000) ‘Food preference of earthworms for soil fungi’. Wallingford. (2003) ‘On the unreliability of published DNA sequences’. Hongos del suelo saprófitos y patógenos de plantas 269 . vol. y Polishook. J. 86. vol. vol. M.W. Pedobiologia. 51. Bills. J. Dupont. K. 13. FEMS Microbiology Ecology. J. 127–145. Steiman. M. Crous. D. (1993) ‘Fungal communities of two grazing-land soils in Uruguay’. 105–114. F. J. D. M. Christensen. M. R. Chet. diversity and detection’. vol. (2002a) ‘Adhering to good cultural practice’. 281–292. pp. P. C. Olsson. P. y Roquebert. G. Brodie. 30. y Clipson. y Nordbring-Hertz.. (2004) ‘Saprobic soil fungi’. Plant and Soil. I. K. L. Bills. pp. St Paul. G. 45.

V. (2000) ‘Analysis of the dynamics of fungal communities in soil via fungal-specific PCR of soil DNA followed by denaturing gradient gel electrophoresis’. y Sinclair.. 43. 16. O. T.Cuvelle. St-Arnaud. H. 2nd edition. W... Enfield.. B. 343–404. y Alabouvette. D. C. Forestier. Dhingra. Recorbet. (2001) ‘Genetic diversity of Fusarium oxysporum populations isolated from different soils in France’. vol. Frankland.. Duarte. FEMS Microbiology Ecology. (2004) ‘Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils’. 397– 404. K. Dreumont. Plant Pathology. 133–151. A. (2007) Compendium of Soil Fungi. 61–71. 11. London. S.. (2003) ‘Direct quantification of fungal DNA from soil substrate using real-time PCR’. pp. CRC Press Inc. y Steinberg. Kluwer Academic Publishers. Teyssier. 53. y Rouxel. (1990) ‘Methods for studying fungi in soil and forest litter’. Eching. A.. R. Boca Raton. G. 47. D. (2000) Detection and Isolation of Soil Fungi. Jourdain-Miserez. Journal Microbiological Methods. (2002) ‘Fungal family trees: Finding relationships from molecular data’. (2002) ‘Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns’. Dordrecht. N. vol. pp. y Smit. The Netherlands. M. Fromin. M. vol. y Galpoththage.Davet. F. A. in R. Mycologist. E. M. Dighton. (1985) Basic Plant Pathology Methods. Gautheron. (1994) ‘Analysis of micromycete communities in soil: A critique of methods’. Pérez-Piqueres. J. 634–643. P. Science Publishers. vol. 22. IHW Verlag. pp67–76. y Anderson. Gams. F. H. M. pp. Norris (eds) Methods in Microbiology. Edena. M. Roesti. pp. y Rossi. G. 36. G.. Tarnawski. pp.... M. Domsch. W. J. Edel-Hermann. Dighton. Hillb. Dick. J. Journal of Microbiological Methods. G. R. N. Mycological Research. K. pp. 515–522. Environmental Microbiology.. vol. V. Gillet. Steinberg. pp. 98. Keijzer-Wolters.. A. G. J. S. (2001) Straminipilous Fungi. Aragno. vol. Grigorova y J. y Jabaji-Hare. C. y Boddy. vol. 796–798. 51–58. J. pp. vol. J. D... FEMS Microbiology Ecology. S. Hamelin. Down. 270 Manual de biología de suelos tropicales . vol. Edel. C. Filion. 49. Academic Press. F. M.. Elsas... N. L.. (2000) ‘An efficient baiting assay for quantification of Phytophthora cinnamomi in soil’.

A. pp.. and prognosis’. L. FEMS Microbiology Letters. Z. D. Studies in Mycology. Stalpers. Baarn. vol.. Watling y A. Frankland. (1992) ‘The analysis of communities of saprophytic microfungi with special reference to soil fungi’. Mendonça-Hagler. pp. C. D. pp. I. E. Hawksworth.Gams. significance and conservation’. prophylaxis.. Isaac. W. Applied and Environmental Microbiology. 3758–3766. Gonçalves. H. C. 78. Baarn.. Gomes. Rumjanek. J. Lower Nahal Keziv. Kluwer Academic Publishers. P. (1997) ‘Where are all the undescribed fungi?’. (1996) ‘Microbial collections as a tool in biodiversity and biosystematic research’. 9–18. (2004a) ‘Fungal diversity and its implications for genetic resource collections’. L. E. O. Grigorova y J. in R. A. Proceedings of the International Congress for Culture Collections. Alfenas. y Hughes. Cambridge University Press.. 161. D. Norris (eds) Methods in Microbiology. vol. P. Grishkan. A.. 26–35. y Aptroot. (1998) CBS Course of Mycology. pp13–15. Hawksworth. L. Hawksworth. pp. (2005) ‘Analyses of soil fungal communities in adjacent natural forest and hoop pine plantation ecosystems of subtropical Australia using molecular approaches based on 18S rRNA genes’... 41. pp. W. D. Jr (1982) Multivariate Analysis in Community Ecology. R. vol.. R. pp. 888–891. G. 95. in R. pp. 641–655. 183–223. Gams. A. G. vol. Costa. 87.. Israel’. vol. y Crous. Winterhoff (ed) Fungi in Vegetation Science. 69. Stouthamer (eds) Culture Collections to Improve Quality of Life. R. D. London. K. He. J. J. Samson. Hoekstra. 22. 310–342. vol.. Cambridge University Press. N. van der Mei y A. 527–539. R. L. D. W. 261–264. (2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. L. y Smalla. Phytopathology. C. Mycoscience. G. L. A.. L. vol. New York. Hawksworth. G. vol. census. western Upper Galilee. (1990) ‘Methods for studying the microbial ecology of soil’. A. magnitude. y Beharav. (2001) ‘Evaluation of bioassays to quantify Cylindrocladium inocula soil’. Gauch. 91–100. 247. A. Nevo. Maffia. CBS. y Rossman. Buchner. (1993) ‘The tropical fungal biota. M. Mycological Research. pp. Xu. Biological Journal of the Linnean Society. S. (2003) ‘Adaptive spatiotemporal distribution of soil microfungi in ‘Evolution Canyon’ II. N. The Netherlands. Gray. (2004b) ‘“Misidentifications” in fungal DNA sequence databanks’. C. Cambridge. Hawksworth. in S. Hongos del suelo saprófitos y patógenos de plantas 271 . pertinence. R. 4th edition. Academic Press. pp. D. Dordrecht. pp. Hawksworth. S. vol. T. S. New Phytologist. in W. J. (1991) ‘The fungal dimension of biodiversity. J. A. H. CBS. Whalley (eds) Aspects of Tropical Mycology. 50. Y. L. Wasser. Fagbola.

C. Isaac. 630–640. 62. L. C. Howard. A. Kirk. D. (ed) (1997a) Biodiversity of Tropical Microfungi. vol. B. Lang. L.. pp. vol. pp.. pp. pp293–302. M. Kirsop. G. pp. WFCC. Plant Pathology. Edwards. Hong Kong. A. W. L. R. Cambridge University Press. S. Plant Pathology. 74–83. Hyde. y Hartman. Kacprzak. 38. 170. Cambridge. pp. D. D.Houston. (1997b) ‘Can we rapidly measure fungal diversity?’. D. Whalley (eds) Aspects of Tropical Mycology. E. sp. Lee. K. Microbial Ecology. pp. vol. N. y Lautenschlager. (2003) ‘Changes in the structure of fungal communities of soil treated with sewage sludge’. (2001) Dictionary of the Fungi. y Smith. K. Applied and Environmental Microbiology. vol. Mycologist. vol.. in S. vol. (1996) ‘Nonradioactive method to study genetic profiles of natural bacterial communities by PCR single-strand-conformation polymorphism’. David. H. vol. C. (1993) ‘Nutrient cycling by fungi in wet tropical forests’. J. 176–178.. vol. J. Lodge. S. T. J. (2005) ‘Soil bacterial and fungal community structure across a range of unimproved and semi-improved upland grasslands’. J.. 50. M. Watling y A. Cannon. Visser. vol. N. C. 75–86. W. (1986) ‘Fungi of a forest soil nitrifying at low pH values’. L. Hyde. A. Li. J. 52. 3112 –3120. vol. D. (2003) ‘Molecular detection of Fusarium solani f. 11. y Stanczyk-Mazanek. Frankland. 38. A. A. vol. Hong Kong University Press. E. 51. World Federation of Culture Collections. (1995) ‘The use of correspondence analysis in studies of successions of soil organisms’. y Stalpers. pp. 518–527. L. R. 89–95. y Nicholson. G. J. pp. 63. (2002) ‘Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil’. Cheng. y Robinson. J. y Kim.. 4516–4522.. P. (1998) ‘Microbial processes and fungal community structure in soils from clear-cut and unharvested areas of two mixed wood forests’. 272 Manual de biología de suelos tropicales . S. S. P. (1995) ‘Soil microbial diversity and the sustainability of agricultural soils’. 39. pp. H. P. glycines in soybean roots and soil’. Cullen.. (1997) ‘Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16s rRNA’. F. y Jagnow. K. Lees. 9th edition. pp. Kennedy. Zo. Sullivan. P. Liu. y Forney. y Clipson. 257–265. S. 37–58. Kennedy. Marsh. 76. CAB International. pp. A. FEMS Microbiology Ecology. Wallingford. Plant and Soil. (ed) (1996) Access to Ex-situ microbial genetic resources within the framework to the convention on Biological Diversity. 463–473. Applied and Environmental Microbiology. Canadian Journal of Botany. K.. M. Y. Biology and Fertility of Soils. Pedobiologia. C.

(2002) ‘Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating’. (1998) ‘Application of denaturing gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology’.Lodge. y Smalla. Hopkins. Applied and Environmental Microbiology. E.. Mazzola. vol... M. 23–39. 36.. R. (2004) ‘Assessment and management of soil microbial community structure for disease suppression’. de Waal. G. y Nakanishi. J. A.. Malosso. vol. H. G. pp. 85–92. y Munch. Antonie van Leeuwenhoek.. O. G. J. F. pp. vol. Magurran. P. pp. vol. Phytopathology. C. 67. N. F. G. H. E.. (1977) ‘Selective inhibition of Pythium spp. (1993) ‘Profiling of complex microbial populations by denaturing gradient electrophoresis analysis of polymerase chain reacHongos del suelo saprófitos y patógenos de plantas 273 . pp. Editora UFLA. 6. D. 127–141. y Uitterlinden. G. (2001) ‘Comparative single-strand conformation polymorphism (SSCP) and microscopy-based analysis of nitrogen cultivation interactive effects on the fungal community of a semiarid steppe soil’. Muyzer. I. (2006) “Fungal diversity in maritime Antarctic soils determined using a combination of culture isolation. 266. 42. Brazil. 81. vol. (1970) ‘Detection. A. Princeton University Press. on a medium for direct isolation of Phytophtora spp. S. L. D. vol. B. M. (2002) ‘Mechanisms of natural soil suppressiveness to soilborne diseases’. isolation and pathogenicity of Phytophthora megasperma from soils and estimation of inoculum levels’. Waite. from soils and plants’.. E. Biodiversity and Conservation. Maidl. T. English. 557–564. y O´Donnell. M. M. Yoshikawa. Princeton. 35–59. K. vol. Schloter. A. 425–428. pp. 60. Mauchline. Antonie van Leeuwenhoek. E. FEMS Microbiology Ecology. Polar Biology. S. Kerry. J (1997) ‘Factors related to diversity of decomposer fungi in tropical forests’. X. pp. y Hirsch. (2002) Microbiologia e bioquímica do solo. 73 pp. Masago. 1846–1853.. 1687–1690. 29. A. K. 552–561. M. Phytopathology. R. Marks. vol. Fukada. pp. pp. y Siqueira. y Klein. L. Annual Review of Plant Pathology. (1988) Ecological Diversity and its Measurement. Mazzola. Smalla. J. 681–688 Lowell. Muyzer. (2004) ‘Effects of transgenic potatoes with an altered starch composition on the diversity of soil and rhizosphere bacteria and fungi’. Moreira. Plant and Soil.. y Mitchell. M. vol. vol. 68. D. A. Milling. pp. J. C. W. molecular fingerprinting and cloning techniques’. C. Lavras.

F. Adams. L. Thioulouse. O’Donnell. Lomsden. Ayers. y Cigelnik. C. y Pineda. J. 90. Ranjard.. Rodrigues. M. Gomes. A. Hong Kong. y Kantzer. vol. 695–700. Jung. N. (1994) ‘Theoretical and practical aspects of the quantification of biodiversity among microorganisms’. C. 51. A. Oros-Sichler. vol. Goodfellow. (2001) ‘Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints. K. F. J. F.. pp. D. pp. biological and methodological variability’. Mycological Progress. M... pp. Molecular Phylogenetics and Evolution. Applied and Environmental Microbiology. L. vol. J. Lews. 7. pp. M. J. 6. 41–49. A. 4479–4487.. H.. 31. pp. 871–877. Papavizas. J.tion-amplified genes coding for 16S rRNA’. L. 85–97.. and bait methods for detection of Pythium and Phytophthora zoospores in water’. 65–73. F. G. C. F. vol. citricola in soil samples from oak stands’.. Applied and Environmental Microbiology. M. P.. y Osswald. 65. G. G. Nechwatal. 345. F. vol. in K. (1994) ‘The foliar fungal endophytes of the Amazonian palm Euterpe oleraceae’. Casado. Biological Sciences. Journal of Microbiological Methods. A. Poly. E. W. culture. D.. 3. vol. R. G. R. Maggi. G. Plant Pathology.. Mycologia. (1998) ‘Diversity and variability in soil fungi from a disturbed tropical rain forest’. Dow. D. S. pp. 720–727. 86. J. (2006) ‘A new seminested PCR protocol to amplify large 18S rRNA gene fragments for PCR-DGGE analysis of soil fungal communities’.. C. L. Phytopathology. L. B. A. (1975) ‘Ecology and epidemiology of Rhizoctonia solani in field soil’. R. A. pp. (2004) “Taxon-specific fungal primers reveal unexpectedly high diversity during leaf decomposition in a stream’. O´Donnell.. E. Pfenning. Wakeham. Philosophical Transactions Royal Society London. K. y Hawksworth. M. J.. Schlenzig.. Nikolcheva. (1997) ‘Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous’. W. 67.. L.. Lata. y White. pp.. T. (2001) ‘A combination of baiting and PCR techniques for the detection of Phytophthora quercina and P. (1997) ‘Soil and rhizosphere microfungi from Brazilian tropical forest ecosystems’. M. Mycologia. 376–385. Mouguel. T. B. J. O. vol. 103–116. Duncan. Persiani. pp. M. Wainwright. K. Hong Kong University Press. y Smalla. y Nazaret. pp. vol. pp. vol. D. 59. pp. (2002) ‘Comparison of serological. A. vol. Pettitt. 274 Manual de biología de suelos tropicales . 206–214. Hyde (ed) Biodiversity of Tropical Microfungi.. Neuber. 341–365. and Bärlocher. D. Cooke. 63–75. Forest Pathology. G. vol..

biochemical and molecular fingerprinting methods’. V. Parkway Publishers. S. (1992) ‘Culture collections of microorganisms. Paul. A. (1998) Protocols for an All Taxa Biodiversity Inventory of Fungi in a Costa Rican Conservation Area. Tulloss. St.. pp. G. Pfenning. M.Rodrigues-Guzman. 3rd edition. vol.. y Rohlf. Potts. Mycological Research. 177–183. W. 72–82. E. (2006) ‘Investigating microbial community structure in soils by physiological. R. D. vol... D. Ryan.. M. P. M. (1992) ‘Competitive PCR’. 66. L. y Silveira. pp. H. y van Elsas. Schneider. Smit. E. y Smith. P. 108. 345-356. Rossman. (1992) “Direct recovery and molecular analysis of DNA and RNA from soil’. J. O´Dell. F. S. W.. 1351–1362. F. their importance in tropical plant pathology’. B. C. vol. J. pp. y Thorn. pp. 12. NC. Glandorf. L. APS Press. Ord. vol. B. in Eucalyptus clonal garden soils’. vol. 31. J. Mihail. special issue no 1. pp.. Umbuzeiro. Canhos. G... MN. pp. W. Sneh B. 17. R. MN. vol. B. Reid. S. y Larrick. P. D. D. (1992) Methods for Research on Soilborne Phytopathogenic Fungi. vol. pp. APS Press. APS Press. J. Freeman. J. Applied and Environmental Microbiology. A. D. (2002) ‘Comparison of baits to quantify inoculum density of Rhizoctonia spp. the Glomeromycota: Phylogeny and evolution’.. Paterson. E (2003) ‘Filamentous fungi isolated from estuarine sediments contaminated with industrial discharges’. Silva. M. T. Oecologia. P. 41–46. (1991) Identification of Rhizoctonia Species. Fitopatologia Brasileira. R. R. M. Munro. (1995) Biometry: The Principles and Practice of Statistics in Biological Research. 105. D. 359. C. Australasian Plant Pathology. Microbial Releases. y Waller. Nature.. Leeflang. Y. (2004) ‘Decomposition rate of organic substrates in relation to the species diversity of soil saprophytic fungi’. St Paul. New York. H. 57. L. y Rush. MN. E. y Millard. pp. Sanfuentes. P. y McLean. Sokal. E. Alfenas. pp.. 1413–1421 Selenska. L. 5–12. Schwarzott. Soil and Sediment contamination.. Burpee. European Journal of Soil Science. Singleton. K. y Esposito. W. Singh. R. vol. Smith. 2614–2621. A.. Maffia. A. pp. E. Setälä. 53–78. M. vol. (1984) Suppressive Soils and Plant Disease. Siebert. A. Mycological Research. pp. 139. Schuessler. y Klingmüller. J. 98–107. (2004) ‘Fungal genetic resource centres and the genomic challenge’. (2001) “Biodiversidad de los hongos fitopatógenos del suelo de Mexico’.. J. A.. y Walker C. y Ogoshi. (2001) ‘A new fungal phylum. H. Paul. (1999) ‘Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes enconding 18S rRNA and temperature gradient gel electrophoresis’. vol. St.. 557–558. Acta Zoológica Mexicana. M. L. Boone. Hongos del suelo saprófitos y patógenos de plantas 275 . E. 1. A.

A. Baldauf. 1070–1074.. Reddy. Tsai. Current Opinion in Microbiology. L. pp. P. E. 309– 317. S. J. D. vol. (2003) ‘Resolving functional diversity in relation to microbial community structure in soil. 58. S. nov. M. 2051.. 90. J. (1973) ‘Fungi from Canadian coniferous forest soils’. Journal of Microbiological Methods. APS Press. pp. 62. C. pp. D. C. 4288–4292. P. G. E. Widden. A. vol. St. M. exploiting genomics and stable isotope probing’. Tsao. 104. 276 Manual de biología de suelos tropicales . H. E. Vujanovic. L. vol. M. (1996) ‘An appraisal of soil fungal diversity: The crossroads between taxonomic and functional biodiversity’. vol. P. pp. Vandenkoornhuyse.. (1988) ‘Metabolic diversity of fungi in relation to growth and mineral cycling in soil: A review’. Y. Applied Environmental Microbiology. Pesticide Science. J.. Wainwright. 924–931. Yergeau.. 6. 295–301. Canadian Journal of Botany. y Visser. Canadian Journal of Botany. pp. 5. R. y Paul. its Biology. 51. 1027–1032. McQuilken. pp. (1993) ‘Use of fungal antagonists for biocontrol of damping-off and Sclerotinia disease’. Pasquier. Mycological Research. J. M. H. B. vol. I. (1998) Illustrated genera of imperfect fungi. (1991a) ‘A revision of the genus Trichoderma. Erwin. y Olson. 37. Bissett. E. Whipps. S. vol. Paul. Canadian Journal of Botany. Taxonomy. (2000) ‘Diversity of soil fungi studied by PCR-RFLP of ITS’. Ecology and Pathology. P. A. vol. J. Manuales para identificación Barnett. y Krsek. (2005) ‘A PCR-denaturing gradient gel electrophoresis approach to assess Fusarium diversity in asparagus’. APS Press. y St-Arnaud. vol. M. vol. P. C. P. 69. y Budge. (1996) ‘Isolation of saprophytic basidiomycetes from soil’. y Young. Biodiversity and Conservation. pp. A. Applied Environmental Microbiology. y Brygoo. MN. M. Bissett. pp. 2275–2290. 169–183.Thorn. Viaud. (2002) ‘Extensive fungal diversity in plant roots’. D.. Transactions of the British Mycological Society.’. y Parkinson. Infrageneric classification’. 4th edition. M. V. p. (1984) ‘A revision of the genus Trichoderma. 60. Section Longibrachiatum sect. vol. pp. II. pp. Straczek. W.. vol. C. y Hunter. B. 2357–2372. MN. H. S. y Bartnicki-Garcia. J.. Wellington. St Paul.. Science. 143– 154. pp. H. vol. Filion. Harris. 295. Y. (1992) ‘Rapid method for direct extraction of DNA from soil and sediments’. Berry.. M. 159–170. Leyval. Zak.. (1983) Phytophthora. 62.

O. CSIRO. Lynch. y Goodman. Minor. P. (1993) Coelomycetous Anamorphs with Appendage-bearing Conidia. London. Liles. F. Ellis. C. vol. B. R. M. II. y Anderson. Section Pachybasium’. W. Canadian Journal of Botany. Betterman. Brady. T. MN. D. M. Hanlin. y Pitt. P. Gams. K. L. Summerell. APS Press. M. J. A. M.. (1985) Microfungi on Land Plants: An Identification Handbook. I. (1976) More Dematiaceous Hyphomycetes. J. L. (2006) The Fusarium Laboratory Manual. W. Clardy. (2002b) Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. R. R. H. vol. St Paul.T. A. K. J. American Phytopathological Society. B. S. (1996) Phytophthora diseases worldwide. M. ‘A revision of the genus Trichoderma. J. pp. MN. Croom Helm.. MN. P. Crous. S. Baarn. 69. J. David. vols I and II. (1977) Chytridiomycetarum Iconographia. Hanlin. F. T. APS Press. Leslie. M. CMI. A.. A. B. Grossman. Tiong. IV. Erwin. H. London. vol. pp. J. Karling. Cramer. Ellis.. St Paul. J. Nag Raj.. Wallingford. T. Waterloo. Vaduz. A. J. Illustrated genera of Ascomycetes. The Netherlands.Bissett. MacNeil. B. P. J.. y Stalpers. Bissett.. (1991c). (2007) Compendium of Soil Fungi. D. R. CAB International. 1990.. Kew. A. Loiacono. London. 2nd edition.. Malden.. Handelsman. 2373–2417. CMI. M. Kew. y Ribeiro. Domsch. St Paul. St Paul.. MN. vol. (2001) Dictionary of the Fungi. F. Australia. 1997). Gilman. A.. Pitt. Rondon. J. III. R. 69. T. T. Hanlin. C. 3rd edition... Blackwell Publishers.. CBS. Cannon. CSIRO. Gams. P. S.. American Phytopathological Society. Canadian Journal of Botany. y Ellis. A. Ellis. (1998) CBS Course of Mycology. Co. Liechtenstein Kirk.. M. St Paul MN. E. M. R. I. Additional notes on section Longibrachiatum’.. M. August. 9th edition. B. expanded reprint (Richmond Publ. J. Eching.. I. Hoekstra. American Phytopathological Society. J. W. MA. y Bullock. (1991b) ‘A revision of the genus Trichoderma. Klich. K. S. Australia. IHW Verlag. Mycologue Publications. R. I. y Aptroot. (1998b) Combined Keys to Illustrated Genera of Ascomycetes. (1988) A Laboratory Guide to Common Aspergillus Species and Their Teleomorphs. North Ryde. R. 4th edition. Osburne. 2418–2420.. (1998a) Illustrated Genera of Ascomycetes. (2000) ‘Cloning the soil meHongos del suelo saprófitos y patógenos de plantas 277 . C. C. North Ryde. (1971) Dematiaceous Hyphomycetes. (2000) A Laboratory Guide to Common Penicillium Species. S.

MN.. vol. y Bartnicki-Garcia. 122. 1–59. G. A.ars-gring. D. (undated) ‘Trichoderma Online’. St Paul. B. pp. E. accessed November 2002. Mycological Papers. London. P. Waterhouse. 109. W. Frisvad. Systematic Botany & Mycology Laboratory. 1–50. M. CMI. (1983) Phytophthora: Its biology. 278 Manual de biología de suelos tropicales . y Filtenborg. B.gov/ taxadesciptions/keys/Trichodermalndex. R.. L. (1967) ‘A key to Pythium Pringsheim’. Sitios web Johnson. S. C. http://nt. S. O. P. Tsao. Waterhouse. 2541–2547. D.. Waterhouse. D. MN. C. Jr. Erwin. L. Farr. St Paul. M. Baarn. taxonomy. J. ecology and pathology. ARS. M.cfm. Mycological Papers. www. USDA. T. vol.. R. pp1–15. Hoekstra. 110. E. (1970) ‘The genus Phytophthora de Bary: Diagnoses or descriptions and figures from the original papers’. B. G. pp. Mycological Papers. APS Press. 6th edition. Sutton. (2000) Introduction to Food and Air-borne Fungi. Kew. Applied Environmental Microbiology. H. (1991) Identification of Rhizoctonia species. F.edu/people/padgett/book. J. Burpee. APS Press. (2002) ‘Biology and systematics of Saprolegniaceae’. vol. y McCray. G... Sneh.uncw. vol. y Padgett. C. A. The Netherlands.tagenome: A strategy for accessing the genetic and functional diversity of uncultured microorganisms’. Samuels. CBS. Samson. E. y Ogoshi. (1980) The Coelomycetes.. (1968) ‘The genus Pythium Pringsheim: Diagnoses or descriptions and figures from the original papers’. Seymour. G. 66. Chaverri. pp.

02g estreptomicina 0.2g pimaricina 0. MA2% .1g V8 agar V8 100 Ml CaCO3 2.0g KNO3 1.agar maltosa peptona maltosa 4.02g estreptomicina 0. (1998) y Erwin y Ribeiro (1996).agar papa zanahoria papa 20g zanahoria 20g agar 18g CA – agar zanahoria zanahoria.0g penicilina 0.1g agar 18g MP5.0g MgSO4 x 7H2O 0.2g pimaricina 0.Apéndice 8. molida 100g agar 18g penicilina 0.0g agar 18g agua destilada 900 ml PARP harina de maíz 17g pimaricina 10mg ampicilina 250mg rifampicilina 10mg pentacloronitrobenceno 100mg himexazol 50mg AHM + p.5g KCL 0.0g peptona 1.p.2g agar 18g OA – agar harina de avena Copos de avena 30g Agar 15g ADP – agar dextrosa y papa papa.s.02g estreptomicina 0.0g agar 18g Antibióticos.agar extracto de malta extracto de malta 20g agar 18g SNA – agar sintético pobre en nutrientes KH2PO4 1.1g Hongos del suelo saprófitos y patógenos de plantas 279 . –agar con harina de maíz harina de maíz 8.5g glucosa 0.p.2g pimaricina 0.1 Medios de cultivo y aditivos: cebos Las recetas son para un litro. cubitos 200g dextrosa 20g agar 18g PCA.s zanahoria. si es necesario penicilina 0. basados en Gams et al. molida 100g agar 18g CA + p.2g sacarosa 0.

papa. papel celofán. Sustratos celulósicos: semillas de Sorghum. Sustratos quitinosos: piel de serpiente.Cebos El uso de cebos es imprescindible para la recuperación de zoosporas formadas por hongos de sustratos complejos como el suelo. hojas secas de maíz. Sustratos queratinosos: cabellos de niños rubios. trozos de manzana. alas de insectos. Dependiendo del tipo de hongo pueden ser utilizados cebos específicos. zanahoria o pepino. epidermis de cebolla. exoesqueleto de camarones. los de origen animal son esterilizados usando luz UV por una hora. granos de polen de Pinus. Los cebos de vegetales pueden ser lavados. 280 Manual de biología de suelos tropicales .

Los daños que producen las moscas de la fruta se dan durante la fase inmadura. con una punta larga y delgada. al final del abdomen. 1996).. Las moscas de la fruta muestran un comportamiento y una taxonomía complejos (Bateman. y a la familia Tephritidae. 1988).. las moscas de la fruta son consideradas una de las más preocupantes. 1996. volviéndola 281 . 1992). Bactrocera. que se extienden globalmente. y su sexo es fácilmente distinguible debido a que las hembras tienen un prominente ovopositor. Algunos estudios han acentuado aspectos ecológicos y etológicos de las moscas de la fruta. ya que representan plagas primarias para la mayoría de los cultivos frutales. Zucchi et al. Steck y Wharton.Capítulo 9 Muestreo. Rhagoletis y Dacus. el periodo durante el cual la larva destruye la pulpa de la fruta. excepto en la Antártida (White y ElsonHarris. Su clasificación se basa exclusivamente en los caracteres morfológicos del adulto. enfocados a las fases de pupa y larva (Silva et al. Ceratitis. en su mayor parte. éstas pertenecen al orden Díptera. Se distinguen cinco géneros importantes de esta plaga: Anastrepha. preservación e identificación de moscas de la fruta Neliton Marques da Silva INTRODUCCIÓN Entre las plagas de la fruta de América tropical. debido al gran impacto económico que causan. Se trata de insectos multivoltinos con un potencial biótico relativamente alto y una gran capacidad para infestar diferentes especies de frutos nativos y exóticos. 1972. 2000). Las características taxonómicas que permitan distinguir sexos entre pupas y larvas aún no se han determinado (Salles.

las larvas migran de la fruta para pupar en el suelo (Ilustración 8a). junto con el suelo. azúcar al 10% o jarabe de caña de azúcar al 10%. La fase pupal dura de 8 a 10 días. sobre todo. Después de que la fruta infestada cae. Estos antagonistas juegan un papel importante en el control biológico de las moscas de la fruta. El desarrollo de la pupa ocurre en el suelo. Esta profundidad varía dependiendo de las condiciones físicas del suelo. y constituye una de las fases más vulnerables al estrés abiótico y a muchos enemigos naturales. Aun cuando las larvas son parasitadas dentro de los frutos. durante una parte de su ciclo de vida. Antes de llegar al estado adulto. 282 Manual de biología de suelos tropicales .inservible para cosecha o consumo. los procedimientos para muestrear varían de acuerdo con la fase y el propósito. En el caso de la mosca adulta. normalmente. dependiendo de la temperatura y de la humedad. por lo tanto. en su mayor parte depredadores y entomopatógenos como bacterias. la mosca de la fruta es un habitante temporal del suelo. sin embargo. Debido a que el ciclo de vida involucra las partes aéreas de la planta hospedera. resulta de suma importancia que en el diseño de la estrategia del manejo integrado de plagas se tome en cuenta la biodiversidad del suelo como un factor fundamental que influye en la mortalidad de larvas y pupas. que también forman parte de la biota del suelo (véase Capítulo 10). Los cebos deberán reemplazarse cada semana y los especímenes capturados. que es diurna y responde a estímulos visuales y olfativos. hongos y nematodos. ramas o semillas en donde las larvas de la mosca residían previamente. el parasitoide adulto puede emerger en el suelo.5 y 9). se puede utilizar jugo de fruta al 10%. esta técnica representa una relación ambigua entre la mosca y su hospedero. De manera alternativa. puesto que ésta sólo se puede establecer usando frutos infectados. la humedad y la textura. la mosca de la fruta se puede considerar un organismo del suelo. las larvas se mueven sobre la superficie del suelo buscando condiciones adecuadas para su desarrollo y penetran hasta una profundidad aproximada de 10 cm para entrar en la fase de pupa. el uso de trampas con cebos alimenticios es lo más recomendable. 200 ml de proteína hidrolizada de maíz (5% en agua preservada con tetraborato de sodio con un pH entre 8. en función de la temperatura. de ahí que. MUESTREO DE LA MOSCA DE LA FRUTA El muestreo de adultos de moscas de la fruta se lleva a cabo utilizando trampas McPhail (Ilustración 8b) con atrayente alimenticio. pues sólo permanece ahí durante una etapa de su vida. por ello. removidos.

si lo hay. La etiqueta deberá incluir la información básica de muestreo y el número de la trampa. Hasta cinco trampas por hectárea pueden ser instaladas en áreas con arbustos o árboles (jardines caseros). En el caso de plantas herbáceas. dispuestos en forma de trípode. M. la trampa puede utilizar como soporte tres palitos. 60° 04´W 23/Marzo/2006 Silva. primero será necesario separar las moscas de la fruta de otros especimenes. mientras que. esto se puede llevar a cabo en el campo o en el laboratorio.5 mm para remover las moscas y separarlas de otros grupos taxonómicos utilizando unas pinzas curvas. COLECCIONANDO LOS ADULTOS CAPTURADOS Debido a la probabilidad de que distintos grupos taxonómicos de insectos sean capturados. el contenido de la trampa deberá pasarse por una malla de nylon de 1. o bien. El número de trampas por unidad de superficie puede variar de acuerdo con los objetivos del proyecto. Si el objetivo es monitorear plagas. con alcohol al 70% para su identificación posterior. Por ejemplo: Manaus-AM Brasil 04° 05`S. Las trampas deberán ser colocadas de manera equidistante. cada tipo de uso de suelo existente debe ser monitoreado con la misma densidad de trampas. Trampa No 5 • • • • • También deberá ser registrada la identidad de individuos de otros grupos taxonómicos capturados en las trampas. preservación e identificación de moscas de la fruta 283 . hasta tres por hectárea son las recomendadas para plantaciones herbáceas. Se anota el sexo y se colocan en frascos de vidrio (de alrededor de 50 ml) etiquetados. Cuando los cebos son reemplazados. N. la densidad deberá ser de tres a cinco trampas por hectárea o estar de acuerdo con el tipo de uso de suelo existente en el predio. Muestreo. Cuando el objetivo es el manejo integrado.Las trampas se instalan en el centro del dosel de los árboles y su localización será tomada con GPS. una trampa cada cuatro hectáreas resulta suficiente. es decir. colocarse sobre un árbol adyacente.

Después de emergidas. OBTENCIÓN DE LAS PUPAS La vermiculita o arena fina deberá pasarse por una malla galvanizada. se depositan en charolas de plástico con una capa de vermiculita o arena fina como substrato de pupación. el aculeo de la hembra bajo un microscopio estereoscó284 Manual de biología de suelos tropicales . para permitir la salida de las moscas adultas y/o parasitoides.MUESTREO DE LA FRUTA Para poder establecer la relación entre las especies Anastrepha con sus plantas hospederas. durante 48 horas para permitir el endurecimiento cuticular y la pigmentación completa de los patrones alares (Ilustración 8c): características de gran importancia para la identificación taxonómica. Las fechas de emergencia. se protegen con bolsas de tela y se transportan en cajas térmicas hasta el laboratorio. las charolas se cubren con una tela de gasa y se aseguran con ligas de plástico para prevenir que se escapen las moscas adultas al emerger. los especimenes recuperados son fijados en una solución de alcohol al 70%. las moscas adultas son alimentadas con una solución de miel disuelta en agua al 10% que será cambiada cada día. de 1. se recogen frutos al azar en diferentes agroecosistemas y en diferente estado de de maduración. La determinación de la relación de sexos hembra-macho (SR) para moscas adultas y parasitoides se hace de acuerdo con Silveira-Neto (1976) en función de la siguiente ecuación: Número de hembras SR= Número de hembras + Número de machos IDENTIFICACIÓN DE ESPECIES La identificación taxonómica de especies de Tephritidae se basa en un examen ventral de la región apical. se pesan. con sus respectivas etiquetas de identificación. Los adultos emergidos serán retenidos. el número y el sexo deberán quedar registrados con relación a las moscas o parasitoides. Estas jaulas deberán ser examinadas diariamente. Finalmente. Posteriormente. Finalmente.5 mm. Los frutos deberán ser colectados directamente de los árboles o inmediatamente después de caer al suelo. para separar las pupas que posteriormente serán colocadas en jaulas. se cuentan y se separan para cada sitio de muestreo. Los frutos muestreados se separan por especie.

utilizando un microscopio de transmisión (100X). Silva (1993). Departamento de Zoologia. Holos. coloración de cuerpo. in A. Norrbom. University of São Paulo. Salles. especialmente. Malavasi and R. es necesario extraer completamente el aculeo de la funda del ovipositor con ayuda de agujas o pinzas (Ilustración 8d). Secretaria da Agricultura. tergito medio. o que éstas sean incorporadas a la colección institucional del laboratorio. R. La identificación de especies del género Anastrepha se logra para las hembras adultas. 4. daciformis.pico (40X) o mediante el montaje sobre laminillas para examinar estas estructuras. Vanzolini (ed) A Catalogue of the Diptera of the Americas South of the United States. como las de Lima (1934). M. in M. PhD Thesis. PhD thesis. (1967) ‘Family Tephritidae’. H. las características morfológicas del aculeo (Ilustración 8e) con especímenes de museo o usando claves taxonómicas. En primer lugar. C. Lima. São Paulo. Foote. REFERENCIAS Bateman. (1985) ‘Phylogenetic analysis and taxonomy of the cryptostrepha. São Paulo. A. The Pennsylvania State University. Pennsylvania. no. Ronchi-Teles. 493–518. Stone (1942). 17. Muestreo. Foote (1967). Es recomendable que se depositen ejemplares de referencia en colecciones de museo. Steyskal (1977). Brazil. A. 1868 (Diptera: Trypetidae)’. Escola Superior de Agricultura “Luiz de Queiroz”. Brazil. mesonoto. L. como lo describe Zucchi (1988). Ribeirão Preto. pp. (1993) “Levantamento e análise faunística de moscas-das-frutas (Diptera: Tephritidae) em quatro locais do Estado do Amazonas’. Manaus. B. vol. Ronchi-Teles (2002). 28. N. Zucchi (1978 y 2000) y Norrbom (1985). Federal University of the Amazon (UFAM) and National Institute for Agricultural Research (INPA). pp. preservación e identificación de moscas de la fruta 285 . A. (1934) “Moscas-de-frutas do gênero Anastrepha Schiner. 487–575. (1972) ’The ecology of fruit flies’. A. Annual Review Entomology. Zucchi (eds) Moscas-das-frutas de importância econômica no Brasil: Conhecimento básico e aplicado. M. A. (2002) “Ocorrência e flutuação populacional de espécies de moscasdas-frutas eparasitóides com ênfase para o Gênero Anastrepha (Diptera: Tephritidae) na Amazônia Brasileira’. vol. Memórias do Instituto Oswaldo Cruz (Rio de Janeiro). robusta and schausi species groups of Anastrepha Schiner (Diptera: Tephritidae)’. PhD Thesis. abdomen y. (2000) ‘Biologia e ciclo de vida de Anastrepha fraterculus (Wied. comparando el patrón alar. Silva.)’. L.

Zucchi. Annals of the Entomological Society of America. no. G. R. (1996) ‘The natural hosts plants of Anastrepha (Diptera: Tephritidae) in the State of Amazonas. limae. Nakano. Silva. Steck. CRC Press. R. A. 1–112. Zucchi. (1992) Fruit Flies of Economic Significance: Their Identifications and Bionomics.. A. and A. J. A. S.Silva. Stone. Steyskal. y Nova. Steck and B. M. S. Malavasi and R. 994–1003. R. in G.. L. A. Zucchi. M. R. in A. Barbin. D. hosts and lectotype designations’. vol. Holos Zucchi. Fundação Cargill. CRC Press. C. Boca Raton. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. Zucchi (eds) Moscas-dasfrutas de importância econômica no Brasil: Conhecimento básico e aplicado. M. M. Entomological Society of Washington. 6. São Paulo. R. Campinas. Boca Raton. y Wharton. Silveira Neto. (1978) “Taxonomia das espécies de Anastrepha Schiner 1868 (Diptera: Tephritidae) assinaladas no Brasil’. Steck and B.. S. M. University of São Paulo. O. A. 286 Manual de biología de suelos tropicales . J. A. N. (2000) ‘Taxonomia’. (1988) “Moscas-das-frutas (Dip. Ceres. distribuição geográfica e hospedeiros”. in G. N. A. R. A. A. PhD Thesis. White. (eds) (1976) Manual de Ecologia dos Insetos. United States Department of Agriculture Miscellaneous Publications. y Elson-Harris. grandis (Diptera: Tephritidae)’. São Paulo. Tephritidae) no Brasil: taxonomia. V. and Silveira Neto. Zucchi. A. Escola Superior de Agricultura ‘Luiz de Queiroz’. I. y Silveira Neto. Ribeirão Preto. (1977) Pictorial Key to Species of the Genus Anastrepha (Diptera: Tephritidae). pp. CAB International. pp. A. in H.. (1996) ‘Anastrepha species (Diptera: Tephritidae) from the Brazilian Amazon: Distribution. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. Brazil’.. Wallingford. (1942) ‘The fruit flies of the genus Anastrepha’. de Souza (ed) Moscas-das-frutas no Brasil. N. (1988) ‘Description of immature stages of Anastrepha interrupta. M. Washington DC. J. 439. vol. 81. A.

Jr y Ricardo Sousa Cavalcanti INTRODUCCIÓN Existe alrededor de medio millón de especies de insectos descritas en la tierra. para resistir la enfermedad.Capítulo 10 Hongos y nematodos entomopatógenos Alcides Moino. Esto es similar a la dinámica natural que sucede en el campo entre el patógeno y su hospedante. y que han demostrado su 287 . Si se asume que cada especie de insectos es susceptible a por lo menos un microorganismo patogénico. prevenir su ocurrencia en insectos benéficos. sin intervención humana. De éstas. o bien. El control microbiano es una forma de control biológico cuyo principio es el uso racional de entomopatógenos sin que necesariamente se eliminen las poblaciones de plagas. Los principales microorganismos utilizados. frecuentemente hospedante-específico. el primero para llevar a cabo el proceso de infección y el segundo. el 10% pueden considerarse plagas agrícolas forestales o urbanas. ello da la idea de la potencial importancia del estudio de estos patógenos de insectos en el contexto de control de plagas y de biodiversidad. pero sí manteniéndolas en niveles por debajo del umbral de daño económico. con el fin de utilizarlas como mecanismos de control de especies que son plaga. aunque la cifra verdadera de diversidad puede ser mucho mayor (Groombridge. aproximadamente. Las enfermedades son procesos dinámicos en donde el patógeno (microorganismo) y el hospedante (insecto) están adaptados morfológica y fisiológicamente. 1992). La patología de insectos es la ciencia que estudia las enfermedades de insectos.

causar la muerte rápida del hospedante y provocar grandes niveles de mortandad en las poblaciones de éste) y causar epizoóticas periódicas (Chandler et al. Un pequeño número de especies generalistas con capacidad para ser cultivadas y producidas de manera masiva. la Sterneinematidae y la Heterorhabditidae que son parásitos obligados de insectos y que son la base de varios plaguicidas biológicos diseñados específicamente para su uso en contra de plagas del suelo como los gorgojos y las larvas de mosca.5 mm de largo. Se conocen cientos de especies de hongos entomopatógenos que atacan una amplia gama de insectos y ácaros. los virus. Roy et al. 2006). La mayoría de los patógenos poseen una estrategia de transmisión de “sentar y esperar” (sensu Ewald. invadiendo su cuerpo y matándolo de cuatro a diez días posteriores a la infección. las bacterias que se introducen junto con el parásito se multiplican rápidamente y matan al hospedante.potencial en el control microbiano de insectos son: los hongos. Después de una a dos semanas posteriores a la invasión del hospedante. y convirtiéndose posteriormente en adultos. 1993). permitiendo que los nematodos crezcan y maduren sobre el tejido en descomposición. 1994.. en donde pueden ser excepcionalmente virulentos (o decir. éstos aparentemente son componentes diversos y universales de las biotas del suelo. pobre persistencia (especialmente bajo condiciones tropicales) y su baja eficacia cuando se compara con los insecticidas químicos (por ejemplo. ambos presentan desventajas debido a su alto costo. aparece una nueva generación de estadios infectivos (Kaya y Gaugler. se producen miles de nuevas esporas que se dispersan y continúan su ciclo de vida en nuevos hospedantes. penetrando directamente la cutícula o a través de las aperturas naturales como los espiráculos. con varios grados de especificidad con su hospedante (Hajek y St. se han utilizado como biopesticidas para su uso contra poblaciones de plagas. Los nematodos entomopatógenos miden alrededor de 0. los nematodos y los protozoarios. 1997. como es el caso de Lecanicillium logisporum. aunque esta tecnología no se ha adoptado por completo en la práctica. Una vez muertos los insectos. Existen dos familias. 1995). A pesar del éxito limitado de hongos y nematodos entomopatógenos como productos biocidas. Leger.. Myers y Rothaman. los basados en toxinas). Los hongos producen esporas que germinan al contacto con el hospedante. baja persistencia e inactividad a bajas temperaturas (en el caso de los nematodos). las bacterias. Los estadios juveniles parasitan a sus hospedantes. debido a su alto costo. a pesar de ello. 1995): los organismos producen fases infectivas que son liberadas al ambiente cuando muere el hospedante 288 Manual de biología de suelos tropicales .

Entomophthora. Aunque los artrópodos que viven por encima del suelo. Entomophaga. el suelo es.. Estas estructuras vegetativas son llamadas hifas. sugiriendo de nuevo que los patógenos se distribuyen ampliamente en el suelo.. Neozygites). Hirsutella thompsonii. M. que constan de células alargadas provistas de una pared que contiene celulosa y quitina. Metarhizium anisopliae. Los hongos de mayor interés por su potencial como patógenos de insectos son: Beauveria bassiana. son susceptibles a hongos y nematodos. Los hongos poseen una gran variabilidad genética y un amplio rango de hospedantes. H ongos y nematodos entomopatógenos 289 . BIOLOGÍA DE HONGOS Y NEMATODOS ENTOMOPATÓGENOS Hongos Los hongos son microorganismos unicelulares (levaduras) o multicelulares (especies filamentosas). En el caso de los hongos entomopatógenos esto se apoya en evidencia molecular que muestra que poblaciones en suelo no son totalmente clonales. aunque su eficiencia competitiva en comparación con otros saprótrofos de vida libre puede ser baja. y hongos del orden Entomophthorales (Zoophthora. lo que les permite mayor distribución geográfica de la población y alta movilidad. Lecanicillium lecanii. ello a pesar de la ausencia de fases sexuales manifiestas y que el significativo flujo de genes ocurre localmente (Bidochka et al. sin duda.. Después de la infección exitosa de un hospedante. además de otros carbohidratos y proteínas. el reservorio de las fases infectivas. flavoviride. Aschersonia aleyrodis. como los que habitan debajo de éste. Las fases de diapausa y latencia reducen la dependencia en la movilidad de su hospedante y pueden complementarse con la capacidad para vivir saprotróficamente en suelo. 2001). Esta capacidad es una adaptación a sus hospedantes artrópodos que son más grandes y con patrones de distribución en parches.y tienen la capacidad de entrar en un estado de letargo o diapausa y permanecer latentes hasta que haya nuevos hospedantes disponibles. debido a que ofrece un microambiente estable con una estructura de poros favorable para nematodos y recursos orgánicos para hongos. Nomuraea rileyi. Cordyceps spp. Paecilomyces spp. Con frecuencia no hay correlación entre la densidad del hospedante y la ocurrencia de la enfermedad. se producen asexualmente estructuras reproductivas conocidas como esporas o conidias que ayudan a la diseminación del patógeno.

La población microbiana en cualquier ambiente natural es muy grande y por lo tanto. en el caso de los hongos. Por lo general.. los nematodos entomopatógenos presentan una estrecha asociación (simbiosis) con bacterias específicas. A continuación se describen dos técnicas básicas para el aislamiento de hongos y nematodos entomopatógenos a partir de muestras del suelo. 290 Manual de biología de suelos tropicales . 1986.. cuando el objetivo del muestreo es evaluar la biodiversidad (por ejemplo. las cuales son los agentes primarios que inician la infección en el hospedante. cuando un insecto muerto es recogido para el cultivo de inóculo infectivo. 1998A) Las muestras de suelo se colectan a una profundidad de 0 a 20 cm y se colocan en bolsas de plástico debidamente etiquetadas. en el suelo). La identificación correcta de un agente entomopatógeno. METODOLOGÍA PARA EL AISLAMIENTO DE HONGOS ENTOMOPATÓGENOS (Chase et al. la identificación se fundamenta en medidas hechas a partir de estructuras presentes en los estadios juveniles infectivos. Alves et al. también pueden obtenerse resultados semejantes y se requerirá de medidas adicionales para identificar patógenos con potencial. parasitismo obligado y parasitismo facultativo. espiráculos y ano. De igual manera. bacterias y otros microorganismos saprotróficos que no tienen potencial como agentes específicos para el control de plagas. aislar poblaciones. Sin embargo. es muy común encontrar también hongos. para lograr una buena identificación es necesario aislar el microorganismo en cultivos puros o al menos. y dentro de éste a las familias Steinernematidae y Heterorhabditidae.Nematodos Los nematodos entomopatógenos son organismos pseudocelomados vermiformes muy similares a los que parasitan plantas y que pueden asociarse con los insectos de tres formas: forecia (adherencia pasiva y transporte). Liud et al. en el caso de los nematodos. En cada sitio de muestreo.. Estas bacterias se multiplican dentro del insecto y lo matan al causarle septicemia (infección generalizada). se basa en caracteres morfológicos del organismo en cultivo y en la estructura de los conidióforos y conidias. Los principales grupos de nematodos de interés pertenecen al orden Rhabditida. 1993. Los nematodos transportan internamente bacterias específicas que son liberadas en el interior del cuerpo del insecto después de que el nematodo penetra a través de aberturas naturales como boca.

con la subsecuente purificación de los cultivos (Figura 10. tales como conidióforos. Después de este paso se toman 0. Esto suele ser efectivo especialmente con Metarhizium anisopliae. El medio ADP se prepara de la siguiente manera: 15 g de agar..2) y almacenaje de conidios en condiciones de congelación utilizando tubos Eppendorf para tal fin. 1998b. 550 mg de dodina (N-dodecilguanidina acetato). el volumen añadido se reparte sobre la superficie utilizando una asa de Drigalski (ya sea de acero inoxidable o vidrio). utilizando agua destilada esterilizada hasta alcanzar una dilución 10-4. En el laboratorio se debe mezclar muy bien la muestra compuesta y tomarse alícuotas de 1g de suelo.1ml y se colocan en medio de cultivo selectivo (el cual contiene el fungicida dodina) y en medio ADP (Agar-Dextrosa-Papa).1 ml de la última dilución y se colocan sobre la superficie del medio de cultivo contenido en una caja Petri. 1998).1). Beauveria bassiana y Paecilomyces spp. Después de la incubación. Las cajas se incuban a 27°C (Figura 10. Samson et al. 20 g de dextrosa.) puede llevarse a cabo usando un microscopio compuesto y claves de identificación basadas en caracteres morfológicos de las estructuras reproductivas. conidias y fiálides (Alves et al. H ongos y nematodos entomopatógenos 291 . se esteriliza durante 20 minutos a 120°C y se filtra. se añade agua destilada hasta alcanzar el volumen original de 1 litro y posteriormente se añaden 20 g de agar. A partir de estas alícuotas se preparan diluciones 10-1 sucesivamente. 5.se toma una muestra compuesta a partir de seis submuestras tomadas en puntos localizados alrededor de un monolito central (véase Capítulo 2)..0 mg de tetraciclina y 10 mg de cristal violeta. la identificación de los cultivos de interés (principalmente Metarhizium anisopliae. aunque puede prescindirse de él. El fungicida dodina se añade en pequeñas concentraciones (cerca de 10 mg ml-¹) al medio selectivo con el fin de aislar hongos entomopatógenos a partir del suelo y preservar los aislamientos menos susceptibles al fungicida. De las diluciones 10-3 y 10-4 se toman 0. y agua destilada hasta completar el volumen total de un litro. 200 g infusión de papa (preparada a partir de papas rebanadas y hervidas para extraer el almidón). Estas muestras pueden tomarse mediante el método de extracción de núcleos (véase Capítulo 4: Mesofauna). El crecimiento de los hongos y su esporulación se evalúan de 7 a 15 días posteriores a la inoculación. El medio selectivo de dodina se prepara de la siguiente manera: 20 g de harina de avena + 1 litro de agua destilada.

b) inoculación de la suspensión (alícuota de 0. c) incubación bajo condiciones controladas en una cámara DBO.2 Cultivos purificados de Beauveria bassiana. creciendo en medio ADP. y transfiriéndola a una caja Petri nueva con medio de cultivo ADP (tres puntos de inoculación por caja).Figura 10.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) dilución seriada de la suspensión acuosa que contiene al hongo. Nota: la separación de contaminantes se logra recogiendo una pequeña porción de cualquiera de las colonias del hongo de interés con una aguja. d) almacenaje de conidios en tubos Eppendorf. 292 Manual de biología de suelos tropicales . bajo condiciones de congelación. Figura 10.1 ml) en una caja petri con medio de cultivo.

000 estados infectivos ml-¹.1M NaCl. que contienen las muestras de suelo y se mantienen cerradas a 23°C en oscuridad.05M KH2PO4. La detección de nematodos se lleva a cabo mediante bioensayos. 2002). Después de dos días. ZnSO4.) (Lepidoptera: Pyralidae). CuSO4 0 1μM. si se encuentran estados infectivos en el líquido. El medio “S” consiste en un litro de solución madre (0.7H2O 0. 0.. La suspensión se deja reposar para permitir que los nematodos queden en el fondo.4M. éstos deben colectarse y colocarse en agua destilada dentro de un frasco Becker. H ongos y nematodos entomopatógenos 293 .4M. Figura 10. Las larvas de este lepidóptero son conocidas como mealworms (o gusanos de la harina).0. Na EDTA 0. pH 6. FeSO4. y pueden adquirirse comercialmente. Posteriormente. 1974) Se recogen las muestras de la misma forma que fue descrita anteriormente. 2004.. 1998b. Las larvas se colocan en cajas de plástico de 500 ml. La mortandad de las larvas se evalúa después de cinco a siete días. CaCl2 0.7H2O 0. el cual cae hasta tocar el líquido en el borde de la caja inferior. La identificación se lleva a cabo con base en las claves específicas de identificación para cada familia de nematodos (Steinernematidae y Heterorhabditidae) (Alves et al.METODOLOGÍA PARA EL AISLAMIENTO DE NEMATODOS ENTOMOPATÓGENOS (Bedding y Arkhurst.6mM. Los nematodos se almacenan en envases cerrados de 50 ml a 11°C o cercano a esa temperatura. Los ejemplares de nuevas especies pueden someterse a un análisis molecular para así comparar los patrones de DNA.3) para colectar los estadios juveniles infectivos a partir de los cuerpos muertos.3M. Una trampa de White se puede construir utilizando dos cajas Petri: una caja de 5 cm de diámetro se coloca invertida dentro de una caja de 9 cm que contiene agua esterilizada o medio “S” esterilizado y cubierta con un círculo de papel filtro de 9 cm.1mM. Las larvas de insectos infectadas se colocan en el centro del papel filtro. Las larvas muertas se colocan en una trampa White (Chen et al. MgSO4 0. Adams y Nguyen. la suspensión se lava adicionando una solución de formaldehído (1%) o solución de Ringer para obtener una concentración final de 10.3mM. utilizando la técnica de trampas de insectos con cinco larvas de Galleria mellonela (L. 1μM colesterol) a la que se le añaden 26 ml de una solución nutritiva fresca que contiene citrato de K 0.

Alves. (1974) ‘A simple technique for the detection of insect parasitic nematodes in soil’. C. REFERENCIAS Adams. Moino Junior. A. y Castello Branco Jr. L. B. L. J. FEALQ. J. Alves (ed) Controle Microbiano de Insetos. Nematologica. M. y De Croos. y Alves. M. Alves (ed) Controle Microbiano de Insetos. M. Deckoning. J. c) larvas que muestran la patología típica de infección por nematodos.. pp. y Akhurst. J. in R. T. A. Bedding. Piracicaba Brazil.. 2nd edition. K.. J. Almeida. S. A. R. E.. B. B. y Nguyen. FEALQ. B. F. CAB International. A. 109–110. B. Kamp. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. M.. N. (1998a) “Técnicas de laboratório”. 2nd edition. Ferraz.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). C. A. (2001) ‘Habitat association in two genetic groups of the insect-pathogenic fungus Metarhi294 Manual de biología de suelos tropicales . (1998b) “Chaves para identificação de patógenos de insetos”. vol. J. in S. Gaugler. (2002) ‘Taxonomy and Systematics’. d) emergencia de juveniles infectivos en la trampa White. Wallingford. Fotos: R. in S. B. 21..Figura 10. Lavender. Gaugler (ed) Entomopathogenic Nematology. S. R. Alves. A. B. Piracicaba Brazil. Bidochka.

C. Osborne. pp. Annual Review of Entomology. R.. (1993) ‘Entomopathogenic nematodes’.zium anisopilae: Uncovering cryptic species’. E. 194–198. y Ferguson. pp.. Hajek. Hajek. (2006) ‘Bizarre interactions and endgames: Entomopathogenic fungi and their arthropod hosts’. V. pp. Milner. 5. (1988) Atlas for Entomopathogenic Fungi. Trends in Ecology and Evolution. vol. London. D. P. Y. y Lutton. World Conservation Monitoring Centre. 331–357. Steinkraus. C. S. H. B. vol. E. A. H. W. R. Y. (1994) ‘Interactions between fungal pathogens and insect hosts’. L. y Dickson. H. vol. 69. Groombridge. 81. Evans. 1335–1342. 10. 38. (1997) ‘Sampling and occurrence of enomopathogenic fungi and nematodes in UK soils’. 133-141. Meyers. vol. vol. H. Eilenberg. Liu. D.. J. 248–251. y Pell. D. (1995) ‘Virulence and transmission of infectious diseases in humans and insects: Evolutionary and demographic patterns’. pp. R. y Gaugler. 293–322. C. (2004) Nematology. Journal of Parasitology. (ed) (1992) Global Biodiversity: Status of the Earth’s Living Resources. 39. K. Advances and Perspectives. Applied and Environmental Microbiology. 181–206. Chen. New York. Chapman and Hall. J. pp. Chen. Wallingford. W. Chandler. E. y Rothaman. 659–669. Ewald. Hay. CAB International. (1995) ‘The evolution of virulence: A unifying link between parasitology and ecology’. J. pp. Florida Entomologist. Roy. 62.. vol. R.. (1993) ‘The use of Dodine in selective media for the isolation of Metarhizium spp. McRae. Journal of Invertebrate Pathology. A. E. G. y St. Z. Applied Soil Ecology. y Latgé. pp. J. Z. pp. J. Kaya. H ongos y nematodos entomopatógenos 295 . vol. Chase. L.P. X. vol. Samson. A.. A.. A. 285–292. y Read. Leger. (1986) ‘Selective isolation of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium’. Annual Review of Entomology.. 67. D. 51. pp. from soil’.. K. J. S. G. P. M. F. Annual Review of Entomology. R. vol. Springer-Verlag.

.

Este método ofrece varios niveles de detalle que describen las características. La clasificación de uso de suelo se facilita por una estructura jerárquica donde se ordenan los atributos. en los puntos de muestreo.Capítulo 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo E. pero las clases finales de uso de suelo dependerán de la selección de dichos atributos a considerar para la clasificación. en función del propósito y del contexto de la clasificación misma. dependiendo de los datos disponibles. Solamente en algunos casos. Cuántas clases de uso de suelo pueden ser definidas con respecto a la intensidad de usos de suelo se ilustra a continuación. los dominios de los valores de los atributos se especifican. 297 . cuando se precise un alto nivel de detalle. En la mayoría de los casos. entrevistas o preguntas. Jeroen Huising RESUMEN DE LA METODOLOGÍA PARA LA DESCRIPCIÓN DE USO DE SUELO Este capítulo muestra una lista estructurada de atributos de uso de suelo que sirve como guía para la observación de características de uso de suelo en el campo. lo cual requiere solamente el valor adecuado por evaluar en el campo. Esto se lleva a cabo mediante la observación directa. se necesitarán mediciones reales.

Lo último. y en particular la intensidad de su uso. Este capítulo presenta una estructura que provee el registro sistemático de las características de uso de suelo. y es por lo tanto. dada la variación en los cultivos y sus posibles combinaciones. el enfoque que se describe a continuación se aleja de la idea de que las clases de uso de suelo sean definidas de acuerdo con la identificación de las características relevantes de uso de suelo (atributos) que permiten una 298 Manual de biología de suelos tropicales . Dicha estructura necesita ser flexible.. a través de puntos de referencia de los países tropicales involucrados. especialmente en las regiones tropicales. Los procesos dominantes que determinan la presencia e incidencia de la biota del suelo y la escala espacial donde éstos se manifiestan no se conocen completamente. de modo que se puedan reflejar las diferencias en la intensidad de uso de suelo. En lugar de utilizar clases predefinidas de uso de suelo. proporciona una estructura para la clasificación de usos de suelo. Las clases de uso de suelo predefinidas no son necesariamente aplicables o relevantes para todas las áreas involucradas porque será muy difícil definir un grupo estándar de clases de usos de suelo. se requiere de un sistema que permita el registro de las características de uso de suelo en las parcelas de muestreo y su clasificación posterior. de manera que se puedan definir las clases de uso de suelo. lo que facilita el análisis de los factores determinantes actuales y una clasificación a posteriori. y al mismo tiempo. en cuanto al uso de varios recursos como fotos aéreas o imágenes satelitales para el propósito de la clasificación. basadas en un común denominador en todas las áreas bajo estudio. La idea general es que el contenido de un estudio depende de la naturaleza de la región (Vink.ANTECEDENTES Y PRINCIPIOS DE DISEÑO Propósito de la clasificación del uso de suelo y de su cobertura vegetal El uso de suelo. la hipótesis central del proyecto CSM-BGBD (Giller et al. implica que las clases de uso de suelo no están definidas a priori. la historia de uso de suelo y las prácticas de manejo de los mismos. pero dependen de los clasificadores o atributos seleccionados para la asignación de la clase de usos de suelo a cualquier observación particular. razón por la cual fue adoptado un sistema regular en cuadrícula para muestrear la biodiversidad del suelo con un inventario detallado de su uso y cobertura en los lugares de muestreo. se considera uno de los factores determinantes de la abundancia y riqueza de poblaciones de organismos del suelo. 2005). Para comprobar esta hipótesis. 1975).

los métodos descritos en este capítulo se aplican únicamente en paisajes agrícolas terrestres (p. forma del paisaje. aunque atributos relacionados con la historia del uso de suelo o condiciones ambientales podrían ser adicionados o modificados del sistema de clasificación. No obstante. Las clases de usos de suelo obtenidas de esta manera pueden ser utilizadas para la extrapolación de los resultados más allá de los lugares de estudio. Asimismo. Los objetivos mencionados arriba fueron también citados en el programa Africover.discriminación entre clases de usos de suelo.. sistemas acuáticos y principalmente áreas sin vegetación. El sistema de clasificación de uso y cobertura del suelo ayuda a la armonización de los procedimientos para la recolección de datos y al manejo de los mismos. ej. El enfoque del inventario de uso de suelo aquí descrito se apoya principalmente en ese sistema de clasificación. el manejo de los cultivos y del suelo) son de particular importancia porque impactarán notablemente sobre la distribución de los organismos del suelo. que desarrollaron el Sistema de Clasificación de Cobertura de Suelo (LCCS) por Di Gregorio y Jansen (2000). El método que se presenta pretende ser de utilidad para la descripción de uso de suelo a nivel parcela. los fenómenos relacionados con la forma en que se está utilizando el suelo (p. áreas cultivadas y manejadas) mientras que el marco del LCCS incluye sistemas terrestres vegetales (semi) naturales. Para la clasificación y descripción de las áreas de vegetación (semi) natural se puede seguir el LCCS. generalmente se traduce en el registro de la ocurrencia de cultivos. Un segundo objetivo para los inventarios de uso de suelo es proveer información básica para definir los usos de suelo alternativos y las prácticas de manejo que mejoran la sustentabilidad de la producción agrícola y conservan la biodiversidad del suelo. especialmente en su intensidad. para el propósito actual. sin incluir elementos relacionados con el manejo de ganaD escripción y clasificación de uso de suelo en puntos de muestreo 299 . La estructura de las descripciones del uso de suelo actual no ha sido hecha para registrar el uso de suelo histórico. La descripción detallada de uso y la cobertura de suelo deberán formar parte del inventario. como clima. etc. es diferente al monitoreo usado con frecuencia que incluye en la descripción de uso de suelo y el estudio de las condiciones naturales y socioeconómicas del suelo como un primer objetivo (Vink. Lo anterior. El método no incluye una estructura para la descripción de los atributos ambientales. El objetivo del inventario para proveer datos que permitan evaluar cambios en la biodiversidad del suelo en relación con el uso del suelo. ej. aunque contiene elementos añadidos relacionados con el manejo de suelo y cultivos. 1975).

por lo tanto. a no ser la cobertura del suelo per se. Cuantos más clasificadores se añaden. no resulta apropiado para la descripción y mapeo de áreas más grandes. Estos “sistemas” de clasificación básicamente representan leyendas. porque esto no está particularmente relacionado a nivel de parcela. Muchos sistemas de clasificación utilizan a priori definiciones descriptivas de uso de suelo y clases de cobertura del suelo. Nivel 5: Características de uso de suelo del área directamente circundante a Manual de biología de suelos tropicales 300 . aunque se reconoce que para los estudios a una escala mayor o para considerar opciones alternativas de uso de suelo. dispuestos en un sistema jerárquico. utilizados para definir una clase. ni incluye elementos relacionados con el sistema de cultivo. representan un subconjunto de un rango de posibles usos y coberturas de suelo) y debido a que no existe un sistema de clasificación de referencia. resultarían de gran utilidad. no son exhaustivos (es decir. Nivel 4: Características relacionadas con el manejo de prácticas del suelo. basada en la interpretación de fotografías aéreas con el propósito de elaborar mapas de uso y cobertura del suelo. La jerarquía de clases es construida sobre un conjunto de clasificadores. por lo tanto. donde cada jerarquía se relaciona con diferentes niveles de detalle temático y espacial. El principio básico se apoya en el uso de clasificadores que refieren a criterios de diagnósticos o atributos independientes. son rígidos y de capacidad limitada para incorporar nuevas clases. Obsérvese. son limitados cuando se les compara con otros sistemas. Dicho sistema a menudo carece de una definición clara de los límites de clases. Nivel 3: Características relacionadas con aspectos culturales como irrigación y cultivo de temporada. por ejemplo. El método que se describe a continuación. descrita por Lillesand y Kiefer (1987).do. Concepto y principios de diseño Los conceptos y principios de diseño del LCCS adoptados utilizan criterios diagnósticos ordenados de manera jerárquica para permitir un sistema de clasificación consistente con límites claros para las clases. el sistema de clasificación de uso de suelo y de su cobertura del US Geological Survey. más detallado queda el nivel de clasificación. Existen cinco niveles en la jerarquía de clasificación: Nivel 1: Características relacionadas principalmente con el cultivo y el campo Nivel 2: Características relacionadas con la combinación de cultivos.

o basados en los datos proporcionados por el agricultor. se han añadido clasificadores que relacionan el manejo del suelo y cultivos que permiten la determinación del nivel de intensidad de uso. Esto puede ser señal de cultivos simultáneos o.la parcela de muestreo. normalmente. Otros aspectos que se deben considerar son la distribución. Este último determina si el campo forma parte de un sistema de cultivo migratorio. lo que sirve para D escripción y clasificación de uso de suelo en puntos de muestreo 301 . Esta información puede ayudar a determinar si la parcela bajo consideración representa una característica (o patrones) del uso de suelo o tipo de cobertura. el manejo de los campos agrícolas (es decir. Dichos clasificadores. Estos tres primeros niveles forman la base para la clasificación de uso de suelo y la colecta de datos en relación con dichas características se sugiere representan los datos mínimos requeridos. Por ejemplo. Estos elementos de vegetación se relacionan con características permanentes en el paisaje. El tamaño del campo generalmente es indicador del tamaño de la finca. barreras de viento y otras estructuras semipermanentes. un sistema de barbecho o un sistema de cultivo permanente. en secuencia. cercas vivas. son características que no se evalúan en los primeros niveles de clasificación. “cultivo de árboles” para un sistema basado en árboles). Las características no siempre son fácilmente observables. pero que se consideran importantes en relación a la intensidad del uso y pueden tener un impacto directo sobre la biodiversidad del suelo. Las subclases pueden definirse basándose en otros cultivos que forman parte del sistema del cultivo general. Asimismo. patrones de campo) y los cultivos asociados. que muchas veces es referencia de la clase social y del tipo de manejo (Huising. la clase mayor es definida por el tipo de cultivo principal (p. El quinto nivel en los sistemas de clasificación se relaciona con elementos de vegetación leñosa (semi) permanentes dentro de la parcela y en los campos aledaños. 1993). pero con algunos antecedentes de uso de suelo y de los sistemas de cultivo habituales. Las características de rotación de cultivos se consideran en otros estudios. incluyendo arreglos espaciales de los campos agrícolas. especialmente en relación con elementos leñosos de la vegetación que no se reconocen como cultivo y en relación con cultivos en campos adyacentes. como setos. el deshierbe y la fertilización del mismo. se refieren a las operaciones realizadas en una parcela en particular. junto con el tamaño de las áreas de los campos. tales como la preparación del suelo. ej. En el siguiente nivel de la clasificación jerárquica se consideran las prácticas culturales relacionadas con el suministro de agua y factores de cultivos de temporada. éstos pueden ser evaluados.

Por otro lado. Los niveles de clasificación definen un eje de la clasificación jerárquica en donde atributos adicionales (conjuntos de ellos) en cada nivel subsecuente definen las subclases (que representan un mayor nivel de detalle). por ejemplo. Estos atributos técnicos específicos. la descripción cuantitativa de la intensidad del uso del suelo. Los valores de datos posibles (dominios de valor) para la mayoría de los atributos son dados para proporcionar una descripción estándar de las características de uso de suelo. el cultivo principal se puede describir como maíz (Zea mays). Los atributos. Los atributos técnicos específicos permiten una definición más precisa de clases de uso de suelo asociados. por lo tanto. como los refiere el LCCS. Estos nuevos atributos ofrecen información más específica sobre el objeto de observación. Además. Si se conoce el valor de clase a un nivel más específico. Registro de datos en campo y observaciones adicionales En las siguientes secciones se presenta la lista de atributos para la descripción de usos de suelo. Además de este eje existe uno más en la clasificación jerárquica que hace referencia al nivel de precisión con que se describen las características de uso o añade información específica (detalles técnicos) de las características de uso de suelo descritas. Los principios de las clasificaciones jerárquicas son explicados por Molenaar (1991. el patrón del campo ofrece información sobre la fragmentación del suelo y constituye otro aspecto de la intensidad de uso de suelo que puede impactar directamente sobre la biodiversidad del suelo. que pueden incluir. Éstas sirven para guiar las observaciones en el campo en los puntos de muestreo y sus áreas circundantes. En el caso de algunos de estos atributos. por lo tanto. son consideradas observaciones a nivel de parcela. a su vez. no son independientes y pueden involucrar algún tipo de medición con un nivel más alto de detalle. pueden añadirse sin mayores consecuencias para el sistema de clasificación. los dominios de valor no son específicos para permitir la definición de 302 Manual de biología de suelos tropicales . sirven para trazar la cartografía del uso de suelo (mediante la interpolación de puntos de observación que complementan un mapa). el valor de clase a un nivel más detallado de generalización puede ser inferido. el cultivo principal puede describirse a un nivel más general (de género) como Zea o a un nivel de familia como Gramineae (pastos). 1998) y Huising (1993). por ejemplo.identificar posibles asociaciones de usos de suelo que. información más específica se remite a variedades y esto representaría un mayor nivel de detalle (especificidad). La transformación de las listas de atributos a formatos para registrar los datos en el campo resulta fácil.

como documentos). Las clases de datos deben indicar una discriminación relevante (significativa) de objetos y el subconjunto de clases debe ser extensivo (no exclusivo). El sistema para describir el uso de suelo muestra varios niveles de detalle. basados en la definición de la clase adoptada (ver Tabla 11. se debería poder inferir información sobre el manejo de la parcela en particular. Si éste no es el caso. la información puede generalizarse para la clase de “fertilizante aplicado” (implicando el uso de fertilizante inorgánico). con los conocimientos de un sistema habitual de cultivo y las prácticas de manejo en el área. media o alta. a personas externas. Los atributos pueden agregarse para facilitar la descripción de características específicas de un área en particular. A menudo. sino que requiere del acceso a fuentes adicionales de información (a través de entrevistas a los agricultores. La situación contraria sería con el conocimiento de la práctica común en el área. media o alta) puede ser asumida.6b). es aceptable clasificar la tasa de aplicación como baja. Las observaciones para los tres primeros niveles del sistema de clasificación se pueden hacer directamente en el campo.valores de datos en los rangos de observación y distribución de los valores de datos. La información de estas fuentes de datos puede resultar incorrecta. relacionada con el manejo. junto con la información relacionada con el tercer nivel (es decir. características culturales) obtenida de un informante o derivada de la información general de las prácticas culturales en el área. basada en observaciones secundarias. simplemente. utilizando otros recursos. una tasa particular de aplicación (baja. clases de tamaño estándar definidas en campo con límites fijos no podrán ser significativas por esa razón. si la información sobre la tasa de aplicación de un fertilizante inorgánico en particular no se considera confiable o correcta. pero ello se compensa con la aplicación de la jerarquía en la precisión de los datos (referidos anteriormente como el segundo eje en el sistema de clasificación). A priori. a partir de la observación directa en el campo. La información en el cuarto nivel. esto no es prescriptivo en el sentido de que los datos necesitan ser colectados en todos los niveles de detalle. los datos relacionados con niveles muy detallados de observación son muy difíciles de obtener. pero éstos deberán añadirse a los niveles más bajos de la clasificación jerárquica para evitar que interfieran con la estructura de la misma. Por ejemplo. Sin embargo. o bien. Sin embargo. El nivel de detalle al cual la información es reunida depende del propósito del inventario de uso de suelo y de la posibilidad de obtener D escripción y clasificación de uso de suelo en puntos de muestreo 303 . o bien. no se obtiene a través de observaciones directas en el campo. sus fuentes no son totalmente confiables.

además de los datos administrativos como hora. será siempre una ventaja. Si la selección se realiza entre dos 304 Manual de biología de suelos tropicales . Si bien estas observaciones no se incluyen en la clasificación del uso de suelo. pueden ser incorporadas fácilmente a las libretas de campo en caso necesario. sí pueden aportar información para el análisis de datos. nombre del encargado del proyecto y nombre de la persona que toma los datos. dependiendo de la experiencia del encargado del proyecto. Para este propósito. para la selección entre un cultivo de árboles y un cultivo anual en el mismo campo. Este tipo de información deberá registrarse en la libreta de campo.la información requerida. al mismo tiempo. Estas observaciones no se consideran como clasificadores y. Estas observaciones secundarias sirven. la información sobre el tipo de lindero se debe registrar. Observaciones secundarias pueden relacionarse con el estatus del cultivo o con la presencia de maleza. como un mecanismo para la validación de los datos en atributos y clasificadores e incluso para los resultados de clasificación finales. El hecho de que el encargado del proyecto se encuentre familiarizado con el uso de suelo y con las prácticas de manejo en el área. OBSERVACIONES DE USO DE SUELO: CLASIFICADORES Y ATRIBUTOS Observaciones respecto del cultivo principal y tamaño del campo El primer nivel del sistema de clasificación se reserva para las observaciones del cultivo principal. sin embargo. Se recomienda revisar el trabajo de Stocking y Murnaghan (2001) para los indicadores relevantes de observaciones en el campo. la explicación de posibles datos atípicos). ya que puede tener un efecto en la distribución de la biodiversidad del suelo. El sistema para la descripción de uso de suelo requiere de una estructura que pueda implementarse a detalle y que se considere viable bajo las condiciones reales. donde el cultivo de árboles se considera como el principal. el segundo. (por ejemplo. por lo tanto. como el elemento de vegetación más dominante. Se deberá registrar la localización específica del punto de muestreo dentro del campo (por ejemplo. fecha. El uso de una cuadrícula regular para el muestreo permite que se tomen puntos de muestreo en cualquier lugar dentro de la parcela y posibles efectos de borde deben tomarse en cuenta. la cobertura del dosel deberá clasificarse como “abierta” o “cerrada”. el centro o los linderos). no se incluyen en las listas de atributos que se detallan a continuación. siempre y cuando la cobertura del suelo no se clasifique como escasa.

La clasificación se basa en la forma de vida del cultivo. más de 10 años] 305 D escripción y clasificación de uso de suelo en puntos de muestreo . En la Tabla 11. porque su apariencia (características de vegetación) puede ser muy distinta. una especificación con más detalle indica si el cultivo pertenece a la categoría de “raíces o tubérculos”. arbusto. no se enlista bajo el título “Atributos técnicos 1” en la Tabla 11.1 los valores posibles (clasificadores o atributos) se enlistan entre corchetes. por ejemplo. es mejor definir una lista de Tabla 11. Los atributos técnicos son específicos para cada una de las diferentes formas de vida. proporcionando una mayor especificación de la forma de vida a nivel de detalle. el cultivo con el mayor porcentaje de cobertura califica como el cultivo principal. o gramíneas] Atributo técnico 1 Atributo técnico 2 Cultivo de árboles o arbusto Tipo de cultivo (especies y Fenología de la hoja [siem. En el caso de un cultivo de árboles o arbustos se puede añadir información sobre el aspecto (es decir. para madera o leña). La información más concreta sería entonces el tipo específico de cultivo. entre 3 – 10 años. por lo tanto. es conocido el tipo de cultivo. deciduo] Tipo de hoja [aguda. ej. pero en lugar de dejarlo abierto. hierba. 1 año. árboles de sombra] Duración del cultivo [Estación (parte del año). El valor de dominio no se especifica aquí. de la edad de la plantación. el propósito) y duración del cultivo. Se prevé para una descripción de un segundo y tercer cultivo. Cuando se considera relevante.1 Clasificadores y atributos técnicos para el cultivo principal Nivel 1a – Clasificador Forma de vida [árbol.variedades) pre verde. entre 1 y 3 años. La categoría de cultivo herbáceo representa un nivel adicional en la clasificación jerárquica (nivel de especificación) y. Generalmente. dependiendo. “forrajes o fibras”. cosecha de toda la planta (p. En el caso de cultivos herbáceos. cosecha de frutas.1. ancha] Propósito [vivero. nueces y otros. “leguminosas o vegetales”. se puede añadir un cuarto nivel que ofrezca información sobre la variedad específica del cultivo.o más cultivos de la misma forma de vida.

La forma del campo se añade principalmente como una preocupación respecto a posibles efectos de borde y. puesto que ello dependerá del contexto de estudio. legumbres y vegetales. ésta queda fuera del marco de este capítulo.lúpulo y otras enredaderas perennes] Herbáceas Categoría de cultivos [raíces y tubérculos. aunque esto se relaciona más con las características del cultivo que. El siguiente nivel en la clasificación jerárquica se determina por las características espaciales de la parcela en observación (Tabla 11. es mejor definir clases significativas basadas en un estudio piloto del rango de tamaño de campo presentes en el área de estudio (Huising.Tabla 11.plátanos y otras plantas herbáceas arbóreas. caña. no obstante. aunque está más relacionada con las características del cultivo que con las características del campo. cereales.2). con las características de campo. pero manteniendo la distinción conceptual entre pequeño. además. forrajes. Aquí se incluye la “cobertura de los cultivos”. fibras] (si se conoce. sirve como indicador del grado de organización y mecanización de las prácticas de manejo. IV. arroz. III-cultivos de cobertura. 2000). especificar el tipo de cultivo) Atributo técnico 2 Tipo de cultivo (especies o variedades) Tipo de cultivo Tipo de cultivo nombres permitidos para los tipos de cultivo. II. La cobertura del cultivo se anexa aquí.1 Continúa Nivel 1a – Clasificador Atributo técnico 1 Gramíneas Tipo [bambú. con el propósito de evitar cualquier confusión. mediano y grande. “mediana” o “grande” no aparece. pastos] Si no son gramíneas Categoría del cultivo [I.herbáceas. 1993) con la opción de utilizar diferentes definiciones para cada una de las distintas regiones en donde se esté llevando a cabo el estudio. véase la lista LCCS (Di Gregorio y Janssen. La cobertura del cultivo se usa generalmente como un parámetro para la interpretación de 306 Manual de biología de suelos tropicales . a manera de ejemplo. La definición de clases de tamaño de campo “pequeña”.

En el caso de un segundo o tercer cultivos. escasa (20-10%)] Observaciones relacionadas a combinación de cultivos y prácticas culturales Las combinaciones de cultivos se consideran el segundo nivel. mediana. en los casos donde un clasificador de segundo nivel “combinación de cultivos” indica que existe un segundo o tercer cultivo creciendo en el campo. proporciona información acerca de la densidad del cultivo y es un indicador útil de la intensidad del uso de suelo.imágenes de percepción remota. El segundo y tercer cultivo pueden describirse por los mismos D escripción y clasificación de uso de suelo en puntos de muestreo 307 . Nivel 1b -Clasificador Atributo técnico 1 Tamaño de campo o parce. circular. baja (30 -15%)] Cobertura permanente: [cerrada (> 70-60%). generalmente. a las diferencias en las etapas de crecimiento y otros factores. En el caso de formas de vida permanentes. Se pueden hacer distinciones de acuerdo con el número de cultivos y con su secuencia. y especialmente en el caso de los cultivos anuales. 2000). se refiere a que se produce un empalme entre las copas. Tabla 11. Además. mediana (60 – 30%). la distribución espacial en el campo puede especificarse. abierta (70-60 – 20-10%). Esto puede servir para entender la importancia relativa del cultivo en sistemas de cultivos múltiples. el tipo de cobertura “cerrada”. Para coberturas no permanentes. los límites de clases son ligeramente diferentes (ver Di Gregorio y Janssen. Por lo tanto. en tira o irregular] Tamaño del campo (metros cuadrados) Atributo técnico 2 Cobertura del cultivo Cobertura no permanente: [alta (> 60%). la cobertura del cultivo puede resultar difícil de interpretar debido a la variación en la arquitectura de las plantas. su densidad puede medirse directamente en términos del número de plantas por unidad de medida (m² o ha) o en términos de espacio entre plantas (el espacio entre surcos y la distancia entre las plantas).2 Tamaño del campo y características de la cobertura del cultivo.Forma [cuadrada. pero dependería mucho del tipo de cultivo. Las clases de densidad podrían especificarse. esto se refiere a que en una misma parcela y durante una sola temporada se realizan uno o varios cultivos. grande] lar. Una cubierta “abierta” significa que la distancia entre los perímetros de las copas puede ser hasta dos veces mayor que el diámetro medio del dosel. En el caso de cultivos anuales. rectangula [chica. multiangular.

2 o más] Secuencia [simultáneo. como por ejemplo. postinundaciones. los cultivos de árboles (hule) en un campo grande (plantación). El segundo tipo de cultivo se añade como un segundo atributo técnico. plantaciones. franjas alternas. la totalidad de su cobertura (es decir. Nivel 2 – Clasificador Combinación de cultivos [simple (monocultivo). El nivel tres en el sistema de clasificación se refiere a las prácticas culturales. por ejemplo. el porcentaje de cobertura del cultivo adicional o añadido) puede alcanzar fácilmente el 100%. traslapar. La descripción para las características del suministro de agua es muy sencilla (ver Tabla 11. serían suficientes. en cuyo caso. aspersión o goteo] Atributo técnico 2 Demanda de agua por irrigación [mm de agua suministrada por temporada de crecimiento o cultivo] 308 Manual de biología de suelos tropicales . en los varios niveles de especificación. múltiple (intercalado)] Atributo técnico 1 Cultivos múltiples No. en donde la especificación de la forma de vida. no habría un arreglo especial. Se realizan previsiones al tercer nivel de clasificación. igual que para el cultivo principal. fragmentadas o dispersas] Tabla 11. definidas como características de suministro de agua y características relacionadas con el barbecho. Es necesario registrar cuando se practica una rotación de cultivo en particular. relacionadas con el “factor de tiempo del cultivo” para especificar esta información. Tabla 11. La vegetación del sotobosque también puede referirse a vegetación (semi) natural.4). Un segundo tipo de cultivo puede referirse a un cultivo de sotobosque como el cardamomo. El segundo (o tercer) cultivo o elemento de la vegetación puede incorporarse en la descripción de clase del sistema de uso de suelo como elemento descriptivo o como atributo. irrigación] Atributo técnico 1 Irrigación Tipo de irrigación [superficial.4 Características del suministro de agua Nivel 3a – Clasificador Suministro de agua [lluvia.3 Atributos de cultivos combiandos.atributos. secuencial] Atributo técnico 2 (Segundo tipo de cultivo) Simultáneo o traslapado Arreglo espacial [una o dos filas intercaladas. también en estos casos. de cultivos adicionales [1. junto con la fenología y tipo de hoja. con un sotobosque herbáceo cerrado.

El cultivo post inundación se define. mediano. barbechos y cultivos permanentes. 1980).5 Factor tiempo de cultivo. Se hace una distinción entre cultivos migratorios. Leguminosas. Los sistemas de barbecho se definen como suelo cultivado entre el 33% y el 66% del tiempo y en los cultivos permanentes. El factor de tiempo del cultivo indica la fracción de tiempo durante la cual el suelo es usado para el cultivo. en términos prácticos. de cultivos en dos años D escripción y clasificación de uso de suelo en puntos de muestreo 309 . Esto es similar. mientras que en el sistema de barbecho Tabla 11. o largo plazo] Barbecho Tipo de barbecho[suelo desnudo. permanente] Atributo técnico 1 Cultivo migratorio Período de barbecho [corto. de la siguiente forma: “después de que un campo ha sido inundado con agua de lluvia. el suelo está cultivado por más de 66% del tiempo.5. la lluvia infiltrada en el suelo se usa intencionalmente como reserva para los cultivos”. Los cultivos migratorios típicamente se refieren a situaciones donde los agricultores abren nuevas parcelas para el cultivo. largo] Permanente Permanente [continuo o intermitente] Atributo técnico 2 Índice de cultivo (valor del índice de cultivo Ruthenberg) Si es mejorado: Tipo de cobertura (ej. en principio. mediano. El cultivo migratorio se define como suelo cultivado durante menos del 33% del tiempo (Ruthemberg et al. al empleo de técnicas de cosecha de agua (tratado por separado en la sección relacionada con el manejo de suelos y cultivos). natural. El barbecho se refiere al periodo (estación de crecimiento) durante el cual se deja descansar el suelo. de acuerdo con el LCCS.Clasificador Factor tiempo de cultivo [cultivo migratorio. Nivel 3b .. se debe hacer la distinción entre si esto se hace con el objetivo de restaurar la fertilidad del suelo o debido a que las condiciones no permiten cultivar (bajas temperaturas o disponibilidad de agua limitada). esta distinción no se mantiene. Los atributos técnicos se especifican en la Tabla 11. mejorado] Duración del barbecho[corto. y debido a que no trae consecuencias en la intensidad del uso de suelo. sin embargo. u otro tipo) Índice de cultivo (valor del índice de cultivo Ruthenberg) Intermitente No. aunque no lo mismo. barbecho.

Si se requiere de datos más precisos. se hace una distinción entre la duración del periodo de barbecho: Barbecho corto. Barbecho largo. pero eso no resulta lo suficientemente largo para clasificarlo como cultivo migratorio. Los barbechos se consideran como “mejorados” en el momento en que se planta o se siembra para cambiar la composición de la vegetación de barbecho o para mejorar su calidad. Periodo medio: 4–5 meses. pero necesita confirmarse y puede ajustarse con base en los datos reales sobre la duración de los periodos de barbecho en el área en cuestión. El barbecho medio refleja la situación donde el suelo descansa durante seis a siete meses. La definición de estos límites de clases se basa en la experiencia en el campo. En el caso de cultivos migratorios. por lo tanto. El periodo largo de barbecho es la situación típica en donde el suelo se deja en barbecho durante un año o más. con un periodo de < 1–2 años. por ejemplo.cultivan la misma parcela o área de suelo. por ello. pero < 8–9 meses. resulta relevante anotar la duración de dicho periodo. Para sistemas de barbecho. Barbecho medio. No se hace ninguna distinción referida al tipo de cultivo o propósito. pero < 8–10 años. dejándola descansar durante diferentes periodos de tiempo para restaurar la fertilidad del suelo. durante el segundo año. el periodo de barbecho típicamente tiende a reducirse. éstos se pue310 Manual de biología de suelos tropicales . con un periodo de > 8–10 años. con un periodo de > 1–2 años. Bajo la presión de una población en aumento. Estas son evaluaciones parcialmente cualitativas y. se sobreponen los límites de clases y se especifican para cubrir la variación específica de un periodo de barbecho para cualquier área que probablemente sea dependiente de las condiciones socioeconómicas y biofísicas habituales. lo cual es muy común en algunos lugares donde uno o dos cultivos “cortos” ocurren durante un año o donde el agricultor deja un periodo de barbecho más largo. Periodo largo: > 8–9 meses El barbecho de periodo corto se refiere a situaciones donde normalmente existen dos temporadas de cultivo en un año y el suelo se deja descansar durante el resto del periodo. la clasificación del periodo de barbecho es la siguiente: Periodo corto: < 4–5 meses. forrajes.

el mejor momento para incluir una descripción de las secuencias de los cultivos sería en el segundo nivel de la clasificación jerárquica donde “la combinación de cultivos” puede describirse como “secuencial”.den calcular utilizando el índice de cultivos de Ruthenberg. tal y como se observa en la Tabla 11. la cosecha. sin embargo. De manera alternativa. puesto que el barbecho a menudo forma parte de un sistema de rotación de un cultivo en particular. Se añade la “preparación del suelo” por su relevancia en los márgenes de la selva en los trópicos. como un clasificador podría ser excluida de la clasificación porque la preparación del suelo es generalmente la D escripción y clasificación de uso de suelo en puntos de muestreo 311 . por lo tanto. Los datos deberán especificar el número de años del ciclo de rotación de cultivos y la secuencia de los cultivos en el ciclo. Alternativamente. fertilización y cosecha.5. Si se practica una rotación de cultivos. plagas y enfermedades. es un factor que deberá tomarse en cuenta en relación con la biodiversidad del suelo. el principal aspecto que se debe considerar sería si esto se realiza por medios mecánicos o no.. una opción para combinar ambos clasificadores dentro de uno que describa el grado de mecanización. por lo que no han sido incluidas en el sistema de clasificación.6a). Esto es. Características de manejo del suelo y de cultivos Las prácticas culturales mencionadas incluyen: “manejo de agua” como una operación de manejo. se podría prever. donde potencialmente existe un alto impacto en la biodiversidad del suelo. 1980): CIr = Tc/(Tc + Tf) En donde: Tc = duración del cultivo (tiempo). Hasta este momento no se han considerado las rotaciones de cultivo. el manejo del suelo y de los cultivos se consideran representativos de un nivel separado en el sistema de clasificación (Tabla 11. el manejo de las malas hierbas. el “factor tiempo de cultivo”. Los mayores componentes de las prácticas de manejo discutidas se refieren a técnicas para la preparación del suelo o su cultivo. Tf = duración del barbecho o duración del tiempo en el que no se cultiva el suelo. tal y como se muestra en la siguiente fórmula (Ruthenberg et al. En cuanto a la preparación del suelo y la cosecha.

o arado de cincel. donde la labranza del suelo se restringe a hacer agujeros para sembrar. estos arados se presentan desde el menos eficiente en remover el suelo y dejará más estructura intacta en el suelo. el suelo (y otras condiciones ambientales) afectarán la eficiencia de la operación. comparado con animales “ligeros” o maquinaria de igual consideración. La “eficiencia” en términos de horas por hectárea requerida para la operación se añade como un atributo opcional. Opcionalmente. ya que no resultará un indicador directo del grado de perturbación del suelo. arado de disco. Se añade un atributo técnico que describe el tipo de arado usado. en lugar de labrar el campo entero o donde el grado de perturbación se minimiza con el uso de equipos especializados. sería más sencillo 312 Manual de biología de suelos tropicales . De acuerdo con el orden mencionado. sin embargo. Por lo tanto. La principal preocupación relacionada con el control de las malezas. Se hace una distinción basada en si el suelo ha sido labrado o no. las opciones son: arado de vertedera. se podría considerar combinar ambos (mecánica y química) dentro de un clasificador que describa el uso de agroquímicos (excluyendo fertilizantes orgánicos). se basa en el tipo de tracción utilizada: animal o mecánica. La labranza mínima se refiere a aquellos sistemas donde el arado y la siembra son típicamente una combinación de una sola operación. plagas y enfermedades es el uso de agroquímicos. El tipo de animal o el tipo de maquinaria empleada es indicado en el siguiente nivel de detalle. Se presume que animales “pesados” o maquinaria pesada causan un mayor impacto en el suelo. Se debe mencionar aquí si se practica la labranza mínima. refiriendo su capacidad. Una distinción más detallada de acuerdo con los requerimientos reales de poder o capacidad en términos de caballos de fuerza no se considera relevante. la profundidad del arado. tales como la unidad de sembrado directo (ripper-planter) utilizada en la agricultura de conservación (de Freitas. tipo de equipo y tipo de tracción. El uso de combustibles puede fácilmente estimarse si se conoce su eficiencia. porque esto dependerá de las condiciones locales. en caso afirmativo.primera operación para ser mecanizada y tiene un profundo efecto en la biodiversidad del suelo. en el sentido de que una mayor o menor eficiencia no causará mayor o menor impacto en el suelo y los organismos que se encuentran en él. La eficiencia se refiere más a lo económico que a lo ambiental. el uso de combustibles debería añadirse como atributo en el siguiente nivel más alto de especificación. tomando en cuenta el impacto directo del peso del animal o la maquinaria y el impacto generado por los diferentes tipos de equipo operados por maquinaria o animales de diferentes capacidades. aquí se incluye su compatibilidad con los métodos que incorporan el uso de combustibles fósiles en los cálculos de la intensidad del uso de suelo. tales como tipo de suelo. pero al contrario. por ejemplo. 2000).

. sea por el método de herbicidas. En el caso de medidas de control culturales (y biológicas). desmontar y cubrir con abono verde] Mecánica Grado [limpieza moderada. por ello. Nivel 4 – Clasificador Limpieza [Sin limpiar. mecánica. química] Atributo técnico 1 Manual Modo [desmontar y quemar. cuatro rue. intermedia e intensa] Manual Atributo técnico 2 Labranza [Sin labranza. Tracción animal Tipo (y número) de anima. cincel. el barbecho.y práctico manejarlas por separado. mecánico.disco. reducida o mínima] Eficiencia (horas/ha) Tipo de arado [vertedera. con la mano] D escripción y clasificación de uso de suelo en puntos de muestreo 313 . mula/burro] Eficiencia (horas/ha) Mecánico Tipo de arado Clase de maquinaria [dos ruedas (ligera). por ejemplo. cincel.[vertedera. mecánico. a Deshierbe a mano Eficiencia (horas/ha) mano. la rotación de cultivos. químico] Tipo de deshierbe [con azadón. Respecto al deshierbe manual se hace una distinción Tabla 11. labranza mínima/unidad de sembrado les usados [búfalo. manual. directo (ripper-planter)] vaca. labranza mínima/unidad de das (pesada)] sembrado directo (ripperplanter)] Eficiencia (horas/ha) Deshierbe [Sin deshierbe. “No quitar malezas” puede atender a situaciones donde no existe la extracción real de las malezas. buey.6a Clasificadores y atributos relacionados con la limpieza de la parcela. estas han sido registradas de las prácticas de uso de suelo en los niveles previos del sistema de clasificación y. biológico o cultural. mecánica] Alcance de la labranza [labranza completa. caballo. labranza y deshierbe. no se incluyen en el valor de dominio. manual (azadón). El clasificador para el control de malezas especifica el modo de mecanismos de control. etc. tracción animal.disco.

los cuales se convierten de libras por acre a gramos por hectárea (weeds. weeds. mientras que una aplicación (ea) de más de 2500 gha-1.edu/pnw/weeds). el herbicida más usado en los trópicos (www. se basa en el volumen de la aplicación que resulta no viable.Tabla 11. orst.6a Continúa. se considera un volumen alto (VA). Si se considera de vital importancia. por mucho. basadas en recomendaciones generales para su aplicación en diferentes cultivos. azadón de presión. azadón rotatorio) Eficiencia (horas/ha) Químico Volumen de aplicación Tipo de equipo [aspersor de [VB (< 850 g ia/ha). En cuanto al uso de químicos en el control de malezas. VI mochila. los diferentes tipos de ingredientes activos y las fórmulas que existen (Oregon State University. dado que el Roundup es. 2005).ippc. por lo 314 Manual de biología de suelos tropicales . Nivel 4 – Clasificador Atributo técnico 1 Mecánico Tipo de deshierbe [labranza frecuente. que es la sustancia activa del Roundup. si se considera el gran número de herbicidas que se encuentran disponibles en el mercado. Una tasa de aplicación de (ea) menos de 850 gha-1 se considera un volumen bajo (VB) de aplicación.iastate. o cualquier otro tipo de herbicida. se debería especificar el ingrediente activo (ia). la distinción se hace acorde con su aplicación: el uso de aspersor de mochila es el más común. se recomienda implementar un sistema de clasificación para la aplicación de volumen de herbicidas que sea relevante para el área en cuestión. si se requiere información más detallada acerca del Roundup.edu/mgmt/2004) por la cantidad de aplicaciones especificada en gramos equivalentes de ácido (ea) por hectárea de glifosato. Sin embargo. VA (> 2500 g ia/ha)] Herbicida. Las especificaciones de manejo de malezas no cubren todas las medidas de control de malezas. ingrediente activo y tasa de aplicación entre si esto se lleva a la práctica con el uso del azadón o mediante la extracción totalmente manual. otros mecanismos] (entre 850 y 2500 g ia/ ha). cultivo para el control de malezas] Atributo técnico 2 Eficiencia (horas/ha) Tipo de equipo (ej. Una diferencia más. junto con la cantidad en gramos del ingrediente activo por hectárea. Las especificaciones son asignadas de manera arbitraria.

en caso de considerarse relevante. sin tomar en cuenta su modo de empleo. Se presume que el modo de aplicación no traerá muchas consecuencias para la tasa de aplicación. Generalmente. Los elementos nutritivos pueden referirse a un solo elemento (por ejemplo N) en los fertilizantes simples o la combinación de elementos en mezclas incompletas o mezclas completas (el porcentaje de peso se relaciona al N para el nitrógeno. y las mismas clases de volumen se consideran relevantes. 1985). mientras que los fertilizantes de alto grado contienen hasta el 50% de elementos nutritivos. sin considerar las disoluciones hechas antes de la aplicación. Para abonos. dentro del rango especificado. se hace una distinción basada en si éstos son ampliamente aplicados en todo el campo o si la aplicación se restringe a puntos específicos y también al tipo de equipo utilizado. se definen clases similares: control natural o medidas culturales. Las clases de volúmenes para aplicar pesticidas se obtienen de Craig et al. Tasas de aplicación bajas de menos de una tonelada por hectárea por año se consideran insuficientes para mantener los niveles de humus y de materia orgánica en el suelo. en lugar de usar un valor en particular. Eso se hace para poder acomodar los diferentes grados de fertilizantes. estas cantidades se suministran una vez cada cuatro a seis años (ILACO. las cifras se convierten en tasas de aplicación por año. los rangos de tasas de aplicación se especifican para los límites superiores e inferiores de las clases. Dos toneladas por hectárea por año se consideran suficientes para todo tipo de cultivo. Respecto al uso de pesticidas. (2002) y son usadas en caso de aspersión aérea. se podrían especificar cantidades reales de aplicación. se presume que se requieren entre 5 y 10 toneladas por hectárea para poder mantener los niveles de humus en el suelo. Con relación a las medidas de control de plagas y enfermedades. Con respecto a la aplicación de fertilizantes inorgánicos. En cuanto a los fertilizantes orgánicos e inorgánicos. Cuando se utilicen fertilizantes de bajo grado.6b).que la libreta de campo es un buen complemento para la observación relacionada con cualquier medida específica de control de malezas. se prevén especificaciones para la tasa de aplicación. P2O5 para el fósforo y K2O para el potasio) El índice toma D escripción y clasificación de uso de suelo en puntos de muestreo 315 . fungicidas u otros químicos. Los volúmenes especificados se refieren a la forma líquida en la cual el pesticida o el fungicida se obtienen. se deberán tomar en cuenta los valores más altos. estos se basan en asumir un contenido de materia orgánica del 30%. Los fertilizantes de bajo grado tienen menos del 25% de nutrientes para las plantas. La frecuencia de la aplicación puede variar y en la tabla que se observa a continuación. En este punto. control biológico o mecanismos de control químico (Tabla 11.

En todos los sistemas es importante registrar si la quema se lleva a cabo para eliminar la vegetación muerta o si esta vegetación se queda como abono orgánico. La “limpieza intensa” significa que la tierra se limpia completamente con el uso de tractores oruga y otra maquinaria pesada. Las otras clases se derivan de estas cifras. Otra distinción se hace basada en el tipo de equipo usado. especialmente. La manera en que se prepara la parcela puede tener un profundo impacto en la biodiversidad del suelo. “Sin limpieza” (ver Tabla 11. La aplicación del fertilizante. La limpieza también es importante en sistemas de barbecho. Esto sería particularmente relevante donde se practican cultivos migratorios o donde las selvas han sido convertidas recientemente en suelo agrícola. Actualmente. se incluye como clasificador separado. Si las tasas de aplicación son generalmente altas. Esto sería la aplicación recomendada para un suelo moderadamente fértil que produce alrededor de cuatro toneladas de maíz (grano). se hace una distinción entre sistemas de “desmontar y quema” y “desmontar y cubrir con abonos verdes”. lo que ha ocurrido en algunos márgenes de selvas en donde opera el proyecto CSMBGBD. 6a) se enlista cuando el campo ha sido convertido a partir de bosque o vegetación secundaria desde hace más de 20 años. de un fertilizante de alto grado y de 700 kg ha-1 o más de un fertilizante de bajo grado. cuando incluyen quemas. será relevante en el caso de tasas bajas o muy bajas de aplicación. ya sea en o alrededor del hoyo de plantación. o si las tasas de aplicación altas son de particular interés. cualquier incidencia de fue316 Manual de biología de suelos tropicales . en donde una tasa muy baja de aplicación representa alrededor de 10 a 15% de esta cantidad de referencia. estos valores se toman como el límite superior de la clase de “tasa de aplicación de fertilizante medio”. por lo tanto. en donde los árboles se cortan a mano o con sierra de cadena y los troncos se remueven utilizando tractores u otra maquinaria más ligera. se podría considerar añadir una clase para las tasas muy altas que serían aplicaciones de 300 kg ha-1 o más. para alrededor de tres toneladas de trigo en suelos relativamente fértiles y 25 toneladas de mandioca en suelos moderadamente fértiles. lo cual coincide más o menos con la duración máxima de barbecho bajo sistemas de cultivos migratorios. La conversión puede incluir operaciones para nivelar el suelo. Una aplicación de 75 kg ha-1 de N requerirá 150 kg ha-1 de un fertilizante con N de alto grado y alrededor de 350 kg ha-1 de un fertilizante de bajo grado. “La limpieza moderada” está indicada cuando se utilizan medios manuales y mecánicos.75 kg ha-1 de N como punto de referencia para la aplicación de N. por lo tanto. Sin embargo.

fertilizantes y cosecha. vehículos. mecánica] Eficiencia (Horas/ha) D escripción y clasificación de uso de suelo en puntos de muestreo 317 . composta. combinación de fertilizantes químicos y orgánicos] Equipo usado [aspersor de mochila. media (entre 1–2 t/ha/año). franjas.go como parte de las prácticas de manejo deberá registrarse en esta sección como fenómeno importante. mezclas incompletas. alta (>150–350 kg/ha) Aplicación [hoyos. (VA >200L/ha)] Tipo de químico y tasa de aplicación Tasa de aplicación [baja (<1t/ha/año). media (entre 75– 175 y 150–350 kg/ha). baja (entre 25–60 y 75–175 kg/ha). estiércol de corral] Aplicación [hoyos.6b Clasificadores y atributos para el manejo de plagas y enfermedades. o de manera homogénea en la parcela] Inorgánico Clases de fertilizantes [simple. aspersor de motor. fertilizantes químicos. alta (>2 t/ha/año)] Fertilizantes [sin fertilizante. Nivel 4 – Clasificador Manejo de plagas y enfermedades [medidas preventivas y control natural. aviones] Fertilizantes orgánicos Tipo de fertilizantes [residuos de cultivos. mezclas completas] Tasa de aplicación [muy baja (<20 – 60 kg/ha). VB (entre 10-100L/ha). VI (entre 100 y 200L/ha). control químico y biológico] Atributo técnico 1 Control químico Aspersión [aspersión focalizada. Tabla 11. abonos. o de manera homogénea en la parcela] Cosecha [manual. aspersión en toda la parcela] Atributo técnico 2 Volumen de aplicación [UVB (<10L/ha). franjas. abono verde.

sean incluidas. cuando se relacionan con su manejo. provee una visión general en su página web de muchas técnicas existentes (www. muros de contención. La información sobre el rendimiento de la cosecha es igual de útil. cuando se compara con un cultivo de 318 Manual de biología de suelos tropicales . bancos.Otras observaciones sobre el manejo de suelo y cultivos Aparte de registrar las características del manejo de suelo y de cultivos como se describió en las tablas anteriores. hondonadas y otras. De manera general. cultivos en curvas de nivel. el uso de elementos de vegetación (referido a tiras de pastizales. al igual que las del estatus del cultivo. pero no como base de clasificación. La World Overview of Conservation Approaches and Technologies (WOCAT).). La información de las medidas de conservación no se captura directamente en el registro de los atributos enlistados arriba. Las medidas de conservación de suelo y agua afectarán las poblaciones de organismos del suelo indirectamente por el almacenamiento de agua mejorada. acolchonado. corta vientos y otros) o medidas estructurales que incluyen terrazas. El rendimiento del cultivo como indicador integra muchos factores. Estos datos proporcionan información adicional sobre el cultivo principal tal y como se especifica en el primer nivel del sistema de clasificación. se incluyen como medidas estructurales. el crecimiento puede clasificarse como: crecimiento retardado. construcciones y empalizadas. Probablemente. 2001). Las técnicas de recolección de agua como cavar zanjas. incluyendo las relacionadas con técnicas de recolección de agua. se recomienda que las observaciones de las prácticas de conservación de suelo y agua. altura y diámetro relativos del cultivo en crecimiento (ver Stocking y Murnaghan. por lo que es difícil obtener cifras confiables y del todo correctas. Las observaciones del estatus de los cultivos podrían ser útiles para corroborar los resultados anteriores (o resultados de clasificación). El registro debe contener la descripción de las medidas de conservación del suelo y el agua. etc. las características del crecimiento del cultivo pueden utilizarse como una medida representativa del rendimiento. número de macollos por planta de cereal. lo que aumenta la capacidad de retención y reduce la pérdida de suelo. en donde se observa que la altura del cultivo es menor. si se conoce la técnica con un nombre en particular (por ejemplo “Zai”.net). wocat. entre otras. esta información deberá adjuntarse. Las evaluaciones del rendimiento basadas en campo deberán incluir lo siguiente: población de plantas por metro cuadrado. la mejor manera de categorizarlas es determinar si incluyen medidas agronómicas (como cultivos mixtos. De manera alternativa. especialmente. barreras de setos. que se practica en el Níger).

un importante aspecto de la intensidad del uso del suelo. en principio. frijol y col. plantas de menor vigor. el factor Ruthenberg se establece. están disD escripción y clasificación de uso de suelo en puntos de muestreo 319 . y la severidad de la infección en términos del grado en el cual la planta es afectada. con un diámetro del cultivo menor y una decoloración generalizada en sus hojas. se esperaría encontrar barbecho como parte del patrón de uso de suelo. Este es el caso cuando la cobertura de árboles es escasa (menos de 10 a 20%). Además. por sí misma. Esto permite la inclusión de elementos de vegetación leñosa en la descripción que no están capturados en el sistema de descripción de uso de suelo. deberá enlistarse su nombre. por ejemplo. 2001) por signos de déficit de nutrientes en maíz. lo cual puede ocurrir cuando los árboles están dispersos dentro de la parcela. permite la validación y la verificación de las observaciones en el lugar del muestreo. El uso de suelo en el área circundante del punto de muestreo tendrá una notable influencia sobre la biodiversidad del suelo de la parcela en observación. Patrones de distribución en el campo y árboles en la finca Las observaciones relacionadas con el tipo de campo y con los elementos de vegetación leñosa dentro de la parcela bajo observación y sus alrededores están incluidas. cercas vivas y otros elementos de vegetación importantes. Queda fuera del marco de este capítulo proporcionar información más detallada sobre plagas. y finalmente. enfermedades y sus clasificaciones. dentro del contexto del uso de suelo en las áreas de los alrededores (esto ayuda a establecer si el uso de suelo en la parcela en observación es representativo o no). Respecto a la distribución de los campos (evaluación del patrón de distribución). en el caso de cultivos migratorios o sistemas de barbecho. Existen guías disponibles para registrar deficiencias específicas de nutrientes en cultivos (ver Stocking y Murnaghan. todos a nivel parcela o paisaje. y cultivo de crecimiento vigoroso. La fragmentación del uso de suelo que puede ser evaluada a partir de estas observaciones resulta ser.crecimiento vigoroso. permite una evaluación del uso del suelo en un punto de muestreo particular. dentro de una proporción espacial entre barbecho y el suelo cultivado en el uso de suelo actual. Las observaciones del estatus del cultivo deberán acompañarse de observaciones acerca de la incidencia de plagas y enfermedades e incluir el porcentaje del cultivo afectado. lo que resulta importante para un mapeo del uso de suelo. Si se conoce la plaga o enfermedad específica. la primera distinción se hace en función de si éstos son continuos.

dispersa] Atributo técnico 1 Continuo Distribución del tamaño de la parcela [uniforme. irregular] No continuo Parte de las tierras cultivadas [% de cultivo y área de manejo] Parte de la cobertura vegetal [% de área (semi) natual] Parte del área acuática cultivada [% de área acuática cultivada] Parte acuática no cultivada [% de área acuática no cultivada] Área urbanizada [% de superficie artificial] Atributo técnico 2 Uniforme clases de tamaño (mayoría del campo) [pequeña. industrial. Clasificador espacial Distribución espacial de la parcela [continua. mediana. vegetación acuática (semi) natural.tribuidos en forma de racimos o dispersos (ver Tabla 11. áreas vacías o cuerpos de agua artificiales y cuerpos de agua naturales (hielo y nieve). Residencial. grande] Cultivo principal (lista de los cultivos de cuatro parcelas vecinas ) Cultivo principal (lista de cultivos de cuatro parcelas vecinas) Cobertura del suelo (cobertura dominante de áreas no cultivadas) Tipo de cultivo o actividad Tipo de área acuática Tipo de área urbanizada (ej. El patrón del campo se relaciona a la forma del lugar y al arreglo espacial del mismo. superficies artificiales. Tabla 11. irregular] Patrón de la parcela [regular. etc. en donde se especifican los cultivos principales. Los distintos componentes de uso del suelo pueden describirse con mayor detalle. agrupada. queda una opción para especificar los porcentajes del área usando varias categorías: tierras cultivadas y áreas manejadas. son las características del suministro de agua y la permanencia del cultivo.7 Características de la parcela y distribución del uso de suelo. La segunda distinción se refiere al tamaño. áreas acuáticas cultivadas o de inundación regular. áreas terrestres seminaturales. lo que parece relevante especialmente en el caso de áreas cultivadas terrestres. utilizando las clases mayores de cobertura de suelo del LCCS.) 320 Manual de biología de suelos tropicales . forma y patrón de los campos y finalmente.7).

para cosechar frutas. En el caso de porcentajes bajos de cobertura de árboles y árboles dispersos dentro del campo o alineados en forma de cerca viva.Tabla 11. pantanos. presas. para madera.8 especifica los atributos utilizados para describir los TROF. para leña o material de construcción). Como se ha mencionado. natural (especificar tipo. si es posible)] El último elemento que debe ser registrado es la presencia de elementos permanentes de vegetación leñosa en el paisaje. Más información trata de la cobertura o densidad del componente árbol. Se hace referencia a éstos como árboles en una finca (TROF). El primer atributo describe la distribución espacial de los árboles.7 Continúa. como estanques. este podría no ser el caso. Es importante derivar las clases de manera sistemática. Los atributos técnicos permiten una descripción del tipo de árbol (ya sea por especie u otro nivel taxonómico) y el propósito de tener árboles (por ejemplo. La información sobre los árboles pertenecientes a la familia leguminosa es útil en relación con la ocurrencia de las bacterias formadoras de nódulos. Las “zonas verdes” se refieren a árboles espaciados en filas dispuestas como empalizadas. especificado en términos del número de árboles por hectárea o longitud de los elementos lineales de la vegetación leñosa. aunque estos elementos pueden ser característicos del uso y cobertura del suelo y tener mayor influencia sobre la presencia de la biota específica del suelo. nueces. a partir de los claD escripción y clasificación de uso de suelo en puntos de muestreo 321 . DESCRIPCIÓN Y CLASIFICACIÓN DE USO DE SUELO Definición y descripción de clases de uso de suelo No es el propósito de este capítulo describir cómo las clases de uso de suelo se definen. La Tabla 11. es importante registrar la localización del punto de muestreo respecto al lindero del campo. Se entiende que los tramos de bosque y otra vegetación leñosa fueron ya cubiertos por el método de clasificación para uso de suelo. Clasificador espacial Atributo técnico 1 Atributo técnico 2 Suelo desnudo [% de áreas desnudas] Cuerpos de agua [% de Tipo de cuerpos de agua [arcuerpos de agua] tificial.

cercas vivas. Nivel 5 Clasificador Tipo de TROF [sin TROF. de manera que un conjunto de clases definido para un área en particular puede ser fácilmente mapeado en el conjunto de clases utilizados para otra área y viceversa. otros] Barreras contra el viento u otros arreglos lineales: especies de árboles Empalizadas: tipo o especie dominante Atributo técnico 2 Cobertura (% de linderos que constituyen cercas vivas) Densidad (número de árboles por ha) Longitud total por ha (m/ha) sificadores y atributos presentados aquí. No todos los atributos o clasificadores tendrán que tomarse en cuenta. utilizando reglas de decisión. Por otra parte. tipo de cultivo). una clase de uso de suelo podría ser definida en función de los siguientes valores de atributos: “cultivo de árboles”. Esto se traduce en “plantación de árboles”. lo que determina el nivel de detalle con que se definen las clases. principalmente árboles de sombra. árboles dispersos dentro de la parcela. cuando se toman en cuenta atributos técnicos adicionales. el diseño de la clasificación jerárquica y el atributo de los valores de clase. Si se contemplan atributos adicionales del cultivo principal (por ejemplo. principalmente madera. distintos grados de cobertura de árboles pueden observarse dentro de la clase “plantación de árboles” (o aun dentro de las plantaciones de teca). es posible distinguir entre una plantación de teca y otra de hule.8 Características de los árboles en la finca (TROF). “cultivo de temporada” y “cultivo permanente”.Tabla 11. Los principios de la definición de usos de clase de suelo. Si únicamente se consideran los primeros tres niveles en la clasificación jerárquica. por ejemplo. son explicados a continuación. Las clases se definen por la combinación particular de clasificadores y atributos (determinados por el valor de los mismos). relacionados con observaciones de campo. “parcela de tamaño grande”. “cultivo único”. no necesariamente tienen que implicar una definición de un conjunto adicional de clases en el siguiente nivel de la clasificación jerárquica. pero esto pue322 Manual de biología de suelos tropicales . barreras contra el viento u otros elementos leñosos. zonas verdes] Atributo técnico 1 Cercas vivas: especies de árboles Árboles dispersos dentro de la parcela Propósito [principalmente frutas y nueces.

No obstante. y por ello podría usarse para realizar ejercicios de mapeo a pequeña escala. se retiene la información sobre el porcentaje de cobertura como un valor de atributo en particular para cada observación individual (instancia u ocurrencia) del objeto clase (es decir.de no ser relevante para definir clases separadas de plantaciones de árboles. no todos los atributos pueden ser fácilmente organizados en una tabla. en la jerarquía de clasificación para observaciones en parcela. Las clases se asignan de acuerdo con las reglas de decisión y al mismo tiempo las clases se definen. ver Huising (1993). y “un cultivo permanente”. Más bien. como han sido presentados arriba. “sin irrigación”. en áreas donde los cultivos migratorios o permanentes se practican uno al lado del otro. lo que D escripción y clasificación de uso de suelo en puntos de muestreo 323 . Para una explicación de clasificación y jerarquías agregadas. Esto se refiere a los niveles de la clasificación jerárquica. Los clasificadores especifican un “cultivo de árboles”. Para ilustrar la definición y descripción de la clase. Una clasificación jerárquica se establece de manera similar. y no a los niveles de generalización (el segundo eje en el sistema de clasificación). Debido a la estructura anidada. XO y NO). La Tabla 11. el factor “tiempo de cultivo” puede tener prioridad sobre el cultivo principal como la característica dominante. Debido a que el sistema que se presenta trata de áreas cultivadas y manejadas.1 a la 11. la jerarquía considera el cultivo principal como la puerta de entrada. combinados a través de operadores Booleanos (es decir. en donde el factor “tiempo de cultivo” sería el parámetro en la jerarquía agregada y no.8. decidiendo la presencia de un clasificador sobre otro. O. Y.10. esta característica es general en áreas grandes y no en parcelas. tal y como se observa en la Tabla 11. Por ejemplo: SI (<forma de vida> igual a ‘árbol’ y <tamaño de parcela> igual a ‘grande’ y <combinación de cultivos> igual a ‘único’ y <factor tiempo de cultivo> igual a ‘permanente’) ENTONCES <clase> = ‘plantación de árboles’.9 contiene una vista global de la estructura de la clasificación principal. La Tabla 11. plantación de árboles).9 proporciona una lista generalizada de los clasificadores y atributos de clases de acuerdo con el nivel la clasificación jerárquica. un “campo grande”. hay que tomar en cuenta los valores especificados para los diferentes clasificadores y atributos técnicos. Las reglas de decisión generalmente toman la forma de un conjunto de condiciones SI – ENTONCES que aplica los atributos. Para información precisa habrá que referirse a las Tablas 11. sin embargo.

a un sistema agroforestal en donde los árboles de hule (Hervea brasiliensis) crecen dentro de la selva (Joshi et al. Posteriormente. De manera alternativa.. se clasificará como “extensivo”.11 muestra los datos para una parcela imaginaria de maíz. permitirá una distinción entre hule de “jungla”. de cacao y otras. si la información es correcta y se considera importante en el contexto de la clasifica324 Manual de biología de suelos tropicales . el segundo nivel indica que entre el maíz se encuentran otros cultivos y. Si se utiliza la información sobre la especie de árbol. frecuentemente no son relevantes para cultivos de plantación. porque la preparación del campo. La principal categoría de uso de suelo a la que esta parcela en particular pertenecerá puede definirse como “cultivos permanentes a pequeña escala con maíz como cultivo principal”. enfermedades y la fertilización del suelo no tienen lugar. lo cual únicamente tendrá sentido si existe una gran variación de dichas características dentro del área y si éstas reflejan diferentes regímenes de manejo. La Tabla 11. Algunos de los clasificadores de suelo y atributos de suelo y cultivos. con relación a la variedad de plantaciones. El manejo de estas plantaciones. Tomando en cuenta la información del cultivo principal (clasificadores del nivel 1) se describirá la parcela como grande (con 10. o si forma parte de un paisaje dominado por plantaciones de cultivos de árboles. el tercer nivel.200 mm de lluvia por año. Esto. se pueden distinguir plantaciones de árboles destinadas a la producción de madera para tablas o para otros fines y si se utiliza la información sobre el propósito. por ejemplo.significa una plantación grande de árboles. el manejo de plagas. por lo tanto. Se pueden tomar en cuenta medidas para el control de malezas mediante corte o también el uso de químicos. que la parcela es cultivada de manera permanente con un pequeño periodo de barbecho cada dos años. Las diferencias entre la intensidad de uso de suelo. El primer nivel especifica que se trata de una pequeña parcela cuyo cultivo principal es el maíz. se pueden distinguir plantaciones de frutales. En cuanto a los clasificadores del nivel 5. si la plantación de árboles bajo estudio es un pequeño bosque aislado dentro de un ambiente dominado por cultivos anuales. podría basarse en la clase de atributo nivel 1 “densidad de árboles” o en el atributo nivel 2 “combinación de cultivo de árboles”. se podría definir una subclase añadiendo la descripción “intercalada con un cultivo de leguminosas” para distinguirla del maíz como único cultivo. 2002) o en lugares donde se cultivan únicamente árboles de hule. es importante informar sobre el uso del suelo circundante. una plantación de más de 10 años de teca (que forma un dosel cerrado). con 100 árboles por hectárea y que recibe 1.000 m² por tamaño de la parcela). por ejemplo.

Nivel 2 cultivo combinado Cultivos simples o múltiples Suministro de agua Factor tiempo de cultivo Nivel 3 prácticas culturales Cobertura del cultivo Nivel 1 características del cultivo y el campo Clasificador Forma de vida del cultivo principal Tamaño del campo Segundo Densidad o espacio entre tipo de cultivo plantas Tercer tipo de cultivo Cantidad de agua suministrada Número de Clase de cobertura del cultivos cultivo Tiempo de secuencia Arreglo espacial Tipo de irrigación Duración del período de barbecho Índice Ruthenberg Clase de tamaño del campo D escripción Modo de preparación del campo Tipo de tracción Frecuencia Tipo de operación Alcance de la operación Frecuencia Modo de deshierbe Manejo de plagas y enfermedades Prácticas de fertilización Tipo de fertilizante Volumen aplicado Atributos Nivel de especie 1 Tipo de cultivo (categoría) Forma del campo Tipo de barbecho Tipo especifico de barbecho Atributos Nivel de especie 2 Cultivo especifico (categoría o especies) Atributos Nivel de especie 3 Cultivo variedad (especie o variedad.9 Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo.) Nivel 4 manejo Modo de cosecha y clasificación de uso de suelo en puntos de muestreo Clasificador Medios de limpieza Atributos Nivel de especie 1 Grado de limpieza Modo de limpieza 325 .Tabla 11.

9 Continúa.Tabla 11. Nivel 2 cultivo combinado Tipo de equipo Ubicación. 3 Atributos Nivel de especie 4 Nivel 5 Configuración espacial del campo y árboles en la finca Clasificador Configuración espacial de los árboles en la finca Atributos nivel 1 Propósito de los árboles en la finca Atributos nivel 2 Tipo de especies de árboles dominantes . Modo de equipamiento Aplicación Nivel 3 prácticas culturales Tipo de arado Alcance de la operación Eficiencia Clasificación de la aplicación Tipo de fertilizante Tipo de químicos Tipo de herbicida Volumen Volumen aplicado Volumen aplicado aplicado Patrones de distribución del campo Cobertura de árboles (copa) Densidad de árboles o longitud de barreras Patrones de distribución del tamaño del campo Partes del área terrestre cultivadas y manejadas Partes terrestres no cultivadas Arreglo espacial del campo Forma de vida del cultivo principal Otros tipos de uso o cobertura Clasificación de la aplicación Clasificafión de la aplicación Tipo de equipo 326 Eficiencia Nivel 1 características del cultivo y el campo Atributos Nivel de especie 2 Manual de biología de suelos tropicales Atributos Nivel de especie.

Tamaño o clases de tamaño del campo Tipo de cultivo principal % cobertura Nivel 5 Configuración espacial del campo y árboles en la finca Atributos nivel 3 Especies de árboles D escripción y clasificación de uso de suelo en puntos de muestreo 327 .9 Continúa.Tabla 11.

aunque no se discuten en este capítulo. se puede describir las plantas debajo de los árboles y estas plantas pertenecerán a la categoría de vegetación (semi) natural.200 mm** n/a n/a Nivel 1 Características del cultivo y el campo Clasificador Árboles Atributos técnicos Nivel 1 Perenes. aunque esto por lo general se describe en las características del sitio.Teca nico nivel 2 Atributo téc.000 m2 100 árboles/ ha n/a n/a 1. de hoja ancha leñoso >10 años Manual de biología de suelos tropicales Atributo téc.Tabla 11. ** En el caso de sistemas de temporada de ser posible debe especificarse la cantidad de lluvia.10 Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca. para lo cual se utilizan otros parametros.Tectona grandis nico nivel 3 * En este caso. Nivel 2 Combinación de cultivos Único 328 Nivel 3 Prácticas culturales De temporada n/a n/a n/a n/a Permanente n/a Grande Regular Cerrado Vegetación natural* 10. . si es relevante.

Tabla 11.11 Ejemplo de clasificadores y valores de atributos para parcelas de maíz. habas.000 m2 Mediano a grande 75 x 25 cm Frijoles NA 0. maíz 10% n/a n/a n/a n/a Ninguno Fertilizante químico Directamente hoyos Manual VMB (muy bajo) 50 kg CAN/ha n/a Atributos nivel de especie 2 Maíz Mucuna (abono verde) Atributos nivel de especie 3 Nivel de manejo 4 n/a Tracción animal n/a 2 bueyes n/a Arado de vertedera n/a Nivel 5 Configuración espacial del campo y árboles en la finca No TROF y clasificación de uso de suelo en puntos de muestreo n/a n/a Caminos .16 1 cultivo adicional Simultaneo 2 filas alternadas NA Intermitente De temporada Permanente Mejorado Nivel 1 Características del cultivo y el campo Nivel 3 Prácticas culturales Clasificador Gramíneas Pequeño Atributos nivel de especie 1 Cereales Cuadrada D escripción Mecánica y química Labranza frecuente (2x) y fumigación una vez (1x) Aspersor de mochila VB (Roundup) Continuo n/a n/a Pequeño Uniforme 90% Regular Hierbas y gramíneas Chícharos.infraestructura 329 n/a . Nivel 2 Combinación de cultivos Múltiple 2.

uso de nutrientes. que indica patrones de uso de suelo fragmentados y un uso intensivo del suelo. dependiendo de las reglas de clasificación. pero una definición de un índice o medida de la intensidad de uso de suelo no es fácil. que las parcelas son generalmente pequeñas. Un esquema de clasificación estándar no funcionará porque la definición de un conjunto de clases depende del contexto y del propósito específico de la clasificación. con escasa o sin presencia de árboles. La información específica se refiere a la densidad de la planta.ción. con cultivos anuales. al arreglo específico de la combinación del cultivo y a qué especie es utilizada para mejorar el barbecho. Ordenamiento de las clases de uso de suelo respecto a la intensidad de su uso En sistemas agrícolas. sin que esto quede reflejado en la definición de las clases. Giller et al. La norma general es que los sistemas culturales y manejados son más intensivos que los naturales (cuanto más insumos de manejo se requieran para mantener los sistemas. insumos de ener330 Manual de biología de suelos tropicales . Parece que existe un consenso sobre los factores que determinan la intensidad del uso de suelo.. (1997) definieron un índice de intensidad de uso de suelo que considera la frecuencia de la ocupación de suelo (según lo expresado en el índice Ruthenberg). el manejo tiene por objetivo modificar o establecer condiciones que propicien la producción de un cultivo. Esto podría traducirse. manejo de plagas. Manejo y nivel de insumos: la información en el manejo del cultivo y el suelo habla de que el nivel de perturbación del suelo se considera intermedio (habiendo sido arado dos veces con el uso de tracción animal) y que el insumo de químicos ha sido bajo. el criterio para mejorar el barbecho podría considerarse en la definición de las subclases. con un bajo volumen de herbicidas. en “un manejo caracterizado por el uso de tracción animal y bajo insumos agroquímicos”. sin el uso de fungicidas o pesticidas y únicamente con muy baja cantidad de fertilizantes. más intenso será su uso). Los clasificadores de nivel 5 y los atributos describen que el suelo es cultivado de manera continua. El grado de interferencia con (perturbación o alteración) el ecosistema natural sería una buena medida de la intensidad del uso de suelo. Esta sección pretende demostrar cómo un conjunto de clases podrá definirse y organizarse en una estructura jerárquica y que el sistema es bastante flexible en cuanto a la selección de clasificadores y atributos considerados para su clasificación. principalmente.

que en el entorno de márgenes de selva se traduce en elementos de vegetación leñosa. También. El primer gradiente representa la presencia (proporción en el espacio o tiempo) de vegetación seminatural. puesto que cada índice es una expresión particular de la intensidad del uso de suelo. Además. pero éstos no han sido del todo exitosos. se requieren categorías de clases de uso de suelo en términos de la intensidad de uso de suelo (o alternativamente una definición de clases de uso de suelo que reflejen diferentes niveles de la intensidad de uso de suelo). Existen dos principales ejes a lo largo de los cuales se mide la intensidad del uso: el primero. indicando que el sistema con una proporción mayor de vegetación permanente (ya sea como elementos de vegetación natural o cultivada) representa una intensidad menor de uso o un grado menor de perturbación.gía y manejo de agua. de la misma manera como lo ilustran Kuechler y Zoonneveld (1988). con la relevancia de que un índice en particular dependiente del contexto o propósito para el cual se está desarrollando. aunque no directamente relacionado con la influencia de la operación del manejo. la proporción del tiempo durante el cual la vegetación del suelo se restablece de manera semipermanente. Lo anterior permite un arreglo de los componentes de la vegetación (objetos) a lo largo de dos gradientes. La presencia de vegetación permanente en el sistema de cultivo limitará las posibilidades para cultivar el suelo o la proporción del suelo que puede ser cultivado. En ambos casos. Han existido varios intentos por definir una medida de intensidad de uso de suelo. en el caso de cultivos migratorios. El segundo gradiente D escripción y clasificación de uso de suelo en puntos de muestreo 331 . como factores relevantes. los esfuerzos para crear un índice universal o una medida de la intensidad de uso de suelo serán inútiles. la presencia de vegetación permanente disminuirá la influencia de la variación climática en el ecosistema del suelo. se refiere a la permanencia (o frecuencia) de operaciones y el segundo. Esto se hace considerando aquellos atributos (y clasificadores) que expresen un aspecto en particular de la intensidad de uso de suelo. reflejando el grado en el que estos factores tienen un efecto en los ecosistemas (el grado en el que se altera o perturba el ecosistema natural) y debido a que algunas veces los datos requeridos para una evaluación cuantitativa de la intensidad del uso de suelo no son accesibles. Para los propósitos de investigar tendencias en la pérdida de la diversidad del suelo en relación con un incremento en la intensidad de su uso. a la intensidad (o amplitud) de las operaciones. el componente de la cobertura de la vegetación (semi) permanente es un indicador útil. se traduce directamente en la frecuencia del cultivo. Es decir. puesto que es difícil asignar un peso adecuado a las variables explicativas.

cultivos anuales y pastizales) en el caso de elementos de vegetación cultivados. este eje también expresa una partición en el espacio entre los elementos de vegetación natural y cultivada. lo que resulta relevante en el caso de sistemas particulares de uso de suelo.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. sólo de árboles plantados (plantación) o sólo de cultivos anuales o pastizales. de acuerdo con el componente Figura 11. Además de servir como una partición en el tiempo. en el siguiente nivel de especificación. de acuerdo con el incremento en la intensidad: “sin cultivar”. pero sobre todo.representa la cobertura de vegetación leñosa. selva). a árboles plantados o cultivados (árboles cultivados) o elementos de vegetación no leñosos (por ejemplo. como en el sistema de “hule de la selva” mencionado arriba. los objetos de uso de suelo son ordenados a lo largo del segundo gradiente de intensidad de uso de suelo. y presencia o ausencia del componente arbóreo. En primer lugar. En segundo lugar. la permanencia se expresa con el factor “tiempo de cultivo” y el sistema de clasificación permite un arreglo de clases de uso de suelo. dentro de cada una de las clases definidas. Cultivos anuales-campo Componente de le vegetación leñosa y semileñosa (natural) Componente de la vegetación leñosa cultivada Componente de la vegetación leñosa no cultivada Componente árbol Selva Tiempo de cultivo-permanencia Plantación 332 Manual de biología de suelos tropicales .“cultivos migratorios”. para el sistema de cultivo permanente.“sistemas de barbecho”-“cultivos permanentes” (véase Tabla 11. como se ha especificado en el atributo técnico 1.5). Los objetos se refieren a árboles que existen en la naturaleza (en el caso de vegetación natural). dentro del sistema de cultivo. Se puede hacer una subdivisión adicional basándose en la duración del periodo de barbecho. se determina basándose en los clasificadores y atributos del sistema de clasificación. La localización a lo largo de los dos ejes. El continuo puede representarse gráficamente con un triángulo en donde los tres ángulos representan los valores extremos de la cobertura del suelo que solo pueden estar constituidos por árboles naturales (es decir.

tracción animal o medios mecánicos). Una asignación de la intensidad de clases se basa en el valor del clasificador en las operaciones de cultivo (es decir. el rango se lleva a cabo basado en las características de manejo (el cuarto nivel en el sistema de clasificación). Tabla 11. los cultivos de árboles se consideran menos intensivos cuando se comparan con cultivos de arbustos.2. como se ve reflejado en la información sobre la categoría del cultivo (ver atributo técnico 1.1) junto con las características de la cobertura del cultivo (es decir. como un nivel más de intensidad. A un nivel más general. En el tercer paso. “plátano y otras plantas herbáceas similares”. Si únicamente se toma en cuenta la forma de vida del cultivo principal. Los clasificadores y atributos del nivel 4 (especialmente relacionados con las operaciones de cultivo. el orden de intensidad de uso sería el siguiente: “cultivo herbáceo”. dentro de las clases resultado de los dos pasos explicados arriba.2) y combinaciones de cultivo (Tabla 11. la clase “bambú” aparece antes que las clases de “pastos”. tiene que considerarse la información relacionada con los árboles en la finca (Tabla 11.5).1).3). se deberá considerar la intensidad de las operaciones. deshierbe y de manejo de plagas y enfermedades) son utilizados para definir las clases de intensidad. las plantaciones de árboles se consideran menos intensivas que cuando se trata de arbustos pequeños como el del café o té. Las clases se ordenan de acuerdo con este gradiente utilizando las características del cultivo principal (Tabla 11.1). Respecto al tipo de cultivo de gramíneas. de gramíneas y con formas de vida herbáceas. operación de cultivo) y con el grado de uso de agroquímicos (para el control de malezas y manejo de plagas y enfermedades) tal y como se indica en la Figura 11. “cereales” y “arroz” (ver Tabla 11. sin cultivo. Existen dos aspectos que deben ser considerados en relación al manejo: uno se relaciona con el grado de perturbación física debida a las operaciones de manejo y el otro se relaciona con el grado de interferencia química con el sistema (uso de agroquímicos). En el caso de cultivos de árboles (sistema basado en árboles) se puede considerar el número de estratos de la vegetación y el porcentaje de cobertura del suelo para una categoría posterior.árbol o arbusto en el sistema de cultivo (referido a las proporciones en el espacio o en el tiempo). Una diferenciación adicional para cultivos que no son árboles se basa en la permanencia o duración del cultivo. “lúpulo y otras enredaderas perenes herbáceas” y “cultivo de cobertura”. Respecto a los cultivos sin gramíneas. Si la cobertura de los árboles es escasa. También se podrían considerar operaciones de deshierbe con “deshierbe mecánico”. Una vez más. Por ejemplo. D escripción y clasificación de uso de suelo en puntos de muestreo 333 . porcentaje de la cobertura del cultivo. las cuatro clases de intensidad se definen de acuerdo con el grado de mecanización (es decir. manual. Tabla 11.

son considerados de manera conjunta. Para poder llegar a una clasificación final de clases de uso de suelo en términos de intensidad de uso. únicamente se considera el “uso” o el “no uso” de agroquímicos.2. En cuanto al orden de categoría respecto del uso de agroquímicos. El procedimiento jerárquico descrito arriba producirá ramificaciones claramente separadas en la clasificación del árbol. el arado escarificado. Al final. pero una diferencia más. la clase de uso de suelo más intensiva pertenece a “cultivos migra334 Manual de biología de suelos tropicales .Figura 11. y no reconoce que puede haber una superposición considerable en términos de intensidad de uso de suelo entre las clases. en el primer paso de la clasificación. A nivel más general. seguido por el arado de disco. ALTO NIVEL DE INSUMOS QUIMICOS Uso de agroquimicos INTENSIDAD ALTA: ALTO GRADO DE MECANIZACIÓN. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. considerando una plantación de árboles (cultivo permanente bajo manejo extensivo) representará un sistema menos intensivo que un cultivo manejado intensivamente bajo un sistema de barbecho corto. podría basarse en el volumen de aplicación (aplicación selectiva o localizada. BAJO NIVEL DE INSUMOS QUIMICOS Otra diferencia podría establecerse en función del tipo de animales o maquinaria usada (de acuerdo con los caballos de fuerza) y el tipo de arado empleado.3. El arado de vertedera tiene un efecto más profundo en el suelo (remoción completa). La superposición será considerable entre las clases de sistemas de barbecho y sistemas de cultivos permanentes. ALTO NIVEL DE INSUMOS QUIMICOS Grado de disturbio físico INTENSIDAD BAJA: BAJO GRADO DE MECANIZACIÓN. una evaluación por pares de clases de uso de suelo individuales en la región de superposición dará la clasificación final en términos de la intensidad de uso de suelo. tipo de equipo o maquinaria usada en el caso de plagas y enfermedades y el volumen de aplicación. ver Tabla 11. que representa el nivel más bajo de perturbación.3. el arado de cincel y. estas clases tienen que relacionarse entre sí. por último. Como se ilustra en la figura 11. Esto se puede observar en la figura 11. los clasificadores para el control de malezas y manejo de plagas y enfermedades.6b). BAJO NIVEL DE INSUMOS QUIMICOS INTENSIDAD MEDIA: ALTO GRADO DE MECANIZACIÓN. INTENSIDAD MEDIA: BAJO GRADO DE MECANIZACIÓN.

que se considera la forma de vida de la vegetación dominante o cultivo. sistema de barbecho (barbecho 4-5 meses) Pte: cultivo de árboles extensivo. bajo cultivo migratorio (1-2 años < barbecho < 8-10 años) Ssce: cultivo extensivo. en primera instancia. si proviene de orígenes culturales o (semi) naturales (por ejemplo. sistema de barbecho (4-5 meses < barbecho < 8-9 meses) Fsci: cultivo intensivo. cultivo permanente Pgi: pastizales intensivos. si el suelo está en barbecho el 60% del tiempo y la vegetación de ese suelo es pasto. cultivo permanente Pchi: cultivo intensivo. en esta fase. este pasto se considera el tipo de vegeD escripción y clasificación de uso de suelo en puntos de muestreo 335 . sin distinguir. cultivo migratorio (barbecho < 1–2 años) Flce: cultivo extensivo.3 Clasificación del uso del suelo en términos de la intensidad de uso.Figura 11. Para establecer una comparación de clases de uso de suelo individual. que corresponde al 66% del tiempo que la tierra no es cultivada. cultivo permanente Pge: pastizales extensivos. sistema de barbecho (barbecho > 8-9 meses) Fmcm: cultivo de intensidad media. bajo cultivo migratorio (periodo de barbecho > 8-10 años) Smce: cultivo extensivo. lo que se toma como el límite superior para la clase “cultivos migratorios”. Esto quiere decir. cultivo permanente Pti: cultivo de árboles intensivo. se aplican los mismos criterios que en el segundo y tercer pasos de la clasificación. cultivo permanente torios” y es seguida por el de menos intensidad de uso “cultivo permanente”. en las regiones superpuestas entre la categoría mayor de uso de suelo. donde se determina el orden a lo largo del gradiente de intensidad de uso de suelo descrito anteriormente. Donde: Fn: selva natural Fl: selva explorada Slce: cultivo extensivo. considerando que la cobertura de árboles en plantaciones puede ser entre el 60% al 70% de la intensidad de uso. cultivo permanente Pcmi: cultivo de intensidad media.

G. in C. y Swift.New York. 336 Manual de biología de suelos tropicales . más que al barbecho en sí) para permitir a la clase bajo consideración subir una o dos posiciones en el orden de clasificación. (2005) ‘Belowground diversity assessment: Developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. in D. De esta manera. P.. A. H... se hace una distinción entre selva natural. B. F. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. Peter Okoth por las discusiones en la preparación de este capítulo. V.. N. FAO. con la introducción de una noción de que la extracción de productos de la selva sirve como un indicador para la intensidad de uso. si se compara con un área de cultivo permanente bajo manejo intermedio o bajo (Pcmi). FAO.. de acuerdo con los sistemas de uso de suelo en el trópico húmedo a diferencia del proyecto ASB (Bignell et al. (2000) Land Cover Classification System (LCCS): Classification Concepts and User Manual. Columbia University Press. M. Marcel Dekker Inc. Nwaga. Respecto a la selva. Tondoh. F. Huang. 2005). FAO Soils Bulletin 77. (2002) Soil Management and Conservation for Small Farms. Susilo. Pashanasi. P. L. y Jansen. S. M.. A. D.. Management and Conservation Service. Woods. Strategies and Methods of Introduction. Pimentel (ed) Encyclopaedia of Pest Management. Igualmente. D.. J. GCP/RA/287/ITA Africover – East Africa Project and Soil Resources. A. y Dorr. REFERENCIAS Bignell. un cultivo con un manejo intensivo bajo un sistema de barbecho corto (Fsci) puede subir una posición. aun en el caso de que sean manejados intensivamente (Pgi) tendrán una clasificación más baja en términos de intensidad de uso de suelo.. A. Techniques and Equipment. Di Gregorio. Moreira. Agradecimientos Al profesor Ken Giller por sus comentarios y al Dr. “sistemas de barbecho” refiriéndose al componente de cultivo. En el segundo ejemplo se considera la intensidad de manejo (en relación con el cultivo más demandante del sistema. si se compara con un cultivo anual con un sistema de barbecho corto (Fsc). Rome. I. los pastizales permanentes. New York. J. Vosti. Dibog. L. S. De Freitas.-X. Craig. E.tación dominante). J. selva manejada y selva explotada. P. Rome. J. es decir. Sanchez and P. (2002) ‘Aerial application’. Palm.

. Vincent..Giller.. P. I. E. E. y Huising. www. 6. H. Ruthenberg. Elsevier Science Publishers B. 3rd edition. Clarendon Press. pp. J. www. John Wiley & Sons. Oxford. Baere. Springer Verlag. M. K. Huising.. M. K. P. Fritsch and C. H. Kluwer Academic.edu/pnw/weeds. The Netherlands. D. Stocking. MacArthur.. A. G. y Kiefer. y Zonneveld. M. B. (2001) Handbook for the Field Assessment of Land Degradation. vol. Usher. ILACO (1985) Compendium for Agricultural Development in the Tropics and Sub-Tropics. soil biodiversity and ecosystem function’. Ph.. van Noordwijk. M. y Swift. y Williams. in H. M.. M. P.. Kuechler. www. Izac. M. Boutin. R. ippc. London. Karlsruhe.orst. H.shtml. Barrios. (1991) ‘Formal data structures. W. in M. N. Berlin WOCAT.. Dordrecht. Taylor & Francis Ltd. Joshi. 10. Karanja.. M. Hopkins (eds) Biological Diversity and Function in Soils. M.. (1980) Farming Systems in the Tropics. A. Wageningen Agricultural University. P. Wibawa. ICRAF-Southeast Asia Regional Research Programme. Indonesia.asp. (2002) Jungle Rubber: A Traditional Agroforestry System Under Pressure. The Netherlands. Vink. S. Lavelle. Earthscan Publications Ltd. Iowa State University (2004) ‘Weed Science’.wocat. Moreira. Bogor. Cambridge University Press. D. T... Cambridge.. A pattern recognition approach to land use inventory at the sub-regional scale using remote sensing and GIS applying an object oriented and data-driven approach’.D. D escripción y clasificación de uso de suelo en puntos de muestreo 337 .. Bardgett and D. D. World Overview of Conservation Approaches and Techniques. W. London. Manurung. Handbook of Vegetation Science. D. S. (1997) ‘Agricultural intensification. Ebner. Molenaar. Amsterdam. Barois. (1987) Remote Sensing and Image Interpretation. y Collinsons. van Noordwijk.-M. J. and Murnaghan. 3–16. Applied Soil Ecology. A. Oregon State University (2005) Pacific Northwest Weed Management Handbook. (eds) (1988) Vegetation Mapping. (1975) Land Use in Advancing Agriculture. J. Swift. E. E. E. The Netherlands. J...org/swcmeas.. F. vol. G. Bignell. L. I. Molenaar. (1998) An introduction to the Theory of Spatial Object Modelling for GIS. (2005) ‘Soil biodiversity in rapidly changing tropical landscapes: Scaling down and scaling up’. New York. Wichman Verlag. object dynamics and consistency rules’. A. N. W. Thesis. Giller. N. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. M..edu/mgmt/2004/ world. Heipke (eds) Digital Photogrammetric Systems.V. G. R.weeds.. R. Lavelle.. Lillesand. J. Akiefnawati.iastate. D. Zandstra.

.

Brasilia. Universidade de Brasilia. Systematic Zoology Research Group of Hungarian Academy of Sciences and Hungarian Natural History Museum.904-979. Brazil. Cares. d. constant@unb. E.org. R.gov. Brazil. 13. CEP 70. Universiti Malaysia Sabah. Coordenação de pesquisas em Entomologia. Franklin. Campus Universitario Darcy Ribeiro. Departamento de Fitopatología.uk. Bangalore. Departamento de Fitopatología. DF. Hungary. Instituto de Ciências Biológicas.com. Bagyaraj. J. D. CEP 69011-970. lmabreu@gmail. (finado). Manaus. Brazil. dbagyaraj@vsnl. S. Departamento de Zoología. GKVK Campus. Universidade Federal de Minas Gerais. Nairobi. World Agroforestry Centre (ICRAF). Gigiri. Csuzdi.904-970.hu. CEP 70910-900 Brasilia. Constantino.br. University of Agricultural Sciences. Belo Horizonte MG. Institute for Tropical Biology and Conservation. Instituto de Ciencias Biológicas. United Nation Avenue. Instituto Nacional de Pesquisas da Amazõnia (National Institute for Amazonian Research-INPA). Brasilia. D. Cx Postal 4457.Colaboradores L.ac.br. Abreu.br.bignell@qmul. r. Brazil. E. P. Malaysia. Cx Postal 4457. Cx Postal 478. PO Box 30677-00100. DF.com. India. Instituto de Química. Kenya. Brazil. M. Universidade de Brasilia (UNB). AM. 88999 Kota Kinabalu. H-1088 Budapest. R. Departament of Agricultural Microbiology. csuzdi-alef@nhmus. cares@unb. Coe. Bignell. CEP 70. beth@inpa. J. Sabah. C. 339 .coe@ criar. Universidade de Brasilia (UNB). DF. Huang. Barross str. E.

Universidade Federal de Lavras. 801. S. H. morais@inpa. Stürmer. swiftmj2003@ yahoo. N. c/o ICRAF. Morais. Brazil. S.gov.org. Lavras. J. F. Departamento de Fitopatologia. Departamento de Ciência do Solo (Soil Science Department). CEP 37200-000.com. Konaté. asgknila@yahoo. alcmoino@ufla. j. Universitas Lampung. L.fr. B. 69011-970. Huising.br. Universidade Federal de Lavras. Manaus. Instituto Nacional de Pesquisas da Amazônia (Nationale Institute for Amazonian Research-INPA). Brazil.com. Université d’Abobo-Adjamé. United Nations Avenue. AM. Cx Postal 478. Bogor. SC. Indonesia. Tropical Soil Biology and Fertillity (FSBF) Institute of CIAT. Coordenação de Pesquisas en Entomnologia.com. Universidade Federal de Lavras. Moreira. F. Brazil. c/o ICRAF.br. M. Jr. Universidade Regional de Blumenau. Bandar Lampung 35145. 340 Manual de biología de suelos tropicales . LIPI JI. PO Box 30677-00100.. Departamento de Entomología. Université d’Abobo-Adjamé. fmoreira@ufla. Jalan Sumantri Brojonegoro nº 1.P. Raya Jakarta-Bogor Km. Faculty of Agriculture. Indonesia. C. Kenya. Kenya. Bandar Lampung 35145. United Nations Avenue. J. CEP 37200-000. Universidade Federal doAmazonas. MG. m. Faculty of Agriculture. Abidjan.br. Faculdade de Ciências Agrárias. M. Côte d’Ivoire. Lavras. sturmer@furb. Gigiri. Indonesia. Louzada. Centre de Recherche en Ecologie. J. Blumenau. fxsusilo@tlkom. J.E. Susilo. Nairobi.br. Gigiri. Pfenning.com. jlouzada@gmail.huising@cgiar.go. Lavras . CEP 37200-000. Tondoh. Tropical Soil Biology and Fertility Institute of CIAT. RC Biology. E. Brazil.com.rahmadi@lipi. CEP 69070-000 Manaus.id. Departamento de Ciências Naturais. Cx Postal 3037. CEP 89010-971. Cx Postal 3037. Abidjan 02. Cx Postal 3037. Karyanto. M. 02 BP 801.br.van-noordwijk@cgiar. S. C. nmarques@ufam.net. van Noordwijk. UFR des Sciences et de la Nature. CEP 37200-000 Lavras MG. N. A. MG. cahyo. 46. ludwig@ufla. CEP. Rahmadi. Department of Plant Protection. Brazil. Cx Postal 1507.edu. A. W. M.br. Moino. L. X. Cibinong. Jalan Suantri Brojonegoro nº1. World Agroforestry Centre SE Asia. Universidade Federal de Lavras. 16001 Indonesia. Brazil. Skonate2@yahoo. AM Brazil. PO Box 161. J. Silva. PO Box 30677-00100 Nairobi. Departamento de Biología (Biology Department). Cx Postal 3037. Côte d’Ivoire. tondohj@ yahoo. Swift. University of Lampung. Zoology Division.

zanetti@ufla. Universidade Federal de Lavras.br. Zanetti.R. C olaboradores 341 . Lavras. MG. Departamento de Entomologia (Enthomology Department). CEP 37200-000. Brazil. Cx Postal 37.

.

263 análisis de conglomerados (cluster) 267 análisis de correspondencia (AC) 266 análisis de varianza (ANOVA) 265 análisis filogenéticos198.127. Véase atributos atributos técnicos específicos. 93. 99. 191. 246 agroquímicos 313. 291 análisis automatizado del espaciador intergénico ribosomal (ARISA) 261. 217. 132 343 .160 nematodos 171-172 AC.Índice analítico A abundancia macrofauna 98.164. 151. 302-329 atributos de tamaño de unidades de muestreo campo o parcela 304-307 cuadrícula 81-82 atributos técnico. 194-197. 280 África 141–142 agroecosistemas 43. 334 aislamiento 190. 177-214. 40. 290 bacterias fijadoras de nitrógeno (BFNFNL) 177-213 Basidiomycota 248. 251-252 bienes y servicios. 252-153 Asia 140–141 atributos 297. 247–248 arado 311. 132 mesofauna 159. de uso de suelo 302 B bacteria 39. 243.314. 334 Ascomycota 248. Véase servicios ecosistémicos biomasa 127.85 ácido láctico 156 aditivos 279. 288. 126. 290-294 alimentación especializada o incidental 111 almacenamiento de las muestras 78. Véase análisis de correspondencia ácaros oribátidos 150 ácaros 149-159 acceso a puntos de muestreo 84.

110 nematodos 171-172 uso de suelo 42-43. 307 características del cultivo 301. 97. 254-255 D D. 171-172 cercas vivas y otros elementos de vegetación 319-321. 265 curvas de rarefacción 265 Cylindrocladium spp. 190 caracterización de sitios 87-88 caracterización genética 197 cartografía. 129. cultivo 305. 310. Véase disturbio datos requeridos y análisis 49-50. 303 DGGE. 313-315 determinación a priori 65. 58. 325-329 conjunto mínimo de datos 129-132 contaminación 78 control microbiano 287 cosecha 311. 102 clasificación. 158-160. 194 HMA 219-222. Véase enumeración cobertura. conservación y manejo sostenible de la biodiversidad del suelo 344 Manual de biología de suelos tropicales cuadrícula estratificada 84-85 cultivo post inundación 308 cultivos de sotobosque 308 cultivos migratorios 309. 124. cultivo 305-307 depredadores 37. jerarquía 323 clasificadores 297. 301. 300. 334335 clasificación de procesos 93. 226-232 hongos 244. 164 descomposición 29-35. 125-132. 325-329 colecciones de recursos genéticos 267 Collembola 123. 265-267.biopesticidas 288 bioturbación 34 C C. 302. 304307. 316 cultivos puros 198 cultivos secundarios 307 cultivos trampa 231-232 curvas de acumulación de especies 113. 101. 37-38. 317 cPCR. 331-332 Chromista 247 Chytridiomycota 248. 94. Véase Proyecto. Véase colonizadores cálculo. 197. 265-267 macrofauna 98-100. 246 descriptores genéricos 194 desmonte de la tierra 311. 96. 325-329 caracterización cultural 189. 149-162 colonización 219-224 colonizadores (c) 172-174 combinación de cultivos 308-311. 298. 251 ciclo de nutrientes 34 clasificación de uso de suelo 332. 302. Véase PCR competitivo CSM-BGBD. 302-304 densidad. 245. Véase taxonómica clasificación. uso de suelo 81 categorías tróficas 110-112. Véase electroforesis en gel con gradiente de desnaturalización diapausa 289 disección 157 diseños multiescala 64 diversidad BFNFNL 178-182. 58 . 304-324. 319-320. 188. 243.

104. 191 enumeración 168. 163-165 grupos funcionales de la biota del suelo 38-41 H herbívoros 37 hidróxido de potasio (KOH) 156 hipótesis de CSM-BGBD 57 Í ndice analítico 345 . 322-323. 263 embudo de extracción 149. 132 nematodos 165-166 extracciones núcleo por núcleo 154 F factor tiempo de cultivo 309. 71 etiqueta 97. 226-228. 319 enfoque sesgado 65 enfoques transversales 57 ensamble de especies 110 ensayo de reducción de acetileno (ERA) 185. Véase ensayo de reducción de acetileno escala 62 escalas espaciales de muestreo 42-50. 140 especies anécicas 100. 116-125.99-100. 288 esquemas de muestreo alternativos 5789. 218. 190. 128 fertilizantes 314-316. 192 . 70. 128 especies trampa 185-186 esporas 88. 152-155 enfermedad 35. 330-333 familia Acaulosporaceae 238 familia Archaeosporaceae 239 familia Gigasporaceae 240 familia Glomeraceae 236 familia Pacisporaceae 239 familia Paraglomeraceae 239 fase de pupa 284 fauna de la hojarasca 37. 315. 229-231. 283 extracción DNA 197. 94-100 esquemas de puntos de muestreo 72-75 estacionalidad 88. 189. 317 fertilizantes inorgánicos 315 fijación de nematodos 165-169 G glomerales 220 Glomeromycota 247 gradientes. 317. 114-118. 115-117. 130. 36. 85-86 escarabajos 100-113. 193 equidad 266 ERA. 128 especies clave 129 especies endógenas 99. 162.E eficiencia en la labranza 312-314 electroforesis en gel con gradiente de desnaturalización (DGGE) 259-260. 99. 257 esporas de HMA 226-228 método de Berlese 152-154 método de extracción Winkler 92. muestreo 80-81 gremios 114-115 grupos funcionales 29-41. 110-111. 128 especies epigeas 78. 98 estándares para BFNFNL descripción de especies 194-196 estatus de los cultivos 318 estratificación en el muestreo 55-57.6567. 312. 113. 112125. 287.

313. 229-230 hongos 255-256 lombrices de tierra 98-100 macrofauna 105-110. patógenos de plantas 41. 91. 44. 185–187 huella molecular 196-198. Véase índice de madurez imágenes satelitales 67. 302-304 manejo de la biota del suelo 47-49 muestreo 79-80 replicación y tamaño de muestra 60–65 I identificación grupos funcionales en macrofauna 112-113 HMA 226-228. Véase hongos micorrizógenos arbusculares hongos entomopatógenos 287-294 esquema de medición por puntos 74 grupos funcionales 39. 263-264 índice fitoparasítico (IFP) 172-174 índice de madurez (IM) 172. 114-118. 193 jerarquía clasificación 323 clasificación de uso de suelo 300-302. 46 datos requeridos 48-50 descripción y clasificación 299. 297-336 investigaciones piloto 60 irrigación308. 301.173 índice de riqueza de género 171 índice de Shannon–Wiener 266 infiltración de glicerina 168 ingenieros del ecosistema 34. 53. 166-168 organismos entomopatógenos 290. 37. muestreo de 63. 140-144 mesofauna 156-159 moscas de la fruta 284-285 nematodos 163-165. 259-260. 91. Véase también taxonomía IM. 243-280 hongos fitopatógenos 41 hongos micorrizógenos 217-241 hongos micorrizógenos arbusculares (HMA) 41.HMA. 243-280 hongos saprofitos 41. 310 limpieza de malezas 313-315 listas de especies 107-109 lombrices de tierra 40. 41 HMA 217–241 patógenos de plantas y saprofitos 41. 129 inoculación 47. 140 hospederos promiscuos 178-185. 187. 305-306. 100–113 . 334 labranza mínima 312 LCCS. 91-92. 304. Véase Sistema de clasificación de cobertura de suelo límites. 193 insectos 287-294 intensidad de uso de suelo agrícola 42. 243-280 hongos antagonistas 41 hongos del suelo. 330-336 inventarios 41-50.93–100. 87-88. 217-241 hormigas 40. 306 índice de diversidad de Shannon 171 346 Manual de biología de suelos tropicales L labranza 312. 317 J jarras de Leonard 186. 217. 64. 293. 100-113.

40. 287–295 nematodos bacteriófagos 164 nematodos omnívoros 164 Í ndice analítico 347 . 54. 75-77. 130 métodos de extrapolación 105 métodos de montaje 157–158. 97 muestreo no aleatorio 67 muestreo secuencial 64 muestreo simple aleatorio (MSA) 55. 131 número de muestras 81–83 esquema de puntos de muestreo 72–75 muestreo estratificado 67. 193–195 clasificación de usos de suelo 297-336 diseño y estrategias 53-90 hongos 249 inventarios de biodiversidad 42-47 macrofauna 91-148 mesofauna 149-162 moscas de la fruta 282-285 muestreo adaptativo 64.114–118. 73. 193 muestras control 193. 98-100. 263-264 método de la cuadrícula de intersección 227-228 método de partículas de suelo251–253 método de reacción en cadena de la polimerasa (PCR) 196. 91-148 manejo 311-319. 82–83. 131 monolitos complementarios para lombrices de tierra 97 moscas de la fruta 281-286 muestras compuestas 61–65. 334 media poblacional 25 medidas de conservación 318 “medio 79” 214 medio “S” 293 medio selectivo. 67-68 muestreo sistemático 67-68 N nematodos 163–176. 118. 56. 249. 229–230 métodos TSBF 93–94 microfauna 37-38. 321-330 materia orgánica 29-35 materia orgánica del suelo (MSO) 34. 40. 73. 48-49 monolitos 94–100. 126. 197. para hongos 252-255 mesofauna 39.84–85 nematodos 165 punto de muestreo 62-63 muestreo aleatorio 55–56 muestreo en cuadrícula clasificación de uso de suelo 304 CSM-BGBD 79–80.M macrofauna 39. 290 método de filtración de partículas 252– 254.149-160 método de Berlese 149-160 método de Berlese modificado 154-155 método de centrifugación en azúcar 166 método de de extracción 190. 114-118. 260.84–85 paisajes 61-63 aleatorio y sistemático 67-68 muestreo en transectos monolitos para lombrices de tierra 97 macrofauna 75. 214 muestreo dentro de una parcela 65 muestreo animales 39 BFNFNL185–189. 39. 261. 58 mecanismos de control 313-315 mecanización 311. 263 método de Seinhorst 168 método de Seinhorst modificado 169 método Winkler 92.118125. 40. 73 microhabitat 47.256–259.

319 plantaciones 322–324 348 Manual de biología de suelos tropicales plantaciones de teca 328 plantas hospederas 178–182. 64-65. subparcela o microhabitat 47. 145. 249–255 proceso de aclarado 156-157 procesos de degradación 44 procesos de rehabilitación 44 productores primarios 37 programa Africover 299 propágulos infectivos 219-224 protozoa 247 proyecto. 49. 48. 328. 250 . Véase Método de reacción en cadena de la polimerasa permanencia de la vegetación 330–332 persistencia (p) 172. 317. 263 prácticas culturales 301. 325. muestreo 81. 330 PCR competitivo (cPCR) 262 PCR cuantitativo 261-262 PCR. 219 población. 250 plagas 35. 81. 49 nivel neotropical 142. 132 Pythium spp. 184–186. 298 prueba de hipótesis 55–57. 329 preparación de la tierra 311-312 primers específicos para “hongos” 257258 principales grupos funcionales 35-38. 102 nivel de parche 46–47. 307–311. 314 Phytophthora spp. Conservación y manejo sostenible de la biodiversidad del suelo (CSMBGBD) 45–47.nematodos parásitos de plantas 164 nematos micofagos 164 nicho. 191 nivel de nicho 47. 85–86.218. 315. 7980. muestreo 60-62 polimorfismo de conformación de cadena única (SSCP) 261. 165. 38.140–144 nomenclatura 106. separación de 85-86 puntos. 174 pesticidas 286. 83–84. 57. 219224 O observación directa 302 observaciones secundarias 303 Oomycota 250 organismos entomopatógenos 287–295 organismos mutualistas 39 P p. 41 procedimientos basados en cultura 333–245. Véase persistencia paisajes 44–47.79–89. 126. 63 prueba piloto 60 pseudo-replicas 62 puntos de medición 53 puntos de muestreo 74 puntos de muestreo.61-62 parcelas de muestreo y clasificación de uso de suelo 46–47. 48-49.147–148 nivel regional 44. 78. 263 polimorfismo de longitud de fragmentos de restricción (RFLP) 260 polimorfismo de longitud de fragmentos de restricción terminal (T-RFLP) 260. 244. 300–336 patógenos fúngicos de plántulas 255 perturbación (P) 56. 49 nitrogenasa 184.185–198. 126 número más probable (NMP) 218.

267 técnicas de procesamiento de muestras 78.249–252. 229-230 macrofauna 105 mesofauna 158-159 moscas de la fruta 281.187 trampas McPhail 282 BFNFNL 190 pitfall 118-125. 328. 82.279–280 técnicas de lavado para partículas del suelo 252. 155158 técnicas específicas de DNA 197. 284 neotropical 145 Véase también identificación visión general 29. 163 sistema de clasificación de cobertura de suelo (LCCS) 299 sistemas de barbecho 309–310. 329 sitios de muestreo 60-63. 325. 334. 41. 145. 130-132. 30–33. Véase Polimorfismo de conformación de cadena única sustancias químicas 156-158 349 . 140. 227 tipos de anidación 112-113 trampa de especies múltiples 185. 285 respuestas multivariadas de interés 63-64 RFLP ver polimorfismo de longitud de fragmentos de restricción rhizobia 177-183 Rhizoctonia spp. 93-95. 149 trampa 118-125.R reactivo de Melzer 230-231 reglas de decisión para la clasificación de usos del suelo 323 rendimiento. 253-255. 79 solución de nutrientes Jensen’s 215 solución Nesbitt 158 SSCP. 300–302. 188189 técnicas de cebo 119. 263 tinción de raíces 224–226. 124. 91. 126. 256–265 termitas 40. 100–113. cultivos 310-311 roundup 314 T tasas de aplicación 303. 297–299 rizosfera 249 rotación. 103105. 103. 123. 251 Ricinius communis 254–255 riqueza de especies 265–267. Véase electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) 259–260.124. 263 técnicas de preservación 267 técnicas de preservación 93-94. 314–316. 147 termitas que se alimentan de madera 111 termitas que se alimentan del suelo 110 TGGE. 317 taxonomía BFNFNL 177–182 HMA 219-222. 335–336 sistemas de cultivo 42. 36-41 técnica de infección de plantas 178. 149 trampa White 293 Í ndice analítico S secuencia de cultivos 107 secuenciación 16S rDNA 196 selección subjetiva 67 servicios ecosistémicos 29–36. 130-132. 304–319. medición del estatus de los cultivos 318-319 resguardo de especímenes 192-193.

7981. 83-84 Véase también intensidad de uso de suelo área de uso de suelo 46. 70–72. Véase polimorfismo de longitud de fragmentos de restricción terminal trituradores 260 V valores cp 171-174 variabilidad 70-72 variabilidad de datos 44. 58 hongos 243 inventarios 87-88 muestreo 65-67.trampas sin cebo 118 transecto de entrenamiento 102 transformación de datos 126. 87 variabilidad intragrupo 51 vegetación leñosa 319. 48 W WOCAT World Overview of Conservation Approaches and Technologies 318 Z Zygomycota 248 350 Manual de biología de suelos tropicales . efectos de mitigación 301. 320–322 vegetación semi-permanente 331 vegetación. 298. 64. 159-160 transformadores procariotas 38 T-RFLP. 132 U uso de suelo a priori definición de clases descriptivas 65. 300. 303 BFNFNL 186 cartografía 81 definición de clases 321–324 descripción y clasificación 297–336 diversidad 42. 83. 61–62. 331–333 ventanas para muestreo 60.

Bignell se terminó de imprimir durante el mes de mayo de 2012 en los talleres gráficos PROAGRAF. 91190.proagraf. 20 de Noviembre No 649. Veracruz. E. México. P. Moreira.A. C.Manual de biología de suelos tropicales. S. Av.V. Badillo.000 ejemplares . Tel/FAX (228) 890 6204/815 1876 www. Col.mx Se tiraron 1. Xalapa.com. Jeroen Huising y David E. de C. Muestreo y caracterización de la biodiversidad bajo suelo . S. editado por Fátima M.