Manual de biología
de suelos tropicales

Esta publicación presenta parte de los resultados del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity”, implementado en siete países tropicales: México, Brasil, Costa de Marfil, Kenia, Uganda, India e Indonesia. El proyecto es coordinado por el Tropical Soil Biology and Fertility Institute del CIAT (TSBF-CIAT) con co-financiamiento del Global Environment Facility (GEF), y con apoyo para su implementación del Programa de Naciones Unidas para el Medio Ambiente (PNUMA-UNEP). Las opiniones expresadas en esta publicación pertenecen a los autores del libro y no necesariamente concuerdan con las de PNUMA-UNEP o GEF. La traducción y publicación de este libro en español fue posible gracias al apoyo financiero del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity” y al Instituto Nacional de Ecología (INE). También queremos agradecer todas las facilidades proporcionadas por Tiberious Brian Etyang del Tropical Soil Biology and Fertility Research Area of CIAT (TSBFCIAT) Nairobi, Kenia, a Teotonio Soares de Carvalho de la Universidade Federal de Lavras, Brazil, al Dr. José Antonio García Pérez por sus valiosos consejos y sugerencias, y a Caridad González Lerma por cuidar los últimos detalles.

Manual de biología de suelos tropicales
Muestreo y caracterización de la biodiversidad bajo suelo
Fátima M. S. Moreira, E. Jeroen Huising y David E. Bignell (editores )

Secretaría de Medio Ambiente y Recursos Naturales (S emarnat) Instituto Nacional de Ecología (INE)

Título original de la obra: A Handbook of Tropical Soil Biology Sampling and Characterization of Below-Ground Biodiversity © Earthscan en el Reino Unido y Estados Unidos en 2008 Hardcover ISBN: 978-1-84407-621-5 Paperback ISBN: 978-1-84407-593-5

Revisión de capítulos por especialistas en el tema: Dra. Isabelle Barois Boullard, Instituto de Ecología, A.C. Dra. Simoneta Negrete Yankelevich, Instituto de Ecología, A.C. Dra. Rocío Vega Frutis , Instituto de Ecología, A.C. M.C. José Antonio Gómez Anaya , Instituto de Ecología, A.C. M.C. Francisco Franco Navarro, Colegio de Posgraduados Dra. Esperanza Martínez-Romero, Centro de Ciencias Genómicas, UNAM Dra. Lucia Varela Fregoso, Hongos y Derivados, S.A. de C.V. Dr. Juan Rull Gabayet, Instituto de Ecología A.C. Dra. Dora Trejo Aguilar, Universidad Veracruzana

Primera edición: 2012
D.R. © Instituto Nacional de Ecología

Periférico Sur 5000. Col. Insurgentes Cuicuilco, Deleg. Coyoacán, 04530, México, D.F. www.ine.gob.mx

Coordinación General de la Publicación en Español: Isabelle Barois Boullard Coordinación editorial y formación: Raúl Marcó del Pont Lalli Corrección de estilo: Adriana Victoria Arcos Méndez Revisión y preparación de originales: Martín De Los Santos Bailón Colaboradora en la traducción al español: Judy Shirley Adaptación del texto: Mariluz Pérez Lorenzo Diseño portada: Álvaro Figueroa Foto de la portada: Claudio Contreras Edición para internet: Susana Escobar Maravillas Forma sugerida de citar el libro: Moreira, F., E. J. Huising y D. E. Bignell. 2012. Manual de biología de suelos tropicales. Muestreo y caracterización de la biodiversidad bajo suelo. Instituto Nacional de Ecología, México, 337 pp., México.
Ninguna parte de esta publicación, incluyendo el diseño de la portada, puede ser reproducida, traducida, almacenada o transmitida de forma alguna ni por ningún medio, ya sea electrónico, químico, mecánico, óptico, de grabación o de fotocopia sin permiso previo de los editores. Pequeños párrafos, tablas o figuras, pueden reproducirse dentro de lo estipulado en la Ley Federal de Derecho de Autor y el Convenio de Berna, o previa autorización por escrito de la editorial. ISBN: 978-607-7908-31-9 Impreso y hecho en México

Índice

1 2 3 4

Listado de tablas Listado de figuras Prólogo a la edición en español Prólogo Prefacio Lista de acrónimos y abreviaturas El inventario de la biodiversidad biológica del suelo: conceptos y guía general Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo Macrofauna Collembola, acari y otra mesofauna del suelo: el método Berlese

9 10 13 17 21 25 29 53 91 149

preservación e identificación de moscas de la fruta 163 177 217 243 281 287 10 Hongos y nematodos entomopatógenos 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo Colaboradores Índice analítico 297 339 343 .5 6 7 8 9 Nematodos del suelo Bacterias formadoras de nódulos en leguminosas Hongos micorrizógenos arbusculares (HMA) Hongos del suelo saprófitos y patógenos de plantas Muestreo.

2 4.8 11.9 11.10 11.Listado de tablas 1.7 11.6a 11.3 6.1 8. fertilizantes y cosecha Características de la parcela y distribución del uso de suelo Características de los árboles en la finca (TROF) Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca Ejemplo de clasificadores y valores de atributos para parcelas de maíz 26 33 44 72 103 122 154 167 168 169 174 210 253 295 297 298 298 299 303 307 310 312 315 318 319 .1 1.1 5.4 11. procesos asociados de cambio y componentes relevantes de la biodiversidad Grupos de organismos del suelo colectados utilizando diferentes métodos de captura Ejemplo de lista de especies Densidad numérica (individuos m-2) de termitas en siete localidades.1 5.2 5.2 11. en la provincia de Jambi del centro de Sumatra Composición química para aclarar y montar especímenes Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina Familias y valores cp utilizados para el índice de madurez Familias y valores cp utilizados para el índice fitoparasítico Filum/Orden. Género.3 11. unidades de referencia. amplificados del DNA total Clasificadores y atributos técnicos para el cultivo principal Tamaño del campo y características de la cobertura del cultivo Atributos de cultivos combiandos Características del suministro de agua Factor tiempo de cultivo Clasificadores y atributos relacionados con la limpieza de la parcela.5 11.1 7. biota del suelo y principales grupos funcionales a los que pertenecen Principales grupos funcionales de la biota del suelo Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo.1 3. Familia.1 11.1 3. a través de una gradiente de perturbación de la selva.1 11. labranza y deshierbe Clasificadores y atributos para el manejo de plagas y enfermedades. Especie de bacterias formadoras de nódulos en leguminosas Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes.2 1.11 Número de especies descritas en las principales categorías taxonómicas de plantas.6b 11.3 2.

94 Extracción de termitas de una muestra de suelo en una charola de aluminio. 32 Principales grupos funcionales. b) ilustración de la división de una cuadrícula entre seis. cuatro palitos pequeños y una cubierta de celofán. 99 Ejemplo de curva de acumulación de especies con una desviación estándar. hecha con un vaso.6 3. 54 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. para muestrear la mesofauna en la hojarasca y en el suelo mineral. 81 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). arañas y otros artrópodos. dispuestas a lo largo del gradiente. b) si se incluyen de manera deliberada valores de MOS más extremos. estudiados en el proyecto CSM-BGBD.4 2. tamaños y procesos de ecosistemas relacionados. b) se utilizan guantes como precaución contra enredaderas. c) incrementando la replicación.4 3. 59 Esquema de muestreo por puntos para toda la biota.3 2.1 2. 116 Sacabocados de metal. utilizando una pequeña cuchara o cuchillo de campo. según se requiera. esto aumentará la precisión de la estimación de la pendiente. 77 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. 70 Esquema alternativo para muestrear macrofauna. hormigas. 91 Esquema de alineación de monolitos complementarios de lombrices de tierra. 148 . d) reconociendo los límites como otra categoría. b) tres cuadrículas que muestrean tres diferentes parches de selva. 115 Trampa pitfall improvisada.7 4. 109 Esquema de una trampa pitfall con cebo. mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.2 2.5 2. con puntos de muestreo adicionales. probablemente arrojará la mayoría de los valores de MOS cercanos a la media.3 3. clasificados de acuerdo con dominios y reinos.5 3. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. por estratificación.2 2. El muestreo se puede ampliar si se usa uno o dos transectos para termitas. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. utilizando permutaciones de datos al azar. 93 Separación a mano de lombrices de tierra en charolas de plástico. tres y dos ventanas.1 3.1 1. dando un estimado pobre de la pendiente. a) cuadrícula completa.6 3.2 3.Listado de figuras 1. utilizando un transecto de 50 m.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. hormigas y escarabajos. 71 Ejemplos de diferentes configuraciones de ventanas de muestreo. 35 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula.

b) inoculación de la suspensión (alícuota de 0. y a la derecha.1 A la izquierda. d) almacenaje de conidios en tubos Eppendorf. 282 10. 216 10.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos 165 5. 184 6. 163 5. 149 4.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) disolución seriada de la suspensión acuosa que contiene al hongo. Las cajas Petri no deben contener más de una tercera parte de líquido. fijadoras de nitrógeno en diversos sistemas de uso de suelo. 152 5.3 Embudos Berlese llenos de suelo y hojarasca. bajo condiciones de congelación.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. 165 5. c) larvas que muestran la patología típica de infección por nematodos. 151 4. 162 5. con embudo superior de 40 cm de diámetro. 151 4.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio.4 Embudo Berlese modificado. b) sistema Berlese– Tullgren en operación. c) incubación bajo condiciones controladas en una cámara DBO.3 Producción de acetileno en campo o laboratorio. 166 6. 187 6. creciendo en medio ADP. b) muerte de nematodos en agua caliente.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. 163 5. d) emergencia de juveniles infectivos en la trampa White. 282 10.4.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. La rejilla que contiene a los tubos se sumerge en un recipiente con agua.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.5 Equipo básico requerido para extracciones núcleo por núcleo Berlese-Tullgren. 166 5. resumida en seis pasos. de 50cm de altura.2 Cultivos purificados de Beauveria bassiana. 189 7. 284 .3 a) Nematodos recuperados mediante el lavado de malla de 400.2 a) contenedor de apoyo para embudos Berlese–Tullgren.1 Evaluación de bacterias formadoras de nódulos en leguminosas.7 Charola con montajes permanentes de especímenes de nematodos. hecho de aluminio. 180 6.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos. suspensión de suelo en reposo. juego de tamices de metal (de malla de 45 arriba y de 400 abajo).1 ml) en una caja Petri con medio de cultivo.

11.2. y presencia o ausencia del componente arbóreo.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. 322 324 325 . 11. 11.3 Clasificación del uso del suelo en términos de la intensidad de uso. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos.

la fijación de nitrógeno. hormigas. pero ahora sabemos que interviene y participa ampliamente en los servicios ambientales que brinda el suelo: por una parte. CH4) son realizados principalmente por el grupo funcional de los ingenieros químicos del ecosistema. colémbolos y nematodos. N2O. hongos y protozoarios y los reguladores biológicos como los ácaros. que son las lombrices de tierra. es la que menos se conoce.Prólogo a la edición en español Este prólogo es el segundo elaborado para esta misma obra y se presenta para su versión en español. La biodiversidad del suelo alberga más del 25 % de la que existe en todo el planeta y. las bacterias. la regulación de la dinámica de la materia orgánica del suelo. escarabajos y pequeños mamíferos. en términos generales. por la importancia que reviste su divulgación en un idioma que puede ser leído por un amplio grupo de países de América Latina. el ciclaje de nutrientes. termitas. es decir. Cabe mencionar que un tipo de organismo puede participar en varios grupos funcionales. El conocimiento de esta biodiversidad se ha dejado de lado durante mucho tiempo por la dificultad para abordarla. “¡Se sabe más de las estrellas que de los organismos del suelo!”. 13 . que pueden incorporar y asimilar estos conocimientos en beneficio de la biodiversidad del suelo. Por otra parte. fundador de la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad de México. la sostenibilidad y el desarrollo de sus comunidades rurales. José Sarukhán. la captura de carbono y la reducción de emisiones de gases traza (CO2. la elaboración de la estructura del suelo y el mantenimiento del régimen hídrico la desarrollan los ingenieros del ecosistema. Como lo afirmó el Dr.

más aun. se requieren muchos años más de investigación taxonómica y funcional para comprender y manejar los procesos edáficos. conservación y equilibrio del ecosistema. tanto del punto de vista morfométrico como molecular para lograrlo. particularmente en las regiones tropicales. Y si bien se ha avanzado mucho al respecto. las condiciones de la biota del suelo continúan alterándose aceleradamente en todo el mundo debido a las actividades humanas. sobre el verdadero impacto que están teniendo las prácticas de manejo. silvícolas y ganaderas en el mundo. el uso de fertilizantes. pues permitirán diseñar y establecer estrategias para mantener la sustentabilidad. pero su impacto y repercusiones sobre los procesos de funcionamiento. reduciendo la materia orgánica contenida y alterando gravemente sus redes biológicas y funcionales.De manera global. Ante este panorama. actualizada y rápida. el equilibrio y la funcionalidad de los suelos modificados por las prácticas agrícolas. así como preservar y restaurar la fertilidad natural de los suelos. Mientras leemos estas líneas. Y aunque es difícil cuantificar el valor económico de estos servicios. su biodiversidad. que se encuentran entre los más afectados por la deforestación y el 14 Manual de biología de suelos tropicales . las técnicas de muestreo y estudio de la materia orgánica y los organismos del suelo que permitan obtener información veraz. lo que visto desde el punto de vista antropogénico. conocer y aprender a manejar dicha biodiversidad resulta fundamental para conservar o restaurar la fertilidad del suelo. son fundamentales. particularmente en los ecosistemas tropicales. combinada con las necesidades alimenticias de una población humana en continuo crecimiento. La pérdida de la fertilidad. son grandes pero se desconocen en buena medida los mecanismos y procesos que se afectan. En este sentido. generan y provocan el avance de la frontera agrícola y la intensificación productiva. que han sido desarrolladas y probadas en siete países y tres continentes. contribuye a nuestro alimento. que se estiman en miles de millones de euros anuales. entendidas ahora bajo el concepto de calentamiento global. Durante años los estudios del suelo fueron enfocados al conocimiento de la física y química del suelo. esta biodiversidad le da estabilidad al paisaje. con repercusiones a nivel global. Este manual reúne técnicas de muestreo en campo. fibra y combustible. pesticidas y técnicas mecánicas de cultivo modifican fuertemente las condiciones originales del suelo. y se dejó de lado el estudio de la biología del suelo y. se reconoce la necesidad de estimular la formación de profesionales en taxonomía y sistemática de la biodiversidad del suelo. permite el control de plagas y fomenta la producción de las plantas y de los animales.

inglés. en México. incluso en plantaciones agrícolas con manejo de bajo insumos. Con esta versión en español. Cabe mencionar que la mayoría de los autores que colaboraron para desarrollar este manual residen justamente en países tropicales. Estas técnicas de muestreo básicas han demostrado ser poderosas herramientas para llevar a cabo investigación básica y aplicada. por sus siglas en inglés) . mejorados y actualizados durante el desarrollo del proyecto Conservación y manejo sostenible de la biodiversidad debajo del suelo (CMS.BGBD. Su elaboración tiene como finalidad no sólo ser una herramienta de utilidad en el trabajo técnico. pues en este caso fueron probados. implementado por el PNUMA y ejecutado por el TSBF a nivel internacional y por el Instituto de Ecología A. estudiantes. lo que demuestra la mayor presencia y formación de especialistas nacionales preocupados por sus recursos naturales. para que su alcance e impacto sea más amplio. sino constituir un apoyo en el camino hacia la sustentabilidad y la relación armónica entre el hombre y la naturaleza. La información contenida en este manual es útil para investigadores. profesores y profesionales involucrados en el manejo productivo de los suelos y también en su conservación. Al inicio del manual se incluyen dos capítulos que ofrecen una guía para establecer un método de muestreo representativo que permita evaluar y comparar la biodiversidad del suelo en diferentes sitios. De manera especial queremos P rólogo a la edición en español 15 .C. mientras que al final se encuentra un capítulo integrador que permite relacionar los inventarios de los organismos del suelo con una clasificación del uso de suelo para estimar el impacto del manejo del suelo sobre su biodiversidad. La información de este manual se ha organizado de acuerdo con la funcionalidad de los grupos del suelo. Esto es así porque. las consecuencias de un mal manejo de suelos pueden provocar consecuencias dramáticas. Agradecemos a todos los especialistas que revisaron la traducción de los textos que correspondían a su especialidad y competencia. permitiendo llevar a cabo evaluaciones sobre la diversidad y salud del ecosistema que sirvan como base para el diseño de prácticas de manejo sustentables.cambio en el uso del suelo. financiado por el GEF. portugués y español. Las técnicas y métodos de muestreo presentados en este manual no constituyen sólo una recopilación de los procedimientos originales ya conocidos. ahora este manual se encuentra disponible en tres idiomas. generando información útil no sólo para investigadores o especialistas sino para toda persona interesada en el estudio de la conservación y la productividad del suelo. Fondo para el medio ambiente.

y en particular a Raúl Marcó del Pont y su equipo.agradecer al Instituto Nacional de Ecología. por su trabajo editorial y su paciencia ejemplar. Isabelle Barois Boullard Coordinadora de la traducción y del proyecto CSM-BGBD en México 16 Manual de biología de suelos tropicales .

en la medida que esto ocurra. Un aspecto a destacar del cambio global en las regiones tropicales. Ante esta situación. Una línea de investigación surgida a partir de entonces es la de cómo evaluar y manejar diversidad bajo suelo en sistemas de agricultura que faciliten la productividad agrícola y sustentabilidad de suelo a largo plazo. la regulación biológica del suelo se verá afectada e incluso sustituida por fertilizantes y cultivos mecánicos. sin lugar a dudas. tiene como consecuencia 17 . surge la gran necesidad de aplicar los conocimientos referentes al papel que desempeña la biodiversidad bajo suelo para su sustentabilidad. la mejor muestra –y la más actual– para poder evaluar la biodiversidad del suelo en ecosistemas que están siendo rápidamente alterados como consecuencia de los cambios en el uso del suelo. Este manual es. Dicha intensificación es necesaria para asegurar el suministro global de alimentos. sin embargo. sólo en tiempos recientes se ha planteado que los suelos contienen un componente biológicamente activo. Esto.Prólogo Durante mucho tiempo la sociedad ha reconocido su dependencia respecto del suelo. sin embargo. celebrada en el año 2006. se enfatizó la importancia de la diversidad bajo suelo y se exhortó a abrir nuevas líneas de investigación multidisciplinaria. los suelos en todo el mundo enfrentan una grave crisis. Sea como fuere. es el cambio de uso de suelo asociado a la intensificación agrícola. Mediante la aprobación de la Iniciativa Internacional para la Conservación y el Uso Sustentable de la Biodiversidad del suelo en la Convención sobre Biodiversidad Biológica. a su vez.

las relaciones entre la biodiversidad del suelo y la ocurrencia y magnitud de los procesos ecológicos son inciertas. el mantenimiento de la estructura física del suelo. Un metro cuadrado de bosque templado puede contener hasta mil especies de invertebrados y. entonces. estas herramientas pueden ser utilizadas para aprovechar los organismos del suelo en el manejo de los ecosistemas. Dichos conocimientos son. así como la conservación de la biodiversidad en todo el mundo y no. La biodiversidad tropical ha sido subestimada y es posible que las verdaderas densidades de especies sean mayores que en otras latitudes. Durante mucho tiempo los ecologistas han debatido sobre la importancia de la diversidad biótica del suelo: el secuestro de carbono en suelos. tanto en el laboratorio como en el campo. cubre casi la totalidad de la gama de biodiversidad biológica. un número mayor de diferentes tipos de microorganismos. Del mismo modo. El propósito de este manual es proveer de métodos estándares internacionales para el inventario de comunidades bajo suelo y la caracterización del uso de suelo en el trópico húmedo. no solamente en regiones en vías de desarrollo. únicamente. El objeto explícito en este caso es práctico: proveer de una herramienta definitiva para establecer una línea de base y luego documentar la pérdida de biodiversidad de suelo. En última instancia. la reducción de las emisiones de gas invernadero. pero constituye uno de los principales objetos de investigación en todos los niveles. vitales para poder alcanzar la meta: productividad agrícola sustentable. la capacidad de retención de agua del mismo.una reducción de la biodiversidad del suelo. La relación entre la diversidad de especies y la diversidad funcional de la biota del suelo sigue siendo incierta. problema cuya solución implica un gran reto: ¿es posible. desde luego. en bioprospección y para promover mejoras sustentables en la pro18 Manual de biología de suelos tropicales . manejar la biodiversidad del suelo para poder incrementar la productividad agrícola en regiones que están siendo degradadas? La respuesta a esta pregunta atañe a toda la humanidad porque la tierra está siendo degradada. en los trópicos. sino también en países de primer mundo. por lo que representa el resultado publicado de más de una década de intensa discusión y un amplio trabajo de campo por parte de un gran número de expertos investigadores de muchos países. la provisión de nutrientes en las plantas y el control de patógenos en plantas como contribuciones específicas de los organismos del suelo a la fertilidad de éste. quizás. desde los invertebrados más grandes hasta las bacterias. asociada a la deforestación y al proceso de Intensificación agrícola en los márgenes de los bosques. además.

por lo que algunos taxa han sido excluidos. también donde es necesario. no obstante. Muchas de las técnicas asociadas con una evaluación de diversidad dentro de grupos específicos microbianos han surgido a partir de P rólogo 19 . En la medida de lo posible esto aplica a la identificación: las claves recomendadas son los más funcionales. dentro del alcance de la población que se encuentra relacionada con su productividad. consecuentemente. esto implica la reconciliación de los intereses y preocupaciones de los agricultores pobres. representan a instituciones académicas y gubernamentales en las que se requiere poner en práctica nuevas políticas para el manejo del suelo que han de ser validadas. El proceso responde a una necesidad selectiva. no obstante. si es que aún estamos a tiempo de parar la pérdida de la biodiversidad tropical. distribuidos en siete países y tres continentes. Durante los últimos cincuenta años se han publicado. Una de las más importantes es que la mayoría de los colaboradores pertenece a los países que se encuentran más afectados por la deforestación y el cambio en el uso de suelo. cada una con amplia identidad taxonómica. especialistas en agricultura y empleados técnicos de todos los niveles. sino también para biólogos en general. ofrece la ventaja de traer consigo los medios para poder hacer una evaluación aproximada de la salud del suelo. porque la verdadera biodiversidad es tan amplia que queda fuera del marco de cualquier sistema científico para que se pueda documentar totalmente. pero que también corresponde a un grupo funcional mayor.ducción agrícola. Finalmente. Inevitablemente. especialmente en el caso de los pueblos más pobres del mundo. manuales metodológicos de muestreo para organismos del suelo. en doce localidades como puntos de referencia. considerado importante o esencial en la función del suelo y. los objetivos nacionales de desarrollo y calidad de nuestro ambiente. por lo tanto. En segundo lugar. Otro aspecto notable de este manual es que la biota del suelo está agrupada en ocho categorías. se aconseja referir los especímenes a especialistas. los autores han incluido la revolución en metodología molecular que ha incursionado en las ciencias biológicas durante los últimos diez años. con cierta frecuencia. los métodos presentados en este manual contemplan también los ecosistemas terrestres en general. los métodos han sido desarrollados y monitoreados en condiciones de campo. sin embargo. el presente manual contiene notables diferencias respecto de los anteriores. a muchos servicios ambientales que los suelos proveen. tanto nacionales como extranjeros. son de interés no sólo para expertos en taxonomía. Tal selección es inevitable cuando se trata del suelo.

Wall Natural Resource Ecology Laboratory Colorado State University Mayo de 2008 20 Manual de biología de suelos tropicales .discusiones entre colaboradores y durante talleres específicamente pensados para la publicación del presente manual. Diana H.

El proyecto se inició en 2002 con el objeto de generar información y conocimientos que puedan ser utilizados para un mejor manejo y conservación de la BGBD en espacios de agricultura tropical. El proyecto se lleva a cabo en México. y. y para su puesta en marcha. India e Indonesia. al NERC por el Reino Unido (UK). al (TIGER). al PNUD/ 21 . que permitan la comparación de resultados de inventario en áreas específicas de países tropicales con validez científica y estadística. a la Red de Macrofauna financiada por la Unión Europea (EU). sobre todo. Este proyecto es ejecutado por el Instituto de Biología y Fertilidad del Suelo Tropical (TSBF). Brasil. Kenia. El manual describe métodos de muestreo y laboratorio para evaluar la biodiversidad de una gama de grupos funcionales básicos de biota de suelo. para mantener la productividad agrícola y reducir la extensión de la agricultura en paisajes naturales.Prefacio Este manual es uno de los resultados del proyecto PNUMA/GEF “Conservación y Manejo Sostenible de Biodiversidad Bajo Suelo” (CSM-BGBD) que surge como respuesta a la necesidad de crear métodos estándares e instrucción práctica para el inventario de la biodiversidad bajo suelo. constituye una actualización de los métodos y protocolos que fueron inicialmente propuestos por investigadores afiliados al Instituto de Biología y Fertilidad del Suelo Tropical del CIAT. Costa de Marfil. institución que pertenece al Centro Internacional de Agricultura Tropical (CIAT). recibe apoyo para su financiamiento del Fondo Global del Medio Ambiente (GEF por sus siglas en inglés). del Programa de Naciones para el Medio Ambiente (PNUMA/UNEP). Uganda. asimismo.

Ésta fue la contribución. como es el caso de aquéllos que se refieren a la mesofauna. Los métodos estándares propuestos contienen avances tecnológicos recientes en genética molecular. Londrina. editado por G.dentro del trópico húmedo. Hall. Bangalore. termitas y hormigas. Una 22 Manual de biología de suelos tropicales . en donde también se habla del principio de grupos funcionales del inventario de organismos de suelo. en especial. una evaluación de la diversidad de especies resulta un proceso poco práctico. o la actualización de métodos para evaluar la diversidad de nematodos. Dado que muchas especies aún son desconocidas o no se han descrito. India 2005. lombrices de tierra. Nairobi. y en varios talleres llevados a cabo desde el inicio del proyecto. febrero 2005. la gama completa -geográfica y biogeográfica. Países Bajos). además. en términos de grupos funcionales. por parte de la UNESCO. al igual que en varios talleres temáticos de taxonomía específica (técnicas moleculares con énfasis en T-RFLP. También cubre. termitas. Cali. Colombia. Los métodos que se describen en este manual reflejan una amplia gama de actividades del proyecto CSM-BGBD. bacterias formadoras de nódulos en leguminosas (BFNFNL) y sus plantas hospederas. al programa DIVERSITAS. 2003 (Sumberjaya. octubre 2003). provee detalles adicionales en el caso de grupos funcionales específicos: como el uso de trampas Winkler para hormigas y trampas Pitfalls para escarabajos en muestras de hojarasca. en el de 2004 (Embu. saprófitos y patógenos y una amplia gama de artrópodos mayores. al igual que métodos que no han sido considerados en las publicaciones mencionadas. dentro del alcance de laboratorios nacionales. agosto 2004. editado por Swift y Bignell (2001). ampliamente. diciembre 2004. S. hongos entomopatógenos. Kenia). Kenia. Manaus. Los métodos fueron discutidos y posteriormente perfeccionados en reuniones anuales celebradas entre los años 2002 y 2005.UNDP-GEF con el apoyo financiero destinado al Proyecto Alternativas de RozaTumba-Quema (ASB). Brasil mayo/2004 y Nairobi. cuya evolución se muestra en los reportes de 2002 (Wageningen. Los métodos para algunos de los grupos funcionales de organismos de suelo fueron incluidos en un manual pionero. Brasil. en su caso. HMA y Ectomycorrhiza. Indonesia) y. Los métodos para una evaluación de biodiversidad de suelo fueron descritos en el ASB (Nota de Lectura 6B). La definición de métodos estándares aprovecha la experiencia obtenida con la implementación de los métodos utilizados en los siete países participantes en el proyecto. tales como el registro de huellas genéticas del BFNFNL. Un manual formal de técnicas para organismos de suelo y organismos que viven en agua dulce y sedimentos marinos fue publicado en 1996. elaborado por Anderson e Ingram (1993).

poco se sabe de las relaciones entre ambos factores o sobre los mecanismos por los cuales ocurren cambios en la BGBD. generalmente. Los efectos en BGBD son condiciones compuestas por el medio ambiente y por características físicas y químicas del suelo (por ejemplo: pH. de manera que causará un impacto inmediato en la BGBD que fácilmente se antepondrá al efecto combinado de todos los factores mencionados. Es por esto que el control de la erosión y la rehabilitación de suelos fuertemente erosionados deberá considerarse parte de las estrategias para conservar y sustentar un buen manejo de la BGBD. hay otros asociados con un incremento en la intensidad del uso de suelo. estos cambios de uso de suelo. Al mismo tiempo. la erosión del suelo significa la más catastrófica de las alteraciones. provoca una pérdida de servicios del ecosistema. tenga implicaciones en la BGBD. La hipótesis actual es que una intensificación en el uso de suelo trae consigo una reducción de la biodiversidad del suelo y a su vez. así. por lo tanto. dejándolo como estaba antes de ser alterado. La premisa es que la diversificación agrícola (en varios niveles) genera biodiversidad en el suelo y que la producción agrícola sustentable (en los márgenes de la selva tropical) se mejora significativamente. interpretar esos procesos en el contexto ecológico. esto se traduce en una alteración del suelo como hábitat. no necesariamente se lograría restaurar la BGBD. Aun si se pudiera regresar a sus condiciones originales. que se espera. van acompañadas por reducciones drásticas en la diversidad de plantas. frecuentemente provocan una reducción de materia orgánica del suelo que forma el sustrato básico para la mayoría de los organismos que en él habitan y. la erosión puede llegar a nulificar todos los demás procesos degenerativos. Quedan muchas interrogantes en cuanto al manejo de BGBD. como consecuencia del labrado o del creciente uso directo de agroquímicos. en contra de una productividad sustentable. Además de estos efectos. restablecer la BGBD no implica precisamente devolver los servicios del ecosistema. por lo tanto.mejor opción sería investigar la pérdida de grupos funcionales básicos dentro de la BGBD que muestran un cambio en el uso de suelo o una intensidad del mismo. llega a influir sobre la abundancia y diversidad de dichos organismos. sin embargo. La mayoría de los organismos del suelo se encuentran en los primeros 20 centímetros de su perfil. nivel de nutrientes y densidad). Además. así se podrían entender las consecuencias de una pérdida en el BGBD y. La conversión de uso de suelo y la intensificación de su uso. Para responder a algunas de las preguntas mencionadas se requiere: P refacio 23 .

• Una caracterización de la biodiversidad del suelo en un amplio rango de uso de suelo de varias intensidades. desde bosque natural hasta agricultura de monocultivo. y Bignell. I. Wallingford. experimental o de muestreo) hasta un paisaje natural. Hall. CAB International. Wallingford. G. E. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. D. ASB Lecture Note 6B. J. J. desde una parcela (agrícola. Jeroen Huising y David. caracterizada por un cultivo continuo y un elevado uso de químicos y mecanización. S. S. y observar cómo esta relación se modifica y se altera por las condiciones prevalecientes en el medio ambiente (incluyendo condiciones de suelo). E. Swift. International Centre for Research in Agroforestry. mediante la introducción y/o manejo de biota de suelo (se experimenta con varios manejos alternativos). CAB International. 2nd edition. Moreira. South East Asian Regional Research Programme.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. Estos “puntos de entrada” pueden incluir un mejor entendimiento del uso de prácticas indígenas. • Identificar “puntos de entrada” para mejorar el manejo de la tierra. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. S. www. 24 Manual de biología de suelos tropicales . Fátima M. M. Indonesia. un conocimiento más amplio de prácticas existentes y un uso más efectivo de tecnologías disponibles que no requieran altos insumos.pdf. • Establecer una relación entre la biodiversidad de la superficie y bajo del suelo en los actuales y alternativos sistemas de uso de suelo. M. e Ingram. Bogor. Se espera que los métodos descritos en este manual sean útiles para el diseño y la ejecución de estudios para inventario y monitoreo de la BGBD en todos los niveles. Bignell ReFERENCIAS Anderson. (ed) (1996) Methods for the Examination of Organismal Diversity in Soils and Sediments.fao.

formadoras de nódulos en leguminosas Reacción en cadena de la polimerasa competitiva Conservación y Manejo Sustentable de Biodiversidad Bajo Suelo Biodiversidad Bajo Suelo Electroforesis en gel con gradiente de desnaturalización Equivalente de ácido European Bioinformatics Institute Ensayo de reducción de acetileno Detector de ionización de flama Universidade Regional de Blumenau Global Environment Facililty 25 .Lista de acrónimos y abreviaturas AC ADP AFLP AHM AM ANOVA ARISA B BFNFNL cPCR CSM-BGBD BGBD DGGE ea EBI ERA FID FURB GEF Análisis de correspondencia Agar dextrosa y papa Polimorfismo en el tamaño de fragmentos amplificados Agar con harina de maíz Agar extracto de malta Análisis de varianza Análisis automatizado del espaciador intergénico ribosomal Bacteriófagos Bacterias fijadoras de nitrógeno.

GF HMA ia ICRAF IFP IM INPA ITS KOH LCCS M MAS MOS NCBI Nd NMP P Pc PCA PCR PFGE PNUMA PP RAPD Rep-PCR RFLP RIA SR SSCP TGGE TRF T-RFLP TROF TSBF-CIAT 26 Grupo funcional Hongos micorrizógenos arbusculares Ingrediente activo World Agroforestry Centre Índice fitoparasítico Índice de madurez National Institute for Amazonian Research (Instituto Nacional de Pesquisas da Amazônia) Espaciadores de trascripción interna Hidróxido de potasio Sistema de clasificación de cobertura de suelo Micófagos Muestreo aleatorio simple Materia orgánica del suelo National Center for Biotechnology Information Nivel de dilución Número más probable Perturbación Porcentaje de colonización Análisis de componentes principales Reacción en cadena de la polímerasa Electrofóresis en campos pulsados Programa de las Naciones Unidas para el Medio Ambiente Parásitos de plantas DNA polimórfico amplificado al azar De fragmentos repetidos palindrómicos-éxtragenicos Polimorfismo de longitud de fragmentos de restricción Resistencia intrínseca a los antibióticos Sensores remotos (imagen) Polimorfismo de conformación de cadena sencilla Electroforesis en gel con gradiente de temperatura Fragmentos de restricción terminal Polimorfismo terminal de la longitud del fragmento de la restricción Árboles en finca Tropical Soil Biology and Fertility Institute of the International- Manual de biología de suelos tropicales .

UC UFAM UFC UFLA UFMG UnB VA VB Center for Tropical Agriculture Unidad de colonización Universidad Federal de Amazonas Unidades formadoras de colonias Universidad Federal de Lavras Universidad Federal de Minas Gerais Universidad de Brasilia Volumen alto Volumen bajo A crónimos y abreviaturas 27 .

.

S. Wall. Sin embargo. David E.Capítulo 1 El inventario de la biodiversidad biológica del suelo: conceptos y guía general Mike J. Bardgett. Swift. Moreira y E. Lavelle. 1996. 1990) y muchos fila.5 millones de especies de eucariontes y con una riqueza de especies estimada muy por encima de 10. cualquiera que sea el sistema de clasificación utilizado. Moreira et al. 2004... Jeroen Huising Organismos y servicios del ecosistema del suelo El suelo es un hábitat que alberga una amplia gama de organismos dentro de los tres dominios taxonómicos (sensu Woese et al.. cuando se hace una evaluación biológica de la salud de los suelos (Lawton et al. 2006). La clasificación taxonómica de organismos vivos aún se encuentra en una situación polémica (Margulis y Schwartz. 1998). Ya que no es ni práctico ni coherente tomar en cuenta todos los organismos presentes. la diversidad de la biota del suelo es elevada en todos los niveles de análisis (véase Swift et al. Wall.Estos procesos apoyan a los servicios del ecosistema. Bignell. contri29 .000 en el caso de procariontes. 1998. la biota (relativa a agentes no bióticos y entre ellos mismos) será evaluada por su contribución relativa a los procesos del ecosistema (sensu Daily.1 se enlistan los principales fila de organismos eucariontes y procariontes que son o pueden ser representativos en la comunidad del suelo. especialmente cuando se trata de los taxa a ser creados en altos niveles y los números de tales categorías altas (como reinos) a ser consideradas. con más de 1. Fátima M. 2004). En la Tabla 1. Brussaard et al..2004). 1998. Cavalier-Smith. 1979.. 2005. 1997. 1997.

000 cochinillas) Filum Mandibulata (Artropoda) Grupo funcionalb 1 1 1 1 1 1 1 1 1 2.000 Filum Crustacead [>6 clases] 25.000 hepáticas) Filum Filicinophyta (helechos) 12.000 Filum Cycadophyta (gimnospermas) 185 Filum Coniferophyta (gimnospermas) 550 Filum Gnetophyta 70 Filum Anthophyta (angiospermas) 235.000 Dicotiledoneas 130.800 y Enchytraeidae) Clase Hirudinea (sanguijuelas) 500 45.000–40. 4 4 común localmente 5 - 30 Manual de biología de suelos tropicales .000 Monocotiledoneas 65.000 Filum Mollusca 35.000 Clase Gastropodad (incluye babosas y caracoles) 18.4 muy raro en el suelo 3.Tabla 1.4 2.000 Clase Malacostracad (incluye orden Decapoda con un esqueleto externo calcificado) Orden Isopoda (ácaros de la madera y >11.000 Filum Annelidad (lombrices segmentadas) Clase Polychaeta 9.000 >10 millones Reino Animalia [37 fila] 750 Filum Tardigradad (osos de agua) d 99. biota del suelo y principales grupos funcionales a los que pertenecen.000 Clase Oligochaeta(lombrices de tierra 8. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Dominio Eucarionte 255.1 Número de especies descritas en las principales categorías taxonómicas de plantas.000 Filum Hepatophyta (plantas 6.000 Reino Plantae [12 fila] Filum Bryophyta (musgos) 10.

000 Clase Chilopoda (ciempiés) 2.000 etc.000 quitos. afidos. abejorros) Familia Formicidae (hormigas) 11.162 ciempiés) Clase Diplopoda (milpiés) 10. 4.000 Orden Dermaptera (tijerillas) 1. 3.000 Orden Isoptera (termitas) 2. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Subfilum Hexapoda (Insectos) >900.826 Orden Lepidoptera (mariposas. 6 2.000 Orden Coleoptera (escarabajos) >350. 6 4.000 langostas) Orden Thysanoptera (trips) 6.500 Orden Diplura (doble cola) 659 Orden Protura 500 Subfilum Myriapoda (milpiés y 15. 4. 4 2.000 Suborden Homoptera (cigarras. polillas. 6.000 Orden Collembola (colémbolos) 7. mosquitos pequeños) Orden Hymenoptera (hormigas. 9 4. 7 31 inventario de la biodiversidad biológica del suelo . 9 2. 9 2.000 abejas. 9 2. 9 2.000 Orden Diptera (moscas.000 Orden Archaeognatha (pececillos de 350 cobre ó bristetails) Orden Thysanura 700 Orden Blattoptera (cucarachas) 4. 7 4.1 Continúa. mosquitos.500 Clase Symphyla 200 Clase Pauropoda 700 El Grupo funcionalb 4 4. 7 2. grillos.Tabla 1. 4.) Orden Trichoptera 12. 9 3. escamas) Suborden Heteroptera 25. peri55. 9 2. 23. 7.800 Orden Hemiptera (chinches) >80.6 4 2.000 gegenes.800 Orden Orthoptera (saltamontes. 6. 9 2. 115. avispas. 180. 6 2. pulgones. 9 6 2. >125.9 Sólo en la rivera 4.

000 Orden Pseudoscorpionida 3. incluidas planarias) Número sin Reino Protoctistac [30 fila] determinar Filum Rhizopoda (amibas) Número sin determinar 4000 Filum Dinomastigotad (dinoflagelados) Filum Ciliophora (ciliados) 10. 4.235 (Pseudoescorpiones) Orden Araneae (arañas) 40.1 Continúa. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos critas en el taxón (todos de organismos de suelo/nombre los hábitats) común Subfilum Cheliceratad [3 clases] >100.000 Order Scorpionida (escorpiones) 2000 400 Filum Gastrotrichad (gastrotricha) d 1000 Filum Acanthocephala (lombrices con cabeza espinuda) 2000 Filum Rotiferad (animales de ruedas) 900 Filum Nemertinad (gusanos planos) Filum Nematoda (nematodos.000 Filum Diatomacead (diátomos) Filum Oomycota (Oomycetes) Cientos Filum Rhodophyta (alga roja) 4. 7. alfilerillos) 25. 6.000 Filum Plathyheminthesd (Helmintos. 9 6 6 6 7 Parásitos artrópodos 4.455 Orden Palpigradi (micro-escorpiones) 80 Orden Acari (ácaros. lom15.000 Clase Arachnida [11 órdenes] 93.6 7 1. 7 Muy raros en suelo 2. 7. garrapatas) 45. 9 1 32 Manual de biología de suelos tropicales . 7 1 5. lombrices enterobius.000 Filum Discomitochondria (flagelados 800 y zooflagelados) 10.7 7 1. 6.100 Grupo funcionalb 6 2. 9 2.Tabla 1.000 briz redonda.

8.000 1.. d) Incluye organismos acuáticos y del suelo.100 204 >22.Grupo funcionalb critas en el taxón (todos los hábitats) 16. 10 Nota: a) Considerando las categorías taxonómicas.398f 1 sólo parásitos 5. desde el más bajo hasta el más alto nivel: dominio. b) Grupos funcionales. 1996.gov.000 1. c) Considerados por algunos autores como Protistas o Protozoos y Chromistas. Categorías taxonómicasa (número total de fila existentes) ejemplos de organismos de suelo/nombre común Filum Chlorophyta (alga verde) Reino Fungi [6 fila] Filum Microsporídia Filum Chytridiomycota (Hongos quitridios) Filum Zygomycota (mohos) Filum Glomeromycota (hongos micorrízicos arbusculares) Filum Basidiomycota (incluidos hongos y algunas levaduras) Filum Ascomycota (incluidas levaduras) Dominio Archaead [4 fila] Dominio Bacteriad [52 fila]e Número de especies des.. 9.500 1. Hongos de acuerdo con James et al. sin cultivo y no especificados. Clasificación. consultado el 13 de mayo de 2007). 2006. filum. familia. 8 5. (1990). Brussard et al. género y especies. Procariotas (Dominio Archaea y Bacteria). la riqueza correspondiente arrojará 3090 y 79.1 Continúa. 1997.342.ncbi. excluyendo organismos no clasificados. cuando éstos se incluyen.000 >70. Kibblewhite et al. 2008).250 >30. orden.. f) National Center for Biotechnology Information: (www. Reinos de Eucariotas clasificadas de acuerdo con Margulis y Schwartz. Dichos procesos pueden ser agrupados de acuerdo a cuatro funciones agregadas del ecosistema: El inventario de la biodiversidad biológica del suelo 33 ..000 >344f >8. por su influencia en la calidad y salud del suelo (Hoavelle.nih.Tabla 1. 1998.9 5 5. de acuerdo con Woese et al. reino. de acuerdo con la Tabla 1. e) Rappé y Giovannoni (2003).nlm. (2006). buyendo al mantenimiento y a la productividad de los mismos.2 (de este capítulo). 5. Fuente: Moreira et al. 8 5. respectivamente. 8 10 1. clase.

por la biota del suelo. sin embargo. Como resultado de la descomposición. Bioturbación. estabilidad de agregados 34 Manual de biología de suelos tropicales . sin embargo. pero también es incorporado en diferentes reservorios en forma de materia orgánica (MOS). nematodos. crean y modifican microhábitats para otros organismos más pequeños y determinan propiedades del suelo como aireación. y moviendo partículas de un horizonte a otro. es esencial para todo tipo de agricultura y silvicultura. Algunos grupos de bacterias del suelo están involucrados en transformaciones elementales autotróficas. Ciclo de nutrientes. porosidad y contenido de carbono. los cuales trituran los residuos de plantas y animales. en gran parte realizada por animales del suelo como ácaros. que ocurre principalmente por actividad enzimática de bacterias y hongos. agregados y montículos. drenaje. estabilidad del suelo. Las raíces de plantas. lombrices de tierra y termitas. el paso que marca la operación del proceso se determina mediante micropredadores. mediante la formación de asociaciones simbióticas como las micorrizas y la fijación de N2 en nódulos de raíces. principalmente como CO2 o CH4. poros. es decir. El ciclo de nutrientes. aunque en un tipo de suelo y medioambiente determinados existe un equilibrio entre el contenido del MOS y las entradas y salidas de carbono en el sistema. Aquí también los microorganismos son mediadores de la mayor parte de las transformaciones. Animales más grandes mejoran algunos procesos porque proveen nichos para un crecimiento microbiano dentro de sus intestinos o excremento. Estos procesos de “bioturbación” influyen y determinan la estructura física del suelo y la distribución de materia orgánica del suelo. milpiés. Microorganismos específicos del suelo también incrementan la cantidad y eficiencia de absorción de nutrientes por la vegetación. los microorganismos y los animales involucrados se llaman “descomponedores”. Así. y dispersan los propágulos microbianos. Estas fracciones de MOS varían en su estabilidad y longevidad. colémbolos y ácaros. aunque el atributo “transformadores de hojarasca” es el más utilizado hoy en día para describirlos. que no dependen directamente de la materia orgánica como fuente de alimento. La descomposición de materia orgánica. estos grupos son afectados indirectamente por factores como el contenido de agua. hormigas y algunos otros de la macrofauna del suelo. lo que controla el resto de la biota. 3. lombrices de tierra. termitas.1. Juntos. se mantienen físicamente activos dentro del suelo formando canales. el carbono orgánico es liberado en la atmósfera. estrechamente asociado con la descomposición orgánica. 2. tales como protoctistas. siempre que no se incluya a los ingenieros del ecosistema (véase más abajo).

debido a una diversidad biológica disminuida y/o en cambios ambientales del suelo. NOX. Jones et al. CH4. 1992. 1997). brotes intensivos de enfermedades en el suelo y plagas. las actividades de plagas potenciales y patógenas son reguladas por interacciones con otros miembros de la biota del suelo. En los agroecosistemas.. y también una amplia variedad de interacciones antagonistas microbianas. que incluyen microbívoros y micropredadores que se alimentan de las plagas microbianas y de animales. y de causar enfermedades y muerte. pero tales epidemias sí son comunes en la agricultura. La bioturbación juega un importante papel en la regulación del equilibrio del agua en el suelo (infiltración.1 muestra la contribución de la biota del suelo a servicios ambientales. respectivamente. bacterias.. debe hacerse notar que la interacción entre la descomposición de materia orgánica. N2O). son relativamente raros. En suelos saludables. todos los organismos enlistados. Especialmente. este rango de interacciones puede encontrarse reducido.. en el cambio climático. 1994. por tanto. incluyendo complejos organominerales estables durante meses o periodos más largos (Lavelle et al. La biota del suelo incluye un amplio rango de virus. 1997). La Figura 1. como resultado de los procesos anteriores. La estructura y las propiedades del suelo también están influenciadas por la producción de excretas de animales. A este conjunto de organismos. Los organismos del suelo juegan un papel importante en la regulación de la composición atmosférica y. pueden ser asignados dentro de una o más de las cuatro categorías funcionales genéricas descritas. bioturbación y ciclo de nutrientes determinará el equilibrio entre la cantidad de carbono secuestrado en el suelo (véase arriba) y entre las emisiones de gases invernadero (principalmente CO2. Para poder interrelacionar El inventario de la biodiversidad biológica del suelo 35 . y hasta humanos. como miembros de la comunidad del suelo. capacidad de almacenaje y drenaje) y tiene una fuerte influencia sobre la susceptibilidad a la erosión. Lavelle et al. tales como los causados por un contenido de MOS más bajo. por lo tanto.y capacidad de retención de agua. 4. Enfermedades y control de plagas. En ecosistemas naturales. se le ha denominado “ingenieros del ecosistema del suelo” (Stork y Eggleton. Grupos funcionales de la biota del suelo En principio. basándose en la función particular que desempeñan o en el proceso específico del suelo del que son mediadores. hongos y animales invertebrados capaces de invadir plantas y animales.

Mantenimiento de estructura del suelo 2. 2008 Servicios agrícolas Procesos de entrega basados en el suelo Alimentos y fibras Captura y ciclaje de nutrientes Descomposición de la MO adicionada Dinámica de MOS Mantenimiento de la estructura del suelo Regulación de la población biológica Manual de biología de suelos tropicales Servicios no agrícolas Calidad y suministro de agua Control de erosión Regulación de la composición atmosférica y del clima Degradación y disminución de contaminantes Control de enfermedades y plagas no agrícolas Conservación de la biodiversidad . Regulación de la población biológica 3.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas.. Transformaciones C Ensamblaje funcional Descomponedores: Hongos Bacterias Microherbívoros Detrívoros Procesos de entrega basados en el suelo Mantenimiento de la estructura del suelo Ciclaje de nutrientes Mantenimiento de la estructura del suelo Dinámica de la MOS Descomposición Ciclaje de nutrientes Regulación de población biológica Provisión de hábitat Regulación de población biológica 4. Fuente: Kibblewhite et al. Ciclaje de nutrientes Transformadores de nutrientes: Descomponedores Transformadores de elementos Fijadores de nitrógeno Micorrizas Ingenieros del ecosistema: Megafauna Macrofauna Hongos Bacteria Biocontroladores: Predadores Microherbívoros Hiperparásitos Figura 1.36 Funciones agregadas del ecosistema 1.

ingenieros del ecosistema. descomponedores y microrreguladores por depredación. 1998) pero también calificado en función de la respuesta fisiológica. 7. también de acuerdo con sus características taxonómicas. construcción de estructuras agregadas y formación de poros. 8. 5. 1. Microrreguladores (microfauna como nemátodos): animales que regulan ciclos de nutrientes mediante forrajeo y otras interacciones con los microorganismos descomponedores. rizobia): microorganismos asociados con raíces que facilitan la absorción de nutrientes. translocando compuestos orgánicos sintetizados arriba del suelo. No existe acuerdo preciso en la definición de grupos funcionales. el Tabla 1. Predadores (mucha macrofauna y mesofauna): animales que regulan a los herbívoros. Microsimbiontes (hongos micorrícicos. en última instancia. de alguna manera. por lo tanto. El inventario de la biodiversidad biológica del suelo 37 . Transformadoras de hojarasca (mucha macrofauna y mesofauna. transformadores de hojarasca. y que son los responsables de la mayor parte del flujo de energía en la red alimenticia de los descomponedores. por ejemplo. normalmente definido por criterio trófico (Brussaard. y chupadores de sabia. con los servicios del ecosistema (Setäla et al. 6.. Pueden incluir predadores.organismos específicos del suelo (biodiversidad colectiva) con las categorías genéricas funcionales y. Esta actividad puede ocurrir a varias escalas espaciales. Ingenieros del ecosistema (macrofauna como termitas y lombrices de tierra): organismos que causan un impacto físico mayor en el suelo mediante su transporte. 1998) es necesario tomar en cuenta el concepto de grupos funcionales básicos. ni de cuántos de estos grupos deberán definirse dentro de un ambiente de suelo típico. Productores primarios (plantas superiores e inferiores): organismos fotosintéticos que asimilan bióxido de carbono del aire y penetran en el suelo mediante sistemas de raíces. 3. de comportamiento bioquímico o ambiental y. incluyendo el ciclaje de nutrientes. muchas hormigas. morfológica. que incluyen minadores de hojas y de tallos. haciéndolo más accesible para los descomponedores o favoreciendo el crecimiento microbiano de excretas en forma de gránulos.2 Principales grupos funcionales de la biota del suelo. 2. alguna microfauna): invertebrados que se alimentan de desechos orgánicos originados por microbios y por trituradores de este material. 4. Herbívoros: animales que consumen y parcialmente digieren tejidos vivientes de plantas. Descomponedores (hongos o bacterias degradadores de la celulosa): microorganismos que poseen las enzimas polímero-degradadoras.

. incluya todos los grupos funcionales considerados como importantes. en cuanto a la fertilidad y calidad del suelo. no relacionados.1. (razón por la cual se emplea el término “taxa seleccionado”) y por su facilidad relativa a ser muestreado. no obstante. Éstas están representadas formalmente en la Tabla 1. uno de los principales desafíos es seleccionar un subgrupo de la biota del suelo que refleje adecuadamente el espectro taxonómico anticipado y que. 10. existe un argumento válido que establece por lo menos diez categorías. 2003). plagas) especies de control biológico también pueden incluirse (ej. existen pocos estudios sobre la salud del suelo agrícola. Éstos son grupos taxonómicos que fueron tomados en cuenta en el proyecto Conservation and Sustainable Management of Below-Ground Biodiversity (CSM-BGBD).2). cuyos métodos de inventario y caracterización se describen en los siguientes capítulos. Plagas y enfermedades del suelo (hongos patógenos. concepto es heurístico y puede modificarse en función del propósito analítico necesario. Los grupos taxonómicos propuestos a continuación son seleccionados de acuerdo con su significado funcional diverso. Por esta razón y porque muchos componentes de biota de suelo son taxonómicamente difíciles de identificar. 9. en donde el espectro taxonómico completo ha sido objeto de un muestreo representativo en el mismo lugar y al mismo tiempo (Bignell et al. Grupos selectivos de biota de suelo En el diseño de trabajo de campo. aislado e identificado (Figura 1. parasitoides e hiperparásitos de plagas y enfermedades). Véase que algunos grupos funcionales incluyen una amplia gama de taxa relacionados y. Transformadores procariontes: Archaea y bacterias que transforman de manera específica el carbono (metanotrofa) o elementos nutricionales como N. 38 Manual de biología de suelos tropicales . a veces. probablemente se relaciona con su abundancia relativa y con la biomasa. 2005). también es importante buscar dentro de los grupos funcionales para descubrir los taxa que alcancen el criterio de ser considerados como ingenieros del ecosistema (sensu Jones et al. no obstante. S o P (nitrificación y fijación de nitrógeno)..2 y se usan para anotar las categorías taxonómicas.2 Continúa. 1994) y especies clave (sensu Davic.: depredadores. mientras que otros son muy específicos en cuanto a su taxonomía. enlistadas en la Tabla 1. al mismo tiempo. invertebrados. La importancia funcional de cualquier especie o de grupos de especies.Tabla 1.

0 mm.2 Principales grupos funcionales.Figura 1. nematodos y protoctistas pueden considerarse como componentes de la microbiota general. clasificados de acuerdo con dominios y reinos. transformadores de hojarasca. un grupo que incluye muchos organismos con papeles especiales y una diversidad de descomponedores genéricos MICROBIOTA GENERAL Microfauna. transformadores procarióticos. patógenos.MICROFAUNA Y MESOFAUNA Nematodos Ácaros Colémbolos Otros Biomasa alta II Alta diversidad y biomasa Micropredadores. promotores de crecimiento Nota: la fauna se clasifica de acuerdo con el ancho de cuerpo: macrofauna >2. patogénos y antagonistas IV Omnipresentes con diversidad alta indeterminada Descomponedores.1 mm. trituradores de hojarasca. y microfauna <0. Por su parte. trituradores de hojarasca. antagonistas. tamaños y procesos de ecosistemas ANIMALES.1-2.MACROFAUNA Lombrices de tierra I Escarabajos Otros Hormigas Termitas Diversidad y biomasa alta Diversidad alta Ingenieros del ecosistema.transformadores de hojarasca plantas HONGOS Y BACTERIAS MUTUALISTAS Hongos micorrizógenos Bacterias formadoras de nódulos en leguminosas Omnipresentes con especificaciones típicas de variedad de hospederos (a varios grados) III Omnipresentes Microsimbiontes mejoran la absorción por la raíz y la fijación de nitrógeno Hongos saprotróficos. parásitos de Micropredadores. especialmente protoctistas Archaea y Bacteria El inventario de la biodiversidad biológica del suelo 39 .0 mm. estudiados en el proyecto CSM-BGBD. macropredadores ANIMALES. mesofauna 0.

en los que viven dependientes de películas de agua. Los grupos incluidos en la selección son: 1 Macrofauna: lombrices de tierra. milpiés (Diplópoda) y otros tipos de larvas de insectos que actúan como transformadores de hojarasca con una importante acción trituradora sobre el tejido de plantas muertas y sus depredadores (ciempiés. también representan factores de interés y preocupación.1). por ejemplo. 3 Otra macrofauna: cochinillas (Isópoda). escarabajos. c) normalmente representan una riqueza genérica y de especies muy alta d) juegan un papel importante en la regulación de abundancia y actividad microbiana. 2 Macrofauna: termitas. lombrices de tierra. microfauna y microsimbiontes.Además. todos ellos conforman un gran número de especies. Enchytraeidae. bacterias y depredadores de otros animales del suelo). c) el control biológico como depredadores. b) el ciclo de nutrientes. e) 40 Manual de biología de suelos tropicales . micófagos. probablemente. hormigas y escarabajos que intervienen en: a) la porosidad y la textura del suelo. 5 Microfauna: nematodos y protoctistas que. 4 Mesofauna: colémbolos y ácaros que actúan como transformadores de hojarasca y micropredadores (forrajeros de hongos. varios de estos grupos taxonómicos son muy importantes por sí mismos como contribuidores a la diversidad biótica en general. mediante el transporte. de la mesofauna. la trituración y digestión de materia orgánica. también actúan como reguladores de las poblaciones de biota del suelo. a escala pequeña. por ejemplo. b) ocupan espacios que existen en pequeños poros. protoctistas. ácaros. que intervienen en la porosidad del suelo y en sus nutrientes. hormigas. Algunas especies también resultan perjudiciales porque se convierten en plaga. a) influyen en la tasa de recambio por su papel como forrajeros de raíces (parásitos de plantas). al compararse con otros grupos taxonómicos superiores (Tabla 1. En este contexto. Algunas especies de ácaros y formas de larvas de muchos artrópodos de suelo son lo suficientemente pequeñas como para clasificarse dentro de la microfauna. nematodos y. la introducción de especies exóticas e invasivas. la distribución geográfica. bacteriófagos. arañas. al cavar sus túneles y mediante la ingestión de materia mineral y orgánica. arácnidos grandes y otros tipos de insectos). omnívoros y depredadores. y la pérdida de especies endémicas. al construir galerías y al cavar túneles e ingerir suelo. de esta manera contribuyen en procesos orgánicos de trituración a pequeña escala y ejercen un importante papel regulatorio dentro de la biota del suelo.

en ocasiones. Métodos para inventario de la biodiversidad bajo suelo: principios generales La metodología actual no permite la identificación de todas las especies en el suelo. aunados a la inmensa escala de diversidad encontrada en el suelo. y enfermedades de las plantas. otros fijadores de nitrógeno microsimbiontes que transforman el nitrógeno atmosférico N2. Estos factores. por ejemplo. que dependen de grupos funcionales. lo anterior aplica para los trituradores de materia orgánica (véase transformadores de hojarasca en Tabla 1. compuestos por relativamente pocas especies y/o especies altamente especializadas. entre bacterias. que es asimilable para las plantas. hongos y animales invertebrados. diversidad funcional (el número de grupos funcionales).como insectos patógenos. requieren de un enfoque selectivo para llevar a cabo un inventario de la biodiversidad bajo suelo. reducen ataques patógenos en plantas y mejoran la tolerancia al estrés del medio ambiente. En la biota del suelo.2). bacterias que nitrifican y denitrifican (como parte de los transformadores procariotas). en NH3. En los casos de Archaea y bacteria. rotación de carbono orgánico en descomposición. composición funcional (la naturaleza de los grupos funcionales) y ocurrencia e intensidad de los procesos ecológicos. y contribuyen al potencial control biológico de plagas y enfermedades. Se espera que los servicios de ecosistema. 8 Hongos fitopatógenos. 6 Hongos micorrizógenos arbusculares: se asocian con las raíces de las plantas y mejoran la disponibilidad de nutrientes. el concepto de especies también es muy variable. la mayoría de las especies aún son desconocidas. En muchos Fila. 7 Bacterias formadoras de nódulos en leguminosas y. Hasta donde se conoce. utilizando el concepto de grupos funcionales clave como los descritos anteriormente. Los métodos empleados para la extracción de diferentes grupos de organismos del suelo también son muy diferentes de un grupo a otro. representan un importante control biológico. sean los más vulnerables ante situaciones de estrés y perturbación que afectan a dichos grupos funcionales. Aún sigue siendo una pregunta sin respuesta la relación existente entre diversidad de especies. saprotróficos y antagonistas: que determinan o median (en diferentes casos) la viabilidad de cultivos. de esta manera. la caracterización molecular y bioquímica reemplaza al enfoque de identificación tradicional. bacterias involucradas con el compuesto El inventario de la biodiversidad biológica del suelo 41 .

aunque se dan referencias de claves para la identificación de especies de varios grupos funcionales.C1 y en las transformaciones de hidrógeno (metanogénicas y metilotróficas). puesto que se reflejarán en los métodos a utilizarse. la fragmentación de hábitat y el manejo de cultivos en la diversidad biológica del suelo. Este manual aborda métodos para el inventario y caracterización de la biodiversidad del suelo. Esto debería servir como respuesta a un gran número de preguntas en contextos similares. Los métodos estándar son necesarios para describir los ecosistemas de manera consistente. centrándose en los grupos funcionales que permitan la evaluación de la diversidad. cobre y azufre quimiolitotrofos. En el prefacio se plantea una breve descripción del proyecto. esto conlleva a una serie de interrogantes como ¿cuál es el número mínimo de especies dentro de los grupos funcionales que garanticen la resistencia del suelo contra el estrés del ecosistema natural y antropogénico. cuando se adopta el concepto de los grupos funcionales principales. Si éste es el caso. y en relación con que “especies clave (si existen) en los grupos funcionales?. para el cual se han desarrollado y probado los métodos. por ejemplo. de manera que sea posible evaluar. Los métodos han sido desarrollados. que para algunos grupos y en algunos países es un desafío importante. en términos de una dis42 Manual de biología de suelos tropicales . hierro. el impacto que provoca la intensificación agrícola. En este manual no se abordan problemas taxonómicos. Por lo tanto. especialmente. escogidos y modificados. deforestación. las consecuencias pueden ser negativas. Inventario de biodiversidad bajo suelo en escalas de espacio y tiempo Cambio de uso de suelo como la causa principal del cambio de diversidad biológica del suelo Un inventario puede demostrar si la biota del suelo responde a intervenciones humanas como prácticas agrícolas. contaminación y cambio climático. lo que exige un alto nivel de conocimientos taxonómicos. preguntas como las anteriores deberían ser consideradas en la definición del propósito del objetivo de la investigación de la biodiversidad bajo suelo. hongos micorrizogenos (entre los microsimbiontes) y bioturbadores (ingenieros del ecosistema). para su aplicación en paisajes con diferentes usos de suelo. La evaluación de la composición de la comunidad biótica depende de la identificación de los especímenes recolectados. abundancia y composición de las especies.

la regulación biológica de los servicios de ecosistema basados en el suelo. Para qué muestrear. al mismo tiempo. pérdida del potencial para la limpieza de los residuos y contaminantes.. dónde y cuándo Aunque éste es un manual de instrucción práctica. la biodiversidad arriba del suelo se verá reducida. interrupción de los ciclos elementales globales y respuesta ante los efectos de los gases invernadero y de la erosión. fertilizantes químicos y pesticidas (Kibblewite et al. varias frecuencias). retener una buena cantidad de diversidad sobre el suelo. por ende. puede causar pérdidas de función y reducir la habilidad de los sistemas agrícolas para soportar periodos inesperados de estrés. en la medida que proceda la intensificación. 2008). especialmente. tales como cultivo mecánico. además. escalas que determinan la predicción de servicios ecosistémicos. lo cual implica una reducción de la biodiversidad bajo suelo y. Dichas funciones regulatorias frecuentemente se describen como “sustitutos” por insumos. El principio central es que el significado funcional de la diversidad biológica cambia de acuerdo con las escalas de El inventario de la biodiversidad biológica del suelo 43 . un gran número de agricultores tienen acceso limitado a insumos. El mantenimiento de una variedad de cultivos y otras plantas es aceptado como una práctica que protege al agricultor contra los riesgos a corto plazo.minución de los servicios del ecosistema. también se manifiestan en diferentes escalas espaciales y temporales (por ejemplo.que afectan la biodiversidad bajo suelo. En los trópicos. debería reflejar un consenso de la teoría ecológica y del pensamiento actual sobre estructuras de la comunidad en diferentes escalas espaciales y temporales. debido a cambios en la fertilidad del suelo y/o incrementos de enfermedades en el mismo. para mejorar la complejidad estructural y diversidad funcional. El suministro global de alimentos depende de la agricultura intensiva. incluso puede producirse la pérdida de la productividad primaria. a pesar de que la producción se ha intensificado. produciendo efectos indeseables. Este hecho puede considerarse tanto a nivel de campo como de paisaje. Una solución alternativa sería intensificar y. Sin embargo. Se presume que de esa forma se reducirá la diversidad bajo suelo y que. muchas veces enlazadas entre sí. la biodiversidad y complejidad arriba del suelo favorecen el restablecimiento o protección de la diversidad de organismos bajo suelo. especialmente en suelos degradados. la complejidad de los agroecosistemas ha sido drásticamente reducida. de los que puedan realizar las funciones biológicas esenciales. los procesos de disturbio -y recuperación. si se acompaña de la extinción de especies individuales. en la medida de lo posible.

. constituye uno de los servicios del ecosistema que integra procesos en todas las escalas. puede quedarse corto en relación con el propósito de evaluación de la diversidad de toda el área. la diferencia que puede ocurrir en la descomposición o la fijación de nitrógeno simbiótico entre dos paladas de suelo del mismo campo. Asimismo. mientras se mantuviera en un paisaje mixto. en otro lugar. en un mismo paisaje. a los servicios del ecosistema en diferentes tipos de comparaciones. Lavelle et al. Esto quiere decir que. como se podría esperar. los números o diversidad pueden mantenerse estables. 2004). Por ejemplo.espacio y tiempo (Swift et al. 2002. los ciclos de vida de diferentes 44 Manual de biología de suelos tropicales . no obstante. dónde y cuándo se mide. Las escalas temporales son importantes en los procesos de degradación. si el objetivo del inventario es conservar la biodiversidad bajo suelo.. por ejemplo. El mayor reto. o bien. El objetivo debería ser reducir la variabilidad intragrupo y maximizar la variabilidad entre grupos. pero en el caso de dos campos colindantes. se pensaría que el material parental y el clima fueran los factores determinantes en el proceso de formación del suelo. mientras que en el caso de la zona de uso de suelo. se puede esperar una variación grande. probablemente es cuestión de saber cuáles microorganismos existen en cada una. el inventario de especies de lombrices de tierra. La formación del suelo. espaciales y temporales. en última instancia podría. la erosión de finas partículas de suelo y la reducción al mínimo de materia orgánica compleja que. Entre dos paisajes o dos regiones. con el propósito de lograr lo anterior. de manera general. los materiales parentales y los suelos serán los principales determinantes de todos los servicios del ecosistema a nivel paisaje. es cómo definir estos “grupos” en relación con niveles de escala. al punto de llegar a hacerla ser irrecuperable. la pérdida progresiva de macroporos. a la existencia de termitas o cualquier otro ingeniero del ecosistema que haya presentado mayor actividad en un lugar que en otro. incluso. en caso de rehabilitación. a escala regional. en un lugar específico. entonces. del campo hacia setos que delimitan el terreno. puede haber una influencia biótica significativa. o bien. destruir la capacidad productiva. que combina estos elementos dentro de un sistema de uso de suelo. en número y diversidad de lombrices de tierra al moverse de un lugar a otro. esto quiere decir qué se mide. En términos generales. puede que se deba al drenaje o manejo previo del lugar. El clima. tomando en cuenta los aspectos de la biodiversidad que puedan afectar. De la misma manera. si uno o más grupos funcionales importantes estuvieran ausentes o permanecieran en baja presencia en una de las localidades o si el ecosistema original de bosque se hubiera reducido a una presencia mínima en uno de los lugares.

como puede ser dentro de los bosques). se enfatiza en el capítulo 2 de este manual. vegetación y tipo de suelo. como calidad y suministro de agua o control de erosión y no parece que éste juegue un papel importante.taxa de biota varían de horas a años y pueden incorporar estados obligados de inactividad. La protección y conservación de los principales agroecosistemas y hábitats representa la mejor El inventario de la biodiversidad biológica del suelo 45 . geología. como se indica más adelante. el tiempo requerido para que una población creciente alcance un tamaño crítico mínimo donde es autosuficiente. por los gradientes o transiciones de las condiciones de humedad o por los gradientes de las propiedades del suelo. Los cuatro niveles de escala espacial en muestreo. comparado con los efectos que produce la vegetación misma. en este caso. por lo tanto. que afectan a la biodiversidad bajo suelo (y servicios ambientales asociados) y el componente de la biodiversidad bajo suelo. No obstante. En el nivel más alto. deberá capturar la distribución. A nivel paisaje es difícil evaluar el efecto de la biodiversidad bajo suelo sobre algunos servicios del ecosistema. la distribución espacial de la biodiversidad bajo suelo estará fuertemente influenciada por los gradientes de altitud y temperatura. a escala de paisaje. El inventario de biodiversidad bajo suelo. será un determinante más de dicho nivel. de gran relevancia en ese nivel. derivados de la base mineral y vegetal. tamaño y forma de estos gradientes y fragmentaciones. son usados en el proyecto CSM-BGBD (véase prefacio) y están considerados como ejemplo. al igual que los procesos de cambio relacionados. incluyendo el descubrimiento de especies invasivas exóticas es. Las características espaciales de la distribución de uso de suelo (“parches” de uso de suelo. La biodiversidad bajo suelo. más útil como indicador de la respuesta del suelo al manejo. mientras que las fecundidades también varían y. Los principales conceptos teóricos que corresponden a estos criterios son: apertura y conectividad. La Tabla 1. al igual que en los protocolos de medición. El patrón de uso de suelo superpuesto en función de dichos efectos de clima. (2006). cada proyecto necesitará determinar su propia escala en función de sus objetivos. 2004). en el caso del ecosistema de suelo y sedimentos (Wall. El impacto en el diseño de muestreo. también tendrán una importante influencia en la biodiversidad. también será diferente de un organismo a otro. ampliamente discutidos. 1.3 muestra un resumen de niveles jerárquicos modificados a partir de los propuestos por Lavelle et al. para explicar las posibles variaciones en la biodiversidad bajo suelo. Paisaje.

La biodiversidad sobre el suelo se determina por la variedad de cultivos encontrados en el área y por los elementos vegetales asociados con barbechos.. describen los gradientes de la fertilidad del suelo en función de los recursos destinados al terreno. La intensificación de uso de suelo. se asocia con la extracción de elementos vegetales como árboles. incluso. también lo es la abundancia de especies relativas. Cambios en la arquitectura del suelo.opción para dicha intervención.. 1993). por lo tanto. los cambios relacionados con el uso y cobertura del suelo. Vanlauwe et al. de cientos de años. Área de uso de suelo. y para la manera en cómo funciona el sistema. típicamente. cuando se trata de agrosilvicultura. Parcela o parche. la composición y actividades funcionales de la biota son de gran interés y. En este nivel. sobre todo. son visibles en escalas de tiempo más cortas que pueden abarcar desde pocos años hasta varias décadas. cercos vivos. incluyendo a las raíces de suelo. 3. respecto al cambio de uso de suelo. una combinación específica de tipos de cobertura. en el caso del inventario de biodiversidad bajo suelo. pero son asociados con el manejo. si no es demasiado grande. éste es el caso de algunos árboles donde ciertos organismos de suelo hacen uso de sus nichos. A nivel de parcela. Las interacciones laterales son componentes muy importantes para la biodiversidad bajo suelo. rompevientos. La escala de tiempo de estos procesos (cambio de la composición de uso de suelo y configuración de paisaje) para ser observable necesitaría de varios o. que implican una pérdida de sus aportes e impactos. pertenecientes a varios niveles tróficos y grupos funcionales que gobiernan la estabilidad de redes alimenticias y la provisión de funciones de apoyo. 2. tramos de bosque y otros elementos de manejo de paisajes. Las áreas de uso de suelo se definen en función de su uso y régimen de manejo (Huising. 2006 y Tittonell et al. la estructura comunitaria y sus interacciones son reguladas por la arquitectura del suelo del lugar en específico (Lavelle et al. normalmente.. 2007. queda dentro de los dominios funcionales de los ingenieros del ecosistema. Los gradientes de las propiedades de suelo sí ocurren en este nivel. 2006). A este nivel. por ejemplo. tal es el caso de un área con plantaciones comerciales de té o la caracterizada por la agricultura de autoconsumo. aunque sean provocados por cambios en la composición funcional y actividad de los ingenieros del ecosistema o del arado del suelo. tendrán un 46 Manual de biología de suelos tropicales . es en este nivel donde la biodiversidad bajo suelo debería estudiarse de manera minuciosa. El terreno o parche. Estas áreas muestran. de manera que la relación entre el patrón de distribución espacial de la biota sobre el suelo con la de bajo suelo son particularmente interesantes.

drilósferas. La lista de intervenciones y mediciones correspondiente a la biodiversidad bajo suelo. la inoculación con especies microbianas. pero un entendimiento de los procesos e interacciones es vital. Las “intervenciones” enlistadas en la Tabla 1. para mayores detalles y terminología). 4. condicionados por los organismos de suelo en la producción de servicios de apoyo tales como mantenimiento de la estructura de suelo y la descomposición de materia orgánica introducida. no es necesariamente exhaustiva. 2001. etc. puede servir para corregir desequilibrios en la composición funcional o para mejorar algunas funciones en particular. la introducción de depredadores para el control de una enfermedad en particular. en la estructura de la red alimenticia. del agregado individual y de la partícula individual. según lo describe Swift (1998). por lo tanto. dado que ésta es la unidad fundamental de la función del suelo. composición funcional) pueden necesitar de varios años. El inventario de la biodiversidad biológica del suelo 47 . el grado de diversidad genética.3 son parcialmente derivadas del concepto “el manejo jerárquico de la biota del suelo”. La redundancia funcional entre los transformadores primarios (especies o familias diferentes que cumplen una misma función). Éstos existen en la escala de los horizontes de suelo. también despiertan gran interés. Tal intervención debería apoyarse en el inventario y la abundancia relativa de especies. en relación con esto. Cambios estructurales en la comunidad biótica (conexiones en la cadena alimenticia. Las opciones para intervenciones de manejo en una escala de subparcela son actualmente limitadas. principalmente. Nicho. como en la cadena alimenticia. sino más bien ilustrativa. pertenecientes a grupos funcionales definidos o a niveles tróficos dentro de la cadena alimenticia. subparcela o microhabitat. tienen escalas de tiempo relativamente cortas y mostrarán variaciones estacionales. Cualquier tipo de inoculación causará un impacto directo sobre la diversidad bajo suelo y.. los procesos involucrados.efecto sobre las interacciones tróficas y. la competencia y la eficiencia son de particular relevancia y. Este nivel se refiere a los microhábitats que alojan a los microbios y a los componentes de la microfauna del sistema de suelo que los regulan. reflejándose la dependencia de los organismos más pequeños en los ingenieros del suelo para el suministro de sus sustratos (véase Lavelle y Spain. El manejo de materia orgánica y el uso de agroquímicos causarán un mayor impacto en la estructura de la red alimenticia. por ende. son segregados en los dominios funcionales: rizósferas. termitósferas. A nivel parcela. dentro de los microorganismos.

mancífico (depentenimiento de de especies y régimen de especialmente diente del nivel áreas de refugio manejo. 3–20 tipos de Intensificación Diversidad Área con uso de áreas de uso de de uso de suelo. manejo ecosistemas: integrado de patrón de distrirecursos naturales bución espacial. por ejemplo. varias suelo: protección lógica de suelo: uso de suelo y de por bioma o por de usos de suelo y especies exótiecosistemas como región dentro elementos de pai. unidades de referencia. saje. cuenca mayor.existiendo una superposición entre niveles de escala dentro de los parámetros a medir. de detalle de la biológicas y bio. corredores biológicos.relacionada con diversidad arriba ingenieros de clasificación).de suelo. parches de selva.3 Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. de un país. Número de cla. Capa de nivel de agregación Paisaje Tipo de unidad Medida/ parámetro de biodiversidad Área caracterizada Sin especificar: Cambio de uso de Diversidad biopor un mosaico de tal vez.Proceso/ ses o unidades intervención Área de uso de suelo 48 Manual de biología de suelos tropicales . procesos asociados de cambio y componentes relevantes de la biodiversidad. dentro de degradación diversidad y tico y patrón de composición cobertura de suelo un paisaje espe.cas e invasoras. Tabla 1. de relevancia específica para la biodiversidad y mantenimiento de la provisión de servicios de ecosistema. suelo caracteríssuelo. del suelo. y prácticas de conservación del suelo. funcional.

10 a 100 por Área con un uso particular y mane. funcional. na. erosión. drilósfera. inoculación con microsimbiontes. El inventario de la biodiversidad biológica del suelo 49 .área de uso de jo particular. diversidad introducción genética. etc. dentro mejoramiento de y entre grupos funcionales y sistemas de cultivo y manejo de niveles tróficos.Proceso/ ses o unidades intervención Medida/ parámetro de biodiversidad Intensificación de Abundancia manejo de suelo y relativa de cultivos. selva. para lo cual se indican en los capítulos 3 y 9 los mejores métodos. • Proporciones relativas de GF. por suelo. materia orgánica. de agentes de control biológico. Sin tomar en cuenta los objetivos específicos y el diseño experimental de cualquier estudio. que consisten en el uso oportuno de tiempo y recursos. etc. composición labranza mínima. • Abundancia (total) y biomasa (en el caso de animales) de taxa. utilizando los métodos previstos en este manual. Nicho Por ejemplo. provee los siguientes datos e información. rizósfera. cepas para microsimbiontes). microhábitat horizontes de suelo. campo agrícola. parche Tipo de unidad Número de cla. ejemplo. Por regla general. proveen un gran número de parámetros para la evaluación de la biodiversidad bajo suelo. los datos tendrán que ser acumulados en cada punto de muestreo. • Abundancia y biomasa de los grupos funcionales (GF). dependiendo del tipo de análisis realizado: En cuanto a la biodiversidad: • Riqueza taxonómica a nivel de especie. Biomasa y actiManejo de vidad microbiabiota clave. inoculación. Datos requeridos Los métodos expuestos en este manual. Capa de nivel de agregación Parcela. o a nivel más alto o más bajo (por ejemplo. el inventario bajo suelo de la biodiversidad.3 Continúa. especies. parcelas de vegetación.Tabla 1.

Promedio de datos climáticos y precipitación real hasta la fecha de muestra. Folgarait. R. Oxford.. T... Brussaard. D. Huising. Klopatek. D. Pashanasi. 75–112. Moreira.. Tondoh. G. V. V. pp. Island Press. (2005) The Biology of Soil. y Swift. S. Hole. (2003) ‘Linking keystone species and functional groups: A new operational definition of the keystone species concept’. Palm. pp. in C. Referencias Bardgett. Susilo. V. Behan-Pelletier. Nwaga... Davic. Sanchez. Hawksworth. Fragoso.. pp. F. uso del suelo.. vol 9. (1981) ‘Effects of animals on soil’. vol 5. intensidad de uso y cobertura de suelo: • • • • • • Cultivo aparente o uso de barbecho. J. L. 123–135. F. T. Brussaard. Ambio. A. P. issue 1. (1997) ‘Biodiversity and ecosystem functioning in soil’. R. E. vol 271. Historia precisa del uso de suelo desde su estado de selva no perturbada hasta otro tipo de vegetación pre-cultural. A pattern recognition approach to land use inventory at the sub-regional scale 50 Manual de biología de suelos tropicales .. L. Cavalier-Smith. Freckman. Oxford University Press. J. C.. Washington DC. Bignell. W. J. Dibog.. Daily. Applied Soil. D. Tiedje. Didden. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. J. T. (ed) (1997) Nature’s Services. vol 7. Conservation Ecology. Hattori.Rusek. D.... En cuanto al suelo. Gupta. 563–570. D.. y Virginia. Prácticas actuales de manejo de suelo y cultivos. (2004) ‘Only six kingdoms of life’. 203–266. Características de vegetación.. Huang. guilds. vol 73. Malloch. Bignell.. Geoderma.Ecology. C.. Vosti. B. vol 26. Propiedades físicas y químicas básicas: pendiente y aspecto del suelo. D. response 11. (1998) ‘Soil fauna. Columbia University Press. E.. L. X. Soderstrøm.. Biological Reviews.. functional groups and ecosystem processes’. Lavelle. pp. P. Proceedings of the Royal Society of London Series B. C. D. pp. A. New York. Cavalier-Smith.• Índices cuantitativos generales de riqueza y equitatividad.. M. A. Brown. B. P. F. S. 1251–1262. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica... P. (1998) ‘A revised six-kingdom system of life’. R. D. (2005) ‘Belowground diversity assessment: developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. P. D. J.

. P. E. R. E. O. y Dillion. Margulis. B. in T. K. F. P. A. DC Lavelle. y Swift. Hunt. Nature (Lond). P. St John. M. (2001) Soil Ecology. 860–871. vol 391. Bignell. M. H.. J. Higashi (eds) Biodiversity. Kibblewhite.S. S. E. A.. Mozley-Standridge... Roger. Mycologia. Thesis. R. Bloemers..... Bignell. Spain. W. D. Garey. W. D. Lawton. (1997) ‘Soil function in a changing world: The role of invertebrate ecosystem engineers’. vol 33.Griffith. T.. Blouin. D.. V. The Inventory of Soil Biological Diversity 15ES_HTSB_11-6 13/6/08 18:14 Page 15 European Journal of Soil Biology. G. H. Lepage. New York.using remote sensing and GIS applying an object oriented and data-driven approach’. Brown. M. L. Behan-Pelletier. S. P. Philosophical Transactions of the Royal Society Series B. J. Springer. Powell. T. J. Kluwer Academic Publishers. J. Hammond. V. Letcher.. M.. 159–193.. Longcore. pp. pp.. Lavelle.. (1998) Five Kingdoms – An Illustrated Guide to the Phyla of Life on Earth. J-P. G. C. P. 72–76. Hodda. M. Bignell. Lavelle. Volters. V. S.. vol 363.. (1996) ‘The role of species in ecosystems: Aspects of ecological complexity and biological diversity’. (2006) ‘A molecular phylogeny of the flagellated fungi (Chytridiomycota) and a proposal for a new phylum (Blastocladiomycota)’. Lavelle. H. Heal. vol 98. Island Press. Margerie. (1996) ‘Diversity of soil fauna and ecosystem function’. D. J.. Abe.pp. W. Srivastava. K.. 373–386. in D.. S.. y Brussaard. 3–16.. Austen. Levin y M. Hawkins. J. Larsen.... James. 3rd edition. E. Brown. R. (2006) ‘Soil invertebrates and ecosystems services’. A... M. 685–701. C. E. M. G. B. European Journal of Soil Biology. J. J. Boulton. Giller. Wall (ed) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. P. Barot. N. indicator taxa and effects of habitat modification in tropical forest’. G. P. pp. Stork. P. Aubert. G. Ritz. (2008) ‘Soil health in agricultural systems’. Holt. S. P. Berlin. H. D. y Watt. Y. G. V.. Siqueira. Ineson. E... y Paul. (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. Wallingford.D.. Lawton. Dordrecht Lavelle. V. (2004) ‘Connecting soil and sediment biodiversity: The role of scale and implications for management’.J. F. P. Oikos. The Netherlands. M. Biology International.vol 69. Eggleton. W. Bureau. S. Jones. pp. El inventario de la biodiversidad biológica del suelo 51 . M. S3–S15.. K. an Ecological Perspective. Lawton. Porter. M. F. P. y Shachak. P.. vol 33.. vol 42.. y Rossi. Ph. N. CAB International. pp. Mawdsley. H. P. D. Mora... L. pp.. T. Freeman.. Wageningen Agricultural University. E. S.. (1994) ‘Organisms as ecosystem engineers’. Moreira. y Schwartz... D. H. y Vilgalys. Decaëns. A. M. M. M. A. Washington. (1998) ‘Biodiversity inventories.

y Van Noorwidjk. M. inJ. (1979) Decomposition in Terrestrial Ecosystems. 11–24. Nutrient Cycling and Agroecosystems. C. A. Lavras. O. Swift. y Eggleton. Furtini Neto y J. Tittonell. Annual Review of Microbiology. y Anderson. 376–390. J. Applied Soil Ecology.. V. pp. pp. Washington. M. J. Setäla. O. Brazil. W. J.. O. F. vol 57. 171–182. Kandler. M. E. N. (ed) (2004) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. Laakso. D. y Giovannoni. S. Proceedings of the National Academy of Sciences USA. S. A. de Ridder. Agricultural systems. Izac.. N. Bacteria. J. Oxford. y Huhta. pp. Guilherme. y Giller. (1998) ‘Functional diversity of decomposer organisms in relation to primary production’. (1992) ‘Invertebrates as determinants and indicators of soil quality’. L. Tittonell. P. vol 9. R. Woese. Ecosystems and Environment. Swift. M. (2003) ‘The uncultured microbial majority’. Siqueira. H. A. vol 7.. Stork. vol 94. (1990) ‘Towards a natural system of organisms: Proposal for the domains Archaea. M. N. 113–134. E. pp. 25–31. R. J. S. Island Press. American Journal of Alternative Agriculture. M. Blackwell. S. B. y Mukalama.. G. Vanlauwe B. 52 Manual de biología de suelos tropicales .. G. and Eucarya’. (1998) ‘Towards the second paradigm: Integrated biological management of soil’. N. Vanlauwe. Lopes. P. pp. y Wheelis. J. M. K. pp. (2007) ‘Heterogeneity of crop productivity and resource use efficiency within smallholder Kenyan farms: Soil fertility gradients or management intensity gradients’. Moreira. 369–394. vol 76. SBCS/UFLA/DCS. Carvalho (eds) Soil Fertility. H. 4576–4579. M. L. J. Heal. J. (2006) ‘Within-farm soil fertility gradients affect response of maize to fertilizer application in western Kenya’. Wall. pp. 23–32 Swift. E. vol 104. M. vol 87.. Soil Biology and Plant Nutrition interrelationships. Faquin.. (2002) ‘Biodiversity and ecosystem services in agricultural landscapes – are we asking the right questions?’ Agriculture. V. Mikola. P. pp.Rappé.

El problema de localizar los puntos de muestreo se presenta a diferentes escalas. Moreira. Gregoire y Valentine. en un punto predeterminado del paisaje. en los cuales se llevarán a cabo los protocolos de medición. también incluye cómo determinar la localización de estos sitios de muestreo: lo que se discutirá más abajo. 1977). se encuentra el problema de la elección de los sitios. En cuanto al argumento es más complicado que una mera elección al azar. Julio N. Richard Coe. se necesita determinar en dónde va a estar localizado todo el estudio. 2007). Susilo. Ronald Zanetti. se cuenta con una teoría de muestreo bien establecida. Hay numerosos textos que describen la teoría y su aplicación (ej. el problema gira en torno a cómo escoger el número y localización de los puntos de muestreo en el paisaje en cuestión. Southwood y Henderson. Entonces ¿para qué se necesita otro capítulo que discuta las técnicas de muestreo de la biodiversidad del suelo? A pesar de los conocimientos y experiencias en rela53 . Fátima M. Louzada. por tanto. S. una gran experiencia al respecto. En una primera escala. es necesario escoger el lugar dónde se tomarán las muestras de suelo para los análisis químicos. Existe una larga tradición de muestreo en la ecología de campo y. Huang (†) INTRODUCCIÓN Gran parte de este manual contiene instrucciones de cómo tomar mediciones una vez que se tiene un sitio de muestreo. Souleymane Konaté. Francis-X. La base del problema radica en el muestreo. 2000. Meine van Noordwijk y Shiou P. Juvenil E. Jeroen Huising. Cares. Además. en otra.Capítulo 2 Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo E. mismos que se describirán en los siguientes capítulos. En algún punto entre estos dos. que aplica en todos los casos (Cochran.

pueden discrepar en lo referente al carácter práctico del estudio que está siendo diseñado. es posible que no sea fácil tomar tantas muestras como se desearía. Ford (2000) hace referencia a una amplia discusión de los objetivos de investigación en ecología. tales como por qué el trabajo de muestreo debe ser de manera aleatoria. 4 Los objetivos del estudio determinan el diseño. Por ejemplo. Comúnmente hay malos entendidos de algunos de los principios básicos. OBJETIVOS DEL ESTUDIO Y BASES DEL MUESTREO La mayoría de los autores que escriben sobre diseños de investigación puntualizan que el diseño se determina en función de los objetivos. están los que “Ven lo que está ahí. En este capítulo se describen algunas opciones para muestrear la biodiversidad del suelo y las ventajas o desventajas de los diferentes enfoques. o qué es una réplica. se presenta un ejemplo del enfoque utilizado en el proyecto CSM-BGBD. Muchos de los debates sobre los métodos apropiados de muestreo se deben a diferencias de opinión en cuanto a los objetivos exactos del estudio. A continuación. 2 La aplicación de una teoría de muestreo puede requerir de información con la que no se cuenta hasta que los datos han sido colectados. (1989) lo explican con detalle en el contexto de muestreo ecológico. 3 Puede haber límites en cuanto a la teoría. Kenkel et al. estos podrían no estar completamente desarrollados o los objetivos múltiples podrían sugerir diferentes enfoques para el muestreo. 54 Manual de biología de suelos tropicales .ción con el tema. 5 Los investigadores toman diferentes posturas filosóficas relacionadas con el enfoque de muestreo. entonces tratan de entenderlo” y aquéllos que “empiezan con una hipótesis y tratan de probarla”. Son varias las razones para ello: 1 La aplicación de una teoría completa o de métodos tan extensivos como los utilizados en otros estudios. entonces esta variación es desconocida. Por ejemplo. el acceso a sitios de muestreo ideales puede ser restrictivo. o bien. debido al tiempo y al costo. el tamaño de muestra requerido depende de la variación entre las muestras. Si datos similares no han sido colectados antes. Sin embargo. en cualquier proyecto habrá desacuerdos y discusiones en cuanto a las estrategias de muestreo.

entonces los nichos raros deben ser incluidos. entonces. Intuitivamente. se han hecho imD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 55 . Un ejemplo de un objetivo que requiere diferentes enfoques de muestreo son los inventarios. argumentando que si se empieza partiendo de un objetivo limitado. La teoría. en ecología. su imaginación y descubrimientos potenciales podrían estar restringidos. y en cada estrato tomar una muestra aleatoria). análisis de conglomerados y ordenación) y luego explicarlos (por ejemplo. Un enfoque de muestreo consiste en colectar datos usando el método de MAS o mediante una cuadrícula. dividir la población en sub-poblaciones o estratos. existe una estimación del error de muestreo basada en el diseño). No obstante. existirá solamente una pequeña porción del área de estudio ocupada por este tipo de nichos. Si el objetivo es estimar la media poblacional (la biomasa media de escarabajos por m2 dentro del área de estudio. La mayoría de los estudios. por lo que prefieren mantener la mente abierta y partir de la observación. incluyendo los del proyecto CSM-BGBD. encontrando correlaciones con variables ambientales). a través de la estratificación (es decir. Piense en un nicho raro en el paisaje (por ejemplo. o el número promedio de especies de hongos en 1 cm3) el MAS adquiere propiedades relevantes. y su error estándar puede ser estimado sin hacer supuestos acerca de la variación dentro de la población (técnicamente. situado en el lindero entre el bosque y la pradera.El muestreo aleatorio simple (MAS) constituye el punto de partida para la discusión sobre cómo muestrear. intentan entender los patrones en la biodiversidad. y la precisión aumenta con un tamaño de muestra fijo. indica cómo la precisión de la estimación puede ser controlada mediante la elección de la muestra. intentando describir patrones (por ejemplo. Por supuesto. Los seguidores del primer enfoque pueden argumentar que no quieren ser prejuiciados por hipótesis previas. no importará si los nichos raros son omitidos o no. el caso de las orillas de un estanque. Otra alternativa es formular algunas hipótesis predictivas para explicar los patrones en la biodiversidad. esto es atractivo. Si el objetivo del estudio es estimar la biomasa media de escarabajos en general. existen pocos estudios ecológicos cuyo objetivo sea estimar la media poblacional. La media de la muestra es una estimación imparcial de la media poblacional. pero si el propósito es realizar un inventario de especies. Otra alternativa al MAS consiste en usar un muestreo sistemático usando una cuadrícula. y luego diseñar un estudio cuyo objetivo específico sea probar estas hipótesis. lo que se discutirá en la sección de muestreo aleatorio y sistemático. Cuando el objetivo es identificar todas las especies de un grupo dado en el área de estudio entonces el MAS resulta inapropiado.

existen tres razones para tratar de diseñar un estudio con objetivos específicos que incluyan hipótesis comprobables: 1 Los descubrimientos inesperados usualmente tienen la naturaleza de formulación de hipótesis observacionales que sugieren explicaciones. los que proponen el enfoque “no hipotético” en realidad parten de alguna forma de hipótesis. Entonces es difícil y hasta imposible. Por ejemplo. Si suponemos la hipótesis de que la biodiversidad del suelo en parcelas agrícolas. 3 Si se parte de hipótesis específicas. además. Si las hipótesis implícitas se hacen explícitas el diseño de los estudios pueden ser mejorado. Se requiere de estudios minuciosamente planeados para poder probar dichas explicaciones. parcelas con un valor alto de P.1). No obstante. separar los efectos de las dos variables. La estratificación puede usarse para incrementar el número de puntos con MOS más extremos y mejorar la estimación de la relación sin incrementar el número de muestras. es imposible elegir cuáles. por ejemplo. pocos puntos con valores altos o bajos. 2 De hecho. son los puntos más extremos los que proporcionan más información (Figura 2. aunque ésta sea implícita. frecuentemente. Sin embargo. deberían ser medidos en los sitios de muestreo. Este último punto subraya o enfatiza gran parte de lo que sigue en este capítulo. 56 Manual de biología de suelos tropicales . haciéndolo más eficiente. cada investigador debería estar abierto a la posibilidad de observaciones no anticipadas y explicaciones verdaderamente nuevas. frecuentemente. sin alguna noción de los factores ambientales que puedan controlar la biodiversidad. el estudio podría ser diseñado para incluir específicamente algunas muestras con valores altos de P y de MOS y otras muestras con valores bajos de P y de MOS. entre un número infinito de factores. entonces es probable que: • La mayoría de los sitios de muestreo tengan valores de P y MOS alrededor de la media con. está determinada por el nivel de Perturbación (P) y el nivel de Materia Orgánica del Suelo (MOS) y se colectan los datos por medio del MAS o por muestreo de cuadrícula. sin seguir estudios planeados. si se trata de entender la relación entre la biodiversidad del suelo y la MOS o la P. tienen valores bajos de MOS.portantes descubrimientos por casualidad. es posible mejorar el diseño del estudio. no obstante. relativamente. • La MOS y la P pueden estar correlacionadas.

en donde las parcelas sean monitoreadas a través del tiempo para observar si los cambios en la biodiversidad del suelo pueden ser correlacionados con cambios en el uso del suelo. Aunque la validez de este enfoque puede ser cuestionable. y sus efectos combinados pueden ser estimados. lo ideal sería llevar a cabo un estudio longitudinal. en lugar del experimental. se aplican los mismos principios de diseño. La única manera cierta para determinar el efecto de un cambio. Se espera que las correlaciones entre la intensidad de usos de suelo y la biodiversidad del suelo reflejen alguna conexión causal. puede que sea imposible o inútil producir un solo índice de biodiversidad del suelo. En el presente estudio. Otro ejemplo de una hipótesis implícita en muchos de los estudios es la escala espacial en la que ocurren los patrones interesantes. Si éstas se seleccionan explícitamente. Si tenemos que utilizar un diseño de estudio observacional. pero aún puede resultar útil cuando se enfoca con un diseño de muestreo. considerando un rango de usos de suelo en un momento específico de tiempo. tampoco es viable en un proyecto de duración fija y corta. los efectos de ambas variables. el investigador hace una selección de las escalas importantes para su estudio. En términos ideales. no siempre resulta viable. que indiquen lo que pasaría con la biodiversidad del suelo si los usos de suelo cambian en el futuro. como en muchos otros.Entonces. como el que se observa en la Figura 2. muchas veces es la única opción disponible. señala una pérdida de biodiversidad del suelo). entonces se abren nuevos debates con una probabilidad de mejorar el diseño del estudio. Este planteamiento es muy amplio. sin embargo. se utiliza una aproximación transversal. generalmente. Lo anterior. Las discusiones en este capítulo sólo consideran esquemas alternativos de muestreo para datos colectados por el método transversal. dicha investigación iría acompañada de un experimento. Cuando se determina la distancia entre los sitios de muestreo y el tamaño total del área de estudio. El objetivo global del proyecto CSM-BGBD fue comprobar la hipótesis de que un incremento en la intensidad del uso del suelo cambia la biodiversidad del suelo (más específicamente. es hacer justamente el cambio y esto precisamente constituye la base de un enfoque experimental. En la práctica. puesto que se desconoce el tiempo necesario para el monitoreo. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 57 . sin embargo.1 y las relaciones pueden ser más complejas que el caso de dos líneas rectas.

por lo tanto. Los detalles de cómo dichos factores prácticos y teóricos pueden mezclarse. ENFOQUES PRÁCTICOS El diseño de un esquema de muestreo exitoso y práctico es todo un arte. con base científica y de las propiedades que ofrecen los diversos métodos. b) si se incluyen de manera deliberada valores de MOS más extremos. esto aumentará la precisión de la estimación de la pendiente. Escríbalos y compártalos con otros para 58 Manual de biología de suelos tropicales . Asimismo.1 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula. el acceso limitado a localidades deseadas para muestrear. tiempos y disponibilidad de expertos. no obstante. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. la necesidad de transportar con rapidez las muestras desde el campo hasta el laboratorio. es posible que se especifiquen algunos pasos del proceso en general que se deben seguir en cualquier estudio. podría surgir una serie de restricciones adicionales. Paso 1: Defina objetivos Como se indicó en la sección de objetivos del estudio y bases de muestreo. desde un principio deberán ser expresados de manera clara y precisa.Figura 2. dando un estimado pobre de la pendiente. Sin embargo. Requiere de un entendimiento profundo. los objetivos determinan todos los aspectos del diseño. por ejemplo. por estratificación. serán diferentes para cada estudio y darán a cada investigación un aspecto único. o bien. es necesario que se combine con las restricciones prácticas impuestas por costos.

Escriba el diseño con tantos detalles como sea posible. su propia experiencia. diseños utilizados en otros estudios y su imaginación. Estos incluyen: mapas topográficos (ej. mapas de cobertura del terreno). Paso 4: Elabore un diseño Elabore un diseño tentativo utilizando una combinación de principios generales. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 59 . para identificar los principales usos del suelo que se incluirán en el estudio). mapas de uso de suelo (ej. datos meteorológicos (ej. Paso 2: Consulte otros estudios Consulte los estudios relacionados con su investigación.1 es un ejemplo simple... para ayudar a decidir cuáles son las temporadas idóneas para el muestreo de campo). Consiga el mayor número de comentarios y sugerencias de los expertos en la materia. Una herramienta que ayuda a refinar los objetivos es la presentación de resultados simulados. ¿Cuáles cumplen con sus objetivos y proveen evidencia para su hipótesis?.. indican la estratificación por altitud o nos permiten entender los problemas de acceso). imágenes de detección remota (ej. Anote específicamente el tamaño de las muestras utilizadas y la variación de los resultados. o bien. otros que tienen experiencia en los métodos que va a utilizar. Paso 3: Reúna datos relacionados Reúna información o antecedentes que serán necesarios para diseñar los detalles del muestreo. siempre deberá plantear un proyecto realista. Si bien puede haber aspectos sobre los cuales tenga poca idea. anótelas y numérelas. otros que han trabajado en el mismo sitio.que pueda discutir algunas sugerencias. Cada estudio cuenta con aspectos únicos y siempre habrá estudios previos de los cuales puede aprender: ésto le permitirá entender qué aspectos de los métodos utilizados han tenido éxito y cuáles limitan la eficiencia y calidad de los resultados. Imagínese que ha finalizado el estudio y ha obtenido resultados ¿Qué tablas y gráficas le gustaría presentar?. Después deberá comprobar con cuidado que: a) los resultados realmente logren los objetivos y b) que el diseño de muestreo simulado realmente pueda mostrar estos resultados. Estos expertos pueden ser investigadores que trabajan sobre temas similares en otros lugares. La Figura 2..

pero deberás seguir adelante. De nuevo. puede ser que tenga que retroceder a un paso anterior para volver a intentar. Una investigación piloto abre la posibilidad de evaluar el aspecto práctico del esquema de muestreo. Un buen estadista. procese algunos datos hasta llegar a un análisis estadístico. En cada área. que han usado métodos similares o que han trabajado en la localidad o simplemente. Dentro de cada sitio de estudio alrededor de 100 puntos de muestreo fue60 Manual de biología de suelos tropicales . también permita estimar el tiempo del muestreo y el procesamiento de las muestras. permita probar y refinar los protocolos de medición. Paso 6: Realice una prueba piloto Pruebe su enfoque. Asimismo. uno o más sitios de estudio (etiquetadas como “ventanas”) fueron seleccionados. REPLICACIÓN Y TAMAÑO DE MUESTRA La mayoría de los diseños de estudio son jerárquicos y el problema de muestreo no sólo consiste en seleccionar el sitio de muestreo dentro del área de estudio. JERARQUÍA. un error común es obtener información que sugiere que los objetivos son inalcanzables. puesto que involucra varios países. fueron seleccionadas una o más áreas de estudio.. probablemente. revise los objetivos a la luz de nueva información. procedimientos de manejo de datos. Trate de incluir un estadista con experiencia en investigación en ecología. que expresan su opinión acerca de su tema. Paso 7: Revise los pasos En cualquier paso. Dentro de cada país. éstos pueden ser personas que han trabajado con temas similares. De ser posible. En particular. esto dará una indicación de la variabilidad. El proyecto CSM-BGBD es un buen ejemplo. lo que puede ser útil para ayudar a decidir el tamaño final de la muestra. etc. considerará algunos aspectos que pueden pasar desapercibidos por el ecólogo.Paso 5: Revise su diseño Comparta su diseño con otros investigadores para que expresen su punto de vista y sus comentarios.

Por lo tanto.ron seleccionados y en cada punto se tomaron muestras (el protocolo de medición determina más capas en la jerarquía. pero. en algún nivel. La segunda idea es la de replicación. ya que estos patrones pueden utilizarse para hacer predicciones y pueden reflejar algunas reglas o procesos. se podría estudiar la biodiversidad del suelo en fincas alrededor de los límites del bosque en el monte Kenia. En cada capa jerárquica. Si se desean resultados que apliquen a los límites del bosque de África del Este en general. es necesario repetir observaciones con el fin de determinar si los patrones son realmente consistentes. La terminología es confusa y no tiene nada que ver con una población biológica. El muestreo implica que el conjunto sobre el que nosotros queremos hacer inferencias (“la población”) necesita ser delimitado antes de que un esquema de muestreo pueda ser planteado. relacionados con los usos de suelo. La intención es saber a qué se refieren sus resultados. las respuestas no necesariamente estarán basadas en la ciencia. entonces también se necesitará una muestra de otros bosques. Como ejemplo. evaluada mediante un análisis estadístico) que las muestras de bosque contienen mayor diversidad que las de los campos cultivados. Los patrones de interés son los que mantienen una consistencia a través de un número de casos. La selección de algunos países puede estar basada en función de su política o de los intereses de algunas agencias financiadoras e investigadores que dirigen el proyecto. como consecuencia de la extracción de cuatro muestras tomadas para la caracterización del suelo y sub-muestras de éstas para los análisis químicos). Suponga que cuenta con diez muestras tomadas de un bosque y diez en las cercanías de campos cultivados y que las muestras de bosque tienen consistentemente una alta biodiversidad del suelo ¿qué podría concluir? Si las muestras fueron seleccionadas de manera apropiada. Sin eso. puede concluir (con un grado conocido de incertidumbre. tales como los patrones de la diversidad del suelo. ¿cuáles son? En los niveles más altos. que trata de mantener la consistencia de patrones y relaciones. estrictaD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 61 . Lo primero es centrarse en la idea de una teoría de muestreo de una “población”. aunque. sólo podemos hacer afirmaciones sobre el monte Kenia con base en los datos obtenidos y no es posible extrapolarlos a otros lugares. dicha selección se deberá basar en los objetivos del estudio y en la aplicación de algunos principios. se plantean las mismas preguntas: ¿cuántas unidades deberían de ser seleccionadas?. El objetivo de la investigación es encontrar algunos patrones. lo que requerirá de una muestra de fincas pertenecientes a esta localidad.

Un enfoque más certero es asegurar una replicación válida y algunos resultados genéricos. determina el nivel jerárquico donde se requiere tener réplicas. En la Figura 2. utilizando más ventanas y más pequeñas (Figura 2. sólo podrá concluir que ese bosque en particular es más diverso y no. Si busca una conclusión válida para los bosques. Una respuesta a esto es definir una nueva categoría de “límites de bosque” y asegurar ventanas en los tres sitios de muestreo (Figura 2. ha sido construida una cuadrícula de tal manera que incluya los dos usos de suelo. deberá buscar una consistencia en varias de ellos.2a. varios bosques son muestreados. Nótese que no es necesario muestrear todos los usos de suelo en cada ventana. puesto que representan “pseudo-réplicas”. por lo que no pueden ser considerados representativos del uso de suelo. por lo tanto. patrones consistentes entre sitios. Si este proceso de reducir el tamaño de las ventanas mientras se incrementa su número se continúa. probablemente. Algunas de las implicaciones de estas ideas en el muestreo de cuadrícula son ilustradas a través de un ejemplo simplificado que se muestra en la Figura 2. La replicación puede aumentarse y abarcar más área total observada. las unidades de nivel más alto.2d). En la Figura 2. representan una “regla” aplicable ampliamente. entonces en algún momento se perderán las ventajas posibles de muestrear por cuadrícula y se terminará con un diseño que podría parecer un muestreo aleatorio de sitios individuales. muestras múltiples de un mismo bosque no sirven al mismo propósito.2c). para poder examinar las diferencias en la biodiversidad del suelo. Dentro de cada sitio de estudio se podrán establecer conclusiones más contundentes si por ejemplo. Dentro de un estudio jerárquico. El que muestras repetidas dentro de un bosque sirvan para ser interpretadas de igual manera que las muestras de diferentes bosques depende de las propiedades de los datos y no. la 62 Manual de biología de suelos tropicales . La palabra “escala” es confusa y controversial en la ecología (Peterson y Parker. como los sitios de estudio pueden proveer un nivel de replicación. del diseño de muestreo. Dicha cuadrícula es una “ventana” con 77 puntos de muestreo (intersecciones) definidos. los bosques en general. pero queda claro que la escala en que se anticipan o hipotetizan los patrones. etiquetados como: “bosque” y “agricultura”. El objetivo es muestrear un paisaje con dos usos de suelo. Una crítica a este tercer tipo de diseño es que todos los sitios de muestreo en tierras agrícolas quedan cerca de un límite de bosque. Por ejemplo. 1998).mente hablando.2b se pueden observar tres ventanas más pequeñas para muestrear tres diferentes parches de bosque y no uno solo. a través de un diseño que replique bosques y otros elementos de uso de suelo. Sin embargo.2.

si se intenta hacer un “análisis en el nivel de paisaje”. utiliza datos en el nivel de parcela y el otro. c) incrementando la replicación. Los dos ejemplos del párrafo anterior son análisis que utilizan factores del paisaje. pero no es relevante para afirmar la consistencia del patrón a través de la unidad de 1 km² necesaria para examinar las hipótesis. Una hipótesis diferente sería “la biodiversidad del suelo en parcelas agrícolas decrece con la reducción de la cobertura del bosque en el paisaje”. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. se basan en datos de diferentes niveles jerárquicos: uno. con la definición de algunos sitios dentro de cada unidad.2 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. con varios niveles de cobertura de bosque. El mensaje es claro: “el nivel de paisaje” no está bien definido y. es decir. Para poder evaluar la biodiversidad del suelo dentro de un 1 km². se requerirá de más muestras. se necesita definir el significado de “en el paisaje”. Entonces la hipótesis necesita una muestra de una unidad de 1 km². En este caso. La réplica dentro de la unidad es importante para determinar la precisión con que la biodiversidad del suelo es medida para cada unidad. los objetivos de un proyecto de biodiversidad del suelo pueden incluir “análisis del paisaje”. suponiendo que fue definida como áreas de 1 km². d) reconociendo los límites como otra categoría. sin embargo. En otras áreas de la ecología. puede ser investigado con parcelas (sitios de muestreo) en un intervalo de distancias. hipótesis puede ser “la biodiversidad del suelo en parcelas agrícolas decrece con el aumento a la distancia del límite del bosque”.Figura 2. factores del paisaje como la fragmentación del bosque. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 63 . Ahora es la réplica quien determina la necesidad de varias áreas en cada nivel de cobertura de bosque. Lo anterior. con réplicas en cada distancia. afectan los procesos. no queda claro el diseño de muestreo que se necesita. b) tres cuadrículas que muestrean tres diferentes parches de selva. por lo tanto. datos en el nivel de unidades de 1 km². la escala espacial en que se evaluó la cobertura del bosque.

etc. requieren puntos más lejanos. muchas veces no es posible especificar un tamaño de muestra que resulte importante. pero normalmente resulta difícil especificarlos. Una estimación aproximada de la varianza puede ser obtenida de estudios previos. Por lo tanto. con muchas mediciones que sólo están disponibles después de un largo periodo de muestreo en campo. la respuesta de un cultivo a un fertilizante) entonces es viable especificar la respuesta mínima que es importante detectar. Otra complicación surge a partir de las respuestas multivariadas de interés. sin embargo. y la variabilidad entre réplicas del mismo uso de suelo. a diferentes escalas. como la diversidad de diferentes grupos funcionales. Los métodos estándares presumen que existe una respuesta medible de la biodiversidad del suelo que se puede utilizar para obtener el tamaño de muestra. la diversidad del suelo entre dos usos de suelo) que es importante detectar. al igual que el software para iniciar el análisis. La idea de estos diseños es elegir posiciones de muestreo. El muestreo adaptativo (Thompson y Seber. cuando el objetivo de la investigación es detectar y entender algunos procesos. medida de diferente manera. Por lo tanto. los métodos estándares están disponibles para ayudar a seleccionar el tamaño de muestra. Los patrones a escala fina requieren puntos muy cercanos. en la práctica. de tal manera que los patrones. Queda claro que la decisión sobre el tamaño de muestra depende de esto. el tamaño de muestra se ha basado en una combinación de información de métodos formales (lo que puede indicar los órdenes de magnitud requeridos). dada la necesidad de planear campañas de campo por adelantado. números. No obstante. 1993) permiten continuar con el muestreo hasta que algunos criterios se cumplan. es improbable su viabilidad. es improbable que sean prácticos para los estudios de biodiversidad del suelo porque el trabajo necesita planearse en distintas fases de campo y de laboratorio. se incluyen ambos 64 Manual de biología de suelos tropicales . ningún estudio real ha multiplicado las respuestas de interés. Si bien existe cierta atracción por esta idea. Patrones a escala más grande. puedan ser investigados. pero saber qué relevancia tendrá en nuevos ambientes puede ser desconocida. y estudios previos similares y pilotos.Una vez que se sepa lo que hay que replicar. Cuando la investigación es dirigida a medir respuestas económicas para decisiones de manejo (por ejemplo. biomasas y proporciones de estos grupos funciones o especies. Una variedad de diseños a multi-escala han sido utilizados en estudios ecológicos. Los métodos requieren conocimiento de dos cosas: de la magnitud de las diferencias (por ejemplo. Enfoques secuenciales (Pedigo y Buntin. 1996) permite que el diseño responda a patrones que se detecten. Aunque sean teóricamente atractivos.

de manera deliberada. muestras de cada uno de ellos. El objetivo de descubrir y entender los efectos del uso de suelo en la biodiversidad del suelo.y los diseños eficientes tienen una estructura en forma de conglomerado (Urban et al. Así. 2002. existen dos razones para ello: una. los estratos son áreas con diferentes usos de suelo y la idea es obtener. dentro de cada parcela se reúnen las muestras. En este sentido. Algunas veces se piensa que este enfoque puede estar “sesgado” porque los tipos de uso de suelo para tomar las muestras se determinan a priori. normalmente sólo resulta posible examinar un grupo en una muestra de suelo dada y la extracción de la muestra de un grupo. lo que quiere decir que se mezclan varias muestras de suelo. Normalmente. Piense en un lugar seleccionado. esto significa que la variación y los patrones en la escala dentro de la parcela (por ejemplo. podrá alterar otros grupos. el número promedio de escarabajos por m2) sin tomar en cuenta un diseño. y los diferentes usos de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 65 . se requiere tomar muestras (ver esquema de puntos de medición abajo). sino de una parcela. antes de cuantificar la biodiversidad del suelo. Necesitará muestrear dentro de toda esta parcela. pero únicamente un volumen de suelo muy limitado puede ser examinado en la mayoría de las mediciones de biodiversidad del suelo y se toman varias muestras para poder representar toda la parcela. puesto que habría demasiadas muestras para procesar si no fuera así. 2003). seguramente las relaciones entre ellos son importantes. quizá en un área del orden de 100 m². Un buen enfoque para mejorar el diseño de muestreo es el uso de la “estratificación”. responde a la necesidad de contar con mediciones iguales de diferentes grupos funcionales del suelo. esto quiere decir que se tiene que medir en el mismo lugar. Stein y Ettema. la segunda.. de tamaños adecuados. Cuando varios grupos de especies están siendo evaluados. entonces los resultados pueden estar sesgados. lo que asegura que se obtengan muestras realmente representativas. todas las mediciones se realizan a nivel de parcela. ENFOQUE DE OBJETIVOS: ESTRATIFICACIÓN En la introducción de este capítulo. no en función de un punto. <10 m) no se han examinado. simplemente es práctica. No obstante. para cada uso de suelo. En cada sitio de muestreo seleccionado. requieren establecer comparaciones en diferentes usos de suelo. se sugiere que un buen enfoque en los objetivos de un estudio mejorará la eficiencia en su diseño e incrementará la posibilidad de lograrlos. Si los datos se usan para hacer afirmaciones sobre el área de estudio en general (por ejemplo.

Resulta más eficiente incluirlas en un número 66 Manual de biología de suelos tropicales .suelo pueden no estar representados en las muestras. 2 Las localizaciones de estos usos de suelo deben ser conocidas. ni aquellas zonas de transición que puedan ser importantes. si el objetivo es hacer un inventario del paisaje. con frecuencias proporcionales a su ocurrencia en el área de estudio. Por supuesto. entonces existen dos prerrequisitos: 1 Se necesita saber cuáles son los usos de suelo a comparar y contar con definiciones precisas de ellos. Si se emplea este enfoque. ¿cuándo se debe uno de mover a lo largo de un gradiente para incrementar la cobertura de árboles? Aquí tenemos otra ganancia potencial en la eficiencia del pensamiento a través de estos requerimientos en el diseño y no sólo en la etapa de análisis. de no ser así. sin embargo. Si se cuenta con un total de N muestras para comparar dos usos de suelo entonces. entonces probablemente muchos de los sitios de muestreo seleccionados terminarán siendo posiciones ambiguas en lo que se refiere a la definición de uso de suelo. es probable que la muestra incluya únicamente algunas observaciones de estas categorías. a partir de las cuales no se podrán establecer conclusiones. pero si el objetivo es investigar los efectos de uso de suelo. Por ejemplo. puesto que no habrá certeza en cómo clasificarlas. el mejor diseño es tener N/2 en cada uno de los dos grupos. Con un enfoque de muestreo estratificado. éstos deberán ser incluidos específicamente en el muestreo. tiene que considerarse en algún momento. El primer aspecto hace que algunos investigadores se sientan incómodos ante la idea de que una predefinición de uso de suelo para la investigación excluya el descubrimiento de patrones potencialmente importantes. al igual que la necesidad de definir con precisión. Si los objetivos incluyen investigación en límites entre áreas de diferentes usos de suelo o de nichos raros. podemos elegir un tamaño idóneo de muestra para cada uso de suelo. no es deseable excluir algunos usos de suelo. La predefinición. ¿dónde se encuentra el límite entre “pastizales con árboles” y “bosque secundario”?. Se requiere de un mapa de uso de suelo del área bajo estudio. rasgos lineales. el diseño no es parcial para el objetivo de comparar los usos de suelo y además es eficiente. por ejemplo. Sin embargo. Si un diseño de muestreo no toma en cuenta el uso de suelo. tiene sentido excluir tales sitios. En un enfoque estratificado. las áreas ambiguas pueden ser excluidas del muestreo. en ausencia de alguna otra información.

sino variables ambientales. excluirlas (dándoles un equivalente de tamaño cero). o en imágenes de SR y utilizar esto para definir los estratos. por ejemplo. El uso de un software para ayudar en la aleatorización y un GPS para localizar los puntos de muestreo en el campo. de tal modo que: a) cada punto tenga las mismas posibilidades de ser seleccionado. Para la implementación del MAS es necesario delimitar el área de estudio. o bien. Por ejemplo. algunas veces por una buena razón. Nótese que muchos de estos argumentos también aplican cuando los factores hipotéticos que influyen sobre la biodiversidad del suelo. MUESTREOS ALEATORIO Y SISTEMÁTICO Las razones esenciales para utilizar el muestreo aleatorio simple (MAS) fue descrito anteriormente y son detalladas en textos tales como Cochran (1977). los estudios ecológicos no siempre usan un muestreo aleatorio. puede ser útil hacer un monitoreo rápido de la MOS. tales como la MOS o la frecuencia de fuego. Aunque a veces es necesario. Sin embargo. esto es equivalente a limitar el área de estudio. si los objetivos lo requieren. influenciadas por el uso de suelo. cuando una “ventana” única se coloca en un área. Un enfoque común no aleatorio es una selección subjetiva de los sitios de muestreo. Si se toma un tamaño de muestra subjetivo igual a 1. El no contar con un mapa de usos de suelo. por lo tanto. ya que existe la posibilidad de la interpretación de imágenes por sensores remotos (SR). calibrarlo en un mapa de uso de suelo. El muestreo aleatorio estratificado requiere hacer lo mismo en cada estrato. abierto al debate cuando los resultados son presentados. y b) la selección de un punto no cambie la probabilidad de incluir cualquier otro punto. resultan muy útiles en la práctica.suficientemente grande. cuando se toman muestras en lugares considerados interesantes o importantes. y seleccionar los sitios de muestreo de manera aleatoria. si los objetivos no lo requieren. que frecuentemente sirven como base para seleccionar unidades de muestreo a niveles jerárquicos más altos. no son usos de suelo per se. Cuando se usan variables como la MOS en la estratificación. no es una limitante. de la propiedad inherente del diseño. la limitante de este enfoque es la posible falta de “representatividad” del área de muestreo (la medida en que los resultados pueden razonablemente ser asumidos para aplicarlos a una población más grade) porque ésta depende de la percepción del ejecutor y no. el que estos no tengan una resolución idónea. entonces dicha área queda representada por esa ventana y el hecho de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 67 . Ello queda.

que esa área sea o no, representativa dependerá únicamente de la habilidad del ejecutor. El muestreo sistemático tiene muchas aplicaciones en la ecología, usando transectos de una dimensión o cuadrículas de dos dimensiones. En el caso de los transectos, las muestras son seleccionadas en puntos que se encuentran a una distancia fija entre sí, a lo largo de una línea predeterminada. Para un muestreo de cuadrícula, una cuadrícula rectangular (usualmente) es definida en el área y las muestras son tomadas en cada punto de intersección. Las ventajas potenciales de este tipo de muestreo sistemático se derivan de la teoría y de la práctica. Las ventajas de la práctica incluyen:
• La facilidad de localizar puntos de muestreo, describir su ubicación y los medios de llegar a los puntos de muestreo; por ejemplo, el protocolo puede ser algo tan simple como “desde el punto de partida, camino al norte y muestreo cada 50 m”. • La facilidad de planear el trabajo de campo; por ejemplo, de estimar el tiempo requerido para muestrear un número fijo de puntos. La razón estadística para utilizar muestreos sistemáticos es que pueden ser eficientes (Webster y Oliver, 1990). Si se considera un estudio con el propósito de calcular la media o el total de algún parámetro (por ejemplo, el carbono total en el suelo en el área de estudio o la media de escarabajos por m2). Si la cantidad medida no es constante, una muestra que utilice la cuadrícula dará una mejor estimación que una simple muestra al azar del mismo tamaño, lo que frecuentemente es el caso de variables ambientales y biológicas. La eficiencia se basa en el hecho de que puntos cercanos son similares, por tanto, no proporcionan mucha información nueva; mientras que en la cuadrícula las muestras están de manera uniforme en toda el área de estudio. Por razones similares, el enfoque de cuadrícula resultará útil para compilar el inventario de un área bajo estudio, salvo que puede excluir nichos raros (véase abajo). Sin embargo, hay aspectos negativos: • Algunos puntos de la cuadrícula tendrían que ser excluidos del estudio, tales como caminos o cuerpos de agua. • Las cuadrículas incluyen muestras de diferentes usos de suelo, con un tamaño más o menos proporcional en cada tipo de uso de suelo. En particular, tipos de uso de suelo raros pueden ser omitidos, lo que se puede compensar moviendo
68
Manual de biología de suelos tropicales

la ventana y añadiendo puntos, aunque el proceso podría llegar a ser arbitrario y subjetivo. • Algunas veces no es posible caracterizar el uso de suelo claramente en cada punto de muestreo. Estos puntos están relacionados con el problema discutido en la sección “enfoque de objetivos: estratificación”. Si el objetivo del estudio es comparar clases de uso de suelo, entonces el muestreo por cuadrícula, a veces, no los captura de forma óptima, de manera que las cuadrículas y los transectos probablemente son más apropiados para muestrear la biodiversidad del suelo, cuando a) no existe ningún objetivo explícito o hipótesis que involucre comparaciones o relaciones con variables ambientales, o b) la hipótesis se refiere a una unidad espacial de un nivel más alto que la escala en que el muestreo por cuadrícula o por transecto fue hecho. Por ejemplo, Swift y Bignell (2001) recomiendan transectos de 40 m de largo, pero éstos quedan dentro de cada clase de uso de suelo. Cuando se comparan usos de suelo, se hacen réplicas de los transectos y se asignan aleatoriamente los estratos definidos por diferentes usos de suelo. De esta forma, el muestreo sistemático por cuadrícula o transecto, normalmente, es combinado con un muestreo aleatorio. Por ejemplo, puede haber varias cuadrículas definidas como se aprecia en la Figura 2.2d, con una localización y orientación hecha al azar. De manera similar, el punto de inicio y la orientación de los transectos que se repiten pueden ser hechos aleatoriamente. Los transectos también pueden ser útiles cuando se alinean con gradientes ambientales considerados importantes; esto se conoce como “gradsectos” (Wessels et al., 1998). Con la aleatorización en algún nivel en la jerarquía, es posible hacer un análisis estadístico basado en las propiedades aleatorias del diseño; por ejemplo, si un número de cuadrículas pequeñas es colocado aleatoriamente en el área de estudio, entonces contamos con las réplicas necesarias para establecer una consistencia, a través de patrones encontrados. El análisis estadístico elegido para una muestra tomada en un diseño sistemático no puede estar basado en la aleatorización, porque los sitios no fueron seleccionados de manera independiente dentro de cada cuadrícula. Existen dos posibles enfoques para el análisis: el primero asume que los datos se comportan de forma aleatoria (por ejemplo, las propiedades estadísticas son las mismas, como si el punto hubiera sido localizado aleatoriamente); el segundo, es utilizar un modelo explícito de patrones espaciales. En la mayoría de los análisis que buscan relaciones entre variables ambientales y la biodiversidad del suelo se usa el primer análisis,
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

69

principalmente, porque las alternativas son complejas. Las consecuencias de suponer esto son raramente investigadas. Es claro que la distancia y el tamaño total de la cuadrícula determinan la escala de los patrones que pueden ser detectados. No es posible observar patrones (por ejemplo, agregación de la biodiversidad del suelo) a escalas espaciales menores que las distancias entre los puntos de la cuadrícula; de la misma manera, tampoco será posible detectar patrones más grandes que el tamaño total de la cuadrícula. Sólo se pueden reconocer los patrones cuando existen varias repeticiones dentro de la misma cuadrícula. Es este aspecto de escala de patrones, definido por los objetivos del estudio, el que debería determinar los espacios y el tamaño total de la cuadrícula. Algunas veces se sugiere que los espacios deben ser de tal manera que los puntos vecinos no estén correlacionados. Esta noción de correlación espacial es importante, pero también confusa. La correlación entre las mediciones de una determinada distancia, no es una cantidad absoluta, pero es una medida relativa a un promedio (técnicamente, el problema tiene que ver con el recambio). Para poder ver esto, piense en analizar datos de una sola ventana en Kenia, donde los puntos de una distancia de más de 200 m entre sí, pueden no indicar similitud en la biodiversidad del suelo, pero si juntamos los datos con otra base de datos global se esperaría encontrar similitud, no sólo en los puntos que pertenecen a una misma ventana, sino entre todos los puntos dentro de Kenia. HABLANDO DE VARIABILIDAD La experiencia de estudios pasados sugiere que se debería de esperar un alto nivel de variación en muchas de las mediciones principales de la biología del suelo. Aún cuando se trata de distancias cortas, se puede esperar una variación grande en número y diversidad de diferentes grupos funcionales. En paisajes agrícolas tropicales la variación dentro de una categoría de uso de suelo puede ser debida a las prácticas de manejo, la variación en las características de la vegetación, las diferencias históricas en el uso de suelo de la parcela, efectos de borde, posición topográfica y características biofísicas. Si los métodos formales para determinar los requerimientos del tamaño de muestra fueran seguidos, probablemente indicarían un tamaño de muestra mucho más grande de lo es viable o costeable, ¿Qué se debe hacer entonces? Primero, ¡no tiene sentido no hacer nada! Simplemente, si se sigue con un tamaño de muestreo preconcebido, no se alcanzarán los objetivos; si el plan original fue
70
Manual de biología de suelos tropicales

trabajar con diez muestras por cada uso de suelo dentro de un sitio de referencia, y las indicaciones son que se necesitan alrededor de 100 muestras por cada uso de suelo, no tiene sentido continuar, puesto que se terminarán obteniendo resultados vagos y no concluyentes, los cuales se traducirán en errores estándares altos y sin efectos significativos cuando se analizan los datos. Tres son las posibles opciones: 1. Incrementar el tamaño de muestra. 2. Utilizar métodos de muestreo para reducir la variabilidad. 3. Reducir la amplitud del estudio. La primera opción no resulta práctica en la mayoría de los casos, pues siempre hay limitaciones de tiempo, dinero, recursos y experiencia. Existen varios métodos para reducir la variabilidad de las muestras; los más útiles consisten en la estratificación y la congruencia. Nótese que el uso del término “estratificación” se usa para el muestreo, pero es diferente a cómo se aplica en “enfoque de objetivos: estratificación” (arriba). Si algunas fuentes de variabilidad pueden ser previstas, éstas pueden ser usadas para definir estratos y removerlas del análisis. Por ejemplo, si el sitio de estudio cubre un rango de altitudes, se puede esperar una variación en la biodiversidad del suelo dependiendo de la altitud. La estratificación, entonces, divide el sitio de estudio en zonas de altitud y los sitios de muestreo dentro de cada una de ellas. En esta fase del análisis de datos, la variación de los usos de suelo se compara dentro y entre estratos para no oscurecer los resultados. Este enfoque requiere que algunos (no todos) de los diferentes usos de suelo estén localizados dentro de zonas de altitud. Si el uso de suelo únicamente varía con la altitud, entonces los dos factores están confundidos y sus efectos en la biodiversidad del suelo no se distinguen. Dado que existe una variación ambiental, la variabilidad en la biodiversidad del suelo estará en respuesta a la variación ambiental. Consecuentemente, los estratos pueden ser útiles para definir puntos de muestro cercanos geográficamente. Las ventanas en la figura 2.2 pueden ser vistas de esta manera. Comparar conlleva la idea de la estratificación a un extremo. Imagine que si dos de los usos de suelo a comparar son bosque y campos de maíz, se puede esperar que la biodiversidad del suelo dependa de muchas variables ambientales, tales como el clima, topografía, y geología. Estas variables ambientales varían típicamente de manera irregular, con sitios cercanamente similares. De esta manera, si seleccionamos parcelas de bosque y maíz que están cercanas, las diferencias entre ellas, principalmente, se deberán al uso de suelo y no, a otros factores, lo que nos
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

71

permite eliminar las variables que “meten ruido” en el análisis. Entonces, el enfoque sería identificar y muestrear, por ejemplo, diez pares de sitios, donde cada par esté formado por parcelas de bosque y maíz cercanas, situadas a cada lado de un lindero de uso de suelo. Formalmente, cada par constituye un estrato de tamaño 2. Más de dos usos de suelo pueden incluirse en el diseño. Las ideas de diseño para experimentos de bloques incompletos son relevantes para seleccionar pares de usos de suelo similares. Controlar la variabilidad mediante la reducción del área de estudio, muchas veces es la mejor solución. El área podría ser reducida, si se reduce el tamaño del sitio de muestreo, reduciendo naturalmente la heterogeneidad, lo que puede ser insatisfactorio porque también reduce la generalidad de los resultados. Si únicamente tomamos muestras en un área pequeña, entonces no existe una base para asumir que se han encontrado patrones ampliamente aplicables. Otras maneras de reducir el ámbito del sitio de estudio son: No incluir todos los usos de suelo encontrados en el área de estudio, sino una selección que cubra un gradiente de intensidades de uso de suelo o que represente alguna transición típica en el uso de suelo. Ajustarse a la definición de una clase de uso de suelo. Por ejemplo, en lugar de tomar un “campo de maíz” como uso de suelo, se podrá limitar la atención a campos de maíz que han sido cultivados continuamente durante los últimos diez años, que no han sido fertilizados en los últimos tres años y que son trabajados con azadón. Evitar tomar muestras en sitios ambiguos, como aquellas que se encuentren cerca de linderos. Mientras esto ayudará a detectar y medir el efecto de la intensidad de uso de suelo en la biodiversidad del suelo, pueden ser inconsistentes con los objetivos del inventario de las especies. Un compromiso entre los dos objetivos puede ser necesario. Esto es común en el diseño de proyectos y, en resumidas cuentas, no se puede esperar encontrar todo en un tamaño limitado de muestra. ESQUEMA DE MEDICIÓN DE PUNTOS Una vez localizados los puntos de muestreo, tiene que ser definido un protocolo de medición, lo que implica la necesidad de un muestreo adicional. El esquema básico
72
Manual de biología de suelos tropicales

de muestreo por puntos adoptado por el CSM-BGBD se presenta en la Figura 2.3, que a la vez se complementa con la Tabla 2.1. Aunque el esquema de medición utilizado para el muestreo de grupos funcionales que son descritos por los procedimientos del proyecto alternativas de roza, tumba y quema (Swift y Bignell, 2001), es diferente de lo que fue propuesto por Swift y Bignell para adecuarse al enfoque basado en la cuadrícula. Por ejemplo, los pocos monolitos en cada punto de muestreo son compensados por el gran número de puntos de muestreo, que resulta en aproximadamente el mismo número de eventos de muestreo. No obstante, los resultados preliminares han indicado que con un pequeño monolito por punto de muestreo no todas las especies pueden ser capturadas. Si éste es el objetivo para llevar a cabo el muestreo, se prevén opciones adicionales para incluir monolitos más grandes. Macrofauna: un solo monolito, trampas de caída (pitfall) y, por lo menos un transecto de 20 m son colocados en cada sitio de muestreo. El muestreo por transectos se amplía para incluir hormigas y escarabajos, en adición a las termitas. En un esquema alternativo adicional los monolitos pueden ser excavados para mejorar el muestreo de lombrices de tierra y se puede introducir un sistema simple para tomar muestras de termitas. Nótese que en las parcelas pequeñas, los sistemas de cultivo pueden estar altamente disecados o los terrenos son difíciles, por lo tanto, no es necesario que el transecto sea lineal. Un transecto puede tener un ángulo de 90 grados, y muestrear parcelas de forma irregular o para evitar arroyos, fuertes pendientes o rocas. Los árboles caídos deben incluirse en el transecto si estos quedan sobre la línea (Swift y Bignell, 2001). Mesofauna: 12 extracciones de suelo tomadas en círculos concéntricos alrededor de un solo monolito a 3 y 6 metros de radio, y extraídas utilizando el método Berlese. Adicionalmente, las trampas pitfalls sin cebo abiertas durante un periodo de 24 horas sirven para colectar mesofauna y macrofauna que viven en la superficie. Las trampas pitfalls generalmente son apropiadas para hormigas, algunos escarabajos, algunos saltamontes, milpiés y arañas. Muestras de suelo extraídas con sacabocado por el método de Berlese contienen colémbolos, ácaros y en sitios húmedos enquitreidos. Microfauna: muestreos con sacabocado de manera similar en 12 extracciones de suelo de dos círculos concéntricos, a 3 y 6 metros de radio del monolito. La “microfauna”, principalmente se refiere a nematodos, aunque también a pequeños ácaros (y larvas de ácaros) extraídos de las muestras de suelo; por el método Berlese pueden cuantificarse.
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

73

Figura 2.3 Esquema de muestreo por puntos para toda la biota. El muestreo se puede ampliar si se usa uno o dos transectos para termitas, hormigas y escarabajos, mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.

Monolito Núcleo de suelo para mesofauna Núcleo de suelo para nemátodos y microbios Muestras para análisis físicoquimicos Transecto 1 m2 para muestra de hojarasca (Winkler) Trampa pitfall

Microsimbiontes y hongos del suelo: muestreos de manera similar mediante 12 extracciones de suelo con sacabocado, puestas en dos círculos concéntricos alrededor de un solo monolito, a 3 y 6 metros de radio. Parámetros físicos y químicos del suelo: cuatro extracciones de suelo con sacabocado puestas en un círculo de 6 metros de radio de un monolito. En el caso de estudios de co-ubicación, una extracción adicional de suelo puede tomarse de la pared exterior de la zanja del monolito (véase Capítulo 3, muestreo de macrofauna). En un esquema alternativo (Figura 2.4) los usos de suelo pueden ser muestreados por una combinación de monolitos principales y subsidiarios, transectos de 50 metros, cuadrantes de hojarasca espaciadas y trampas pitfalls. El muestreo casual alrededor de los transectos puede ser empleado y también trampas Malaise colocadas para capturar insectos voladores mayores. El protocolo difiere de la propuesta anterior, en lo concerniente a los puntos del transecto, cuadros de hojarasca, trampas pitfalls y monolitos subsidiarios colocados en líneas paralelas de 50 m, con una separación lateral de 10 m. Este protocolo debe ser tomado básicamente como una extensión del propuesto anteriormente y se considera aplicable en donde se le dé más importancia al muestreo de todas las especies que existen dentro del área y en los casos donde la frecuencia de muestreo es baja (número de parcelas muestreadas) por las razones explicadas anteriormente. Estas modificaciones
74
Manual de biología de suelos tropicales

resultan más adecuadas cuando se encuentran diferentes usos de suelo en todos los sitios. CONSIDERACIONES PRÁCTICAS EN LA ORGANIZACIÓN DEL TRABAJO DE CAMPO La colecta de muestras o la medición directa en el campo deberían, en la medida de lo posible, realizarse de forma secuencial y durante una sola salida. En el caso de parámetros físicos y químicos del suelo que permanecen estables en el tiempo, el muestreo puede hacerse en un momento diferente. Lo anterior, por supuesto, no se aplica en el caso de características dinámicas del suelo, por ejemplo, el contenido de agua en el suelo.
Figura 2.4 Esquema alternativo para muestrear macrofauna, utilizando un transecto de 50 m.
Extracción Winkler Transecto Mini-monolito

Trampa pitfall Monolito adicional
12 muestras de suelo (12 x 12 x 10 cm)
MS MS MS MS

Monolito principal 10 m

10 m 10 m 5m 50 m
MS MS MS

MS MS

Monolito adicional

MS MS MS

30 cm Hormigas de hojarasca Hormigas endogeas Termitas

2m

D iseño

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

75

Tabla 2.1 Grupos de organismos del suelo colectados utilizando diferentes métodos de captura.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Manual de biología de suelos tropicales
Suelo Mesofauna Descripción X X X X X X X X

76
Trampas pitfall con cebo* - 3 trampas por punto de muestreo. Las trampas se deben quitar después de 48 horas en campo. Transectos semi-cuantitativos 2 x 20 m uno por punto de muestreo, perpendicular a la pendiente Trampas Winkler para muestras pequeñas de hojarasca (1 x 1 m) a lo largo del transecto, 3 Winkler por punto de muestreo Núcleos de suelo con hojarasca (3.5 x 3.5 x 5 cm),12 submuestras por punto de muestreo (profundidad de 0-5 cm). Para mesofauna se hace una muestra compuesta (1er opción), o 4 muestras compuestas por 3 submuestras de cada cuadrante (segundo opción) o 3 muestras compuestas por 4 submuestras. Núcleos de suelo para microbios de 0-20 cm de profundidad sin hojarasca. En círculos a 3 y 6 m, del punto de muestro, una muestra compuesta de 12 submuestras por punto de muestreo.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

Trampa (pitfall)

X

X

X

Transecto

X

X

Trampa Winkler

X

X

X

Embudo de Berlese

X

X

X

Varios

Tabla 2.1 Continúa.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Monolito X

X

X

X

X

X

X

Mesofauna

D iseño
Suelo Descripción Monolito (25 x 25 x 30 cm), incluyendo hojarasca, una muestra por punto método TSBF. Muestra de suelo, una muestra compuesta de suelo por al menos 4 submuestras para análisis físicos y químicos, profundidad 0-10; 10-20; 20-30 cm.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

*Nota.- El cebo sugerido para las trampas pitfall es excremento de monos o de humanos, el cual es muy efectivo para extraer escarabajos coprófagos (Coleoptera) y, al mismo tiempo, no interfiere con la captura de escarabajos saprofíticos (Scarabaeidae, Aphodidae, Trogidae) y predadores (Sistiridae, Staphilinidae). El excremento de omnívoros, resulta más adecuado, en el caso de áreas de selva tropical porque los omnívoros predominan en estos ambientes

77

La colecta de muestras de los principales grupos funcionales de organismos del suelo, requiere de la colaboración de mucha gente en cada punto de muestreo, con el riesgo de lastimar el cultivo en pie, al igual que afectar el inventario, especialmente de aquellos organismos con alta motilidad o sensibles a la intromisión humana. Por ejemplo, las lombrices de tierra epígeas y algunos tipos de termitas comedoras de tierra son sensibles al disturbio, y especialmente a las pisadas, por lo que se alejarían rápidamente. Por lo tanto, es importante reducir el número de personas involucradas en la colecta de las muestras, aunque se necesita un número suficiente de manos para poder manejar y procesar las muestras. Durante el entrenamiento de técnicos y asistentes de campo, es necesario prestar atención a los riesgos que pudieran surgir en cada grupo específico de organismos de suelo. El riesgo de contaminación cuando se trata de microorganismos debe ser entendido y la importancia de utilizar procedimientos adecuados para evitar la contaminación debe ser enfatizada, especialmente en las personas inexpertas. El mismo principio rige cuando existe la posibilidad de que dichos organismos escapen de los sitios de muestreo, como consecuencia de una severa perturbación. Otra preocupación es el gran volumen de suelo que será colectado durante el muestreo y la necesidad de reducir dicho volumen para transportarlo. Desde este punto de vista, la extracción de especímenes de las muestras se hace mejor en, o cerca, del sitio de muestreo. También, en el sitio de muestreo se deben agrupar todas las muestras y extraer sub-muestras para su posterior análisis. El tiempo y la temperatura a la que se almacenan las muestras juegan un papel importante, dado que muchos organismos del suelo pueden morir a temperatura ambiente, en la superficie del suelo, o cuando son guardados en bolsas o contenedores durante unas cuantas horas. Para poder evitar dichos riesgos es importante identificar una instalación local adecuada antes de colectar las muestras o, hacer la extracción inmediata in situ de los especímenes. En algunas ocasiones, por ejemplo, el embudo de Berlese para la mesofauna y de Winkler para la extracción de hormigas y escarabajos de la hojarasca, pueden instalarse en el campo para su uso inmediato; en otros casos, cuando los organismos necesitan ser cultivados in vitro o cuando las propiedades del suelo necesitan ser determinadas, es necesario disponer de un transporte rápido para su traslado hacia el laboratorio. Bajo ninguna circunstancia las muestras deberán permanecer bajo el sol, ni aun cuando el protocolo de extracción requiera de un secado final de la materia. Otros detalles sobre las precauciones a tomar en cuenta y consejos
78
Manual de biología de suelos tropicales

sobre la logística general, se pueden encontrar en los capítulos que tratan grupos y métodos específicos.

MUESTREO EN EL PROYECTO CSM-BGBD
La jerarquía de muestreo
En el proyecto fueron seleccionadas áreas de siete países tropicales, con el propósito de evaluar la pérdida de biodiversidad del suelo con el incremento en la intensidad del uso de suelo. Los sitios se localizaron en las principales regiones biogeográficas de los trópicos, desde la selva tropical húmeda Amazónica hasta la selva montañosa del Himalaya, en la India; áreas que presentan una biodiversidad global importante. Cada sitio incluyó un intervalo de usos de suelo desde selvas prístinas relativamente no perturbadas, hasta tierras agrícolas sometidas a uso intensivo, para determinar tendencias comunes, que puedan ser observadas en el cambio de la biodiversidad del suelo en relación con la intensidad del uso del suelo. El uso de métodos estándares de muestreo en los países y sitios de estudio, permite hacer comparaciones entre los sitios. Se adoptó un enfoque para el muestreo dentro de los sitios que hace uso del muestreo por medio de ventanas. Una ventana es (usualmente un rectángulo) una parcela de tierra que incluye en el estudio varios usos de suelo locales y se consideran “representativos” de los sitios de estudio. Típicamente, las ventanas miden entre 2 y 5 km²; estas ventanas de muestreo varían en tamaño y número debido a la configuración del uso del suelo en cada sitio, y sólo se presentó un caso donde el acceso fue problemático. Por ejemplo, se utiliza una ventana más grande para incluir los usos de suelo relevantes en el área y hasta seis ventanas más pequeñas se distribuyen dentro del área para los diferentes usos de suelo requeridos. Una cuadrícula regular (con espacios variables, véase a continuación) se utiliza para identificar un conjunto de posibles puntos de muestreo dentro de cada ventana; los puntos corresponden a las intersecciones de las líneas en la cuadrícula. El muestreo de cuadrícula se usó por las razones descritas anteriormente, eficiencia estadística y para racionar el trabajo de campo. Además, el inventario es de naturaleza exploratoria, sin tomar en cuenta la hipótesis general formulada, pues quedan pendientes las siguientes preguntas: ¿cuáles de los factores que determinan las prácticas intensivas de uso de suelo influyen en la distribución y riqueza de la biota del suelo? y, ¿a qué escala los patrones de distribución espacial se manifiestan? Este
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

79

enfoque es similar al usado para el proyecto de BioAssess, financiado por la Unión Europea, cuyo objetivo, similar al de éste proyecto, fue evaluar la biodiversidad en función de la intensidad del uso del suelo en paisajes agrícolas (véase Ponge et al., 2003; Federoff et al., 2005). La biodiversidad del suelo se muestrea en el nivel de parcela (punto de muestreo o sitio). La cuadrícula define una serie de parcelas, con un objetivo de cerca de 100 a 200 parcelas por ventana. La parcela es un área de, por lo menos, 25 x 25 m determinada por el área mínima requerida para colectar todas las muestras necesarias y realizar su medición, tal y como se describió anteriormente. El principio de co-ubicación es adoptado para análisis de muestras físicas y químicas del suelo y para los inventarios de la biodiversidad del suelo. Al mismo tiempo las ventanas permiten comparar la biodiversidad del suelo entre los componentes del paisaje.

Localización y definición de las ventanas de muestreo y cuadrícula
La posición de las ventanas dentro del sitio de estudio se hace de tal modo que abarque los diferentes usos de suelo. Generalmente, una ventana no puede abarcar los diferentes usos del suelo, por lo que son necesarias otras ventanas más pequeñas. La Figura 2.5 describe las distintas configuraciones utilizadas. La Figura 2.5a ilustra el uso de una ventana de 9 x 11 puntos de muestreo (además de algunos puntos adicionales de muestreo). La figura 2.5b ilustra el uso de 6, 3 y 2 ventanas separadas. En el caso donde se usan seis ventanas separadas, una ventana medirá 1 km², dependiendo de la distancia entre los puntos de la cuadrícula. En sitios caracterizados por fuertes pendientes se esperaría que el gradiente del uso del suelo esté orientado en la misma dirección, y las ventanas estarán entonces localizadas a lo largo del gradiente (Figura 2.5b). En los linderos de la selva en los trópicos, frecuentemente se observa que el patrón de distribución de usos de suelo refleja un gradiente de intensidad de uso de suelo, con un uso más intensivo a mayor distancia de la selva. En tales casos, las ventanas de muestreo se localizan a lo largo de tal gradiente. Se necesita, por lo tanto, contar con suficientes conocimientos de la región antes de seleccionar los sitios de muestreo. Cuando algunos gradientes no son obvios, la selección de las ventanas deberá cubrir dos o tres de los usos de suelo más importantes y, por tanto, también las transiciones observadas con mayor frecuencia de un tipo a otro tipo de uso de suelo. Por ejemplo, en los márgenes del bosque puede darse la transición de bosque a pastizal, bosque a tierras de cultivo o bosque a grandes plantaciones, en donde
80
Manual de biología de suelos tropicales

Esto permitirá un análisis comparativo de transiciones de uso de suelo (por medidas relativas). De esta forma. tres y dos ventanas. utilizando un papel traslúcido sobre la fotografía. dispuestas a lo largo del gradiente. según se requiera. Para la selección de las ventanas de muestreo se utilizaron fotos aéreas o imágenes de satélite de alta resolución. Cuando únicamente están disponibles materiales análogos. antes que un cambio de uso de suelo per se. lo que facilitará la selección de las ventanas. Figura 2. Número de parcelas de muestreo y tamaño de la cuadrícula El número total de puntos de muestreo por área de referencia se mantiene fijo entre 100 y 120. el área ocupada por cada uso de suelo.5 Ejemplos de diferentes configuraciones de ventanas de muestreo. mientras minimiza los cambios en la biodiversidad del suelo que surgen de los diferentes usos. variaciones topográficas o climáticas. con puntos de muestreo adicionales. a) cuadrícula completa. Lo anterior se obtiene mediante varias configuraciones de ventana(s) D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 81 . b) ilustración de la división de una cuadrícula entre seis. dentro de una ventana definida puede ser determinada utilizando software de Sistemas de Información Geográfica (SIG) estándar. Cuando se encuentran disponibles mapas digitales de uso de suelo.una ventana cubre cada transición típica de uso de suelo. Mapas detallados de uso de suelo y de vegetación también son adecuados para este propósito. se hace una selección manual por interpretación visual. se introduce un elemento de replicación.

De esta manera. un transecto de 40 x 5 m. suponiendo que existan entre seis y siete usos de suelo distintos por cada área de referencia (correspondientes a seis o siete clases de usos de suelo generalmente definidos en el sistema de clasificación de usos de suelo) donde cada uso de suelo es muestreado por tres transectos.. 2003) recomienda un número similar de puntos de muestreo. Eggleton et al. En este último. termitas). Se añaden puntos de muestreo donde el uso de suelo es altamente variable. Davies et al. otra opción es ensamblar de una manera sinóptica por combinación de transectos a lo largo de diferentes años o en proyectos no relacionados (ej. más puntos en la misma parcela). Con 100 a 200 puntos por área de referencia generalmente se llega al punto donde la curva de acumulación de las especies para grupos de macrofauna es asintótica. en el caso de por lo menos algunos de los grupos funcionales (ej. descritos anteriormente. es que únicamente se toma un monolito y una muestra agrupada para los microsimbiontes por parcela. con un transecto extendido en el caso de algunos grupos (por ejemplo. La captura adicional de especies requiere de un esfuerzo de muestreo considerable. del cual un mínimo de cinco monolitos son cavados para muestrear la macrofauna y cinco muestras conjuntas para los microsimbiontes.. termitas y hormigas). Por ejemplo. el número de puntos de muestreo deberá incrementarse de 5 a 8 por transecto (es decir. Los resultados del inventario del proyecto CSM-BGBD indican que es necesario un esfuerzo mínimo de muestreo de 100 a 120 puntos para poder capturar la mayoría de las especies dentro del sitio. cada uso de suelo es evaluado en.de muestreo y las dimensiones de las cuadrículas. 2002. el proyecto BioAssess (Ponge et al.. en parte por consideraciones logísticas. 2003). y el procedimiento recomendado por el proyecto ASB (Swift y Bignell. Mientras el tamaño de muestra sigue siendo más o menos igual en los transectos y cuadrículas. En este sentido Swift y Bignell (2001) argumentan. que para incrementar la confiabilidad de los datos del esquema basado en transectos. En un muestreo basado en transectos la idea de replicación recomendada por Swift y Bignell (tres transectos por cada uso de suelo) casi nunca se logra. por lo menos. dando un total de 90 a 105 monolitos muestreados (y el mismo número de muestras agrupadas para evaluar los microsimbiontes) aproximadamente igual al número de puntos en la cuadrícula. 2001) tendrá un esfuerzo de muestreo comparable. el diseño 82 Manual de biología de suelos tropicales . La principal diferencia con el enfoque de muestreo de cuadrícula. el esfuerzo de muestreo promedio probablemente varía. El número total de puntos de muestreo concuerda con otras estrategias de muestreo propuestas en ejercicios similares de evaluación de la biodiversidad.

en lo que concierne a la evaluación de la diversidad de especies.de muestreo se ajusta a los objetivos del inventario del área de estudio. basándose en otros datos o en un estudio piloto. es importante considerar el número mínimo de puntos requeridos para cada categoría de uso de suelo. La colecta de muestras rara vez es el paso que limita la evaluación de la biodiversidad porque la extracción. historia. si esta prueba confirma alta variabilidad en la biodiversidad del suelo dentro de las D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 83 .. el número de puntos por categoría de uso de suelo aumenta. El número de muestras requeridas por uso de suelo deben ser representativas de la biodiversidad del suelo presente y entonces. Si la capacidad para procesar y analizar esta cantidad de muestras no está disponible. 1998). normalmente no todas las especies son capturadas y hará más difícil demostrar las diferencias en biodiversidad del suelo entre los tipos de usos de suelo que normalmente se caracterizan por una alta variabilidad en la riqueza de especies. pero aun así se requiere de una campaña organizada en el campo y de instalaciones establecidas para poder procesar y analizar las muestras. identificación y catalogación de especímenes son los pasos que requieren mayor tiempo en el proceso (Lawton et al. Se le da prioridad al tipo de agricultura de subsistencia a la hora de incrementar el número de muestras porque es precisamente en esta categoría dónde se espera que ocurra una mayor variación debido al manejo. Reducir el número de puntos de muestreo por categoría de uso de suelo mientras se mantiene el número de categorías de uso de uso de suelo investigado puede comprometer el objetivo de obtener resultados estadísticamente verificables. el procedimiento correcto para reducir el número total de puntos de muestreo deberá ser estimado. Dado el alto nivel de variación en las medidas de los componentes de la biodiversidad del suelo. restringir el número de usos de suelo de manera que el esfuerzo total sea compatible con la capacidad de procesamiento. Número de puntos de muestreo por categoría de uso de suelo Con seis o siete tipos de uso de suelo en cada área determinada. En números pequeños o en una distribución irregular de puntos de muestreo en los diferentes usos de suelo. etc. Se aconseja hacer una prueba piloto para informar el diseño de muestreo. un promedio alrededor de 15 puntos por clase de cobertura de suelo resultan de muestrear la cuadrícula. Con menos categorías de uso de suelo presentes. La experiencia del proyecto CSM-BGBD indica que el procesamiento de 100 a 120 muestras es viable con los recursos generalmente disponibles.

Esto implica adoptar un nivel más alto de detalle en el sistema de clasificación de uso de suelo y. seleccionar las clases de uso de suelo que cubren un claro gradiente en intensidad de usos de suelo. Este procedimiento permitirá eliminar los puntos que caigan en tipos de uso de suelo no especificados. Para este propósito. de tal manera que se cumpla el criterio para un mínimo número de puntos de muestreo en cada uno de los tipos de uso de suelo. El enfoque de la cuadrícula asume un acceso libre al terreno o parcela donde se localizan los puntos de muestreo. con el propósito de seleccionar aleatoriamente puntos de muestreo para cada categoría de uso de suelo. Cuando éste no es el caso. se necesita una 84 Manual de biología de suelos tropicales . Para poder seleccionar o eliminar sitios de muestreo (parcelas) es necesario conocer los usos de suelo en cada punto de la cuadrícula y se requiere de un inventario de uso de suelo previo al muestreo de la biodiversidad del suelo. Esta opción se puede observar en la Figura 2. De la misma manera. se puede partir de una cuadrícula vacía (que únicamente contenga posibles puntos de muestreo). mientras se cumplen los requerimientos para el número mínimo de puntos de muestreo para cada categoría de uso de suelo. La definición de un sistema de clasificación de uso de suelo se detalla en el Capítulo 11. se aplica un procedimiento no-sesgado para restar un número de puntos que permitan contrarrestar el incremento en el número total de puntos de muestreo que resulta de ampliar la cuadrícula. La segunda opción es seleccionar puntos adicionales dentro de las ventanas entre los puntos existentes de la cuadrícula para aquellas categorías de uso de suelo que están siendo muestreadas. donde la distancia mínima entre puntos necesita ser respetada. deberán hacerse algunos intentos para aleatorizar la selección de los puntos originales para ser divididos en dos. Esta estrategia implica incluir ventanas de muestreo irregulares. Una estrategia es usar una “cuadrícula estratificada” según lo ilustrado en la Figura 2.5a. posteriormente.categorías de uso de suelo. se define una cuadrícula mayor (resaltando el número de intersecciones). de forma separada hasta que se cumpla con el requerimiento del número mínimo de puntos de muestreo. de acuerdo con los principios detallados en “Hablando de variabilidad” (arriba). Aunque la inserción de puntos adicionales es conveniente.6. entonces se hace un ajuste de la definición de clases de uso de suelo. Posteriormente. Adaptación del enfoque de muestreo a condiciones de campo Hay dos estrategias disponibles para asegurar una representación de los usos de suelo y clases de cobertura en el muestreo.

Distancia entre los puntos de muestreo La distribución de los organismos del suelo puede reflejar gradientes. Por ejemplo: en un área determinada en México. en lugar de utilizar una cuadrícula regular que cubriera un área mayor. colocando una cuadrícula fija dentro de dichas ventanas. por ejemplo. de una a tres ventanas fueron colocadas en cada comunidad disponible. aquéllos de carbono orgánico y prácticas de cultivo. debido al aislamiento de las comunidades. Los patrones de distribución de los organismos del suelo puede correlacionarse con la topografía.6 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. el acceso a las tierras de los agricultores estuvo restringida. con D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 85 . En el área determinada en La Amazonia en Brasil. En este caso las tierras seleccionadas fueron aquéllas que pertenecían a agricultores que sí permitieron el acceso y se adoptó un patrón específico para muestrear dentro de estas tierras.Figura 2. estrategia de muestreo alterna.

Por otro lado. los espacios en la cuadrícula fueron reducidos en el área determinada en Brasil. al mismo tiempo permite. si las parcelas individuales miden más de dos a cuatro hectáreas. se pueden reducir los espacios en la cuadrícula.5 ha) y donde no es posible atravesar (ej. dependiendo de los organismos implicados. con parcelas muy pequeñas (menos de 0. atravesar de un punto a otro. en la Amazonia. En el caso del proyecto de la biodiversidad del suelo. que las termitas siguen patrones espaciales en un intervalo de hasta 330 m y que la distribución de especies de nematodos muestra tamaños de parches entre 6 a 80 m. Ettema y Wardle (2002) mencionan que la biomasa microbiana y los colémbolos son espacialmente dependientes en intervalos de más de 200 m. No obstante. o bien. a 100 m. Por estas razones. reproducción y competencia (Lavelle y Spain. vegetación secundaria muy densa dentro de parcelas barbechadas). tales como las lombrices de tierra. Existen varias teorías para explicar la riqueza extremadamente alta de las comunidades del suelo y el bajo grado de especialización en recursos. se debe considerar aumentar la distancia entre los puntos. Al mismo tiempo reduce la dependencia espacial de las observaciones para la mayoría de los principales grupos de organismos del suelo. el muestreo en cuadrícula permite examinar patrones espaciales a escalas entre la distancia inter-muestra y el tamaño de la cuadrícula.los parches de vegetación. la investigación de la distribución de patrones específicos no representa un objetivo deseado. Una distancia de 200 m parece aceptable porque permite un área relativamente mayor de muestreo a través de la cuadrícula y es probable que refleje los usos de suelos más dominantes en la muestra. con la ubicación de árboles individuales. en el caso de paisajes altamente fragmentados. anidadas en estructuras más grandes. Sin embargo. En la literatura se pueden encontrar varios ejemplos de la estructura espacial de la biota de suelo sobre distancias de menos de un centímetro hasta de cientos de metros en el campo. razón por la que no fueron considerados esquemas de muestreo adecuados para llevar a cabo un análisis de la distribución espacial. con muchos grupos diferentes de organismos del suelo estudiados. 2001). con gradientes de recursos del suelo. en la mayoría de los casos. la distribución y agrupación de organismos de suelo también son gobernadas por fuerzas intrínsecas de procesos poblacionales tales como dispersión. También se registra una distribución parchada en una escala miniatura de centímetros a metros. 86 Manual de biología de suelos tropicales .

El conjunto básico de las propiedades físicas y químicas del suelo debería incluir densidad aparente. Es posible que la variabilidad en abundancia y diversidad de organismos del suelo dentro de una categoría de usos de suelo pueda ser mayor que la variabilidad entre categorías de uso de suelo. pF (tensión de humedad del suelo). pH. Sin embargo. materia orgánica del suelo) y características de manejo (tipo de labranza. lo indicado será incluir una descripción detallada de uso y cobertura del suelo. y debido a que las características completas del sitio no pueden ser obtenidas solamente por la apariencia del uso del suelo. la información sobre la precipitación anual. especialmente en sistemas tan diversos como los representados en los trópicos. Existn un número de factores interrelacionados: bióticos y abióticos (ej. Por lo tanto. la diversidad del suelo es inventariada independientemente a lo largo de un gradiente de intensidades de usos de suelo para cada área seleccionada. en términos de los factores que determinan la biodiversidad del suelo. duración de secas y la precipitación acumulada hasta la fecha de muestreo. días de lluvia. las condiciones bióticas y abióticas. textura (la proporción arcilla/arena/limo). descrita a nivel de las principales categorías de uso de suelo. C y N total. a fin de permitir un análisis completo de los datos para identificar los parámetros que explican la variabilidad en la biodiversidad del suelo. deberían registrarse para la ventana e incluso para el área seleccionada. con referencia especial al uso del suelo también es importante de conocer (aunque no siempre se cuenta con este dato). Al mismo tiempo. asumir que una categoría de uso del suelo está en una escala correcta para acomodar su variación puede ser incorrecto. temperatura y humedad media. diversidad de plantas. La definición de clases de uso de suelo resulta importante y se discute en el Capítulo 11 de este manual. Debido a que se sabe muy poco sobre la importancia relativa de los factores antes mencionados. etc. La historia del sitio. pendiente y aspecto. junto con la altitud.) que afectan la distribución de organismos del suelo y se asume que las principales categorías de uso de suelo proporcionan una diferencia significativa. así como las características de uso y manejo del suelo pueden variar considerablemente entre regiones. y de las características del suelo. uso de químicos. como parte del proceso del inventario. cationes D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 87 .Inventario de uso del suelo y caracterización del sitio La hipótesis central plantea que la mayor variación en la biodiversidad del suelo está asociada con la diferencia en la intensidad de usos de suelo.

no siempre suele ser factible. La producción de esporas responde a la fenología de las plantas y. ver Anderson e Ingram (1993). pero inmediatamente adyacentes a la zanja de cada monolito (la zanja exterior probablemente sea el mejor lugar). en la práctica. Idealmente. el porcentaje de cubierta vegetal. en áreas de bosque. Una descripción de los sitios puede ser completada por el tipo de vegetación. cobertura dominante/abundancia de flora en el nivel del suelo. El Capítulo 11 proporciona más detalles sobre los requerimientos respecto de usos de suelo específicos. Además. por ejemplo. debido a la senescencia de las raíces. lo que puede ser diferente. CIC. y los resultados del inventario de la riqueza de especies y abundancia (relativa) mostrarán marcadas diferencias entre las épocas. También. características como la altura media del dosel. los inventarios deberían elaborarse durante la época de lluvias y también en la época de seca. por esta razón se hace el muestreo al final de la época de lluvias 88 Manual de biología de suelos tropicales . la evolución de las estructuras y ciclos reproductivos (como la formación de esporocarpos) se sincronizan con los cambios estacionales que ocurren dentro del hospedero y son mejor observados durante y hacia finales de la época de lluvias. Al3+ y H+.intercambiables. Épocas de muestreo Los organismos del suelo responden a cambios estacionales. puesto que de esta manera surge la posibilidad de correlacionar las propiedades del suelo con la presencia o ausencia de un taxa en particular y grupos funcionales (véase Anderson e Ingram. ayudan a elegir sitios a lo largo de un gradiente de diversidad botánica que tiene alguna relación con sus posiciones actuales en las cronosecuencias e intensidades de perturbaciones. Respecto de hongos micorrizógenos arbusculares. 2005). la época seca será la más apropiada para muestrear. en el caso de cultivos anuales las esporas son más abundantes durante la época seca. acumulación y abundancia de hojarasca. 1993). especies de plantas y la riqueza de géneros. Sin embargo. área basal. dependiendo de los métodos utilizados. Muestras de suelo son tomados de suelos no perturbados. cuando el método depende del conteo e identificación de esporas. Para el muestreo de otras variables relacionadas con la caracterización del sitio. por ejemplo. La diversidad y abundancia de especies de leguminosas son de particular importancia en relación con la presencia de las bacterias formadoras de nódulos en leguminosas. la actividad de las lombrices de tierra es mayor al final de la época de lluvias (Tondoh y Lavelle. En los casos de hongos fitopatogénos y hongos ectomicorrízicos. P.

B. Boulton. CAB International. indicator taxa and effects of habitat modification in tropical forest’. Ettema.. Bignell. REFERENCIAS Anderson. Ponge. A. (1998) ‘Biodiversity inventories. pp.. S. (2001) Soil Ecology. New York. J-F.. D. pp177-183. A. Eggleton. y Watt.. Mawdsley. Wiley. New York. B. A.con la opción de tomar muestras adicionales durante la época de secas. P.. Agriculture. Cochran W. Dubs. Dordrecht Lawton.. Hodda. Kenkel. London. e Ingram. y Wardle. N. vol 83. (2007) Sampling Strategies for Natural Resources and the Environment. Gregoire. R. L. (2000) Scientific Method for Ecological Research. y Spain.. Vegetatio. Agriculture.. 195–207. P. vol 105. S. G. Gathorne-Hardy. Srivastava. (eds) (1993) Handbook of Sampling Methods for Arthropods in Agriculture. T. (2003) ‘Evolution of termite functional diversity: Analysis and synthesis of local ecological and regional influences on local species richness’. Pedigo. D. N. Jones.. E. G. D . Hammond. G. Norgrove. D. P. 847–877. (2005) “Small-scale response of plant species to land-use intensification”. Cambridge University Press. J. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 89 . J. M. D. Lo último puede realizarse con el objetivo específico de investigar cambios temporales en la biodiversidad del suelo. T. F. y Podani.. L. M. Holt. Federoff. F. Bignell. P. T. y Valentine. 72–76. (1989) ‘On sampling procedures in population and community ecology’. P. G.. G. P. vol 90. y Buntin. L. B. pp. Hauser. E. E. D. Trends in Ecology and Evolution. y Lavelle.. D. M. S. Journal of Biogeography. Dibog. Bloemers. D. Juhfisz-Nagy.. Nature (Lond). D. Lavelle. 283–290. J. y Madong. D. P. L. H. New York. y Parker. 89–202. P... pp. V. vol 17. (eds) (1998) Ecological Scale: Theory and Applications. Eggleton. Wallingford. vol 391. (1977) Sampling Techniques. R. (2002) ‘Termite diversity across an anthropogenic disturbance gradient in the humid forest zone of West Africa’. F. L. pp. vol 30. Kluwer Academic Publishers. 3rd edition. CRC. T. N... 2nd edition. A. pp.. Davies.. Ecosystems and Environment. F. Cambridge.. Columbia University Press. H. T. Peterson.. Chapman and Hall/CRC Press. Fernández-González. I. Eggleton. E. C. Larsen. Ecosystems and Environment.. (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. y Hernandez. Stork. Ford. C.E. J. (2002) ‘Spatial soil ecology’.

Tondoh. E.org/SEA/Publications. T.Ponge. D. Webster. P. South East Asian Regional Research Programme. (2000) Ecological Methods. (2003) ‘An overview of spatial sampling procedures and experimental design of spatial studies for ecosystem comparison’.. pp. y Lookingbill. Bogor. Gillet. S. P. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. Biodiversity Conservation.. Journal of Tropical Ecology. pp. P. www. M. E. vol 35. C. Thompson. (1998) ‘An evaluation of the gradsect biological survey method’. Ecoscience. L. y Lavelle. F. (eds) (2001) Standard Methods for the Assessment of Soil Biodiversity and Land-use Practice. K. 813–826. J. Soil Biology & Biochemistry. A. Wiley. (1996) Adaptive Sampling. M. Ecosystems and Environment.. Blackwell Science. A.. J. 3rd edition. K. y Seber. Goslee. Pierce. Oxford. (2002) ‘Extending community ecology to landscapes’. (2003) ‘Collembolan communities as bioindicators of land use intensity’. Oxford University Press. D. S. G. 200–202. E. J. pp. A. New York. M.. y Henderson. Grimbeek. Eudrilidae) in Ivory Coast’. 1093–1121. Indonesia. vol 9. (1990) Statistical Methods in Soil and Land Resource Survey. Sousa. vol 21. y Oliver. J. F. Federoff. van. A. R. Agriculture. Southwood. y van der Linde. ASB-Lecture Note 6B . J..worldagroforestrycentre. pp. Dubs. vol 94. E. Swift. y Bignell. Haese. 31–47. Wessels. 90 Manual de biología de suelos tropicales . T. Oxford. 493–500. vol 7. Urban. y Lavelle. y Ettema. S. K. R. P. Jaarsveld. Stein. F. S. A. International Centre for Research in Agroforestry. D. J... pp.

Mucha macrofauna desempeña un importante papel en los ecosistemas del suelo. aunque éste se concentra en los grupos más significativos: lombrices de tierra. los grupos de macrofauna frecuentemente son utilizados o propuestos como indicadores de la calidad biológica del suelo. en la creación de macroporos y en la transformación y redistribución de materia orgánica. Bignell. indicativos de la biodiversidad de suelo y de los efectos del cambio de uso y prácticas de manejo del mismo. debido a su biomasa. Francis-X. se consideran un componente determinante de la biota del suelo. el grupo macrofauna incluye aquellos animales del suelo que miden más de un centímetro de largo. e influyen de manera notable en las propiedades físicas y químicas de los suelos. sobre todo. los invertebrados más importantes en el suelo de regiones templadas. Otros son trituradores que deshacen la materia orgánica y un buen número de estos grupos son macropredadores. 91 .Capítulo 3 Macrofauna David E. Reginaldo Constantino. por tanto. Debido a su importante papel en los procesos del ecosistema y a su sensibilidad ante condiciones ambientales. Csaba Csuzdi. que habitan especialmente en ambientes tropicales. predominan las termitas y las hormigas. Una diversidad de organismos de suelo se incluye en esta categoría (capítulo 1). Susilo. Las lombrices de tierra son. sin embargo. probablemente. en ambientes tropicales. hormigas y escarabajos. termitas. o que tienen una anchura o diámetro de más de 2 mm. como ingenieros del suelo. Agus Karyanto. Además. Jérôme Ebagnerin Tondoh y Ronald Zanetti INTRODUCCIÓN Este capítulo describe los métodos para realizar el inventario de la macrofauna del suelo. Julio Louzada. Souleymane Konaté.

por ende. cuyo énfasis se concentra en un grupo específico de organismos asociados y. demuestra cómo ha crecido durante los últimos años nuestra percepción de la importancia de estos organismos. Se entiende que los métodos propuestos son aplicados en ambientes tropicales. En el capítulo 2. utilizando cualquiera de los métodos enlistados en el capítulo 2. Éstos están basados en monolitos de suelo y. en cada una de las siguientes secciones que describe un método en particular. Nuevos esquemas son propuestos en el diseño de monolitos para mejorar el muestreo de lombrices de tierra. y la extracción Winkler es el método más idóneo para la captura y extracción de hormigas de muestras de hojarasca. Para poder contar con datos de diversidad y abundancia de lombrices de tierra. No obstante. se requiere de métodos estándares en el muestreo para diversidad. por lo tanto. sin embargo. en la generalidad de la macrofauna. algunos grupos representativos de macrofauna específica son capturados. el hecho de que se pueda dedicar un capítulo entero al muestreo de macrofauna. 1993) consolidados y mejorados por Swift y Bignell (2001). forman un importante componente de la red alimenticia en el suelo. podrán ser utilizados más ampliamente. con la extracción de los insectos de los marcos de hojarasca por el método Winkler (Bestelmeyer et al. en el caso de termitas. Generalmente. cada uno de los métodos descritos es idóneo para un grupo en particular: los monolitos son especialmente escogidos para el inventario de lombrices de tierra. mientras que las trampas pitfall con cebo son apropiadas para la captura de escarabajos. los que generalmente se refieren como métodos “TSBF”. Un avance mayor consiste en utilizar el principio de transecto para hormigas y escarabajos.generalmente alta. Como en el caso de otros grupos de biota de suelo. al mismo tiempo. el método de transecto es más adecuado para un inventario de termitas. en un transecto corto (20-40 X 2m) al que ahora han sido añadidas trampas pitfall (principalmente para escarabajos) y otras guías para muestreo casual. el punto de partida de desarrollo de los protocolos han sido los procedimientos de Anderson e Ingram (1989. abundancia y biomasa. tal y como fueron aplicados en el proyecto CSM-BGBD. se explica que no existe un sólo método para llevar a cabo un inventario de un grupo específico de macrofauna. 2000). 92 Manual de biología de suelos tropicales . En este capítulo se describen métodos propuestos para realizar un inventario de macrofauna. este capítulo se estructura de acuerdo con el método utilizado y no tanto en función del grupo funcional. y no simplemente tres páginas que fueron impresas en los métodos originales “TSBF”. que sirvan como indicadores para monitorear el cambio de efecto de uso de suelo.

con dimensiones de 50 x 50 x 20 cm de profundidad para lombrices de tierra. preferentemente en el lugar y bajo sombra. de 0-10 cm. de manera que puedan trabajar varios asistentes en la misma muestra de suelo o en muestras diferentes. En el caso de la hojarasca. pero que representan una biomasa importante. éstos. Para revisar el suelo es conveniente utilizar la superficie de una mesa grande de campo para llevar a cabo la extracción.. Se aísla el monolito utilizando una pala a unos pocos centímetros fuera del marco y luego se cava una zanja a su alrededor de 25 cm de ancho y 30 cm de profundidad. 2000). junto con monolitos extraídos del suelo. son dictados por Anderson e Ingram (1993). es decir. Su abundancia y biomasa podrán ser calculadas con base en las muestras de 0. UTILIZANDO MONOLITOS DE SUELO Macroartrópodos de hojarasca y de suelo.INVENTARIO DE MACROARTRÓPODOS DE SUELO. HOJARASCA Y LOMBRICES DE TIERRA EN PARTICULAR. todos los invertebrados mayores de 10cm de largo. aislando el monolito como un pilar no perturbado (Figuras 3. sirve como un buen recipiente para la M acrofauna 93 . En una variante del método.1d). con un reborde. 2001) y las extracciones con trampas Winkler (Bestelmeyer et al. esto se puede hacer de manera sencilla.50 m². Se revisa manualmente la hojarasca y cada capa de monolito por separado. Se utiliza un transecto adicional de 20 x 2 m para muestrear las termitas. una charola de plástico grande de cocina. excavados de la zanja y la hojarasca pueden ser colectados. Si no hay mucho tiempo o si la luz es insuficiente (colectar en selva cerrada es difícil porque la luz disminuye muy temprano). Monolito TSBF Los procedimientos generales. La muestra de suelo en botes se debe guardar alejada del sol directo y deberá ser revisada antes de 24 horas. 10-20 cm y 20-30 cm. Primero se coloca un marco de 25 x 25 cm para marcar la posición del monolito y cualquier hojarasca o madera dentro de él es removida e introducida en una charola (Figura 3. Para la discusión del número y posicionamiento de monolitos.1a y 3. aunque es mejor si se muestrea la hojarasca delimitada por marcos dispuestos en una línea paralela. hay que meter la muestra en un bote de 19 L y llevarla al laboratorio.1c y 3. Este transecto también puede ser utilizado para hormigas y escarabajos.1b). en su mayor parte. la anchura aproximada del monolito más dos anchuras de zanja. utilizando un machete o parang tomado de forma horizontal y agarrado por ambos lados. con la adición de trampas pitfall (Swift y Bignell. Se divide el bloque del monolito en tres capas. véase el capítulo 2. serán milpiés y lombrices de tierra con bajas densidades de población.

las pequeñas ramas deberán romperse y ser golpeadas en la charola para que se desprenda cualquier insecto que contengan. termitas y escarabajos colectados. en la que se anotan los datos siguientes (con lápiz o tinta indeleble. Las hormigas pueden ser extraídas tomando un puñado de suelo. al igual que obreras. generalmente. no usar bolígrafo o pluma): • Fecha y clave de identificación del lugar.). La información es importante para establecer la naturaleza de los organismos encontrados (especialmente la diversidad de grupos funcionales) y para construir una curva de acumulación de especies. se conservan en formol (formaldeído) al 4% para evitar la supuración de la mucosa. Las lombrices de tierra y moluscos. el periodo destinado deberá incluir el tiempo para el llenado de la etiqueta. sin embargo. Las hormigas.2. como en el caso de un transecto. hojarasca. pasándolo a través de un tamiz de malla grande. en una charola. Se añadirá una etiqueta dentro del alcohol o formaldehído. cuando se hace la extracción durante un tiempo determinado. • En el caso de transectos o monolitos alineados. • El microhábitat en cuestión (madera nueva. Se deberá utilizar un tubo o frasco por cada especimen o población encontrada (o colonia aparente). en el caso de las termitas. suelo de raíz de árbol. etc. madera seca. Protocolo de muestreo alternativo para evaluar la abundancia y diversidad de lombrices de tierra en ecosistemas tropicales Introducción Este protocolo alternativo combina el llamado monolito de suelo TSBF (25 x 25 x 30 cm) y tres grandes monolitos (50 x 50 x 20 cm) para evaluar la abundancia y diversidad de lombrices de tierra a nivel local y de paisaje en ecosistemas tropicales. se incluirán soldados. El tamiz retiene las hormigas que pueden ser aspiradas. deberán preservarse en alcohol al 80%. Se diseccionarán los pedacitos de madera en diferentes piezas para ver si hay termitas. Para evitar confusión en lugares ricos. madera podrida. las etiquetas deberán escribirse en el momento en que los especímenes sean introducidos en los tubos o frascos. el número de la sección en el transecto en donde se encontró el espécimen (1. 94 Manual de biología de suelos tropicales . montículo.3 ó 4). suelo.revisión. de 5 mm. las etiquetas se pueden hacer cuando se ha completado la extracción en cada sección del transecto. En otros casos. hormigas o escarabajos.

por lo menos. (2002) y Mathieu et al. 2004). la mayoría de los estudios sobre lombrices de tierra han sido elaborados utilizando el método TSBF (Anderson e Ingram. (1995). (1994. véase Gilot et al. un monolito cuadrado de suelo de 25x25 cm y de 30 cm de profundidad. A B C D Nota: las ilustraciones A y B muestran la colocación de un marco de madera para delimitar el monolito y la limpieza de hojarasca suelta. cinco monolitos por parcela bajo estudio. véase Bhadauria et al. antes de muestrear el monolito. Dlamini y Haynes (2004) para el muestreo de lombrices de tierra en África. los monolitos se distribuyen a lo largo de un transecto corto (40 m) con. siendo la unidad de muestreo. Haymes et al. La ilustración C muestra un monolito grande (50 x 50 x 30 cm) y la D un monolito pequeño (25 x 25 x 30 cm) y la excavación de la zanja. 1993) para macroinvertebrados. satisface el requerimiento de rapidez y la necesidad de tomar en cuenta la heterogeneidad del suelo a nivel parcela. Barrios et al. M acrofauna 95 . En todos los casos. Por más de una década. (2000) para Asia y Decaëns et al. para ejemplos de América del Sur.Figura 3. (2004). (2003).1 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm).

Decaëns y Jiménez. (1999) y Agosti et al. bajo diferentes prácticas de manejo de suelo (Fragoso et al. Se seleccionan cinco puntos de muestreo al azar. Eggleton et al. 1997. que combina pequeños y grandes monolitos. por ejemplo. pero consumen mucho tiempo y resultan tediosos. Tal avance será crucial para desarrollar indicadores de degradación de suelo (Moreno y Halffter. (2000). cubriendo grandes áreas.. 1998) porque las lombrices de tierra son reconocidas por presentar sensibilidad ante la perturbación antropogénica (Fragoso et al. 2002). 2005). el reto será desarrollar un protocolo de muestreo rápido para muestrear a nivel paisaje. el muestreo debería realizarse al final de la temporada de lluvias. Protocolo de muestreo De manera ideal. aunque pocas investigaciones se han enfocado a la evaluación de la abundancia y diversidad de lombrices de tierra en paisajes agrícolas. 2002). Recientemente. Se pueden usar argumentos similares para justificar un muestreo más extensivo de lombrices de tierra. Fragoso et al. ha sido reportada para monitorear la dinámica de población de la lombriz peregrina Hyperiodrilus africanus (Tondoh y Lavelle. Vincent. 2005).. 2001. la carencia relativa de centros de colonias y su distribución altamente parchada. 1969. Este esquema de muestreo estratificado. se estudió la demografía de lombrices de tierra. utilizando grandes monolitos de suelo de 1 m² x 40 cm de profundidad. Lavelle. Originalmente. Decaëns y Jiménez. cuando se sabe que las lombrices de tierra son más activas (Tondoh y Lavelle. Burel et al. 1999. Como las prácticas agrícolas contemporáneas muestran un mosaico de tipos de uso de suelo. Las lombrices de tierra son colectadas a mano.. 10-20 cm y 20-30 cm. en cada tipo de uso de suelo. aunque pequeños monolitos han sido utilizados con éxito para identificar cambios importantes en la diversidad de lombrices de tierra a nivel parcela. en cada punto de muestreo se extrae un pequeño monolito de 25 x 25 x 30 cm que se rebana en tres capas: 0-10 cm. debido a su especificidad de grupo funcional. han propuesto protocolos de muestreo más exhaustivos para muestrear termitas y hormigas. una combinación más eficiente de 100 x 100 x 40 cm para grandes y de 25 x 25 x 30 cm para monolitos pequeños de suelo. Los monolitos de tamaño medio (50 x 50 x 40 cm) fueron utilizados por Ortiz-Ceballos y Fragoso (2004) para evaluar el impacto de una cobertera en poblaciones de lombrices de tierra. 1978). permite tomar en cuenta la variación a 96 Manual de biología de suelos tropicales .A pesar del éxito relativo del método TSBF para estimar la abundancia y diversidad de los macroinvertebrados del suelo. respectivamente. 1997.

mientras la variación a nivel paisaje se hace con un muestreo en los usos de suelo más representativos. M acrofauna 97 . perpendicular a la pendiente.2. cuando se considere apropiado (TSBF modificado. 2005). se extraen tres grandes monolitos de 50 x 50 cm y de 20cm de profundidad. Anderson e Ingram. en intervalos de 5 m. El transecto aparece representado esquemáticamente en la Figura 3.Figura 3. las lombrices de tierra son muestreadas. 1993).2 Esquema de alineación de monolitos complementarios de lombrices de tierra. de acuerdo con el procedimiento de TSBF (Anderson e Ingram. a lo largo de un transecto. Monolitos adicionales son extraídos para poder tomar en cuenta la heterogeneidad a nivel de la parcela. Cada monolito mayor se separa en dos capas (0-10 y 10-20cm) y no en tres. 1993). Las lombrices de tierra se colectan a mano (Figura 3. Los individuos después son identificados. De manera adicional. con un punto de partida elegido al azar. como en los pequeños monolitos. contados y pesados. En cada punto seleccionado. Monolitos grandes (50x50x20 cm) Monolito pequeño (25x25x30 cm) nivel parcela de las poblaciones. porque la mayoría de los especímenes (57-99%) son localizados en los primeros 20cm durante la temporada de lluvias (Tondoh y Lavelle.3) y son almacenadas en una solución de formol al 4% para su posterior identificación.

1995. Sims e Easton (1972). pueden ser identificados a nivel de familia. cuando sea necesario. que se encuentran distribuidas en toda la región tropical. 1987) y Csuzdi (1996) y. La abundancia de lombrices de tierra se estima 98 Manual de biología de suelos tropicales .3 Separación a mano de lombrices de tierra en charolas de plástico. Para las especies africanas de Eudrilidae y Acanthodrilidae (Benhamiinae) se pueden utilizar las revisiones de Sims (1980. son identificables a nivel especie utilizando las guías y descripciones dadas por Blakemore (2002). Zicsi. 2001. las especies nativas requieren de la pericia específica del país. Fragoso y Rojas-Fernández. 2005) son los principales puntos de referencia. no existen a la fecha monografías disponibles para la identificación de lombrices de tierra de América Central y América del Sur. utilizando las claves desarrolladas por Blakemore (2005). Identificación de lombrices de tierra y estimaciones de su abundancia Especímenes de lombrices de tierra. 1994. 1971. Desgraciadamente. Para la identificación de lombrices de tierra de la India y del Sureste de Asia. Las especies de lombrices de tierra peregrinas comunes. Easton (1979) y Julka (1988) son las apropiadas. las monografías de Gates (1972). la revisión de Eisen (1900) y estudios seleccionados de varios autores (Righi. debido a la carencia de guías comprensivas para su identificación. previamente agrupados como morfoespecies. se debe consultar la descripción original de especies.Figura 3. por lo tanto. sin embargo.

Lombrices endógeas: de tamaño medio. 1997). a nivel de la superficie del suelo. Dentro de un ecosistema dado. se lleva a cabo mediante la identificación en cada tipo de uso de suelo de especies nativas y exóticas o peregrinas. Lavelle 1983. 1983. Desde el punto de vista ecológico. en cada tipo de uso de suelo. Fragoso et al. 2. Fragoso et al. El segundo nivel de diversidad taxonómica trata de la biogeografía de lombrices de tierra (Fragoso et al. las comunidades de lombrices de tierra pueden dividirse en tres grupos (Bouché. El aspecto funcional de la diversidad resulta de gran interés para evaluar la relación entre diversidad y servicios del ecosistema. no pigmentadas y que viven dentro del suelo. Lavelle. mientras que las especies exóticas son. 1997. Blanchart et al. Se pueden utilizar tres categorías de expresión de la riqueza de especies: 1) el número de especies registrado en todos los monolitos.. M acrofauna 99 . 2) la diversidad promedio expresada en términos de la media de número de especies por cada tipo de uso de suelo y 3) el índice ShannonWiener de diversidad (Pielou.. La diversidad de lombrices de tierra se estudia en dos niveles complementarios: diversidad taxonómica y funcional (Bouché. 1981): 1. 1996). 1997). La relación nativas vs exóticas puede utilizarse como un índice para calcular la extinción de especies nativas o como un claro indicador de la invasión de especies exóticas o peregrinas. Como resultado de su actividad. 1977). La estructura de las comunidades de lombrices de tierra puede ser caracterizada por la densidad y biomasa de lombrices nativas y exóticas La importancia de la diversidad funcional en las lombrices de tierra ha sido ampliamente documentada (Lavelle. 1987). éstas han sido llamadas peregrinas para indicar su amplia distribución a niveles regionales y continentales (Lee. en casi todos los casos. regional y continental. con este enfoque. Los servicios que proveen las lombrices de tierra al ecosistema se relacionan con el impacto de su actividad en el sistema de suelo (Lavelle et al. 1977.como el número de individuos por m² y la biomasa como g de individuos por m². El primer nivel de diversidad taxonómica trata del número y de la identidad de especies de lombrices de tierra.. 1997). producen excretas dentro del perfil del suelo y sobre la superficie. Especies nativas son las caracterizadas por una distribución restringida a nivel local. dos grupos de lombrices de tierra pueden ser distinguidos de acuerdo con su origen: especies nativas o exóticas.. El análisis de comunidades de lombrices de tierra. con pigmentación y que viven en la hojarasca. Lombrices epígeas: de tamaño pequeño. introducidas por interferencia humana... 1977. 1997 y Lavelle et al.

se basa en un transecto de 100 m. tal y como se describe y desarrolla más adelante. presentan una alta resolución.. aunque se ha acortado a 20 m en el protocolo estándar. ESCARABAJOS Y LOMBRICES de tierra Introducción Este método utiliza un transecto de 100. La mayoría de las lombrices de tierra que pertenecen a los tipos endógeos y anecicos son destacados ingenieros del ecosistema (Lavelle et al. tumba y quema. A las lombrices de tierra se les puede asignar una categoría ecológica o grupo funcional y posteriormente comparar dichos grupos con base en su densidad y biomasa. Sus actividades forman una red densa de túneles dentro del suelo. sin pigmentación y viven en el suelo. modificando así las propiedades hídricas y químicas del mismo. fue desarrollado para bosques o localizaciones recientemente derivadas como en la agricultura de roza. Lombrices anecicas: de tamaño grande. cinta métrica de 30 m o preferiblemente cuerda de nylon o mecate. Equipo requerido Brújula. marcada en secciones de 5 m. relativamente. aunque se considera que. para el proyecto CSM-BGBD y a 50 m en el esquema alternativo de muestreo (véase Capítulo 2). por lo que los transectos se tratan separados de los monolitos y de las trampas pitfall. Cada persona lleva un machete o parang afilado. 50 o 20 x 2m. una 100 Manual de biología de suelos tropicales .3. Los datos obtenidos son cualitativos (identificación y número de especies) y/o semi-cuantitativos (abundancia relativa de especies y/o grupos funcionales específicos). MÉTODOS DE TRANSECTO PARA TERMITAS. Este método se considera de bajo impacto y resulta idóneo para ser usado por aquellos que no son especialistas en termitas y puede ser completado en cada punto de muestreo por dos personas en un día (dos días para un transecto de 100 m). 1997) porque son activas mezclando y cavando el suelo. El método. y sigue las descripciones formales de Jones e Eggleton (2000). pero comen en la superficie. HORMIGAS. utilizando cinta naranja o amarilla fluorescente o a prueba de agua y un palo de 2 m. Swift y Bignell (2001).

a 15m de distancia.cuchara de albañil. Si la línea atraviesa un árbol. estrechas zanjas con arroyos o cortes en el dosel. el transecto se puede desviar hacia un lado. una charola de plástico o metal con reborde alto. el transecto puede incorporar otros fenómenos naturales del ambiente biótico que contribuyen a su heterogeneidad física. dirección del transecto con la brújula y cualquier cambio de dirección. pero los dos “brazos” principales de la línea del transecto deberán encontrarse. de manera simultánea. Un equipo de dos personas será capaz de muestrear entre 8 y 12 secciones por día (2 a 3 transectos). en cada sección de 5m. a una distancia suficiente para evitar cualquier perturbación durante el muestreo. Frecuentemente se necesita evaluar. Las líneas de transecto no necesariamente tienen que ser rectas. de modo subjetivo. No obstante. alrededor de 40 frasquitos de aproximadamente 1 x 5 cm. Se debe asegurar que las líneas de pitfall se mantengan sin perturbación en todo momento. ese tiempo podrá reducirse si se trabaja con varios equipos de dos personas. El tiempo requerido para realizar transectos de 20 m es de 30 minutos de muestreo por dos personas. En una parcela pequeña. un cuchillo de campo de hoja fija. siempre que no se crucen con ellas mismas. para poder replicar un monolito) los transectos deberán posicionarse para evitar interferencia mutua y separarse. pueden inclinarse para alcanzar ángulos de hasta 90°. por lo menos. Se coloca el transecto de manera que visualmente atraviese los alrededores de manera homogénea. El muestreo se estratifica por M acrofauna 101 . acantilados o caminos en uso que no sean hábitats adecuados para termitas. siempre que por lo menos una parte del sistema de raíces quede dentro de la cinta de muestra de dos metros de ancho. para evitar obstáculos naturales. Procedimiento Se traza una línea de transecto de 20. Es necesario anotar el punto de partida. cuando se trata de decidir sobre la línea ideal. se pueden colocar dos transectos de 50m (o de 10 m) para que queden en paralelo. especialmente en los casos de pequeñas parcelas. un transecto puede curvarse sucesivamente por dos ángulos de 90° para que corra hacia atrás hasta su punto de partida. de área basal muy grande. Si se emplean otros transectos en la misma parcela (por ejemplo. puede ser útil para picar madera o suelo. sin embargo. de alrededor de 8-10 cm. dos pares de pinzas. evitando grandes arroyos. tales como pendientes. con alcohol al 80% (se necesitarán más para hábitats ricos en termitas). para evitar pisadas excesivas en un solo lugar. Alternativamente. 50 o 100 m junto al monolito. en diferentes secciones.

de 50 ó 100 m. La madera podrida. otros invertebrados. junto con sus cámaras centrales. Los siguientes micronichos son investigados con detalle: hojarasca y la superficie del suelo hasta una profundidad de alrededor de 5 cm. o cubierta de pedazos de suelo. También resulta de ayuda descansar unos minutos entre secciones. un transecto de entrenamiento. acumulaciones profundas de hojarasca y suelo entre grandes raíces que funcionan como retenedores. debería muestrearse la primera vez bajo la supervisión de un colector experimentado.4). madera en todas sus etapas de descomposición. Es imposible muestrear con lluvia fuerte. Idealmente. se recomienda completar no más de 12 secciones en un día. nidos de termitas o pistas de tierra en troncos de árboles y otra vegetación. esto ayuda mucho a ver las termitas (Figura 3. escarabajos y lombrices de tierra en nichos crípticos o cuando escasea la luz. El suelo. por lo tanto. El tronco de un árbol vivo puede ser investigado para ver si contiene túneles de termitas a una altura accesible. por esta razón y para poder minimizar la necesidad de tener que trabajar con escasa luz. nidos subterráneos epígeos y arbóreos y montículos de una altura de hasta 2 m sobre la superficie del suelo (incluyendo nidos de bolsitas suspendidos en la vegetación). la hojarasca y los restos de madera pueden diseccionarse rápidamente en charolas. Normalmente se requiere de un corto periodo de entrenamiento u orientación para que colectores sin experiencia puedan muestrear con la misma eficiencia que un experto. frecuentemente contiene termitas. por ello se permite interrumpir la labor 102 Manual de biología de suelos tropicales . En la mayoría de las localizaciones no es necesario colectar cada termita y las especies más comunes podrán ser ignoradas después de muestrearse inicialmente para poder buscar las formas más raras o crípticas o para buscar soldados en especies que tengan una relación relativamente baja de soldado/obrero (tomando en cuenta que algunas especies no tienen soldados). Los palitos deberán romperse en pedazos y golpearse moderadamente en las charolas para desplazar cualquier termita u hormiga que contengan. sin necesidad de usar una escalera o tener que trepar (alrededor de 2 m).nichos. Los pedazos más grandes de madera deberán cortarse tomando en cuenta que pueden estar infectados en alguna parte. posiblemente. sin olvidarse de las ramificaciones o de los helechos que pueden acumular suelo que contenga termitas. Los colectores deberán trabajar de manera constante (no frenética) en cada uno de los periodos de muestra de 30 minutos y tratar de mantener el mismo nivel de eficiencia de muestreo en cada sección del transecto. lombrices de tierra y. es aconsejable comprobar la periferia y la base de la estructura. Otras especies pueden habitar montículos y nidos o podrán coexistir con los que están construyéndolos. incorporada en el suelo de superficie.

se puede usar un pincel de artista humedecido con alcohol para depositar el espécimen en el frasco colector. En los transectos donde se encuentran pocas termitas. para dividir cada sección en dos subsecciones de 2. el otro examina el suelo y las raíces de los árboles. Se recomienda que el suelo se extraiga en. por ejemplo. previo acuerdo. en lo posible. hasta que mejoren las condiciones climatológicas. a pesar de que se trate de una pequeña cosecha. contener soldados y obreros. una docena de lugares separados en cada sección del transecto.5 x 2 m. Nota: las pinzas finas son idóneas para atrapar insectos con cuidado. sin dañarlos. Alternativamente.4 Extracción de termitas de una muestra de suelo en una charola de aluminio. es importante observar el protocolo de muestreo con precisión. sección a sección. El trabajo puede dividirse entre los colectores. Procesamiento de especímenes Los especímenes representativos de las termitas encontradas deberán ser preservadas en alcohol al 80% y. de manera que mientras uno muestrea la madera. en lados opuestos de la línea. Se debe destinar un tubo de especímenes para cada población (o colonia aparente). en el M acrofauna 103 . por lo menos. Esto dependerá de la naturaleza del lugar y de la topografía. cada persona trabaja en una cinta de un metro de ancho.Figura 3. sin interrumpir el trabajo.

Lo anterior hace que el procesamiento sea más eficiente. Al tratar cada sección de 5 m. los treinta minutos para el trabajo deberían incluir el etiquetado. por lo que se podrán leer con mayor facilidad. suelo a raíz de árbol). 3. lo que facilitará el trabajo. utilizando una impresora láser. que se cortarán y pegarán en una libreta de campo. los siguientes datos: • Fecha y clave del transecto. Para evitar la confusión. se deberán escribir las etiquetas (o las notas de campo) tan pronto como se hayan colocado las termitas en los tubos de especímenes. sin embargo. como una muestra independiente. reduciendo así las posibilidades de cometer errores en la numeración. Alternativamente. se podrá construir una curva de acumulación por especies basada en especímenes o simplemente por especies. montículo. todas las etiquetas seguirán el mismo patrón. donde se anotan. Las termitas deberán separarse en unidades taxonómicas reconocidas. razón para destinar un mínimo de dos días a cada transecto de 100 m (proporcional para transectos más cortos). el mismo día en que son colectados o tan pronto como sea posible. suelo. • El micro hábitat en cuestión (madera fresca. Los especímenes pueden resultar dañados o afectados en su color por el suelo o basura contenido en el frasquito. con pluma o bolígrafo.). Todas las notas de campo se guardan en la libreta y. En otros lados. al completar cada sección del transecto. en el campo únicamente se añaden las etiquetas a los frasquitos y se toma nota en la libreta de campo de los números por sección y del transecto. Se generan diez secuencias al azar de las secciones por 104 Manual de biología de suelos tropicales . madera seca. los números de las etiquetas estarán relacionados. con lápiz o tinta indeleble y no. en lugares ricos en termitas.cual se introducirá una etiqueta. se añade alcohol fresco y se escriben las etiquetas nuevas). por lo tanto. para los taxónomos expertos. • Número de sección en el transecto donde se encontró el espécimen (1. hojarasca. madera podrida. etc. se podrán imprimir etiquetas numeradas. se podrán escribir etiquetas o notas. 2. en orden secuencial. La información referente al micronicho en donde se encuentra cada espécimen es importante para poder establecer la naturaleza de la comunidad de termitas (especialmente la diversidad funcional del grupo) y para construir una curva de acumulación de especies. por morfoespecies o especies nombradas. razón por la cual deben limpiarse lo antes posible (se separan las termitas del suelo o de la hojarasca.

género y especie. tales como Jackknife de primer orden y Jackknife de segundo orden. trabajando desde niveles altos como órdenes hasta familia. pero esto muchas veces no es posible para algunos grupos de organismos de suelo. También es importante que las morfoespecies “A”. en el lugar 2. finalmente. debería subir y posteriormente inclinarse. La colección entera deberá ser preservada durante un tiempo después de la identificación para su posterior confirmación y se debe de depositar. Las muestras y los especímenes necesitan ser etiquetados y organizados cuidadosamente. lo que resulta muy laborioso en términos de tiempo. entre otros (Magurran. será identificar cuáles son las que están presentes en la muestra. un subjuego en una colección de una institución nacional. la identificación consiste en la determinación de la posición de un espécimen en la clasificación existente. Lo ideal sería que todos los especímenes fueran identificados hasta especie. el resto. se calcula la media acumulativa de especies de los diez juegos de 20 secciones para cada sección y se construye una curva de acumulación de especies. Identificación El primer paso para compilar una lista de especies y organizar los datos del ensamble de las especies encontradas. Chao y ACE. parcialmente compuesta por especies identificadas y. Las especies y morfoespecies encontradas por transecto pueden ser desde sólo unas cuantas hasta más de 50. sin reemplazo. para cada selección de las diez secuencias. dependiendo del lugar y de la región biogeográfica. 2004) que son implementados por el software libre EstimateS (Colwell. Una manera más realista sería obtener la lista final. es importante utilizar el mismo esfuerzo de identificación y métodos. El número de especies encontradas en cada sección se usa para calcular el número acumulativo de especies. normalmente requiere una pericia taxonómica alta. en un museo. se identificaría a nivel género y. o bien. en el lugar 1. de manera permanente. se separaran en morfoespecies. Cuando se comparan datos de diferentes hábitats o localidades. La riqueza específica del lugar puede ser estimada utilizando métodos de extrapolación. sean las mismas que “A”. 2000. es decir. Una curva ideal debería ser asintótica.medio de un trazo (en cada secuencia) de 20 secciones al azar. La identificación de organismos de suelo. M acrofauna 105 . Una taxonomía pobre podría resultar en una baja o sobreestimación de diversidad y similitud de especies y hacernos llegar a establecer conclusiones erróneas. 2004). a nivel especie. indicando que se encontrarían pocas o nuevas especies con transectos adicionales en el área.

por ejemplo. No obstante. será el Código Internacional de Nomenclatura Zoológica (Comisión Internacional de Nomenclatura Zoológica. Los paréntesis.Los métodos comunes de identificación de la fauna del suelo incluyen: a) uso de claves de identificación publicadas. c) comparaciones con colecciones de referencia y d) envío de especímenes a un experto taxónomo. Nota que las abreviaciones “sp” y “cf” no aparecen en cursivas. los Códigos de Nomenclatura contemplan reglas muy estrictas de formato para nombrar autores. En el caso de animales. 1999). por lo tanto. Tal abreviación se usa para indicar que la identificación es incierta. se utilizan con la misma connotación o de manera similar. El formato de los nombres deberá seguir el código respectivo de nomenclatura. b) comparaciones con descripciones. a modo de rutina. A y Termes sp. hormigas y escarabajos en el apéndice 1 y listas más especializadas en las publicaciones 106 Manual de biología de suelos tropicales . y para bacterias. (abreviación del latín confer. similis. La Tabla 3. el Código Internacional de Nomenclatura Botánica (Greuter et al.1 presenta un ejemplo de una lista de especies. B fueron identificadas únicamente a nivel género y morfoespecie. ocasionalmente. aunque frecuentemente se recomienda. lo cual generalmente resulta más práctico que un “orden taxonómico” subjetivo. tienen un significado y su uso se determina de acuerdo con las reglas de nomenclatura. para grupos de organismos diversos o poco conocidos. Se utilizan. fueron identificadas plenamente a nivel especie. Otras abreviaciones. pero no es obligatorio. de manera particular. Termes sp. Consulta un catálogo taxonómico que te permita comprobar la validez y cómo se deletrean los nombres. Se muestran tres niveles de identificación. La abreviación “cf” en el caso de Coatitermes y Armitermes. para plantas. compare). si existen. excluyendo animales. Se trata de una lista organizada en orden alfabético. N. el Código Internacional de Nomenclatura de Bacterias (Sneath. que deberán ser respetadas: los géneros y especies se imprimen en cursiva. El dato de autor y año de publicación no forma parte de un nombre de especies y su uso es opcional. El paréntesis que abarca el nombre de los autores indica que la especie fue originalmente descrita en otro género y después se transfirió al género actual. técnicas moleculares para la identificación de microorganismos. nunca se deben utilizar nombres manuscritos no publicados. Lista de guías y catálogo de identificación Se puede consultar una lista integrada de claves de identificación para termitas. 2000). 1992). corniger y N.

2 Angularitermes sp. 16 Angularitermes sp.1 Ejemplo de lista de especies. 17 Angularitermes sp. peruanus Caetetermes taquarussu Constrictotermes cavifrons M acrofauna 107 . 7 Angularitermes sp. 5 Angularitermes sp. 8 Angularitermes sp. No. 18 Angularitermes sp. 13 Angularitermes sp. 14 Angularitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Kalotermitidae Angularitermes nasutissimus Angularitermes sp. 4 Angularitermes sp. 11 Angularitermes sp. 9 Angularitermes sp.Tabla 3. 19 Araujotermes nanus Armitermes holmgreni Armitermes minutus Armitermes teevani Atlantitermes osborni 1 1 1 13 9 13 46 2 2 1 15 7 1 1 1 1 1 2 2 6 1 7 3 4 1 3 1 2 1 1 5 1 1 1 1 1 4 14 1 6 1 6 25 8 1 1 2 19 20 3 1 9 4 10 71 47 3 10 1 2 16 7 1 3 Armitermes cf. Angularitermes sp. 15 Angularitermes sp. 10 Angularitermes sp. 1 Angularitermes sp. 12 Angularitermes sp. 3 Angularitermes sp. 6 Angularitermes sp.

I 5 1 10 9 10 1 22 4 1 1 1 3 85 1 6 29 1 35 6 1 89 4 2 8 3 2 7 4 1 10 7 1 18 2 2 3 15 1 12 17 21 1 56 29 6 2 11 1 9 1 5 29 1 1 2 16 1 1 1 37 19 1 Nasutitermes sp. No. J Nasutitermes surinamensis Nasutitermes unduliceps 1 Nasutitermes wheeleri Neocapritermes pumilis Neocapritermes sp. A Nasutitermes sp. Curvitermes odontognathus Cylindrotermes flangiatus Cylindrotermes parvignathus Embiratermes parvirostris Heterotermes tenuis Labiotermes psilus Microcerotermes strunckii Nasutitermes callimorphus Nasutitermes corniger Nasutitermes gaigei Nasutitermes guayanae Nasutitermes octopilis Nasutitermes sp. Neocapritermes talpa 1 2 6 1 1 1 108 Manual de biología de suelos tropicales .Tabla 3. Especie Selva Barbecho Cultivo Agroforestal Pastizales 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 Coptotermes testaceus Cornicapritermes mucronatus Cornitermes pugnax Cornitermes sp.1 Continúa.

2 Ruptitermes sp.4 1 5 2 2 1 3 8 7 471 50 39 2.91 .3 50.1 25. 3 Subulitermes baileyi Subulitermes microsoma Syntermes molestus Syntermes spinosus Syntermes territus Termes hispaniolae Termes medioculatus Triangularitermes sp. 3 Triangularitermes triangulariceps Velocitermes sp. No.80 .04 .3 17.2 18.1 3 119 15 10 2.3 52. 1 6 8 1 1 1 2 1 1 1 2 3 9 3 6 5 1 1 5 1 1 1 9 9 259 52 20 3.Tabla 3.6 4 Muestras Especies Transectos Índice Shannon(H) Índice Simpson Rarefacción (100 muestras) Estimación de Chao 86.8 72.80 14.7 Estimación de Jackknife 1 74.4 3 2 1 229 35 18 2.01 .1 Continúa.6 81. Planicapritermes planiceps Rhinotermes hispidus Rhinotermes marginalis Rotunditermes bragantinus Rugitermes sp.90 26.90 25. 1 Ruptitermes sp.3 25.4 M acrofauna 109 . Ruptitermes sp.81 14.41 0.8 203 18 13 2. Especie Selva Barbecho Cultivo Agroforestal Pastizales 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Neocapritermes taracua Neocapritermes villosus Obtusitermes sp.96 34.

Las termitas pueden colocarse dentro de las siguientes categorías tróficas: • Las que se alimentan del suelo. Existe también una “literatura gris” extensiva de reportes de talleres. pueden consultarse en la lista de literatura. es necesario extrapolar de la muestra y utilizar estimaciones comparables de la diversidad local. desde muestreo en campo hasta identificación y análisis de datos. en relaciones ecológicas actuales. por ende. Los ensambles pueden o no. con un grado de selección de limos y fracciones de ar110 Manual de biología de suelos tropicales . pues dichos ensambles son delimitados por una clasificación taxonómica basada en historia y filogenia y no. Interpretación de resultados Los ensambles de especies son grupos de especies relacionadas taxonómicamente. formar un grupo funcional (GF) uniforme y su composición también puede verse afectada por los métodos de muestreo utilizados. la cual se puede definir y estimar por varios métodos. El mejor enfoque para identificación. cuentan con sus propios manuales. varían entre el taxa y entre regiones. otra información puede ser obtenida del transecto. será el entrenamiento o bien que el procesamiento de especímenes esté a cargo de un taxónomo con experiencia. pero este término no es correcto.taxonómicas para termitas. conferencias y documentos producidos por proyectos de desarrollo internacional sin una distribución global. junto con su calidad. Aunque la información básica generada es la de riqueza especifica. Si los detalles bibliográficos no están incluidos en la tabla. por lo tanto. esto se obtiene como resultado de la anotación del número de especies y morfoespecies. antes de tomar las muestras. La caracterización de un ensamble de especies involucra varios pasos. la capa de hojarasca orgánica y/o montículos epigeos se alimentan del suelo mineral. Las termitas distribuidas en el perfil de suelo. Algunas veces se refieren a “comunidades de especies”. por lo que muchos museos o instituciones científicas dedicadas a la taxonomía y conservación de la biodiversidad. la disponibilidad de claves adecuadas publicadas. en los apéndices 2 y 3. Casi siempre la muestra no contiene todas las especies presentes en el hábitat. los cuales no están disponibles para el público en general. Los ensambles de diferentes hábitats o localidades pueden compararse con varias estimaciones o índices y agruparse de acuerdo con sus similitudes. Una de las principales propiedades de un ensamble es “la diversidad de especies”. que se centran en una sola región. Invariablemente. al final del presente capítulo. aparentemente. de un hábitat o área geográfica específica. Lo más importante es la diversidad funcional del grupo.

Esta categoría sigue la lista de alimentación de termitas de acuerdo con Wood (1978). pero no en la misma categoría de “alimentadores de madera podrida”. Este grupo incluye algunos Macrotermitinae subterráneos y constructoras de montículos y otras Nasutiterminitinae y algunas otras que se alimentan en la superficie del suelo. Las termitas de alimentación especializada o incidental. algas. Este grupo incluye termitas con nidos arbóreos. Este grupo es sinónimo de “alimentadores medios” sensu DeSouza y Brown (1994). subterráneos o epígeos. Ruptitermes y otras especies de Constrictotermes en América del sur que se M acrofauna 111 . normalmente compuestas por obreros y soldados forrajeros.raíces. junto con por lo menos una termita inferior del sur de África Hodotermes mossambicus con un hábito similar. quedan proporciones más altas de materia orgánica del suelo y sílica. Las termitas que buscan hojas muertas. Las que forrajean la hojarasca (Termitas forrajeras). debajo de troncos o en suelo adherido a la superficie de troncos en estado de putrefacción. todavía unidas del árbol viviente y árboles muertos en pie. reconocida por Collins (1989). o mezclada con hojas podridas en complejos de limo . Las que se alimentan del suelo y de madera. todos menos los que se encuentran en una fase de descomposición terminal. que pueden volverse centros de colonias. al igual que otros que se han caído y se conservan aún frescos. El término “madera” incluye ramas muertas. provenientes de pasajes subterráneos o la formación de columnas descubiertas de individuos. Las termitas que se alimentan de madera y que cavan túneles en piezas más grandes de madera. la cual se ha vuelto fácilmente desmenuzable y que se asemejan al mismo suelo o que predominan dentro del suelo. Aunque el material digerido es altamente heterogéneo..• • • • cilla. normalmente cortan el material antes de consumirlo o lo llevan a sus nidos. Las que se alimentan de madera. incluye especies que se alimentan de hongos. o bien. 1996). Las termitas que se alimentan de madera muy podrida. Este tipo de termita forrajera usualmente es más conspicua que otros tipos alimenticios. y menos tejidos de plantas reconocibles que en otros grupos (Sleaford et al. Hospitalitermes hospitalis en el sureste de Asia. pastos vivos o secos y pequeños pedazos de madera. briofitas y líquenes en la corteza de los árboles (por ejemplo. pero que se alimentan en otro lado y muchas Macrotermitinae que cultivan jardines de hongos. por razones de las numerosas galerías o placas de suelo que construye encima de la madera. hojarasca y superficie del suelo y porque hace agujeros que se abren en la superficie.

la mayoría de la Apicotermitinae se alimentan de suelo o de suelo y madera). 1997. aunque el excremento se puede considerar como forma de basura descompuesta) y también ciertas habitantes secundarias de montículos de termitas que se alimentan de los forros hechos de rica materia orgánica. las Macrotermitinae no se alimentan del suelo. la ausencia de soldados (generalmente indica las que se alimentan del suelo) y la afiliación taxonómica (por ejemplo. Las termitas cuyos centros de colonia normalmente se concentran en troncos muertos o árboles en pie. según las siguientes categorías: • Las que anidan en madera. aunque ninguna especie es realmente fitófaga. especialmente bajo condiciones desfavorables. encontrada en las cámaras interiores como inquilinas obligadas (Por ejemplo: Ahamitermis y Incolitermis. en África oeste y central. una aproximación útil se obtiene dividiendo las especies en “alimentadas de suelo” o geófagas (alimentadas de suelo. • Las que anidan de manera hipogea. otros aspectos biológicos como el lugar donde anidan (las que anidan en árboles normalmente no se alimentan de suelo). de manera similar. Algunas veces la madera muerta es gradualmente reemplazada por material acartonado o por panales de hongos. Algunas termitas también se alimentan de tejido de planta viva. suelo. generalmente. Inquilinitermes. Ophiotermes y Tuberculitermes. y suelo y madera) como las definidas arriba. Si se dificulta la selección de un grupo funcional. 1970. Eggleton y Bignell.Gay y Calaby. en Australia. La identificación del grupo funcional puede hacerse de acuerdo con el color abdominal en especímenes vivos (las alimentadas de suelo y suelomadera son más oscuras). Las categorías no son mutuamente excluyentes y muchas especies toman sus alimentos de por lo menos dos fuentes diferentes. el lugar de su descubrimiento (en madera.). Termitas cuyos centros de colonia quedan bajo el suelo. incrementa las proporciones de otros grupos funcionales. La forma de distribución de dichas categorías indica la estructura de la comunidad de termitas. Los centros son pocos definidos y amorfos (especialmente en 112 Manual de biología de suelos tropicales . y “las que no se alimentan de suelo” (todas las demás). pero la perturbación o un periodo de secas. etc. las comunidades de selva son frecuentemente dominadas por las que se alimentan de suelo.alimentan de líquenes). las que se alimentan de excrementos o las carroñeras de cuerpos de vertebrados (probablemente consumidos oportunamente. que habitan dentro de los nidos de Constrictotermes). es posible comparar ensambles de termitas en base a tipos de nidos.

• Montículos epigeos. con estructura interna poco obvia.los Apicoterminotenae que no tienen soldados). Estos montículos. pero con una tendencia a volverse más irregulares con el paso del tiempo por razones de erosión. Figura 3. En la mayoría de los casos. Termitas cuyos centros de colonia se sitúan arriba del suelo. Nidos que se sujetan a árboles y que se localizan en diferentes alturas. M acrofauna 113 . adiciones y ocupación por parte de habitantes secundarios. • Montículos arbóreos. hechas de acuerdo con especificaciones típicas de la especie. normalmente están bien definidos y constituyen estructuras altamente complejas. que se forman por sí solos o que se asocian con los contrafuertes de los árboles. usualmente construidos con material de apariencia acartonada (cartón).5 Ejemplo de curva de acumulación de especies con una desviación estándar. utilizando permutaciones de datos al azar. aunque algunas forman nidos subterráneos complejos (por ejemplo Marcotermitinae). pero excluyen montículos arbóreos. Este grupo incluye especies que son habitantes secundarias facultativas de montículos epigeos. estos nidos están conectados con el suelo mediante pistas cubiertas que pueden ayudar a distinguir algunos nidos de termitas arbóreas de los de hormigas.

Para más análisis estadísticos. el de correspondencia (AC) y el de co-inercia pueden ser útiles para determinar factores que afectan la densidad y la diversidad de lombrices de tierra. hasta 500 veces. muestra. en el caso de lombrices de tierra. se establece la comparación de la media del índice Shannon-Wiener. tiempo (o persona por tiempo). En el caso de un esfuerzo de colecta grande. se pueden obtener utilizando permutaciones (reiteraciones) de los datos al azar (Figura 3. Otro método será normalizar la densidad y la biomasa de las lombrices de tierra antes de llevar a cabo el análisis paramétrico de varianza (ANOVA). tales como el de componentes principales (PCA). en relación con el número de unidades de muestreo. tienen diferentes sig114 Manual de biología de suelos tropicales . producción de excretas por cada tipo de uso de suelo. mediante la prueba Fisher. 2000).5) u otros métodos que normalmente requieren de programas computacionales especializados. Aunque algunos autores consideran estos nombres como sinónimos. Las curvas de acumulación de especies pueden ser obtenidas reiterativamente mediante remuestreo al azar de los monolitos de suelo o por secciones de transectos.. con desviaciones estándar. en todos los paisajes agrícolas (Thioulouse et al. UTILIZANDO EL MÉTODO WINKLER Introducción Las hormigas pueden clasificarse en grupos funcionales o gremios. La forma más simple de estas curvas es conocida como la curva del colector. en la secuencia en que fueron anotadas en el campo. La prueba Kruskal-Wallis ANOVA puede utilizarse para probar si existe un efecto significativo de los tipos de uso de suelo en relación con la abundancia de lombrices de tierra. utilizando el software de EstimateS versión 6. Las curvas más sofisticadas. HORMIGAS. es únicamente una gráfica del número de especies acumuladas. 1997). la curva es asintótica y tiende a inclinarse. con un 5% de nivel de probabilidad. trampa. La relación entre abundancia de lombrices de tierra y el índice de uso de suelo se comprueba utilizando regresiones.0b1 (Colwell. número de especies y.Curvas de acumulación de especies Las curvas de acumulación de especies son gráficas que representan la relación entre el esfuerzo de muestreo y el descubrimiento de las especies en un hábitat o región. Los análisis de multivariados. o área. El esfuerzo de muestreo puede ser medido por espécimen. OTRA MACROFAUNA Y MESOFAUNA EN HOJARASCA.

que pueden coexistir con la dominante Iridomyrmex spp. Eurhopalothrix spp. en su mayoría. mientras que los grupos funcionales se refieren a especies que utilizan estrategias similares para explotar el recurso y pueden estar formados por más de un gremio.nificados: los gremios son un grupo de especies que utiliza el mismo tipo de recurso para su supervivencia (Terborgh y Robinson. Aphaenogaster spp. Meranoplus spp. • Especies oportunistas: escasamente competitivas.) muestran adaptaciones fisiológicas.)... Paratrechina spp. Crematogaster y Pheidole.). se recomienda utilizar el de Andersen (1997). • Especies forrajeras solitarias de tamaño relativamente grande: predadoras solitarias que manifiestan muy poca interacción con otras especies de hormigas (especies dentro de los géneros Myrmecia. • Especies subordinadas asociadas: incluyen. las pertenecientes al género Camponotus. • Especies dominantes: especies muy abundantes y agresivas que influyen sobre la distribución y el comportamiento de otras especies de hormigas. • Especies generalistas myrmicines: especies que pertenecen al género Monomorium.. no especialistas y altamente competitivas. originalmente diseñado para hormigas australianas. y Notoncus spp. M acrofauna 115 . 2000). hormigas no especialistas que frecuentemente viven en ambientes perturbados (Rhytidoponera spp. • Especies especialistas en clima y suelo: estas especies (Melophorus spp. Aunque han sido varias las propuestas de esquemas de clasificación de grupos funcionales. 1986). morfológicas y de comportamiento que reducen su interacción con la dominante Iridomyrmex spp.. pues es la más usada en diferentes paises.. debido al tamaño relativamente grande de su cuerpo y a su comportamiento sumiso. son cosmopolitas. Ejemplo: Iridomyrmex spp. Los siguientes son ejemplos de gremios en la selva brasileña de la Costa Atlántica (Delabie et al. • Especies crípticas: especies de hormigas forrajeras que normalmente anidan bajo el suelo (en la capa de suelo y hojarasca). Bothroponera y Odontomachus).. de modo que minimizan el contacto con otras hormigas que no ocupan este hábitat (Brachyponera spp.

• Especies de hormigas legionarias: también conocidas como “formigas da correição”. • Especies de hormigas subterráneas: dependen de gotitas de aguamiel y comen secreciones de azúcar de otros insectos. b) verdaderas omnívoras: Brachymyrmex. Anochetus e Hypoponera. por ejemplo. es conveniente escoger las clasificaciones más cortas. por ejemplo. • Especies cultivadoras de hongos: especies que utilizan hongos simbióticos. Cyphormyrmex. forrajean toda la vegetación arriba de la superficie y en la hojarasca. • Especies de hormigas arbóreas dominantes: especies omnívoras que anidan en árboles. • Especies predadoras generalistas: especies que se alimentan de diferentes tipos de presas.• Especies omnívoras: especies que se alimentan de varias fuentes. se subdividen en dos grupos: a) predadoras generalistas grandes. para trabajo de campo práctico. Pachycondyla y Centromyrmex (inquilinas de nidos de termitas). Sericomyrmes y Trachymyrmex. Campanotus. normalmente miembros de Attini. Utilizan hojas frescas. son altamente agresivas y presentan una influencia competitiva sobre otras especies. Atta. Paratrechina. • Especies predadoras de suelo: especies que se establecen en el suelo y en la hojarasca. También existen otras clasificaciones funcionales. probablemente comedoras de larvas de termitas del género Syntermes (Delabie. predadoras especialistas que comen otras hormigas. ejemplos: Acromyrmex. Apterostigma. ejemplo: Odontomachus y Ectatomma. ejemplo: Azteca y Crematogaster. • Especies predadoras especialistas: especies que se alimentan de un solo tipo de presa. • Especies de hormigas dominantes en suelo u hojarasca: hormigas forrajeras de hojarasca y suelo o de la superficie. Solenopsis (especies grandes) y Wasmannia. carroña y restos de plantas para cultivar sus hongos. Mycocepurus. donde son forrajeras. 1995). ejemplo: Megalomyrmex. Pheidole y Solenopsis. Labidus (predadoras generalistas) y Neivamyrmex y Normamyrmex. ejemplos: Gnamptogenys (hormigas y otros insectos depredadores). la empleada en el taller CSM-BGBD (2005): 116 Manual de biología de suelos tropicales . son generalistas o especialistas dentro de las especies predadoras. ejemplo: Amblyopone (predadoras de termitas) y Thaumatomyrmex (predadoras de miriápodos) y Strumigenys (predadoras de colémbolos). incluyendo los restos de animales muertos. ejemplos: Eciton. Myrmicocrypta. ejemplo: Acropyga.

con un centro de colonia subterránea. como complemento o alternativa. Se recoge primero la hojarasca. Se coloca un frasco con alcohol al 70% en la base de la trampa Winkler. véase también el Capítulo 2). Este procedimiento permite separar la macrofauna pequeña y alguna de la mesofauna M acrofauna 117 . Se almacenan los especímenes en tubos cerrados y etiquetados. La fracción fina queda en el fondo de la bolsa del tamiz. con un centro de colonia subterráneo. junto a la coordenada GPS y al monolito (Ilustración 1. que se encuentra en. con un centro de colonia epigeo o arbóreo. estas redes se fijan dentro de la trampa Winkler. se mantiene la trampa durante por lo menos 72 horas. • Carnívoras (especialistas o generalistas). por lo menos. de manera que no escape ningún insecto. con el fin de maximizar la recuperación de los especímenes (Delabie. • Carnívoras (especialistas o generalistas). preferentemente colocados a lo largo de la línea de transecto. realizando movimientos laterales. 1999). con el centro de colonia epigeo o arbóreo. c) extraer las hormigas dentro de la trampa Winkler. se puede pasar la hojarasca burda por una malla de 2 mm. • Herbívoras. en alcohol al 70%. • Herbívoras. hacia arriba. lentamente las hormigas y otros insectos migran hacia afuera y se caen en el alcohol. ventilado y bajo condiciones ambientales. sobre una sábana blanca. cuando los Winklers no se encuentren disponibles. de manera que se puedan separar los fragmentos más gruesos. cerrado pero ventilado. Una vez en el laboratorio. posteriormente. • Herbívoras. junto con las hormigas y se transfiere a bolsas en campo. Se utiliza un marco para delimitar un área de un 1 m2 y se remueve la hojarasca a mano. con un centro de colonia en las capas superficiales de hojarasca. Esto debe hacerse con suficiente habilidad. Procedimiento de muestreo El procedimiento completo se lleva a cabo en tres fases: a) tamizar en campo para separa la hojarasca fina (con hormigas) de la materia más gruesa. Se tamiza cada muestra de hojarasca para remover pedazos grandes. con el centro de su colonia en las capas superficiales de hojarasca. trabajando desde el borde hacia el centro. conforme se seque la hojarasca. los cuales son colgados en un lugar cubierto. b) transportar al laboratorio dentro de una bolsa segura.• Carnívoras (especialistas o generalistas). con guantes de cuero. el contenido de las bolsas de campo se transfiere a redes. tres cuadrantes de 1 m2.

La lista completa de los materiales para la extracción con trampas Winkler (Bestelmeyer et al. tazas. • Bolsas de nylon. botellas de plástico. de esta manera. a prueba de insectos y mide 1. las cuales serán llenadas holgadamente con la hojarasca trasportada en las bolsas del campo y se colocaran en el centro de la trampa Winkler para dar paso a los invertebrados.5 m de largo. deberá ser pesada al final de la extracción. el cual contiene alcohol al 70%. en este caso. que entre dentro de una bolsa resistente de nylon o tergal. La hojarasca seca. 25 cm de ancho y 20 cm de profundidad central. de 25 cm de ancho y 37 cm de largo. • Tamiz de malla grande. • Redes. hasta el lugar donde se encuentren las trampas Winkler. de aproximadamente 34 cm de ancho x 55 cm de largo. tarros. latas. se pueden recolectar los especímenes de la sábana. después de limpiar la hojarasca suelta en el punto donde se va a colocar la trampa. 2000) es la siguiente: • Marco con una medida de 1 x 1 m de madera. Como variación de este método.. Se achica el fondo de la bolsa para que se pueda colocar un frasco de aproximadamente 200 ml de capacidad.50 m de largo. vasos. las cuales se usarán en campo para transportar el material tamizado. que se entierran de manera que la parte superior del envase quede exactamente al ras del suelo. se marca un límite de búsqueda de 30 minutos por cada metro cuadrado de hojarasca muestreada. utilizando un aspirador manual (pooter). dichas trampas están hechas de envases profundos relativamente pequeños. OTRA MACROFAUNA Y MESOFAUNA QUE SE ENCUENTRAN EN LA HOJARASCA: TRAMPAS PITFALL CON Y SIN CEBO Introducción Las trampas pitfall o de caída constituyen un método efectivo de recolección de muestras de los invertebrados meso y macro que viven en la hojarasca. plástico o aluminio para delimitar el área de muestreo. de aproximadamente 1. por ejemplo. contenida en la trampa Winkler. • La trampa Winkler consiste en una bolsa porosa de algodón o nylon.del material orgánico y. la parte superior del envase puede situarse a 1 cm más arriba de 118 Manual de biología de suelos tropicales . una por cada trampa. ESCARABAJOS. de alrededor de 5 mm.

arañas y otros arácnidos grandes tienden a dominar. hormigas. El diámetro más pequeño ofrece la ventaja de sufrir menos perturbación al momento de insertar la trampa. Una típica trampa pitfall puede observarse en la Figura 3. presentan algunas desventajas: sobre todo que no muestrean todos los grupos taxonómicos con la misma eficiencia (escarabajos.6. pero la trampa debe ser lo suficientemente amplia como para poder colectar un número razonable de especímenes y suficientemente profunda Figura 3. se encuentran dispuestas de manera lineal (para facilitar la instalación y el retiro) sufren la misma desventaja que los transectos. Las pitfall son baratas. por lo que se utilizan frecuentemente en los trabajos de inventario de la biodiversidad. Además. ahogándose en agua contenida en el fondo de la trampa. mientras que los insectos alados se escapan). colémbolos). al igual que a actos de vandalismo. de fácil instalación. se pueden utilizar específicamente para atrapar animales nocturnos.6 Esquema de una trampa pitfall con cebo. las dimensiones no son fundamentales. puesto que en ambas existe un alto grado de autocorrelación entre muestras adjuntas. de manera simultánea. la macrofauna y parte de la mesofauna (especialmente. M acrofauna 119 . Nota: frascos con diámetro de 10 a 20 cm generalmente son efectivos. Las trampas se colocan bajo cubierta para evitar que entre la lluvia y funcionan como colectores de artrópodos que viven en el suelo y que caen en el envase. normalmente. las pitfall son proclives a sufrir daños ocasionados por mamíferos y aves. No obstante.la superficie y se construye una rampa de suelo suelto a su alrededor. miriápodos. ortópteros juveniles. Las trampas pitfall no son cuantitativas y dado que. Las trampas normalmente se limpian y se recolocan una vez al día. éstas ofrecen ventajas adicionales: se puede muestrear.

éstos pueden ser improvisados en el campo. ésta descansará sobre palitos o clavos. una caja Petri de vidrio invertida. es lo ideal. 120 Manual de biología de suelos tropicales . Un aditamento usual a las trampas es un techo inclinado para protegerlas de la lluvia.7 Trampa pitfall improvisada.para impedir la fuga. Entre 1 o 2 cm de agua en el fondo y un poquito de detergente serán suficientes para ahogar o inmovilizar a la mayoría de los animales y el detergente contrarrestará las propiedades hidrofóbicas de muchas cutículas de artrópodos. Los clavos galvanizados o de madera son la mejor opción para elevar el techo hasta dos Figura 3. cuatro palitos pequeños y una cubierta de celofán. hecha con un vaso. sin embargo.

hojarasca. Las trampas pitfall pueden usarse en cualquier sustrato a nivel del suelo. pero deberán evitarse siempre que se pueda. dentro de un rango de unidades vegetales. En otras palabras. el número de especies obtenidas por medio de las trampas pitfall se incrementa cuando éstas son colocadas en un máximo de unidades vegetales.7). de manera alternativa. Se puede argumentar que cuando se trata de sol directo. En estudios referidos a riqueza de especies. Colocación de trampas Mientras las pitfall son estrictamente no cuantitativas. El número de réplicas puede basarse en curvas de acumulación de especies y ha de ser seleccionado para lograr un 85% o más de las especies buscadas. al mismo tiempo que ayuda a mantener el contenido fresco. ajenos a la fauna del suelo. lo que resulta atractivo para los artrópodos diurnos activos en la superficie. El vidrio pesa más que el plástico. una solución de hidrato de cloruro al 5% o una mezcla de ácido láctico/ácido acético (10% de cada uno de ellos. con la excepción de agua y roca. El uso de envases de color fuerte o con dibujos puede mejorar la captura de parasitoides u otros insectos voladores que serán atraídos por los colores. de manera que permitan el acceso a las trampas. 2001). aunque su aplicación más común es en un sustrato de suelo para la fauna de artrópodos activa en la superficie del suelo (Figura 3. muestran que un nivel de captura aproximada puede obtenerse mediante la replicación de trampas pitfall. El techo puede hacerse también de loseta de cerámica. madera podrida y turba. por lo que el techo se mantendrá más estable. éste deberá ser gris claro. Estudios que se enfocan a la abundancia. retardando así la descomposición. pero se puede utilizar. también crea un microhábitat como si fuera una cueva. En algunas variaciones de este procedimiento se añade sal como conservador.o tres centímetros. ¿cuál sería el número apropiado de trampas pitfall requeridas para colectar el 85% o más de las especies capturables en una unidad vegetal dada? En el muestreo basado en transectos (Swift y Bignell. con una respuesta negativa a la luz. combinados con un poco de glicerina) para mejorar su conservación. pueden ser útiles para la estimación de la diversidad alfa. el techo debería ser opaco para evitar un efecto invernadero dentro de la trampa. madera u otro material lo suficientemente pesado como para que no lo eleve el viento o que pueda ser afectado por la lluvia o el sol y que además no sea comestible para las termitas. Pueden emplearse para muestrear artrópodos en madrigueras. de manera que no atraiga insectos voladores. plástico. las pitfall normalmente se colocan en paralelo y M acrofauna 121 .

capítulo 2. en forma de “V” o de embudo. pero esto no trata de ser prescriptivo. En el sistema de muestreo recomendado para el proyecto CSM-BGBD. 122 Manual de biología de suelos tropicales . se canalizan los animales móviles hacia la base de la “V” o embudo. una precaución sensata sería. de manera que se minimice al máximo la perturbación del microhábitat adjunto. La colecta de las pitfall es sensible a la perturbación.a cada lado. las pitfall pueden ser distribuidas de la misma manera que en el muestreo casual para hormigas y termitas. es decir. sugerido por Southwood (1978) hace uso de tablas de madera o de algunos obstáculos similares de hasta 30 cm de alto. deberán ser extraídas a mano. se sugiere que las pitfall sean colocadas a lo largo de la línea de transecto y a un lado de los cuadrantes de 1 m² del muestreo para hojarasca. Se usa el relleno para construir una rampa. No se especifica el número. 3 El suelo fino. con el fin de hacer un hoyo del tamaño del vaso a introducir. fuera del área principal de actividad. Se muestrea. especialmente a pisadas. Se debe tener especial cuidado para evitar remover suelo y raíces. colocados en la superficie del suelo. el monolito. finalmente. extracciones de núcleos de mesofauna y de microsimbiontes y. 2 Se coloca la trampa pitfall en el hoyo y el borde externo se llena de tierra procedente de la excavación. podrá hacerse en cualquier momento. se aplana con cuidado para mantener el mismo nivel que el borde de la trampa. Cuando una parcela es botánicamente compleja y varias unidades vegetales pueden ser reconocidas. que cae en la trampa durante su colocación. Un esquema variable de muestreo con pitfall. a una distancia de alrededor de 5 m. Un muestreo ocasional. De esta manera. ordenar el lugar entero. las partículas más grandes. según el orden de vulnerabilidad decreciente: primero las pitfall (de un día para otro) seguidas por los transectos. ello depende del largo del transecto. puede soplarse hacia afuera. 1 Se utiliza una cuchara de albañil para cortar y sacar las raíces y suelo. El número recomendado es de 3 a 5 trampas por cada punto de muestreo. cualquier microhábitat de interés podrá ser investigado. de manera que los animales caminen sin obstáculos hacia el borde de la trampa. Instalaciones de las trampas pitfall Las trampas pitfall deben ser introducidas en el suelo con el borde superior del envase al ras del mismo o de la superficie de la hojarasca. por lo tanto. donde se puede colocar una colección de pitfall de manera cercana (véase "cercas movibles”).

Los especímenes deberán procesarse el mismo día en laboratorio o la base de campo. esta película es difícil o hasta imposible retirar una vez que los ejemplares quedan conservados. arriba del substrato. la sal y el detergente. a no ser que la frecuencia de mantenimiento sea de 24 horas o menos. Para poder retener los colémbolos. que hayan caído en la trampa.4 Se insertan tres soportes de techo en el suelo alrededor de la trampa. 6 Se coloca el techo sobre los soportes. siempre se necesitará sal u otro tipo de conservador en climas tropicales. 7 Se coloca un indicador con el número de lugar y trampa (en tinta indeleble o lápiz) cerca de la trampa. El lavado de ejemplares en agua fresca es esencial porque el detergente y la suciedad forman una película sobre los insectos. animales más grandes. enjuagando el contenido de cada bolsa en la red. tales como hojas. con el fin de remover la suciedad. lo que servirá para separar los últimos ejemplares. se utiliza por separado un colador de 53 µm. Se transfieren los especímenes en bolsas de plástico o frascos desde la red. palitos. colocado verticalmente con un pedazo de cinta o banderín amarillo o naranja. durante varios minutos. utilizando un flujo suave de agua.5 cm de cada soporte visible. un palito. Se añade un poquito de detergente como agente tensoactivo. Se extraen los elementos grandes. Cada trampa se debe procesar de manera separada y se coloca en la bolsa o frasco una etiqueta con la identificación del lugar. situado en su parte superior. resulta útil para identificar la localización de la trampa y para prevenir pisadas accidentales. etc. se agita suavemente el contenido restante del vaso para levantar los especímenes del fondo y se filtra con una red de acuario. utilizando un frasco para enjuague o pipeta de agua. ver abajo). lo que dificulta que sean manipulables y visibles bajo M acrofauna 123 . El detergente facilitará la inmovilización por ahogamiento de animales activos. El mantenimiento y el procesamiento de especímenes El mantenimiento de las trampas se lleva a cabo de la siguiente forma: se quita el techo y se levanta el vaso interior que contiene el cebo (en el caso de que lo contenga. trampa y fecha de recolección. Se retira cualquier basura grande restante y se trata de retirar al máximo la tierra u otra basura orgánica. dejando así 2. 5 Se llenan las trampas hasta alrededor de ¼ de su capacidad con agua y suficiente sal como para lograr una solución saturada (en caso de escoger una solución salina). si se les introduce directamente en alcohol.

cebos de color (amarillo. Para el procesamiento de ejemplares de colémbolos véase Capítulo 4 (Mesofauna). Una variante de este proceso es usar dos filtros para colémbolos (malla 53 µm y 38 µm) se utilizan para separar estos animales de la otra fauna (ver Capítulo 4). si es posible. Se pueden preparar trampas pitfall adicionales (opcional) con un contenido de 120 ml de etanol al 95% + glicerina (9:1) que se dejan en campo durante 72 horas. y se introducen las etiquetas (escritas con tinta indeleble o con lápiz). lleno de alcohol. El excremento humano fresco también es apetecible para una gran variedad de escarabajos y. El uso de cebos resulta controversial porque el muestreo se sesga hacia los animales con un marcado olfato. por supuesto. se invierte el contenido de la red en una bolsa de especímenes y con un atomizador o piseta. feromonas). Para mejorar la capacidad de captura con trampas pitfall Es posible mejorar la capacidad de captura con las trampas pitfall haciendo varios cambios en el diseño de la trampa o usando cebo atractivo para artrópodos. Las trampas con cebo no podrán utilizarse en una evaluación semi-cuantitativa como medio de captura (por ejemplo. se lava suavemente el contenido de la red y los lados de la bolsa o frasco con el fin de que los ejemplares caigan hasta el fondo. o sustancias sintéticas atractivas (por ejemplo. frutos caídos u hongos en descomposición que resultan indistintamente atractivos para los detritívoros y algunos otros tipos de artrópodos. porque la capacidad de captura de las pitfall está en función del tamaño de su circunferencia. en espera de futuros procedimientos. Se recomiendan dos trampas de este tipo más tres de diseño convencional por cada punto de muestreo. se encuentra fácilmente disponible. se refrigeran o se congelan las muestras. Después de siete días se debe cambiar el alcohol y. Después de este lavado. El cebo deberá separarse del líquido conservador. el porcentaje de todas las trampas estará ocupado por una sola especie) porque no se puede determinar 124 Manual de biología de suelos tropicales . El cebo puede ser estiércol.microscopio. carroña. rojo o azul) para atraer moscas o parasitoides. El hecho de usar cebos atractivos implica un mejoramiento general para la captura de una gran variedad de artrópodos. Se cubre con alcohol la muestra hasta la altura de los ejemplares que se encuentran dentro de la muestra. se usa alcohol al 95% en el caso de colémbolos y al 70% para otros especímenes. Las muestras almacenadas deberán quedarse en una bolsa doble o frasco. La principal modificación en el diseño consiste en agrandar su diámetro. esto se lleva a cabo con la suspensión del cebo en un pequeño bote colocado en la boca del envase principal.

• Bolsas de plástico para muestreo con sello (tipo ziplock son las más convenientes para el almacenamiento de especímenes de campo) o frascos. se hace una lista de especies. pesados después de un secado con papel absorbente. • Detergente puro: detergente líquido no perfumado para platos.el área en donde se llevó a cabo el muestreo y la captura no sólo depende de la abundancia de animales. • Soportes del techo: clavos de madera o galvanizados de 152 mm (seis pulgadas). • Indicadores de plástico o de madera. esto es aplicable para las lista de especies de la localidad. sin embargo. • Techo de 200 x 200 mm (uno por trampa). se combinan los resultados de los monolitos. • Alcohol al 70 al 90%. hasta el nivel de determinación taxonómica y funcional más alta posible. loseta de color gris claro. • Agua: agua de la llave o de una fuente natural. no. • Lápiz de grafito (ej. siempre que sea posible agruparlas en familias o subfamilias. • Sal. trampas pitfall junto con un muestreo casual. transectos. M acrofauna 125 . Lista de materiales requeridos • Trampas pitfall: vasos de plástico de 1000 ml (con dimensiones de 180 mm de diámetro superior x 120 mm de profundidad). sino también de la movilidad relativa. por lo menos. Para completar la lista. • Red de acuario o similar (de malla fina). • Cubeta o envase para agua. trampas Winkler. Si no se cuenta con una balanza disponible en el campo. REGUISTRO E INTERPRETACIÓN DE DATOS Parámetros Registre el número y peso fresco de todos los organismos e identifique. utilizando el nombre genérico y por orden alfabético. se puede estimar el peso fresco para ejemplares conservados. La presencia y el peso de hongos cultivados por las termitas (si los hay) también deberán anotarse. 2 o 6B) • Etiquetas tipo tarjeta.

Incorpore la lista de especies en una tabla que muestre las localidades donde fue encontrada cada una. Selva de hule 211 BS12.445 2-1. a través de un gradiente de perturbación de la selva. la especie A es la misma especie en toda el área de muestreo. y Crematogaster sp. Tabla 3. Árboles talados 163 BS6. en la provincia Jambi del centro de Sumatra. Fuente: datos de especies de Jones et al.772 0-20 2-534 95% de confianza 3-64 43-148 24-78 1-50 * Datos retrotransformados. los cuales se muestrean en el mo126 Manual de biología de suelos tropicales . se multiplica el número crudo de cada monolito x 16.Las especies plenamente identificadas deberán enlistarse con su nomenclatura binomial (género y especie) y la autoridad que las describió completas: Ejemplo Dorylus laevigatus Smith. 2003.892 BS3. A. Las morfoespecies deberán enlistarse por letra: Ejemplo Crematogaster sp. de cada monolito y de cada estrato. Selva primaria 2. Paraserianthes 512 BS8. Alang-alang 3 BS14.827 22-977 5-16. con la excepción de las lombrices de tierra y milpiés. deberán enlistarse sin letras: Ejemplo Colobobsis sp. Las especies identificadas únicamente a nivel género. B. Por ejemplo.2 Densidad numérica (individuos m2) de termitas en siete localidades.046 2-9. La abundancia se estima como número o individuos por m2. Hule 128 BS10.. Es importante que la designación de letra sea consistente entre las localidades. Sitio Media aritmética individuos m-2 (n=5) BS1. Cassava 26 Media aritmética Nivel del estrato (Promedio de todas individuos m-2 (n=5) las localidades) 46 0–10 cm 106 10–20 cm 55 20–30 cm 49 Media geométrica individuos m-2 (n=5)* 971 65 47 11 25 2 10 Media geométrica individuos m-2 (n=5)* 15 80 44 4 95% de confianza 347-12.

también para cada grupo taxonómico superior y se combinan los datos de todas las especies. Cuando no hay demasiados ceros (muestras sin organismos) este procedimiento debería normalizar los datos y producir varianzas homogéneas de grupo a grupo. También partiendo de que un transecto completo representa una muestra única y grande. 1996).. número de pitfall respecto al total. véanse las discusiones en Eggleton y Bignell (1995). o sea. Los datos transformados pueden usarse para histogramas y comparaciones de lugar a lugar (Eggleton et al. el número de veces que se descubren colonias separadas en el caso de hormigas o termitas. también es posible que el número total de encuentros. y prepare una tabla resumida.nolito y la zanja (véase monolitos arriba). los datos primarios deberán transformarse en log10(x+1). Jones e Eggleton (2000). se determina la abundancia para cada taxón. El peso de los desconocidos puede entonces estimarse desde la curva. resulta más conveniente M acrofauna 127 . si es posible. datos transformados y los límites de confianza para log10(x+1). En el caso de transformaciones a log de los datos. junto con las medias geométricas. o para otros grupos individuos separados a lo largo del transecto completo. etc.2). (2005). Se citan las medias para datos no transformados. se utiliza peso fresco o la masa de un espécimen parcialmente seco. En casos difíciles. incluyendo el 95% de los límites de confianza y con los datos transformados se obtiene una media geométrica. Algunos indicadores de la abundancia relativa se pueden obtener a partir de la frecuencia de encuentro de diferentes especies (número de secciones de un transecto en donde se localizó la especie con respecto al número total muestreado. Woodcock (2005) y Jones et al.m-2 de manera similar a como se calcula la abundancia. Para poder estimar el 95% de límite de confianza.). Para la información completa obtenida de transectos. tal y como se muestra en la tabla 3. (1997). se calculan las medias aritméticas. por lo tanto. finalmente. Eggleton et al. Se estima la biomasa en g. en especímenes representativos que cubren todo el rango de tamaños. existe un método alternativo que consiste en calibrar la biomasa viva con el ancho de cabeza. se puede probar una transformación loglog. Este concepto no se puede aplicar de la misma manera para las pitfall. es posible asignar dominancia y. Donde se dispone de especímenes de insectos de varios tamaños. puedan ser parámetros útiles de población. Se aplican estadísticas descriptivas al juego de datos transformados. Se evita el uso del peso seco debido a las diferentes temperaturas de los hornos que usan algunos investigadores y por el contenido variable de agua de los diferentes tipos de organismos. derivar en índices de diversidad de especies y de equitatividad.

una variedad de artrópodos (hormigas. Para poder establecer una comparación. sin embargo. Se debe mostrar riqueza de especies/morfoespecies. la clasificación de lombrices de tierra (ya mencionada) puede aplicarse a todos los invertebrados del suelo. Análisis Los análisis se deben llevar a cabo por grupo funcional. elementos minerales y materia orgánica se redistribuyen con esta actividad y también se acompañan de efectos físicos sobre la estructura del suelo y las propiedades hídricas. puesto que no implica pesar especímenes individuales o hacer otras medidas para estimar la biomasa. como arriba. Ensambles pueden ser comparados por la proporción relativa de especies o unidades taxonómicas (morfoespecies). es decir. La macrofauna activa en la superficie incluirá a los organismos muestreados en las trampas pitfall. Se prepara una tabla resumida. cucarachas. el efecto de estos invertebrados es fraccionar y despedazar la hojarasca. Especies endógeas que viven en el suelo y se alimentan de materia orgánica y de raíces muertas. en su mayoría. Los dos grupos principales son las lombrices de tierra y las termitas que se alimentan del suelo. escarabajos. muchas tasas de procesos en el ecosistema son proporcionales a la biomasa y no a la abundancia. Este grupo incluye. cochinillas y grillos). Especies epigeas que viven y se alimentan en la superficie del suelo. pero también algunos arácnidos. definido por su hábito alimenticio y su distribución en el perfil del suelo. Nota: determinar solamente la abundancia resulta fácil. menos informativa. ciempiés. por tanto. pero no redistribuyen activamente materiales de las plantas (aunque el material despedazado sea más fácilmente transportado por el viento o el agua que el material de donde deriva). caracoles y pequeñas lombrices de tierra completamente pigmentadas.trabajar en (mg+1) y luego se transforman y se expresa en gramos. las cuales pueden ser incluidas en una o más 128 Manual de biología de suelos tropicales . Las lombrices de tierra y las termitas que no se alimentan de suelo constituyen los principales grupos dentro de esta categoría. milpiés. Cantidades considerables de suelo. Especies anécicas son las que retiran hojarasca de la superficie del suelo a través de su actividad alimenticia. y liberar nutrientes. abundancia y biomasa en forma gráfica. ingiriendo grandes cantidades de materia mineral. de manera que monitorear datos sin estimaciones de biomasa proporciona información incompleta y.

La riqueza de especies actual puede ser estimada por medio de Sob. ACE. pero ocasionalmente más pequeños) ingieren una mezcla de materia orgánica y minerales. Se recomienda probar la clasificación de un grupo funcional (GF) adicional para la macrofauna. utilizando las siguientes categorías: Los ingenieros del ecosistema (normalmente hormigas. Nota: los términos “ingeniero de ecosistema y especies claves” con frecuencia son utilizados.categorías funcionales. según se explica a continuación.2 a 1cm). Este grupo incluye invertebrados grandes (> 1cm) y medianos (0. lombrices epigeas y ácaros grandes) ingieren una mezcla de materia orgánica y biomasa microbiana y forman heces holorgánicas de corta vida.2 cm. que son complejos organominerales. Jackknife. termitas y lombrices anécicas y endógeas). Transformadores de hojarasca (normalmente artrópodos no sociales o semisociales. Los índices de diversidad y de similaridad útiles incluyen: ShannonWiener. Jacquard y Sorensen (véase Southwood. Conjunto mínimo de datos por punto muestreado De todo el muestreo Lista de especies/morfoespecies para hormigas. termitas y escarabajos capturados con cebo. Lista por familia de los otros escarabajos. Macropredadores (especies predadoras >0. pero algunos animales más pequeños (varios ácaros) pueden tener funciones análogas. M acrofauna 129 . 1998). 1978 y Krebs. CONJUNTO mínimo DE DATOS El conjunto mínimo de datos puede ser expresado por cada punto de muestreo. Simpson. normalmente procedentes de varios grupos de artrópodos). de forma incorrecta. como sinónimos. Las especies clave (termitas y posiblemente algunos transformadores de hojarasca) proveen oportunidades físicas de nichos para organismos de nivel más bajo y determinan la estructura de la comunidad de estos organismos. y forman heces longevas y estables. ICE y EstimateS. por categoría de uso de suelo y por ventana de muestreo. Los grandes invertebrados (> 1cm.

etc. el número de encuentros. etc. etc. Se hace un cálculo para cada GF. Todas las termitas (y por GF 1. Abundancia total en número m2 de forma separada para: Todas las hormigas (y por grupo funcional GF1. varía de 0 a 4 para transectos de 20 m y de 0 a 20 para transectos de 100 m. GF 2. GF2. utilizando todas las secciones de transectos disponibles para el muestreo. Todas las lombrices de tierra (además por GF 1. números totales por cada grupo funcional (GF1. Todos los escarabajos Otros invertebrados Todos los invertebrados. con la excepción de lombrices de tierra). 130 Manual de biología de suelos tropicales .Lista de los otros invertebrados en la resolución taxonómica la más alta posible.).) también pueden estimarse. Para cada taxón se indica el método de muestreo empleado: C = casual T = transecto W = Winkler P = pitfalls M= monolito (Para el monolito no observar estratificaciones de 3 x 10 cm. En el caso de las hormigas. La abundancia relativa para cada GF está dada por el número de encuentros de divididos entre el número total de encuentros de todos los GFs. Datos de abundancia para hormigas y escarabajos (número de individuos m²). por lo tanto. etc.). Se pueden juntar los datos obtenidos de diferentes transectos en puntos de muestreo separados. Nótese que un encuentro es un evento en una sección de 5 m del transecto. GF 2. De las trampas Winkler Frecuencia de especies por muestra. GF2. en su defecto las que se alimentan de madera o de suelo). Desde el transecto o los transectos Abundancia relativa de termitas..

etc. M acrofauna 131 . etc. P= Pitfalls y M= Monolito De los monolitos Es necesario proveer la abundancia media como: a) Número de individuos m² ±SD b) Media geométrica ± 95% de intervalo de confianza c) Media aritmética ± 95% de intervalo de confianza donde n = número de puntos por uso de suelo. GF 2. GF 2. utilizando las mismas claves que las especificadas anteriormente: C= Casual. Conjunto mínimo de datos por uso de suelo Las categorías de uso de suelo son anotadas y cuando esto no es posible se clasifican de acuerdo con la intensidad de uso de suelo. etc. De los transectos Abundancia relativa media de termitas GF 1. GF 2.). etc. De todo el muestreo Listas de especies/morfoespecies para hormigas. termitas. todas las lombrices de tierra (y por grupos GF 1.).. todos los escarabajos. lombrices de tierra y escarabajos capturados con cebos. GF 2. separado para hormigas (y para grupos funcionales GF1. todas las termitas (y para los grupos GF 1. Lista de familias para los demás escarabajos Lista de invertebrados en la resolución taxonómica la más alta posible Para cada taxón se indica el método de muestreo empleado. W= Winkler. o en su defecto las que se alimentan de madera o de suelo).De las trampas pitfall Se desglosa los taxa no muestreados por otros medios (únicamente). otros invertebrados y todos los invertebrados (igual a lo indicado para datos mínimos por punto de muestreo). como % ± SD. T = Transecto. donde n = número de puntos por uso de suelo.

De manera similar. Abundancia media de escarabajos como individuos m² ± SD. GF 2.De las trampas Winkler Abundancia media de hormigas (y como GF 1. 1994).) como individuos m² ± SD. 1995. 132 Manual de biología de suelos tropicales . ejemplo Diversidad β. incluyendo los resultados de intensificación de uso de suelo. si el muestreo se hace en una colonia. Conjunto mínimo de datos por ventana de muestreo De todos los métodos de muestreo Recambio de especies a lo largo del gradiente como la β de Whittaker. Por ejemplo.. Lawton et al. se argumenta que los organismos se deben asignar únicamente como ingenieros del ecosistema. el cálculo retrospectivo hasta llegar a la densidad numérica.. donde n = número de puntos por uso de suelo. Para todas las abundancias medias totales y las abundancias medias relativas de los GF Correlación con parámetros individuales del gradiente. cuando su abundancia o biomasa lo justifique. si el régimen de muestreo es suficientemente robusto (incluyendo réplicas adecuadas. 1996) y que la biomasa es tan importante para la determinación del impacto ecológico que no se puede prescindir de ella o sustituirla. será sobreestimada (Colwell y Coddington. La frecuencia de especies por muestreo presenta un parámetro alternativo. muestreo anidado y estratificado ejemplo Eggleton et al. El uso de datos crudos de abundancia y de biomasa en la interpretación de la función del ecosistema resulta controversial. no obstante. en base de lugar a lugar. etc. la escala del esfuerzo requerida para poder evaluar la biomasa es enorme (véase Eggleton y Bignell. existen contra argumentos de que los insectos sociales pueden evaluarse correctamente en cuanto a su abundancia y biomasa. Desafortunadamente. se dice que la abundancia de individuos no se debe usar en el caso de hormigas porque son insectos sociales que se organizan en colonias formadas por miles de individuos que se alimentan en grupos.

pp. y Saha. C. vol. R. G. Lavelle.. S. M. Ecology and Systematics from Various Regions of the World. R. D. K.ac. J. Blakemore. D. P. Leeanne. VermEcology. Journal of Biogeography. T. T. COE Soil Ecology Research Group. Constantino. Lebissonnais. I. S. J. Washington. Yokohama National University. Halder. J.. DC.htm. J. Environmental & Ecology. 3. (2000) ‘Soil microarthropods of a rubber plantation and a natural forest’. P. pp. Agosti. CAB International. Brandão. 2nd edition. R. pp. Delabie. vol. Y. 35. (eds) (1989) Tropical Soil Biology and Fertility: A Handbook of Methods. y Lavelle. 143–147. India’. Standard Methods for Ground-living Ants. B. (2005) ‘Introductory key to revised earthworm families of the world’. Persson (eds) Soil Organisms as Components of Ecosystems.jp/eng/index.eis. Kaneko and M. M acrofauna 133 . M. vol. Blanchart. Biology and Fertility of Soils. Brown. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods... Ito (eds) A Series of Searchable Texts on Earthworm Biodiversity.. lo que compromete la caracterización de la heterogeneidad del paisaje porque restringe el número de puntos de muestreo que pueden ser utilizados. Barrios.. 24. B. W. (2002) Cosmopolitan Earthworms – An Eco-Taxonomic Guide to the Peregrine Species of the World. Ecological Bulletins. Kippax. M.. 32.1998).338–347. Wallingford. (1997) ‘Regulation of soil structure by geophagous earthworm activities in humid savanna of Côte d’Ivoire’. T. www. T. Soil Biology and Biochemistry. J.... in U. Bestelmeyer. 29. vol. Majer. L. 1st edition. E. K. Ramakrishnan. S.bio-eco. pp. Blakemore. E. Braudeau. (2002) ‘Effects of land-use system on the soil macrofauna in western Brazilian Amazonia’. R.. (1997) ‘Functional groups and patterns of organization in North American ant communities: A comparison with Australia’. Soil Biology and Biochemistry. Bhadauria T. 25. Australia. Alonso L. vol. C. e Ingram. e Ingram. C. Smithsonian Institution. Anderson. I. N.T. J. Wallingford. CAB International. (2000) ‘Diversity and distribution of endemic and exotic earthworms in natural and regenerating ecosystems in the central Himalayas. Bouché. y Schultz T. y Srivastava. Japan. E. F. 433–460. H. Pashanasi.. 2045–2054. Anderson. P. A.. Andersen. J. pp. y Valentin. REFERENCIAS Agosti. 431–439. 122–132. E...ynu. Alonso. Bhattacharya. (1977) ‘Stratégies lombriciennes’. R. D. N. (eds) (2000) Measuring and Monitoring Biological Diversity. Lohm and T. vol. pp. J. in N. M..

J. y Lavelle... D. Colwell. (1998) ‘Comparative biodiversity along a gradient of agricultural landscapes’. C. y Coddington. Clergeau. 157–168. Nasutermitinae)’. S. (1995) ‘Inquilismo simultâneo de duas eespécies de Centromyrmex (Hymenoptera. Feira De Santana. T. vol. G. Dubs.eeb.. C. Delabie. Decaëns. 39.. (1989) ‘Termites’. Csuzdi. (1999) ‘Comunidades de formigas (Hymenoptera: Formicidae): Métodos de estudo e estudos de casos na Mata Atlântica’. vol. Agosti. C. São Paulo. pp. Nairobi. H.. in D. (1994) ‘Estimating terrestrial biodiversity through extrapolation’. Schultz 134 Manual de biología de suelos tropicales .. F.. T. y Lefeuvre. vol. N. Resumos Feira De Santana. R. J. Colwell. J.-C. P. Ecosystems and Environment. E.. Paillat. vol.. Alonso and T. H. (2000) ‘Litter ant communities of the Brazilian Atlantic rain forest region’. 101–118. D. M. and Rippstein.. Amsterdam. CSM-BGBD (2005) Global workshop on ant and termite sampling and identification.. (2005) ‘EstimateS. Agriculture. G. J. Baudry. E. J. vol. 103. Version 6. 19. Barros. Software and User’s Guide’. pp. pp. Philosophical Transactions of the Royal Society (Series B). European Journal of Soil Biology. A. R. Lavelle.Burel. Jiménez.5: Statistical Estimation of Species Richness and Shared Species from Samples. http://viceroy. J. Sociedade Nordestina De Zoologia. K. y Nascimento. (Isoptera. C. A. Tropical Soil Biology and Fertility Institute of CIAT. J. R. 58–68. K. E. pp133-143. J. G. 347–367. K. Revista Brasileira De Entomologia. uconn. H. C. (2000) ‘Statistical Estimate of Species Richness and Shared Species from Samples. vol. Mitteilungen aus dem Zoologischen Museum in Berlin. Colwell. Jiménez. Delettre. in H. J.. Formicidae. http://viceroy. Fragoso.. P. C. Acta Oecologia. pp.. Ponerinae) em cupinzeiros de Syntermes sp. Blanchart. Werger (eds) Tropical Rain Forest Ecosystems. Kenya. Majer. 47–60. Le Coeur. pp. T. J. 301–312 Decaëns. 605–609. (2002) ‘Earthworm communities under an agricultural intensification gradient in Colombia’. (2004)‚‘Soil macrofauna communities in permanent pastures derived from tropical forest or savannas’. L. (1994) ‘Impact of land management on soil macrofauna in the Oriental Llanos of Colombia’. Plant and Soil. S. Butet. Agosti.. 240. A. Delabie.. J. vol. P. Y.. (1996) ‘Revision der Unterfamilie Benhamiinae MICHAELSEN. Leith and M. Version 7. J. Brunel.edu/estimates.eeb. Collins. A. D. Delabie.edu/EstimateS. 1897 (Oligochaeta: Acanthodrilidae)’.0b1’. J.. Petit. 12. 72. Decaëns. J. F. Chauvel. Encontro De Zoologia Do Nordeste. C. Escobar. N.ucon. I. pp. Termitidae.. vol. T. 30. 345. pp. y Jiménez.. Elsevier Science Publishers. Thenail. Morvan.

351.. 51–68. Easton. E.. y Bignell. Journal of Tropical Ecology. pp. y Maryati. P. 354. A. (1997) ‘The species richness and composition of termites (Isoptera) in primary and regenerating lowland dipterocarp forest in Sabah. D. 111. D. Jones. vol. 10. P. E. Washington. East Malaysia’. P.. Southern Cameroon. Dlamini. 1791–1802. Bignell. y Rojas-Fernandez. vol. Eggleton. D. T. pp. 119–128. y Bignell. C. 6. F. Jones. pp. J. pp. y Maryati. Mawdsley. London. V. Jeeva. Davies. (1997) ‘The incidence of secondary occupation of epigeal termite (Isoptera) mounds by other termites in the Mbalmayo Forest Reserve. F. A. D. (1994) ‘Effects of habitat fragmentation on Amazonian termite communities’. T. Bulletin of the British Museum (Natural History) Zoology. C.. (1979) ‘A revision of the ‘acaecate’ earthworms of the Pheretima group (Megascolecidae: Oligochaeta): Archipheretima. (1996) ‘The diversity. Jeeva. MacDonald... Haynes. (2004) ‘Influence of agricultural land use on the size and composition of earthworm communities in northern KwaZulu-Natal.. Fragoso.. pp. D. vol. vol. 489–498.. G. Ecotropica. D. J. D. Philosophical Transactions of the Royal Society of London.. East Malaysia’. Proceedings of the Californian Academy of Sciences.. K. Series B. M. DeSouza. (1900) ‘Researches in American Oligochaeta with especial reference to those of the Pacific Coast and adjacent islands’. Eggleton.. Applied Soil Ecology. Bignell. Oligochaeta)’. Wood. DC.. vol. Eggleton. y Bignell. Series B. Eggleton.. R. Pleinogaster and Polypheretima’. 35. M acrofauna 135 . N. N. Lawton. pp. E. H. 27. Smithsonian Institution.(eds) Measuring and Monitoring Biological Diversity: Standard Methods For Groundliving Ants. W. Sands. P. pp. G. vol. forest disturbance and greenhouse gas fluxes in Sabah. Homathevi. C. Stork (eds) Insects in a Changing Environment. in R. R. Eisen. pp. Philosophical Transactions of the Royal Society of London. Homathevi. and its biological significance’. A. pp. Megadrilogica. 1–12. E. South Africa’. E. Journal of African Zoology. 3. R. vol. (1999) ‘Termite assemblages. O. 77–88. 1–128. 87–276. Eggleton. G. y Brown. E.. R. P. R. 2. abundance and biomass of termites under differing levels of disturbance in the Mbalmayo Forest Reserve. Academic Press. P. vol. Davies. (1995) ‘Monitoring the response of tropical insects to changes in the environment: troubles with termites’. vol. Metapheretima. 197–206. (1994) ‘Earthworms from Southeastern Mexico. Harrington and N.. New Acanthodriline genera and species (Megascolecidae. G. D. J. T. Planapheretima. Southern Cameroon’. G. M.

. T. Wallingford. Blackwell. Suryo. pp. Lavelle.. soil biodiversity and agroecosystem function in the tropics: The role of earthworms’. D. pp. Gates. Megadrile Oligochaeta (Earthworms) Family Octochaetidae.. y Hawksworth. Zoological Survey of India. y Tondoh.. Jones.-M. Dominy. D. 95. in K. pp. C. C.. P.. C. P. A.. Journal of Applied Ecology. Calcutta. E. Gilot. y Eggleton. E. Verkerk. Nicolson. (2003) ‘Effect of agricultural land use on soil organic matter status and the composition of earthworm communities in KwaZuluNatal.... Susilo. H. D. B. Keli. J. M. A. (1995) ‘Biological activity of soil under rubber plantation in Côte d’Ivoire’. Ecosystems and Environment. R.. vol. 17–35. J.. D. R. F. y Graham. P.. y Eggleton. G. M. 196. Transactions of the American Philosophical Society. C. International Trust for Zoological Nomenclature. P. 62. y Kumar. pp. South Africa’... Lavelle. 37. Barrie. H. D. J. S. 191–203.. P. Greuter. T. Demoulin. in S. (1970) ‘Termites of the Australian region’. New York. Filgueiras. Martinez. Weesner (eds) Biology of Termites. 1–326. S. Journal of Applied Ecology. Applied Soil Ecology. (1972) ‘Burmese earthworms. P. vol. M. (1997) ‘Agricultural intensification. L. 136 Manual de biología de suelos tropicales . J. vol. G. (2000) ‘Sampling termite assemblages in tropical forests: Testing a rapid biodiversity assessment protocol’. Leather (ed) Insect Sampling in Forest Ecosystems. Julka. J. J. 453–464 International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature. C. J. Blanchart. in P. Blanchart. T. London. Blanchart. Gay. (2000) International Code of Botanical Nomenclature (St Louis Code). M. Jones. T. J. pp... 6. T.. E. CAB International. V. D. vol. Jones. an introduction to the systematics and biology of Megadrile oligochaetes with special reference to South-East Asia’. J. (2003) ‘Termite assemblage collapses along a land-use intensification gradient in lowland central Sumatra.. P. 4th edition. J. Patron. P. vol. Burdet. Lavelle. Kouassi. (2005) ‘Methods for sampling termites’. Haynes. Jiménez. C. J. y Eggleton. Konigstein. 186–189. Agriculture. Krishna and F.. R. Brussard and P. W. B.. F. 380–391. H. Skog. E. Turland N.. (1988) The Fauna of India and the Adjacent Countries. Fragoso... G. Senapati.. Indonesia’.. H. Decaëns. E. Oxford.. structure and influence of management pratices’. E. Bignell. Acta Zoologica Fenica.. Senapati. J. F. Pashanasi. J. F. Gillison. W. K. E. B. T.-X. Academic Press. L. Hendrix (eds) Earthworm Management in Tropical Agroecosystems.Fragoso.. H.. G. pp. y Calaby. 40. Trehane. y Guillaume. Brown. P. Lavelle. vol.. McNeill. (1999) ‘Earthworm communities of tropical agroecosystems: Origin. Koeltz Scientific Books.. Silva.

2nd edition. (1998) ‘Biodiversity inventories. Blackwell Science.. Roger. (1978) ‘Les vers de terres de la savane de Lamto (Côte d’Ivoire): Peuplements. Magurran... R. Righi. pp. Ecole Normale Supérieure 12. E. N. vol. Journal of Theoretical Biology. 37. A. vol. Lawton. G. (1995) ‘Colombian earthworms’.. B. 10. Omodeo (eds) On Earthworms: Selected Symposia and Monographs. Mucchi. Lee. (2004) ‘Earthworm populations under tropical maize cultivation: The effect of mulching with velvet bean’. and Fragoso.. Pearson Education. vol. Boulton. Lepage. Oxford. y Watt.. vol. Heal. vol. A. P. y Dhillion. pp... D. Nature (Lond).. 40. Lavelle. Moreno. Studies on Tropical Andean Ecosystems. Lavelle. P.. Mora. Bloemers. y Halffter. 33. C. Mawdsley. 1–95. S. Thèse de Doctorat. Bignell. E. C. J. 2. C. O. 485–607. B.. pp. (2000) ‘Assessing the completeness of bat biodiversity inventories using species accumulation curves’. Srivastava. M.. D. and diversities of bats in a fragmented landscape’. Mathieu. 20. E. M. D. 117–133. (1981) ‘Strategies de reproduction chez les vers de terre’. 72–76.. Holt. G. N. Bonvicini and P. Elsevier Publishing Company. (1971) ‘Sobre a familia Glossoscolecidae (Oligochaeta) no Brasil’. Amsterdam. A. M. y Rouland-Lefèvre.Krebs. Larsen. pp. P. France. 213–226. M. vol. G. II The earthworms’. Hammond. populations et fonction dans l’écosystème’. E. S. (1997) ‘Soil function in a changing world: The role of the invertebrate ecosystem engineers’. H. in F. E. (1983) ‘The soil fauna of tropical savannas. Hodda. Biology and Fertility of Soils. indicator taxa and effects of habitat modification in tropical forest’. Journal of Applied Ecology. C. 300–305. y Halffter. P. Acta Oecologia – Oecologia Generalis. Pielou. in A. Wolters. A. 159–193. (2001) ‘Spatial and temporal analysis of. F. Unione Zoologica Italiana 2. C. (1996) ‘The measurement of diversity in different types of biological collections’. pp. (1998) Ecological Methodology. pp.. 438–445. 13. pp367–382 Ortiz-Ceballos.. T. D. Lavelle. Eggleton. M acrofauna 137 . (2004) Measuring Biological Diversity. vol. Biology and Fertility of Soils. Lavelle. G. Rossi. Lavelle. J. Stork. 391. Moreno. 149–158. Bignell.. I. Université Paris VI. E. J.. vol. vol. (2004) ‘A multi-scale study of soil macrofauna biodiversity in Amazonia pastures’. M.-P.. London. 39.. P. Laboratoire de Zoologie. European Journal of Soil Biology. vol. D. Grimaldi. Biodiversity and Conservation.. Bourlière (ed) Tropical Savannas. pp. P. P. P. pp. (1987) ‘Peregrine species of earthworms’. E. 4. K. P. G. C. Arquivos de Zoologia. Righi. V. pp. Modena. J.

V. 113–131. Indonesia. Cambridge. Wood. 4. suborder Lumbricina (Haplotaxida: Oligochaeta)’. Mucchi. y Eggleton. E. 138 Manual de biología de suelos tropicales . France. (1978) Ecological Methods with Particular Reference to the Study of Insect Populations.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. (1992) International Code of Nomenclature of Bacteria: Bacteriological Code. London. Pattern and Process. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. S. W. R. Woodcock. D. in M. pp. (1978) ‘Food and feeding habits of termites’. A. 7. J. International Centre for Research in Agroforestry. 33. Unione Zoologica Italiana 2. W. (2005) ‘Pitfall sampling in ecological studies’. Opuscula Zoologica Budapest. J. E. 21. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. (1996) ‘A pilot analysis of gut contents in termites from the Mbalmayo Forest Reserve. (1986) ‘Guilds and their utility in ecology’. Leather (ed) Insect Sampling in Forest Ecosystems. 1995) (Oligochaeta: Glossoscolecidae). 2nd edition. J. Anderson (eds) Community Ecology. Journal of Tropical Ecology. B. ASB Lecture Note 6B. H. 39. vol. R. y Easton. Regenwürmer aus Südamerika’. R. P. ASM Press. Tondoh. S. 169–268.fao. Eudrilidae) in Ivory Coast’. A. Sneath. (1972) ‘A numerical revision of the earthworm genus Pheretima auct. Chapman and Hall. Swift. G. Chessel. F. W. Oxford. Dolédec. pp. Omodeo (eds) ‘On earthworms. T. (1969) ‘Recherche sur le peuplement en Oligochète de la savane de Lamto (Côte d’Ivoire)’. Cambridge University Press. (1980) ‘A classification and the distribution of earthworms. P. Kikkawa and D. pp. 1990 Revision. E. P. Bulletin of the British Museum (Natural History) Zoology. R. vol. VA. in A. T. South East Asian Regional Research Programme. 103–124. (1997) ‘ADE: A multivariate analysis and graphical display software’. Herndon. A.. M. D. Bignell. Vincent. in S.Sims. pp. vol.. pp. Pagliani and P. E. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition’. 21. y Robinson. Sleaford. Oxford. Blackwell Science. Cameroon’. Biological Journal of the Linnean Society.. G. (2001) ‘Revision der Untergattung Martiodrilus (Maipure Righi. Southwood. D. www. 279–288. Terborgh. vol. Bogor. M. J. Modena. y Olivier. y Bignell. Sims. selected symposia and monographs’. y Lavelle.. Université Paris VI. P. (1987) ‘A review of the Central African earthworm family Eudrilidae (Oligochaeta)’. Sims. M. Ecological Entomology. Thioulouse. E.pdf. pp. in J. Blackwell. Thèse de 3e cycle. Zicsi. R. vol. Statistics and Computing. vol. 493–500. Brian (ed) Production Ecology of Ants and Termites. 75–83.

Zicsi. pp. A. Regenwürmer aus Südamerika 39. vol. (2005) ‘Über den heutigen Stand der Regenwurmfauna (Oligochaeta) Ekuadors mit einem Bestimmungsschlüssel der Glossoscoleciden-Arten’. 95–130. 92. Berichte des Naturwissenschaftlicher-Medizinischer Vereins in Innsbruck. M acrofauna 139 .

Y. R. Fácil de usar. 30. (1992) ‘Termites of peninsular Malaysia’ en L. with descriptions of one new genus and new species and including a key to genera’ Journal of Natural History. escarabajos y hormigas. Forest Research Institute of Malaysia. pp 95162. pp1-244. (2 003). 35 pp. Alexander von Humboldt.R. S.E. vol. ‘Introducción a las hormigas de la región Neotropical’ Instituto de Investigaciones de Recursos Biológicos. Incluye una revisión de la biología ecología. F. de Asia. de Asia Thapa. Gathorne-Hardy. pp. Bogota. 12-26 octubre. taxonomía y la importancia económica de las hormigas. M. Kepong. Colombia. Disponible y económica. Tho. ‘Termites of Sabah’ Forest Record 12. (2001). 36. protocolos de muestreo por región. Notas Clave de géneros de hormigas de Borneo (útil en el S.G. Preparado por “Tools for Monitoring Soil Biodiversity in the ASEAN Region”. pero no cubre toda la diversidad de animales que se alimentan del suelo. E. 2003. vol. XXVI. pp. 1485-1506. Claves de identificación de termitas. ‘A review of the South-east Asian Nasutitermitinae (Isoptera Temitidae). Clave un poco obsoleta de géneros de termitas del Norte de Borneo. Borneo Java y Sulawesi. pp. vol. 1-374. útil para Sumatra. N. Kirton (ed) Malaysian Forest Records. Título y referencias ‘Manual for Bornean Ant (Formicidae) Identification’. (1984) Collins. F. 1-398. P. de fácil manejo. 140 Manual de biología de suelos tropicales . Región y autor Hormigas del S. incluyendo Indonesia).E. Y. Publicación clave para géneros de la región Neotropical. Hormigas Neotropicales Fernández. Clave moderna y de fácil interpretación. Bien ilustrada clave de fácil identificación para los soldados. Bien ilustrada con sinopsis genérica. (2003) Termitas del S.Apéndice 1. 65-87. Universidad Malasis Sabah. (1984). dentro del clado Termes. Sarawak Museum Journal. de Asia Hashimoto. ‘The termites (Isoptera) of Gunung Mulu National Park with a key to the genera know from Sarawak’. Trabajo estándar. y Homathevi.

‘A revision of the termite subfamily Nasutitermitinae (Isoptera. pp. M acrofauna 141 . G. L. Bulletin of the British Museum (Natural History). A. Booth. B. 2–38. W. M. Nigeria. R. Bien ilustrada. ‘Manual for Bornean beetle (Coleoptera) family identification’. (1965). Coleoptera. R. 12–26 Octubre 2003. Escarabajos de Asia Chung. London pp. incluyendo Indonesia. Sabah Forest Record 12 pp. Universiti Malaysia Sabah. Training course on Arthropod preservation. vol 8. Explicación detallada de la IIE Guides to insects of importance morfología y agrupaciones de to Man.Apéndice 1. Región y autor Homathevi.E. R. de fácil manejo. C. R. (1990). preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Sands W. Y. A. 1-374. 2003. Termitas africanas Sands. 1–172. Claves hasta especies. A. curation and data management. Trabajo estándar. CAB International).. Un poco anticuado. Coleoptera. Clave moderna. tanto para imagos como soldados. Ibadan University Press. C. fácil de usar. 1–384. con muchas referencias que incorporan descripciones taxonómicas recientes. The Natural History Museum. Termitidae) from the Ethiopian region’. Thapa. 36 p. (2006). La autoridad estándar del momento para este genero. Bulletin of the British Museum (Natural History).Cox. 129-156 Keys to the Genera of the African Termites. Continúa. Clave de géneros de imagos y soldados. 3. Universiti Malaysia Sabah. (2003). y Madge R. Octubre 2003. International Institute of Entomology (and Institute of escarabajos. (1981). Universiti Malasia Sabah. Lo que opera actualmente sobre esta subfamilia en África. 12–26. (1961). Notas Clave inédita de géneros de termitas en el S. G. Adaptación de Chung. Supplement 4. 2006. (1959). pp. Escarabajos en general. de Asia. pp. pp. Hormathevi. ‘A review of the termites of the genus' Antitermes the Ethiopian region. (2003) Título y referencias ‘Manual for Bornean Termites (Isoptera)’ preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Webb. 1-28. corta y bien ilustrada de familias con una sinopsis diagnóstica de más de 100 familias y casi 50 subfamilias. 18-22 Septiembre. “Termites of Sabah”. S. Clave bien ilustrada a nivel género de soldados.

vol 67.. pero recomendada para formarse. Longman. Natural Science 6. soldados mayores y soldados menores. Notas Clave a nivel familia de imagos y soldados. especialmente Apicotermitinae y todas las que se alimentan del suelo. 1. 142 Manual de biología de suelos tropicales . (1970) A revision of the termites of the genus Macrotermes from the Ethiopean (Isoptera: Termitidae) Bulletin of the British Museum (Natural History) Entomology vol. Wallingford. ‘Report on a survey of the termites of Zimbabwe’. Their Recognition and Control. Clave hasta género para soldados y muchos géneros ilustrados de manera detallada a nivel de especies (en francés). 24. S. pp. Harris W. Clave completa muy ilustrada y detallada. ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. Kluwer Academic Publishers.Apéndice 1. Sands. Bignell and M. Higashi (eds) Termites: Evolution. Abe. Sociality. E. pp 1–23. ‘Taxonomy and phylogeny of termites’. (1980). de difícil manejo. Título y referencias Quel est ce termite Africain? Zooleo. vol. pp. London. G. D. Symbioses Ecology. no muy útil como clave. Estudio comprensivo que incluye claves hasta géneros de soldados. (2000). 187–323. E. Termitas neotropicales Constantino. más 32 referencias. muy útil para termitas subterráneas crípticas. V. pero útil para confirmaciones. pp. R. Ruelle. 1–115. y Eggleton P. W. L. anticuada. utilizando imagos. Continúa. Series B. Estudio prestigiado. únicamente para géneros principalmente en el contexto africano. J. 1–40. A. (2002). en: T. “The Identification of Worker Castes of Termite Genera from Soils of Africa and the Middle East”. Clave corta. Clave de especies para imagos. Lo que opera actualmente este género. Incluye una sinopsis de familias y subfamilias en forma de clave con notas e identifica caracteres diagnósticos. (1971). CAB International. 365–444. (1966). Kambhampati. (1998). obreros y soldados. Mitchell B. Región y autor Bouillon. A. Termites. Occasional Papers of the National Museums of Rhodesia. incluye detalles del enrollamiento del intestino y de cómo está conformada la válvula entérica para identificar algunas Apicotermitinae. pp. y Mathot. Zootaxa. 500 pp.

Excelente para entrenaPest Research. (1997). eje de muchas claves privadas de museos nacionales. imagos y soldados. y Chhotani. Entomology department. (Family Termitidae) Zoological survey of do Sri Lanka. Chhotani. M. utilizadas en taxonomía. incluyenCountries: Isoptera (Termites). vol. Los volúmenes I y II cubren todo el The Fauna of India and Adjacent subcontinente de la India. y Williams. Zoological Survey of India. O. (1983). 'Ant subfamilies’. K. R. (2001). Darlington. Bibliografía completa. B. Calcutta. Región y autor Claves inéditas de termitas y listas de comprobación Wanyoni. No publicado. miento avanzado. Centre for Overseas para géneros de África del Oeste y Central. 801 pp. Clave detallada y de fácil manejo A Key to the Genera of the Termitinae by the Soldier Caste. con una amplia bibliografía. B. C. P. (sin fecha). Documentos variados Roowal. M acrofauna 143 . B. India. subfamilias. Fisher. No publicado. Listas de material requerido para un muestreo de hormigas con precios en $US del 2001. incluye claves hasta familias y subfamilias.Uganda. Fisher. Williams R. L. Calcutta. (J. vol. géneros y especies para imagos y soldados. (2003). M. M. Continúa. E. C. Ward. ‘Equipment specifications’ Department of Entomology. B. ed) International Centre of Insect Physiology and Ecology. C. Guías para caracterización del sitio y anotaciones relacionadas con el muestreo de hormigas. I. ‘Taxonomy of Termites’. S. Department of Entomology. O. UC Davis. Harvard University. II. Documento de base. The Fauna of India and Adjacent Countries: Isoptera (Termites). 672 pp. Los volúmenes I y II contienen claves hasta familias. (sin fecha). Harvard University. Centre for Overseas Pest Research. P. (1989). Título y referencias Notas No es una clave. reporte detallado con definiciones de características morfológicas. pero sí un listado Checklist of the Species of Termites que identifica la distribución entre (Isoptera) Recorded from East Africa. 'Guidelines for data collection for ants’. Sands W. Tanzania y Zanzibar. (2001).Apéndice 1. A. Sinopsis ilustrada de subfamilias y su distribución. Kenia.

Región y autor Jones. Harvard University Entomology. (Anónimos. Isópteros y arañas (Araneae). Department of Entomology. sin fecha). Título y referencias ‘Tools for the Rapid Assessment of Soil Invertebrate Biodiversity in the ASEAN Region’. pero sin ilustraciones. D. termitas. Universiti Malaysia Sabah. prepared for ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. escarabajos del suelo. Bibliografía amplia y actual. “Glossary of morphological characters used in ant taxonomy”. Completo. 12–26 October. pp. Harvard University 144 Manual de biología de suelos tropicales . No publicado. lectura obligatoria. 2003. lombrices de tierra diplópodos. Notas Revisión moderna y completa de la naturaleza de la biodiversidad del suelo y métodos de evaluación rápidos para hormigas. T. 1–39. (ed) 2003.Apéndice 1. Continúa.

Clave de soldados. Constantino (1990). únicamente Kalotermitidae). Revisión y claves de soldados (en portugués).Apéndice 2. con claves. Nasutitermes Parvitermes Procornitermes Holmgren (1910). Revisión y claves (anticuado). Revisión de mapas de distribución de especies del Nuevo Mundo con clave de soldados y alados. Revisión y claves. Mill (1983) y Constantino (1999. Constantino (1997). Clave de soldados de Paracomitermes (anticuado). 2002). Clave de soldados de América del Sur. Fontes (1985). Revisión y claves (anticuado y en alemán). Cancello (1986). Las claves hasta género son dadas en Krishna (1961. (2006). Constantino y DeSouza (1997). Revisión y claves. Emerson (1952). Referencia Contenido RHINOTERMITIDAE Heterotermes TERMITIDAE Amitermes Anoplotermes Atlantitermes Cornitermes Cyranotermes Cyrilliotermes Labiotermes Light (1932). Género KALOTERMITIDAE Cryptotermes Eucryptotermes Procryptotermes Bacchus (1987) Scheffrahn y Krecek (1999). M acrofauna 145 . Snyder (1926). Revisión y claves. Scheffrahn y Krecek (2001). Emerson y Banks (1965). Clave de alados (anticuado). Araujo (1954). Clave de soldados. Revisión y claves. Scheffrahn y Krecek. Claves de soldados de especies de Las Antillas (anticuado). Scheffrahn and Krecek (1993). Emerson (1952). Constantino et al. Revisión mundial con revisión de claves de las especies antillanas con claves hasta la diagnosis de los soldados. Claves de soldados de especies de Las Antillas (anticuado). Revisión de Labiotermes sensu stricto. Constantino (2001). Clave de soldados. Neocapritermes Parvitermes Krishna y Araujo (1968). Trabajos taxonómicos con claves de especies de algunos géneros neotropicales.

Contenido Revisión y claves.Apéndice 2. Claves de soldados (anticuado). Fontes y Bandeira (1979). Revisión y claves de soldados (en portugués). Emerson (1945) . Rhynchotermes Rotunditermes Syntermes Fontes (1985). Cancello (1986). Revisión y claves (anticuado). Revisión y claves. Constantino (1995). Género Procornitermes Referencia Emerson (1952). Continúa. 146 Manual de biología de suelos tropicales . Claves de soldados.

K. 463–472. R. (1986) ‘Revisão de Procornitermes Emerson (Isoptera. with a new species from Brazil (Isoptera: Termitidae: Nasutitermitinae)’. vol. Termitidae. 1–44. pp. M.. 181–189.. Carvalho. Emerson. O. Termitidae. L. Termitidae. 1–11. (1965) ‘The Neotropical genus Labiotermes (Holmgren): Its phylogeny. 205–213. 83. A. pp. 427–472. F. A. Constantino. vol. paper 1340. (1952) ‘The Neotropical genera Procornitermes and Cornitermes (Isoptera. vol. 475– 540. Revista Brasileira de Entomologi. pp. Emerson. 30. vol. E. Schmidt. distribution and ecology (Isoptera. 36. A. Literatura especializada en termitas neotropicales Araujo. pp. vol. Bulletin of the American Museum of Natural History. Nasutitermitinae)’.Apéndice 3. Zootaxa. (2002) ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. (2006) ‘A taxonomic revision of the Neotropical termite genera Labiotermes Holmgren and Paracornitermes Emerson (Isoptera: Termitidae: Nasutitermitinae)’. pp.. (1997) ‘Key to the soldiers of Atlantitermes Fontes 1979. paper 67. A. R. vol. (2001) ‘Key to the soldiers of South American Heterotermes with a new species from Brazil (Isoptera: Rhinotermitidae)’. pp. y DeSouza. E. Bacchus. 189–236. Nasutitermitinae)’. Emerson. vol. 1–33. Constantino. (1945) ‘The Neotropical genus Syntermes (Isoptera: Termitidae)’. E. 125–131. A. Zootaxa. A. R. A. 1. American Museum Novitates. 7. 1–40. 31. N. F. Sociobiology. Tropical Pest Bulletin. (1954) ‘Notes on the genus Paracornitermes Emerson 1949 with description of two new species (Isoptera. Constantino. Nasutitermitinae)’. y Vasconcellos. Papéis Avulsos de Zoologia (São Paulo). vol. 10. 2. Acioli. Bulletin of the American Museum of Natural History.. R. R. pp. S. vol. Constantino. C. pp. pp. Cancello. (1997) ‘Notes on Eucryptotermes with a new species from central Amazonia (Isoptera: Kalotermitidae)’. 1–91. F. pp. S. Constantino. Insect Systematics and Evolution. (1987) ‘A taxonomic and biometric study of the genus Cryptotermes (Isoptera: Kalotermitidae)’. 55. Termitidae. H. R. Nasutitermitinae)’. R. Constantino. (1990) ‘Notes on Cyranotermes Araujo with description of a new species (Isoptera. M acrofauna 147 . Tropical Zoology. Termitidae)’. Cuezzo. pp. y Banks. Constantino. University of Kansas Science Bulletin. 99. E. no 2208. 455–518. (1995) ‘Revision of the Neotropical termite genus Syntermes Holmgren (Isoptera: Termitidae)’. pp. Goeldiana Zoologi. pp. vol. R.

Fontes. (1993) ‘Parvitermes subtilis. Termitidae)’. pp. pp. L. (1999) ‘Termites of the genus Cryptotermes Banks (Isoptera: Kalotermitidae) from the West Indies’. Mill. Proceedings of the US National Museum. Termitidae. vol. y Araujo. y Bandeira. vol. E. (1968) ‘A revision of the Neotropical genus Neocapritermes (Isoptera. pp. pp. 148 Manual de biología de suelos tropicales . Nasutitermitinae)’. Fontes. vol. Krishna. pp. (1932) ‘Contribution toward a revision of the American species of Amitermes Silvestri’. 111–171. vol. N. 3. pp. K. Bulletin of the American Museum of Natural History. Snyder. Scheffrahn. Annals of the Entomological Society of America. vol. R. 76. R. (2001) ‘New world revision of the termite genus Procryptotermes (Isoptera : Kalotermitidae)’. L. (1961) ‘A generic revision and phylogenetic study of the family Kalotermitidae (Isoptera)’. pp. Krishna. y Krecek. J. 122. R. vol. pp. E. Bulletin of the American Museum of Natural History. 107–110. 68. Insecta Mundi. vol. y Krecek. 23. 13. University of California Publications in Entomology. A. A. 94. R. (1910) ‘Versuch einer Monographie der amerikanische Eutermes – Arten’. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten. 335–414. 7–25. (1985) ‘New genera and new species of Nasutitermitinae from the Neotropical region (Isoptera. pp. 27. F. Florida Entomologist. (1983) ‘Generic keys to the soldier caste of New World Termitidae (Isoptera: Insecta)’. 84–138. 179–190. vol. 303–408. vol. K. a new subterranean termite (Isoptera: Termitidae) from Cuba and the Dominican Republic’. H. R. J. J. T. G. vol. R. 171–325. pp. H. 603–607. Scheffrahn. y Krecek. 530–539. H. 1–76. vol. Termitidae. (1926) ‘Termites collected on the Mulford Biological Exploration to the Amazon Basin 1921–1922’. Holmgren. S. Systematic Entomology. pp. Revista Brasileira de Entomologia. Nasutitermitinae)’. 5. Light. Revista Brasileira de Zoologia. (1979) ‘Redescription and comments on the Neotropical genus Rotunditermes (Isoptera. L. 138. Scheffrahn. 9.

Pauropoda y otros Nematodos son típicos representantes de la mesofauna. sirven para colectar mesofauna que habita en el suelo mineral. El muestreo de la mesofauna (y otra biota del suelo) se encuentra integrado como parte de la estrategia global del inventario de la biodiversidad bajo del suelo. acari y otra mesofauna del suelo: el método Berlese Agus Karyanto. Protura.Capítulo 4 Collembola. bien por el método Berlese-Tullgren o por el de Berlese modificado. Cahyo Rahmadi.2 y 2. b) del contenido líquido de las trampas pitfall. Los núcleos de suelo. Collembola (colémbolos).0 mm. en principio. a 3 m y 6 m de radio del monolito. Elizabeth Franklin. y cuya abundancia no puede ser evaluada con exactitud por medio de la selección manual del suelo. respectivamente. localizadas a por lo menos 14 m del centro del monolito. Acari (ácaros). formas de larvas de especies de macrofauna también caen dentro del rango de tamaño de mesofauna. Enchytraeidae. y se complementan con pitfall. sin embargo. En cada punto de muestreo. por debajo de la hojarasca de la superficie y en la hojarasca en sí. Susilo y Jose Wellington de Morais INTRODUCCIÓN La mesofauna está conformada por animales cuyo tamaño de cuerpo oscila entre 0. La mesofauna se colecta utilizando dos métodos de muestreo: a) una muestra compuesta que contiene varios núcleos de suelo y hojarasca extraída de la superficie. 149 . descrito en el Capítulo 2. los núcleos de suelo se localizan en dos círculos concéntricos. Francis-X. mientras las trampas pitfall se utilizan para colectar los que habitan en la superficie del suelo.

asimismo. 1990). de manera que la muestra se seca lentamente. su densidad puede alcanzar cientos de miles de individuos por m². En este sistema circula agua caliente entre las paredes dobles de latón del embudo (o embudos). después de muertos. reemplazando la envoltura de agua por un foco de luz eléctrica. se convierten en un importante desecho nitrogenado. a su vez. por ejemplo. Se sugiere que para un muestreo normal ambas extracciones de embudo y pitfall deben emplearse de manera conjunta. se alimentan de nematodos vivos (Siepel. Tullgren modificó el método Berlese. El principio es colectar pequeños núcleos o bloques y combinarlos para hacer una sola muestra compues150 Manual de biología de suelos tropicales . Los ácaros oribátidos (también conocidos como Cryptstigmata a los que se refieren como ácaros escarabajos o ácaros de caja) son artrópodos numéricamente dominantes en los horizontes orgánicos de la mayoría de los suelos. y algunos son predadores. MÉTODOS DE MUESTREO Los protocolos aquí descritos abordan principalmente los de los ácaros y colémbolos presentes en los horizontes minerales y en la hojarasca. 1990). a finales del siglo XIX. El método pitfall (Capítulo 3. sin embargo. Lo anterior es aplicable para los grupos mayores de microartrópodos del suelo o a partir de las proporciones de abundancia y diversidad entre los grupos de mesofauna del suelo. constituyen un componente integral de la estructura del suelo. al igual que en la formación de la estructura de suelo.) es suficientemente eficaz como para poder capturar colémbolos que viven en la superficie del suelo (edáficos). normalmente. fue desarrollado por Antonio Berlese. Estos ácaros se alimentan de materia de plantas vivas o muertas y de carroña. no resulta útil para colectar ácaros oribátidos (Acari: Oribatida) porque estos animales. en suelos no perturbados. 2004). forrajean en hongos y algas. Sus heces fecales proporcionan una amplia superficie para la descomposición primaria por hongos y bacterias y. su abundancia. composición de especies y diversidad en un hábitat específico son buenos indicadores de un suelo “sano” (Minor. con una diversidad de especies también muy alta y. son sedentarios (con la excepción de algunas familias como Galumnidae y Scheloribatidae).El método Berlese es un sistema de extracción por embudo para separar los pequeños artrópodos del suelo. se pueden encontrar entre 50 y 100 especies (Norton. en contraste con los grupos más oportunistas como los colémbolos. Debido a su papel regulador en la descomposición y el reciclaje de nutrientes. En 1918.

para ello es recomendable utilizar un vehículo con aire acondicionado. el suelo deberá someterse de inmediato a su extracción. Al llegar al campo de base o laboratorio. se colocan todos los costales de tela bajo techo. se colectan en el campo. el suelo de 12 sub-muestras se coloca entonces en una bolsa de 5 kg como una muestra compuesta. con un promedio de un kilo por bolsa.5 x 3.5 x 5 cm de profundidad. porque la tela permite que circule el aire. Una vez en el laboratorio. donde serán identificadas. las muestras del suelo pueden ser colectadas en muestras de 3. C ollembola . con una capa de papel para mantener un ambiente de humedad estable dentro de la caja. lo que provocaría la muerte de la mesofauna antes de su extracción.1a y b). No se debe usar un costal de plástico porque la temperatura del suelo puede aumentar sustancialmente. la cual es entonces sub-muestreada por extracción por el método de BerleseTullgren. acari y otra mesofauna del suelo 151 . evitando que la temperatura se eleve. Dichas muestras deben permanecer alejadas del calor del motor del vehículo y de su sistema de escape. de acuerdo con su localidad de muestreo. La muestra compuesta de suelo se divide en 10 bolsas de nylon. De manera alternativa. Las muestras de suelo.5 x 3. Si se transporta la muestra sin aire acondicionado. utilizando una pequeña cuchara que tome un volumen constante de aproximadamente 100 ml. también se deben proteger de la lluvia durante el traslado. Este aparato mide 3. Enseguida se empacan las muestras en una caja de cartón. utilizando un sacabocados. se utilizan tres o cuatro muestras compuestas y no sólo una. y toma muestras a una profundidad de hasta 5cm que posteriormente se transfieren a un recipiente de plástico de 300 ml de volumen (Figuras 4. Ahora las muestras estarán listas para su traslado al laboratorio. porque si éstas se mojan o humedecen demasiado. El siguiente paso es almacenar las muestras en cajas grandes para transportarlas hasta el laboratorio. ésta deberá situarse en el asiento del pasajero. De la misma manera. tanto la luz solar como el calor del motor. son dañinos para los animales que se encuentran en la muestra. De manera alternativa.ta.5 cm de ancho y 10 cm de alto. Se ha observado que los costales de tela son muy eficientes para almacenar temporalmente y transportar las muestras durante largas distancias y tiempos. se etiquetan y se transfieren a un costal de tela de 30 x 35 cm de tamaño. se debe evitar que la muestra se exponga a sol directo durante el encostalado en el campo. la fauna también puede morir. con o sin hojarasca. para evitar que la mesofauna muera. Así.

utilizando una pequeña cuchara o cuchillo de campo. La manera ideal es utilizar un contenedor de madera de alrededor de 160 x 50 cm.5 mm. dejando los focos encendidos cada vez 152 Manual de biología de suelos tropicales . aunque también se podrían usar los de 40 W. Morais y E.2 a) al igual que puertas. A B EXTRACCIÓN Método Berlese-Tullgren El aparato Berlese-Tullgren (Figura 4. utilizando para ello focos eléctricos (los de 25 W son ideales). deberá contener cuatro agujeros de 4 mm de diámetro para permitir que animales mayores escapen hacia abajo. Se calientan ligeramente los embudos. cerca del área de referencia. se mantiene el aparato en el laboratorio del campo de base. se debe incrementar el calentamiento de manera gradual cada día.W. éstos se suspenderán a 14 cm por encima del tamiz. para evitar que otros insectos voladores pasen a formar parte de la muestra. Se coloca un tamiz (de 8 cm de diámetro y 5 cm de altura) con muestras de suelo y hojarascas encima del embudo. cada compartimento contará con un marco para sostener los embudos de plástico (Figura 4.2) es utilizado para extraer la mesofauna activa que habita en las muestras de suelo y en la hojarasca. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. Franklin.1 Sacabocados de metal para muestrear la mesofauna en la hojarasca y en el suelo mineral. b) se utilizan guantes como precaución contra enredaderas. arañas y otros artrópodos. de 1. Cortesía de: J. hormigas. El tamaño de malla del tamiz.Figura 4. dividido en compartimentos superiores e inferiores.

Franklin.W. esto inmovilizará a la mesofauna antes de que se escape. por lo tanto.2 a) contenedor de apoyo para embudos Berlese–Tullgren. en una botella que los recibe hasta la base del embudo. la cual contiene un conservador. Las muestras se quedan en el aparato hasta que estén completamente secas. Se ajusta la posición de la lámpara para asegurar que la temperatura del suelo suba gradualmente. es decir. acari y otra mesofauna del suelo 153 . de modo que los animales que caen por la malla lo hagan de manera rápida hasta llegar a la botella que los recibe. para una mayor efectividad. Típicamente. Figura 4. Nota: nótese que las patas están sumergidas en agua para evitar la invasión de hormigas y de otros insectos. Morais y E. la temperatura de la muestra se aumenta gradualmente de 27°C hasta aproximadamente 40-45°C. b) sistema Berlese–Tullgren en operación. para evitar que el material de la muestra se seque demasiado rápido.durante mayor tiempo. por un periodo de hasta 8 días. evitando así que las especies que se mueven con mayor lentitud queden atrapadas en las capas secas y duras del suelo. Cortesía de: J. el embudo deberá presentar una superficie lisa y una fuerte pendiente. hasta que mantengan un peso seco constante que generalmente tarda unos 8 días. si se dejan durante más tiempo nacen los C ollembola . El principio básico del aparato Berlese-Tullgren es que los organismos de suelo responden al incremento de temperatura o sequedad en el suelo migrando hacia abajo hasta que finalmente caen a través de la malla.

Una ventaja de dichos sistemas es que se pueden operar a diferentes escalas. es uno de los más usuales para la extracción en la evaluación de la diversidad y densidad de microartrópodos del suelo (André et al. Para evitar lo anterior.. El envase receptor se llena con etanol al 96% para su conservación y durante intervalos de 4 a 5 días se cambia el envase receptor. En la presencia de luz. El uso de un foco puede atraer insectos nocturnos. cuando se compara con otros métodos de muestreo. arriba de las muestras de suelo. al tiempo que utilizan el mismo principio para extraer un solo núcleo o una muestra conglomerada mayor. El aparato Berlese sensu stricto puede transformarse en un modelo Berlese-Tullgren. se utiliza formol al 4% o etanol. El método Berlese modificado Cuando no se cuenta con electricidad. el equipo completo requerido es barato y puede ser fácilmente improvisado (Figura 4. A pesar de una eficiencia menor. que se muestra en la figura 4. 2006). el de Berlese. el agujero de ventilación de la tapa deberá cerrarse durante la noche. con la colocación de una bombilla de 10 a 40W. el sistema Berlese-Tullgren y.3. Asimismo. especialmente si el embudo Berlese no está perfectamente cerrado. al 96%. Un sistema Berlese que opera sin luz muchas veces permite una mejor extracción. aun en regiones remotas (Frankin y Morais. por lo que las muestras serán menos representativas. un embudo de aluminio modificado de Berlese. es el adecuado para el secado sin electricidad. éste se cerrará con una tapa para prevenir la entrada de otros insectos. en este caso.5). 2002). en cierta manera.huevos y las formas inmaduras se vuelven adultos. pueden moverse con facilidad desde el lugar del muestreo y ser ajustados para acomodar un gran número de muestras. en donde se coloca un tamiz con una malla de 2 x 2 mm (malla 13). Como líquido conservador. generalmente. dependiendo de las condiciones de humedad inicial del suelo. el tiempo de espera será de 7 a 14 días. el tiempo de incubación (tiempo necesario para extraer la fauna del suelo) es aproximadamente de 4 a 5 días. aunque tomará más tiempo. Son baratos y sencillos. lo único que se requiere es un embudo más grande y un tiempo de secado más largo. 154 Manual de biología de suelos tropicales . el embudo se coloca sin luz y el proceso de calentamiento-secado se lleva a cabo simplemente a temperatura ambiente.

El proceso de montaje debe realizarse bajo un microsC ollembola . R. después de su aclarado. Suhardjono LIPI Bogor.3 Embudos Berlese llenos de suelo y hojarasca. con embudo superior de 40 cm de diámetro. Y. Figura 4. Fuente: cortesía del Dr. los especímenes de mesofauna son montados sobre laminillas. PROCESOS DE ACLARADO Y MONTAJE DE ESPECÍMENES Para su identificación. de 50cm de altura.4 Embudo Berlese modificado. acari y otra mesofauna del suelo 155 .Figura 4. hecho de aluminio.

con o sin calentamiento. dependiendo del tamaño. este método es más barato. aunque Greenslade et al. normalmente se usa una solución de Nesbitt (su composición se describe a continuación). requiere de un microscopio compuesto. copio de disección. Los especímenes pueden ser aclarados con un 15% de KOH. (2008) propusieron una solución de KOH 10% durante 1 a 5 minutos. como algu156 Manual de biología de suelos tropicales .R. y da buenos resultados (Greenslade et al. dependiendo del pigmento y de la grasa del cuerpo del animal.Figura 4. 2008). mediante el lavado y removido de las grasas y pigmentos del cuerpo. Un método más simple de aclarado es utilizando ácido láctico. durante dos a cinco minutos. Los taxa con cutículas delicadas.. en donde se sumergen y calientan durante los diferentes periodos de tiempo. normalmente. fácil y seguro..5 Equipo básico requerido para llevar a cabo extracciones Berlese-Tullgren núcleo por núcleo. durante unos minutos. la observación de la morfología. Coelho. Después de la inmersión en KOH. se transfieren los especímenes a una solución de cloral fenol. hasta neutralizar la reacción. Para ello. Proceso de aclarado El aclarado consiste en volver más transparente el tejido de los especímenes. Cortesía de: M. aunque el hidróxido de potasio (KOH) y el ácido láctico son alternativas efectivas.

con el propósito de identificarlos viendo la quetotaxia de cada parte. Los ácaros esclerotizados pueden ser aclarados con lactofenol (compuesto por ácido láctico. Algunos grupos necesitan ser disecados o disectados antes del montaje. porque el ácido láctico continúa aclarándolos y ablandándolos.. en el C ollembola . utilizando el ejemplo de los colémbolos. sin calentamiento. en proporciones 50:25:25) o simplemente con ácido láctico (frío o caliente). fúrcula. acari y otra mesofauna del suelo 157 . por ejemplo. cristales de fenol y agua destilada. tales como cabeza. La posición de los especímenes sobre el portaobjetos difiere entre los órdenes: por ejemplo. Montaje No existen métodos totalmente satisfactorios para el montaje (Greenslade et al. En cada caso se debe regular y controlar el tiempo. Protura y Pauropoda no deben meterse en una solución concentrada de ácido. Después de su identificación. Symphypleona y Neelipleona. si no se hace. como característica clave. Otras soluciones. Los ácaros también pueden aclararse y conservarse trasladándolos del alcohol a un medio de Hoyer. muchos ácaros oribátidos se guardan en viales etiquetados. el medio líquido Hoyer. los especímenes deben transferirse a otro medio. abdomen grande (látero-lateral). Las especímenes son montados en laminillas y secadas en el horno a 70°C durante. Para dicho montaje se requiere de una solución Berlese.nos Diplura. mientras que las partes del cuerpo de los Symphypleona grandes se montarán de la siguiente manera: cabeza (dorsoventral). Las partes diseccionadas del cuerpo de los Entromobrymorpha deberán colocarse de forma dorso-ventral sobre el portaobjetos. los especímenes pueden destruirse o desarticularse. se recomienda la disección en el caso de Symphypleona y de las Paronellidae y Entomobrydae mayores (6 a 8mm). Para un almacenaje permanente. también pueden usarse para el proceso de montaje (Tabla 4. para que puedan ser bien identificados. la posición indicada es látero-lateral. abdomen pequeño y fúrcula (dorsoventral). es aconsejable montar todas las partes del cuerpo en una sola preparación. tubo ventral y en los segmentos V y VI abdominales. La disección se realiza en varias partes del cuerpo. los colémbolos Poduromorpha se deben colocar en posición dorso-ventral. con alcohol 70%. De nuevo. estos especímenes deberán sumergirse en una mezcla de 50% de ácido láctico/etanol durante unas horas. patas. mientras que para los Entromobrymorpha. siete días. por lo menos. al que se añade un 5% de glicerina. Normalmente.1). 2008). En el caso de especímenes mutilados.

hacia el borde de la depresión. Krantz (1978) y Norton (1990). la pericia taxonómica quizás sea el factor determinante en la selección de una taxa para su estudio posterior.edu/course/ent591k/kwikey1. de donde se pueden obtener guías de ayuda para la identificación. Tabla 4. El espécimen puede rodarse suavemente hasta conseguir la orientación deseada. pero las preparaciones pueden hacerse semipermanentes sellando el recubrimiento con barniz de uñas transparente.5 ml de ácido hidroclórico 20 ml de agua destilada. Trave (1965). una identificación más allá de este nivel. ofrecen una buena discusión de fondo acerca de cómo aclarar y montar ácaros. 50 g de hidrato de cloro. www.ac. 5 ml de glicerina. 50 ml de agua destilada. se hace un montaje temporal. 10 g de glucosa y 5 ml de ácido acético glacial.cals. sin embargo. resulta difícil. tales como los de Bachelier (1978) y Dindal (1990). Montaje de especimenes: medio líquido de Hoyer Nota: montaje Berlese: calentar a 70°C durante 7 días. Para aclarar especimenes solución Nesbitt’s 10% KOH ó NaOH Montaje de especimenes : medio líquido de Berlese 25 ml de agua destilada. Se coloca de manera parcial un cubreobjetos sobre la depresión y se empuja el espécimen por debajo del recubrimiento.nz/key. donde se indican las características distintivas de varios grupos de invertebrados. IDENTIFICACIÓN DE ESPECÍMENES Y ANÁLISIS DE DATOS Identificación La mayoría de los invertebrados del suelo pueden identificarse hasta orden o familia con la ayuda de trabajos estándares de referencia. A nivel de especies.massey. 15 g de goma arábiga. 158 Manual de biología de suelos tropicales . aunque también se puede usar para otros grupos de mesofauna. Se encuentran disponibles varias páginas en la web. El espécimen se traslada a unas gotas de ácido láctico o glicerina en un portaobjetos excavado. 30 g de goma arábiga. en el caso de la mayoría de los grupos de artrópodos de suelo.1 Composición química para aclarar y montar especímenes.ncsu. esta última dirección también concentra la literatura principal. 40 g de hidrato de cloro y 2.php. 200 g de hidrato de cloro y 20ml de glicerina.htm o http://soilbugs.caso de ácaros de suelo. El medio líquido de Hoyer es un agente temporal y no se endurece con calentamiento. Por ejemplo.

Pauropoda. al igual que referencias de la taxonomía actual de estos grupos. Protura. a nivel familia. 1982a. de especies para algunos grupos como Nematoda. Bachelier (1978) ofrece buena información de fondo dentro de las amplias unidades taxonómicas de artrópodos del suelo e incluye guías ilustradas para varios grupos. órdenes. Chilopoda. utilizando pequeños núcleos o bloques. quienes ofrecen guías y figuras a nivel genérico para ácaros que pertenecen a la suborden Oribatida. 1981b. Symphyla. hasta nivel de familia y. Diplura. Mites. La base de identificación y clasificación se encuentra resumida en las referencias que se citan a continuación. 2008. al igual que una lista de comprobación y bibliografía de especies descritas en esta área. Enchytraeidae. C ollembola . Los recursos para la identificación de ácaros. la identificación a nivel género y/o especies. a nivel genérico. Coleoptera. la identificación de colémbolos. Balogh y Balogh (1990) ofrecen una breve caracterización y claves de identificación para ácaros oribátidos que habitan en la región neotropical. por ejemplo. El libro contiene claves de identificación para todas las clases. Los subórdenes de ácaros y muchas familias de colémbolos son de fácil identificación. Adis (2002) ofrece guías ilustradas para principiantes y cualquier persona interesada en Arachnida y Myriapoda Neurotropicales. se encuentra disponible en Greenslade et al. Collembola. ya que contiene guías de identificación ilustradas. algunas veces. Las muestras colectadas. Desafortunadamente. Análisis de datos El número de individuos en cada orden y en cada lugar. Asimismo. por lo que es recomendable tanto para principiantes como para profesionales. Balogh (1972). Scorpiones. Un estudio completo de la biología. por lo menos.permitiendo así. son combinadas para crear una muestra compuesta que se somete a extracción. Opiliones. es mostrado en Dindal (1999). Balogh y Mahunka (1983) y Balogh y Balogh (1992). en las familias Entomobryidae y Paronellidae. Pseudoscorpionida. una vez conocida su morfología y características básicas (Crossley y Coleman. Isóptera.1982b y 1983) pueden utilizarse para identificar colémbolos a nivel especies. El libro se escribió para un fácil manejo. es utilizado para estimar su abundancia. acari y otra mesofauna del suelo 159 . Araneae. están disponibles en Kranz (1978) y Dindal (1990). Isopoda. son escasas las guías específicas para este grupo en los trópicos.. 1999). algunos géneros y listas de especies terrestres conocidas. familias. Diptera y Hymenoptera. Publicaciones de Yoshii (1981a. taxonomía y ecología de grupos de la biota del suelo.

2006. J. junto con otros índices de diversidad. y Lebrun. REFERENCIAS Adis. La comparación de la composición de taxa entre usos de suelo debería llevarse a cabo utilizando un análisis jerárquico de agrupación y la unión promedio de agrupaciones de los datos transformados. de acuerdo con su función ecológica mayor (detritivoros. no 38. También puede llevarse a cabo un análisis adicional como rarefacción y estadística multivariada. los taxa escasamente conocidos también se pueden clasificar a niveles taxonómicos más altos (orden o familia). Ducarme. 2005. El programa DIVERS. basada en la correspondencia estadística entre combinaciones de singletons y de otras especies raras (estimador de abundancia Chao-SØrensen) fue desarrollada por Chao et al. G.. incluir la riqueza de especies en el caso de los taxa seleccionada para la identificación a nivel especies. (1978) “La faune des sols. tales como colémbolos. un nuevo estimador estadístico que toma en cuenta especies compartidas no detectadas.. son écologie et son action“. André. 2006). Los datos obtenidos deben. El número de individuos normalmente se transforma de forma logarítmica log: x’=log10 (x+1) para evitar dar mayor peso a las especies dominantes en el análisis de datos (Ludwig y Reynolds. (2002) Amazonian Arachnida and Myriapoda. ácaros oribátidos y hormigas. etc. X. 2006). Paris. del paquete de metodología ecológica para Windows. Ph. pp. 1988). M. 3–24. H. Dado que los grupos de lugares similares ofrecen una fauna similar y que la mayoría de animales del suelo pueden distribuirse en los grupos funcionales básicos (Ruf et al. Se ha demostrado que datos a nivel género y familia. pueden ser calculados utilizando el programa EstimateS (Colwell. (2002) “Soil biodiversity: Myth. ejemplo: ácaros oribátidos. Este índice resulta especialmente útil para eliminar invertebrados hiper-diversos.). Pensoft. también pueden detectar los efectos de la perturbación con poca pérdida de información y llegar a ser una herramienta preliminar para describir patrones y sucesiones en ecosistemas del suelo perturbado por humanos (Caruso y Migliorini. predadores. vol. 96. 160 Manual de biología de suelos tropicales . ORSTOM. fitofagos. 2003). por lo tanto. con numerosas especies raras. puede usarse para calcular los índices de riqueza de especies. o bien. Initiations et Documents Techniques.utilizando el método Berlese-Tullgren. Este estimador. Este procedimiento mejora la eficiencia de la extracción porque maximiza las posibilidades de captura de grupos o especies representativos. Bachelier.. reality or conning?” Oikos. Sofia-Moscow.

L. T-J. Ecology Letters.edu/estimates. Mahunka (eds) The Soil Mites of the World. Amsterdam. O. (1972) The Oribatid Genera of the World. pp. Caruso. y Migliorini. Balogh. Minor. html. Boca Raton. P. R. no 1.Balogh. Chao. (1978) A Manual of Acarology. P. John Wiley and Sons. in D. (1999) ‘Microarthropods’. L. y Shen. Budapest. Elsevier. K. Balogh. G. (1992) The Oribatid Mite Genera of the World.. Brussaard (eds) Soil Biodiversity in Amazonian and Other Brazilian Ecosystems. 142–162. S Moreira. 8. K.. J. R. 59–65. New York. C ollembola . P. Acta Oecologica. pp. R. (2005) ‘A new statistical approach for assessing compositional similarity based on incidence and abundance data’. y Morais.ac.nz/~maminor/mites.. pp. R. Elsevier. y Suhardjono. 2. J. M. A. John Wiley and Sons. pp. 30. R. Fauna Malesiana. J. Franklin. Siqueira and L. R. y Balogh. acari y otra mesofauna del suelo 161 . in M. Oregon State University Book Store Inc.. (2006) ‘EstimateS: Statistical estimation of species richness and shared species from sample. S. E. Krantz. F. in F. CABI Publishing. Deharveng. (1990) ‘Acarina: Oribatida’. J. M. (2004) ‘Soil mites and other animals’. y Shen. New York. Balogh. T-J. vol. Ludwig. 2. Budapest. Version 8 User’s Guide and Application’. D. Norton. M. no. pp. Sumner (ed) Handbook of Soil Science. A. (1983) Primitive Oribatids of the Palaearctic Region. Amsterdam. y Balogh. Hungarian Natural History Museum Press. W. Dindal. Chazdon. K. http://viceroy. www. 779–803.. L. (1988) Statistical Ecology: A Primer on Methods and Computing. Brill. y Reynolds. vol. Balogh and S. Biometrics. 148–159. Colwell. vol. Chazdon. J.. (1990) Soil Biology Guide. (2006) ‘Abundance-based similarity indices and their estimation when there are unseen species in samples’. D. Leiden (in press). (2006) ‘Micro-arthropod communities under human disturbance: Is taxonomic aggregation a valuable tool for detecting multivariate change? Evidence from Mediterranean soil oribatid coenoses’.eeb. L. A. Crossley. Dindal (ed) Soil Biology Guide. uconn. E. Bedos. J. Colwell. pp. Wallingford. Akadémiai Kiadó. A. Greenslade. CRC Press. 361–371. Chao. W.massey. accessed 10 January 2008. in J. J. 46–53. T. vols 1 and 2. (2006) ‘Soil Mesofauna in Central Amazon’. John Wiley & Sons. 62. A. J. y Mahunka. (1990) ‘Oribatid Mites of the Neotropical Region II’. y Coleman. no.. New York. L. Oregon. Y. R. D. (2008) Handbook to Collembola of Indonesia. Colwell.

pp. Yoshii. Dreher. R. 5. Japan International Cooperation Agency. y Spelda.Ruf. Yoshii. Japan International Cooperation Agency.. EX-1 JR. Japan International Cooperation Agency. 81-12. Oribatida. vol. 9. (2003) “A biological classification concept for the assessment of soil quality: “Biological soil classification scheme” (BBSK)’. Entomological Report from the Sabah Forest Research Centre No. J. 139–144. pp. 1–70. d’observation et de conservation des Oribates (Acariens) et autres microathropodes”. Ecosystems and Environment.. 162 Manual de biología de suelos tropicales . vol. Japan International Cooperation Agency. Japan International Cooperation Agency. (1990) ‘Niche relationships between two panphytophagous soil mites. Revue d’Écologie et de Biologie du Sol. vol. pp. 1–38. Hund-Rinke. 6. Yoshii. 2. (1981a) ‘Paronellid Collembola of Sabah’. (1982a) ‘Lepidocyrtid Collembola of Sabah’. Agriculture. pp. Biol. P. Beck. 23–47. Travè. A. pp. Entomological Report from the Sabah Forest Research Centre No. Camisiidae)’. R. R. 1–28. Entomological Report from the Sabah Forest Research Centre No. no. Entomological Report from the Sabah Forest Research Centre No. pp. (1965) “Quelques techniques de récolte. 263–271. Soils. Yoshii. (1983) ‘Studies on Paronellid Collembola of East Asia’. 8112. (1981b) ‘Neanurid Collembola of Sabah’. pp1–38. R. (1982b) ‘Studies on the Collembolan Genera Callyntrura and Dicranocentroides’. 2. pp. 98. Römbke.. 4. Fert. Yoshii. 3. 1–70. K. Nothridae) and Platynothrus peltifer (Koch) (Acari. Siepel. R. Nothrus silvestris Nicolet (Acari. de triage. J. EX-1 JR. no. 7. L. H. J. Entomological Report from the Sabah Forest Research Centre No. Oribatida. 1–3..

los nematodos se adaptaron a la exploración de una amplia variedad de fuentes de alimento. 1982). La palabra nematodo deriva del griego “nema” que significa “forma de un hilo”. animal y de plantas. 1990). ya que poseen un cuerpo alargado y cilíndrico. Derivado de su evolución.Capítulo 5 Nematodos del suelo Juvenil E. 1980. ellos juegan un papel importante como agentes de ciclado de nutrientes y como reguladores de la fertilidad del suelo mediante el flujo de energía y la movilización y utilización de nutrimentos (Procter. algas. los cuales se consideran uno de los grupos de animales más abundantes y más diversos en el planeta. Los nematodos en una primera aproximación. protozoarios. son conocidos como una amenaza para la salud humana. Aunque la biomasa de nematodos en el suelo es pequeña (10¹ a 104 mg peso seco m-2). los nematodos están presentes en cualquier lugar donde exista carbono orgánico. los nematodos parásitos tienen la capacidad de colonizar y alimentarse de tejidos de plantas y animales. Debido a su gran capacidad de adaptación. Cares y Shiou P. ellos son responsables del 10 a 15% de la respiración de los animales del suelo (Sohlenius. De esta manera. sin embargo. mientras que las formas de vida libre se alimentan de microorganismos (bacterias y hongos). Petersen. otros nematodos y microinvertebrados. Huang (†) INTRODUCCIÓN Los nematodos del suelo son pequeños invertebrados dependientes del agua. en todas las latitudes del planeta y desde fondo del mar hasta la cima de las montañas. además de estos bene163 .

en la mayoría de los casos la identificación de los diferentes grupos funcionales puede lograrse en base a la morfología de su aparato bucal. micófagos. Por tal motivo. una condición que puede interpretarse como indicador de la fertilidad del suelo (Ferris et al. son polífagos.ficios para el ecosistema. por lo que pueden fungir como micófagos. Se distinguen también entre ellos mismos por su 164 Manual de biología de suelos tropicales . bacteriófagos. influir en la nodulación por parte de bacterias tipo Rhizobium. Su omnipresencia y abundancia en todo tipo de suelos y hábitats acuáticos. equipados en su mayoría con un estilete pequeño y delicado (Ilustración 2b). algunos nematodos micófagos son pueden comportarse como parásitos facultativos de plantas. poseen un estilete que les permite alimentarse de otros nematodos. los nematodos bacteriófagos pueden incrementar su población ante cualquier perturbación del suelo o bien. el aparato bucal incluye un estilete tipo aguja (lustración 2a). 2006). o en algunos casos. los nematodos están bien representados a lo largo de la red trófica del suelo. pueden regular el nitrógeno y el fósforo disponible para las plantas. así como su ciclo de vida corto y sensibilidad ante alteraciones ambientales. benéficos y micorrízicos. Algunos nematodos viven en un amplio rango de ambientes. mediante el cual puede causar pérdidas significativas en varios cultivos. bacteriófagos. compuestos por lo general de cinco grupos funcionales principales: parásitos de plantas. bajo condiciones de enriquecimiento de nutrimentos. 2001). Como típicos estrategas r. Los micófagos. Los omnívoros tienen la cavidad bucal armada con un estilete hueco (Ilustración 2e). Los nematodos depredadores tienen la cavidad bucal equipada con una o más estructuras en forma de dientes (Ilustración 2d). así como alimentarse y diseminar bacterias benéficas y fitopatógenas. Los nematodos bacteriófagos. patogénicos. en algunos casos. tal es el caso de los nematodos entomofílicos Deladenus siricidicola o los entomopatógenos Steinernema carpocapsae y Heterorhabditis bacteriophora. pueden alimentarse de bacterias y esporas de hongos. Aunque la identificación de estos organismos requiere de intenso entrenamiento. En el caso de nematodos parásitos de plantas. también participan en importantes servicios del agroecosistema al fungir como agentes de control biológico de plagas de insectos. con la capacidad de alimentarse de cualquier fuente. Los nematodos del suelo viven en grupos o gremios. se alimentan de las hifas de hongos saprofíticos. los califican como poderosos bioindicadores de condiciones ecológicas (Huang y Cares. depredadores y omnívoros (Ilustración 2). mismos que carecen de estilete (Ilustración 2c). mientras otros ocupan áreas más restringidas. microinvertebrados y protozoarios. herbívoros y también como depredadores al alimentarse de otros nematodos.

se agita durante 30 segundos y se deja reposar otros 2 minutos para que las partículas del suelo se sedimenten. además son los más resistentes a la perturbación del suelo y a contaminantes químicos. la cual se vacía a una cubeta con 2 litros de agua. Según lo propuesto por Bongers (1990) y Bongers y Borgers (1998). Por otra parte. puede presentar un índice de sistemas de uso de suelo y cambios de uso de suelo y medir los niveles de perturbación provocados por contaminantes y otros factores. poseen una baja movilidad. abundancia y estructura de comunidad. por tal motivo. MUESTREO DE SUELO En cada punto de muestreo dentro de un sistema de cuadrícula (véase Capítulo 2). Las muestras son transportadas al laboratorio en una caja aislada y almacenadas a 4° C hasta su extracción. y los nematodos se colectan directamente en un tamiz de 400 mallas (tamaño de malla de 37 µm) (Figura 5. Esta suspensión se pasa a través de tamices de 40 a 60 mallas (tamaño de malla de 250 a 350 µm. Para colectar el suelo se utiliza un nucleador de acero y las muestras se toman en cuatro puntos equidistantes en el círculo pequeño. respectivamente). todos los núcleos de suelo se deben tomar a una profundidad de 20 cm. Los doce núcleos de suelo se depositan en una bolsa de plástico que deberá sellarse para evitar su desecación y además protegerla de la luz solar. lo cual deberá hacerse con la mayor rapidez posible. producen muchos huevecillos pequeños. los nematodos colonizadores (similares a los estrategas r) típicamente poseen un tiempo de generación corto. con un radio de 3 m y 6 m. pero más grandes.sensibilidad a la perturbación del suelo y a los contaminantes químicos. y ocho puntos en el círculo grande. una ausencia de dauerlarva y sensibilidad ante contaminantes y otros factores de perturbación. un análisis apropiado de la comunidad de nematodos. tomando en cuenta su diversidad. se trazan dos círculos concéntricos. producen pocos huevillos. EXTRACCIÓN DE NEMATODOS La muestra de suelo se mezcla completamente y se toma una submuestra de 300 ml. respectivamente. A esta última suspensión de nematodos se le pueden eliminar aún más partículas de N ematodos del suelo 165 .1). los nematodos persistentes (similares a estrategas k) se caracterizan por necesitar un largo tiempo de generación. muestran la presencia de dauerlarva e incrementan sus poblaciones cuando existen condiciones ricas en alimentación.

Los especímenes que se hallan sobre la malla se lavan y arrastran con agua. Posteriormente.3a). 166 Manual de biología de suelos tropicales .1 A la izquierda. 1970).2b). para luego colectarse en un vaso de precipitados (Figura 5. FIJACIÓN Y CONTEO DE NEMATODOS Los nematodos extraídos se matan con agua caliente a 50-60°C durante un máximo de un minuto (Figura 5.000 rpm durante uno a dos minutos. dejando así una suspensión de nematodos de 10 a 20 ml. 1964). se distribuye en tubos de ensayo para su fijación. se añade un volumen igual de solución Golden Figura 5. En este procedimiento. los nematodos se colectan a partir del sobrenadante utilizando un cernidor con tamaño de malla de 37 µm (Figura 5. posteriormente se fijan con solución Golden 2X (Hooper. La suspensión. contenida en el vaso.suelo mediante un método modificado de centrifugación con flotación de azúcar (Jenkins. juego de tamices de metal (de tamaño de malla 45 arriba y 400 abajo). y a la derecha. el sedimento o botón dentro del tubo de centrífuga se resuspenden en solución de sacarosa (456g L-1) (Figura 5.2a) y se centrifuga de nuevo a 1.3b) y.500 rpm durante 5 minutos y el sobrenadante se descarta. Una vez calentados los tubos. la suspensión acuosa se centrifuga primero a 3. éstos se dejan reposar durante 30 minutos y se remueve el exceso de sobrenadante utilizando una pipeta o por medio de succión al vacío (preferentemente). suspensión de suelo en reposo. Posteriormente.

2%. el número total se obtiene de multiplicar la media de tres conteos de manera que el número total representará el número medio de 3 conteos de submuestras x 15. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. con lo que se obtiene una concentración final de formol 3. 2X. N ematodos del suelo 167 . a b Figura 5. de alícuotas de 1 ml. b) muerte de nematodos en agua caliente. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa.3 a) Nematodos recuperados mediante el lavado de malla de 400.Figura 5.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos. La suspensión resultante se ajusta a un volumen de 15 ml y se cuenta el total de nematodos en la población mediante la toma al azar.

Cares y Huang..5. 1951. Andrássy. 2001). luego se añaden 7 ml de la solución Seinhorst I (Figura 5. Después de este proceso. 1991. El procedimiento se ilustra en la Figura 5. 1992. 1991.5. 1991. 1991. Goseco et al. al final. Geraert. la caja se coloca en un desecador a 43°C durante la noche (Figura 5.1) y el volumen resultante se vacía por completo en una caja Petri de 5 cm de diámetro.000 x). utilizando una gota de glicerina deshidratada como medio de montaje. Maggenti. Baldwin y Mundo-Ocampo. Raski. La modificación consiste en reducir a 3 ml el volumen de la suspensión (Figura 5. Jairajpuri y Ahmad. se tapa la caja y se deja nuevamente en el desecador durante la noche. La identificación de nematodos por caracteres morfológicos se basa en la literatura taxonómica especializada (Goodey. 1991. Loof. 1988. 1959) suele modificarse para evitar la laboriosa tarea de pescar individualmente cada nematodo y elaborar numerosas preparaciones permanentes. 1993. El volumen de la caja se reestablece con solución Seinhorst II. 1991. Decraemer. utilizando un microscopio compuesto (se requiere un aumento de 400 a 1. Fortuner. la caja se retira del desecador y se deja evaporar a la misma temperatura durante un mínimo de cuatro horas. May et al. Smart Jr y Nguyen. Se hace una selección al azar de aproximadamente 100 nematodos montados para su identificación a nivel de género. Tabla 5. 1994. Antes de colocar el cubreobjetos de vidrio sobre la gota. Thorne. 1991. aunque en la última ocasión no es necesario añadir solución Seinhorst II pero sí incubar a la misma temperatura durante otras 48 horas para evaporar todo el alcohol. Anderson y Potter. Nickle y Hooper. 1991. 168 Manual de biología de suelos tropicales . la preparación se sella utilizando bálsamo de Canadá (Huang et al.INFILTRACIÓN CON GLICERINA Y OBSERVACIÓN DE NEMATODOS El método de Seinhorst (Seinhorst. 1984) (Figura 5.6).1974. 1991. 1988.7). 1991. 2000. 1961. Bongers.. Estos pasos se repiten tres veces. Hunt. Smart Jr y Nguyen. Al segundo día. en esas condiciones se retira la tapa de la caja para que se reduzca por lo menos a la mitad de su volumen. los nematodos de la caja se montan en laminillas. 1996.1. se coloca una tira de cinta adhesiva para evitar que el cubreobjetos aplaste a las especímenes. 1983. mientras que la composición de las soluciones se puede observar en la Tabla 5.4).

Las cajas Petri no deben contener más de una tercera parte de líquido. Evaporación a 43°C durante 4 hrs para reducir a la mitad del volumen Completar volumen con Seinhorst II Evaporación a 43°C durante 4h para reducir el volumen a la mitad Desecador a 43°C durante la noche N ematodos del suelo 169 .4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos Figura 5.Figura 5. Nematodos en: Golden (3 ml) + Seinhorst I (7 ml) Evaporación a 43°C durante 4h para reducir el volumen a la mitad Completar volumen con Seinhorst II Desecador a 43°C durante la noche Desecador a 43°C durante la noche Desecador a 43°C durante la noche Evaporación a 43°C durante 48 horas.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos.

Foto: Marcella A. 170 Manual de biología de suelos tropicales .6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina.Figura 5. Nota: el fondo del contenedor se mantiene a 43°C. Figura 5. Teixeira.7 Charola con montajes permanentes de especímenes de nematodos. Foto Francisco Franco.

N ematodos del suelo 171 . abundancia total y abundancia relativa de cada uno de los géneros. Los datos de frecuencia y abundancia de los diferentes grupos tróficos se usan para calcular el Índice de Diversidad Trófica y varios cocientes que consideran la abundancia relativa de los grupos tróficos. Si un nematodo posee dos tipos de hábito alimenticio. Los datos sobre frecuencia absoluta. micófagos.Σpi log2 pi].Tabla 5. pueden utilizarse para calcular índices de diversidad y equitatividad.1 Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina. Índice de Diversidad de Shannon [H’ = . Índice de Riqueza de Género [d = (S – 1)/log N. depredadores y omnívoros. todos ellos basados en los criterios de Yeates et al. Golden X Formol (+ 40% formaldehído) Glicerina Agua destilada Alcohol 96% Glicerina Agua destilada 8 partes 2 partes 90 partes Seinhorst I 20 partes 2 partes 78 partes Golden 2X 16 partes 4 partes 80 partes Seinhorst II 95 partes 5 partes ÍNDICES Y PARÁMETROS PARA LA CARACTERIZACIÓN DE POBLACIONES DE NEMATODOS Los nematodos identificados a nivel de género pueden dividirse en cinco grupos tróficos: parásitos de plantas. (1993). Índice de Diversidad de Simpson [Ds = 1 – Σ(pi)². su número poblacional se divide entre dos para cada hábito. donde S = número de géneros y N = número total de nematodos]. bacteriófagos. donde pi = porcentaje de género ‘i’ en la abundancia total]. empleando las fórmulas que se mencionan líneas adelante. Equitatividad del Índice de Diversidad de Simpson [Es = Ds/Ds max’ donde Dsmax = 1 – 1/S Equitatividad del Índice de Diversidad de Shannon (J’= H’/H’max’ donde H’max = Log2 S]. cuando un nematodo tiene dos tipos de hábitos alimenticios.

el Índice de Madurez (IM) (que incluye únicamente nematodos de vida libre) (Tabla 5. La relación micófagos/bacteriófagos (M/B) y (micófagos+bacteriófagos)/parásitos de plantas [(M+B)/PP]. 1994].3). 1990). siempre están activos. y fi = frecuencia relativa del género ‘i’). pero excluyendo a los nematodos cp1) para evaluar factores de estrés inducidos por contaminación.2) y el Índice Fitoparasítico (IFP) (que incluye únicamente parásitos de plantas) (Tabla 5. Porcentajes de criconematidos y de dorylaimidos en la población. véase Norton. ausencia de dauerlavae y elevada sensibilidad ante la presencia de contaminantes y otros factores de perturbación (Bongers y Bongers. 1978. 1998). En base a estos conceptos. Bongers y Bongers (1998) propusieron IM2–5 (igual que IM. los persistentes cp5 se distinguen por tiempos generacionales largos. Magurran.2 Familias y valores cp utilizados para el índice de madurez* Familia Neotylenchidae Anguinidae Aphelenchidae Aphelenchoididae Rhabditidae 172 valor cp 2 2 2 2 1 Familia Achromadoridae Ethmolaimidae Cyatholaimidae Desmodoridae Microlaimidae valor cp 3 3 3 3 3 Manual de biología de suelos tropicales . Yeates (1994) amplió el Índice de Madurez para incluir a todos los nematodos del suelo (mIM). Índice de Diversidad Trófica [T = 1/ Σ(pi)². Bongers (1990) dividió a los nematodos del suelo en una serie desde los colonizadores (c) hasta los persistentes (p) (similar a los estrategas r y k. presentan dauerlarvae o estadios de sobrevivencia y crecen bajo condiciones de riqueza de alimento. producen muchos huevecillos pequeños. donde pi = abundancia relativa de un grupo trófico . Para medir el nivel de perturbación del suelo (Bongers. Tabla 5. la producción de pocos huevecillos pero muy grandes. Σ(vi x fi) (donde vi = valor c-p de 1 a 5 para el género ‘i’. Por el contrario. se han utilizado varios índices para la evaluación del suelo. asignándoles un “valor cp” en una escala de 1 a 5. Los colonizadores cp1 se caracterizan por tener tiempos generacionales cortos. y el cociente IFP /IM como un indicador de fertilidad del suelo. 1988. Krebs. baja movilidad. respectivamente).

3 Familias y valores cp utilizados para el índice fitoparasítico cp2 Tylenchidae Psilenchidae Tylodoridae cp3 Dolichodoridae Hoplolaimidae Pratylenchidae cp4 Trichodoridae cp5 Longidoridae N ematodos del suelo 173 Nota:*modificado de Bongers (1990). .2 Familias y valores cp utilizados para el índice de madurez* Familia Alloionematidae Diploscapteridae Bunonematidae Cephalobidae Ostellidae Panagrolaimidae Myolaimidae Teratocephalidae Diplogasteridae Neodiplogasteridae Diplogasteroididae Tylopharyngidae Odontopharyngidae Monhysteridae Xyalidae Linhomoeidae Plectidae Leptolaimidae Halaphanolaimidae Diplopeltidae Rhabdolaimidae Chromadoridae Hypodontolaimidae Choanolaimidae valor cp 1 1 1 2 2 1 2 2 1 1 1 1 1 1 2 3 2 3 3 3 3 3 3 4 Familia Odontolaimidae Aulolaimidae Bastianiidae Prismatolaimidae Ironidae Tobrilidae Onchulidae Tripylidae Alaimidae Bathyodontidae Mononchidae Anatonchidae Nygolaimidae Dorylaimidae Chrysonematidae Thornenematidae Nordiidae Qudsianematidae Aporcelaimidae Belondiridae Actinolaimidae Discolaimidae Leptonchidae Diphtherophoridae valor cp 3 3 3 3 4 3 3 3 4 4 4 4 5 4 5 5 4 4 5 5 5 5 4 3 Nota: *Bongers (1990).Tabla 5. Tabla 5.

CABI Publishing. T. T. 529–586. 174 Manual de biología de suelos tropicales . Bongers. Koninklijke Nederlandse Natuurhistorische Vereniging.and non-cyst-forming nematodes’. New York. M. London. 185–223. S. Cares. pp. (1994) De Nematoden van Nederland. (1991) ‘Stunt nematodes: Tylenchorhynchus. 14–19. Chave sistemática simplificada para gêneros Parte I”. Budapest. 239–251. New York. T. Bibliotheekuitgave no 46. Revisão Anual de Patologia de Plantas. Moreira. in F. Cares. G. Koninklijke Nederlandse Natuurhistorische Vereniging.Tabla 5. 8. 46. y Huang. E. V. M. J. 163–183. O. Baldwin. vol. Bongers. Schoorl. vol. no. vol. vol. y Bongers. y Huang. P. (1983) A taxonomic review of the suborder Rhabditina (Nematoda Secernentia). Nickle (ed) Manual of Agricultural Nematology. Eötvös Lorand University. Merlinius. T. 177–235. E. W. The Netherlands. The Netherlands. pp.3 Continúa cp2 Ecphyadophoridae Paratylenchidae Anguinidae cp3 Heteroderidae Hemicycliophoridae cp4 cp5 Nota: * modificado de Bongers (1990). Siqueiera and Brussaard. (1991) ‘Heteroderinae cyst. M. J. 9. (2001) “Taxonomia de fitonematóides. pp. (eds) (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. Bibliotheekuitgave no. (1988) De Nematoden van Nederland. Pirola. 83. L. in W. 2nd edition. E. y Huang. Cares. R. pp. 10. J. (1998) ‘Functional diversity of nematodes’. Nickle (ed) Manual of Agricultural Nematology. Pirola. S. pp. Marcell Dekker. Schoorl. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian amazon and savanna vegetation’. J. REFERENCIAS Anderson. 3. Andrássy. Oecologia. I. (2000) “Taxonomia atual de fitonematóides. P. 275–362. y Mundo-Ocampo. pp. Applied Soil Ecology. R. y Potter. (1990) ‘The maturity index: An ecological measure of environmental disturbance based on nematode species composition’. J. Bongers. S. and related genera’. Bongers. Revisão Anual de Patologia de Plantas. pp. R. P. in W. Chave sistemática simplificada para gêneros Parte II”. Marcel Dekker. J.

pp. R. 48. W. Geraert. W. O. M. E. (1994) Ecology: The Experimental Analysis of Distribution and Abundance. Goodey. (1992) Dorylaimida: Free-living. A. C. (1984) ‘Preparing nematode permanent mounts with adhesive tapes’. pp. M. D. J. Fortuner. Nickle (ed) Manual of Agricultural Nematology. R. staining and mounting nematodes’. pp. New York. (2001) ‘A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept’. J. 16. (1991) ‘Nemata: Higher classification’. Goseco. J. M. S. Wallingford. T. Huang. S. J. 662–665. Bongers. 18. S. (1970) ‘Handling. 363–422. (1951) Soil and freshwater nematodes. and Trichodoridae: Their systematics and bionomics. 341–342.. 4th edition. (1964) ‘A rapid centrifugal flotation technique for separating nematodes from soil’. P. (1991) ‘Tylenchidae in agricultural soils’. Fisheries and Food. Hooper. Purdue Nematode Collection Department of Entomology. Wallingford. New York. R. Ministry of Agriculture. (1991) ‘The Hoplolaimidae’. Siqueira and L. G. 1949’. 147–190. Allotrichodorus. H. R. Methuen and Co. Jairajpuri. pp. Nickle (ed) Manual of Agricultural Nematology. Applied Soil Ecology. G. Leiden. in F. Marcel Dekker. y Silva. pp. in W. Marcel Dekker. New York. in W. vol. D. (1974) Revision in Leptonchoidea (Nematoda: Dorylaimida). y Cares. (1993) Aphelenchida. S. R. New York. y Ferris.Decraemer. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian Amazon and savanna vegetation’. Ltd. Brussaard (eds) Soil biodiversity in Amazonian and other Brazilian ecosystems. London. (1991) ‘The family Pratylenchidae Thorne. 587–626. P. no 1. y Goede. in J. Ferris. Moreira. R. West Lafayette. CAB International. pp. Hunt. A. F. pp. J. no 3. Indiana. R. Southey (ed) Laboratory Methods for Work with Plant and Soil Nematodes. fixing. C. pp. 795–826. F. E. 669–720. and Monotrichodorus’. 13–29. Nickle (ed) Manual of Agricultural Nematology. pp. in W. Plant Disease Reporter. Paratrichodorus. Harper Collins College Publishers. Purdue University. Journal of Nematology. Nickle (ed) Manual of Agricultural Nematology. Longidoridae. New York. Bittencourt. vol. vol. in W. Predaceous and Plant Parasitic Nematodes. Loof. Nickle (ed) Manual of Agricultural Nematology.. W. T. C. Jenkins. in W. 34–39. V. N ematodos del suelo 175 . (1991) ‘Stubby root and virus vector nematodes: Trichodorus. F. M. M. Maggenti. 163–183. and Ahmad. Brill. Marcell Dekker. J. Krebs. R. no 9.. 1st edition. E. E. CAB International. R. Marcel Dekker. pp. Technical Bulletin No 2. Huang. Ferris. New York. R. Marcel Dekker. C.

Procter.. R. Nickle (ed) Manual of Agricultural Nematology. 1–7. J. D. 186–194. leaf. Journal of Nematology. New York.Magurran. E. pp. Sohlenius. 176 Manual de biología de suelos tropicales . S. 97–101. D. R. B.. Lyon. C. K. H. and Nguyen. (1996) Pictorial Key to Genera of Plant Parasitic Nematodes. J. Journal of Nematology. John Wiley and Sons. J. G. (1990) ‘Global overview of the functional roles of soil-living nematodes in terrestrial communities and ecosystem’. 315–331. H. in W.’. W. M. D. B. de Goede. 1. (1988) Ecological Diversity and its Measurement. Thorne. biomass and contribution to energy flow by soil nematodes in terrestrial ecosystems’. vol. 38. pp.an outline for soil ecologists’. Oikos. C. Freckman. K. vol. 5th edition. Yeates. 465–508. 25. C. (1980) ‘Abundance. Marcel Dekker. B. no. G. R. pp. (1991) ‘Tylenchulidae in agricultural soils’. pp. University of Florida. Nickle. 627–668. L. H. (1988) Illustrated Key for Identification of Common Nematodes in Florida. Nickle (ed) Manual of Agricultural Nematology. no. 22. Cornell University Press. Raski. New York. W. Marcel Dekker. G. and insect nematodes’. (1994) ‘Modification and quantification of the nematode maturity index’. R. C. P. New York. Pedobiologia. F. Cambridge. no. Nickle (ed) Manual of Agricultural Nematology. Gainesville.. in W. T. 39. (1959) ‘A rapid method for the transfer of nematodes from fixative to anhydrous glycerin’. W. (1978) Ecology of Plant Parasitic Nematodes. Norton. G. May. pp. Yeates. W.. R. pp. 3. W. vol. Mullin. (1991) ‘Sting and awl nematodes: Belonolaimus spp. and Dolichodorus spp. K. Marcell Dekker.. D. y Nguyen. 67–69. in W. vol. Smart Jr. D.. (1982) ‘Structure and size of soil animal populations’. Bongers. Cambridge University Press. Oikos. S. 34. New York Petersen. New York. New York. (1993) ‘Feeding habits in soil nematode families and genera . vol. G. W. (1991) ‘The Aphelenchina: Bud. G. 4. pp. Seinhorst. 306–329. G. y Hooper. 761–794. McGraw Hill Co. vol. y Loeffer. (1961) Principles of Nematology. pp. pp. Smart Jr. 2. A. y Georgieva. Nematologica.

Sistema de extracción de hormigas y escarabajos con trampas Winkler a) Delimitación de un metro cuadrado de hojarasca.Ilustración 1. que contiene alcohol al 70%. por un marco. c) Introducción de la hojarasca en un tamiz para separar los fragmentos más gruesos. i . desde el borde hacia el centro. b) Colecta de la hojarasca utilizando guantes de cuero. d) Transferencia del material tamizado a bolsas de nylon en campo. e) Cada muestra de hojarasca tamizada se transfiere a una red. f y g) Se fijan las redes al interior de la trampa Winkler previamente colgadas en un espacio bien aireado con un frasco colocado en el fondo.

D) depredador. A y B: Estoma con estilete C: Estoma sin estilete D: Diente dorsal E: Odonto estilete ii Manual de biología de suelos tropicales . Fotomicrografías de la región anterior en las que se muestra el aparato bucal (flechas) de nematodos de suelo pertenecientes a diferentes grupos funcionales: A) parásito de plantas.Ilustración 2. Fotos: Juvenil Cares. B) micófago. C) bacteriófago. E) omnívoro.

b) Plantas de Prosopis juliflora en agar inclinado con solución de nutrientes. Moreira excepto e) de Lima et al. Pasos de la metodología para caracterizar a las bacterias fijadoras de nitrógeno y formadoras de nódulos en leguminosas (BFNFNL) aplicada en el proyecto CSMBGBD. 2009. I lustraciones a color iii . tropici (CR crecimiento rápido) creciendo en YMA f) Perfiles de Rep-PCR de e) Perfiles de proteínas totales obtenidos por electroforesis diferentes cepas. Fotos: F. en gel de poliacrilamida.Ilustración 3. a) Siratro en bolsa de plástico con solución de nutrientes Pheseolus vulgaris c) Pruebas en plantas de Pheseolus vulgaris para ver la eficiencia de aislamientos en Jarras de Leonard.. cr CL CL d) Características de dos aislamientos de Bradyrhizobium (CL de crecimiento lento) y de R. PAB vol 319.

Ilustración 4. g) espora de Acaulospora scrobiculata mostrando la cicatriz (flecha) que queda en la espora después de que se suelta el sáculo esporífero. iv Manual de biología de suelos tropicales . c) detalle de la ornamentación de la pared de la espora (verrugas) de Scutellospora coralloidea. pared germinal 1 (gw1) y pared germinal 2 (gw2) con su capa más interna en reacción con el reactivo Melzer. h) esporas de Acaulospora sp. mostrando algunos sáculos esporíferos todavía fijados a la espora (flecha). obsérvese el escudo redondo de germinación de color café que contrasta con el color hialino de la espora. típica de la familia. Fotos: Sidney Stümer. Esporas y estructuras producidas por especies de hongos micorrizógenos arbusculares de la familia Gigasporaceae: a) espora de Gigaspora albida mostrando la célula suspensora bulbosa (flecha). Esporas y estructuras producidas por especies de HMA de la familia Acaulosporaceae: e) espora de Entrophospora colombiana mostrando la pared de la espora. f) espora de Entrophospora colombiana mostrando las dos cicatrices (flecha). d) células auxiliares nudosas diferencias por miembros del género Scutellospora. b) espora de Scutellospora scutata con la célula suspensora bulbosa (flecha).

Esporas y estructuras producidas por especies de HMA de la familia Glomeraceae: a) Espora de Glomus clarum mostrando la hifa de sostén. d) Esporocarpo de Glomus sp. L2 y L3) (obsérvese que la capa L2 está ornamentada con pequeñas crestas). obsérvese que la capa más profunda de la pared de la espora se separa y se asemeja a la pared germinal.caf. Fotos: Sidney Stümer. g) Espora de Paraglomus occultum mostrando la estructura de la pared de la espora formada por tres capas (L1. b) Espora de Glomus sp. I lustraciones a color v . L2 y L3). f) Detalle de Archaeospora Leptoticha mostrando salientes y depresiones en las capas 2 y 3 de la pared de la espora (flecha). brasilianum que fueron tomadas de http:// invam. c) Esporocarpo de Glomus clavispora. mostrando la pared de la hifa de sostén de manera continua con la pared de la espora. Esporas y estructuras producidas por especies de HMA de la familia Archaeosporaceae (e y f) y Paraglomeraceae (g y h): e) espora de Archaeospora Leptoticha con sáculo esporífero.wvu.Ilustración 5. h) Espora de Paraglomus brasilianum mostrando la estructura de la pared de la espora formada por tres capas (L1. excepto de Paraglomus occultum y P.edu.

Aislamientos de hongos zoospóricos de muestras del ambiente (Oomycota y Chytridiomycota): a) muestra de suelo con cebo. vi Manual de biología de suelos tropicales .Ilustración 6. c) cultivo puro en cebo. b) muestra de agua con cebo. e) Oogonio y anteridio de Pythium. f) Pythium liberando zooesporas. d) esporangio de Phytophthora.

Fotos: Lucas M.Ilustración 7. Abreu. b) tamices con diferentes mallas. h) colonias de hongos en medio de cultivo para retardar el crecimiento. Técnica de lavado del suelo para el aislamiento de microhongos del suelo: a) Pre-lavado. I lustraciones a color vii . c) suelo pre-lavado. e) partículas de suelo lavado. f) medio de cultivo en placas. d) continuando con el procedimiento de lavado. g) placa con partículas de suelo para su incubación.

E) Adulto de mosca de la fruta y detalle del aculeo. A C Banda costal Banda “s” Banda “s” D B E Cabeza Punta del oviducto Mesonoto Aculeo Mediotergio Abdomen Terminalia viii Manual de biología de suelos tropicales . A) Larvas y pupas de la mosca de la fruta en el suelo. C) Patrones alares típicos con bandas. D) Extracción del aculeo. B) Trampa MacPhail con cebo.Ilustración 8.

En el año 2006. Las cepas. La inoculación con cepas de BFNFNL altamente eficientes y adaptadas a las condiciones ambientales dominantes. debido a las múltiples interacciones que se dan entre organismos del suelo y plantas. en el caso de la soya. un conocimiento de la diversidad de BFNFNL en el suelo deberá ser el primer paso para el manejo y la conservación de este recurso genético de tanto valor. usadas para la inoculación. se utiliza en algunos países con un pequeño y selecto grupo de leguminosas con el propósito de reemplazar el uso de fertilizantes químicos de nitrógeno. En Brasil. la biodiversidad del suelo puede afectar el comportamiento de la formación de nódulos de manera positiva o negativa. S. Moreira LA IMPORTANCIA ECONÓMICA Y ECOLÓGICA DE LA SIMBIOSIS DE BACTERIAS FORMADORAS DE NÓDULOS EN LEGUMINOSAS (BFNFNL) La fijación biológica de nitrógeno es uno de los procesos más importantes para mantener la vida en el planeta. se ahorraron alrededor de US$ 3. provienen de una diversidad que se encuentra en el suelo. la inoculación con cepas de Bradyrhizobium reemplaza completamente la aplicación de fertilizantes sintéticos.Capítulo 6 Bacterias formadoras de nódulos en leguminosas Fátima M. manteniendo así la armonía con el medio ambiente. 1975). donde se cosecharon cerca de 57 millones de toneladas de soya. considerando un área de 21 millones de hectáreas. por lo tanto. 177 .3 billones de gastos en fertilizantes mediante la aplicación de esta biotecnología. al mismo tiempo. pues proporciona alrededor del 70% de todo el nitrógeno requerido en los ecosistemas naturales y agroecosistemas (Burns y Hardy.

Filum/Orden. 1991 Segovia et al. 1997 Chen et al. aunque se continúa usando en alguna literatura.. 1984 Lindström. 1889. gallicum R. El término rhizobia se deriva de Rhizobiaceae (Conn. 1938). forman nódulos en las raíces (y algunas veces en los tallos) de algunas especies de leguminosas y en las raíces de Parasponia spp. Especie de bacterias formadoras de nódulos en leguminosas.TAXONOMÍA ACTUAL DE BFNFNL Las bacterias fijadoras de nitrógeno.Familia/Género/Especie α-Proteobacteria-Orden Rhizobiales Referencia Rhizobiaceae Rhizobium R. 2004 Rivas et al. 1999a . 2001.proteobacteria (por ejemplo.1).1 Filum/Orden. (Ulmaceae). 1997 Amarger et al. 1993 Amarger et al. Una extensión reciente de conocimientos acerca de las bacterias formadoras de nódulos en leguminosas fue el descubrimiento que estableció que las bacterias pertenecientes al β-proteobacteria (género Burkholderia y Ralstonia/Cupriavidus) y a otras familias de la α. Jordan. el nombre ”rhizobia” ya no resulta idóneo para describir bacterias formadoras de nódulos.. hainanense R. etli biovar mimosae 178 Manual de biología de suelos tropicales Frank. una taxa a nivel familia de bacterias creada expresamente para acomodar organismos que pueden formar nódulos en leguminosas.. Las citas referidas describen a las especies y/o comprueban su capacidad de nodulación. viceae R. etli R. 1879. 2002. 1997 van Berkun et al. trifolii. 2003) (Tabla 6. conocidas anteriormente como rizobios... 2001. 1989 Martinez-Romero et al. 1998 Wang et al. 2001. Chen et al. Familia. 1998 Wang et al. Género. huautlense R. giardinii biovars phaseoli. por esta razón. Sy et al. Jourand et al. Methylobacterium Methylobacteriaceae y Dovosia Hyphomicrobiaceae) también pueden formar nódulos en leguminosas (Moulin et al. mongolense R. Tabla 6. leguminosarum biovars phaseoli. tropici R. galegae R. giardinii R.

Jordan et al. mesosinicum R. Filum/Orden. Chen et al. alkalisoli R. sullae R. daejeonense R. 2011 Dangeard. saheli E. 2009 Hou et al. 1994. kummerowiae E. vignae R. 2011 Zhang et al. 1999 Nick et al. medicae E. 1984. 1988. 2008 Han et al. 2008 Ren et al. 2008 Berge et al. 2003 Quan et al. 1994 Chen et al. pisi R. kostiense E. arboris E. 1999 Wei et al. selenireducens R. fredii E. 1988 de Lajudie et al. 2005 Valverde et al. morelense E. loessense R. 1926. tubonense Ensifer (Sinorhizobium) E. Chen et al. 1988. 2008 Peng et al. oryzae R. multihospitium R. 2002 Toledo et al. indigoferae R. 2002 Wei et al. 2008 Ramirez-Bahena et al. xinjiangense E. 2003 B acterias formadoras de nódulos en leguminosas 179 . 1996 Nick et al. 2009 Tian et al. 1994 Rome et al.Familia/ Género/Especie R. 1984. americanum Referencia Tan et al.Tabla 6. 2009 Lin et al. 2009 Li et al. lusitanum R. teranga E. fabae R. yanglingense R. 2002 Wei et al. 2007 Gu et al. tibeticum R. de Lajudie et al. 2001 Squartini et al. 2002 Wang et al.1 Continúa. de Lajudie et al. meliloti E. miluonense R. 2006 Hunter et al. alamii R. 2003 Scholla & Elkan. 1994 de Lajudie et al. Young.

Jarvis et al. Young. (Rhizobium) undicola Agrobacterium* A (Rhizobium). (2010) de Lajudie et al. caulinodans A.adiobacter/ tumefasciens Shinella S. 1984. 1997 Chen et al. japonicum B. liaoningense B. 2009 Merabet et al. chiapanecum E.canariense B. iriomotense Bradyrhizobium (Blastobacter) B. Jarvis et al. Jarvis et al. 2009 Lin et al. loti M. 2006** Dreyfus et al. 2009 Islam et al. 1982. 1995 Yao et al. numidicus Allorhizobium* A. 2005a Ramírez-Bahena et al. (2010) Merabet et al. 2006 Jordan et al. jicamae B. 2008 Jordan.Familia/Género/ Especie E.Tabla 6. doebereinerae Phyllobacteriaceae Mesorhizobium M. 1982. 2009 Ramírez-Bahena et al. garamanticus E. denitrificans** Xanthobacteraceae Azorhizobium A. 1992 Xu et al. 2007 Rincon-Rosales et al. adhaerens E. van Berkun et al.1 Continúa. 2002. 2002 Vinuesa et al. 2001 Cummings et al. yuanmingense B. huakuii 180 Referencia Casida. pachyrhizi B. 1991. 1997 Manual de biología de suelos tropicales . Willems et al. kummerowieae Bradyrhizobiaceae Bradyrhizobium B. 2003 Lloret et al. Filum/Orden. mexicanus E. elkanii B. Young et al. 1998a. 2008 van Berkun & Eardly. 1988 Moreira et al. 1984 Kuykendall et al. 2003.

chacoense M. 2006 Sy et al. 2008 Li et al. 1995.Familia/Género/ Especie M. nodulans Brucellaceae Ochrobactrum O. ifriqiyense*** P. Jarvis et al. 2009 Vidal et al. temperatum M. tarimense M. ciceri Hyphomicrobiaceae Devosia D. 1999b Velásquez et al. 2008 Han et al. lupini O. 1997 De Lajudie et al. 2009 Nandasena et al. 2001. 2005 Zurdo-Pineiro et al. albiziae M. opportunistum M. ciceri M. septentrionale M. amorphae M. 2005 Mantelin et al. 2007 Imran et al. 2002. 1997 Nour et al. cytisi O. 2001 Gao et al. 2004 Gao et al. leguminum*** Methylobacteriaceae Methylobacterium M. metallidurans M. 2006 Mantelin et al. 2004 Wang et al. Filum/Orden. 2004 Trujillo et al. neptuniea Referencia Nour et al. 1995. australicum M. Jarvis et al. 2010 Valverde et al. shangrilense M. Jourand et al.1 Continúa. tianshanense M. caraganae M. Jarvis et al. plurifarium M. 2008 Han et al. mediterraneum M.Tabla 6. 2010 Rivas et al. 2003 B acterias formadoras de nódulos en leguminosas 181 . 1994.alhagi Phyllobacterium P. 2009 Chen et al. 1998b Wang et al. 2009 Nandasena et al. trifolii P. 2007 Gu et al. 1997 Chen et al. gobiense M.

mimosarum B. Arubi y A. 2002. 1999.. Vermis et al. 2001 Vandamme et al..800 spp. vitis y (Young et al. tumetaciens (syn. rhizogenes. Hasta 1989. adiobacter). 2005). ** Estos autores no describieron estas especies. Mimosoideae (3270 spp. 2006 Chen et al. 2008 Chen et al. larrimoorei (Young 2004) en Rhizobium.. Las leguminosas contienen alrededor de 20 mil especies. yakushimensis β-Proteobacteria Orden Burkholderiales Burkolderiaceae Burkholderia **** B. 2010 Moulin et al. distribuidas en las subfamilias Caesalpinoideae (2250 spp. nodosa B.. phymatum B.cepacia genomovar VI) B. 2001. Vandamme et al. (Ralstonia) taiwanensis ***** Referencia Bautista et al. 2004 Chen et al. 2007 Chen et al.Tabla 6. 2002 Vandamme et al. del trópico. 2004) fueron propuestos para acomodar dichas especies de Ralstonia. Filum/Orden. A. en su mayoría herbáceas) (Lewis et al. sabie Cupriavidus (Ralstonia) C. dolosa (B. 2001) y A. subtrópico y zona templada) y Papilionoidae (13. en su mayoría plantas tropicales leñosas). 2002 Vandamme et al.. caribensis B. El alcance de la simbiosis con BFNFNL entre leguminosas queda todavía sujeta a investigación. **** Estos autores no describieron el género.Familia/Género/ Especie D. pero descubrieron que pueden formar nódulos en leguminosas y la propusieron para que se incluyera en el género Bradyrhizobium. únicamente el 57% del género y el 20% de las espe182 Manual de biología de suelos tropicales . Vandamme & Conye 2004 Notas: * Se propuso incluir a las especies Agrobacterium como A. pero descubrieron que pueden formar nódulos en leguminosas ***** El género Wautersia (Vaneechoutte et al. 2004) y más tarde del género Cupriavidus (Vandamme y Conye. 2002 Achouak et al. tuberum B. *** Fueron aislados de nódulos.1 Continúa. A. pero su capacidad de nodular no fue comprobada. plantas leñosas.

muestran una B acterias formadoras de nódulos en leguminosas 183 . Sin embargo. en 1984 (véase Tabla 6. El cultivo posterior y caracterización de BFNFNL y de los nódulos.1). 1989. por ejemplo. 1995). 90 y 97% entre Caesalpinoideae. 1992. Para poder aislar o enumerar BFNFNL en una población microbiana diversa. para poder estimar la población de BFNFNL en el suelo.cies habían sido examinadas por la formación de nódulos y los porcentajes de las especies que sí podían formar nódulos se encontraron en porcentajes de 23. en ecosistemas naturales (por ejemplo. Aunque se han llevado a cabo búsquedas extensivas para nuevos géneros y especies formadoras de nódulos. y que han sido desarrolladas nuevas técnicas de genética molecular. Moreira et al... es posible que nuevas simbiosis se identifiquen en el futuro. Bradyrhizobium betae (Rivas et al.... especialmente en Brasil (Magalhães et al.. y se esperan más revisiones en un futuro. ahora que se encuentran disponibles las que han sido aisladas de otras especies y regiones. 2006) EVALUACIÓN DE DIVERSIDAD DE BFNFNL EN EL SUELO Los estudios sobre poblaciones y diversidad de BFNFNL dependen de un aislamiento exitoso de nódulos de raíces y ocasionalmente de tallos. De esta manera. 1982.. 1992). aunque este método puede resultar difícil en el caso de hospederas perennes o leñosas (Moreira et al. de leguminosas hospederas. puede proveer información sobre la composición taxonómica de poblaciones de BFNFNL y determinar el grado de especificidad entre cepas específicas y candidatos hospederos. El proceso de infección de la planta es el resultado de la formación de nódulos en sí. Aunque algunas plantas hospederas se consideran muy promiscuas. la taxonomía del BFNFNL estaba basada en cepas aisladas de cultivos de zonas templadas. ha ocurrido una revolución en la taxonomía con 90 especies y 10 géneros adicionadas a las 4 especies y a los 2 géneros originales enlistados por Jordan.. se requiere de un método que separe claramente BFNFNL de otras especies bacterianas y que permita un muestreo fácil y sistemático de los nódulos. Faria et al. los nódulos pueden muestrearse en plantas cultivadas en el campo (colecciones in situ). se estima que hoy en día. Mimosoideae y Papilionoidae. tradicionalmente. únicamente el 25% de las especies existentes han sido examinadas. Odee et al. 2004) y Mesorhizobium thiogangeticum (Ghosh et al.. respectivamente (Faria et al. en selvas tropicales). 1989). 2007). Tres especies de los géneros descritos de BFNFNL no fueron incluidas en la tabla porque no fueron aisladas de nódulos ni la capacidad de nodulación se comprobó hasta el momento: Rhizobium cellulosilyticum (García-Fraile et al. como la que surge en el suelo.

Por lo anterior. pero.. de hecho. es deseable hacer uso de una variedad de especies de plantas hospederas candidatas y cuantas más sean empleadas. y. 1993. más variedad resultará de cepas de BFNFNL. 2009). 2009). entre otros sustratos. debería incluirse una especie leguminosa nativa como trampa hospedera. también cabe la posibilidad de que sea nodulado por especies de rápido crecimiento como Rhizobium (Pereira. De manera similar. 1970).. Pereira. Resultados obtenidos en Brasil (Alto río Solimões) muestran que caupí (Vigna unguiculata) captura más especies que M. acetileno a etileno (Dilworth. por ejemplo: Macroptilium atropurpureum es uno de los hospederos ampliamente conocido (Vicent. tiene una especificidad muy baja y puede ser nodulada por Rhizobium spp. cultivados en muestras de suelo tomadas del campo o inoculadas con suspensiones del suelo (Moreira et al. entre otras (Moreira et al. 2006 y 2008. de crecimiento lento. Resultados preliminares de Taita. Lewin et al. normalmente considerada como hospedero de Badyrhizobium. 1997. 2000). 1966. Lima et al. 1988a). de manera contraria.. en la mayoría de los casos. representa una comprobación útil de la exactitud del procedimiento en el laboratorio. se reporta que suele estar nodulado por la especie Bradyrhizobium (Woomer et al. Aunque algunas de las asociaciones mencionadas pueden ser relativamente específicas. la comparación de BFNFNL. Moreira. indican que M. por Bradyrhizobium spp. Lima. siratro (Macroptilium atropurpureum) atrapa BFNFNL en los 98 puntos de muestreo del proyecto CSM-BGBD (Lima et al. Para poder evaluar la diversidad de BFNFNL en el suelo. La nitrogenasa es la enzima responsable de la reducción del gas nitrógeno a amoniaco.. Las especies encontradas posteriormente deberían compararse con las especies que forman nódulos en el lugar. 2000. en la mayoría de los casos.. en Kenia... atropurpureum fue nodulado.baja especificidad. aisladas de nódulos formados de manera natural. de rápido crecimiento. no existe ninguna cepa de BFNFNL que sea lo suficientemente promiscua como para nodular a todas las especies leguminosas. 184 Manual de biología de suelos tropicales . ningún hospedero promiscuo puede ser nodulado por todas las especies o cepas existentes de BFNFNL y. donde sea posible. Odee et al. 2007) y Burkholderia.. de manera natural. aisladas e identificadas. 2002. se recomienda llevar a cabo experimentos preliminares para cada tipo de suelo. 1987 demostraron que Vigna unguiculata. atropurpureum y que el frijol Phaseolus vulgaris. únicamente. con los que se muestrea con el bioensayo. También reduce. punto de referencia CSM-BGBD.. El bioensayo para BFNFNL puede hacer uso de hospederos promiscuos. Antes de escoger las plantas hospederas para realizar un bioensayo.

Esta reacción se utiliza como técnica para medir la actividad de la nitrogenasa. dentro de cámaras de crecimiento o invernadero. como trampas para aislar las BFNFNL de las muestras del suelo. con esto se B acterias formadoras de nódulos en leguminosas 185 . La actividad de la nitrogenasa constituye una información invaluable porque en muchos casos es imposible verificar que los nódulos aún son efectivos y viables (color interior rojo). la gran ventaja de un ensayo de reducción de acetileno (ERA). tal y como se describe a continuación. METODOLOGÍA APLICADA EN EL PROYECTO CSM-BGBD: UNA REVISIÓN GENERAL Los pasos utilizados en la metodología para la caracterización de BFNFNL. Aunque el uso de ERA para obtener estimaciones cuantitativas de fijación de nitrógeno a la nutrición de la planta ha sido ampliamente discutido (Boddey. el personal que no posee la suficiente experiencia podrá confundirlos con estructuras no inducidas por BFNFNL. resulta idóneo Macroptilium atropurpureum (siratro). es que destaca por su gran sensibilidad y velocidad. cuyos seis pasos a seguir se muestran en la ilustración 3a hasta la 3f. ya que posee pequeñas semillas y resulta fácil de manipular bajo condiciones controladas en bolsas de plástico y jarras de Leonard. Es por ello que se emplea una única especie promiscua como trampa. 1992). con una solución nutritiva.1. dado que la anatomía de los nódulos varía ampliamente en forma y en tamaño. el uso de especies múltiples no es viable con un gran número de puntos de referencia (por ejemplo 100). Por ejemplo. Los nódulos sin actividad de la nitrogenasa pueden estar senescentes o ser inefectivos. aplicados en el proyecto CSM-BGBD. sin embargo. puesto que deben quedarse intactos para su aislamiento posterior o secarse cuando requieran ser almacenados durante un largo periodo. 1987. es barato y fácil de realizar aun en condiciones de campo. dado lo afanoso del procedimiento. Una descripción previa fue hecha por Moreira en 2004. 1987). Bajo estas circunstancias. Paso 2A: para el proyecto se utiliza el método convencional de uso de especies promiscuas. Cuando se llevan a cabo varios experimentos. y estará limitado por el tiempo disponible y las facilidades que ofrezca el laboratorio. Paso 1A: recoger muestras de suelo del campo.Schollhorn Burris.. se encuentran resumidos en la Figura 6. El ensayo también puede usarse para confirmar una nueva simbiosis de BFNFNL o en el caso de nódulos no usuales (Moreira et al. deben utilizarse semillas de la misma procedencia. resulta muy útil para la detección simple de fijadores de nitrógeno. 1966). Giller.

Caupí (opcional) 3. agar inclinado (Ilustración 3. capturando BFN: técnica de infección de planta: inoculación de especies promiscuas. tales como dnaK. Siratro* 2. Dos controles sin inoculación (con o sin mineral N) más un control con un tipo eficiente (Ilustración 3. cuando se aprecian diferencias significativas entre tratamientos 4. Nódulos de especies de plantas locales 5. capturadas con suspensiones de suelo 1:1. representativos de grupos previos. Jarra de Leonard. Ensayo de reducción con acetileno (opcional) 3 B. solución de nutriente de suelo o NaCl a 0. peso de materia seca y peso seco de planta (contenido N). Caracterización de cultivos (son necesarios los experimentos preliminares con suelo de selvas y cultivos de leguminosas para determinar el número de aislamientos requeridos para caracterizar las comunidades de simbiontes en su conjunto. Captura de BFN. eficiente. 12 muestras compuestas de suelo por punto. utilizando la técnica de infección de planta. 2A.1 Evaluación de bacterias formadoras de nódulos en leguminosas. 6. dos controles sin inoculación (con o sin mineral N). basados en una 186 Manual de biología de suelos tropicales . Eficiencia de poblaciones nativas: número de nódulos.Figura 6. Especies nativas (opcional) Bolsas de plástico (Ilustración 3. Capítulo 2). 3A. contenido de N por planta (opcional). c) 2 B. Nota: 1A. en caso necesario. peso seco de materia aérea de planta. ** Algunos nódulos pueden guardarse en gel de sílice para su aislamiento. La eficiencia de poblaciones nativas es evaluada con la floración. índices de diversidad. colectadas bajo condiciones asépticas Área de referencia /Uso del suelo/ Puntos de muestreo 1B. 2A. secuencia del gen (16S rRNA para todos los géneros. d) caracterización de cultivo 3 A. * Puede usarse para conteo NMP (opcional). (Ilustración 3. b).55% 1. f (ii). con la muestra de suelo. Frijol (opcional) 4. a). más un control de una cepa conocida. resumida en seis pasos. fijadoras de nitrógeno en diversos sistemas de uso de suelo. especialmente para Bradyrhizobium). 2e) 1C. Aislamiento de NLB de nódulos ** en YMA/79 con azul de bromotimol (Ilustración 3. Doce muestras en cada punto de muestreo (véase esquema global CSM-BDBG. Caracterización de aislados verificados. Almacenaje en frascos con gel de sílice o CaCl2 4. Claves de identificación de plantas. Bioensayos con aislados: verificación (postulados de Koch) y propiedades simbióticas (número de nódulos y peso seco de materia). tamizar según características de cultivo y REP-PCR o perfiles de proteína (Ilustración 3. 1A. otros genes. Origen del hospedero.

las cuales se describen a continuación. éste no es obligatorio. Los suelos con un alto contenido de N deberán evitarse. caupí y frijol) se pueden seleccionar otras.evita cualquier variación de NFNLB debida a las plantas. Paso 3 A: aunque la eficiencia bajo condiciones controladas no refleja lo que está pasando in situ. por supuesto. es fácil de medir y proporciona información útil sobre la variabilidad y eficiencia de las poblaciones nativas. Después de las tres especies mencionadas (siratro. incluso puede indi- curva de extinción de especies). acidez y un alto contenido de Al. Incluye características de cultivos obtenidos en el paso número 4. aunque sería imposible estandarizar esta selección. otros factores limitantes como deficiencias de macro y micronutrientes. El criterio para la selección debe basarse en que la especie-trampa sea ecológica y económicamente relevante para el país. deberán corregirse para los ensayos. basados en características de cultivo (si este es el caso) y/u otro método deben ser secuenciados para 16SrRNA y otros genes como dnaK (por ejemplo. B acterias formadoras de nódulos en leguminosas 187 . pueden cultivarse especiestrampas en bolsas de plástico. Se selecciona Phaseolus vulgaris con base en que en varios países existen datos. incluyendo algunas especies nativas que. jarras de Leonard o en macetas que contengan las muestras de suelo. para trampas promiscuas adicionales se recomienda usar Vigna unguiculata (como segunda especie) y Phaseolus vulgaris (frijol) como tercera especie. Las dos especies fueron escogidas por ser bastante promiscuas y porque se cultivan en muchos países. en el tamizado de la colección entera de aislamientos (para conseguir racimos) y elementos repetitivos extragénicos palindrómicos/secuencias de DNA (REP-PCR) (u otros métodos como perfiles de proteínas por electroforesis con SDS-PAFE/poliacrilamida gel puede ser complementario). esto puede servir como un punto de referencia. Las muestras de suelo en macetas pueden usarse únicamente cuando haya disponibilidad en los laboratorios y se deben seguir todas las técnicas asépticas normales de la microbiología. Cuando un equipo puede manejar más de una trampa de especies. debido a diferentes relaciones simbióticas (diferentes especies de plantas) y condiciones ambientales. Dada la complejidad del primer ejercicio. aún dispersos. sobre poblaciones de BFNFNL donde se utiliza el frijol común como especie-trampa. Las especies-trampas pueden usarse para capturar y contar BFNFNL o simplemente para capturarlas. aunque también se puede aplicar a otros géneros). Las semillas que se encuentren disponibles en la localidad proveerán información útil para agricultores del lugar. Representantes de racimos. ni forma parte de la metodología estándar. Bradyrhizobium. Para poder capturar BFNFNL. pueden ser diferentes en cada país.

3B: se recomienda también que las BFNFNL sean aisladas de especies leguminosas (nativas e introducidas) que nodulan naturalmente. se necesitarán más aislamientos para obtener una buena resolución.. Se necesitará aplicar las curvas de muestreo a todos los aislados. cultivadas en una serie de diluciones de suelo. hará posible la mejor evaluación de diversidad y de eficiencia de la especie-trampa. Una comparación de BFNFNL aisladas de nódulos del campo y de nódulos introducidos en una especie-trampa. 2001) porque los tipos de BFNFNL capturadas pueden variar también con la dilución (Bala et al. esto indica que no se han detectado todas las especies y que muestras adicionales (aisladas de nódulos) deberán ser analizadas. deben ser inventariadas para que las relaciones con poblaciones naturales de BFNFNL puedan determinarse. los nódulos deberán muestrearse a partir de plantas que nodulen y representen niveles secuenciales de diluciones (Moreira y Pereira. junto con los de nódulos recogidos de plantas nativas que naturalmente forman nódulos. 2001).. 2005). tal y como se explicó anteriormente. En la literatura se ha discutido que. por lo menos. proporcionarán los datos de la diversidad. formados en el campo.2). Paso 1B/2B.. y los de plantas. los aislados de estos nódulos. con una inoculación de suspensiones de suelo. en caso de no alcanzarlo. Considerando que estas curvas se obtienen con base en el número de diferentes cultivos que todavía pueden mostrar características genéticas variables. las BFNFNL deben ser aisladas. para una especie hospedera en particular. de esta forma estarán disponibles para futuros aislamientos. Paso 1C: las especies de leguminosas en un área específica. a los del bioensayo y a los nódulos colectados en campo. de ocho metros de radio alrededor de cada punto de muestreo. se necesitan entre 30 y 50 nódulos. y quizá más de 100 por uso del suelo (Jesús et al. Paso 4: después de la aparición y crecimiento de nódulos. 2001). Cuando se usa la técnica de infección por planta. por ejemplo. lo que permite la construcción de curvas de muestreo para evaluar si la diversidad en un lugar ya ha sido completamente caracterizada. Las curvas de muestreo (acumulación o escasez) pueden revelar el número de aislados requeridos para evaluar correctamente la diversidad. en condiciones de laboratorio (Bala et al. es decir. pertenecientes a los diferentes sistemas de uso de suelo en cuestión. en los diferentes sistemas de uso de suelo. Los nódulos se almacenan en sílica gel (Figura 6. Este número se encuentra en el punto (asíntota) donde la curva alcanza su mayor nivel.car la existencia de cepas eficientes en las poblaciones del suelo. Se sabe que la diversidad genética en poblaciones naturales de las NFNLB del mismo lugar puede presentar diferencias entre los aislados de nódulos. 188 Manual de biología de suelos tropicales .

El aislamiento de BFNFNL de nódulos deberá hacerse en el medio 79 con azul de bromotimol (Fred y Waksman, 1928). El medio 79 se conoce también como YMA (Vincent, 1970) (anexo 6.1); esto permite la caracterización completa del cultivo (tasa de crecimiento, cambio de pH, producción de exo-polisacáridos, morfología de colonia, color, tamaño, etc.). Para obtener grupos a partir de estas características de cultivo. La diversidad genética de poblaciones de BFNFNL puede evaluarse al agrupar los perfiles que resultan de rep-PCR, utilizando un software como Gelcompar (Brujin et al., 1997) o mediante el uso de otra técnica: perfiles de proteínas por electroforesis con gel de SDS-Poliacrilamida; que dan una buena resolución a nivel cepa (Paso 6); sin embargo, esto puede ser opcional, de acuerdo con los recursos disponibles en cada país y debe llevarse a cabo después del paso 5 para evitar perder el tiempo con contaminantes. Finalmente, los representantes de cultivos de los clados generados mediante el agrupamiento por Rep-PCR u obtenidos mediante otros métodos se secuenciarán para obtener el gen 16SrRNA (Paso 6). Cuando existen recursos suficientes, dnaK u otros genes involucrados en el mantenimiento de la bacteria, tales como atpD, rpoB, recA, glnII (Parker, 2004; Vinuesa et al., 2005b; Gaunt et al., 2001), pueden ser probados para algunas cepas de género que no hayan sido bien discriminadas por 16 SrRNA, como en el caso de Bradyrhizobium.
Figura 6.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. Fuente: Moreira y Pereira, 2001.
1 ml de C2H2 Muestra de gas Tapón de goma (a) Vial (10 ml) 30 minutos a 1 hora Tapón de goma Tubo al vacío

Nódulo Nódulo efectivo Nase C2H2+2H++2e 2C2H4 Tubo de ensayo 8.5 ml (b)

Tapón de rosca Tapón de rosca, nódulo, algodón y sílica gel o CaCl2

B acterias

formadoras de nódulos en leguminosas

189

REQUERIMIENTO DE MATERIALES PARA TRABAJO DE CAMPO Y LABORATORIO Trabajo de campo: para muestrear suelo: alcohol al 95%, agua para eliminar el suelo del equipo de muestreo antes de la esterilización con alcohol, caja refrigeradora, bolsas de plástico esterilizadas (300 ml), espátula, bolsas grandes de plástico (5 l) y un pequeño sacabocados. Para muestrear nódulos: tijera pequeña, cuchara, azada y azadón, pinzas, pala, tubos de tapón de rosca, sílica gel o CaCl2 anhidro. Para resguardo de plantas: alcohol, prensa y periódico. Trabajo de laboratorio para aislar y enumerar BFNFNL: pipetas de 1 ml y 5 ml, solución para dilución, matraces Erlenmeyer de 1 L y 125 ml, agitador orbital, bolsas esterilizadas de plástico (125 ml) para crecimiento, tubos de ensayo (150 x 20 ml ó 200 x 30 mm), o botellas de cerveza recicladas, rejillas para bolsas de crecimiento o tubos, solución de nutrientes, semillas de plantas leguminosas hospederas promiscuas o nativas, temperatura ambiente controlada de luz y humedad. Trabajo de laboratorio para aislamiento de BFNFNL y caracterización de cultivos: cajas Petri, alcohol al 95%, HgCl2 al 0.1% (acidificado con HCl concentrado a 5ml/L) (Hipoclorito de Na o Ca; puede usarse H2O2 para sustituir al HgCl2), agua esterilizada, pinzas, medio de cultivo que contiene levaduras, manitol y sales minerales (hipoclorito de sodio o calcio, o H2O2 (pueden sustituir al HgCl2), agua esterilizada, pinzas, medio de agar con sales, levadura-manitol-mineral, pH6.8. Para la actividad de nitrogenasa mediante reducción de acetileno: matraces Kitasato Erlenmeyer, globo de hule, jeringas de 1 ml a prueba de gas, tubos de vacío de 5 ml, frascos de 10 ml o de mayor capacidad con tapones de goma, carburo de calcio CaC2, cromatógrafo de gases equipado con un detector de ionización de flama (FID) y columna RN Poropak para determinaciones de acetileno/etileno. Nota: los ensayos de nitrogenasa pueden llevarse a cabo en campo. MÉTODOS DETALLADOS Muestreo del suelo. Se saca una muestra de suelo a una profundidad de 20 cm, en 12 puntos, distribuidos alrededor de cada parcela de muestreo (véase Capítulo 2, Figura 2.3). Se utiliza el mismo esquema de extracción del núcleo para el muestreo en todos los grupos microbianos, incluyendo el BFNFNL. Se junta cada juego de 12 muestras, para formar una muestra compuesta de alrededor de 300 g que, posteriormente, se introduce en una bolsa plástica esterilizada. De manera alter190
Manual de biología de suelos tropicales

nativa, cuando lo permitan los recursos, se pueden obtener tres o más muestras compuestas en cada punto. Todas las herramientas: sacabocados, espátulas, azadón, etc. deberán lavarse muy bien con agua para remover partículas de suelo y ser esterilizadas mediante alcohol y flama antes y después de cada muestreo, con el fin de evitar la introducción de BFNFNL exóticas. Se deben minimizar las pisadas cerca de los puntos de extracción y la hojarasca deberá ser removida justo antes de que se lleve a cabo el muestreo. Las muestras de suelo se trasladan al laboratorio lo antes posible, utilizando un envase con aislamiento (preferiblemente debe permanecer a 4° C). Una segunda muestra compuesta de alrededor de 200 g será recogida en una bolsa de plástico no estéril para su análisis físico-químico. Muestreo de nódulos. Se deberán identificar plantas leguminosas dentro de un radio de 8 m (lo mismo que para un inventario de vegetación) en el punto de muestreo y se recogerá el material vegetal resultante. Será de gran ayuda contar con información previa acerca de cuáles son las especies que pueden nodular, de manera que se confine el muestreo a estas especies en concreto; sin embargo, hay que aclarar que existe un enorme potencial para el descubrimiento de nuevas especies de leguminosas de este tipo. En el caso de plantas herbáceas, se puede extraer todo el sistema de raíces del suelo, utilizando una azada, un azadón o una pala, cuidando no romper nódulos de manera accidental. Los nódulos de plantas leñosas deberán descubrirse extrayendo las raíces y poniendo gran atención para no dañar las ramificaciones delgadas en donde éstos normalmente se encuentran. Se debe verificar, con extremo cuidado, que las raíces delgadas pertenezcan a la planta leguminosa identificada; por este motivo, se recomienda empezar la excavación junto al tallo; se extirpan los nódulos (dejando un pedazo de raíz para facilitar la manipulación) y se guardan en tubos de tapón de rosca con un desecador (Figura 6.2b). Antes del almacenaje, las partículas de suelo deberán removerse, bien por sacudido o bien mediante lavado, retirando el exceso de agua con una servilleta. Por lo menos se recogerán 50 nódulos por cada punto de muestreo y la muestra será representativa de todas las especies nodulantes existentes en la parcela de muestreo. En ocasiones, algunos nódulos pueden ser demasiado grandes para los tubos normales de rosca: deberán ser almacenados en un recipiente de mayor capacidad. Actividad nitrogenasa. La actividad de nitrogenasa puede medirse en el campo o a partir de cada nódulo, justo después del muestreo o en el laboratorio (Figura 6.2). Se introduce el nódulo en un frasco de tapa de goma de 10 ml o de mayor capacidad, en caso necesario. Se produce acetileno en un matraz Kitasato Erlenmeyer
B acterias
formadoras de nódulos en leguminosas

191

por la reacción de CaC2 con agua (Figura 6.3). Si se lleva a cabo el trabajo en laboratorio, se obtiene acetileno de cilindros de gas comerciales. Se inyecta 1 ml de este gas en el frasco que contiene el nódulo. Después de una hora aproximadamente, se remueve 1 ml de gas de la superficie y se transfiere a un tubo al vacío para su posterior análisis de etileno por cromatografía de gases (Figura 6.2a). Especímenes de resguardos de plantas. Los especímenes de resguardos de plantas nodulantes, deberán recogerse en el área que se encuentra alrededor del punto de muestreo (radio de 8 m). Se debe poner especial atención en el etiquetado (véase a continuación) y si es posible, incluya flores y frutas. Enseguida, los especímenes se mandan al herbario para su identificación junto con una tarjeta de identificación de las mismas: Proyecto: CSM-BGBD Colector: Fátima Moreira Fecha: 2 de abril de 2005 Localidad: Benjamin Constant Altitud: 500 m Nombre vulgar de la especie: faveira Nombre científico de la especie: ¿? Número de vale: 05 Características del nódulo: crecimiento medio, tamaño 0.5 a 1.5 cm Descripción del lugar: pastizales abiertos con ganado y troncos de madera Tipo de suelo: limo arenoso
Figura 6.3 Producción de acetileno en campo o laboratorio.
Agua Globo de hule CaH2

Tubo de goma

CaC2

CaC2 + H2O ⇒ C2H2 + Ca (OH)2 Sólido Gas Sólido

192

Manual de biología de suelos tropicales

Características de la planta: herbácea con frutos maduros Otros comentarios: se recogieron semillas; flores amarillas. El conteo de BFNFNL. Se someten muestras de suelo a una serie de diluciones antes de la inoculación de las plantas hospederas candidatas (Figura 6.4). La correlación de diluciones varía entre 2.0 (1:2) y 14.5 (1:14.5), según la concentración de células esperada en la muestra. Esto significa una mayor dilución para suelos con más BFNFNL; sin embargo, aún es necesario inocular plantas hospederas en todas sus diluciones (véase a continuación). Asimismo, en cada dilución se debe emplear una réplica del bioensayo (2 a 5 veces). Las plantas se cultivan en condiciones controladas (Vicent, 1970) y después de 15 días, se les examina para ver si han formado nódulos. Las poblaciones de BFNFNL se estiman por el método del Número más Probable (Cochran 1950; Woomer et al., 1988b, 1999). En el caso de inocular las plantas únicamente para capturar las BFNFNL, las muestras de suelo deberán resuspenderse en agua esterilizada o en una solución de nutrientes (la misma que se utiliza para un medio de cultivo o crecimiento de plantas) (véase anexo 6.1 y 6.2) en una correspondencia 1:1. Las plantas pueden cultivarse en bolsas de plástico, jarras de Leonard u otro tipo de frasco. Se deben utilizar tres tipos de controles sin inoculante de suelo: el primero comprueba la presencia de contaminación durante los procedimientos experimentales. Si no se mantienen de manera correcta las condiciones axénicas, este control resultará en nódulos y el experimento se invalidará (aún cuando nódulos ocurren en una sola réplica). Se recomienda que el número de réplicas dentro de este control sea mayor que las réplicas de tratamientos de inoculación y el control debe localizarse dentro de diferentes posiciones en el protocolo. Los otros dos controles permitirán comprobar la eficiencia de las comunidades de BFN. Las comunidades que nodulan la planta hospedera indican si las condiciones del experimento (temperatura, concentraciones de nutrientes) son adecuadas para que se lleven a cabo la nodulación y la fijación de nitrógeno en las plantas y su crecimiento. El primero de los controles se complementa con nitrógeno mineral (para jarras de Leonard, 70 mg N-NH4NO3) cada semana desde la tercera hasta la penúltima, pero no se inocula. Para bolsas de plástico o recipientes de pequeños volúmenes, se utiliza una sola aplicación de 70 mg N-NH4NO3). De esta manera el caupí, que alcanza su nivel de floración en dos meses, con el uso de jarras de Leonard recibirán un total de 350 mg N-NH4NO3, mientras que los frijoles con un periodo de crecimiento de mes y medio, en jarras de Leonard, recibirán 280 mg de N-NH4NO3. El otro control se inoculará con un inoculante recomendado para esta
B acterias
formadoras de nódulos en leguminosas

193

especie de planta; por ejemplo, CIAT 899 para Phaseolus vulgaris en Brasil, pero no se añade nitrógeno. Aislamiento y caracterización de BFNFNL. Las BFNFNL son aisladas de los nódulos recogidos en campo y por bioensayo en el laboratorio. En el último caso, los nódulos obtenidos en cada dilución sucesiva pueden indicar cuáles son las cepas menos frecuentes en la muestra de suelo y cuáles, las más comunes. El primer paso será esterilizar la superficie de los nódulos con una breve inmersión en 95% de alcohol, seguida de una inmersión más larga de tres a cuatro minutos en HgCl2 (hipoclorito de Na o Ca, o H2O2 pueden usarse como sustitutos) y lavado mediante varios enjuagues con agua estéril (Vicent, 1970). A continuación se aplasta el nódulo dentro de unas gotas de agua estéril, utilizando pinzas y esto se vierte sobre un medio de agar. En el caso de los nódulos disecados, éstos deben remojarse en una solución de agua esterilizada para mejorar la absorción de la solución desinfectante. Los tiempos de inmersión en HgCl2 u otros desinfectantes, deberían ajustarse al tamaño del nódulo (más corto para nódulos pequeños). En la composición del medio de agar: levadura-manitol-sales minerales (Fred y Waksman, 1928) (Anexo 6.1), especialmente el pH y la fuente de carbohidrato pueden variarse, tomando en cuenta las condiciones específicas del suelo (Date y Halliday, 1979; Souza et al., 1984; Elkan y Bunn, 1991). Puede incluirse azul de bromotimol como indicador porque los cambios en el pH, causados por la formación de BFNFNL, pueden resultar útiles en la identificación de género. Otros caracteres incluyen: la tasa de crecimiento (tiempo TAIC de aparición de colonias aisladas), la cantidad de polisacáridos celulares, forma y tamaño de colonia, diámetro y color según lo descrito por Moreira et al. (1993) y Jesús et al. (2005). Los principales descriptores de cada género son: Allorhizobium, Rhizobium y Sinorhizobium: colonias circulares, de 2 a 4 mm de diámetro, normalmente unidas debido a la copiosa producción de polisacáridos extracelulares, convexas, semitraslúcidas, elevadas y mucilaginosas, la mayoría con el centro de color amarillo (debido al indicador de pH), de crecimiento rápido (TAIC: de 2 a 3 días). Mesorhizobium: igual que Rhizobium, pero normalmente de crecimiento más lento (TAIC: de 4 a 5 días). Bradyhizobium: colonias circulares que no exceden de un milímetro de diámetro, producción extracelular de polisacáridos de abundante a escasa (esto último, generalmente en el caso de los tipos que toman más de diez días para su crecimiento), opacas, raramente traslúcidas, blancas y convexas, granulares en textura y que producen un cambio de pH a alcalino, de crecimiento lento o muy lento (TAIC: de 6 a más días).
194
Manual de biología de suelos tropicales

Figura 6.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.

Paso de dilución

Nivel de dilución

El porcentaje base de la dilución (Nd) puede variar de 1:2 hasta 1:14.5 y el numero de replicas por dilución (N) de 2 a 5. Fuente: adaptado de Woomer, 1993 y Vincent, 1970 por Moreira y Pereira, 2001.
B acterias
formadoras de nódulos en leguminosas

195

patrones totales de proteína por SDS-PAGE (Dreyfus et al. donde incluyeron serología (Dudman y Belbin. hibridación DNA:DNA. hibridación rRNA-DNA y polimorfismos en los tamaños de fragmentos de restricción del DNA. 1989). electroforesis de enzimas metabólicas (Selander et al. con un poco más de producción extracelular de polisacáridos. de acuerdo con los postulados de Koch. de color cremoso.5 mm de diámetro. secuencia de la subunidad pequeña del RNA ribosomal (Young y Haukka. Graham et al. crecimiento en diferentes fuentes de carbono (Dreyfus et al. será necesario definir el nivel apropiado de diversidad que permita caracterizar géneros y especies específicos.. de 0. mediante una demostración en la que formen nuevos nódulos en una planta hospedera de prueba. al mismo tiempo. producen un cambio de pH a alcalino.Azorhizobium: colonias circulares. 1988). generalmente. por lo tanto. por ejemplo. La diversidad de cepas.. Cupriavidus: similar a Azorhizobium. 1996). (1991) aportaron estándares mínimos para la descripción de nuevos géneros y especies.. muy poca producción extracelular de polisacáridos (mucho menos que en el caso de Bradyhizobium). perfiles de plásmidos (Giller et al. a veces. con la excepción de modificación de pH porque pueden producir una reacción ácida o alcalina (dependiendo de la edad). sino también la capacidad de discriminación dentro de diferentes taxas: cada una tiene un nivel específico de resolución para la clasificación bacteriana. Burkholderia: con características de crecimiento muy similares a las de crecimiento rápido. por ejemplo Rhizobium. composición de bases de DNA (%C + G). también conocidas como huellas 196 Manual de biología de suelos tropicales . En la Tabla 6. lo que mejora no sólo la clasificación bacteriana.1 se pueden observar referencias que ofrecen amplios detalles de las características de especies de NFNLB. 1988). bajo condiciones bacteriológicas controladas. de crecimiento rápido a medio (TAIC: de 3 a 4 días). Estas técnicas.. dentro de la especie puede ser genéticamente y fenotípicamente alta. Moreira et al. Las cepas aisladas deben reconfirmarse como BFNFNL. Recientemente.. 1988. 1983). contienen gránulos refráctiles de poly-β-hidroxibutirato en microscopio de contraste de fases. 1988). Las BFNFNL son bastoncillos Gram negativos que no forman esporas y que. lipopolisacáridos celulares (De Maagd et al. lo que puede ser muy útil para numerosos estudios. morfológicas y fisiológicas. en sus características simbióticas.. 1993).. resistencia intrínseca a los antibióticos (RIA) (Kingsley y Bohlool. 1986). se han descrito nuevas técnicas para la caracterización de los procariotes.

tales como ARDRA (Análisis de Restricción del rDNA Amplificado). en algunos casos. en la actualidad. Los costos y beneficios de una caracterización previa y secuenciación de representantes versus una secuenciación directa de un número mayor de aislados. 1997. deben tomarse en cuenta.) (Rademaker y Bruijn. si existe disponibilidad de recursos. Empresas privadas dan buenos servicios para productos PCR y su purificación y secuenciación. la secuenciación directa de 16S rARN u otros genes puede ofrecer ventajas económicas. Los costos de la secuenciación de DNA se han reducido notablemente durante los últimos años y. El número total de placas de 96 muestras cuesta alrededor de US $350 para la secuenciación. 23S rARN u otras secuencias de genes. para cada tipo se suspende una azada con bacterias de una colonia aislada en 1 ml de agua B acterias formadoras de nódulos en leguminosas 197 . Por ejemplo. por otro lado. Los análisis numéricos con un número adecuado de cepas y la comparación con las cepas de BFNFNL permiten la caracterización de grandes poblaciones. la purificación y secuenciación de un fragmento de genes (una muestra) ya amplificada por PCR. Se pueden utilizar el kit “Ultraclean” para el aislamiento de DNA de suelo de los laboratorios MOBIO o cualquier otro kit recomendado por el productor. RAPD (DNA polimórfico amplificado al azar): AP-PCR (PCR Con Arimers Arbitrarios). la secuenciación de genes específicos puede aplicarse directamente a un número de cepas determinado por las curvas de rarefacción o acumulación. normalmente. homología DNA:DNA) requiere de mucho tiempo y de equipo especializado y. Los métodos basados en la reacción de Polimerasa en Cadena (PCR). Bruijn et al. Se cuantifica el DNA a A260 nm con un espectrofotómetro o se estima por comparación con diferentes estándares de concentraciones de DNA en geles de agarosa. REP-PCR (Huellas Genómicas de Elementos Genómicos Repetidos de DNA. Extracción de DNA: el DNA genómico es aislado de cultivos de fases log en 79/YMA durante diferentes periodos de incubación. tRNA-PCR o ITS (Amplificación y Análisis del tRNA y de Regiones Intergénicas del 16S-23S rRNA). La caracterización genética de DNA (secuencia del 16S. puede costar alrededor de US $6. Alternativamente. dependiendo de la tasa de crecimiento específica para cada cepa (de 2 a 10 días). incluyen: la digestión de DNA genómico con endonucleasas que cortan sitios (de restricción) poco frecuentes seguido por PFGE (Electroforesis en Gel en Campos Pulsados) y otros métodos de RFLP. se restringe únicamente a representantes de grupos. 1997).. AFLP (Polimorfismo de Tamaño de Fragmentos Amplificados) para el análisis de todo el genoma. si se piden las placas completas de 96 muestras.genómicas.

se utiliza un volumen de esta suspensión como templado para el PCR. apareamiento a la temperatura de 55°C.msu. 0. respectivamente. Sin embargo. Otros oligonucleótidos pueden utilizarse si permiten la síntesis de un gen 16S rARN casi completo. Se comparan las secuencias con otras conocidas contenidas en las bases de datos.edu/index.uk) y el Ribossomal Database Project (RDP) (http://rdp. con extensión a 72°C durante 90 segundos.jsp). La purificación de los productos PCR se hace con filtros Microcon™ (Millipore) o mediante otros métodos de purificación. similares a los presentados en la Figura 6.gov/). durante 7 minutos. MANTENIMIENTO Y COLECCIÓN DE CULTIVOS PUROS Normalmente. usando los aislamientos representativos de diferentes grupos (obtenidos bien por caracterización de cultivo. Cuando se requiere la secuencia de todo el gen se deben elegir otros primers internos y usarse para amplificar y secuenciar el fragmento del gen que falte después de utilizar 27F y 1492R. tales como la del National Center for Biotechnology Information (NCBI) (www. 1990).esterilizada. Un paso de secuenciación del PCR amplificado se obtiene con el primer 27F. del gen 16S del RNA ribosomal de Escherichia coli (Wilson et al. Estos pares de oligonucléotidos corresponden a posiciones 8-27 y 1507-1492. 198 Manual de biología de suelos tropicales . Secuenciación 16S rDNA. lo que produce una suspensión ligeramente turbia que posteriormente se hierve durante cinco minutos para lisar las células.ebi. durante 40 segundos.ac. perfiles REP-PCR. La extensión final se lleva a cabo a 72°C.2 μm de cada oligonucleótido y dos unidades de la enzima Taq polimerasa (DNA extraído o cultivos líquidos): 6 μl. seguido por 30 ciclos de desnaturalización a 94°C durante 40 segundos. Análisis filogenético.ncbi. pero también con el primer reverso 1492R. la viabilidad de dichos cultivos no es larga: los métodos como liofilización y almacenaje en un congelador (–80°C) garantizan una larga conservación de las células viables.2.. por otras técnicas). o bien. El programa para PCR incluye un paso inicial: desnaturalizar a 94°C durante 5 minutos. Los genes casi completos del 16S rDNA se amplifican con un par de oligonucleótidos 27F (pA: 5`AGAGTTTGATCCTGGCTCAG) y 1492R (5´GGTTACCTTGTTACGACTT). Las concentraciones finales en las mezclas de reacción (100 ml) son: 1 x PCR Buffer.nih.2 mm de cada dNTP.cme.5 mm MgCl2. el European Bioinformatics Institute (EBI) secuenciación de base de datos (www. los cultivos puros se mantienen en agar inclinado dentro de tubos de tapa rosca en el mismo medio de cultivo.nlm. 2. 0.

R.. Soil Biology and Biochemistry. isoled from root nodules of Pueraria lobata (Willd. Barakat. . E. E. Amarger. (1982) ‘Ensifer adhaerens gen. K. Lodhi.. Sheu.. Giller. (2007)´ Burkholderia nodosa sp. (1999) ‘Burkholderia caribensis sp. Sprent. S. Bontemps. Critical Reviews in Plant Sciences. J. Cnockaert. B acterias formadoras de nódulos en leguminosas 199 . J.G. pp627-632. J. J. nov. Chen. Monsalud. A. De Faria. I. I.) Ohwi´ International Journal of Systematic and Evolutionary Microbiology vol 60. Heulin. W. James....: A bacterial predator of bacteria in soil’. R. T. (1975) Nitrogen Fixation in Bacteria and Higher Plants.. Elliot.. G. y Heulint. G.pp367-372. V. nov. International Journal of Systematic Bacteriology. W. (2009) ´Rhizobium alamii sp. nov.787-749.. pp339–345. Lin. De Faria. y Achouak. K. Berge. G. isolated from root nodules of Mimosa caesalpiniifolia´ International Journal of Systematic and Evolutionary Microbiology vol 58. vol 33. J. pp2174-2179.. S. Chen. Chou.. Chou... Elliot. C. T. nov. W.H. Bala. (1987) ‘Methods for quantification of nitrogen fixation associated with Graminae’. Marlet. F. P. O. an exopolysaccharide-producing bacterium isolated from vertisol microaggregates in Martinique‘. A. P. Sprent. International Journal of Systematic Bacteriology. vol 32. Christen. M. S. pp841–843. W. N. New York. N. K. M.. R. L. International Journal of Systematic and Evolutionary Microbiology vol 49. Roncato. R. pp. Brandelet.. R. nov.. M. y Hardy. (2001) ‘Genetic diversity of rhizobia varies from natural populations with the soil dilution sampled’. Esperanza Martínez... vol 47. Y. C.. C. an exopolysaccharide-producing species isolated from legume and non-legume rhizospheres´ International Journal of Systematic and Evolutionary Microbiology vol 59. Christien.. y Yakta. G. E.. (2010) ´Devosia yakushimensis sp. P. y Vandamme. M. David Odee y Nancy Karanja. Burns. A.. W. M. from Phaseolus vulgaris nodules’.. nov.H.W y Vandamme. sp. Boddey.. y Laguerre.. E. M. Murphy. Young... Springer-Verlag. J. James. K. Y. N. and Rhizobium giardinii sp. REFERENCIAS Achouak. Bautista. M. V.. Casida Jr. M. (2008) ´Burkholderia sabiae sp. pp996–1006.... M..P. nov... R. Macheret.. Santealla. (1997) ‘Rhizobium gallicum sp.AGRADECIMIENTOS Agradecimientos especiales por sus comentarios y revisiones a los Drs.. vol 16.. nov. nov.V. pp209–266.

Yuan. Y.M. Y. W. S. Lee. Chen. isolated from wild Alhagi sparsifolia in north-western China´. J. International Journal of Systematic and Evolutionary Microbiology vol 51. a moderately and slowly growing root nodule bacterium isolated from an arid saline environment in Xinjiang. E. y James. S. H. L.P. M. M. J.S.. Sprent. Humphry. P.. Chou. vol 38.. pp392–397. vol. y Li. H. Cochran. (1950) Estimation of bacterial densities by names of the “most probable number”. 200 Manual de biología de suelos tropicales . G.. pp870–873. W.T. S. Z. Zhu. W. People’s Republic of China’. Y. W. J. James.. M.. Farruggia. G. vol 47. Li. Chen. X. International Journal of Systematic Bacteriology. Chen. P.K. Biometrics. P. Coenye.M. Gao..P. S. Laevens. nov. M. J. X. Mergeay.. pp105-116. Wang. International Journal of Systematic Bacteriology.. Botaniste (Paris). isolated from tropical legumes’..P.. (1926) ‘Recherches sur les tubercles radicaux des légumineuses’. Wang. Cummings. L. M. y Vandamme. X.. Chen.F.. y Vandamme. (2001) ‘Ralstonia taiwanensis sp. T. Tan.W y Wei.. isolated from nodules of Mimosa species and sputum of a cystic fibrosis patient’. 6. Chen. International Journal of Systematic Bacteriology. isolated from nodules of Mimosa spp.. Andrews. Gyaneshwar. nov. vol 41. vol 16. Li..... vol 57. S. P. S.. F. L. E. Sprent. (1991) ‘Rhizobiumhuakuii sp. nov. y Li. Young.. E. (2010) ´Mesorhizobium alhagi sp. W. Vos. y Wang.’. Viniesa. pp2510-2525.. vol 45. Shen.. J.. International Journal of Systematic and Evolutionary Microbiology vol 60 pp958962. T. nov. K..I. vol 56.. Chen. T. isolated from the root nodules of Astragalus sinicus’. International Journal of Systematic Bacteriology. N. A. J.W. L. pp10551059. L. E. Coenye. G. Barrios. D. pp1–275. nov. J. M. X. vol 11. Li. pp153–159. (2006) ‘Burkholderia mimosarum sp. Odee. F.. Yan. P. G. Faria. E. Chen.. from Taiwan and South America’. T.. Y. Y. Wang. T. y Li..isolated from root nodules of the woody Brazilian legumes Mimosa bimucronata and Mimosa scabrella´ International Journal of Systematic Bacteriology.G. (2009) ´Nodulation of Sebania species by Rhizobium (Agrobacterium) strain IRBG74 and other rhizobia´Environmental Microbiology. W. Qi... pp1729–1735.. pp275–280.. (1995) ‘Characteristics of Rhizobium tianshanense sp. I. Chen.. M.. E. Dangeard. Elliot. W. W. (1997) ‘Rhizobium hainanense sp.. C. pp1847–1851. nov. Young.. W. Moreira. D. J. (1988) ‘Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned to Sinorhizobium gen. Bontemps.. nov. X. P. International Journal of Systematic and Evolutionary Microbiology.

The Prokaryotes. M.. vol 277.. M. Elmerich. E. C. B.. R. (1998b) ‘Characterization of tropical tree rhizobia and description of Mesorhizobium plurifarium sp.. M. C. pp62–64. De Lajudie. Lindstrom.. M. F. and Sinorhizobium teranga sp. J. M. A. B. van Rossum. nov.. vol 44. infertile soils of the tropics’. (1991) ‘The Rhizobia’. M. W. D. (1988) ‘Numerical taxonomic analysis of some strains of Rhizobium spp. K. nitrogenfixing bacteria that efficiently nodulate Neptunia natans in Senegal’. Dewettinck. H. Dudman. Torck. Struffi. Dworkin. 2nd Edition. pp1277–1290.. J. vol 48. Kersters. G. (1994) ‘Polyphasic taxonomy of rhizobia: Emendation of the genus Sinorhizobium and description of Sinorhizobium meliloti com. y Belbin. Laurent-Fulele. B acterias formadoras de nódulos en leguminosas 201 ... R. Molouba. Schultz.. Hoste. M. A. nov.... J. y Gilles. (1987) ‘Collection. y Lugtenberg. U.. vol 38.. E. vol 54. U. B. De Lajudie. F. International Journal of Systematic Bacteriology. McSpadden-Gardener. Moreira. vol 48. De Maagd. B.. Dreyfus. B. in G. Dordrecht. Neyra. P. Applied and Environmental Microbiology.. F. H. M. a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata’. pp285–294. A. (1988) ‘Characterization of Azorhizobium caulinodans gen. Collins.. nov. sp. International Journal of Systematic Bacteriology. D. y Halliday. nov.. Davey. Truper (eds). R. A..’. Elkan. nov. in C. M.. (1997) ‘Molecular approaches in microbial ecology to assess genomic diversity and stress-induced gene expression in plantassociated diazotrophs’.’.. pp369–382. Newton (eds) Biological Nitrogen Fixation for the 21st Century.. Dreyfus. pp3782–3785. Sinorhizobium saheli sp. M.. Pot.. vol 127. Kersters. Rademaker. Dreyfus... R.Date. Willems.. nov. A. B. F. L. Marcel Dekker Inc. K. Ragatz. L. J. International Journal of Systematic Bacteriology. y Gillis. Dilworth. Schlegel and H.. Journal of Bacteriology. L. vol 170. P. De Lajudie. (1998a) ‘Allorhizobium undicola gen. y Gillis. M. cultivation and maintenance of rhizobia’ .. (1979) ‘Selecting Rhizobium for acid. D. J. G. Biochemica et Bioophysica Acta. pp89–98. B. De Bruijn. Kondorosi and W. Nature.. A.. isolation. Willems. Kluwer Academic Publishers.. D. nov. New York. y Stoltzfus. Maestrojuan.. y Halliday. J. that uses a qualitative coding of immunodiffusion reactions’. Torck. G. y Gillis. M. E. pp1825–1830. (1988) ‘Recognition of individual strains of fast-growing rhizobia by using profiles of membrane proteins and lipopolysaccharides’. Berlin. (1966) ‘Acetylene reduction by nitrogen fixing preparations of Clostridium pasteurianum’. L. Elkan (ed) Symbiotic Nitrogen Fixation Technology. Collins. Millcamps. J. A. Dreyfus. Neyra. Coopman. J. G. sp. Collins. H. W. P. International Journal of Systematic Bacteriology. Balows. Garcia. y Bunn.. Nick. P. pp715–733. in A... R. nov. Date.. Willems. D. A. K. Springer-Verlag.. M.

Martens. y Young. W. (1879) ‘Ueber die Parasiten in den Wurzelan-schwillungen der Papilionaceen’. (2007) Rhizobium cellulosilyticum sp. y Velázquez. R. vol 41. I. (2004) ‘Mesorhizobium septentrionale sp..X. M. pp 607–619.... H.. Sui. P.. Lindstrom. J. New York and London. Strijdom.. E. García-Fraile. Graham. H. P.. pp2003–2012.. E. C. M. Ghosh. M. E.. E. Kan.. E. Bradley. W.T.H. Han. nov. de Ley.. P.. Lewis. pp783–784.. E.. (2006) ´Mesorhizobium thiogangeticum sp. Terefework. Soil Biology and Biochemistry. (1991) ‘Proposed minimum styards for the description of new genera and species of root. a novel sulfur-oxidizing chemolithoautotroph from rhizosphere soil of an Indian tropical leguminous plant´... P. y Chen. B. pp 841–848. T. pp91-97.. X.. Keyser. pp 844-848. Soil Biology and Biochemistry. A. Y. Gaunt. International Journal of Systematic and Evolutionary Microbiology... Rigottier-Gois. M. Giller.. Jarvis. (1889) ‘Ueber die Pilzsymbiose der Leguminosen’. (1987) ‘Use and abuse of the acetylene reduction assay for measurement of “associative” nitrogen fixation’. K. International Journal of Systematic and Evolutionary Microbiology.. Qiu. vol 37. J. Frank. Cooper. W. P. vol 51. R. Sadowsky. Tian. S. Z. W. Botanik Zeitung. L. L.and stem-nodulating bacteria’. J. S. Peix. Mateos. Inc.nov. isolated from sawdust of Populus alba’.F. Wang. Rivas. P.F. A. L. A. R.. (1989) ‘Occurrence of nodulation in the Leguminosae’. X. Young. Barnet. W.. Chen. Willems.... E. y Roy. K. Fred. nov. y Young. H. vol 7. D. and Mesorhizobium temperatum sp. Berichte der Deutschen Botanischem Gesellschaft. J.. International Journal of Systematic and Evolutionary Microbiology. Wang.. B. P. K. pp 582–587. W.X. W. C. McGraw-Hill Book Company. P. E. isolated from Astragalus adsurgens growing in the northernregions of China’.T. E.. pp332–346. 394–399. Giller. Tan. vol 21. vol 57.M. B. A. McGrath. y Sutherly. (2008) Rhizobium miluonense sp.F. Z. Turner. Y. Y.P. Gao. W. (1989) ‘Absence of nitrogen fixation in clover grown on soil subject to long-term contamination with heavy metals is due to survival of only ineffective Rhizobium’. H.. International Journal of Systematic Bacteriology. G. vol5. Roslycky.. J. J. S.Faria. Martínez-Molina. J. S. New Phytologist. y Hirsch. Frank.. Turner. R.. M. Gu. nov. pp2037–2048. B.. y Chen.. Lloyd-Macgilp. y Waksman. J. F. nov. International Journal of Systematicand Evolutionary Microbiology. J. (2001) ‘Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia’. L. B.. S. S. B. pp376–387. T. L. W. vol 19. vol 56. a symbiotic bacterium isolated from Lespedeza root 202 Manual de biología de suelos tropicales . vol 111. Sprent. W. S. (1928) Laboratory Manual of General Microbiology.

X. International Journal of Systematic and Evolutionary Microbiology. Chen. Nakagaka. vol58. Hunter. T. pp2610-2618. M.. a new species of legume root nodule bacteria’. B. X. Yan. in China ‘. Cleyet-Marel.. W.I. C. Chen. F.. W.. L. pp378–380.. (2008) Mesorhizobium gobiense sp. y Gillis. Nour.X.. Pankhurst. and Mesorhizobium tarimense sp. Chen. Sui.’.International Journal of Systematic and Evolutionary Microbiology.. Y.G. D.J. Hou.F.. (2008). y Chen. Guan. C. pp455-460.T.T.J. J.nodules‘. T.. y Stackebrandt. vol 47. W. I. Han. Fernyez. nov. Y. Y. Isolated from a Tumor-Like Root of the Legume Entada koshunensis from Iriomote Island in Japan‘. isolated from nodules of Cicer arietinum´. vol 60: 1548 . E. X.1553. Jarvis. Rhizobium ciceri.. X. D. J.. International Journal of Systematic and Evolutionary Microbiology..... Gu. isolated from wild legumes growing in desert soils of Xinjiang.. Wang.. pp1693-1699. W. Li. C. nov. International Journal of Systematic and Evolutionary Microbiology.X. Y. K. P.. R. vol 58.X.H. L. X.. Gu.T. L.. Wang. Rhizobuim huakuii. W.L.J.. nov. Gao. Florentino.. nov.K. Oliveira.. isolated from multiple legume species native of Xinjiang. Jarvis. A. nov. M..R. (2005) ‘Leguminosae nodulating bacteria diversity from three different land use B acterias formadoras de nódulos en leguminosas 203 . pp1416-1429. nov. International Journal of Systematic Bacteriology. a novel rhizobial species nodulated with Caragana spp. China‘.J. C.Z. (1997) ‘Transfer of Rhizobium loti. Imran. D. E.F. van Berkum. y Patel. M. J. Jesus. Biotechnol. M. Han. y Chen. Kawasaki. pp1364-1368. Tian C.pp3051-3057. S.T. y Moreira.T. (2007) ´ Rhizobium selenireducens so. y Chen.(2008) ‘Rhizobium multihospitium sp.. P. B. (2009) ´Rhizobium tibeticum sp.. M. International Journal of Systematic and Evolutionary Microbiology. A. Mesorhizobium caraganae sp. H. W. B. W. (1982) ‘Rhizobium loti.. China‘. S.vol 59.. W.. Chen. Han. Malik. Hafeez. E.X. E. nov.: a selenite-reducing (alpha)-Protobacteria isolated from a bioreactor´Current Microbiology.H. vol 58.. Schumann. Wang. y Manter D. Jia. Y. L. S. International Journal of Systematic and Evolutionary Microbiology.. Biosci. Frühling. nov. M. International Journal of Systematic Bacteriology. W. J.C. A. Zhang. W. L. Wu. J..F. Y. R. y Chen. Muramatsu. nov.. W. Kuykendall. (2010)´Ochrobactrum ciceri sp.X. vol58. vol 32..B. W..X. P.. E.. E.. pp2646-2653. Gu.. E. T. Islam. Chen. e Seky.F. 895–898.G...) Vassilcz´. Dong. F. Rodrigues. Wu. Biochem vol 72... M. a symbiotic bacterium isolated from Trigonella archiducis-nicolai (irj. vol 55. (2008) ‘Bradyrhizobium iriomotense sp... Wang. Lu.. Rhizobium mediterraneum and Rhizobium tianshanense to Mesorhizobium gen.F.s. A.

Pesquisa agropecuária Brasileira. Wang. D. X. Hu. D.L. L. legume root-nodule-forming and nitrogen fixing bacteria’. F.X. (2009)´Rhizobium mesosinicum sp. Tang. D. pp518–526.nov. Lin... He.. y Bohlool. pp769–776.. T.. F. H. y Udell. E.. W. Kuykendall.. Wang. Manen. G.) by immunofluorescence.. L. C..T. Kingsley.... Chen. C. Lin. y Chen. D.’. International Journal of Systematic and Evolutionary Microbiology. H. E. Mackinder. S. pp2269–2273.X. for a group of aerobic facultatively methylotrophic. Royal Botanic Gardens. Jordan. Dreyfus..H. Chen... pp3006-3011. (2008) ´ Shinella kummerowiae sp. Y. Hu. Plant Molecular Biology. Li. H. Han. G. (Cicer arietinum L.X. vol 40. Stanley. W. a symbiotic bacterium isolated from root nodules of the herbal legume Kummerowia stipulacea ‘. Dénarie.. pp501–505...T. B. J. Rosenberg.Y. y Chen. (2004) ‘Methylobacterium nodulans sp. J. Dowling.. (2009) ´ Mesorhizobium shangrilense sp. W. (1983) ‘Characterization of Rhizobium sp.. (2005) Legumes of the world. y Lock. F.R. J.L.. vol 58. D.. vol 29. B..F. Wang. Bena. Lewin. y de Lajudie. Sui. L. isolated from Caragana intermedia growing in saline-alkaline soils in the north of China´. Chen. y Broughton. immunodiffusion and intrinsic antibiotic resistance’. nov. nov. J. Jourand. A. pp1409-1413.T..H. International Journal of Systematic and Evolutionary Microbiology. P. Sy. vol 8.. International Journal of Systematic and Evolutionary Microbiology. in N. London. (1987) ‘Multiple host-specificity loci of the broad host-range Rhizobium sp.. Saxena. isolated from root nodules of three different legume´. y Chen. M. Kew. (2009)´Rhizobium alkalisoli sp. M. Willems. L. Nelson.F. B. W.T. vol 59. R. Giraud.X. S.. Lewis.. nov. Canadian Journal of Microbiology. Li. W. W. Wang E.F. W... P. A. Holt (eds) Bergey’s Manual of Systematic Bacteriology.X. Gillis. C.Y. D. nov. nov..Q.X..1923. Wang E. B. B. B. NGR234 selected using the widely compatible legume Vigna unguiculata’. International Journal of Systematic and Evolutionary Microbiology. Williams and Wilkins. vol 38. M. D. pp447–459. Wong.X. D.Q. E. T. A. International Journal of Systematic and Evolutionary Microbiology.H... Krieg and J. Schrire.. vol 59: 1919 .. pp30123018. T. X. 204 Manual de biología de suelos tropicales .. isolated from root nodules of Caragana species ‘. N. Wang E.systems in Brazilian Western Amazon’.. Devine. (1992) ‘Genetic diversity in Bradyrhizobium japonicum and a proposal for Bradyrhizobium elkanii sp. Han. y Chen. Meyer. vol 59.. (1984) ‘Rhizobiaceae Conn 1938’.. vol 54. Canadian Journal of Microbiology. W. Sui. Guan..

a new species of legume root nodule bacteria’. Coopman. vol 30. D. M. R. nov.. y Moreira. PhD Thesis. pp365–367. nov. M. Sy. International Journal of Systematic and Evolutionary Microbiology. Phyllobacterium ifriqiyense sp. Nairobi.. Willems... and Phyllobacterium brassicacearum sp. M. E. F.S.) Kuntze in Mexico. M. M.. y de Lajudie. Argyrolobium uniflorum and Medicago sativa (Tunisia) and description of Ensifer numidicus sp. B.´. y Martínez-Romero.. C.S. nov. Acta Amazônica.674.. Kenya. F. (2006) ´Emended description of the genus Phyllobacterium and description of four novel species associated with plant roots: Phyllobacterium bourgognense sp. Ormeno-Orrillo. Phyllobacterium leguminum sp. Graham. C. (2007)´Ensifer mexicanus sp. F. nov. P. Domergue.. Rogel-Hernández. pp417– 426. (2009) ´Nitrogen-fixing bacteria communities occurring in soils under different uses in the Western Amazon Region as indicated by nodulation of siratro (Macroptilium atropurpureum)´ Plant and Soil. Magalhães.M.. Minas Gerais. L.. A. E.. pp280-290. Lindström. G. A. Fischer-Le Saux.. nov. F. Béna. pp509-514. Barberi. (2010) Multilocus sequence analysis of root nodule isolates from Lotus arabicus (Senegal). L. M. y Pardo. Annual meeting report 4. Lotus creticus.. and Ensifer garamanticus sp.C. Merabet. y Cleyet-Marel. Segovia.. J. (1982) ´Ocurrência de nodulacão en leguminosas florestais notivas de terra firme da região de ManausAM´. vol 319. (1991) ‘Rhizobium tropici. Franco. (2004) ‘Methodology for the inventory of nitrogen-fixing Leguminosae nodulating bacteria’. E. Mars. L. pp827-839. Systematic and Applied Microbiology. K. International Journal of Systematic Bacteriology. Oliveira. Magalhães.. Martínez-Romero.. Moreira. M. Zakhia. de Lajudie. beans and Leucaena trees’. A. Martens. (2007) ‘Densidade. A. Brasil. vol 41.S. International Journal of Systematic Bacteriology. vol 60: 664 .M. S.. H.. Lima. Llorente. Mercante. Bonneau..M... y Döbereiner. F.. Silva. Mahdhi. Nóbrega. PP.M. P. A.. J. A. R. J. Conservation and Sustainable Management of Below-ground Biodiversity CSM-BGBD.. L. A. nov´..A. S. a new specie nodulating Acacia angustissima (Mill. F. Jeder.. vol 56. S. vol 39.R. (1989) ‘Rhizobium galegae.. P. K. O. Ferreira..S.Lima. nov.127-145. Mantelin. Martínez-Romero. S. a new species nodulating Phaseolus vulgaris L. Le Roux.. Bekki. A. Universidade Federal de Lavras.A.. B acterias formadoras de nódulos en leguminosas 205 .. Rincon. International Journal of Systematic and Evolutionary Microbiology.A. eficiência e diversidade de bactérias fixadoras de N2 que nodulam o siratro (Macroptilium atropurpureum) de solos sob diferentes usos na Amazônia Ocidental’. Zakhia. A.F. vol 12.

y Fernandez. J. S. A. vol 411. M. isolated from leguminous trees in Sudan and Kenya’. Systematic and Applied Microbiology.. Pot. Systematic and Applied Microbiology. vol 121. F. S. Cruz. L. K. M. International Journal of Systematic Microbiology. Eardly. are among fast growing symbiotic diazotrophs isolated from diverse land use systems in Amazônia and from Brazilian Leguminosae forest species’. International Journal of Systematic and Evolutionary Microbiology. Nandasena. M. nov. y Pereira. B. pp345–354. Bignell (eds) Standard Methods for Assessment of Soil Biodiversity and Land Use Practice. Moreira. (2006) ‘Azorhizobium doebereinerae sp. Dreyfus. J. Bogor. B. S. pp563–570. y Young. O. F. Moulin. Indonesia (available at http://fao. M. F. F. in M. y Howieson. Nour.. M.. X. Willems.. M. Pitard. F. Zhang. M. D. M. Kersters. Canadian Journal of Microbiology. S. J. M.. Siqueira and L.. Silva. S. R. Beck. vol 29. L. Suomalainen. nov. P. microsymbiont of Sesbania virgata (Caz.. y Marsh.’.. pp197–206. nov. G. (1993) ‘Characterization of rhizobia isolated from different divergence groups of tropical Leguminosae by comparative polyacrylamide gel electrophoresis of their total proteins. y Faria. S. J. M.. isolated from Biserrula pelecinus L. E. M.nov. vol 40. Brussaard (eds) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. Siqueira and L.. S. (2009) Mesorhizobium australicum sp. International Centre for Research in Agroforestry. F. Editora. M. T. S. Tiwari. E. A. vol 16. and Mesorhizobium opportunistum sp. y Lidstrom. pp2140-2147. pp135–146. Marsh. Cocoyoacan... C. UFLA. J. M. Effosse.) Pers.. W. A... O. (2008) ‘Bactérias fixadoras de nitrogênio que nodulam Leguminosae’. K. Pedrosa. y Bolvin-Masson. Cleyet-Marel. F.P. Moreira.W. K.. A. Gillis. B. P. Moreira.. M. vol 59. L. A. F. and Sinorhizobium kostiense sp. (1992) ‘Occurrence of nodulation in legume species in the Amazon region of Brazil’.. Tiedje.. C.org/AG/agl/agll/soilbiod/docs/manual-soil%2). S. Brussaard (eds) Biodiversidade do solo em ecossistemas brasileiros. (2001) ‘Microsymbionts: rhizobia’. 280pp. CAB International.. de Lajudie. S. T. S. (1994) ‘Genotypic y phenotypic diversity of Rhizobium isolated from chickpea (Cicer arietnum L. P.. in F. J. Swift and D. pp948–950. S. y Franco. D. L.G. New Phytologist. Nick. (2002) ‘Burkholderia spp. Lavras. Moreira. G. Memorias da XXI Reunión Latinoamericana de rhizobiologia. pp1359–1368. Moreira. S. R. M. Moreira.. Gillis. Paulin. (2001) ‘Nodulation of legumes by members of the b sub-class of Proteobacteri’. M.G. Faria. 206 Manual de biología de suelos tropicales . G. nov. México.. Munive.... Wallingford. (1999) ‘Sinorhizobium arboris sp. Nature. in Australia´.)’.Moreira. Moreira. F. Martínez-Romero.. O’Hara. Moreira.. (2006) ‘Nitrogen-fixing Leguminosae nodulating bacteria’. M. 768pp. O. in F. vol 49.

Reclassification of the strain R. Chen. R.F.. PhD Thesis. Peix. S. and P. nov. pp2158-2163.. isolated from the wild rice Oryza alta´. International Journal of Systematic and Evolutionary Microbiology. J. A. E. W. Ramírez-Bahena. M. W. M. (1997) ‘Characterization and classification of microbes by rep-PCR genomic fingerprinting and computer-assisted pattern analysis’. Camacho.. Kimiti. M. nov.. H.. vol 45.. M. (2008)´Revision of the taxonomic status of the species Rhizobium leguminosarum (Frank 1879) Frank 1889AL. P. M. Normy. Z. H. M. pp65–75.. A. Ramírez-Bahena. y Velázquez. Q.. G. E. S.. R. M.. Martínez-Molina. Brazil. M. y Velázquez. vol 55. J. J. W.. vol 58. Willems.N. trifolii is a later synonym of R.. D. (2008) ´Rhizobium oryzae sp. R. y Fernandez.F. S. pp211–224. vol 58. Bae. J.. (2004) ‘rRNA and dnaK relationships of Bradyrhizobium sp.. y Sprent. García-Fraile. International Journal of Systematic Bacteriology. leguminosarum. P. J. P.. Valverde. International Journal of Systematic and Evolutionary Microbiology.. Mateos.H. Mateos. International Journal of Systematic and Evolutionary Microbiology. Igual. (2000) ‘Diversity of rhizobia isolated from different land use systems in Amazon region’. A.’. T. and Bradyrhizobium jicamae sp. in G. (1995) ‘Genomic heterogeneity of strains nodulating chickpea (Cicer arietnum L. Odee. (2009)´ Bradyrhizobium pachyrhizi sp. nodule bacteria from four Papilionoid legume trees in Costa Rica’. nov. J. G. y Tan.nov. Cleyet-Marel. A. Sutherland. John Wiley and Sons Inc. E. vol 188. leguminosarum DSM 30132 (=NCIMB 11478) as Rhizobium pisi sp. Peng. isolated from effective nodules B acterias formadoras de nódulos en leguminosas 207 .. McInroy. Parker. I. Systematic and Applied Microbiology... (1997) ‘Phenotypic characteristics and composition of rhizobia associated with woody legumes growing in diverse Kenyan conditions’. pp640–648.. E. Rivas. and Overviews. E. J.H. y Lee. y de Bruijn. nov. (1995) ‘Natural rhizobial populations and nodulation status of woody legumes growing in diverse Kenyan conditions’. E. D. Baek. C.. W. Zhang. nov. New York.. F. J. Odee. M. G. Universidade Federal de Lavras.M.) and description of Rhizobium mediterraneum sp. Sutherland.. A. Lavras.. pp334–342. y Sprent. W. Z. D... Rademaker. D. isolated from a cyanide treatment bioreactor’.Nour. vol 27. Gresshoff (eds) DNA Markers: Protocols. pp2543–2549.. Li. Peix. (2005) ‘Rhizobium daejeonense sp. J. Pereira. Martínez-Molina. L. I. Quan. P. Rodríguez-Navarro. M. Caetano-Anollés. Applications.... Rivas. Plant and Soil. Plant and Soil. Yuan. pp2484-2490. vol 173. Rhizobium phaseoli Dangeard 1926AL and Rhizobium trifolii Dangeard 1926AL. Im. Makatiani. P. W..

Vizcaíno... pp972–980. E. K. Selyer.. Applied and Environmental Microbiology. Young.. Ochman. J. y Whittam. y Elkan. nov.. Rivas.. vol 26. Ponce. P.. Subba-Rao. M. Schollhorn. R. International Journal of Systematic Bacteriology.. P. A. B. vol 68.. pp484–486..X. Sui. Rivas. nov.) Druce’.. R. Subba-Rao. E. vol 43. T. FEMS Microbiology Ecology Vol 68. N. pp5217–5222. P. Mateos. M. Rincón-Rosales. M. (1966) ‘Study of intermediates in nitrogen fixation’.. Scholla. Kroppenstedt.. J. R. R. Gillis.. S. which has common symbiotic genes with Sinorhizobium mexicanum´. Dazzo. including Sinorhizobium chiapanecum sp. L. D. Palomo. A. R. pp374–377. Brunel.. vol 59. (2003) ‘Description of Devosia neptuniae sp. D. E. M. y Vizcaíno.H.. D. D. (1986) ‘Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics’. J. (2004) Bradyrhizobium betae sp. pp873–884.W.. H. E. A. y Velázquez. Rome. N. International Journal of Systematic and Evolutionary Microbiology. Willems. Llorente... Gilmour. (2002) ‘A new species of Devosia that forms a unique nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (L. M. Gillis. P. Mateos. International Journal of Systematic and Evolutionary Microbiology.L. S.. F. p710 Segovia. y Burris. vol 61. (2011)´Rhizobium vignae sp. Wang. Willems. nov. E. nov. pp255. W. H.’. Dazzo. vol 24.. Martínez-Molina. N.. 208 Manual de biología de suelos tropicales ... Martinez-Molina. vol 46. a fast-growing species that effectively nodulates soybeans’. International Journal of Systematic Bacteriology. Mateos. Systematic and Applied Microbiology. pp580-586. A. (1984) ‘Rhizobium fredii sp.. Chen. Rivas. nov. y Cleyet-Marel. N. Ren.F. H.. y Martinez-Molina. pp5217-5222. y Martínez-Romero. Normy. (1996) ‘Sinorhizobium medicae sp.. nov. F. W. E. vol 51.f. Proceedings of the Federation of American Societies for Experimental Biology. C. P.. Fernadez. Caugant. M. H. pp1271-1275. G.. M. N.T.. Gillis. y Chen. E.. Willems.. P. vol 34. that nodulates and fix nitrogen in symbiosis with Neptunia natans. E. L. isolated from roots of Beta vulgaris affected by tumour-like deformations´ International Journal of Systematic and Evolutionary Microbiology. a symbiotic bacterium isolated from multiple legume species´.’.. y Martínez-Romero..F. E. M. W. (2009)´ Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico. García-Benavides. F. R. Velázquez. F. R. Musser.nov.. an aquatic legume from India’. isolated from annual Medicago spp.of Pachyrhizus erosus’. International Journal of Systematic Bacteriology. (1993) ‘Reclassification of American Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp. vol 54. P. Applied and Environmental Microbiology.. R. X. J. pp47–53.

Souza. nov. A. Valverde. Wu. vol 26. Neyra.nov. B. International Journal of Systematic and Evolutionary Microbiology‘..nov.. M. Sy. vol 68. 58: pp 2871-2875. C. R. Campbell. International Journal of Systematic and Evolutionary Microbiology. Mateos. International Journal of Systematic Bacteriology. A. Struffi.. Tola. vol 51. Lloret. E. pp214–220. (2005) ‘Nodulation of Lupinus albus by strains of Ochrobactrum lupine sp. Giraud...G. A. Systematic and Applied Microbiology. W. P. is one of three rhizobial genotypes identified which nodulate and form B acterias formadoras de nódulos en leguminosas 209 . A. Chen. Applied and Environmental Microbiology.. Squartini. D. Han...F. P.. Van Berkum. Wang. nodulating Trifolium and Lupinus in Spanish soils’...F. Trujíllo.. Beyene. L. S. D. Van Berkum. E. B. F.T.. Tan. vol 71. Journal of Bacteriology. F. Joury. 2631-2637. E. Willens.. A. a bacterium that nodulates Vicia faba. y Mateos. Igual. pp1132–1136. nov. Z. G. X. Giacomini. M. Planchuelo... Tian. A.G. Garcia.. y Martínez-Molina.. F. E. Wang.M. B. M... Velázquez. pp. A. Abril. pp1318–1327. N. E..X. P. pp1267–1276. L. International Journal of Systematic Bacteriology. T. y Chen. Gu. F. Mateos. A. (2002) ‘Rhizobium sullae sp. y Velazquez. A. D. Prin..X.. W. Willems.. A. B. H. Selnska-Pobell.’.. (1998) ‘Rhizobium mongolense sp. J. T. (1984) ‘Avaliaçao do crescimento de rhizobium de leguminosas florestais tropicais em diferentes meios do culura’. Valverde. E.T. A. (2003) ‘Sinorhizobium americanum sp. X. nov. Magalhaes. F. Pesquisa Agropecuária Brasileira – Ediçao Especial 19. y Dreyfus. (2002) ‘The aquatic budding bacterium Blastobacter denitrificans is a nitrogen-fixing symbiont of Aeschinomene indica’. Dazzo. Cervantes. in Mexico’. y Eardly. Y. vol 52. nov. J. M. E. y Martínez-Romero. L. C. Fernández-Santos. a new Sinorhizobium species nodulating Acacia spp.. Rivas. Boivin-Masson. Peix.. E. A. P. Vizcaíno. Döring. nov. Reinhold-Hurek. s/n.. E. M.. A. M. (formely ‘Rhizobium hedysari’). y Chen.’. (2001) ‘Rhizobium yanglingense sp. P. vol 183. G. de Lajudie. the root-nodule microsymbiont of Hedysarum coronarium L. F. a bacterium that nodules Phaseolus vulgaris´. Toledo. I.. pp54–64.. (2001) ‘Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes’. (2008) ‘Rhizobium favae sp. y Nuti. P. (2005) ‘Phylobacterium trifolii sp. P.. Applied and Environmental Microbiology. International Journal of Systematic and Evolutionary Microbiology. Casella. Gillis. E. B... Bao. R. Y.. Rivas. W. Vendramin.... Kan. (2006) ‘Rhizobium lusitanum sp.. E.. C. Velázquez. y Eardly.. isolated from arid and semi-arid regions in China’. pp901–914. P. Ludeña. L. E. N. G.J. nov.. Gu. P. pp1985– 1989. y Oliveira...... vol 56. S.. E. Matínez-Molina. vol 55.

J. pp2285–2289. Leibold. Vaneechoutte. International Journal of Systematic and Evolutionary Microbiology.. Munoz.. Jarabo-Lorenzo. y Conye.nitrogen fixing symbioses with Medicago ruthenica [(L. y Martinez-Molina. Béna. Vinuesa. France´. vol 29. P. Igual. Velazquez. (1970) A Manual for the Practical Study of Root-Nodule Bacteria. F. Van Berkum. B.. de Vos. Systematic and Applied Microbiology. y Verschraegen. pp689691.. E.. de Baere. vol 54. A.. M. P. LiPuma. Kamfer.. International Journal of Systematic Bacteriology. y Willems.. Goris. Léon-Barrios. Berge. vol 51. sp. (2004) ‘Taxonomy of the genus Cupriavidus: A tale of lost and found’. T. Mauré.. M.. Escarré. C. J. Vandamme. Brunel. nov. P. B. C. Systematic and Applied Microbiology. 1985) to the genus Bradyrhizobium as Bradyrhizobium denitrificans (comb... E. Normy.J. N.. L. Mateos. y CleyetMarel. International Journal of Systematic and Evolutionary Microbiology. pp13–22. P. Willems. E. Mahenthiralingam. T. P. (2004) Proposal to accommodate Burkholderia cepacia genomovar VI as Burkholderia dolosa sp. P. M. Werner.. nov. R. vol 59. (2006) ‘Proposal for combining Bradyrhizobium spp.. and Burkholderia phymatum sp. M. J. pp1011–1021. M. Oxford. nov. K.. nov. Gillis.. Willems. H. Silva. 1990) comb. pp317–327. Blackwell Scientific Publications. Pérez-Galdona.. nov.. G. Coenye. a new genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species. nov. Cervantes. Vermis...) Ledebour]’. E. y Vandamme. and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al. A. (2009)´Mesorhizobium metallidurans sp. pp507–512..’. (2002) ‘Burkholderia tuberum sp. P. Falsen. G. Nelis. P.. Vincent. Abril.. J. pp207–215. y Eardly..C.. Chen. J. Vandamme.. E. Fernyez. an acid tolerant endosymbiont that nodulates endemic genistoid legumes 210 Manual de biología de suelos tropicales . C. M.. (2005a) ‘Bradyrhizobium canariense sp.. nov. vol 25. Vidal. International Journal of Systematic and Evolutionary Microbiology... Toro.-M. A. vol 54. (2001) ‘Mesorhizobium chacoense sp... nov. (Aeschynomene indica) with Blastobacter denitricans and to transfer Blastobacter denitrificans (Hirsh and Muller. M. O. E. M... J. (2004) ‘Wautersia gen. y Martínez-Romero. nodulate the roots of tropical legumes’. W.J. P. T. pp850-855. nov. Chantreuil. a metal-resistant symbiont of Anthyllis vulneraria growing on metallicolous soil in Languedoc. a novel species that nodulates Prosopis alba in the Chaco Arido region (Argentina)’. International Journal of Systematic and Evolutionary Microbiology. P. D.. A.)’.. A. vol 48. J. D. nov. International Journal of Systematic Bacteriology vol 54..

. y Martínez-Romero. T. pp1479–1491. Wang...T. Zhu. Rogel-Hernández.. vol 53. Wang. Wang. E. nov’. E. pp2231–2239.. vol 52. Wang. Wang.. International Journal of Systematic Microbiology. vol 48.. E. E.. H. S. D. X. and Sinorhizobium kummerowieae sp. Vinuesa.. M. H. J. E. Z. W. Rinhold-Hurek. E..... van Berkum. respectively isolated from Indigofera spp.. Chen. Martínez-Romero. H. A. Wang. E. T. genistearum. Sui. mimosae. International Journal of Systematic and Evolutionary Microbiology. W. vol 34. X. E. vol 52. Cevallos. M. H.. X. nov. E. G. D.... Sui. X. a novel biovar isolated from Mimosa affinis’. F.. Wang. Bradyrhizobium genospecies a and Bradyrhizobium genospecies b’.H. y Chen. Wei. nov. International Journal of Systematic and Evolutionary Microbiology. P.. International Journal of Systematic and Evolutionary Microbiology.. W..... a symbiont of Sesbania herbacea that has a close phylogenetic relationship with Rhizobium galegae’. nov. G. and Kummerowia stipulacea’. (2007)´Mesorhizobium albiziae sp... Silva. O. Liu. X. Han. vol 57. M... Z. y Chen.. pp1687–1693. E. y Martínez-Romero. W. Chen. International Journal of Systematic Bacteriology.. nov. y MartínezRomero. pp1575–1583 B acterias formadoras de nódulos en leguminosas 211 . van Berkum. pp29–54. International Journal of Systematic Bacteriology. pp687–699.F. Werner. E. W. Zhu. T.(Papilionoideae:Genisteae) from Canary Islands.X. pp51–65. Dorado. E. a novel bacterium that nodulates Albizia kalkora in a subtropical region of China´. Molecular Phylogenetics and Evolution. E. Beyene. Wang. (2003) ‘Characterization of rhizobia isolated from legume species within the genera Astragalus and Lespedeza grown in Loess Plateau region of China and description of Rhizobium loessense sp. A. Santos.. (2002) ‘Rhizobium indigoferae sp. pp1192-1199. E.. along with Bradyrhizobium japonicum bv. P. E.Q.. vol 55. (1998) ‘Rhizobium huautlense sp. International Journal of Systematic and Evolutionary Microbiology. Chen. A. a Leucena leucocephala-associated bacterium that is highly resistant to multiple antibiotics’. T. Q. (1999b) ‘Diversity of rhizobia associated with Amorpha fruticosa isolated from Chinese soils and description of Mesorhizobium amorphae sp. Willems. G. nov. T. Wei. Tan. y Chen. M. (2002) ‘Sinorhizobium morelense sp.. y MartínezRomero. (1999a) ‘Rhizobium etli bv. vol 49. P. Tan. Chen. Beyene. Y. X. D. International Journal of Systematic Bacteriology. E. W. Sui. C. X. J. vol 49. M. T. y Martínez-Romero. pp569–575. Wang. (2005b) ‘Population genetics and phylogentic inference in bacterial molecular systematics: The roles of migration and recombination in Bradyrhizobium species cohesion and delineation’. Fernández-López. T. A.’.. nov. B.

. Ge. International Journal of Systematic and Evolutionary Microbiology. Cui. K. Wallingford. (1995) ‘Bradyrhizobium liaoningense sp. C. B. Applied and Environmental Microbiology. vol 54 pp149. B. Young. vol 52. vol 54. y Fan. X. M. L. P. (2003) ‘The genus name Ensifer Casida 1982 takes priority over Sinorhizobium Chen et al 1988 and Sinorhizobium morelense Wang et al 2002 is a junior synonym of Ensifer adhaerens Casida 1982. I. H. M.’. Singleton. Fernández-Lopez.. pp1942–1946. International Journal of Systematic and Evolutionary Microbiology. S. B. Y. y Gillis. Yerson and J. CAB International. Is the combination “Sinorhizobium adhaerens” (Casida 1982) Willems et al 2002 legitimate? Request for an opinion’. Z. Yao. P. (1993) ‘Most Probable Number Counts of Rhizobia in Soils’. J. P. J. nov. Xu. isolated from the root nodules of soybeans’. pp706–711. R. J. Woomer. A. R. J. P. (1990) ‘Amplification of bacterial 16S ribossomal DNA with polymerase chain reaction’. Woomer. P. pp1494–1497. T. y Green.. in J. F. M. Applied and Environmental Microbiology.. B. (1988b) ‘Reliability of the most-probable technique for enumerating rhizobia in tropical soils’. M... Bennet. nov. Journal of Clinical Microbiology. E. Vos. W.. y Bohlool. Blitchngton. y Bohlool. Kan. pp2219–2230. Request for an opinion’. pp349–353. L.. Muñoz-Adelantado.. y Yost. (2004) Renaming of Agrobacterium larrymoorei Bouzar and Jones 2001 as Rhizobium larrymoorei (Bouzar and Jones 2001) comb. vol 53. Wang.. vol 28. J. nov.. pp2107–2110. E. W. vol 54. P. nov. E. Goris. Li.. vol 45. H. Z.´ International Journal of Systematic Evolutionary Microbiology. M. W. vol 82. B. Young.. 212 Manual de biología de suelos tropicales . M. vol 53. MartínezRomero. C. pp1207–1217. (1990) ‘Agroclimatology and modeling – overcoming the inflexibility of most-probable-number procedures’.Willems. P. (1988a) ‘Ecological indicators of native rhizobia in tropical soils’.. Wilson. Agronomy Journal. y Chen. pp1112– 1116. Ingram (eds) Tropical Soil Biology and Fertility: A Handbook of Methods.. R. pp172–178. International Journal of Systematic Bacteriology. Woomer.. Singleton. (2002) ‘Characterization of rhizobia that nodulate legume species within the genus Lespedeza and description of Bradyrhizobium yuanmigense sp. International Journal of Systematic Bacteriology. (2003) ‘Description of new Ensifer strains from nodules and proposal transfer Ensifer adhaerens Cassida 1982 to Sinorhizobium as Sinorhizobium adhaerens comb. Toro. Woomer. N.

.. Martínez-Romero. M. Zurdo-Piñeiro. W. Young J. Kuykendall..vol 133. R. y Sawada. B. isolated from root nodules of Oxytropis glabra´International Journal of Systematic Evolutionary Microbiology. K.E. J.X. R. vol 51.. E. Kerr. R. A. y Haukka. 1998 as new combinations: Rhizobium radiobacter.C. D. Carrasco. R. X. (2011)´Rhizobium tubonense sp. pp89–103. H. pp87–94. R. Li.. (2001) ‘A revision of Rhizobium Frank 1889.. Palomares. P. J. Chamber.. rubi. Zhang. pp784-788..Young..A. Mateos. M.F.X. Martínez-Molina. with an emended description of the genus. A... Y. E. Hou.L. (1996) ‘Diversity and phylogeny of rhizobia’. B acterias formadoras de nódulos en leguminosas 213 . nov.. y Velázquez. y Chen. and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. E. nov. N. rhizogenes.. Vizcaíno. M. vol 61. J. pp512-517. New Phytologist.T.. isolated from nodules of Cytisus scoparius in Spain´ International Journal of Systematic Evolutionary Microbiology.J.. P. International Journal of Systematic Evolutionary Microbiology. vol 57. E. Rivas. L. (2007)´Ochrobactrum cytisi sp. vitis’. E. undicola and R. Zhang... W. Trujillo. Wang. .

1928) (similar a medio YMA – Vincent.APÉNDICE 6.1 gl–1) 100ml extracto de levadura (o polvo 0. Cuando pH <5. NaCl (10%) (o 0. 214 Manual de biología de suelos tropicales . K2HPO4 (10%) (o 0.4 gl–1) 5ml sol. MgSO4. 1970): 10g manitol o sacarosa 1ml sol.8–7.2 gl–1) 1ml sol. KH2PO4 (10%) (o 0. 0.0.5% azul de bromotimol en 0.75g Agar Autoclave a 120°C durante 15 minutos. 7H2O (10%) (o 0.4 gl–1) 2ml sol. Medio sólido: 15g Agar Medio semisólido: 1.0 se reemplaza azul por Azul de Bromotimol por Verde de Bromocresol y se aumenta agar hasta 20 gl–1.1 Composición de medio 79 para el crecimiento de Bfn Medio 79 (Fred y Waksman.2 N KOH. para hacer 1000 ml con agua destilada pH 6.1 gl–1) 4ml sol.

....... Diluir solución a 1:4....... También después se usa la solución con sirato en bolsas de plástico.. ajustar con KOH..6H2O 1... 2........... Normalmente.... 2.05% KN03 o NH4 NO3)...... sin inoculación del suelo B acterias formadoras de nódulos en leguminosas 215 ..09 g El mismo protocolo que para agar con semillitas... entonces la concentración puede aumentar o hacer una suplementación dividida...... H3BO3 . o entre 7 a 10 días después de plantar.H2O . los controles absolutos.22 g CuSO4.08 g Na2MoO4. Vicent (1970) recomienda la mezcla para una solución de nutrientes.. por lo tanto.5H2O .7% KNO3) pueden ser tóxicas..7 % o FeCl3 1% Solución de micronutrientes* Agua destilada (completar a) Volumen 10 ml 10 ml 10 ml 10 ml 10 ml 1 ml 1. es decir.......7H2O .. 0... diluida de la misma manera.. * Solución de micronutrientes (para 1 l de agua)..... 0..000 ml pH = 6.. Esto puede añadirse a la solución de nutrientes al principio del experimento. las concentraciones más altas (>0.. 0... Si al final del experimento esto resulta insuficiente para el crecimiento sostenido y el color verde de las plantas control...4H2O ...86 g MnSO4. pues las dosis elevadas inhiben la nodulacíon.APÉNDICE 6.......... los controles nitrogenados no presentan nódulos. Sin embargo. Control Se proveen los controles con nitrógeno a una concentración final de aproximadamente 70 ppm N (0..03 g ZnSO4..2 Solución de nutrientes Jensen’s para el crecimiento de espe- cies de leguminosas en bolsas de plástico y jarras de Leonard Componentes K2HPO4 (2%) MgSO4..7H2O (2%) NaCl (2%) CaHPO4(10%) FeCl3..7..

éstas deberán utilizarse. es el uso de una cepa eficiente como un control positivo para la nodulación y la fijación de nitrógeno. 216 Manual de biología de suelos tropicales . no mencionado por Vincent. Si existe la disponibilidad de las cepas recomendadas.son necesarios para comprobar las condiciones asépticas del experimento. Otro control importante.

altas temperaturas. selvas tropicales. producción de cultivos redituables o plantaciones forestales industriales provoca cambios en las características quí217 . 1991). 1990. La conversión de estos dos ecosistemas en agro-ecosistemas ya sea para agricultura de subsistencia. sequía.Capítulo 7 Hongos micorrizógenos arbusculares (HMA) Joseph D. Stürmer INTRODUCCIÓN Actualmente. Bagyaraj y Sidney L. 1981. salinidad. En los trópicos. por lo tanto. el fósforo disponible es muy bajo. salinas y sistemas manejados como praderas. Además. Bagyaraj.. dunas de arena. cobre y zinc. 1995). provee una mayor superficie de absorción que los pelos radiculares y. La red de hifas producidas por los HMA en el suelo durante su asociación con la planta huésped. En la mayoría de los suelos tropicales. esto limita el desarrollo de las plantas. la agricultura se practica en áreas previamente ocupadas por dos principales ecosistemas naturales ricos en especies vegetales: bosques tropicales y sabanas. Los HMA han sido registrados en ecosistemas naturales como desiertos. pH desfavorable del suelo y al choque por trasplante que sufren las plantas no micorrizadas (Mosse et al. aumenta significativamente la captación de iones relativamente inmóviles. patógenos de la raíz. huertos y cultivos agrícolas (Brundrett. hortícola y forestal. tales como fosfato. se encuentra bien documentado que los hongos micorrizógenos arbusculares (HMA) mejoran la salud y el crecimiento de las plantas de importancia agrícola. Bagyaraj and Varma. se ha demostrado que las plantas micorrizadas tienen mayor tolerancia a metales tóxicos.

Johnson y Wedin (1997). La conversión de los ecosistemas naturales para distintos usos de suelo influye en la abundancia de esporas y composición de especies de HMA. especialmente de los géneros Glomus y Gigaspora. se siembran con una sola especie de la misma edad. La medición del porcentaje de colonización (PC) (Moorman y Reeves. físicas y biológicas del ambiente edáfico. También notaron un cambio en la composición de especies. 1985). La infectividad micorrízica se determina fácilmente por el método del número más probable (NMP) y puede servir para propósitos comparativos (Porter. se eliminan muchas especies vegetales de todas las edades y. Jasper et al. a través de una cuenta directa y de la identificación de esporas recuperadas del campo. Picone (2000) demostró que la densidad de esporas y la comunidad fúngica disponible para la formación de micorrizas eran relativamente similares entre praderas y bosque tropical lluvioso.. (1987) observaron un descenso en el número de esporas y un cambio en la composición de especies después del disturbio en algunos lugares de Australia. 218 Manual de biología de suelos tropicales . 1996) y también en desiertos (Stutz and Morton. en donde se detectaron 28 morfotipos de HMA con Glomus aggregatum y dos especies de Glomus no descritas. Mason et al. En estos sitios. (1992) encontraron que el número de esporas de HMA en una plantación de Terminalia ivoriensis en Camerún disminuyó notablemente después de tres meses de una desforestación. Asimismo.micas. Las macetas trampa preparadas con suelo de campo han sido usadas exitosamente para detectar y recobrar especies crípticas durante estudios de diversidad en huertos de manzano en regiones templadas (Miller et al. usualmente. No obstante.. 1996). estas determinaciones no detectan a las especies crípticas de HMA que no están esporulando en el momento del muestreo (pero que están asociadas con las plantas hospederas) e impiden la adecuada identificación de algunas especies. 1979). generalmente. como los hongos dominantes. 1979) y la determinación de las unidades de colonización (UC) (Franson y Benthlenfalvay. La medición de la diversidad taxonómica de HMA se ha hecho. 1989) son también adecuadas. por lo general. De igual forma. Aunque comúnmente no es reportado. sin embargo. pastizales (Bever et al. encontraron una riqueza similar de especies en la selva tropical seca y en praderas con dominio de una especie. las medidas de diversidad taxonómica deberían estar acompañadas de algunas evaluaciones de la actividad de la comunidad micorrízica.

La formación de esporas en este género es similar a la de Glomus pero éste diferencia paredes germinales internas. Datos moleculares y morfológicos fueron usados para transferir a los miembros del género Sclerocystis a Glomus (Almeida y Schenck.1). especialmente.. (2001) transfirieron todas las especies de HMA a una nueva división monofilética: Glomeromycota. 1990. 2000) y para erigir dos nuevos géneros en dos familias distintas (Morton and Redecker. (2001) (Tabla 7. Recientemente. La taxonomía y clasificación de los hongos micorrizógenos han cambiado radicalmente en los últimos años. 2001). Aunque se han aplicado técnicas moleculares para aclarar la clasificación filogenética entre las especies de HMA. cuando se requieren comparaciones entre los sistemas de uso de suelo. El método del Número Más Probable se ha utilizado para estimar el número de propágulos infectivos de HMA en varios suelos. la identificación de especies está basada principalmente en las características morfológicas de las esporas. (2001).. colocando a este grupo de hongos en el mismo nivel que Basidiomycota y Ascomycota. Gerdemann y Trappe (1974) incluyeron todas las especies de HMA dentro del orden Endogonales en la familia Endogonaceae (División Zygomycota). un género nuevo llamado Pacispora fue propuesto por Oehl y Sieverding (2004). Por lo tanto.. Redecker et al. Schüßler et al. Este género es incluido en el orden Diversisporales en la filogenia molecular propuesta por Schüßler et al. Morton y Benny (1990) transfirieron todas las especies de HMA al orden Glomerales (División Zygomycota) con tres familias y seis géneros. se propone un esquema de clasificación para estudios de diversidad que surge de los esquemas de Morton y Benny (1990). También incluyeron en el Nuevo esquema de clasificación tres nuevos órdenes y varias familias. Se basa en una serie de diluciones decimales H ongos micorrizógenos arbusculares 219 . con aquellos de Morton y Redecker (2001) y Schüßler et al.TAXONOMÍA Y CLASIFICACIÓN DE HMA Debe establecerse un esquema taxonómico antes de cualquier estudio de diversidad. MÉTODOS PARA EVALUAR PROPÁGULOS INFECTIVOS DE HMA Y COLONIZACIÓN MICORRÍZICA Número más probable (NMP) El protocolo propuesto para estimar la diversidad de HMA (descrito en el Capítulo 2) es el mismo que se sigue para todos los microorganismos y no será discutido aquí.

La pared de la espora esta formada por tres o cuatro capas y no se forma una verdadera bicapa germina. 220 Manual de biología de suelos tropicales . La micorriza se tiñe débilmente. Las vesículas varían en forma con protuberancias y concavidades. solitarias. Germinación a través de una estructura de germinación esférica. Berch (31 especies) Esporas formadas a los lados del cuello de un sáculo esporífero el cual deja una cicatriz en la superficie de la espora. Scharzott y Walker Orden Glomerales Morton y Benny Suborden Glomineae Morton y Benny Familia Glomeraceae Pirozysnki y Dalpé Glomus Tulasne y Tulasne (85 especies) Esporas formadas blásticamente sobre una hifa de sostén. Familia Archaeosporaceae Morton y Redecker Archaeospora Morton y Redecker (una especie) Esporas formadas terminalmente de una hifa de sostén o como una ramificación de una estructura que semeja un sáculo esporífero. flexible. Entrophospora Ames y Schneider (cinco especies) Esporas formadas dentro de un cuello de un sáculo esporífero el cual deja dos cicatrices sobre la superficie de la espora. Hifas intrarradicales rectas o enrolladas cerca de los puntos de entrada. La micorriza se tiñe muy obscuro. Otras estructuras subcelulares de la espora y germinación idéntica a la de Acaulospora. Esporas con la pared esporal formada por dos capas. Vesículas. hifas intrarradicales y micorriza se tiñen como en Acaulospora. Se presentan especies dimórficas formando esporas acaulosporoides y glomoides. conectada a una hifa ramificada. Germinación a través del lumen de la hifa de sostén o a través de la pared de la espora. Las vesículas y células auxiliares no están diferenciadas. No se observan paredes germinales diferenciadas. arbúsculos. Hifas intrarradicales raramente enrolladas. División Glomeromycota Schüßler. Arbúsculos con troncos aplanados o cilindricos adelgazándose sucesivamente en las ramificaciones. en agregados laxos o en esporocarpos. plana. Los arbúsculos e hifas intrarradicales se tiñen débilmente. La pared germinal más interna tiene una superficie con excrecencias. Vesículas de pared delgada y elipsoides.1 Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales. Esporas con la pared esporal formada por un número variable de capas todas originadas a partir de la hifa de sostén. y Trappe emend.Tabla 7. Familia Acaulosporaceae Morton y Benny Acaulospora Gerd.

Esporos glomoides de forma aislada en el suelo o agregados en racimos. Familia Pacisporaceae Walker. y germinan atreves de hifa suspensora. Esporas con la pared esporal formada por dos capas permanentes. Vestberg & Schüßler Ambispora Walter. Vesículas y arbúsculos las raíces teñidas en azul franco con azul tripano. Esporos acaulosporoide formado un apéndice hifal emergiendo lateralmente del cuello de un sáculo esporífero. células auxiliaries que van de casi lisas a nodosas. a menudo nodosas o con proyecciones. No se forman vesículas. Pared de la espora generalmente formada por tres capas distintas y la pared germinal compuesta también por tres capas. Schüßler y Schwarzott Pacispora Sieverding y Oehl (siete species) Esporas formadas terminalmente de una hifa de sostén (como en Glomus). células auxiliares finamente papiladas o equinuladas. No se forman vesículas. Germinación de la espora directamente de la pared germinal a través de la pared de la espora. Las vesículas y células auxiliares no están diferenciadas. Familia Paraglomeraceae Morton and Redecker Paraglomus Morton y Redecker (dos especies) Esporas formadas terminalmente de una hifa de sostén como en Glomus. Arbúsculos e hifas intrarradicales similares en morfología a las de H ongos micorrizógenos arbusculares 221 . especialmente. La segunda capa de la pared germinal generalmente reacciona con el reactivo de Melzer. Al germinar. Scutellospora Walker y Sanders (30 especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa.1 Continúa Familia Ambisporaceae Walter. cerca de los puntos de entrada. Las paredes de la hifa de sostén son continuas con la primera y segunda capa de la pared esporal. Arbúsculos con troncos hinchados angostándose abruptamente en las ramificaciones. Hifas intrarradicales frecuentemente enrolladas. se diferencia una capa delgada con verrugas esparcidas y crece un tubo germinativo a través de la pared esporal. Blaszkowski. y Trappe (cinco especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. Las estructuras subcelulares de la espora y la germinación como en Glomus. Los arbúsculos y las hifas intrarradicales se tiñen débilmente. no se diferencian paredes germinales. Suborden Gigasporineae Morton y Benny Familia Gigasporaceae Morton y Benny Gigaspora Gerd. Vestberg & Schüßler (ocho especies) Especies generalmente dimórficas con asociaciones micorrizicas produciendo morfotipos acaulosporoide y glomoides.Tabla 7.

cada una con dos capas. y puede llevarse a cabo por cualquiera que esté familiarizado con la morfología de la micorriza. basándose en una tabla estadística. Sin embargo. el método es apropiado para comparaciones entre sistemas con diferente uso del suelo si los ensayos del NMP se establecen de forma simultánea. de suelo en donde la presencia o ausencia de colonización micorrízica se registra y da como resultado el número más probable de propágulos infectivos.edu. se puede utilizar cualquier otro hospedero.. 222 Manual de biología de suelos tropicales . Fuente: compilado de Morton y Benny.Tabla 7. 2004.5 cm) y gradillas bolsas de plástico (30 X 20 cm) diluyente esterilizado (arena: mezcla de suelo 1:1) semillas de cebolla. Como el resultado es un solo número.caf. 1990. el análisis de las raíces de las plantas trampa para comprobar la colonización es fácil y rápido. si tiene cierta dependencia micorrízica. El tubo de germinación crece a partir de un escudo flexible plano. se pueden utilizar gramíneas C4. 1986). que se diferencia sobre la superficie de la última pared germinal. 2006 y http://invam. pero el número calculado tiene hasta un 95 por ciento del nivel de confianza (Adelman y Morton. Oehl y Sieverding. Una de las desventajas de esta prueba es que se requiere mucho tiempo para la preparación del bioensayo. Materiales necesarios • • • • tubetes para plantas (150 X 2. Si no contamos con semillas de cebolla. La ventaja es que. como el sorgo y el Paspalum. ya que es dependiente de la micorriza y las raíces son fáciles de teñir.1 Continúa Gigaspora. La planta hospedera recomendada para el ensayo del NMP es la cebolla. Spain et al. Esporas con una pared formada por dos capas permanentes y de una a tres paredes germinales internas.wvu.

Después de emerger. Agitar bien para obtener una dilución 10-1. considerando las cinco réplicas (tubetes) para cada una de los cuatro diluciones (10-1. Supongamos que. 3. Utilice las tablas de Cochran (1950). 10-2. dejar una sola planta por tubete y dejarlas crecer en un invernadero o en una cámara de crecimiento durante seis semanas. Para el cálculo del NMP. sólo tres números de una secuencia dada son necesarios. H ongos micorrizógenos arbusculares 223 . N2 = 3 y N3 = 2. tres réplicas fueron positivas en la dilución 10-3 y dos réplicas fueron positivas en la dilución 10-4. Al cosechar. 3. 2. la combinación sería: N1 = 5. El procedimiento para el cálculo del NMP. 10-3 y 10-4). 7. si no se dispone de las semillas de cebolla puede utilizar cualquier otro hospedero (ver arriba).Procedimiento 1. 5. lavar el suelo de las raíces y teñirlas con azul de tripán (véase más abajo). Pesar 30 g de suelo de campo en una bolsa de plástico y añadirle 270 g del diluyente esterilizado. se ilustra con el siguiente ejemplo. Sembrar las semillas de cebolla en cada tubete. se obtiene la siguiente secuencia de números de tubetes positivos: 5. 5. Retirar 30 g de la dilución anterior y colocarlo en otra bolsa que contiene 270 g del diluyente estéril. 2. Distribuir el suelo de cada dilución en los tubetes para plantas. Los otros dos números (N2 y N3) son los correspondientes a las próximas dos diluciones. Bajo un microscopio de disección. Agitar bien para obtener una dilución decimal. El primer número (N1) corresponde al número de tubetes positivos para la colonización micorrízica en la dilución que muestra el mayor número de tubetes positivos (se toma la serie menos concentrada. Esto significa que las cinco réplicas fueron positivas para la colonización micorrízica en las diluciones 10-1 y 10-2. si el número de tubetes positivos es el mismo en diluciones posteriores). 4. hacer cinco replicas por cada dilución. hacer más diluciones decimales hasta la dilución 10-4 (o más. El número de tubetes positivos (los que contienen colonización) en diluciones diferentes se utilizan para calcular los valores de NMP. En este ejemplo. determinar la presencia o ausencia de colonización micorrízica en cada réplica. de Fisher y Yates (1963) o Alexander (1965). si es necesario). 6.

5 g/l) • H2O2 alcalinizada (3 ml NH4OH al 20%. (500 ml de glicerol. Teniendo en cuenta el costo de los productos químicos y el ahorro al reducir el número de productos químicos sin interferir con la calidad de la tinción. 567ml de agua). El método más ampliamente utilizado es el descrito por Philips y Hayman (1970). Para obtener el NMP de propágulos infectivos de HMA en la muestra. Por lo tanto. el suelo tiene 1. (en este caso 10-3). las raíces son sometidas a un procedimiento de clareo y tinción. no altera la morfología de la raíz. 450 ml de H2O. se propone para la tinción de raíces el método de Philips y Hayman (1970) modificado por Koske y Gemma (1989).4.Usando la tabla del NMP el valor dado para esta combinación de tubetes positivos es 1. 2. este valor debe de ser multiplicado por la dilución media. Sumergir las raíces en KOH a 90°C por una hora o a 120°C por 15 minutos en autoclave. Lavar las raíces para eliminar residuos de suelo y enjuagar con varios cambios de agua. para detectar y medir la colonización micorrízica. Procedimiento 1.4 X 10-3 propágulos infectivos g–1. 30 ml de H2O2 al 3%. Materiales necesarios • solución de KOH al 10% (hidróxido de potasio) • solución de HCl al 1% (ácido clorhídrico) • solución acidificada de glicerol.05 % en solución de glicerol (0. mientras que Koske y Gemma (1989) modificaron el procedimiento mediante la eliminación de ácido láctico de estas soluciones sin interferir con la intensidad de la tinción. 50 ml de de HCl al 1%) • azul de tripano 0. Kormanik y McGraw (1982) eliminan el fenol en las soluciones para tinción y decoloración. Tinción de raíces para observar la colonización micorrízica La colonización de las células corticales de la raíz por HMA. 224 Manual de biología de suelos tropicales . en contraste con las asociaciones ectomicorrízicas. Por lo tanto.

1 x 1. las raíces pueden guardarse en agua adicionada con unas gotas de azida de sodio al 0. Sumerga las raíces en HCL al 1% por cinco minutos. Medición de la colonización micorrízica La determinación de la colonización micorrízica de la raíz. Para almacenar por un tiempo largo. El paso 4 puede ser omitido si las raíces no están muy pigmentadas. se realiza con frecuencia en raíces colectadas de campo (sacadas directamente del suelo o de plantas individuales) o en plantas experimentales. un baño de agua a 90°C es apropiado para mantener las muestras. Tiña las raíces en una solución de glicerol ácido con azul de tripano a 90°C por una hora o a 120 °C por cinco minutos. 5. Esta medida estima el crecimiento de un aislamiento de un hongo o de una comunidad fúngica dentro de la corteza de la raíz.1 cm.3. • Agujas de disección. 4. H ongos micorrizógenos arbusculares 225 .01%. El método de intersección de cuadrante (Giovannetti y Mosse. 40ml de glicerol y 40 ml de agua destilada). No enjuague las raíces en esta paso ya que éstas deben estar acidificadas para una tinción adecuada. crecidas bajo condiciones del invernadero. es usado comúnmente para medir la longitud de la raíz y el porcentaje de la colonización micorrízica. 7. Enjuagar nuevamente las raíces con agua. Descargue la solución colorante y mantenga las raíces en glicerol acidificado (sin azul de tripano) o agua a temperatura ambiente o 4°C. 1980) que se presenta a continuación. la solución de glicerol acidificada puede ser reemplazada por una solución de lactoglicerol (20 ml de ácido láctico. Eliminar el KOH y enjuagar las raíces con agua (dos o tres veces) para quitar el exceso de KOH. 6. Material necesario • Cajas de Petri cuadriculadas en la base con cuadrados de 1. Comentarios: si lo desea. Elimine el HCl. la solución de agua oxigenada alcalinizada debe de prepararse justo antes de su uso. 8. Para los pasos 2 y 7. Si las raíces están demasiado pigmentadas se deben sumergir en agua oxigenada alcalinizada durante 10-30 minutos.

2.htm. las estructuras subcelulares de las esporas están altamente conservadas y son fenotípicamente estables independientemente del ambiente y la planta huésped (Morton et al. 4. Por lo tanto. De esta manera. usando la relación entre el peso seco de la planta y la submuestra. Las esporas se extraen del suelo mediante un tamizado húmedo (Gerdemann y Nicolson. con estructuras micorrízicas. La morfología del micelio interno y externo durante la asociación micorrízica es prácticamente indistinguible entre las especies del mismo género y entre géneros. 1995). Si se toma una muestra pequeña de toda la raíz.caf.. las esporas son la única parte del organismo del hongo que puede utilizarse para delimitar las especies. con las líneas de la cuadricula separadas en 1. 1963). Métodos para evaluar la diversidad de HMA Extracción de esporas del campo La Identificación de las especies de HMA está basada en el análisis de estructuras subcelulares de las esporas asexuales. el total de la longitud de la raíz micorrizada será el número de intersecciones. Comentarios: los datos obtenidos en el paso 3. En contraste. también se pueden utilizar para determinar las longitudes tanto de la raíz completa como de la raíz micorrizada.edu/ methods/mycorrhizae/rootlengths. Es posible calcular la longitud total de la raíz y la longitud de la raíz micorrízada de la planta completa.1 cm.wvu. Registre: a) el número total de intersecciones de las raíces y las líneas de la cuadricula y b) el número de intersecciones con raíces micorrizadas. seguido por centrifugación en un gradiente de sacarosa. En una caja de Petri extienda al azar las raíces teñidas.Procedimiento 1. representan la longitud total de la raíz en cm. el número total de raíces que interceptan las líneas de la cuadricula. Calcule el porcentaje de colonización micorrízica (% CM) utilizando la siguiente fórmula: % CM = (Número total de intersecciones con raíces micorrizadas/ Número total de intersecciones entre la raíz y las líneas de la cuadrícula) X 100. Bajo el microscopio de disección explore las líneas horizontales y verticales de la cuadrícula. Si toda la raíz se extiende en la caja de Petri. 226 Manual de biología de suelos tropicales . se teñirá y se medirá en el microscopio con este método. 3. Para más detalles ver http://invam.

vidrio de reloj.Figura 7. • Cubeta de plástico o un vaso de precipitados grande. Figura 7. • Tubos para centrífuga y centrífuga.1 provee una ilustración del método de intersección de línea. después de expander las raíces. H ongos micorrizógenos arbusculares 227 . cajas de Petri. el largo de la raíz = 43 cm (25 + 18) y el largo de la raíz micorrizada=12 cm (Seis intersecciones positivas sobre líneas horizontales y seis intersecciones positivas sobre líneas verticales). • Soluciones de sacarosa (20 % y 60%).9%. el numero de intersecciones entre una raíz y las líneas horizontales y verticales tendríamos: • 25 intersecciones (Línea horizontal) • 18 intersecciones (Línea vertical) y • 12 intersecciones (Puntos negros) presentando colonización micorrizica. • El porcentaje de colonización micorrízica= (12/43) x 100=27. Materiales necesarios • Un juego de tamices anidados que tengan al menos 710 µm y 45 µm de abertura de malla. Ejemplo.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. • Por lo tanto. • Vasos de precipitados. Nota. En el diagrama las infecciones de micorrizas son representadas con puntos negros.

000 rpm durante 60 segundos. agregue otros 15 ml de la solución al 60% . comprada en el supermercado. 5. al menos. Colocar 100 g de la muestra de suelo en la cubeta /vaso de precipitados y suspender en. ya que el tamaño de las esporas de HMA para la mayoría de las especies está en un intervalo de 40 a 600 μm. 228 Manual de biología de suelos tropicales . Centrifugue a 2. Pasar la suspensión repetidamente a través de dos tamices anidados con abertura de malla de 710 µm y 45 µm. Transferir las esporas y el material retenido en el tamiz 45 µm a una caja de Petri y bajo el microscopio colecte las esporas en un vidrio de reloj limpio. La solución de sacarosa se hace con azúcar comercial. Agitar hasta que las esporas queden suspendidas y dejar reposar 30 segundos . En este momento. Vacíe el sobrenadante en el tamiz de 45 µm y lave con agua corriente para quitar el exceso de sacarosa. se pueden anidar otros tamices entre los dos recomendados. 3. Comentarios: en el paso 3. 2. Coloque el material retenido en el tamiz de 45 µm en una vaso de precipitados con una pequeña cantidad de agua. después transfiera este material a un tubo de centrífuga que contenga un gradiente de sacarosa de 20–60%. Para preparar el gradiente de la sacarosa. 1979) para dispersar las partículas de arcilla y liberar las aberturas del tamiz. 8. 4. Los suelos con alto contenido de arcilla pueden obstruir los tamices. Los tamices recomendados (con mallas de 710 µm y 45 µm) son adecuados para recuperar la mayoría de especies.1M (Fogel y Hunt. 500 ml de agua. se puede agregar una pequeña cantidad de pirofosfato de sodio a 0. si hay demasiados pedazos de raíz y otros desechos. 7.Procedimiento 1. 6. Esto separa a las esporas por tamaños pero incrementa la cantidad de trabajo ya que el material retenido en cada tamiz debe centrifugarse por separado. las esporas se pueden separar por morfotipos de acuerdo con su color y tamaño y si las esporas están en buen estado se pueden identificar hasta género y especie. en el fondo. es preferible vaciar la suspensión de suelo a través de un tamiz de 1 mm antes de pasar por el tamiz de 710 μm. Coloque el material retenido en el tamiz de 710 µm en una caja de Petri grande y observe bajo el microscopio de disección para observar esporas grandes (esporas de Gigaspora y Scutellospora) y esporocarpos. agregue 15 ml de la solución de sacarosa al 20% en un tubo de centrífuga de 50 ml y después. Sin embargo. Las esporas pueden separarse de los residuos orgánicos y recogerse de la caja de Petri usando unas pinzas finas o una pipeta Pasteur adelgazada en la punta.

Poland) en http://www.wvu. Por otro lado. Algunas claves de identificación para HMA (por ejemplo Hall y Fish. 3 y 4 se proporcionan los nombres de las especies y los autores. c) un detalle de la ornamentación de H ongos micorrizógenos arbusculares 229 . 1990) y comparando con las descripciones e ilustraciones de las especies proporcionadas por el Dr. Sin embargo. usando como referencia al Manual para la identificación de HMA (Schenck y Pérez. contrastando con el color hialino de las esporas). USA) sitio web (http://invam. deben ser montadas en portaobjetos y observadas en un microscopio compuesto.agro. Janusz Blaszkowski (Department of Plant Pathology of the Agricultural University of Szczecin. g.pl/~jblaszkowski. b) espora de Scutellospora scutata con la hifa de sostén bulbosa (note el escudo de germinación redondo. West Virginia University. La fotografia a) muestran una espora de Gigaspora albida con la hifa de sostén bulbosa típica de esta familia.. 2.edu) y por Dr. la INVAM y el sitio de Blaszkowski poseen excelentes fotografías con detalles de la estructura subcelular de las esporas.Identificación de especies y montaje de preparaciones En la mayoría de los casos. 1982) se publicaron antes de algunas revisiones de taxonomía recientes e importantes. Joseph Morton en la INVAM (Colección Internacional de hongos micorrizógenos arbusculares.caf. el tamaño de las esporas y una descripción estandarizada de las especies de HMA. La identificación de especies de HMA se puede hacer por comparación con la descripción original de la especie. café. 1979. y por consiguiente. a la vez que Bentivenga y Morton (1995) proponen una clave para identificar las cinco especies de Gigaspora. b. Koske y Walker (1985) proponen una clave para algunas especies de Scutellospora con esporas con paredes ornamentadas. W. La ilustración 4 muestra las esporas y las estructuras producidas por las especies de la familia Gigasporaceae (fotografías a. Fotografías de esporas de especies representativas de diferentes géneros se muestran en las ilustraciones 4 y 5. En los anexos 1. las esporas extraídas del campo no son identificables bajo el microscopio de disección. alberga todos los problemas inherentes a esas descripciones (falta de estandarización de las estructuras subcelulares de las esporas. Trappe. en estos sitios web se describen 79 y 55 especies respectivamente. y h). El manual de Schenck y Pérez es una copia de las descripciones originales de las especies y por lo tanto. f. de 160 especies de HMA descritas en total. este manual incorpora en un solo volumen toda la descripción de las especies hasta 1990. c y d) y Acaulosporaceae (e.V.szczecin. falta de buenas fotografías para las comparaciones y las descripciones están hechas con esporas extraídas del suelo de campo por lo cual pueden no incluir características taxonómicas importantes).ar.

y d) células auxiliares nodosas que diferencian a los miembros de Scutellospora. presencia de hifa de sostén. finalmente. mostrando algunos sáculos esporíferos adheridos a las esporas. forma. esporas de Acaulospora sp. la foto f) muestra un detalle de Archaeospora leptoticha en donde se observan protuberancias y depresiones de las capas 2 y 3 de la pared esporal (indicada con flechas). cubreobjetos y etiquetas • Agujas de disección 230 Manual de biología de suelos tropicales . de células suspensoras y del sáculo esporífero (raramente observado en esporas recolectadas directamente del campo). se observan. La foto b) muestra la pared de la hifa de sostén continua con la pared de la espora de un Glomus sp. también con la pared formada por tres capas (L1. en la foto d). la pared germinal 1 (gw1) y la pared germinal 2 (gw2) con su capa más interna reaccionando al reactivo de Melzer. En el microscopio compuesto pueden observarse algunas características taxonómicas importantes como son la presencia y tipo de ornamentación sobre la pared de la espora. La fotografía g) representa una espora de Acaulospora scrobiculata que muestra la cicatriz que queda en la espora después de que el sáculo esporifero se desprende. b. c. Materiales necesarios • Portaobjetos. La ilustración 6 muestra a las esporas y estructuras producidas por especies de la familia Glomeraceae (a. Foto a): espora de Glomus clarum indicando la hifa de sostén (note que la capa más interna de la pared de la espora se desprende y se ve parecida a la pared germinal. d). Una espora de Entrophospora colombiana mostrando las dos cicatrices características se ve en la foto f). L2 y L3) de Paraglomus occultum y en la foto h) se muestra una espora de Paraglomus brasilianum. reacción al Melzer. en la foto h). Archaeosporaceae (e y f) y Paraglomeraceae (g y h). Las características taxonómicas importantes que pueden observarse bajo el microscopio de disección son tamaño de las esporas. la foto g) ejemplifica la estructura de la pared formada por tres capas (L1. Un esporocarpo de Glomus clavispora se observa en la foto c) y un esporocarpo de Glomus sp. La foto e) muestra un espora de Archaeospora leptoticha con el sáculo esporífero. color. número de paredes germinales y grosor de la pared de la espora.la pared de las esporas (verrugas) de Scutellospora coralloidea. Las esporas necesitan montarse en líquidos de montar permanentes como son el PVLG (alcohol polivínilico lactoglicerol) y PVLG mezclado con reactivo de Melzer. En la foto e) se muestra una espora de Entrophospora colombiana (familia Acaulosporaceae) con la pared de la espora. L2 y L3) (la capa L2 está ornamentada con pequeñas crestas).

5. 5 g de yoduro de potasio.6 g de alcohol polivínilico (PVA) • Reactivo de Melzer (100 g de hidrato de cloral. 7. Además. En un porta objetos. género y especie (si se conoce).• Solución de PVLG (100 ml de agua destilada. si se agrega demasiada agua. Establecimiento de cultivos trampa Los cultivos trampa se utilizan con más frecuencia en estudios de diversidad de HMA porque revelan las especies que no están esporulando en el campo. Con una aguja de disección. 4. 16. las esporas se deslizan hasta los bordes cuando se coloca el cubreobjetos en la parte superior de cada gota. 3. ofrecen esporas nuevas y saludables que pueden ser utilizadas para establecer cultivos puros de HMA. 6. Usando una aguja de disección. tenga cuidado de no agregar demasiada agua). 1. y fecha. Procedimiento 1. rompa cada espora individualmente bajo el microscopio de disección. Comentarios: el paso 2 es crucial para el montaje de las esporas sobre el portaobjetos. Coloque suavemente un cubre objeto sobre la gota de PVLG y otro cubreobjetos sobre la gota de PVLG + Solución de Melzer.5 g Iodo. colocar una gota de PVLG y una gota de la solución de PVLG + Melzer. 2. Este paso es importante para exponer las paredes germinales y sus capas. en el momento del muestreo. 100 ml de ácido láctico. Mezclar el reactivo de Melzer con el PVLG (1:1) para preparar la solución de PVLG + Melzer. El método propuesto se basa en los protocolos de Stutz y Morton (1996). Guardar las preparaciones a temperatura ambiente durante cinco días y luego incubar a 40-60ºC. 10 ml de glicerol. Etiquetar las preparaciones incluyendo número de muestra. Colocar las esporas al centro de cada gota usando un pinza fina o una micropipeta (en este caso. durante dos días para endurecer el medio de montaje. H ongos micorrizógenos arbusculares 231 . mezcle las esporas en la solución de PVLG y de PVLG + Solución de Melzer y deje secar la superficie de la gota por lo menos cinco minutos. 100 ml de agua destilada.

Materiales necesarios • • • • Arena estéril Macetas de plástico de 1. pp . durante el muestreo de suelo de campo. si el sorgo y frijol no están disponibles. N. 18. Mycologia. J. vol. 82. colecte uno o dos núcleos de suelo de 50 ml de cada maceta. y Schenck. Se recomienda cualquier gramínea C4 y/o leguminosa como hospederas. bajo condiciones del invernadero. (1965) ‘Most-Probable-Number Method for Microbial Populations’.Soil Biology and Biochemistry. 7–13. Alexander. M. T. R. vol. Almeida. Klute (ed) Methods of Soil Analysis.5 kg Bandejas o bolsas de plástico Semillas de Sorghum sudanense (Sorgo) y Vigna unguiculata (Frijol) Procedimiento 1 En una bandeja de plástico (o en una bolsa de plástico). y Morton. Después de tres a cuatro meses. Madison. REFERENCIAS Adelman. 3. donde las plantas intactas colectadas del campo se trasplantan a una maceta con un sustrato libre de HMA y se evalúa la esporulación después de tres a cuatro meses. Soil ScienceSociety of America. pp. in A. otras plantas hospederas pueden utilizarse. (1990) ‘A Revision of the Genus Sclerocystis (Glomaceae. (1996) utilizan un procedimiento diferente para establecer cultivos trampa. homogeneizar el suelo de campo con arena estéril (50% de suelo de campo y 50% de arena).5 kg y sembrar abundantemente con una mezcla de semillas de sorgo y frijol (40-50 semillas por maceta). En el paso 2. Bever et al. se incluyan las raíces de las plantas ya que también sirven como propágulos para iniciar los cultivos trampa. 703–714. B. (1986) ‘Infectivity of vesicular-arbuscular mycorrhizal fungi: Influence of host-soil diluent combinations on MPN estimates and percentage colonization’. J. Comentarios: es importante que. Glomales)’. pp. llamado “cultivos trampa de trasplante”. Part 2: Chemical and Microbiological Methods. 232 Manual de biología de suelos tropicales . extraer las esporas e identificarlas. según lo explicado arriba. M. 2 Colocar esta mezcla en macetas de plástico de 1. Cubrir las semillas con la mezcla de suelo y arena. 1467–1472. T. Wisconsin.

87. P. (1974) ‘Endogonaceae in the Pacific Northwest’. pp.. J. y Fish. (1980) ‘An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots’. Fisher. Journal of Ecology. R. B. 84. 21. D. (1979) ‘Fungal and arboreal biomass in a Western Oregon Douglas-fir ecosystem: Distribution pattern and turnover’. J. y Morton. M. 53. Giovannetti. M. 641–652. Cochran. R. Biometrics. 84.Bagyaraj. G. pp. J. K. Hall. 14. G. J. 46. 171–213. (1963) ‘Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting’. J. G. y Abbott. L. D. A. B. D. Canadian Journal of Forest Research. J. Robson. Rai. Bentivenga. Mycologia Memoir. y Yates. J. P. pp. (1990) ‘Ecology of vesicular-arbuscular mycorrhizae’. Mukerjii and G. Oliver and Boyd. pp. Soil Science Society of America Journal. (1991) ‘Mycorrhizas in natural ecosystems’. J. D. (1989) ‘Infection unit method of vesicular-arbuscular mycorrhizal propagule determination’. Antonovics. vol. B.. Mycol ogi a. 261–270. B. 1–76. in D. A. 489– 500. M. 720–732. vol. W. vol. (1987) ‘The effect of surface mining on the infectivity of vesicular-arbuscular mycorrhizal fungi’.. vol. 71–82. R. 35. Gerdemann. Marcel Dekker Inc. vol. K. (eds) (1963) Statistical Tables for Biological. (1979) ‘A key to the Endogonaceae’. y Mosse. Australian Journal of Botany. A. (1950) ‘Present status of biometry’. 245–256. incorporating developmental patterns of morphological characters’. R. Edinburgh. pp. Advances in Ecological Research. F. A. H ongos micorrizógenos arbusculares 233 . Agricultural and Medical Research. J. I. pp. pp. Morton J. vol. 119–142. New Phytologist. y Varma. y Schultz. pp. W. vol. D. L. 235–244. 73. 754–756. pp. pp . Brundrett. Fogel. A. (1995) ‘A monograph of the genus Gigaspora. Gerdemann. Transactions of the British mycological Society. y Hunt. Advances in Microbial Ecology. vol. (1996) ‘Host-dependent sporulation and species diversity of arbuscular mycorrhizal fungi in a mown grassland’. Jasper. y Nicolson. 9.. G. T. Bagyaraj. Arora. New York. W. y Bethlenfalvay. y Trappe. 75–78. (1995) ‘Interaction between arbuscular mycorrhizal fungi and plants: Their importance in sustainable agriculture and in arid and semiarid tropics’. Franson. Bever. S. 5. vol. Transactions of the British Mycological Society. vol. C. Knudsen (eds) Handbook of Applied Mycology: Soil and Plants. pp. J. K. vol. H. vol. pp. R. 6.

137–210. 93. pp. 37. Morton. J. 1). Mosse. S25–S32. y Wedin. Mycotaxon. vol. New Phytologist. P. 471–491. P. and interpretation of diversity in arbuscular endomycorrhizal fungi (Glomales. F. Alexander (eds) Mycorrhizas in Ecosystems. L. P. (1985) ‘Species of Gigaspora (Endogonaceae) with roughened outer walls’. Read. (2001) ‘Two new families of Glomales. a new vesicular-arbuscular mycorrhizal fungal genus in the Glomeromycetes’. y Hayman. C. vol. D. P. A. (1997) ‘Soil carbon. C. Zygomycetes)’. (1989) ‘A modified procedure for staining roots to detect VA mycorrhizas’. pp. pp. y Gemma. C. Mycologia. y Redecker.Johnson. Acaulosporaceae and Gigasporaceae. T. B.. Archaeosporaceae and Paraglomaceae. 72–82. Schenck (ed) Methods and Principles of Mycorrhizal Research. J. 379–391. 486–505. y Sieverding E. 261–267. H. (1982) ‘Quantification of vesicular-arbuscular mycorrhizae in plant roots’. St. and two new families. pp. E. based on concordant molecular and morphological characters’. E. D. G. D. pp. American Phytopathological Society. in D. Mason. Stribley. y Benny. B. J. A. J. O. vol.. with two new genera Archaeospora and Paraglomus. 702–720. Transactions of the British mycological Society. y Bever. B. Mycologia. F. (1995) ‘Discovery. y Walker. P. (1979) ‘The role of endomycorrhizae in revegetation practices in the semi-arid West. D. D. Paul. Domoto. vol. Koske. D. 66. 5. vol. Philips. (1992) ‘Short-term changes in vesicular-arbuscular mycorrhizal spore populations in Terminalia plantations in Cameroon’. in N. vol. J. Advances in Microbial Ecology.. (1970) ‘Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection’. CAB International Wallingford. B. Ecological Applications. Glomineae and Gigasporineae. M. with an emendation of Glomaceae’. vol. y Last. N. y McGraw. (2004) ‘Pacispora. 7. two new suborders. vol. Journal of Applied Botany. 158–161. 92.. E. American Journal of Botany. Moorman. Canadian Journal of Botany. y Le Tacon. 100. A. nutrients and mycorrhizae during conversion of dry tropical forest to grassland’. T. vol. Morton. (1990) ‘Revised classification of arbuscular mycorrhizal fungi (Zygomycetes): A new order. pp. Oehl. vol. pp. P. Lewis. C. C. A. M. F. Fitter and I. B. Miller. pp. 234 Manual de biología de suelos tropicales . y Walker. (1985) ‘Mycorrhizal fungi at eighteen apple rootstocks plantings in the United States’. H. N. Mycological Research. Kormanik. R. pp. 77. J. Bentivenga. J. (1981) ‘Ecology of mycorrhizae and mycorrhizal fungi’. y Reeves. D. S. J. 14–18. 55. pp. pp. Musoko. D. Glomales. pp. measurement. 78. A. S. 73 (suppl. Koske. 171–182. R. vol. 181–195 Morton. II: A bioassay to determine the effect of land disturbance on endomycorrhizal populations’.

Stutz. Schwarzott. Biotropica. 1413–1421. USA. (2001) ‘A new fungal phylum. C.Picone. y Pérez. N. Spain. 105. 72. 32. W. 734–750.L.. D. pp. F. Appendicispora: a new genius in the arbuscular micorrhiza-forming Glomeromycetes. C. E. 92. 1102–1108. pp. (1996) ‘Successive pot cultures reveal high species richness of arbuscular endomycorrhizal fungi in arid ecosystems’. 17. y Walker. Y. vol. (1979) ‘Most Probable Number method for enumerating infective propagules of vesicular arbuscular mycorrhizal fungi in soil’. y Morton. the Glomeromycota: Phylogeny and evolution’. Gainesville. Redecker. Mycologia. Synergistic Publications. Mycotaxon vol 97. A. vol. J. Australian Journal of Soil Research. vol. 163-182. Sieverding. (2000) ‘Molecular phylogeny of the arbuscular mycorrhizal fungi Glomus sinuosum and Sclerocystis coremioides’. 2006. (1990) Manual for Identification of VA Mycorrhizal Fungi. J. M. pp. J. Canadian Journal of Botany. vol. B. 282–285. B. pp515–519. 3rd Edition. D. pp.. y Bruns. J. T. C. Porter. vol. H ongos micorrizógenos arbusculares 235 . with a discussion of the genus Archaeospora. y Oehl.. Trappe. C. 1883–1889. vol. J. Schenck. 74. D. pp. Phytopathology. Morton. (2000) ‘Diversity and abundance of arbuscular-mycorrhizal fungus spores in tropical forest and pasture’. Schübler. pp. Mycological Research. (1982) ‘Synoptic key to the genera and species of Zygomycetous mycorrhizal fungi’. M.

aggregatum Schenck y Smith G. coremioides (Berk. maculosum Miller y Walker G. Bhattacharjee y Tewari G. Tadych y Madej G. monosporum Gerdemann y Trappe G. albidum Walker y Rhodes G. canadense (Thaxter) Trappe y Gerd. Renker y Buscot G. citricola Tang y Zang G. y Trappe G. Gemma y Olexia G. clarum Nicol. género Glomus Género/Especies Glomus G. microcarpum Tulasne y Tulasne G. y Gerd. botryoides Rothwell y Victor G. y Schenck G. minutum Blaszk.) Trappe y Gerd. pubescens (Sacc. G. macrocarpum Tulasne y Tulasne G. y Ellis) Trappe y Gerdemann 236 Manual de biología de suelos tropicales . melanosporum Gerd. y Trappe G. boreale (Thaxter) Trappe y Gerd. G. corymbiforme Blaszkowski G. microaggregatum Koske. lacteum Rose y Trappe G. proliferum Dalpe y Declerck G. Bhattacharjee y Tewari G. cerebriforme McGee G. multicaule Gerd. y Bakshi G. pallidum Hall G. manihotis Howeler. coronatum Giovannetti G. magnicaule Hall G. liquidambaris (Wu y Chen) Almeida y Schenck G. mortonii Bentivenga y Hetrick G. ambisporum Smith y Schenck G. y Trappe G. clavisporum (Trappe) Almeida y Schenck G. mosseae (Nicol. antarticum Cabello G. y Gerd.1. pansihalos Berch y Koske G.) Gerd. Especies de HMA de la familia Glomeraceae. callosum Sieverding G. delhiense Mukerji. G. arborense McGee G. laccatum Blaszkowski G.. nanolumen Koske y Gemma G. convolutum Gerd. multisubstensum Mukerji. constrictum Trappe G. australe (Berkeley) Berch G. aurantium Blaszkowski. y Broome) Redecker y Morton G. przelewicensis Blaszkowski G. caledonium (Nicol. Sieverding y Schenck G. invermaium Hall G.Apéndice 7. claroideum Schenck y Smith G. Blanke.

G. tenerum Tandy emend. G. versiforme (Karsten) Berch G. fuegianum (Spegazzini) Trappe y Gerdemann G. Spooner y Ivory G. y Trappe emend. glomerulatum Sieverding G. McGee G.1. xanthium Blaszk. warcupii McGee H ongos micorrizógenos arbusculares 237 . tortuosum Schenck y Smith G.caf. fragile (Berk. trimurales Koske y Halvorson G. intraradices Schenck y Smith Fuente: tomado de http://invam. y Broome) Trappe y Gerd. fragilistratum Skou y Jakobsen G. reticulatum Bhattacharjee y Mukerji G. segmentatum Trappe.Apéndice 7. heterosporum Smith y Schenck G. pulvinatum (Henn. y Trappe) Almeida y Schenck G. viscosum Nicol. tenebrosum (Thaxter) Berch G. sterilum Mehrotra y Baijal G. Bloss y Menge G. G. hoi Berch y Trappe G. halonatum Rose y Trappe G. y Broome) Trappe y Gerd. vesiculiferum (Thaxter) Gerd. rubiforme (Gerd. y Gerd. tubiforme Tandy G. dimorphicum Boyetchko y Tewari G. fasciculatum (Thaxter) Gerd. insculptum Blaszkowski G. fulvum (Berk. pustulatum Koske. diaphanum Morton y Walker G. radiatum (Thaxter) Trappe y Gerd.wvu. y Trappe G. G. G. Blanke. G. sinuosum (Gerd.) Walker G.. globiferum Koske y Walker G.) Trappe y Gerdemann G. Continúa Género/Especies G. Walker y Dalpe G. Walker y Koske G. flavisporum (Lange y Lund) Trappe y Gerd. taiwananse (Wu y Chen) Almeida y Schenck G. y Bakshi) Almeida y Schenck G. deserticola Trappe. geosporum (Nicol.edu. tenue (Greenhall) Hall G. Friese. dominikii Blaszkowski G. formosanum Wu y Chen G. etunicatum Becker y Gerdemann G. Renker y Buscot G.

edu. Reed y Sanders A. nicolsonii Walker. thomii Blaszkowski A. Especies de HMA de la familia Acaulosporaceae. Pfeiffer y Bloss A. polonica Blaszkowski A. lacunosa Morton A. infrequens (Hall) Ames y Schneider4 E. laevis Gerdemann y Trappe A. géneros Acaulospora y Entrophospora Género /Especies Acaulospora A.Apéndice 7. schenckii Sieverding y Toro 238 Manual de biología de suelos tropicales . gedanensis Blaszkowski A. longula Spain y Schenck A. kentinensis Wu y Liu E. dilatata Morton A. denticulata Sieverding y Toro A. tuberculata Janos y Trappe A. undulata Sieverding A. mellea Spain y Schenck A. A. Sieverding y Schenck A. excavata Ingleby y Walker A. foveata Trappe y Janos A. delicata Walker. walkeri Kramadibrata y Hedger Entrophospora E.wvu. capsicula Blaszkowski A.2. myriocarpa Spain. colombiana Spain y Schenck E. taiwania Hu A. cavernata Blaszkowski A. Chaverri y Rojas A. bireticulata Rothwell y Trappe A. baltica Blaszkowski E. sporocarpia Berch A. koskei Blaszkowski A. splendida Sieverding. scrobiculata Trappe A. spinosa Walker y Trappe A. morrowiae Spain y Schenck A.caf. elegans Trappe y Gerdemann A. rugosa Morton A. paulineae Blaszkowski Fuente: tomado de http://invam. rehmii Sieverding y Toro A.

franciscana Sieverd. dominikii Sieverd. y Oehl P. y Oehl P. y Oehl P. y Oehl Fuente: tomado de Oehl y Sieverding. Especies de HMA de las familias Archaeosporaceae(Género Archaeospora). y Oehl P.Apéndice 7.3. y Oehl P. trappei (Ames y Linderman) Morton y Redecker Ar. boliviana Sieverd. Sieverd. Daniels y Trappe) Morton y Redecker Ar. coralloidea Sieverd. brasilianum (Spain y Miranda) Morton y Redecker P. emend. chimonobambusae Blaszk. scintillans Rose y Trappe emend.caf. occultum (Walker) Morton y Redecker Pacispora P.wvu. Paraglomeraceae (Género Paraglomus) y Pacisporaceae (Género Pacispora) Género /Especies Archaeospora Ar.edu. Sieverd. y Oehl P. gerdemannii (Rose. robigina Sieverd. leptoticha (Schenck y Smith) Morton y Redecker Paraglomus P. 2004 y http://invam. H ongos micorrizógenos arbusculares 239 .

dipapillosa (Walker y Koske) Walker y Sanders S.) Walker y Sanders 240 Manual de biología de suelos tropicales . reticulata (Koske. hawaiiensis Koske y Gemma S. coralloidea (Trappe.4.) Walker y Sanders S. y Trappe Gi. gilmorei (Trappe y Herd.) Walker y Sanders S. gregaria (Schenck y Nicol. armeniaca Blaszkowski S.) Walker y Sanders S. fulgida Koske y Walker S. albida Schenck y Smith Gi. cerradensis Spain y Miranda S. y Gerd. y Gerd. erythropa (Koske y Walker) Walker y Sanders S. decipiens Hall y Abbott Gi. persica (Koske y Walker) Walker y Sanders S. y Herr. minuta (Ferr. Miller y Walker) Walker y Sanders S. y Ho) Walker y Sanders S. biornata Spain. nigra (Redhead) Walker y Sanders S. géneros Gigaspora y Scutellospora Género /Especies Gigaspora Gi. y Herr. pellucida (Nicol.) Walker y Sanders S. rosea Nicol. calospora (Nicol. dipurpurascens Morton y Koske S.) Gerd. y Herr.Apéndice 7. castanea Walker S. savannicola (Ferr. margarita Becker y Hall Gi. arenicola Koske y Halvorson S. Especies de HMA de la familia Gigasporaceae. y Gerdemann) Walker y Sanders S. heterogama (Nicol. y Schenck Scutellospora S. Sieverding y Toro S. nodosa Blaszkowski S. aurigloba (Hall) Walker y Sanders S. alborosea (Ferr. y Schenck) Walker y Sanders S.) Walker y Sanders S. gigantea (Nicol. Gerd.

) Walker y Sanders S.edu. spinosissima Walker. weresubiae Koske y Walker Fuente: tomado de http://invam. scutata Walker y Diederichs S. H ongos micorrizógenos arbusculares 241 . tricalypta (Herr.caf.4. verrucosa (Koske y Walker) Walker y Sanders S.wvu.Apéndice 7. Continúa Género /Especies S. Cuenca y Sanchez S. y Ferr.

.

Lodge. causando una notable reducción en las cosechas y afectando su calidad. Las investigaciones deben ser diseñadas en forma de estudios a largo plazo donde intervengan especialistas en taxonomía y micología. Los hongos son una parte importante de la cadena alimenticia en el suelo. Pfenning y Lucas Magalhães de Abreu INTRODUCCIÓN Los hongos del suelo juegan un papel clave en los procesos de descomposición que mineralizan y reciclan nutrientes de plantas. Para poder obtener una evaluación confiable de la diversidad de los hongos del suelo. (Wainwright. los hongos interactúan con una compleja comunidad microbiana que incluye: bacterias. 1988. 2000). La evaluación de la diversidad de hongos en suelos tropicales bajo diferentes usos de suelo es. Cuando un estudio de largo plazo involucra varios especialistas no resulta viable. Las actividades agrícolas pueden afectar la diversidad de organismos presentes en el suelo. En el suelo. principalmente para la mesofauna que habita en el suelo (Bonkowski et al. En los ecosistemas agrícolas. por lo 243 . debido al tiempo y la limitación de los recursos. existen dos condiciones básicas. El uso de organismos indicadores. 1993). 1997a y b). podrían ser una alternativa (Hyde.. grupos específicos o un conjunto de predictores. junto con una metodología precisa.Capítulo 8 Hongos del suelo saprófitos y patógenos de plantas Ludwig H. los cuales juegan un importante papel en el reciclaje de nutrientes o son mediadores del equilibrio entre los patógenos y sus antagonistas. los patógenos de plantas actúan en el suelo y en la rizósfera. actinomicetos (actinobacterias) y pequeños invertebrados.

afirmaciones genéricas de que únicamente el 1% de los “microorganismos” del suelo son cultivables aumentan la dificultad y no tienen en cuenta la inmensa diversidad biológica que realmente representan dichos microorganismos (Rondon et al. Gray. Muyzer et al. 1990. debido a que los medios de cultivo imponen nuevas condiciones selectivas y pueden introducir un sesgo en los análisis (Liu et al. Los procedimientos clásicos microbiológicos para estudiar los hongos del suelo se basan en cultivos que implican el aislamiento de propágulos microbianos o hifas activas que crecen en el suelo. Dentro de este grupo se encuentran grupos filogenéticamente diversos. Una medida confiable de las comunidades de hongos en el suelo sin prejuicios requiere del seguimiento de un laborioso programa de aislamientos sistemáticos. que cubran las diferentes idiosincrasias de la diversidad taxonómica y grupos fisiológicos de hongos presentes en los ecosistemas del suelo. y su crecimiento en un medio de cultivo axénico para su posterior identificación y cuantificación.. tales como suelos que muestran limitaciones inherentes debido a la naturaleza de las especies y la inhabilidad de los medios de cultivo para copiar con exactitud los hábitats del suelo (Tsao et al. Sin embargo. medios de cultivo parcialmente selectivos y adictivos que reducen el crecimiento de ciertos grupos de hongos. Los métodos utilizados para el aislamiento del suelo. 2004). aún no están disponibles. 1993.tanto. No obstante. la mayoría de los hongos que habitan en el suelo pueden ser considerados saprotróficos. tales como fila de Eubacterias. puede no ser representativo de la dinámica de las comunidades del suelo. un grupo monofilético de organismos de hongos obligados asociados a las raíces de las plantas (véase Capítulo 7). 1996. Las metodologías para aislar y cultivar hongos de ecosistemas complejos. (1992).. 2000). por lo tanto. 1992. 1983. deben ser capaces de crecer en cultivos axénicos.. con diferentes medios de cultivos y estrategias de aislamiento. han sido revisados por varios autores (Frankland et al. rizósfera y hongos rizoplanos. Gams. 1997).. Cannon. junto con muchos grupos homogéneos como el filum Glomeromycota. 1990. Bills et al. Davet y Rouxel. un objetivo del proyecto CSM-BGBD. Bridge y Spooner. Una visión global de los métodos para estudiar hongos patógenos de plantas en el suelo fue descrita por Singleton et al.. 244 Manual de biología de suelos tropicales . Singleton et al. Incluso el análisis de abundancia relativa de especies cultivables recuperadas del suelo. 1992.. Se ha progresado considerablemente utilizando técnicas de lavado. Los métodos estándares aceptados para inventariar la diversidad de hongos o para evaluar su impacto en varias prácticas agrícolas u otras actividades humanas. 2000... 2001).

1998. LA IMPORTANCIA ECOLÓGICA DE LOS HONGOS DEL SUELO El suelo es un hábitat o ecosistema. y no un sustrato. Aunque este enfoque no es exhaustivo. por lo tanto. se han aplicado métodos que dependen del análisis de la biomasa microbiana del suelo. exudados. además. En este capítulo se hace referencia a algunos de los métodos más comunes y también a algunas técnicas menos conocidas para la evaluación y monitoreo de comunidades de hongos del suelo. Houston et al. sino un ecosistema compuesto por una mezcla de sustratos más diversos que incluyen partes de las plantas vivas y muertas. pequeños invertebrados y contenidos intestinales. No obstante. microorganismos. Por esta razón. y no existe ninguna estimaHongos del suelo saprófitos y patógenos de plantas 245 . se deberá tomar en cuenta que el suelo no es un sustrato. Brodie et al. de los métodos utilizados.. porque el suelo representa una mezcla compleja de fracciones orgánicas e inorgánicas con agua y organismos vivos. Malosso et al. 2003. poca información acerca de las especies de hongos involucrados en dichos procesos. Por ello. animales y otros microorganismos. junto con minerales y agua. Las fracciones orgánicas se componen de material de plantas en diferentes fases de descomposición. principalmente. es necesario adoptar métodos similares dentro de los proyectos cooperativos o multidisciplinarios para garantizar la comparación de los datos en un futuro. 2003). También son tomados en cuenta los principios y aplicaciones de herramientas moleculares en los estudios de comunidades de hongos del suelo. reciclaje de nitrógeno y contenido de ácidos grasos del hongo o de observaciones directas del crecimiento del micelio en partículas de suelo (Widden y Parkinson. estos métodos proporcionan. el suelo alberga una parte considerable de la biodiversidad total de hongos. se requieren los procesos de aislamiento e identificación tradicionales (Brodie et al. raíces vivas. generalmente aceptados. 2006). 1973.. esta característica complica las definiciones y la metodología. Con estos fines.Otras metodologías que han sido desarrolladas se enfocan en el análisis de la actividad de los hongos y su papel en los procesos biogeoquímicos que ocurren en el suelo. En general.. por sí solos. para un mejor entendimiento de la estructura y función de las comunidades de hongos del suelo. respiración del suelo. El objetivo principal es contribuir al establecimiento de una serie de métodos estándares. Los resultados obtenidos de un estudio de hongos del suelo dependen. intenta ofrecer una visión global de los procedimientos disponibles.. cada método presenta ciertas preferencias a ciertos grupos específicos de hongos.

causando que las plántulas se marchiten y. 2003. Algunos elementos biológicos han sido identificados como los principales factores de la supresión de enfermedades (Chet y Baker.. aunque la mayoría ataca una amplia gama de plantas hospederas. 1997.. Éstos pueden ser específicos.. Lodge. 2002. por ende. 1997). los patógenos de plantas y sus antagonistas son particularmente importantes. 2007. Schneider. 1993).. Hawksworth y Rossman. Los hongos del suelo juegan un papel clave en los procesos de descomposición.. 1993. una mejor estructura física del suelo y el control de antagonistas de los patógenos de las plantas en el suelo.. 2001. En sistemas agrícolas. Silva et al.ción fidedigna del número de especies de hongos del suelo (Hawksworth. Lodge. por tanto. pero también es posible que se mantenga o incremente con algunas prácticas agrícolas específicas. 2001). o Coniothyrium minitans pueden reducir la incidencia de una variedad de enfermedades en el suelo (Whipps et al. provocan grandes pérdidas. 246 Manual de biología de suelos tropicales . cabe mencionar que los hongos son responsables de la degradación de xenobióticos y contaminantes orgánicos introducidos en el suelo (Bordjiba et al. plantas utilizadas como cubierta vegetal y la diversificación de cultivos. Los hongos también constituyen una parte importante de la cadena alimenticia dentro del suelo. mineralizando y reciclando los nutrientes de las plantas (Wainwright. especialmente en el caso de la mesofauna (Bonkowski et al. Zak y Visser. Rodrigues-Guzman. por ejemplo. 1991. Existen evidencias de que las prácticas agrícolas causan más alteraciones cuantitativas que cualitativas en la comunidad de microhongos del suelo (Pfenning. 1980. 1997). Barratt et al. 2000). beneficiar directamente la agricultura sustentable. Los patógenos de plantas actúan en el suelo. 1997). los zygomycetes usan carbohidratos simples. mientras los ascomycetes descomponen principalmente celulosa y hemicelulosa (Domsch et al.. 1988. en la rizósfera o infectan tallos. Beare et al. El mantenimiento de la diversidad de hongos del suelo debería. 1996. Mazzola. La supresión de patógenos de plantas puede resultar intrínseca en los suelos. 2004). Con relación al papel de los organismos descomponedores. mediante el suministro de nutrientes. Se ha demostrado experimentalmente que la introducción de antagonistas específicos como Trichoderma spp. 1984. tales como la incorporación de materia orgánica. 2003). Los saprófitos tienen una especificidad limitada por sustratos.

su hábitat e importancia ecológica son variables. La detección de estos organismos requiere de bioensayos o cebos. con un sistema de clasificación filogenético (Kirk et al. Los hongos del reino Protozoa no son numerosos. 2001). Dentro de este reino se reconocen cinco fila: los géneros que pertenecen al filum Glomeromycota forman micorrizas arbusculares y no crecen en ausencia de su planta hospedera (Schußler et al. Plasmodiophora brassicae o Polymyxa graminis. Dentro del grupo de los Oomycetes del suelo es posible encontrar saprófitos. A pesar de que estos hongos representan un grupo delimitado de acuerdo con sus características y filogenia. como se discutió en el Capítulo 7. 2001. Mientras que algunos son verdaderos hongos acuáticos asociados con restos de plantas en agua o con patógenos de otros organismos acuáticos.ASPECTOS DE SISTEMÁTICA MODERNA Protozoa Los organismos conocidos como hongos actualmente se agrupan en tres reinos. tales como Spongospora subterranea.. Estas especies se clasifican en la clase Plasmodiophoromycetes. Los hongos llamados mohos mucosos -un grupo de organismos heterogéneos y polifilético. Por sus características biológicas requieren de técnicas específicas para su aislamiento y caracterización. Kirk et al. Glomeromycota Los hongos clasificados en el reino Fungi se caracterizan por tener quitina como el mayor componente en su pared celular.. aunque algunos de ellos son importantes patógenos de las plantas del suelo. Hongos del suelo saprófitos y patógenos de plantas 247 . Chromista Los hongos que son derivados de algas y que contienen celulosa como el mayor componente en su pared celular pertenecen al reino Chromista Filum Oomycota (Dick. Moreira y Siqueira.. 2001). aunque también pueden encontrarse en el suelo.habitan en restos de plantas. 2002). las cuales se presentan en la sesión “Procedimientos basados en cultivos”. así como otros géneros patógenos de plantas. Trabajar con este grupo de simbiontes biotróficos obligados requiere del uso de diferentes técnicas específicas. otros habitan en el suelo. 2001.

Mucor. Se caracterizan por la formación de las ascas. Especies de los géneros Absidia. 2006) y en la mayoría de los casos por la formación de un cuerpo fructífero.. Varias de estas especies se conocen como trasmisores de virus patógenos de plantas (Krik et al. tales 248 Manual de biología de suelos tropicales . por lo general. Ascomycota El filum Ascomycota representa el grupo más abundante de hongos. insectos. algunos de estos hongos habitan en el suelo. una estructura formada durante la fase sexual de su ciclo de vida. Zygomycota Representan el filum Zygomycota y se consideran como hongos de azúcar por su preferencia por carbohidratos simples y por su crecimiento vigoroso en un cultivo axénico. Gongronella. pero normalmente son acuáticos y viven como saprófitos o parásitos de otros organismos como nematodos. La fase asexual de los ascomycetes se llama anamórfica y es la fase más comúnmente encontrada. 2008). El micelio vegetativo se desarrolla. Muchos de ellos forman ectomicorrizas en asociación con el sistema de raíces de árboles forestales. plantas u otros hongos. 1998) que no son consideradas en este manual. un meiosporangio en el que generalmente se forman cuatro esporas sexuales (Bauer et al. distinguir los grupos más importantes. Los patógenos de plantas importantes en el suelo son especies de Rhizoctonia y Sclerotium. Para fines prácticos. en el suelo y en restos de plantas. Mortierella o Rhizopus son muy comunes en el suelo y se encuentran en casi todos los estudios de hongos de suelo. La filogenia de este grupo aún es objeto de discusión y de revisión. Cunninghamella. La evaluación de la diversidad de estos hongos y el monitoreo de su impacto en la comunidad requieren de técnicas específicas (Rossman et al..Chytridiomycota El único grupo dentro del reino de los hongos que forma esporas flageladas es el filum Chytridiomycota. Basidiomycota El filum Basidiomycota se caracteriza por el basidium..

como plectomycetes. pueden resultar contraproducentes para la recuperación de especies de hongos. en caso de que se haya previsto realizar otros análisis físicos y químicos del suelo.) deberán lavarse antes y después de tomar las muestras. tres o más muestras compuestas podrán colectarse en cada punto de muestreo. Algunos de los ascomycetes como Aspergillus y Penicillium que habitan en el suelo. etc. a pesar del uso de antibióticos en los medios de cultivo. 2008). pertenecen a los plectomycetes. azadón. debido a que la micobiota de la rizósfera es altamente influenciada por las especies de plantas. con el fin de evitar la contaminación entre puntos de muestreo. discomycetes. ascomycetes que forman un asca en un cuerpo fructífero cleistotecal. si los recursos lo permiten. preferentemente a 4°C y congelarse lo más pronto posible para su futuro procesamiento. la detección y el monitoreo de los hongos de organismos protistas como Spongospora y Plasmodiophora puede llevarse a cabo mediante bioensayos. La rizósfera también contiene una alta concentración de bacterias que. MUESTREO DE SUELO Utilizando un nucleador se extraen pequeñas cantidades de suelo. espátula. EVALUACIÓN DE LOS HONGOS DEL SUELO: PROCEDIMIENTOS BASADOS EN CULTIVOS Todos los métodos propuestos dependen de muestras del suelo y no contemplan el uso de raíces para aislar hongos del suelo. Para la extracción del DNA. La hojarasca deberá ser removida justo antes de extraer la muestra. De manera alternativa. el grupo más grande de hongos encontrados en el suelo son los pyrenomycetes anamorfos (Krik et al. Todos los materiales de muestreo (nucleador. Cada juego de 12 muestras se homogenizan para formar una muestra compuesta de alrededor de 500 g que se coloca en una bolsa de plástico.. utilizando plantas altamente susceptibles. Debido a su pequeño tamaño y estructura poco diferenciada. Hongos del suelo saprófitos y patógenos de plantas 249 . las muestras del suelo deberán trasladarse al laboratorio utilizando un recipiente con aislamiento. pyrenomycetes y loculoascomycetes puede ser útil. a una profundidad de 20 cm en 12 puntos distribuidos en cada parcela de muestreo de acuerdo con el esquema mostrado en el Capítulo 2. Probablemente. También se recogerá una segunda muestra compuesta de alrededor de 200 g.

1 para la composición del medio). la C) muestra un cultivo puro en el cebo y en la D) se observa el esporangio de Phytophthora. Alícuotas de 2 g de suelo se traspasan a cajas Petri que contienen agua estéril destilada. Se esterilizan en autoclave fragmentos de hojas de zacate y se añaden a los tubos como tejidos para recuperar el Pythium spp. Otra técnica con sustrato susceptible utiliza muestras de suelo húmedo de 0. Pueden llevarse a cabo ensayos cuantitativos utilizando la frecuencia de la colonización relativa de los tejidos del cebo entre las réplicas de cada muestra de suelo.. 1998. agar dextrosa y papa (ADP) o agar de papa y zanahoria (en el caso de Pythiaceae) (véase Apéndice 8. Tsao et al. Gams et al. 2000). mientras que el oogonio y anteridio de Pythium se ilustran en E)”. 250 Manual de biología de suelos tropicales . en la sección de color de este manual. en la última ilustración F). Al final de dicho procedimiento se deberá observar que se obtiene únicamente un aislamiento para cada placa. Se añaden granos de sorgo como cebo y se incuban por cinco días.. Chytridiomycetes) de muestras ambientales aparece en la ilustración 6. El micelio del hongo formado en el sustrato deberá traspasarse a charolas con el medio MP5 (en el caso de Saprolegniaceae) y agar con harina de maíz (AHM). 1983. se observa la liberación de zoosporas de Pythium.. después se comprueba la presencia de micelio en el cebo. las porciones de agar que contengan micelio serán transferidas a placas con agua estéril destilada y con dos mitades de semillas de sorgo. Edena et al. Los tejidos infectados deben transferirse en agua estéril con el antibiótico cloranfenicol durante unas horas. la B) una muestra de agua con cebo. El aislamiento de hongos zoospóricos (Oomycetes. Las muestras son incubadas durante tres a cinco días a 25°C en la oscuridad. Especies de Pythium y Phytophthora pueden causar serios daños a plantas cultivadas. tomate o papa. Este procedimiento deberá continuarse durante varias semanas. La ilustración A) representa una muestra de suelo con cebo.Oomycota: uso de cebos para el aislamiento de Pythium y Phytophthora Para poder recuperar del suelo los oomicetes es aconsejable el uso de plantas susceptibles o tejidos vegetales. El micelio en crecimiento se verifica directamente mediante montajes con agua en un microscopio o se transfiere del cebo al medio de aislamiento (AHM) que contiene cloranfenicol (50 mg L-¹) y benomil (10 mg L-¹) (Marks y Mitchell. 1970. Después de incubar durante tres a cinco días. Las hojas de zacate como cebo pueden ser sustituidas por pedazos de frutas o verduras como pepino. finalmente.5 g colocadas en tubos de ensayo de vidrio esterilizado con 3 ml de agua estéril.

se verifica el crecimiento típico de Rhizoctonia. Después de un periodo de incubación de 24 a 48 horas. (2002). Un método para evaluar la densidad de inóculo de Rhizoctonia spp. se describen varios métodos. (1991). y pedazos de frutas y verduras (Gams et al. A continuación. Las partículas de suelo retenidas se secan con papel absorbente estéril y se transfieren a una caja Petri de 15 cm de diámetro que contenga un medio de agar con agua acidificada (al 2%) con 250 mg L-¹ de cloranfenicol. piel de serpiente.Uso de cebos para el aislamiento de Chytridiomycota Para evaluar los Chytridiomycota se usan las mismas técnicas empleadas para los oomicetos. 1998). 1991).5 mm. se lavan con agua destilada durante Hongos del suelo saprófitos y patógenos de plantas 251 . alas de insectos.. se presentan dos métodos de aislamiento útiles. Los cebos más apropiados incluyen cáscara de camarón. los cebos pueden transferirse a viales. se recuperan las semillas con un tamiz de 1. se evalúa la frecuencia de la colonización en las partículas del suelo y el micelio se transfiere a ADP para su eventual caracterización (Sneh et al. Método de partículas de suelo Una suspensión de 10 g de muestra de suelo y agua de la llave es agitada. en suelos de jardines de eucaliptus clonados fue descrito recientemente por Sanfuentes et al. después decantada usando un tamiz de 0. Después de un periodo de incubación de 48 horas a 25°C.. Técnica de cebo Se mezcla 1 g de semillas de betabel con 100 g de suelo húmedo en cajas Petri. posteriormente. a 25°C. compilados por Sneh et al. Basidiomycota – Rhizoctonia: técnica de cebo y aislamiento directo de partículas de suelo Para evaluar este género de basidiomicetes anamórficos del suelo. Como el aislamiento de colonias individuales en un medio de cultivo axénico es difícil.5 mm. la caracterización e identificación se hace directamente en el cebo. El suelo retenido se resuspende y se pasa varias veces por el tamiz. Para su preservación.

para la inhibición de hongos de rápido crecimiento. La técnica de lavado de suelo es un método adecuado para el aislamiento de estas especies. utilizando un juego de tamices de 1. Técnica de lavado Una muestra de 10 g de suelo mineral se agita con 200 ml de agua destilada en una centrífuga a 180 rpm durante 10 minutos. 1975). primers) específicos y su análisis cualitativo e incluso cuantitativo puede resultar idóneo bajo circunstancias específicas (Lees et al. que contenga 100 mg L-¹ de cloranfenicol.7 mm. el empleo de técnicas de cultivo independiente.5 mm y 0. 0. Las partículas de suelo prelavadas son filtradas.20 minutos. su aplicación en el estudio de suelos bajo vegetación natural. Ascomycota: técnica de lavado del suelo y filtración de partículas Éste es el mayor grupo de hongos del suelo que incluye especies saprófitas. Todas estas especies exhiben una fase saprotrófica en el suelo y pueden ser aisladas utilizando una metodología con placas de suelo. por el grupo de investigadores involucrados en el proyecto. Los coloidales de suelo y granos de arena son removidos del último tamiz.0 mm.. se secan con papel absorbente estéril para ser transferidas a un medio de agar con agua al 2%. 0. en estos suelos. fitopatógenas y sus antagonistas. 2002). secados con papel absorbente esterilizado y transferidos (7 partículas por placa) a 5 cajas Petri (90 mm) que contienen el medio de aislamiento AHM (30 g L-¹). el sobrenadante se desecha y se repite el procedimiento dos veces. Después de la sedimentación de las partículas del suelo durante 2 minutos. La frecuencia de colonización de partículas de suelo para cada especie de hongos es utilizada en ensayos cuantitativos. De esta manera.. más estreptomicina plus (50 mg L-¹) para la inhibición de bacterias y ciclosporina (10 mg L-¹) o rosa de Bengala (70 mg L-¹). entomopatógenas. como la amplificación de DNA ribosomal de Rhizoctonia con iniciadores (en inglés. A pesar del uso común de varios métodos para el aislamiento de Rhizoctonia de muestras de suelo agrícola.21 mm usando agua destilada (alrededor de 2 litros) por 2 minutos. Cuando se emplea ciclosporina se logra una supresión casi completa 252 Manual de biología de suelos tropicales . ha mostrado severas limitaciones debido a la continua presencia de Trichoderma spp. El crecimiento de Rhizoctonia se verifica y se transfiere micelio a ADP para su aislamiento y caracterización (Papavizas et al.

una cantidad conocida de suelo es suspendida en agua estéril. se debe evitar el uso de ciclosporina (Dhingra y Sinclair. Gams. Se pueden lograr medidas cuantitativas multiplicando el promedio de las unidades formadoras de colonias (UFC) en las placas. Por lo tanto. Bååth. El método de dilución del suelo en placa Este es el método de uso más común para el aislamiento y estimación cuantitativa de bacterias y hongos.. estreptomicina o penicilina para inhibir el crecimiento de bacterias. 2003). Las alícuotas de la dilución final son distribuidas en cajas Petri que contienen un medio de agar generalmente. 1985. por el factor de dilución empleado. 1992. Un factor final de dilución de 10-4 ó 10-5 se considera adecuado para el aislamiento de hongos (Dhingra y Sinclair. éstos pueden contener fuentes de carbono preferiblemente metabolizados por algunos grupos fisiológicos de hongos o pueden modificarse con químicos que inhiben el crecimiento de organismos no deseados. rutinariamente se utilizan medios selectivos. 1985). Gams et al. 1988. Lang y Jagnow. Kacprzak y Stanczyk-Mazanek. hasta lograr la dilución final.de zygomycetes saprotróficos. Un gran número de medios selectivos ha sido desarrollado para el aislaHongos del suelo saprófitos y patógenos de plantas 253 . La técnica es muy simple y se han descrito varias modificaciones. cuando se trata de estudiar este último grupo de hongos. De esta suspensión se prepara una serie de 10 diluciones. modificado con antibióticos como cloranfenicol. Tsao et al. Ascomycota: medios selectivos y técnica con cebo Para un aislamiento selectivo de grupos blanco o especies de hongos del suelo. la cual se mantiene en agitación durante unos momentos. la diversidad de hongos que normalmente existen en forma de micelio que crece activamente en el suelo. 2004). 1983). Este método se puede observar en la ilustración 7.. Existe una preocupación generalizada porque el método de dilución en placas muestra un sesgo hacia los hongos que son capaces de producir grandes cantidades de esporas y que crecen muy rápido en un medio de cultivo rico. el resultado es una estimación del número de propágulos de hongos por gramo de suelo (Bills et al. Por lo tanto. Básicamente.. se toma 10% de la suspensión. 1994. y que tienen poca habilidad de competir con especies de rápido crecimiento en medios axénicos son subestimados por esta técnica (Bååth. 1988. 1986. 1998. Bills y Polishook.

utilizando como cebo hojas de Ricinus communis Cylindrocladium es un género conformado por especies saprotrófitas y patógenas de plantas comúnmente encontradas en el suelo. Procedimiento para el aislamiento para el aislamiento de Cylindrocladium y géneros afines del suelo. quitina para los productores de quitinasa. el tejido cebo es incubado con una muestra de suelo durante unos días. La colonización del cebo por un hongo clave también puede llevarse a cabo mediante la observación directa al microscopio (Gams et al.. 1983. larvas de insectos para los entomopatogénos y nematodos para los hongos nematófagos (Marks y Mitchell. después se transfiere a un medio selectivo de agar para su posterior aislamiento de los hongos deseados.. Hojas jóvenes y frescas se recogen y se lavan bajo agua de la llave para posteriormente ser sometidas a una desinfección con etanol al 70% durante un minuto. el medio usado es Komada (Masago et al.. 1996. 2002b).. cuyo protocolo se describe a continuación. 1975.. aquéllos que contienen especies patógenas de plantas. en particular. 1998. Pettitt et al. Barratt et al.... A pesar de ello. Como el Cylindrocladium y probablemente otros géneros son sensibles a la ciclosporina. Edel et al... para el aislamiento de Rhizoctonia solani se utiliza agua-agar acidificada. 2003.. cabello para las especies queratinofílicas. Gonçalves et al. 1991. Wellington et al. 1998). deberán aislarse selectivamente usando cebos. En el laboratorio se utilizan hojas de ricino (Ricinus communis) como cebo para el aislamiento de hongos del complejo Cylindrocladium de manera rutinaria. 1985. Ejemplos de cebos utilizados para el aislamiento selectivo de hongos del suelo son tejidos de plantas para el caso de patógenos de plantas. 1970. Dackman et al. 2001). El aislamiento selectivo de los hongos del suelo también puede llevarse a cabo con cebos que son colonizados por grupos fisiológicos específicos de hongos. Gams et al. especies de Cylindrocladium y de las especies relacionadas Cylindrocladiella y Gliocladiospsis raramente son reportadas en muestras de suelo que emplean el método de dilución del suelo por placas. En la mayoría de los casos. 2002.1987... Sneh et al. basidiomycetes y oomycetes del suelo. Thorn et al. Dhingra y Sinclair. Sneh et al.. 2000. Tsao et al. Edena et al. 254 Manual de biología de suelos tropicales . Papavizas et al. 1991.. 2001. por ejemplo. 1977.miento de varios géneros de ascomycetes. 2003). varios materiales de plantas adecuados para su aislamiento fueron descritos en una monografía reciente (Crous. mientras que para Fusarium spp.

que es un grupo heterogéneo que incluye saprófitos. IDENTIFICACIÓN DE HONGOS DE SUELO La identificación de hongos que habitan el suelo puede causar problemas para aquéllos que no tengan suficientes conocimientos de micología.. El trabajo de Barnett y Hunter (1998) es usado para unos pocos de los muchos saprófitos. durante dos minutos. tal como ADP y AM (agar extracto de malta) que contiene cloranfenicol (250 mg L-¹). donde diariamente se verifica la esporulación típica de Cylindrocladium.seguida de hipoclorito de sodio al 3%. Después de más de 20 años. endófitos y patógenos de plantas. 1998. utilizando agujas finas de cristal. Gliocladiospsis y otros géneros relacionados. síntomas de podredumbre. por lo tanto. Gonçalves et al. Las hojas enteras se colocan un una caja Petri de 15 cm y se cubren con una capa de suelo húmedo. Las semillas de tomate se germinan en 100 g de suelo y se verifica si las plántulas manifiestan o no. el amplio trabajo de Domsch et al. incluyendo hongos del suelo.. El aislamiento del hongo se logra con la transferencia de esporas a un medio de cultivo. después de tres días de incubación se lavan las hojas cuidadosamente con agua destilada y se transfieren a una cámara húmeda. 2001. Crous. Cylindrocladiella. (2007) aún sigue siendo una fuente importante para todos los involucrados en el estudio de hongos del suelo. es recomendable para su aislamiento el uso de plántulas de tomate como cebo. Los tejidos de plántulas infectadas se esterilizan con hipoclorito de sodio (al 2%. enseguida se lavan con agua destilada y se secan en papel absorbente esterilizado para ser transferidas a un medio de aislamiento. 2002b). Además de las claves y monografías de alrededor de 250 géneros. este compendio contiene claves para especies de varios géneros importantes y una recopilación de la literatura. durante 30 segundos). Las hojas utilizadas sin desinfección previa tienden a ser degradadas con mayor rapidez y a ser colonizadas por bacterias. bajo un microscopio estereoscópico (Gams et al. Hongos del suelo saprófitos y patógenos de plantas 255 . Las dificultades de identificar a nivel de especie se ilustran con el género Fusarium. Técnica de cebo para el aislamiento de patógenos fúngicos de plántulas Una amplia gama de hongos patógenos de plantas en el suelo puede causar la muerte prematura de las plántulas.

Samson et al. Si se trata de identificar ascomycetes.. 2002b)... (1991) resulta útil para trabajar con Rhizoctonia.. Las secuencias de DNA son amplificadas directamente desde el suelo por medio de la reacción en cadena de 256 Manual de biología de suelos tropicales . Tsao et al. algunos tipos de hongos como Basidiomycota son difíciles de aislar y pueden no esporular en un medio axénico (Thorn et al. éstos incluyen técnicas específicas de DNA. (1998). (Klich y Pitt 1988). Penicillium (Pitt. 1967. La monografía de Sheh et al. 1971. las monografías y claves de Hanlin (1990. No obstante. Samuels et al. Nag Raj. 2001. c. Muyzer et al. 1983. 1996). 1993. Bills et al. b. de mucha utilidad para este tema otras recopilaciones y monografías como la de Ellis y Ellis (1985). 1981) y para Phytophthora (Waterhouse. 1980. 1983. Las herramientas moleculares basadas en el análisis del DNA han sido aplicadas con éxito en el estudio de complejos bacterianos y.Monografías y páginas web se encuentran disponibles para identificar las especies de Aspergillus. 1976) y coelomycetes anamórficos (Sutton.. van der Plaats-Niterink. 1993). 2001). Erwin y Ribeiro. EVALUACIÓN DE HONGOS DEL SUELO: TÉCNICAS ESPECÍFICAS DE DNA Una medida confiable de las comunidades de hongos del suelo. Trichoderma (Bissett. 1984. 2004).. se puede consultar el Dictionary of the Fungi (Kirk et al. 2000). b) pueden ser un buen punto de partida. (2000) o el manual de Gams et al. Fusarium (Leslie et al. sin embargo. 1968.. Existen monografías disponibles para chyrids (Karling 1977) y también para el género Pythium (Waterhouse. requiere de un laborioso programa de aislamientos sistemáticos con diferentes medios de cultivos y estrategias de aislamiento que reflejen la inmensa diversidad taxonómica y fisiológica de grupos de hongos que habitan en el suelo (Tsao et al. hifas anamórficas pigmentadas (Ellis. Se pueden utilizar otras metodologías para complementar los enfoques tradicionales usados para un mejor entendimiento de la diversidad y dinámica de los hongos del suelo. No son específicas para el caso de hongos del suelo. 2006). recientemente. Cylindrocladium (Crous. Para más instrucciones acerca de cómo identificar hongos o grupos específicos de hongos.. 1998a. 1996). 1970. 1991a. sí. Bridge y Spooner.. en ensambles de hongos a partir de muestras ambientales. Una lista de referencias de guías y manuales para la identificación de grupos de hongos de suelo puede consultarse al final de este capítulo.. (página web).

La heterogeneidad encontrada a nivel de micro-escala en el suelo debe ser considerada cuando se selecciona el tamaño de la muestra de suelo sometida a la extracción total de DNA. 1997. El rDNA también contiene espaciadores entre las regiones codificantes conocidos como espaciadores internos de transcripción (ITS) que presentan secuencias de bases menos conservadas y que pueden utilizarse para la diferenciación entre especies relacionadas o para evaluar Hongos del suelo saprófitos y patógenos de plantas 257 . El polimorfismo en la longitud del DNA y la variación en la secuencia de las bases pueden utilizarse para agrupar organismos de acuerdo con su origen y relación evolutiva. facilitando la amplificación de pequeñas muestras de DNA. en los procesos físicos de macerado asociado con calor y lisis química. es la extracción del DNA directamente del suelo. 5. Viaud et al. 2001)... Los kits para la extracción de DNA del suelo están comercialmente disponibles. debido a una variabilidad más alta dentro de la muestra (Ranjard et al. tienen que estar correctamente lisadas. Las muestras muy pequeñas (menores a un gramo) deben usarse con precaución porque tienen mayor probabilidad de error. Uso de Primers específicos para “hongos” El grupo de genes para las moléculas de RNA Ribosomales 18S. Bridge y Spooner. 2001). La identificación de secuencias de DNA desconocidas también puede realizarse comparándolas con bases de datos de secuencias de nucleótidos de taxones conocidos. este paso se logra mediante separaciones a través de columnas de separación o con el uso de kits comerciales de purificación de DNA (Liu et al. principalmente. Extracción de DNA Un paso crucial antes del PCR.la polimerasa (PCR) y posteriormente caracterizadas utilizando varios enfoques (Bridge y Spooner. Las células de los hongos presentes en la muestra del suelo. 2001). Varias copias del DNA ribosomal (rDNA) se encuentran en el genoma eurocariota.8S y 28S se considera que son altamente conservados entre los organismos eucarióticos y normalmente se emplean como marcadores moleculares.. Reacción en cadena de la polimerasa. El total de DNA obtenido debe estar completamente purificado para eliminar sustancias húmicas y fenólicas que interfieren con el PCR. 2000. Los protocolos de extracción se basan. incluso como micelio o esporas.

2002. utilizando Primers específicos para Géneros y/o especies de interés (Nechwatal et al. Algunos hongos que están presentes en muy bajas densidades en suelos naturales.divergencias genéticas intraespecíficas (Viaud et al.. además. tales como especies de Phytophthora. 2003). conectados a vectores plásmidos y clonados en células bacterianas. ya que el PCR tiende a amplificar moléculas del DNA que son dominantes en el extracto del DNA total. algunos de estos Primers específicos han mostrado que amplifican DNA no fúngico o muestran preferencia hacia la amplificación de grupos taxonómicos específicos dentro del reino de los hongos (Smit et al.. 2000. Como el suelo contiene un gran número de organismos. 2003). Estos procedimientos son caros.. Por 258 Manual de biología de suelos tropicales . Baayen et al. la detección molecular de muestras de suelo puede ser mejorada mediante el uso de técnicas de cebo en conjunto con PCR. consumen tiempo y. extraídos de matrices de gel.. El DNA clonado es secuenciado y comparado con las bases de datos que contienen secuencias oligonucleotídicas del rDNA fúngico mediante análisis de software. 2000... son difíciles de detectar por métodos moleculares. Para este tipo de investigación se han desarrollado varios iniciadores especie-específicos para una detección directa y el monitoreo de patógenos de estas plantas a partir de muestras del suelo (Cullen et al. no son adecuados para la evaluación de muestras ambientales complejas. el obtener Primers o iniciadores de rDNA de hongos específicos constituye un paso fundamental en la amplificación del PCR. los amplicones de tamaño correcto pueden separarse en geles de agarosa. Filion et al.. Secuenciación del DNA Para poder conocer las identidades del DNA de los hongos amplificados por PCR. han sido desarrollados y compilados por Anderson y Cairney (2004). Basándose en las secuencias de genes de RNA ribosomal disponibles en bancos de datos especializados para varias especies de hongos. 2000. 2002. 2001).. 1999. Borneman y Hartin. Lees et al. Down. La detección y/o cuantificación de pocas especies específicas de hongos es requerida generalmente en el campo de la fitopatología. purificados. Sin embargo. En el caso de estos hongos. Anderson et al. los Primers que son específicos para amplificar PCR del DNA de hongos de muestras complejas de suelo. 2002). Los Primers permiten la amplificación de una amplia gama de especies de hongos sin perder la especificidad de este grupo clave.

Las restricciones y limitaciones están representadas en la selección de Primers utilizados en el primer paso de amplificación después de la extracción total del DNA de las muestras. al igual que para monitorear modificaciones o impactos debidos a prácticas agrícolas o actividades industriales (Smit et al. 2000. las moléculas 18S DNA amplificadas por PCR son sometidas a una electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) o con un gradiente desnaturalizante (DGGE). el DNA se extiende a la misma longitud (como resultado del PCR). contienen un DNA con bases repetitivas de GC que resultan menos propensas a la desnaturalización debido a su alta estabilidad química. Anderson et al.. Vandenkoornhuyse et al. Hongos del suelo saprófitos y patógenos de plantas 259 .. 2003). Los iniciadores usados en el PCR.. 2000. En esta técnica. En varios estudios se ha usado esta técnica para evaluar la estructura de la comunidad de hongos y otros microorganismos. 2004).. Varias combinaciones de Primers han sido propuestas para amplificar DNA de distintos grupos de hongos como Ascomycota. Gomes et al. pero con diferentes secuencias de pares de bases. El gradiente de desnaturalización en DGGE puede variar con el uso de diferentes cantidades de urea y de formamida en la matriz del gel. presentan diferentes comportamientos de desnaturalización y migran hacia diferentes puntos en el gel (Muyzer et al. Los patrones de bandeo generados son utilizados para analizar complejas comunidades de hongos del suelo. 2003. pero difieren en su contenido de Guanina-Citosina (GC). Basidiomycota.. lo que determina el modo de desnaturalización y la movilidad electroforética al migrar en el gel desnaturalizante. Viaud et al. Bajo estas condiciones de desnaturalización.. Por lo tanto. y se llaman dominios de fusión.. 2002. 1993).ello. Elsas et al. Milling et al. Método de huella molecular TGGE y DGGE La electroforesis en gel con gradiente de desnaturalización fue introducida en estudios sobre ecología microbiana por Muyzer y Smalla (1998). 2000. parcialmente desnaturalizadas debido a las diferencias de la desnaturalización de los dominios menos estables en las moléculas. moléculas de DNA con diferentes secuencias en sus pares de bases. 1999. generalmente. se han desarrollado técnicas moleculares de huella o rastreo molecular (en inglés fingerprint) para estudiar la diversidad a nivel de comunidad (Borneman y Hartin.. Los amplicones tienen exactamente el mismo número de nucleótidos.

los análisis bioquímicos y las técnicas de aislamiento. después de la amplificación del DNA por PCR directamente extraídos del suelo utilizando Primers género-específicos (Nechwatal et al. la comigración de diferentes moléculas de DNA hacia un mismo punto en el gel. 2004). el DNA es amplificado por PCR con uno de los dos Primers marcados con fluorescencia. T-RFLP Liu et al.. son la mejor opción (Malosso et al. 2006). 2006. 2000).. El uso de un PCR anidado puede arrojar aún mejores resultados e incrementar la resolución en la separación de los productos del PCR (Oros-Sichler et al. los enfoques polifásicos que incluyen la construcción de bibliotecas de fragmentos clonados. Recientemente.. la restricción enzimática del DNA antes de la electroforesis puede utilizarse en una técnica conocida como polimorfismo de longitud de fragmentos de restricción (RFLP) del DNA amplificado por PCR (Viaud et al. tales como TGGE y DGGE. Para incrementar el polimorfismo de la banda y mejorar la resolución. Zygomycota y Oomycota (Nikolcheva y Bärlocher. Los fragmentos de restricción terminal (TRFs) se marcan con fluorescencia y pueden ser detectados y cuantificados en un secuenciador automático. el DNA es tratado con enzimas de restricción y los fragmentos de restricción separados en un gel de acuerdo con su tamaño. la técnica puede proporcionar un estándar altamente reproducible de un gran número de muestras ambientales durante un periodo de tiempo relativamente corto. En el T-RFLP. 2003). Singh et a. llamada polimorfismo de longitud de fragmentos de restricción terminal para el análisis (T-RFLP) de comunidades bacterianas de muestras ambientales. el método de huella molecular.Chytridiomycota. 2006). 2001). Se puede construir una base de datos de TRFs a partir de especies de hongos conocidos y utilizarla en corre260 Manual de biología de suelos tropicales . Técnica PCR-RFLP La escasa variabilidad de rDNA de hongos puede resultar desventajoso en la técnica de huella molecular. No obstante. por ejemplo. Otra limitante es que el DNA obtenido de organismos filogenéticamente distantes puede producir productos de PCR con una movilidad electroforética idéntica (Gomes et al. Después de la amplificación.. (1997) desarrollaron una versión complementaria del PCR-RFLP..l. Las especies de hongos relacionadas pueden identificarse de acuerdo con sus patrones típicos de RFLP.

Lowell y Klein 2001.. Las moléculas de una sola hebra de DNA adquieren estructuras con dobleces únicos dictados por sus secuencias nucleotídicas y migran hacia puntos específicos en el gel. Después de la amplificación. 1997.. especialmente con hongos patógenos de plantas. Kennedy et al.1 muestra algunos ejemplos de técnicas moleculares empleadas para el estudio de comunidades de hongos del suelo publicadas en años recientes. 2005. Kennedy et al. están enfocados en una o en pocas especies de hongos presentes en el suelo. 2005).laciones taxonómicas con los haplotipos detectados en el análisis T-RFLP (Brodie et al. El ARISA de hongos es una técnica altamente sensible. 2000. los fragmentos de DNA del mismo largo.. En el polimorfismo de conformación de cadena sencilla (SSCP). el DNA fúngico es extraído del suelo y amplificado por PCR utilizando Primers específicos para la región ITS con uno de los Primers marcados con fluorescencia. 2006). 1996. PCR cuantitativo Algunos estudios. 2003.. SSCP Otro estudio de huella molecular utiliza la migración diferencial de moléculas de una hebra de DNA en un gel para poder estudiar a las comunidades microbianas más complejas... ARISA El polimorfismo natural de la región ITS del rDNA entre especies de hongos puede utilizarse para la evaluación de comunidades de hongos de suelo. En estos esHongos del suelo saprófitos y patógenos de plantas 261 . Viaud et al. pero disímiles en su secuencia de pares de bases pueden ser fácilmente separados en SSCP por su diferencial de migración en el gel cuando existe la conformación de una sola hebra (Lee et al.. el polimorfismo intra-específico del ITS puede presentar problemas en la separación de distintas especies filogenéticas (O’Donnell y Cigelnik. los diferentes fragmentos de ITS son separados en un gel y posteriormente detectados y cuantificados en un secuenciador automático (Ranjard et al. En el análisis automatizado del espaciador intergénico ribosomal (ARISA). Como consecuencia... La Tabla 8. 2001). sin embargo. Edel-Hermann et al. He et al. 2004. 2005). el DNA amplificado es completamente desnaturalizado antes de ser sometido a una corrida de electroforesis. Singh et al.

Filion et al. Mauchline et al. 2002. Mauchline et al. Las sondas fluorescentes son capaces de emitir fluorescencia en la presencia de DNA de dos hebras. 2002. 2003). Después de un número definido de ciclos de PCR éstos se usan para cuantificar el DNA directamente de muestras de suelo. 1998. Esta técnica es más rápida y más sencilla que cPCR porque no existe la necesidad de construir un competidor de DNA y no se requiere de ningún análisis post-PCR (Cullen et al. se deben diseñar Primers de PCR específicos para obtener la amplificación correcta del DNA de la especie clave y otros marcadores moleculares pueden ser empleados como secuencia del gen β-tubulina o el factor de elongación de traducción del gen EF 1-α (Baayen et al. el PCR convencional es inapropiado para enfoques cuantitativos porque cualquier pequeña variación durante la fase exponencial en la reacción de amplificación puede alterar drásticamente las cantidades de los productos del PCR.. En el caso de ensayos cuantitativos.. los distintos productos de PCR son cuantificados por separado de acuerdo con sus intensidades de bandeo relativas en geles de agarosa. 1992. Filion et al. 2000. La cantidad de DNA en la muestra puede calcularse con la adición de diferentes cantidades de DNA competitivos. En el cPCR. Otro método empleado en aproximaciones cuantitativas es el de PCR en tiempo real. han sido desarrolladas modificaciones del PCR convencional como PCR competitivo (cPCR) y PCR en tiempo real... por lo tanto. Después de esta amplificación. 2003). la cuantificación del DNA de hongos en el suelo es requerida frecuentemente para estudios epidemiológicos y ecológicos. a una cantidad estándar de una muestra de DNA en una serie de PCRs y con el monitoreo de productos PCRs competitivos producidos en cada reacción (Siebert y Larrick. Li y Hartman. fragmentos de DNA que contienen los mismos sitios iniciadores que la muestra de DNA son añadidos en cantidades conocidas a las reacciones del PCR y coamplificados con el DNA específico. Baek y Kenerley. Sondas fluorogénicas o colorantes adicionados al PCRs permiten el monitoreo correcto de los productos obtenidos durante la amplificación. 262 Manual de biología de suelos tropicales ... lo cual puede calibrarse y medirse con precisión. Lees et al. Una curva estándar puede construirse con cantidades conocidas de DNA e intensidades de fluorescentes. 2003. el incremento de moléculas de DNA durante la amplificación conlleva un incremento en la intensidad de la emisión fluorescente..tudios. Además de la detección molecular. 2002. 2002). No obstante.

Tabla 8. los efectos de cambiar el suelo al añadir composta o excremento. 2005 Kennedy et al. análisis de detección y diversidad de especies de Fusarium. 2003 Brodie et al. 2005 Yergeau et al. Suelos de bosque natural y plantaciones de pino hoop... Suelo estepario con pasto corto con o sin presencia de nitrógeno... Gradiente de pastizales semi-naturales a suelos agrícolas mejorados. Tres diferentes suelos cultivados con Lolium perenne... Técnica* TGGE PCR-RFLP SSCP ARISA DGGE Evaluación de comunidades de hongos en Rizósfera y suelo compuesto con trigo. Suelos con diferentes propiedades fisicoquímicas.. 2006 Hongos del suelo saprófitos y patógenos de plantas 263 .. Análisis de la dinámica de comunidades de hongos del suelo vía PCR hongoespecíficos del DNA del suelo. 2004 Edel-Hermann et al.. 2003 Agnelli et al... Suelos bajo cultivos de papa transgénica y no transgénica. Campos de espárragos. Una muestra de suelo por métodos de cultivo y molecular. 2004 Milling et al. 1999 Viaud et al. Rizósfera de dos cultivos de maíz durante el periodo de ciclo de vida de la planta. Pastizales bajo diferentes tipos de vegetación. 2001 Ranjard et al.. amplificados del DNA total. 2004 He et al.1 Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes. 2000 Lowel y Klein. 2003 Gomes et al. Suelos con diferentes propiedades fisicoquímicas. seguido por DGGE..2005 DGGE SSCP y TGGE ARISA y T-RFLP DGGE con iniciadores específicos para Fusarium DGGE y T-RFLP Singh et al. Referencias Smit et al. 2001 Elsas et al. Diferentes horizontes de un suelo de selva. 2000 DGGE DGGE y TRFLP DGGE y restricción de DNA amplificado DGGE T-RFLP Anderson et al.. Gradiente de suelo desde llanuras hasta bosques de pino escocés.

Sin embargo. lo que origina errores en identificaciones morfológicas. generalmente. Muchos obstáculos para la identificación basada en cultivos han sido superados con la llegada de técnicas de aislamiento más sofisticadas como. contienen las mismas limitaciones que las técnicas de cultivos para hongos (Selenska y Klingmüller. los métodos de lavado del suelo y la filtración de partículas.. Las técnicas de huella molecular en comunidades puede monitorear composiciones complejas de hongos de suelo. O’Donnell et al. pero una mejor caracterización y análisis filogénico de taxas dominantes. Otra limitación del enfoque molecular basada en la amplificación del DNA es la falta de conocimientos acerca de la actividad de crecimiento o grupos funcionales 264 Manual de biología de suelos tropicales . los enfoques taxonómicos de hongos basados únicamente en datos moleculares. No obstante. amplificación y secuenciación de contaminantes de hongos e incluso. sin duda. CONCLUSIONES Las herramientas moleculares para ensayos de comunidades de hongos del suelo fueron extraídas. principalmente. 1992. requieren de una secuenciación y comparación utilizando bancos de datos de DNA al alcance del público. 2006 Nota: * la clonación del DNA y la secuenciación fueron usadas por todos los autores para la identificación de haplotipos dominantes amplificados del DNA total. 1994). por ejemplo. este método no se describe para cada ejemplo. pueden presentar algunos problemas debido a que los bancos de datos pueden estar incompletos y puede que las secuencias de DNA se encuentren mal identificadas. 1992. Tsai y Olson. no se aplica en el caso de hongos saprófitos. Hawksworth. por lo tanto. tal y como ha sido discutido. en el caso de los hongos el número de especies no cultivables es.. 2004b).Tabla 8. invariablemente. Lo que puede ser verdad para organismos estrictamente simbióticos. en la secuenciación de quimeras (Crous. Técnica* DGGE y ARDRA Evaluación de comunidades de hongos en Diversidad de hongos en suelos antárticos que combinan cultivo de aislamiento.. huella molecular y técnicas de clonación. Incluso la mayoría de los hongos patógenos de plantas no son parásitos obligados. Referencias Malosso et al. de estudios sobre la diversidad bacteriana y. exagerado.1 Continúa. 2002a. como hongos micorrízicos arbusculares. Bridge et al. 2003.

.de hongos del DNA total extraído del suelo. tales como logaritmo o raíz cuadrada pueden aplicarse antes del análisis (Houston et al. Por el momento. Singh et al. por lo tanto. además del número de cepas.. las curvas que se forman con más facilidad. 1995).. por ejemplo. y también dan información sobre el esfuerzo de muestreo empleado en la investigación. Cuando están disponibles datos sobre variaciones cuantitativas entre las repeticiones dentro de las muestras. los protocolos de extracción del DNA son capaces de lisar y extraer ácidos nucleicos ya sea de micelio en crecimiento activo o de esporas latentes. haciendo difícil la diferencia del crecimiento activo o grupos funcionales basados únicamente en el producto del análisis del PCR. fechas de colecta o diferentes tratamientos de suelo. un enfoque más confiable es realizar un análisis de varianza (ANOVA). La pendiente de las curvas muestra cuáles son las muestras con mayor riqueza de especies. Por medio del ANOVA es posible derivar variaciones entre diferentes muestras y dentro de las muestras (error). ANÁLISIS DE DATOS Una lista de especies o agregados de especies aisladas y su abundancia relativa en cada muestra. 2006. 2006). dado que algunos de los datos no tienen una distribución normal. Como se ha discutido. resulta ser un análisis robusto y confiable (Sokal y Rolf. 1994. 1995). Las curvas de acumulación de especies o curvas de rarefacción pueden proporcionar comparaciones gráficas de la riqueza de especies entre muestras. un entendimiento más completo sobre las comunidades de hongos del suelo deberá centrarse en enfoques polifásicos con ensayos basados en cultivos y taxonomía molecular en asociación con el estudio de los procesos biogeoquímicos que ocurren en el suelo (Malosso et al. pueden añadirse al ANOVA para evaluar sus efectos y sus interacciones con otros datos cuantitativos (Setälä y McLean. 2004). las transformaciones de datos. La prueba de independencia de Chi cuadrada puede usarse para este análisis. donde el número total de cepas de cada muestra se usa en comparaciones pareadas. Adicionalmente. El conjunto de datos preliminares usualmente no es adecuado para hacer los análisis de ANOVA. Sokal y Rohlf. constituye el primer conjunto de datos. La forma de las curvas indica si el número Hongos del suelo saprófitos y patógenos de plantas 265 . generalmente. otros factores. de acuerdo con la acumulación de las cepas muestreadas. como parámetros físicos y químicos del suelo bajo análisis. 1998). el análisis de Kruskall-Wallis (Rodrigues. Otra opción consiste en llevar a cabo un análisis de varianza no paramétrico. Se verifica el número de cepas de cada muestra y este dato puede ser usado para comparar entre sitios. por ejemplo. Para solucionar ese problema.

Muchos índices se han obtenido para evaluar y comparar la diversidad de especies. por ejemplo. Grishkan et al. 1994). 1988. idealmente. El índice Shannon-Wiener se basa en la riqueza y equitatividad de la diversidad de las especies y se encuentra frecuentemente en la literatura (Dighton. 1995). al igual que en otras técnicas de ordenación. Bettucci et al. análisis de correspondencia sin tendencia. Curvas que no tienden a una asíntota indican que el número de especies podría aumentar si se aumenta el esfuerzo de muestreo (Bills y Polishook. son métodos de ordenación adecuados para la clase de datos generados de hongos y de otras comunidades. De manera general. el análisis multivariado no se lleva a cabo en el total de comunidad debido a la naturaleza “ruidosa” de la frecuencia y a la distribución de especies raras. 1994. explican la mayoría de la variabilidad de datos. La información sobre la estructura de la comunidad es mejor si se usa un análisis multivariado. tales como los métodos de ordenación. 1993. El análisis de correspondencia (AC) y su versión modificada.. matrices de datos de gran tamaño (llenas de ceros) y datos de distribución no paramétricos..de especies es estable después de la acumulación de todas las cepas. Los índices de similitud (disimilitud) de diversidad para realizar comparaciones pareadas entre diferentes muestras también son usados con frecuencia (Magurran. 1995). Los índices de diversidad son puramente numéricos y no proporcionan información sobre la estructura de la comunidad. De esta manera. La diversidad de especies de cualquier sistema está compuesta por dos componentes: la riqueza de especies (el número de especies) y la equitatividad o equidad de la frecuencia de especies (Kennedy y Smith. En el caso de AC. común o rara y a la complejidad de los modelos matemáticos que se basan en la distribución de las especies.. 1995). El porcentaje de la varianza total explicada por el primer eje del AC y la contribución de las especies y muestras a la varianza (inercia) de cada eje apoya la designación de especies que ocurren en la comunidad como clave y “casual” (Howard y Robinson. se elige un límite (por ejem266 Manual de biología de suelos tropicales . si las curvas tienden a llegar a una asíntota.). Persiani et al. 1998. Howard y Robinson. basándose en su riqueza o equitatividad o tomando ambas variables y éstos cambian en función de la importancia relativa que se da a la especie dominante. 1982. las relaciones multidimensionales entre muestras y especies se reducen a un número reducido de ejes que. por ejemplo. Los resultados se muestran gráficamente y permiten el análisis de tendencias generales de la estructura de la comunidad (Gauch. datos generados de conteos. 2003). y existen casos en donde dos comunidades distintas pueden tener el mismo índice de diversidad.

2003). 1982. En el futuro. 1996. 0. así como el análisis de conglomerados (cluster). por lo tanto. Oros-Sichler et al. Kirsop... es necesario que sean recopilados. 1992. Los métodos de ordenación de análisis de componentes principales y análisis de correspondencia.. con el objetivo de la preservar las especies ex situ y de suministrar a instituciones de investigación e industrias de este material. 1% ó 5% del número total de aislamientos) y únicamente aquellas especies con una frecuencia de aislamientos igual o superior a este límite son incluidas en el análisis (Gauch. Agradecimientos Al profesor Richard Mibey y a la Dr. 2004). Ryan y Smith. la biología molecular y la conservación de hongos han sido revisados recientemente (Hawksworth. Bettucci et al. Hawksworth. 1993. 2006). al igual que las aplicaciones prácticas y económicas de las especies (Smith y Waller. Sheila Okoth por sus comentarios y discusiones durante la preparación del capítulo. Hongos del suelo saprófitos y patógenos de plantas 267 . como en el caso de la publicación de nuevos nombres (Agerer et al. para la preservación a largo plazo de especímenes de resguardo será fundamental validar las entradas de secuencia y bases de datos genómicas. Las colecciones de referencia deberían ser apoyadas por países con una política fuerte en ciencia y tecnología dado que contienen información acerca de la distribución geográfica y de los hospederos. 2002). Bettucci y Alonso. Las colecciones de recursos genéticos hoy en día son solicitadas en todo el mundo. 2002. 1995. El estatus actual de las colecciones de recursos genéticos de hongos y los retos para apoyar la necesidad de la genómica de hongos. son normalmente empleados para derivar resultados procedentes de los métodos de huella molecular. en donde las matrices son construidas con datos de presencia o ausencia de bandas distintivas (de manera ideal para especies diferentes) en los geles y la estructura de la comunidad es analizada posteriormente (Fromin et al. por lo que proveen material de trabajo básico para quienes estudian las características y la variación.plo.. PRESERVACIÓN Y COLECCIÓN DE RECURSOS GENÉTICOS Los inventarios de biodiversidad proporcionan argumentos y algunas bases científicas para la preservación de hábitats y el uso sustentable de suelos. 1996). 2004a.5%.

M. Dejardin. Kroon. R. Hallenberg. M. R. FEMS Microbiology Ecology. G. P. Canadian Journal of Botany.. Triebel. Ennos. C. R...P. Anderson. L. J. I. the role of decomposer organisms’. C. Ascher. J. y Handley. 95. Ammirati. L.. M. R.E. G.. Korf. (2004) ‘Distribution of microbial communities in a forest soil profile investigated by microbial biomass. M. (1988) “A critical examination of the soil washing technique with special reference to the effect of the size of the soil particles’. S. Roebroeck. Gams. J. Ceccherini. Horak. W. M. Anderson. E. Cortia. L. 1566–1569. pp. soil biodiversity and agroecosystem function in the tropics. A. vol. A... y Srivastava. C. (2003) ‘Potential bias of fungal 18S rDNA and internal transcribed spacer polymerase chain reaction primers for estimating fungal biodiversity in soil’.. D. Cigelnik. F. vol. pp. Beare.. Barratt.. y Kenerley. vol. vol... 859–868. y Cairney. pp. (2003) ‘Fungi are the predominant micro-organisms responsible for degradation of soil-buried polyester polyurethane over a range of soil water holding capacities’.. J. A. K. Soil Biology and Biochemistry. (1998) ‘Detection and enumeration of a genetically modified fungus in soil environments by quantitative competitive polymerase chain reaction’. 104. O’Donnell. 769–779. H. (2006) ‘The simpleseptate basidiomycetes: A synopsis’. C.... Robson. 470–480.. R. Bååth. vol. G. Bonants. N. J. vol. R. Nannipieri. E. P. (1997) ‘Agricultural intensification. Oberwinkler.. P. Begerow. 891–900. Campbell.. Baek. M. C. forest’. pp. Hawksworth. R. Mycological Progress. 6. W. pp. D. R. T. y Waalwijk. S... 36–47. soil respiration’. Vikram Reddy. pp. Applied Soil Ecology. Summerbell.. Sampaio. vol.. (2004) ‘Diversity and ecology of soil fungal communities: Increased understanding through the application of molecular techniques’. vol. R.. 41–66. 25. (1995) ‘The effect of wildfire on the opportunistic decomposer fungal community of Uruguayan Eucalyptus spp.. vol. G. P. M.. (2000) ‘Gene genealogies and AFLP analyses in the Fusarium oxysporum complex identify monophyletic and nonmonophyletic formae speciales causing wilt and rot disease’. D. S. R. Phytopathology. J. C. (2003) ‘Always deposit vouchers’ Mycological Research. E.. 5. Journal of Applied Microbiology.REFERENCIAS Agerer. P. 66. 5. Bauer. Agnelli. E. 39. pp. G. Environmental Microbiology. Blanz. 268 Manual de biología de suelos tropicales . vol.. I. pp. F. 87–108. pp. D. R. pp. P. P.. Weiss. J. Environmental Microbiology. G. y Pietramellar. pp. vol. J. y Alonso. y Prosser. M.. 419–428. Bettucci. Baayen. Halling. Greenhalgh.. 36. 6. D. C... N. y Watling. 78–85. Tian. I. Pedobiologia. Courtecuisse. y Oberwinkler. 90. Mueller. 642-644. G. Rambold. D.

MN. M. 106. Griffith. R. Spooner.. pp. Chet. P. Hongos del suelo saprófitos y patógenos de plantas 269 . P. y Hartin. F. y Polishook. Roberts. Powell.Bettucci. Bills. (1980) ‘Induction of suppressiveness to Rhizoctonia solani in soil’. A. ppv147–154.. y Clipson. y Roquebert. 89–93. Applied and Environmental Microbiology. M. New Phytologist. 46. pp. 232. J. (2004) ‘Saprobic soil fungi’. F.. St Paul. 66. Phytopathology. S. G.. Olsson. APS Press. R. M. vol. vol. B. J. Plant Pathology. W. D. J. Dackman. y Panchal. in G. vol. G. W. vol. P. 666–676. (1987) ‘Quantification of predatory and endoparasitic nematophagous fungi in soil’. K.. R. Malvarez. S. y Duncan. D. Bills y M. Mycologia. B. K. Crous. O. Bettucci. M. Plant and Soil. Dupont. C. pp. B. (2000) ‘Food preference of earthworms for soil fungi’. (2002) “Paraná river delta wetlands soil microfungi’. Brodie. J. N. (2003) ‘On the unreliability of published DNA sequences’. K. Bordjiba. 13. in G. y Thorn. 51.. Christensen. (2003) ‘Soil fungal community structure in a temperate upland grassland soil’. 43–48. pp. vol. FEMS Microbiology Ecology. vol. L. Bury. B. 4356–4360. M. vol. M.W. (2002a) ‘Adhering to good cultural practice’. Borneman. G. Journal of Environmental Quality. vol. (2000) ‘PCR primers that amplify fungal rRNA genes from environmental samples’. vol. S. (2001) ‘Removal of herbicides from liquid media by fungi isolated from a contaminated soil’. D. E. F. (1993) ‘Fungal communities of two grazing-land soils in Uruguay’.. Semadi. I. Edwards. G. pp. 44. K. B. vol. vol. Wallingford. J. 70. CAB International. (2001) ‘Soil fungi. A. 45. vol. pp. Amsterdam.. 606–623. pp1378–1379. 187–198. y Guiraud. pp994–998. F. 127–145. G. Mueller.. pp. 281–292. P. vol. S. Toth. (2002) ‘Detection of Colletotrichum coccodes from soil and potato tubers by conventional and quantitative real-time PCR’. y Ritz. Mycological Research. Bills. y Indarte. F. Hall (ed) Methods for the Examination of Organismal Diversity in Soils and Sediments. M. Rodriguez. (1996) ‘Filamentous fungi’. E. Bridge. H. Pedobiologia. pp. Foster (eds) Biodiversity of Fungi: Inventory and Monitoring Methods. Pedobiologia. pp. 72–82. I... pp. y Spooner. C. (1994) ‘Abundance and diversity of microfungi in leaf litter of a lowland rain forest in Costa Rica’. Bonkowski. (2002b) Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. Cullen.. Steiman. P. diversity and detection’. 418–426.. Elsevier. Lundgren. M.. pp. Bridge. 105–114.. I.. 37. 86. 30. J. F. Lees. Pedobiologia. P. Microbial Ecology. M.. pp. y Nordbring-Hertz. P. 160. y Baker. 271–302. D. Crous. Jansson. Kadri.. Cannon. L.

in R. vol. L. 61–71. (2002) ‘Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns’. 796–798. S. 36. Steinberg.. M. F. 43. H. pp. G. Duarte. (2000) Detection and Isolation of Soil Fungi. D. Mycological Research. vol. R. V. (2000) ‘An efficient baiting assay for quantification of Phytophthora cinnamomi in soil’. J. Dhingra. 343–404. y Jabaji-Hare. pp67–76. vol. F. y Boddy. Edena. J... G. Hamelin. M. vol. St-Arnaud. J. D. 51–58. G. T. vol. Grigorova y J. 270 Manual de biología de suelos tropicales . Recorbet. y Smit. Dreumont. pp. Science Publishers. N. (2000) ‘Analysis of the dynamics of fungal communities in soil via fungal-specific PCR of soil DNA followed by denaturing gradient gel electrophoresis’. B. vol. Kluwer Academic Publishers. Down. J. 22. y Anderson. S. P. Gautheron. Dordrecht. Roesti. K. 634–643. FEMS Microbiology Ecology. K.. J. Pérez-Piqueres. M. CRC Press Inc. Tarnawski. 16. M. Environmental Microbiology. Eching. Filion. y Alabouvette. y Steinberg. E. Elsas. Edel-Hermann.Cuvelle. pp. M. FEMS Microbiology Ecology.. N. C. 53.. Norris (eds) Methods in Microbiology.. vol. 98. (2007) Compendium of Soil Fungi. 133–151. IHW Verlag.. (2001) ‘Genetic diversity of Fusarium oxysporum populations isolated from different soils in France’. y Galpoththage. Jourdain-Miserez. Journal of Microbiological Methods. M. 2nd edition.. Dighton. vol.. A. Boca Raton. A. H. 47. V. pp. y Sinclair.. Frankland. (1990) ‘Methods for studying fungi in soil and forest litter’. Dick.. The Netherlands. Plant Pathology. 515–522. N.. (2001) Straminipilous Fungi. Keijzer-Wolters. Gams. C. 49. Journal Microbiological Methods. C.. Mycologist. vol. J. G. Fromin. F.. Forestier. y Rouxel. Dighton. A.. Aragno. pp. G. pp. W. Gillet. Enfield. London. O. S. Edel. (2004) ‘Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils’. (1985) Basic Plant Pathology Methods. 397– 404.Davet. R. Teyssier.. Domsch. pp. (2002) ‘Fungal family trees: Finding relationships from molecular data’. pp. (1994) ‘Analysis of micromycete communities in soil: A critique of methods’. (2003) ‘Direct quantification of fungal DNA from soil substrate using real-time PCR’. Hillb.. M. W.. Academic Press. 11. D. A. y Rossi.

888–891. vol.. Israel’. y Aptroot. Applied and Environmental Microbiology. L. 22. G. Nevo. J. pp. 78. pp13–15. Watling y A. Grigorova y J. L.. (1990) ‘Methods for studying the microbial ecology of soil’. 41. Hongos del suelo saprófitos y patógenos de plantas 271 . pp. C. T. (2003) ‘Adaptive spatiotemporal distribution of soil microfungi in ‘Evolution Canyon’ II. L. 527–539. pp. Hawksworth. Studies in Mycology. A. (1998) CBS Course of Mycology. A. vol. R. A.. Fagbola. (2004b) ‘“Misidentifications” in fungal DNA sequence databanks’. Xu. Norris (eds) Methods in Microbiology. Hawksworth. C.Gams. D. G. vol. R. Stalpers. Alfenas. R. vol. Jr (1982) Multivariate Analysis in Community Ecology. 261–264. D. Cambridge University Press. Hawksworth. pp. Z. J. Winterhoff (ed) Fungi in Vegetation Science. D. A. census. 183–223. CBS. Wasser. 310–342.. P. Stouthamer (eds) Culture Collections to Improve Quality of Life. y Hughes. (1996) ‘Microbial collections as a tool in biodiversity and biosystematic research’. Costa. Isaac. Phytopathology. Hawksworth. Gonçalves. Lower Nahal Keziv. pp. E. y Crous. W. Whalley (eds) Aspects of Tropical Mycology. 69. Baarn. Hawksworth. W. J. Baarn. vol. 3758–3766. Proceedings of the International Congress for Culture Collections.. Academic Press.. Mycoscience. L. The Netherlands. J. N. A. (1993) ‘The tropical fungal biota. western Upper Galilee. pp. (1992) ‘The analysis of communities of saprophytic microfungi with special reference to soil fungi’. A. pertinence. y Smalla. significance and conservation’.. van der Mei y A. S. 26–35. 247. Grishkan. 87. A. C. H.. pp. A. vol. Mycological Research. Maffia. London. Rumjanek. D. pp. Y. M. G. S. D. Gams. 95. C.. O. and prognosis’. vol. pp... (1991) ‘The fungal dimension of biodiversity. E. I. D. y Rossman. D. L. Hawksworth. G. magnitude. 641–655.. pp. CBS. New York. 4th edition. P. Cambridge. (2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. 9–18. 161. in S. W. (2005) ‘Analyses of soil fungal communities in adjacent natural forest and hoop pine plantation ecosystems of subtropical Australia using molecular approaches based on 18S rRNA genes’. 91–100. N. L. New Phytologist. Gray. Kluwer Academic Publishers. L. J. (2004a) ‘Fungal diversity and its implications for genetic resource collections’. Cambridge University Press. in R. Mendonça-Hagler. 50. Biological Journal of the Linnean Society. y Beharav. Gomes. R. K. in R. Dordrecht. Gauch. FEMS Microbiology Letters. Hoekstra. Frankland. vol. H. (1997) ‘Where are all the undescribed fungi?’. in W. (2001) ‘Evaluation of bioassays to quantify Cylindrocladium inocula soil’. prophylaxis. Samson. Buchner. L. S. vol. R. He.

R. pp293–302. 89–95. Lee. 272 Manual de biología de suelos tropicales . 4516–4522. vol. J. Cambridge University Press. 170. Hyde. S. C.. 9th edition. J. Plant Pathology. 3112 –3120. (ed) (1996) Access to Ex-situ microbial genetic resources within the framework to the convention on Biological Diversity. (1997) ‘Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16s rRNA’. (1997b) ‘Can we rapidly measure fungal diversity?’.. A. 176–178. Plant and Soil. D. A. G. pp. W. Isaac. vol. y Smith. Lang. K. vol. Y. (1993) ‘Nutrient cycling by fungi in wet tropical forests’. 37–58.. vol. Hong Kong. y Lautenschlager. Howard. y Clipson. E. P. Liu. R.. P. C. B. (2005) ‘Soil bacterial and fungal community structure across a range of unimproved and semi-improved upland grasslands’. vol. 11. 39. 463–473. A. D. A. D. Cambridge. C. J. CAB International. N. Biology and Fertility of Soils. vol. C. Cheng. World Federation of Culture Collections. Kacprzak. Zo. J. Hyde. David. (2003) ‘Molecular detection of Fusarium solani f. 518–527. pp.. 257–265. vol... K. J. Sullivan. D. Wallingford. (2003) ‘Changes in the structure of fungal communities of soil treated with sewage sludge’. Pedobiologia. Edwards. 74–83. Cullen. pp. (ed) (1997a) Biodiversity of Tropical Microfungi. L. 51. Li. Applied and Environmental Microbiology. Applied and Environmental Microbiology. y Hartman. vol. Visser. Frankland. Cannon. 38. y Forney. S. G. K. F. L.. S. pp. FEMS Microbiology Ecology.Houston. T. Kennedy. (2002) ‘Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil’. (2001) Dictionary of the Fungi. Kennedy. S. pp. M. Canadian Journal of Botany. M. K. y Jagnow. Marsh. (1996) ‘Nonradioactive method to study genetic profiles of natural bacterial communities by PCR single-strand-conformation polymorphism’. pp. glycines in soybean roots and soil’. pp. (1995) ‘The use of correspondence analysis in studies of successions of soil organisms’. sp. Whalley (eds) Aspects of Tropical Mycology. vol. pp. W.. A. A. P. vol. J. C. E. WFCC. y Robinson. y Stalpers. S. 38. Lees. L. L. 52. P. 630–640. 62. L. Microbial Ecology. M. D. (1986) ‘Fungi of a forest soil nitrifying at low pH values’. Hong Kong University Press. H. H. pp. y Stanczyk-Mazanek. N. 63. 50. Kirk. vol. (1998) ‘Microbial processes and fungal community structure in soils from clear-cut and unharvested areas of two mixed wood forests’. Watling y A. J. y Kim. 75–86. pp. Plant Pathology. 76. Mycologist. in S. (1995) ‘Soil microbial diversity and the sustainability of agricultural soils’. Lodge. Kirsop. y Nicholson. pp.

R. G. W. (1988) Ecological Diversity and its Measurement. Schloter. pp. 681–688 Lowell.. vol. F. 1846–1853. Yoshikawa. de Waal. 425–428. vol. C. Princeton University Press. vol. 36. Editora UFLA. L. G. Hopkins. 557–564. (2002) ‘Mechanisms of natural soil suppressiveness to soilborne diseases’. FEMS Microbiology Ecology. L. M.. isolation and pathogenicity of Phytophthora megasperma from soils and estimation of inoculum levels’. y Mitchell.. (2002) ‘Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating’. H. I. Lavras. vol.. D. y Smalla. (2004) ‘Effects of transgenic potatoes with an altered starch composition on the diversity of soil and rhizosphere bacteria and fungi’. A. K. vol. Brazil. Phytopathology. Waite. (1998) ‘Application of denaturing gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology’. S.. Magurran. y Siqueira.. E. y Munch. vol. E. Applied and Environmental Microbiology. Polar Biology. Mazzola. Antonie van Leeuwenhoek. 552–561. Mazzola. Moreira. pp. 81. Annual Review of Plant Pathology. 73 pp. D. M. G. vol. Milling. molecular fingerprinting and cloning techniques’. A. Biodiversity and Conservation. 42. Princeton. E. vol. M. on a medium for direct isolation of Phytophtora spp. Mauchline. C. Fukada. T. (2006) “Fungal diversity in maritime Antarctic soils determined using a combination of culture isolation. C. M. J. Muyzer. A. pp.. P. H. 1687–1690. B. Malosso. y Uitterlinden. vol. 266. 23–39. M. O. y Hirsch.. Muyzer. 85–92. K. (2002) Microbiologia e bioquímica do solo. M. D. Smalla. E. S. Antonie van Leeuwenhoek. (1977) ‘Selective inhibition of Pythium spp.Lodge. pp. J (1997) ‘Factors related to diversity of decomposer fungi in tropical forests’. (1993) ‘Profiling of complex microbial populations by denaturing gradient electrophoresis analysis of polymerase chain reacHongos del suelo saprófitos y patógenos de plantas 273 . pp. pp. A. R. J. A. y O´Donnell.. Maidl. (1970) ‘Detection. F. X. Kerry. Plant and Soil. (2004) ‘Assessment and management of soil microbial community structure for disease suppression’. Masago. y Klein. from soils and plants’. J. J. pp. 127–141. 6. (2001) ‘Comparative single-strand conformation polymorphism (SSCP) and microscopy-based analysis of nitrogen cultivation interactive effects on the fungal community of a semiarid steppe soil’. 67. Marks. G. Phytopathology. y Nakanishi. 68. English. N. pp.. pp. G. 29. vol. 35–59. 60.

Neuber. Mycologia. 376–385. 206–214. pp. D. F. vol. J. Plant Pathology. L. J. vol. Gomes. 3. 65–73. pp. vol. A. Schlenzig. 7. L. 345. M. y Osswald. Casado. M. vol. Lomsden. Ayers. O. Hyde (ed) Biodiversity of Tropical Microfungi. (2002) ‘Comparison of serological. E. Journal of Microbiological Methods. 695–700. C. 41–49. 6. J. A. (1997) ‘Soil and rhizosphere microfungi from Brazilian tropical forest ecosystems’. pp. P. vol.. Mouguel. G. vol. L.. (2004) “Taxon-specific fungal primers reveal unexpectedly high diversity during leaf decomposition in a stream’. R. F. M. Molecular Phylogenetics and Evolution. F. O’Donnell.. M. M. A.. Papavizas.. Applied and Environmental Microbiology.. Lata. R. Pfenning. Phytopathology. citricola in soil samples from oak stands’. S.tion-amplified genes coding for 16S rRNA’. Applied and Environmental Microbiology... Nikolcheva. W. J. 4479–4487.. G. Rodrigues. Goodfellow. vol. pp. pp.. pp. G. (2001) ‘Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints. 103–116... (1998) ‘Diversity and variability in soil fungi from a disturbed tropical rain forest’. pp. M.. Jung.. y White. pp. 341–365. 871–877. Biological Sciences. R. T. 67. Adams. 90. F. in K.. vol. Pettitt. T. K. (2001) ‘A combination of baiting and PCR techniques for the detection of Phytophthora quercina and P. Nechwatal. A. pp. Wainwright. 86. pp. K.. y Hawksworth. J. 31. 63–75. G. y Pineda.. 85–97. pp. L. Wakeham. J. 65. C. 51. L. C. G. y Cigelnik. (1975) ‘Ecology and epidemiology of Rhizoctonia solani in field soil’. Mycologia. G. Thioulouse. Persiani. Philosophical Transactions Royal Society London. culture. Oros-Sichler. A. and bait methods for detection of Pythium and Phytophthora zoospores in water’. B. Hong Kong University Press. J. and Bärlocher. vol. 59. K.. y Nazaret. L. Mycological Progress. Maggi. F. vol. D.. J. Cooke. 274 Manual de biología de suelos tropicales . Forest Pathology. pp. (1994) ‘Theoretical and practical aspects of the quantification of biodiversity among microorganisms’. B. O´Donnell. Duncan. (1997) ‘Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous’. Poly. A. H. D. 720–727. vol. F.. N. y Smalla. Ranjard. A. y Kantzer. Lews. E. M. biological and methodological variability’. C. W. D. (1994) ‘The foliar fungal endophytes of the Amazonian palm Euterpe oleraceae’. Hong Kong. D. Dow. (2006) ‘A new seminested PCR protocol to amplify large 18S rRNA gene fragments for PCR-DGGE analysis of soil fungal communities’.

. vol. pp. (2006) ‘Investigating microbial community structure in soils by physiological.. St. Ryan. (2004) ‘Decomposition rate of organic substrates in relation to the species diversity of soil saprophytic fungi’. D. R.. 2614–2621. R. P. Potts. Parkway Publishers. 359. y Waller. Burpee. A. 177–183.. E. M. Singh. C. APS Press. 12. 41–46. Munro. (1992) “Direct recovery and molecular analysis of DNA and RNA from soil’. y Walker C. 108. Singleton. C. A. 1413–1421 Selenska. Canhos. R. Umbuzeiro. Australasian Plant Pathology.. F. y Smith. Rossman. 3rd edition. (2001) “Biodiversidad de los hongos fitopatógenos del suelo de Mexico’. Boone. European Journal of Soil Science.. 105. MN. 53–78. E. MN. Maffia. pp. L. vol. H. A. M. A. APS Press. Siebert. (2004) ‘Fungal genetic resource centres and the genomic challenge’. Fitopatologia Brasileira. vol. 557–558. (1991) Identification of Rhizoctonia Species. vol. special issue no 1. (1999) ‘Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes enconding 18S rRNA and temperature gradient gel electrophoresis’. APS Press. E... B. M. D. W. E (2003) ‘Filamentous fungi isolated from estuarine sediments contaminated with industrial discharges’. L.Rodrigues-Guzman. S. F. 17. M. J. Paterson. Oecologia. M. Hongos del suelo saprófitos y patógenos de plantas 275 .. Nature. J. E. New York. 345-356. pp. Tulloss. (2001) ‘A new fungal phylum. y McLean. P. W. L. D. 98–107. B. pp. 1351–1362. T. Setälä. Mycological Research. J. Sokal.. (1995) Biometry: The Principles and Practice of Statistics in Biological Research. D. Schwarzott. L. G. Sneh B. B. y Esposito. y Silveira. A. y Thorn... Leeflang. 1. (2002) ‘Comparison of baits to quantify inoculum density of Rhizoctonia spp. J. vol. their importance in tropical plant pathology’. 72–82. NC. (1992) ‘Competitive PCR’. St. vol. D. M. D. Glandorf. Ord. M. Y. vol. (1992) Methods for Research on Soilborne Phytopathogenic Fungi. Schuessler. H. G.. H. R. y Klingmüller. pp. R. E. Sanfuentes. Schneider. V. Paul. in Eucalyptus clonal garden soils’. Applied and Environmental Microbiology. Alfenas. vol. J. Smit. L. Freeman. pp. E. y Ogoshi. A. P. K. Mycological Research. the Glomeromycota: Phylogeny and evolution’. pp. 139. Acta Zoológica Mexicana. W. Smith. MN. pp. y Larrick. Reid. vol. O´Dell. Silva. Mihail. pp. St Paul.. Paul. Soil and Sediment contamination.. 31. W. 57.. A. Microbial Releases. (1992) ‘Culture collections of microorganisms. pp. (1984) Suppressive Soils and Plant Disease. Pfenning. pp. P. vol. 5–12. y Millard. J. P. y Rush.. biochemical and molecular fingerprinting methods’. S. 66. y Rohlf. (1998) Protocols for an All Taxa Biodiversity Inventory of Fungi in a Costa Rican Conservation Area. S. y van Elsas. J.

y Hunter. Vandenkoornhuyse.. M. Science. St. Canadian Journal of Botany. 4288–4292. 37. pp. A. Erwin. (1988) ‘Metabolic diversity of fungi in relation to growth and mineral cycling in soil: A review’. 169–183. y Parkinson. (2002) ‘Extensive fungal diversity in plant roots’. APS Press. C. L. V.. Mycological Research. y Brygoo. Berry. Biodiversity and Conservation. E. Paul. 276 Manual de biología de suelos tropicales . Bissett. its Biology. S. vol. Transactions of the British Mycological Society. C. vol. Canadian Journal of Botany. Current Opinion in Microbiology. 69. P. M. Zak. M. 2357–2372. A. (2003) ‘Resolving functional diversity in relation to microbial community structure in soil. (1992) ‘Rapid method for direct extraction of DNA from soil and sediments’. Widden. vol. Baldauf.. 159–170. II. 2051. M.. pp. exploiting genomics and stable isotope probing’. 104. y Visser. D. P. J. 62. pp. pp.Thorn. E. (1993) ‘Use of fungal antagonists for biocontrol of damping-off and Sclerotinia disease’. MN. Pasquier. B. vol. Tsao. vol. Straczek. y Young. S. (1998) Illustrated genera of imperfect fungi. J. pp. (2005) ‘A PCR-denaturing gradient gel electrophoresis approach to assess Fusarium diversity in asparagus’. S. P. L. (1973) ‘Fungi from Canadian coniferous forest soils’. (1983) Phytophthora. vol. vol. Journal of Microbiological Methods. (1984) ‘A revision of the genus Trichoderma. E. pp. Reddy. Ecology and Pathology. 1027–1032. G. A. Applied Environmental Microbiology. pp. W. y Paul.. y Bartnicki-Garcia. Viaud. H. y Olson. McQuilken. C. Applied Environmental Microbiology. Manuales para identificación Barnett. Section Longibrachiatum sect. 6. I. pp. St Paul. Yergeau. H. B. vol. P. M. (1991a) ‘A revision of the genus Trichoderma. Filion. y Budge. Whipps. Y. S.. Infrageneric classification’. 51. Wellington. Wainwright. 143– 154. 924–931. H. P..’. 1070–1074. vol. Taxonomy. P.. A. 295–301. vol. vol. C. 295. (1996) ‘An appraisal of soil fungal diversity: The crossroads between taxonomic and functional biodiversity’. Pesticide Science. Bissett. 60. 4th edition.. MN. M. Canadian Journal of Botany. M. nov. E. J... pp. Harris. 5. M. APS Press. 2275–2290. J. 58. J. y St-Arnaud. pp. Leyval. Tsai. R. D. vol. p. 62. 309– 317. J. pp. 90. Y. H. D. (1996) ‘Isolation of saprophytic basidiomycetes from soil’. y Krsek. (2000) ‘Diversity of soil fungi studied by PCR-RFLP of ITS’. Vujanovic.

C. M. Section Pachybasium’. (1993) Coelomycetous Anamorphs with Appendage-bearing Conidia. Erwin. MacNeil.. St Paul MN. A.. MA. Klich. Waterloo. Vaduz. vols I and II. Co.. Australia. B. North Ryde. A. Lynch. M. M. W. (2001) Dictionary of the Fungi. P. Karling. y Ribeiro. IHW Verlag. K.. y Stalpers.T. y Anderson. CBS. M. y Goodman.. Eching. vol. J. F.. J. (2007) Compendium of Soil Fungi. Wallingford. S. expanded reprint (Richmond Publ. W. P. St Paul. T. (2006) The Fusarium Laboratory Manual. M. Hanlin. B. R. (1971) Dematiaceous Hyphomycetes. 2nd edition. American Phytopathological Society. CMI. J. Minor. Hoekstra. APS Press. S. S. B. Additional notes on section Longibrachiatum’. A. E.. A. Croom Helm. pp. M. I. Liechtenstein Kirk. J. D. Kew. H. I. CMI. 4th edition. R. Malden. B. Domsch. vol. MN. J. St Paul. MN. 2373–2417. y Ellis. C. (1977) Chytridiomycetarum Iconographia. The Netherlands. 69. Illustrated genera of Ascomycetes. 9th edition. J.. (1991b) ‘A revision of the genus Trichoderma. P. Hanlin. MN.. H. (2000) ‘Cloning the soil meHongos del suelo saprófitos y patógenos de plantas 277 . T. F. Ellis. August. R. CSIRO. (1998b) Combined Keys to Illustrated Genera of Ascomycetes. A. American Phytopathological Society. D. Cannon. Canadian Journal of Botany. M. P. (1985) Microfungi on Land Plants: An Identification Handbook. R. Gams. Hanlin. I. vol. Kew.. Brady. 1990. (2002b) Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. St Paul. Crous. T.. M. J.. Ellis. Tiong. (1996) Phytophthora diseases worldwide. North Ryde.. (1998) CBS Course of Mycology. Cramer. Liles. L.. J. ‘A revision of the genus Trichoderma. L. Betterman. K... A. Baarn. Grossman. Osburne. Blackwell Publishers. pp. St Paul. S. R. W. A. II. Gilman. B. (1991c). Ellis. Leslie. American Phytopathological Society. vol. Rondon. APS Press. London. Loiacono. David. London. 69. R.Bissett. J. CAB International. C. M. (1998a) Illustrated Genera of Ascomycetes. K.. S. Australia.. MN. C. M. IV.. F. y Bullock. O.. (1976) More Dematiaceous Hyphomycetes. CSIRO. A. 2418–2420. 1997). Gams. R. Summerell. Pitt. y Aptroot. I. T. R. y Pitt. (2000) A Laboratory Guide to Common Penicillium Species. (1988) A Laboratory Guide to Common Aspergillus Species and Their Teleomorphs. J. P. Clardy. Mycologue Publications. Bissett. Handelsman. J. Nag Raj. III. Canadian Journal of Botany. 3rd edition. T. J. London.

gov/ taxadesciptions/keys/Trichodermalndex.cfm. Jr. pp1–15. Sitios web Johnson. (1967) ‘A key to Pythium Pringsheim’. London. Kew. Mycological Papers. F. A. Sneh. 109. P. E. 122. J. Samson. y Padgett. H. Applied Environmental Microbiology. pp. (1983) Phytophthora: Its biology.. L. CBS. (2000) Introduction to Food and Air-borne Fungi. Sutton. D. C.edu/people/padgett/book. 1–50. accessed November 2002. vol. M. (2002) ‘Biology and systematics of Saprolegniaceae’. E. CMI.ars-gring. 6th edition. y Bartnicki-Garcia. APS Press. y Ogoshi. USDA. G. G.. APS Press. http://nt. S. Mycological Papers. O. ecology and pathology. Waterhouse. Systematic Botany & Mycology Laboratory. C. 2541–2547.. Seymour.. 66. D. M. W. G. vol. M. D. S. St Paul. www. Baarn. G. E.. The Netherlands. y McCray. MN. B. Erwin. B. C. Farr. taxonomy. 110. (1991) Identification of Rhizoctonia species. Samuels. (1980) The Coelomycetes. Mycological Papers. Waterhouse. 1–59. St Paul.. y Filtenborg. vol. Waterhouse.tagenome: A strategy for accessing the genetic and functional diversity of uncultured microorganisms’. Hoekstra. R. R. Frisvad. (undated) ‘Trichoderma Online’. A.uncw. B. vol. (1968) ‘The genus Pythium Pringsheim: Diagnoses or descriptions and figures from the original papers’. MN. pp. Tsao. P. ARS. Chaverri. J. Burpee.. L. (1970) ‘The genus Phytophthora de Bary: Diagnoses or descriptions and figures from the original papers’. T. 278 Manual de biología de suelos tropicales . pp.

1g Hongos del suelo saprófitos y patógenos de plantas 279 .0g peptona 1.p.02g estreptomicina 0.1g agar 18g MP5.2g pimaricina 0. –agar con harina de maíz harina de maíz 8.2g pimaricina 0.02g estreptomicina 0.0g agar 18g Antibióticos.0g KNO3 1.p.5g glucosa 0.agar extracto de malta extracto de malta 20g agar 18g SNA – agar sintético pobre en nutrientes KH2PO4 1. cubitos 200g dextrosa 20g agar 18g PCA. molida 100g agar 18g penicilina 0. si es necesario penicilina 0. (1998) y Erwin y Ribeiro (1996).1 Medios de cultivo y aditivos: cebos Las recetas son para un litro. basados en Gams et al.agar maltosa peptona maltosa 4. molida 100g agar 18g CA + p.agar papa zanahoria papa 20g zanahoria 20g agar 18g CA – agar zanahoria zanahoria.s zanahoria.0g MgSO4 x 7H2O 0.2g pimaricina 0.s.2g agar 18g OA – agar harina de avena Copos de avena 30g Agar 15g ADP – agar dextrosa y papa papa.5g KCL 0.02g estreptomicina 0.2g sacarosa 0.0g penicilina 0.1g V8 agar V8 100 Ml CaCO3 2. MA2% .Apéndice 8.0g agar 18g agua destilada 900 ml PARP harina de maíz 17g pimaricina 10mg ampicilina 250mg rifampicilina 10mg pentacloronitrobenceno 100mg himexazol 50mg AHM + p.

Sustratos celulósicos: semillas de Sorghum. los de origen animal son esterilizados usando luz UV por una hora. hojas secas de maíz. Sustratos quitinosos: piel de serpiente. Los cebos de vegetales pueden ser lavados. Dependiendo del tipo de hongo pueden ser utilizados cebos específicos. papa. epidermis de cebolla. exoesqueleto de camarones. Sustratos queratinosos: cabellos de niños rubios. zanahoria o pepino. papel celofán. granos de polen de Pinus. trozos de manzana.Cebos El uso de cebos es imprescindible para la recuperación de zoosporas formadas por hongos de sustratos complejos como el suelo. alas de insectos. 280 Manual de biología de suelos tropicales .

excepto en la Antártida (White y ElsonHarris. Ceratitis. Las características taxonómicas que permitan distinguir sexos entre pupas y larvas aún no se han determinado (Salles. Se trata de insectos multivoltinos con un potencial biótico relativamente alto y una gran capacidad para infestar diferentes especies de frutos nativos y exóticos.. 1988). al final del abdomen. Rhagoletis y Dacus. ya que representan plagas primarias para la mayoría de los cultivos frutales. 1972. Bactrocera. el periodo durante el cual la larva destruye la pulpa de la fruta. y a la familia Tephritidae. debido al gran impacto económico que causan. Se distinguen cinco géneros importantes de esta plaga: Anastrepha. Steck y Wharton. Zucchi et al. éstas pertenecen al orden Díptera. y su sexo es fácilmente distinguible debido a que las hembras tienen un prominente ovopositor. enfocados a las fases de pupa y larva (Silva et al. las moscas de la fruta son consideradas una de las más preocupantes. Las moscas de la fruta muestran un comportamiento y una taxonomía complejos (Bateman. 2000). con una punta larga y delgada. Los daños que producen las moscas de la fruta se dan durante la fase inmadura. preservación e identificación de moscas de la fruta Neliton Marques da Silva INTRODUCCIÓN Entre las plagas de la fruta de América tropical. en su mayor parte. Algunos estudios han acentuado aspectos ecológicos y etológicos de las moscas de la fruta. que se extienden globalmente. 1996. volviéndola 281 . Su clasificación se basa exclusivamente en los caracteres morfológicos del adulto.Capítulo 9 Muestreo. 1992). 1996)..

azúcar al 10% o jarabe de caña de azúcar al 10%. las larvas se mueven sobre la superficie del suelo buscando condiciones adecuadas para su desarrollo y penetran hasta una profundidad aproximada de 10 cm para entrar en la fase de pupa. dependiendo de la temperatura y de la humedad. las larvas migran de la fruta para pupar en el suelo (Ilustración 8a). El desarrollo de la pupa ocurre en el suelo. esta técnica representa una relación ambigua entre la mosca y su hospedero. puesto que ésta sólo se puede establecer usando frutos infectados. que es diurna y responde a estímulos visuales y olfativos. en su mayor parte depredadores y entomopatógenos como bacterias. Antes de llegar al estado adulto.5 y 9). de ahí que. se puede utilizar jugo de fruta al 10%. De manera alternativa. durante una parte de su ciclo de vida. 282 Manual de biología de suelos tropicales . Debido a que el ciclo de vida involucra las partes aéreas de la planta hospedera. En el caso de la mosca adulta. hongos y nematodos. junto con el suelo. la humedad y la textura. y constituye una de las fases más vulnerables al estrés abiótico y a muchos enemigos naturales. que también forman parte de la biota del suelo (véase Capítulo 10). Los cebos deberán reemplazarse cada semana y los especímenes capturados. sobre todo. Aun cuando las larvas son parasitadas dentro de los frutos. el uso de trampas con cebos alimenticios es lo más recomendable.inservible para cosecha o consumo. La fase pupal dura de 8 a 10 días. MUESTREO DE LA MOSCA DE LA FRUTA El muestreo de adultos de moscas de la fruta se lleva a cabo utilizando trampas McPhail (Ilustración 8b) con atrayente alimenticio. Estos antagonistas juegan un papel importante en el control biológico de las moscas de la fruta. la mosca de la fruta se puede considerar un organismo del suelo. Después de que la fruta infestada cae. normalmente. resulta de suma importancia que en el diseño de la estrategia del manejo integrado de plagas se tome en cuenta la biodiversidad del suelo como un factor fundamental que influye en la mortalidad de larvas y pupas. el parasitoide adulto puede emerger en el suelo. Esta profundidad varía dependiendo de las condiciones físicas del suelo. los procedimientos para muestrear varían de acuerdo con la fase y el propósito. 200 ml de proteína hidrolizada de maíz (5% en agua preservada con tetraborato de sodio con un pH entre 8. la mosca de la fruta es un habitante temporal del suelo. en función de la temperatura. ramas o semillas en donde las larvas de la mosca residían previamente. por ello. sin embargo. pues sólo permanece ahí durante una etapa de su vida. removidos. por lo tanto.

Hasta cinco trampas por hectárea pueden ser instaladas en áreas con arbustos o árboles (jardines caseros). Las trampas deberán ser colocadas de manera equidistante. hasta tres por hectárea son las recomendadas para plantaciones herbáceas. Trampa No 5 • • • • • También deberá ser registrada la identidad de individuos de otros grupos taxonómicos capturados en las trampas. con alcohol al 70% para su identificación posterior. si lo hay. En el caso de plantas herbáceas. Si el objetivo es monitorear plagas. cada tipo de uso de suelo existente debe ser monitoreado con la misma densidad de trampas. colocarse sobre un árbol adyacente. 60° 04´W 23/Marzo/2006 Silva. Cuando el objetivo es el manejo integrado. o bien. la densidad deberá ser de tres a cinco trampas por hectárea o estar de acuerdo con el tipo de uso de suelo existente en el predio. mientras que. El número de trampas por unidad de superficie puede variar de acuerdo con los objetivos del proyecto. COLECCIONANDO LOS ADULTOS CAPTURADOS Debido a la probabilidad de que distintos grupos taxonómicos de insectos sean capturados. Por ejemplo: Manaus-AM Brasil 04° 05`S. preservación e identificación de moscas de la fruta 283 . N. la trampa puede utilizar como soporte tres palitos. La etiqueta deberá incluir la información básica de muestreo y el número de la trampa. M.5 mm para remover las moscas y separarlas de otros grupos taxonómicos utilizando unas pinzas curvas. Cuando los cebos son reemplazados. esto se puede llevar a cabo en el campo o en el laboratorio. Muestreo. una trampa cada cuatro hectáreas resulta suficiente. primero será necesario separar las moscas de la fruta de otros especimenes.Las trampas se instalan en el centro del dosel de los árboles y su localización será tomada con GPS. dispuestos en forma de trípode. es decir. Se anota el sexo y se colocan en frascos de vidrio (de alrededor de 50 ml) etiquetados. el contenido de la trampa deberá pasarse por una malla de nylon de 1.

las charolas se cubren con una tela de gasa y se aseguran con ligas de plástico para prevenir que se escapen las moscas adultas al emerger. Después de emergidas. Finalmente. de 1. se cuentan y se separan para cada sitio de muestreo. se pesan. La determinación de la relación de sexos hembra-macho (SR) para moscas adultas y parasitoides se hace de acuerdo con Silveira-Neto (1976) en función de la siguiente ecuación: Número de hembras SR= Número de hembras + Número de machos IDENTIFICACIÓN DE ESPECIES La identificación taxonómica de especies de Tephritidae se basa en un examen ventral de la región apical. Estas jaulas deberán ser examinadas diariamente. Los adultos emergidos serán retenidos. se depositan en charolas de plástico con una capa de vermiculita o arena fina como substrato de pupación.MUESTREO DE LA FRUTA Para poder establecer la relación entre las especies Anastrepha con sus plantas hospederas. para permitir la salida de las moscas adultas y/o parasitoides. los especimenes recuperados son fijados en una solución de alcohol al 70%.5 mm. Las fechas de emergencia. se recogen frutos al azar en diferentes agroecosistemas y en diferente estado de de maduración. Los frutos muestreados se separan por especie. para separar las pupas que posteriormente serán colocadas en jaulas. Posteriormente. el aculeo de la hembra bajo un microscopio estereoscó284 Manual de biología de suelos tropicales . se protegen con bolsas de tela y se transportan en cajas térmicas hasta el laboratorio. Los frutos deberán ser colectados directamente de los árboles o inmediatamente después de caer al suelo. OBTENCIÓN DE LAS PUPAS La vermiculita o arena fina deberá pasarse por una malla galvanizada. el número y el sexo deberán quedar registrados con relación a las moscas o parasitoides. las moscas adultas son alimentadas con una solución de miel disuelta en agua al 10% que será cambiada cada día. durante 48 horas para permitir el endurecimiento cuticular y la pigmentación completa de los patrones alares (Ilustración 8c): características de gran importancia para la identificación taxonómica. Finalmente. con sus respectivas etiquetas de identificación.

Norrbom. Departamento de Zoologia. Silva. Federal University of the Amazon (UFAM) and National Institute for Agricultural Research (INPA). A. o que éstas sean incorporadas a la colección institucional del laboratorio. abdomen y. Ronchi-Teles (2002). Muestreo. Manaus. Silva (1993). A. A. (2002) “Ocorrência e flutuação populacional de espécies de moscasdas-frutas eparasitóides com ênfase para o Gênero Anastrepha (Diptera: Tephritidae) na Amazônia Brasileira’. (1985) ‘Phylogenetic analysis and taxonomy of the cryptostrepha. 493–518. Salles. A. vol. Annual Review Entomology. Foote. L. L. tergito medio. in M. (1993) “Levantamento e análise faunística de moscas-das-frutas (Diptera: Tephritidae) em quatro locais do Estado do Amazonas’. Escola Superior de Agricultura “Luiz de Queiroz”. Memórias do Instituto Oswaldo Cruz (Rio de Janeiro). Malavasi and R. São Paulo. PhD Thesis. São Paulo. REFERENCIAS Bateman. University of São Paulo. B. C. Es recomendable que se depositen ejemplares de referencia en colecciones de museo. N. utilizando un microscopio de transmisión (100X). H. A. (1934) “Moscas-de-frutas do gênero Anastrepha Schiner. vol. especialmente. Holos. es necesario extraer completamente el aculeo de la funda del ovipositor con ayuda de agujas o pinzas (Ilustración 8d). Steyskal (1977). Secretaria da Agricultura. M. Foote (1967). PhD thesis. Brazil. Ronchi-Teles. 487–575. (1967) ‘Family Tephritidae’. Lima. como las de Lima (1934). En primer lugar. (1972) ’The ecology of fruit flies’. comparando el patrón alar. no. pp. mesonoto. daciformis. PhD Thesis.)’. pp. Brazil. Stone (1942). preservación e identificación de moscas de la fruta 285 . 28. in A. robusta and schausi species groups of Anastrepha Schiner (Diptera: Tephritidae)’. Zucchi (eds) Moscas-das-frutas de importância econômica no Brasil: Conhecimento básico e aplicado. 4. (2000) ‘Biologia e ciclo de vida de Anastrepha fraterculus (Wied. coloración de cuerpo. The Pennsylvania State University. 1868 (Diptera: Trypetidae)’.pico (40X) o mediante el montaje sobre laminillas para examinar estas estructuras. Zucchi (1978 y 2000) y Norrbom (1985). La identificación de especies del género Anastrepha se logra para las hembras adultas. como lo describe Zucchi (1988). R. Pennsylvania. M. Vanzolini (ed) A Catalogue of the Diptera of the Americas South of the United States. 17. las características morfológicas del aculeo (Ilustración 8e) con especímenes de museo o usando claves taxonómicas. Ribeirão Preto.

y Elson-Harris. Zucchi. Silva. in A. M. D. (1977) Pictorial Key to Species of the Genus Anastrepha (Diptera: Tephritidae). y Wharton. M. I. Fundação Cargill. pp. N. A. in G. Stone. (1992) Fruit Flies of Economic Significance: Their Identifications and Bionomics. A. M. R. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. S. (1996) ‘Anastrepha species (Diptera: Tephritidae) from the Brazilian Amazon: Distribution. C. Boca Raton. N. vol. CRC Press. G. Boca Raton. University of São Paulo. A. Annals of the Entomological Society of America. White. M. Steck. 286 Manual de biología de suelos tropicales . A. Escola Superior de Agricultura ‘Luiz de Queiroz’. Ribeirão Preto. United States Department of Agriculture Miscellaneous Publications. L.. R. and Silveira Neto. (1978) “Taxonomia das espécies de Anastrepha Schiner 1868 (Diptera: Tephritidae) assinaladas no Brasil’. (1996) ‘The natural hosts plants of Anastrepha (Diptera: Tephritidae) in the State of Amazonas. distribuição geográfica e hospedeiros”. A. R. y Nova. A. R. S. Steyskal. (1988) ‘Description of immature stages of Anastrepha interrupta. Zucchi.. São Paulo. M. V. Brazil’. São Paulo. CAB International.. Campinas. Zucchi. S. Washington DC. (2000) ‘Taxonomia’. N. O. de Souza (ed) Moscas-das-frutas no Brasil. in H. Silveira Neto. pp. R. CRC Press. A. R. hosts and lectotype designations’. limae. Steck and B. 81. A. J. Steck and B. Nakano. Ceres. Entomological Society of Washington. grandis (Diptera: Tephritidae)’. 439.. vol. A. and A.Silva. J. A.. 1–112. A. Wallingford. (eds) (1976) Manual de Ecologia dos Insetos. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. Zucchi (eds) Moscas-dasfrutas de importância econômica no Brasil: Conhecimento básico e aplicado. in G. Zucchi. Malavasi and R. (1988) “Moscas-das-frutas (Dip. 6. A. Tephritidae) no Brasil: taxonomia. (1942) ‘The fruit flies of the genus Anastrepha’. J. M. 994–1003. PhD Thesis. no. y Silveira Neto. Holos Zucchi. Barbin.

con el fin de utilizarlas como mecanismos de control de especies que son plaga. 1992). el primero para llevar a cabo el proceso de infección y el segundo.Capítulo 10 Hongos y nematodos entomopatógenos Alcides Moino. pero sí manteniéndolas en niveles por debajo del umbral de daño económico. sin intervención humana. para resistir la enfermedad. prevenir su ocurrencia en insectos benéficos. El control microbiano es una forma de control biológico cuyo principio es el uso racional de entomopatógenos sin que necesariamente se eliminen las poblaciones de plagas. aproximadamente. ello da la idea de la potencial importancia del estudio de estos patógenos de insectos en el contexto de control de plagas y de biodiversidad. Si se asume que cada especie de insectos es susceptible a por lo menos un microorganismo patogénico. Jr y Ricardo Sousa Cavalcanti INTRODUCCIÓN Existe alrededor de medio millón de especies de insectos descritas en la tierra. La patología de insectos es la ciencia que estudia las enfermedades de insectos. Los principales microorganismos utilizados. Esto es similar a la dinámica natural que sucede en el campo entre el patógeno y su hospedante. Las enfermedades son procesos dinámicos en donde el patógeno (microorganismo) y el hospedante (insecto) están adaptados morfológica y fisiológicamente. o bien. frecuentemente hospedante-específico. el 10% pueden considerarse plagas agrícolas forestales o urbanas. y que han demostrado su 287 . aunque la cifra verdadera de diversidad puede ser mucho mayor (Groombridge. De éstas.

Myers y Rothaman. pobre persistencia (especialmente bajo condiciones tropicales) y su baja eficacia cuando se compara con los insecticidas químicos (por ejemplo. las bacterias que se introducen junto con el parásito se multiplican rápidamente y matan al hospedante. Un pequeño número de especies generalistas con capacidad para ser cultivadas y producidas de manera masiva.5 mm de largo. debido a su alto costo. aunque esta tecnología no se ha adoptado por completo en la práctica. se han utilizado como biopesticidas para su uso contra poblaciones de plagas. en donde pueden ser excepcionalmente virulentos (o decir. 1997. baja persistencia e inactividad a bajas temperaturas (en el caso de los nematodos). 1994.. 1995): los organismos producen fases infectivas que son liberadas al ambiente cuando muere el hospedante 288 Manual de biología de suelos tropicales . con varios grados de especificidad con su hospedante (Hajek y St.potencial en el control microbiano de insectos son: los hongos. Roy et al. éstos aparentemente son componentes diversos y universales de las biotas del suelo. Los hongos producen esporas que germinan al contacto con el hospedante. y convirtiéndose posteriormente en adultos. A pesar del éxito limitado de hongos y nematodos entomopatógenos como productos biocidas. Leger.. 2006). a pesar de ello. como es el caso de Lecanicillium logisporum. Los estadios juveniles parasitan a sus hospedantes. las bacterias. La mayoría de los patógenos poseen una estrategia de transmisión de “sentar y esperar” (sensu Ewald. se producen miles de nuevas esporas que se dispersan y continúan su ciclo de vida en nuevos hospedantes. Se conocen cientos de especies de hongos entomopatógenos que atacan una amplia gama de insectos y ácaros. 1993). los basados en toxinas). la Sterneinematidae y la Heterorhabditidae que son parásitos obligados de insectos y que son la base de varios plaguicidas biológicos diseñados específicamente para su uso en contra de plagas del suelo como los gorgojos y las larvas de mosca. causar la muerte rápida del hospedante y provocar grandes niveles de mortandad en las poblaciones de éste) y causar epizoóticas periódicas (Chandler et al. Una vez muertos los insectos. Después de una a dos semanas posteriores a la invasión del hospedante. Los nematodos entomopatógenos miden alrededor de 0. Existen dos familias. ambos presentan desventajas debido a su alto costo. penetrando directamente la cutícula o a través de las aperturas naturales como los espiráculos. invadiendo su cuerpo y matándolo de cuatro a diez días posteriores a la infección. aparece una nueva generación de estadios infectivos (Kaya y Gaugler. permitiendo que los nematodos crezcan y maduren sobre el tejido en descomposición. los nematodos y los protozoarios. 1995). los virus.

debido a que ofrece un microambiente estable con una estructura de poros favorable para nematodos y recursos orgánicos para hongos. M. Metarhizium anisopliae. Las fases de diapausa y latencia reducen la dependencia en la movilidad de su hospedante y pueden complementarse con la capacidad para vivir saprotróficamente en suelo. y hongos del orden Entomophthorales (Zoophthora. sugiriendo de nuevo que los patógenos se distribuyen ampliamente en el suelo. Hirsutella thompsonii. ello a pesar de la ausencia de fases sexuales manifiestas y que el significativo flujo de genes ocurre localmente (Bidochka et al. Cordyceps spp. son susceptibles a hongos y nematodos. lo que les permite mayor distribución geográfica de la población y alta movilidad. que constan de células alargadas provistas de una pared que contiene celulosa y quitina.. Los hongos de mayor interés por su potencial como patógenos de insectos son: Beauveria bassiana.. flavoviride. Paecilomyces spp. Nomuraea rileyi. el suelo es. como los que habitan debajo de éste. aunque su eficiencia competitiva en comparación con otros saprótrofos de vida libre puede ser baja. además de otros carbohidratos y proteínas. Neozygites). Aschersonia aleyrodis. Estas estructuras vegetativas son llamadas hifas. Los hongos poseen una gran variabilidad genética y un amplio rango de hospedantes. Lecanicillium lecanii. Entomophaga. sin duda.. 2001). Después de la infección exitosa de un hospedante. Entomophthora. En el caso de los hongos entomopatógenos esto se apoya en evidencia molecular que muestra que poblaciones en suelo no son totalmente clonales. BIOLOGÍA DE HONGOS Y NEMATODOS ENTOMOPATÓGENOS Hongos Los hongos son microorganismos unicelulares (levaduras) o multicelulares (especies filamentosas). H ongos y nematodos entomopatógenos 289 . Con frecuencia no hay correlación entre la densidad del hospedante y la ocurrencia de la enfermedad. el reservorio de las fases infectivas. se producen asexualmente estructuras reproductivas conocidas como esporas o conidias que ayudan a la diseminación del patógeno. Aunque los artrópodos que viven por encima del suelo.y tienen la capacidad de entrar en un estado de letargo o diapausa y permanecer latentes hasta que haya nuevos hospedantes disponibles. Esta capacidad es una adaptación a sus hospedantes artrópodos que son más grandes y con patrones de distribución en parches.

1998A) Las muestras de suelo se colectan a una profundidad de 0 a 20 cm y se colocan en bolsas de plástico debidamente etiquetadas. Los principales grupos de nematodos de interés pertenecen al orden Rhabditida. Liud et al.. Por lo general. METODOLOGÍA PARA EL AISLAMIENTO DE HONGOS ENTOMOPATÓGENOS (Chase et al. espiráculos y ano.. La identificación correcta de un agente entomopatógeno. las cuales son los agentes primarios que inician la infección en el hospedante. cuando un insecto muerto es recogido para el cultivo de inóculo infectivo. 1986. 290 Manual de biología de suelos tropicales . 1993.. para lograr una buena identificación es necesario aislar el microorganismo en cultivos puros o al menos. parasitismo obligado y parasitismo facultativo.Nematodos Los nematodos entomopatógenos son organismos pseudocelomados vermiformes muy similares a los que parasitan plantas y que pueden asociarse con los insectos de tres formas: forecia (adherencia pasiva y transporte). A continuación se describen dos técnicas básicas para el aislamiento de hongos y nematodos entomopatógenos a partir de muestras del suelo. Sin embargo. La población microbiana en cualquier ambiente natural es muy grande y por lo tanto. De igual manera. aislar poblaciones. Los nematodos transportan internamente bacterias específicas que son liberadas en el interior del cuerpo del insecto después de que el nematodo penetra a través de aberturas naturales como boca. Estas bacterias se multiplican dentro del insecto y lo matan al causarle septicemia (infección generalizada). Alves et al. bacterias y otros microorganismos saprotróficos que no tienen potencial como agentes específicos para el control de plagas. también pueden obtenerse resultados semejantes y se requerirá de medidas adicionales para identificar patógenos con potencial. los nematodos entomopatógenos presentan una estrecha asociación (simbiosis) con bacterias específicas. es muy común encontrar también hongos. en el caso de los hongos. cuando el objetivo del muestreo es evaluar la biodiversidad (por ejemplo. en el suelo). En cada sitio de muestreo. y dentro de éste a las familias Steinernematidae y Heterorhabditidae. se basa en caracteres morfológicos del organismo en cultivo y en la estructura de los conidióforos y conidias. la identificación se fundamenta en medidas hechas a partir de estructuras presentes en los estadios juveniles infectivos. en el caso de los nematodos.

Samson et al. conidias y fiálides (Alves et al. tales como conidióforos. Estas muestras pueden tomarse mediante el método de extracción de núcleos (véase Capítulo 4: Mesofauna)..1ml y se colocan en medio de cultivo selectivo (el cual contiene el fungicida dodina) y en medio ADP (Agar-Dextrosa-Papa). H ongos y nematodos entomopatógenos 291 . 1998). 1998b. aunque puede prescindirse de él. De las diluciones 10-3 y 10-4 se toman 0. El crecimiento de los hongos y su esporulación se evalúan de 7 a 15 días posteriores a la inoculación.) puede llevarse a cabo usando un microscopio compuesto y claves de identificación basadas en caracteres morfológicos de las estructuras reproductivas.0 mg de tetraciclina y 10 mg de cristal violeta. se añade agua destilada hasta alcanzar el volumen original de 1 litro y posteriormente se añaden 20 g de agar. el volumen añadido se reparte sobre la superficie utilizando una asa de Drigalski (ya sea de acero inoxidable o vidrio).. El fungicida dodina se añade en pequeñas concentraciones (cerca de 10 mg ml-¹) al medio selectivo con el fin de aislar hongos entomopatógenos a partir del suelo y preservar los aislamientos menos susceptibles al fungicida.2) y almacenaje de conidios en condiciones de congelación utilizando tubos Eppendorf para tal fin. con la subsecuente purificación de los cultivos (Figura 10. 550 mg de dodina (N-dodecilguanidina acetato). utilizando agua destilada esterilizada hasta alcanzar una dilución 10-4. se esteriliza durante 20 minutos a 120°C y se filtra. 200 g infusión de papa (preparada a partir de papas rebanadas y hervidas para extraer el almidón).1 ml de la última dilución y se colocan sobre la superficie del medio de cultivo contenido en una caja Petri. Después de la incubación. 5. Después de este paso se toman 0. Beauveria bassiana y Paecilomyces spp. El medio ADP se prepara de la siguiente manera: 15 g de agar. y agua destilada hasta completar el volumen total de un litro. A partir de estas alícuotas se preparan diluciones 10-1 sucesivamente. Esto suele ser efectivo especialmente con Metarhizium anisopliae. En el laboratorio se debe mezclar muy bien la muestra compuesta y tomarse alícuotas de 1g de suelo. 20 g de dextrosa.1).se toma una muestra compuesta a partir de seis submuestras tomadas en puntos localizados alrededor de un monolito central (véase Capítulo 2). El medio selectivo de dodina se prepara de la siguiente manera: 20 g de harina de avena + 1 litro de agua destilada. Las cajas se incuban a 27°C (Figura 10. la identificación de los cultivos de interés (principalmente Metarhizium anisopliae.

c) incubación bajo condiciones controladas en una cámara DBO. Nota: la separación de contaminantes se logra recogiendo una pequeña porción de cualquiera de las colonias del hongo de interés con una aguja. d) almacenaje de conidios en tubos Eppendorf.1 ml) en una caja petri con medio de cultivo. y transfiriéndola a una caja Petri nueva con medio de cultivo ADP (tres puntos de inoculación por caja). bajo condiciones de congelación.2 Cultivos purificados de Beauveria bassiana. creciendo en medio ADP.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) dilución seriada de la suspensión acuosa que contiene al hongo. b) inoculación de la suspensión (alícuota de 0. Figura 10. 292 Manual de biología de suelos tropicales .Figura 10.

3) para colectar los estadios juveniles infectivos a partir de los cuerpos muertos. H ongos y nematodos entomopatógenos 293 . 2004. La identificación se lleva a cabo con base en las claves específicas de identificación para cada familia de nematodos (Steinernematidae y Heterorhabditidae) (Alves et al. Figura 10.6mM. 0. MgSO4 0. Los nematodos se almacenan en envases cerrados de 50 ml a 11°C o cercano a esa temperatura. que contienen las muestras de suelo y se mantienen cerradas a 23°C en oscuridad. La mortandad de las larvas se evalúa después de cinco a siete días.1mM. 2002). Las larvas de este lepidóptero son conocidas como mealworms (o gusanos de la harina).4M. ZnSO4.. si se encuentran estados infectivos en el líquido. Los ejemplares de nuevas especies pueden someterse a un análisis molecular para así comparar los patrones de DNA. Después de dos días. Una trampa de White se puede construir utilizando dos cajas Petri: una caja de 5 cm de diámetro se coloca invertida dentro de una caja de 9 cm que contiene agua esterilizada o medio “S” esterilizado y cubierta con un círculo de papel filtro de 9 cm.7H2O 0.7H2O 0.0. éstos deben colectarse y colocarse en agua destilada dentro de un frasco Becker. Las larvas de insectos infectadas se colocan en el centro del papel filtro.1M NaCl. Adams y Nguyen.3M. La suspensión se deja reposar para permitir que los nematodos queden en el fondo. el cual cae hasta tocar el líquido en el borde de la caja inferior. CuSO4 0 1μM.METODOLOGÍA PARA EL AISLAMIENTO DE NEMATODOS ENTOMOPATÓGENOS (Bedding y Arkhurst.. y pueden adquirirse comercialmente. Posteriormente. la suspensión se lava adicionando una solución de formaldehído (1%) o solución de Ringer para obtener una concentración final de 10.) (Lepidoptera: Pyralidae). Na EDTA 0.000 estados infectivos ml-¹.05M KH2PO4. 1998b. pH 6. CaCl2 0.4M. 1μM colesterol) a la que se le añaden 26 ml de una solución nutritiva fresca que contiene citrato de K 0.3mM. utilizando la técnica de trampas de insectos con cinco larvas de Galleria mellonela (L. Las larvas muertas se colocan en una trampa White (Chen et al. El medio “S” consiste en un litro de solución madre (0. FeSO4. 1974) Se recogen las muestras de la misma forma que fue descrita anteriormente. La detección de nematodos se lleva a cabo mediante bioensayos. Las larvas se colocan en cajas de plástico de 500 ml.

. FEALQ.. A. (1974) ‘A simple technique for the detection of insect parasitic nematodes in soil’. M. Bedding. Wallingford. Alves.3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). CAB International. (1998a) “Técnicas de laboratório”. R. Alves. L. B. y Nguyen. pp. Moino Junior. A. (2001) ‘Habitat association in two genetic groups of the insect-pathogenic fungus Metarhi294 Manual de biología de suelos tropicales . (2002) ‘Taxonomy and Systematics’. F. 21. N. y Castello Branco Jr. A. Ferraz. M. M.. T. B. S. L. REFERENCIAS Adams. J. Piracicaba Brazil. B. A.. E. 2nd edition. y Akhurst. B. c) larvas que muestran la patología típica de infección por nematodos. J. S. Gaugler. J.. R. Deckoning. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo.Figura 10. B. J. Piracicaba Brazil. (1998b) “Chaves para identificação de patógenos de insetos”. Kamp. A. in R. Almeida. B. vol. Lavender. C. J. Bidochka. Alves (ed) Controle Microbiano de Insetos. M. y De Croos. d) emergencia de juveniles infectivos en la trampa White. in S. B. 109–110. K.. Fotos: R. y Alves. C. Nematologica. in S. Gaugler (ed) Entomopathogenic Nematology. 2nd edition. A. Alves (ed) Controle Microbiano de Insetos. FEALQ. J.

J. Annual Review of Entomology. X. pp. y Rothaman. Annual Review of Entomology. Hay.. A. pp. E.. (1993) ‘Entomopathogenic nematodes’. E. R. (ed) (1992) Global Biodiversity: Status of the Earth’s Living Resources. Applied Soil Ecology. D. G. K. B. R. Steinkraus.zium anisopilae: Uncovering cryptic species’. y Gaugler. Kaya.. from soil’. (1986) ‘Selective isolation of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium’. C. Z. Advances and Perspectives. pp. Milner.. Chen. pp. C. J. (2004) Nematology. L. Roy. Hajek. Meyers. D. vol. Osborne. y Read. (2006) ‘Bizarre interactions and endgames: Entomopathogenic fungi and their arthropod hosts’. S. vol. R. 51. vol. W. R. E. J. H. 39. D. y Pell. 181–206. (1995) ‘Virulence and transmission of infectious diseases in humans and insects: Evolutionary and demographic patterns’. New York. CAB International. A. 194–198. 331–357. 38. Leger. Evans. E. vol. H. vol. Y. Chapman and Hall. Y. Chen. pp. R. vol. L.P. Ewald. P. A. Hajek.. 1335–1342. H. 81. Applied and Environmental Microbiology. J. 293–322. K. P. Chandler. (1993) ‘The use of Dodine in selective media for the isolation of Metarhizium spp. W. D. 133-141. y Ferguson. 62. pp. A. Journal of Invertebrate Pathology. Liu. Wallingford. Springer-Verlag. pp. vol. Z. y Lutton.. vol. 659–669. (1997) ‘Sampling and occurrence of enomopathogenic fungi and nematodes in UK soils’. London. J. C. y Latgé.. 285–292. (1988) Atlas for Entomopathogenic Fungi. S. (1995) ‘The evolution of virulence: A unifying link between parasitology and ecology’. (1994) ‘Interactions between fungal pathogens and insect hosts’. vol. M. y St. pp. V. 67. pp. World Conservation Monitoring Centre. Journal of Parasitology.. 248–251. Annual Review of Entomology. Groombridge. 69. H ongos y nematodos entomopatógenos 295 . Trends in Ecology and Evolution. 10. McRae. G. Samson. Chase. F. H. y Dickson. Florida Entomologist. Eilenberg. 5. J. A..

.

Solamente en algunos casos. 297 . Jeroen Huising RESUMEN DE LA METODOLOGÍA PARA LA DESCRIPCIÓN DE USO DE SUELO Este capítulo muestra una lista estructurada de atributos de uso de suelo que sirve como guía para la observación de características de uso de suelo en el campo. La clasificación de uso de suelo se facilita por una estructura jerárquica donde se ordenan los atributos. dependiendo de los datos disponibles. lo cual requiere solamente el valor adecuado por evaluar en el campo. se necesitarán mediciones reales. pero las clases finales de uso de suelo dependerán de la selección de dichos atributos a considerar para la clasificación. en los puntos de muestreo.Capítulo 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo E. cuando se precise un alto nivel de detalle. los dominios de los valores de los atributos se especifican. en función del propósito y del contexto de la clasificación misma. Este método ofrece varios niveles de detalle que describen las características. entrevistas o preguntas. Cuántas clases de uso de suelo pueden ser definidas con respecto a la intensidad de usos de suelo se ilustra a continuación. En la mayoría de los casos. Esto se lleva a cabo mediante la observación directa.

se requiere de un sistema que permita el registro de las características de uso de suelo en las parcelas de muestreo y su clasificación posterior.. dada la variación en los cultivos y sus posibles combinaciones. de manera que se puedan definir las clases de uso de suelo. proporciona una estructura para la clasificación de usos de suelo. en cuanto al uso de varios recursos como fotos aéreas o imágenes satelitales para el propósito de la clasificación. En lugar de utilizar clases predefinidas de uso de suelo. razón por la cual fue adoptado un sistema regular en cuadrícula para muestrear la biodiversidad del suelo con un inventario detallado de su uso y cobertura en los lugares de muestreo.ANTECEDENTES Y PRINCIPIOS DE DISEÑO Propósito de la clasificación del uso de suelo y de su cobertura vegetal El uso de suelo. Lo último. la historia de uso de suelo y las prácticas de manejo de los mismos. especialmente en las regiones tropicales. de modo que se puedan reflejar las diferencias en la intensidad de uso de suelo. se considera uno de los factores determinantes de la abundancia y riqueza de poblaciones de organismos del suelo. el enfoque que se describe a continuación se aleja de la idea de que las clases de uso de suelo sean definidas de acuerdo con la identificación de las características relevantes de uso de suelo (atributos) que permiten una 298 Manual de biología de suelos tropicales . la hipótesis central del proyecto CSM-BGBD (Giller et al. y al mismo tiempo. Dicha estructura necesita ser flexible. basadas en un común denominador en todas las áreas bajo estudio. pero dependen de los clasificadores o atributos seleccionados para la asignación de la clase de usos de suelo a cualquier observación particular. 2005). Las clases de uso de suelo predefinidas no son necesariamente aplicables o relevantes para todas las áreas involucradas porque será muy difícil definir un grupo estándar de clases de usos de suelo. Para comprobar esta hipótesis. implica que las clases de uso de suelo no están definidas a priori. lo que facilita el análisis de los factores determinantes actuales y una clasificación a posteriori. y en particular la intensidad de su uso. La idea general es que el contenido de un estudio depende de la naturaleza de la región (Vink. Los procesos dominantes que determinan la presencia e incidencia de la biota del suelo y la escala espacial donde éstos se manifiestan no se conocen completamente. Este capítulo presenta una estructura que provee el registro sistemático de las características de uso de suelo. a través de puntos de referencia de los países tropicales involucrados. 1975). y es por lo tanto.

El enfoque del inventario de uso de suelo aquí descrito se apoya principalmente en ese sistema de clasificación. para el propósito actual. Las clases de usos de suelo obtenidas de esta manera pueden ser utilizadas para la extrapolación de los resultados más allá de los lugares de estudio. generalmente se traduce en el registro de la ocurrencia de cultivos. aunque atributos relacionados con la historia del uso de suelo o condiciones ambientales podrían ser adicionados o modificados del sistema de clasificación. que desarrollaron el Sistema de Clasificación de Cobertura de Suelo (LCCS) por Di Gregorio y Jansen (2000). ej. El objetivo del inventario para proveer datos que permitan evaluar cambios en la biodiversidad del suelo en relación con el uso del suelo. El método no incluye una estructura para la descripción de los atributos ambientales.discriminación entre clases de usos de suelo. es diferente al monitoreo usado con frecuencia que incluye en la descripción de uso de suelo y el estudio de las condiciones naturales y socioeconómicas del suelo como un primer objetivo (Vink. aunque contiene elementos añadidos relacionados con el manejo de suelo y cultivos. especialmente en su intensidad. sistemas acuáticos y principalmente áreas sin vegetación. El método que se presenta pretende ser de utilidad para la descripción de uso de suelo a nivel parcela. forma del paisaje. Para la clasificación y descripción de las áreas de vegetación (semi) natural se puede seguir el LCCS. 1975). Los objetivos mencionados arriba fueron también citados en el programa Africover. los métodos descritos en este capítulo se aplican únicamente en paisajes agrícolas terrestres (p. No obstante. como clima.. Lo anterior. los fenómenos relacionados con la forma en que se está utilizando el suelo (p. etc. el manejo de los cultivos y del suelo) son de particular importancia porque impactarán notablemente sobre la distribución de los organismos del suelo. sin incluir elementos relacionados con el manejo de ganaD escripción y clasificación de uso de suelo en puntos de muestreo 299 . áreas cultivadas y manejadas) mientras que el marco del LCCS incluye sistemas terrestres vegetales (semi) naturales. La estructura de las descripciones del uso de suelo actual no ha sido hecha para registrar el uso de suelo histórico. Un segundo objetivo para los inventarios de uso de suelo es proveer información básica para definir los usos de suelo alternativos y las prácticas de manejo que mejoran la sustentabilidad de la producción agrícola y conservan la biodiversidad del suelo. La descripción detallada de uso y la cobertura de suelo deberán formar parte del inventario. Asimismo. ej. El sistema de clasificación de uso y cobertura del suelo ayuda a la armonización de los procedimientos para la recolección de datos y al manejo de los mismos.

La jerarquía de clases es construida sobre un conjunto de clasificadores. a no ser la cobertura del suelo per se. resultarían de gran utilidad. aunque se reconoce que para los estudios a una escala mayor o para considerar opciones alternativas de uso de suelo. ni incluye elementos relacionados con el sistema de cultivo. Existen cinco niveles en la jerarquía de clasificación: Nivel 1: Características relacionadas principalmente con el cultivo y el campo Nivel 2: Características relacionadas con la combinación de cultivos. Estos “sistemas” de clasificación básicamente representan leyendas. por lo tanto. Concepto y principios de diseño Los conceptos y principios de diseño del LCCS adoptados utilizan criterios diagnósticos ordenados de manera jerárquica para permitir un sistema de clasificación consistente con límites claros para las clases. son rígidos y de capacidad limitada para incorporar nuevas clases. el sistema de clasificación de uso de suelo y de su cobertura del US Geological Survey. no son exhaustivos (es decir. El principio básico se apoya en el uso de clasificadores que refieren a criterios de diagnósticos o atributos independientes. Nivel 5: Características de uso de suelo del área directamente circundante a Manual de biología de suelos tropicales 300 .do. Muchos sistemas de clasificación utilizan a priori definiciones descriptivas de uso de suelo y clases de cobertura del suelo. Dicho sistema a menudo carece de una definición clara de los límites de clases. representan un subconjunto de un rango de posibles usos y coberturas de suelo) y debido a que no existe un sistema de clasificación de referencia. dispuestos en un sistema jerárquico. Nivel 3: Características relacionadas con aspectos culturales como irrigación y cultivo de temporada. utilizados para definir una clase. Nivel 4: Características relacionadas con el manejo de prácticas del suelo. descrita por Lillesand y Kiefer (1987). más detallado queda el nivel de clasificación. por ejemplo. por lo tanto. Cuantos más clasificadores se añaden. son limitados cuando se les compara con otros sistemas. porque esto no está particularmente relacionado a nivel de parcela. basada en la interpretación de fotografías aéreas con el propósito de elaborar mapas de uso y cobertura del suelo. no resulta apropiado para la descripción y mapeo de áreas más grandes. donde cada jerarquía se relaciona con diferentes niveles de detalle temático y espacial. Obsérvese. El método que se describe a continuación.

se refieren a las operaciones realizadas en una parcela en particular. especialmente en relación con elementos leñosos de la vegetación que no se reconocen como cultivo y en relación con cultivos en campos adyacentes. ej. Esto puede ser señal de cultivos simultáneos o. junto con el tamaño de las áreas de los campos. Estos tres primeros niveles forman la base para la clasificación de uso de suelo y la colecta de datos en relación con dichas características se sugiere representan los datos mínimos requeridos. barreras de viento y otras estructuras semipermanentes. se han añadido clasificadores que relacionan el manejo del suelo y cultivos que permiten la determinación del nivel de intensidad de uso. El tamaño del campo generalmente es indicador del tamaño de la finca. Dichos clasificadores. el manejo de los campos agrícolas (es decir. Las características no siempre son fácilmente observables. son características que no se evalúan en los primeros niveles de clasificación. incluyendo arreglos espaciales de los campos agrícolas. Las subclases pueden definirse basándose en otros cultivos que forman parte del sistema del cultivo general. un sistema de barbecho o un sistema de cultivo permanente. que muchas veces es referencia de la clase social y del tipo de manejo (Huising. En el siguiente nivel de la clasificación jerárquica se consideran las prácticas culturales relacionadas con el suministro de agua y factores de cultivos de temporada. éstos pueden ser evaluados. el deshierbe y la fertilización del mismo.la parcela de muestreo. tales como la preparación del suelo. Estos elementos de vegetación se relacionan con características permanentes en el paisaje. Asimismo. o basados en los datos proporcionados por el agricultor. Otros aspectos que se deben considerar son la distribución. normalmente. Esta información puede ayudar a determinar si la parcela bajo consideración representa una característica (o patrones) del uso de suelo o tipo de cobertura. la clase mayor es definida por el tipo de cultivo principal (p. pero que se consideran importantes en relación a la intensidad del uso y pueden tener un impacto directo sobre la biodiversidad del suelo. “cultivo de árboles” para un sistema basado en árboles). pero con algunos antecedentes de uso de suelo y de los sistemas de cultivo habituales. como setos. Este último determina si el campo forma parte de un sistema de cultivo migratorio. en secuencia. patrones de campo) y los cultivos asociados. lo que sirve para D escripción y clasificación de uso de suelo en puntos de muestreo 301 . Por ejemplo. cercas vivas. El quinto nivel en los sistemas de clasificación se relaciona con elementos de vegetación leñosa (semi) permanentes dentro de la parcela y en los campos aledaños. Las características de rotación de cultivos se consideran en otros estudios. 1993).

el cultivo principal se puede describir como maíz (Zea mays). Éstas sirven para guiar las observaciones en el campo en los puntos de muestreo y sus áreas circundantes. los dominios de valor no son específicos para permitir la definición de 302 Manual de biología de suelos tropicales . Los valores de datos posibles (dominios de valor) para la mayoría de los atributos son dados para proporcionar una descripción estándar de las características de uso de suelo. Los atributos. no son independientes y pueden involucrar algún tipo de medición con un nivel más alto de detalle. Los niveles de clasificación definen un eje de la clasificación jerárquica en donde atributos adicionales (conjuntos de ellos) en cada nivel subsecuente definen las subclases (que representan un mayor nivel de detalle). por ejemplo. que pueden incluir. Estos nuevos atributos ofrecen información más específica sobre el objeto de observación. En el caso de algunos de estos atributos. la descripción cuantitativa de la intensidad del uso del suelo. Los principios de las clasificaciones jerárquicas son explicados por Molenaar (1991. La transformación de las listas de atributos a formatos para registrar los datos en el campo resulta fácil. Los atributos técnicos específicos permiten una definición más precisa de clases de uso de suelo asociados. 1998) y Huising (1993). pueden añadirse sin mayores consecuencias para el sistema de clasificación. Por otro lado. por ejemplo. Estos atributos técnicos específicos. el valor de clase a un nivel más detallado de generalización puede ser inferido. a su vez. Si se conoce el valor de clase a un nivel más específico. sirven para trazar la cartografía del uso de suelo (mediante la interpolación de puntos de observación que complementan un mapa). son consideradas observaciones a nivel de parcela. Además.identificar posibles asociaciones de usos de suelo que. por lo tanto. como los refiere el LCCS. el cultivo principal puede describirse a un nivel más general (de género) como Zea o a un nivel de familia como Gramineae (pastos). Además de este eje existe uno más en la clasificación jerárquica que hace referencia al nivel de precisión con que se describen las características de uso o añade información específica (detalles técnicos) de las características de uso de suelo descritas. el patrón del campo ofrece información sobre la fragmentación del suelo y constituye otro aspecto de la intensidad de uso de suelo que puede impactar directamente sobre la biodiversidad del suelo. información más específica se remite a variedades y esto representaría un mayor nivel de detalle (especificidad). Registro de datos en campo y observaciones adicionales En las siguientes secciones se presenta la lista de atributos para la descripción de usos de suelo. por lo tanto.

Sin embargo.valores de datos en los rangos de observación y distribución de los valores de datos. los datos relacionados con niveles muy detallados de observación son muy difíciles de obtener. una tasa particular de aplicación (baja. se debería poder inferir información sobre el manejo de la parcela en particular. media o alta. Sin embargo. características culturales) obtenida de un informante o derivada de la información general de las prácticas culturales en el área.6b). a partir de la observación directa en el campo. esto no es prescriptivo en el sentido de que los datos necesitan ser colectados en todos los niveles de detalle. Las observaciones para los tres primeros niveles del sistema de clasificación se pueden hacer directamente en el campo. a personas externas. o bien. basados en la definición de la clase adoptada (ver Tabla 11. clases de tamaño estándar definidas en campo con límites fijos no podrán ser significativas por esa razón. pero ello se compensa con la aplicación de la jerarquía en la precisión de los datos (referidos anteriormente como el segundo eje en el sistema de clasificación). como documentos). La información de estas fuentes de datos puede resultar incorrecta. Los atributos pueden agregarse para facilitar la descripción de características específicas de un área en particular. La situación contraria sería con el conocimiento de la práctica común en el área. utilizando otros recursos. no se obtiene a través de observaciones directas en el campo. relacionada con el manejo. junto con la información relacionada con el tercer nivel (es decir. media o alta) puede ser asumida. El nivel de detalle al cual la información es reunida depende del propósito del inventario de uso de suelo y de la posibilidad de obtener D escripción y clasificación de uso de suelo en puntos de muestreo 303 . es aceptable clasificar la tasa de aplicación como baja. sus fuentes no son totalmente confiables. A menudo. Si éste no es el caso. Por ejemplo. pero éstos deberán añadirse a los niveles más bajos de la clasificación jerárquica para evitar que interfieran con la estructura de la misma. si la información sobre la tasa de aplicación de un fertilizante inorgánico en particular no se considera confiable o correcta. El sistema para describir el uso de suelo muestra varios niveles de detalle. A priori. o bien. Las clases de datos deben indicar una discriminación relevante (significativa) de objetos y el subconjunto de clases debe ser extensivo (no exclusivo). sino que requiere del acceso a fuentes adicionales de información (a través de entrevistas a los agricultores. simplemente. basada en observaciones secundarias. con los conocimientos de un sistema habitual de cultivo y las prácticas de manejo en el área. La información en el cuarto nivel. la información puede generalizarse para la clase de “fertilizante aplicado” (implicando el uso de fertilizante inorgánico).

Estas observaciones secundarias sirven. Se recomienda revisar el trabajo de Stocking y Murnaghan (2001) para los indicadores relevantes de observaciones en el campo. la información sobre el tipo de lindero se debe registrar. sí pueden aportar información para el análisis de datos. fecha. Observaciones secundarias pueden relacionarse con el estatus del cultivo o con la presencia de maleza. El uso de una cuadrícula regular para el muestreo permite que se tomen puntos de muestreo en cualquier lugar dentro de la parcela y posibles efectos de borde deben tomarse en cuenta. (por ejemplo. al mismo tiempo. Si bien estas observaciones no se incluyen en la clasificación del uso de suelo. dependiendo de la experiencia del encargado del proyecto. OBSERVACIONES DE USO DE SUELO: CLASIFICADORES Y ATRIBUTOS Observaciones respecto del cultivo principal y tamaño del campo El primer nivel del sistema de clasificación se reserva para las observaciones del cultivo principal. será siempre una ventaja. Para este propósito. El sistema para la descripción de uso de suelo requiere de una estructura que pueda implementarse a detalle y que se considere viable bajo las condiciones reales. Se deberá registrar la localización específica del punto de muestreo dentro del campo (por ejemplo. la cobertura del dosel deberá clasificarse como “abierta” o “cerrada”. la explicación de posibles datos atípicos). sin embargo. donde el cultivo de árboles se considera como el principal. como el elemento de vegetación más dominante. para la selección entre un cultivo de árboles y un cultivo anual en el mismo campo. nombre del encargado del proyecto y nombre de la persona que toma los datos. pueden ser incorporadas fácilmente a las libretas de campo en caso necesario. no se incluyen en las listas de atributos que se detallan a continuación. Si la selección se realiza entre dos 304 Manual de biología de suelos tropicales . por lo tanto. Este tipo de información deberá registrarse en la libreta de campo. El hecho de que el encargado del proyecto se encuentre familiarizado con el uso de suelo y con las prácticas de manejo en el área. además de los datos administrativos como hora. como un mecanismo para la validación de los datos en atributos y clasificadores e incluso para los resultados de clasificación finales. el centro o los linderos). el segundo. ya que puede tener un efecto en la distribución de la biodiversidad del suelo.la información requerida. Estas observaciones no se consideran como clasificadores y. siempre y cuando la cobertura del suelo no se clasifique como escasa.

por lo tanto. nueces y otros. de la edad de la plantación.variedades) pre verde. En la Tabla 11. más de 10 años] 305 D escripción y clasificación de uso de suelo en puntos de muestreo . es mejor definir una lista de Tabla 11. “leguminosas o vegetales”. entre 1 y 3 años.1. el cultivo con el mayor porcentaje de cobertura califica como el cultivo principal. por ejemplo. para madera o leña).1 Clasificadores y atributos técnicos para el cultivo principal Nivel 1a – Clasificador Forma de vida [árbol. cosecha de toda la planta (p. se puede añadir un cuarto nivel que ofrezca información sobre la variedad específica del cultivo. La categoría de cultivo herbáceo representa un nivel adicional en la clasificación jerárquica (nivel de especificación) y. ej. La información más concreta sería entonces el tipo específico de cultivo. 1 año. o gramíneas] Atributo técnico 1 Atributo técnico 2 Cultivo de árboles o arbusto Tipo de cultivo (especies y Fenología de la hoja [siem. pero en lugar de dejarlo abierto. porque su apariencia (características de vegetación) puede ser muy distinta. hierba. Se prevé para una descripción de un segundo y tercer cultivo. dependiendo. En el caso de un cultivo de árboles o arbustos se puede añadir información sobre el aspecto (es decir. es conocido el tipo de cultivo. ancha] Propósito [vivero.1 los valores posibles (clasificadores o atributos) se enlistan entre corchetes. El valor de dominio no se especifica aquí. La clasificación se basa en la forma de vida del cultivo. árboles de sombra] Duración del cultivo [Estación (parte del año). Los atributos técnicos son específicos para cada una de las diferentes formas de vida. deciduo] Tipo de hoja [aguda. no se enlista bajo el título “Atributos técnicos 1” en la Tabla 11. “forrajes o fibras”. proporcionando una mayor especificación de la forma de vida a nivel de detalle. Generalmente. una especificación con más detalle indica si el cultivo pertenece a la categoría de “raíces o tubérculos”. cosecha de frutas. el propósito) y duración del cultivo. Cuando se considera relevante. arbusto. entre 3 – 10 años.o más cultivos de la misma forma de vida. En el caso de cultivos herbáceos.

además. 1993) con la opción de utilizar diferentes definiciones para cada una de las distintas regiones en donde se esté llevando a cabo el estudio. El siguiente nivel en la clasificación jerárquica se determina por las características espaciales de la parcela en observación (Tabla 11.Tabla 11.plátanos y otras plantas herbáceas arbóreas. cereales. aunque está más relacionada con las características del cultivo que con las características del campo. IV. mediano y grande. II. pero manteniendo la distinción conceptual entre pequeño. La cobertura del cultivo se anexa aquí. ésta queda fuera del marco de este capítulo. “mediana” o “grande” no aparece. caña. especificar el tipo de cultivo) Atributo técnico 2 Tipo de cultivo (especies o variedades) Tipo de cultivo Tipo de cultivo nombres permitidos para los tipos de cultivo.lúpulo y otras enredaderas perennes] Herbáceas Categoría de cultivos [raíces y tubérculos. 2000). legumbres y vegetales. La definición de clases de tamaño de campo “pequeña”. III-cultivos de cobertura. La cobertura del cultivo se usa generalmente como un parámetro para la interpretación de 306 Manual de biología de suelos tropicales . es mejor definir clases significativas basadas en un estudio piloto del rango de tamaño de campo presentes en el área de estudio (Huising. La forma del campo se añade principalmente como una preocupación respecto a posibles efectos de borde y.2). forrajes.herbáceas. véase la lista LCCS (Di Gregorio y Janssen. pastos] Si no son gramíneas Categoría del cultivo [I. aunque esto se relaciona más con las características del cultivo que. Aquí se incluye la “cobertura de los cultivos”. no obstante. fibras] (si se conoce.1 Continúa Nivel 1a – Clasificador Atributo técnico 1 Gramíneas Tipo [bambú. con las características de campo. a manera de ejemplo. sirve como indicador del grado de organización y mecanización de las prácticas de manejo. puesto que ello dependerá del contexto de estudio. con el propósito de evitar cualquier confusión. arroz.

Nivel 1b -Clasificador Atributo técnico 1 Tamaño de campo o parce. Para coberturas no permanentes. 2000). abierta (70-60 – 20-10%).imágenes de percepción remota.Forma [cuadrada. en los casos donde un clasificador de segundo nivel “combinación de cultivos” indica que existe un segundo o tercer cultivo creciendo en el campo. Se pueden hacer distinciones de acuerdo con el número de cultivos y con su secuencia. mediana. Por lo tanto.2 Tamaño del campo y características de la cobertura del cultivo. Tabla 11. a las diferencias en las etapas de crecimiento y otros factores. En el caso de formas de vida permanentes. rectangula [chica. grande] lar. proporciona información acerca de la densidad del cultivo y es un indicador útil de la intensidad del uso de suelo. esto se refiere a que en una misma parcela y durante una sola temporada se realizan uno o varios cultivos. En el caso de un segundo o tercer cultivos. escasa (20-10%)] Observaciones relacionadas a combinación de cultivos y prácticas culturales Las combinaciones de cultivos se consideran el segundo nivel. multiangular. En el caso de cultivos anuales. mediana (60 – 30%). circular. la cobertura del cultivo puede resultar difícil de interpretar debido a la variación en la arquitectura de las plantas. en tira o irregular] Tamaño del campo (metros cuadrados) Atributo técnico 2 Cobertura del cultivo Cobertura no permanente: [alta (> 60%). pero dependería mucho del tipo de cultivo. se refiere a que se produce un empalme entre las copas. y especialmente en el caso de los cultivos anuales. Esto puede servir para entender la importancia relativa del cultivo en sistemas de cultivos múltiples. Además. su densidad puede medirse directamente en términos del número de plantas por unidad de medida (m² o ha) o en términos de espacio entre plantas (el espacio entre surcos y la distancia entre las plantas). El segundo y tercer cultivo pueden describirse por los mismos D escripción y clasificación de uso de suelo en puntos de muestreo 307 . generalmente. Las clases de densidad podrían especificarse. la distribución espacial en el campo puede especificarse. el tipo de cobertura “cerrada”. Una cubierta “abierta” significa que la distancia entre los perímetros de las copas puede ser hasta dos veces mayor que el diámetro medio del dosel. los límites de clases son ligeramente diferentes (ver Di Gregorio y Janssen. baja (30 -15%)] Cobertura permanente: [cerrada (> 70-60%).

en donde la especificación de la forma de vida. Se realizan previsiones al tercer nivel de clasificación. El segundo (o tercer) cultivo o elemento de la vegetación puede incorporarse en la descripción de clase del sistema de uso de suelo como elemento descriptivo o como atributo. también en estos casos.4). La vegetación del sotobosque también puede referirse a vegetación (semi) natural. Es necesario registrar cuando se practica una rotación de cultivo en particular. La descripción para las características del suministro de agua es muy sencilla (ver Tabla 11. serían suficientes. la totalidad de su cobertura (es decir. en cuyo caso. Nivel 2 – Clasificador Combinación de cultivos [simple (monocultivo). los cultivos de árboles (hule) en un campo grande (plantación). aspersión o goteo] Atributo técnico 2 Demanda de agua por irrigación [mm de agua suministrada por temporada de crecimiento o cultivo] 308 Manual de biología de suelos tropicales . El nivel tres en el sistema de clasificación se refiere a las prácticas culturales. por ejemplo. Tabla 11. el porcentaje de cobertura del cultivo adicional o añadido) puede alcanzar fácilmente el 100%. no habría un arreglo especial. como por ejemplo.atributos.3 Atributos de cultivos combiandos. franjas alternas. postinundaciones. de cultivos adicionales [1. traslapar. El segundo tipo de cultivo se añade como un segundo atributo técnico. secuencial] Atributo técnico 2 (Segundo tipo de cultivo) Simultáneo o traslapado Arreglo espacial [una o dos filas intercaladas. plantaciones.4 Características del suministro de agua Nivel 3a – Clasificador Suministro de agua [lluvia. irrigación] Atributo técnico 1 Irrigación Tipo de irrigación [superficial. Un segundo tipo de cultivo puede referirse a un cultivo de sotobosque como el cardamomo. múltiple (intercalado)] Atributo técnico 1 Cultivos múltiples No. 2 o más] Secuencia [simultáneo. fragmentadas o dispersas] Tabla 11. relacionadas con el “factor de tiempo del cultivo” para especificar esta información. junto con la fenología y tipo de hoja. en los varios niveles de especificación. igual que para el cultivo principal. con un sotobosque herbáceo cerrado. definidas como características de suministro de agua y características relacionadas con el barbecho.

El cultivo post inundación se define. permanente] Atributo técnico 1 Cultivo migratorio Período de barbecho [corto. u otro tipo) Índice de cultivo (valor del índice de cultivo Ruthenberg) Intermitente No. Se hace una distinción entre cultivos migratorios.5 Factor tiempo de cultivo. y debido a que no trae consecuencias en la intensidad del uso de suelo. o largo plazo] Barbecho Tipo de barbecho[suelo desnudo. Nivel 3b . de cultivos en dos años D escripción y clasificación de uso de suelo en puntos de muestreo 309 . El barbecho se refiere al periodo (estación de crecimiento) durante el cual se deja descansar el suelo. mientras que en el sistema de barbecho Tabla 11. sin embargo. el suelo está cultivado por más de 66% del tiempo. Los atributos técnicos se especifican en la Tabla 11. natural.5. la lluvia infiltrada en el suelo se usa intencionalmente como reserva para los cultivos”. mediano. Esto es similar. Leguminosas. Los cultivos migratorios típicamente se refieren a situaciones donde los agricultores abren nuevas parcelas para el cultivo. de la siguiente forma: “después de que un campo ha sido inundado con agua de lluvia. se debe hacer la distinción entre si esto se hace con el objetivo de restaurar la fertilidad del suelo o debido a que las condiciones no permiten cultivar (bajas temperaturas o disponibilidad de agua limitada).. El factor de tiempo del cultivo indica la fracción de tiempo durante la cual el suelo es usado para el cultivo. 1980). mejorado] Duración del barbecho[corto. barbecho. esta distinción no se mantiene. mediano. de acuerdo con el LCCS.Clasificador Factor tiempo de cultivo [cultivo migratorio. barbechos y cultivos permanentes. en principio. Los sistemas de barbecho se definen como suelo cultivado entre el 33% y el 66% del tiempo y en los cultivos permanentes. al empleo de técnicas de cosecha de agua (tratado por separado en la sección relacionada con el manejo de suelos y cultivos). en términos prácticos. aunque no lo mismo. largo] Permanente Permanente [continuo o intermitente] Atributo técnico 2 Índice de cultivo (valor del índice de cultivo Ruthenberg) Si es mejorado: Tipo de cobertura (ej. El cultivo migratorio se define como suelo cultivado durante menos del 33% del tiempo (Ruthemberg et al.

resulta relevante anotar la duración de dicho periodo. pero < 8–9 meses. El barbecho medio refleja la situación donde el suelo descansa durante seis a siete meses. con un periodo de < 1–2 años. forrajes. Periodo largo: > 8–9 meses El barbecho de periodo corto se refiere a situaciones donde normalmente existen dos temporadas de cultivo en un año y el suelo se deja descansar durante el resto del periodo. durante el segundo año.cultivan la misma parcela o área de suelo. dejándola descansar durante diferentes periodos de tiempo para restaurar la fertilidad del suelo. con un periodo de > 1–2 años. se hace una distinción entre la duración del periodo de barbecho: Barbecho corto. Los barbechos se consideran como “mejorados” en el momento en que se planta o se siembra para cambiar la composición de la vegetación de barbecho o para mejorar su calidad. pero eso no resulta lo suficientemente largo para clasificarlo como cultivo migratorio. Periodo medio: 4–5 meses. Si se requiere de datos más precisos. por ello. éstos se pue310 Manual de biología de suelos tropicales . por lo tanto. por ejemplo. Barbecho largo. la clasificación del periodo de barbecho es la siguiente: Periodo corto: < 4–5 meses. pero < 8–10 años. Para sistemas de barbecho. Bajo la presión de una población en aumento. En el caso de cultivos migratorios. lo cual es muy común en algunos lugares donde uno o dos cultivos “cortos” ocurren durante un año o donde el agricultor deja un periodo de barbecho más largo. pero necesita confirmarse y puede ajustarse con base en los datos reales sobre la duración de los periodos de barbecho en el área en cuestión. No se hace ninguna distinción referida al tipo de cultivo o propósito. Estas son evaluaciones parcialmente cualitativas y. Barbecho medio. El periodo largo de barbecho es la situación típica en donde el suelo se deja en barbecho durante un año o más. con un periodo de > 8–10 años. La definición de estos límites de clases se basa en la experiencia en el campo. el periodo de barbecho típicamente tiende a reducirse. se sobreponen los límites de clases y se especifican para cubrir la variación específica de un periodo de barbecho para cualquier área que probablemente sea dependiente de las condiciones socioeconómicas y biofísicas habituales.

Se añade la “preparación del suelo” por su relevancia en los márgenes de la selva en los trópicos.den calcular utilizando el índice de cultivos de Ruthenberg. plagas y enfermedades. sin embargo. Tf = duración del barbecho o duración del tiempo en el que no se cultiva el suelo. Hasta este momento no se han considerado las rotaciones de cultivo. el “factor tiempo de cultivo”. De manera alternativa. es un factor que deberá tomarse en cuenta en relación con la biodiversidad del suelo. 1980): CIr = Tc/(Tc + Tf) En donde: Tc = duración del cultivo (tiempo). Los mayores componentes de las prácticas de manejo discutidas se refieren a técnicas para la preparación del suelo o su cultivo. Los datos deberán especificar el número de años del ciclo de rotación de cultivos y la secuencia de los cultivos en el ciclo. Características de manejo del suelo y de cultivos Las prácticas culturales mencionadas incluyen: “manejo de agua” como una operación de manejo. el manejo del suelo y de los cultivos se consideran representativos de un nivel separado en el sistema de clasificación (Tabla 11. Esto es. donde potencialmente existe un alto impacto en la biodiversidad del suelo.6a).. Alternativamente. por lo tanto. fertilización y cosecha. el mejor momento para incluir una descripción de las secuencias de los cultivos sería en el segundo nivel de la clasificación jerárquica donde “la combinación de cultivos” puede describirse como “secuencial”. se podría prever. En cuanto a la preparación del suelo y la cosecha. tal y como se observa en la Tabla 11. puesto que el barbecho a menudo forma parte de un sistema de rotación de un cultivo en particular. una opción para combinar ambos clasificadores dentro de uno que describa el grado de mecanización. la cosecha. Si se practica una rotación de cultivos. tal y como se muestra en la siguiente fórmula (Ruthenberg et al. como un clasificador podría ser excluida de la clasificación porque la preparación del suelo es generalmente la D escripción y clasificación de uso de suelo en puntos de muestreo 311 . el manejo de las malas hierbas.5. por lo que no han sido incluidas en el sistema de clasificación. el principal aspecto que se debe considerar sería si esto se realiza por medios mecánicos o no.

Se añade un atributo técnico que describe el tipo de arado usado. en lugar de labrar el campo entero o donde el grado de perturbación se minimiza con el uso de equipos especializados. pero al contrario. Se hace una distinción basada en si el suelo ha sido labrado o no. sería más sencillo 312 Manual de biología de suelos tropicales . en el sentido de que una mayor o menor eficiencia no causará mayor o menor impacto en el suelo y los organismos que se encuentran en él. las opciones son: arado de vertedera. porque esto dependerá de las condiciones locales. estos arados se presentan desde el menos eficiente en remover el suelo y dejará más estructura intacta en el suelo. plagas y enfermedades es el uso de agroquímicos. Se presume que animales “pesados” o maquinaria pesada causan un mayor impacto en el suelo.primera operación para ser mecanizada y tiene un profundo efecto en la biodiversidad del suelo. La eficiencia se refiere más a lo económico que a lo ambiental. se podría considerar combinar ambos (mecánica y química) dentro de un clasificador que describa el uso de agroquímicos (excluyendo fertilizantes orgánicos). donde la labranza del suelo se restringe a hacer agujeros para sembrar. comparado con animales “ligeros” o maquinaria de igual consideración. el uso de combustibles debería añadirse como atributo en el siguiente nivel más alto de especificación. se basa en el tipo de tracción utilizada: animal o mecánica. tales como la unidad de sembrado directo (ripper-planter) utilizada en la agricultura de conservación (de Freitas. en caso afirmativo. ya que no resultará un indicador directo del grado de perturbación del suelo. 2000). Una distinción más detallada de acuerdo con los requerimientos reales de poder o capacidad en términos de caballos de fuerza no se considera relevante. por ejemplo. La labranza mínima se refiere a aquellos sistemas donde el arado y la siembra son típicamente una combinación de una sola operación. Se debe mencionar aquí si se practica la labranza mínima. La principal preocupación relacionada con el control de las malezas. El tipo de animal o el tipo de maquinaria empleada es indicado en el siguiente nivel de detalle. sin embargo. tipo de equipo y tipo de tracción. o arado de cincel. Opcionalmente. refiriendo su capacidad. el suelo (y otras condiciones ambientales) afectarán la eficiencia de la operación. aquí se incluye su compatibilidad con los métodos que incorporan el uso de combustibles fósiles en los cálculos de la intensidad del uso de suelo. El uso de combustibles puede fácilmente estimarse si se conoce su eficiencia. Por lo tanto. tomando en cuenta el impacto directo del peso del animal o la maquinaria y el impacto generado por los diferentes tipos de equipo operados por maquinaria o animales de diferentes capacidades. arado de disco. la profundidad del arado. De acuerdo con el orden mencionado. La “eficiencia” en términos de horas por hectárea requerida para la operación se añade como un atributo opcional. tales como tipo de suelo.

manual (azadón). reducida o mínima] Eficiencia (horas/ha) Tipo de arado [vertedera. biológico o cultural. Nivel 4 – Clasificador Limpieza [Sin limpiar.. mecánica] Alcance de la labranza [labranza completa. la rotación de cultivos. mula/burro] Eficiencia (horas/ha) Mecánico Tipo de arado Clase de maquinaria [dos ruedas (ligera). mecánico. por ejemplo.[vertedera. etc. el barbecho.disco. Respecto al deshierbe manual se hace una distinción Tabla 11. tracción animal. con la mano] D escripción y clasificación de uso de suelo en puntos de muestreo 313 . El clasificador para el control de malezas especifica el modo de mecanismos de control. química] Atributo técnico 1 Manual Modo [desmontar y quemar. estas han sido registradas de las prácticas de uso de suelo en los niveles previos del sistema de clasificación y. mecánico. no se incluyen en el valor de dominio. a Deshierbe a mano Eficiencia (horas/ha) mano. cincel. labranza mínima/unidad de das (pesada)] sembrado directo (ripperplanter)] Eficiencia (horas/ha) Deshierbe [Sin deshierbe. Tracción animal Tipo (y número) de anima. mecánica. desmontar y cubrir con abono verde] Mecánica Grado [limpieza moderada. directo (ripper-planter)] vaca. sea por el método de herbicidas. En el caso de medidas de control culturales (y biológicas). caballo. químico] Tipo de deshierbe [con azadón. intermedia e intensa] Manual Atributo técnico 2 Labranza [Sin labranza. labranza y deshierbe.y práctico manejarlas por separado. “No quitar malezas” puede atender a situaciones donde no existe la extracción real de las malezas. labranza mínima/unidad de sembrado les usados [búfalo. cuatro rue.disco. buey. por ello. manual. cincel.6a Clasificadores y atributos relacionados con la limpieza de la parcela.

por mucho. VA (> 2500 g ia/ha)] Herbicida.edu/mgmt/2004) por la cantidad de aplicaciones especificada en gramos equivalentes de ácido (ea) por hectárea de glifosato. otros mecanismos] (entre 850 y 2500 g ia/ ha). weeds. se basa en el volumen de la aplicación que resulta no viable.Tabla 11. los cuales se convierten de libras por acre a gramos por hectárea (weeds. si se requiere información más detallada acerca del Roundup. o cualquier otro tipo de herbicida. Las especificaciones de manejo de malezas no cubren todas las medidas de control de malezas. basadas en recomendaciones generales para su aplicación en diferentes cultivos. En cuanto al uso de químicos en el control de malezas. azadón de presión. azadón rotatorio) Eficiencia (horas/ha) Químico Volumen de aplicación Tipo de equipo [aspersor de [VB (< 850 g ia/ha).ippc. Una diferencia más. si se considera el gran número de herbicidas que se encuentran disponibles en el mercado. junto con la cantidad en gramos del ingrediente activo por hectárea. cultivo para el control de malezas] Atributo técnico 2 Eficiencia (horas/ha) Tipo de equipo (ej. que es la sustancia activa del Roundup. Las especificaciones son asignadas de manera arbitraria.6a Continúa. Una tasa de aplicación de (ea) menos de 850 gha-1 se considera un volumen bajo (VB) de aplicación.edu/pnw/weeds). por lo 314 Manual de biología de suelos tropicales . mientras que una aplicación (ea) de más de 2500 gha-1.iastate. Nivel 4 – Clasificador Atributo técnico 1 Mecánico Tipo de deshierbe [labranza frecuente. Si se considera de vital importancia. se recomienda implementar un sistema de clasificación para la aplicación de volumen de herbicidas que sea relevante para el área en cuestión. 2005). dado que el Roundup es. ingrediente activo y tasa de aplicación entre si esto se lleva a la práctica con el uso del azadón o mediante la extracción totalmente manual. los diferentes tipos de ingredientes activos y las fórmulas que existen (Oregon State University. orst. se considera un volumen alto (VA). la distinción se hace acorde con su aplicación: el uso de aspersor de mochila es el más común. Sin embargo. se debería especificar el ingrediente activo (ia). VI mochila. el herbicida más usado en los trópicos (www.

sin tomar en cuenta su modo de empleo. Generalmente. Para abonos. Dos toneladas por hectárea por año se consideran suficientes para todo tipo de cultivo. P2O5 para el fósforo y K2O para el potasio) El índice toma D escripción y clasificación de uso de suelo en puntos de muestreo 315 . los rangos de tasas de aplicación se especifican para los límites superiores e inferiores de las clases. dentro del rango especificado. mientras que los fertilizantes de alto grado contienen hasta el 50% de elementos nutritivos. sin considerar las disoluciones hechas antes de la aplicación. Los volúmenes especificados se refieren a la forma líquida en la cual el pesticida o el fungicida se obtienen. Eso se hace para poder acomodar los diferentes grados de fertilizantes. se hace una distinción basada en si éstos son ampliamente aplicados en todo el campo o si la aplicación se restringe a puntos específicos y también al tipo de equipo utilizado. se podrían especificar cantidades reales de aplicación. Se presume que el modo de aplicación no traerá muchas consecuencias para la tasa de aplicación. Las clases de volúmenes para aplicar pesticidas se obtienen de Craig et al. 1985). Cuando se utilicen fertilizantes de bajo grado. se deberán tomar en cuenta los valores más altos. Tasas de aplicación bajas de menos de una tonelada por hectárea por año se consideran insuficientes para mantener los niveles de humus y de materia orgánica en el suelo. en caso de considerarse relevante. se presume que se requieren entre 5 y 10 toneladas por hectárea para poder mantener los niveles de humus en el suelo.que la libreta de campo es un buen complemento para la observación relacionada con cualquier medida específica de control de malezas. En este punto. se prevén especificaciones para la tasa de aplicación. La frecuencia de la aplicación puede variar y en la tabla que se observa a continuación.6b). En cuanto a los fertilizantes orgánicos e inorgánicos. (2002) y son usadas en caso de aspersión aérea. se definen clases similares: control natural o medidas culturales. Respecto al uso de pesticidas. estas cantidades se suministran una vez cada cuatro a seis años (ILACO. en lugar de usar un valor en particular. las cifras se convierten en tasas de aplicación por año. y las mismas clases de volumen se consideran relevantes. estos se basan en asumir un contenido de materia orgánica del 30%. fungicidas u otros químicos. Con relación a las medidas de control de plagas y enfermedades. control biológico o mecanismos de control químico (Tabla 11. Con respecto a la aplicación de fertilizantes inorgánicos. Los elementos nutritivos pueden referirse a un solo elemento (por ejemplo N) en los fertilizantes simples o la combinación de elementos en mezclas incompletas o mezclas completas (el porcentaje de peso se relaciona al N para el nitrógeno. Los fertilizantes de bajo grado tienen menos del 25% de nutrientes para las plantas.

lo cual coincide más o menos con la duración máxima de barbecho bajo sistemas de cultivos migratorios. Si las tasas de aplicación son generalmente altas. cualquier incidencia de fue316 Manual de biología de suelos tropicales . Actualmente. o si las tasas de aplicación altas son de particular interés. lo que ha ocurrido en algunos márgenes de selvas en donde opera el proyecto CSMBGBD. 6a) se enlista cuando el campo ha sido convertido a partir de bosque o vegetación secundaria desde hace más de 20 años. se podría considerar añadir una clase para las tasas muy altas que serían aplicaciones de 300 kg ha-1 o más.75 kg ha-1 de N como punto de referencia para la aplicación de N. estos valores se toman como el límite superior de la clase de “tasa de aplicación de fertilizante medio”. Las otras clases se derivan de estas cifras. para alrededor de tres toneladas de trigo en suelos relativamente fértiles y 25 toneladas de mandioca en suelos moderadamente fértiles. “La limpieza moderada” está indicada cuando se utilizan medios manuales y mecánicos. La conversión puede incluir operaciones para nivelar el suelo. cuando incluyen quemas. La limpieza también es importante en sistemas de barbecho. por lo tanto. en donde los árboles se cortan a mano o con sierra de cadena y los troncos se remueven utilizando tractores u otra maquinaria más ligera. se incluye como clasificador separado. Esto sería particularmente relevante donde se practican cultivos migratorios o donde las selvas han sido convertidas recientemente en suelo agrícola. en donde una tasa muy baja de aplicación representa alrededor de 10 a 15% de esta cantidad de referencia. Una aplicación de 75 kg ha-1 de N requerirá 150 kg ha-1 de un fertilizante con N de alto grado y alrededor de 350 kg ha-1 de un fertilizante de bajo grado. Otra distinción se hace basada en el tipo de equipo usado. La manera en que se prepara la parcela puede tener un profundo impacto en la biodiversidad del suelo. La aplicación del fertilizante. En todos los sistemas es importante registrar si la quema se lleva a cabo para eliminar la vegetación muerta o si esta vegetación se queda como abono orgánico. “Sin limpieza” (ver Tabla 11. Sin embargo. por lo tanto. de un fertilizante de alto grado y de 700 kg ha-1 o más de un fertilizante de bajo grado. La “limpieza intensa” significa que la tierra se limpia completamente con el uso de tractores oruga y otra maquinaria pesada. Esto sería la aplicación recomendada para un suelo moderadamente fértil que produce alrededor de cuatro toneladas de maíz (grano). se hace una distinción entre sistemas de “desmontar y quema” y “desmontar y cubrir con abonos verdes”. especialmente. será relevante en el caso de tasas bajas o muy bajas de aplicación. ya sea en o alrededor del hoyo de plantación.

Tabla 11. VI (entre 100 y 200L/ha). mezclas incompletas. vehículos. VB (entre 10-100L/ha). mezclas completas] Tasa de aplicación [muy baja (<20 – 60 kg/ha). fertilizantes químicos. o de manera homogénea en la parcela] Inorgánico Clases de fertilizantes [simple. alta (>150–350 kg/ha) Aplicación [hoyos. Nivel 4 – Clasificador Manejo de plagas y enfermedades [medidas preventivas y control natural. o de manera homogénea en la parcela] Cosecha [manual. (VA >200L/ha)] Tipo de químico y tasa de aplicación Tasa de aplicación [baja (<1t/ha/año). abono verde. combinación de fertilizantes químicos y orgánicos] Equipo usado [aspersor de mochila. franjas.go como parte de las prácticas de manejo deberá registrarse en esta sección como fenómeno importante. media (entre 1–2 t/ha/año). mecánica] Eficiencia (Horas/ha) D escripción y clasificación de uso de suelo en puntos de muestreo 317 .6b Clasificadores y atributos para el manejo de plagas y enfermedades. composta. fertilizantes y cosecha. alta (>2 t/ha/año)] Fertilizantes [sin fertilizante. aviones] Fertilizantes orgánicos Tipo de fertilizantes [residuos de cultivos. media (entre 75– 175 y 150–350 kg/ha). abonos. control químico y biológico] Atributo técnico 1 Control químico Aspersión [aspersión focalizada. franjas. estiércol de corral] Aplicación [hoyos. aspersor de motor. aspersión en toda la parcela] Atributo técnico 2 Volumen de aplicación [UVB (<10L/ha). baja (entre 25–60 y 75–175 kg/ha).

lo que aumenta la capacidad de retención y reduce la pérdida de suelo. si se conoce la técnica con un nombre en particular (por ejemplo “Zai”. cuando se compara con un cultivo de 318 Manual de biología de suelos tropicales . corta vientos y otros) o medidas estructurales que incluyen terrazas. hondonadas y otras. incluyendo las relacionadas con técnicas de recolección de agua. al igual que las del estatus del cultivo. pero no como base de clasificación. acolchonado. wocat. Las medidas de conservación de suelo y agua afectarán las poblaciones de organismos del suelo indirectamente por el almacenamiento de agua mejorada. De manera general. se incluyen como medidas estructurales. cultivos en curvas de nivel. número de macollos por planta de cereal. De manera alternativa. el crecimiento puede clasificarse como: crecimiento retardado. se recomienda que las observaciones de las prácticas de conservación de suelo y agua. Probablemente. por lo que es difícil obtener cifras confiables y del todo correctas. altura y diámetro relativos del cultivo en crecimiento (ver Stocking y Murnaghan. Las evaluaciones del rendimiento basadas en campo deberán incluir lo siguiente: población de plantas por metro cuadrado. Estos datos proporcionan información adicional sobre el cultivo principal tal y como se especifica en el primer nivel del sistema de clasificación. El rendimiento del cultivo como indicador integra muchos factores.). La información de las medidas de conservación no se captura directamente en el registro de los atributos enlistados arriba.net). esta información deberá adjuntarse. Las observaciones del estatus de los cultivos podrían ser útiles para corroborar los resultados anteriores (o resultados de clasificación). que se practica en el Níger).Otras observaciones sobre el manejo de suelo y cultivos Aparte de registrar las características del manejo de suelo y de cultivos como se describió en las tablas anteriores. barreras de setos. provee una visión general en su página web de muchas técnicas existentes (www. Las técnicas de recolección de agua como cavar zanjas. 2001). La World Overview of Conservation Approaches and Technologies (WOCAT). construcciones y empalizadas. El registro debe contener la descripción de las medidas de conservación del suelo y el agua. bancos. en donde se observa que la altura del cultivo es menor. sean incluidas. La información sobre el rendimiento de la cosecha es igual de útil. etc. especialmente. las características del crecimiento del cultivo pueden utilizarse como una medida representativa del rendimiento. la mejor manera de categorizarlas es determinar si incluyen medidas agronómicas (como cultivos mixtos. muros de contención. cuando se relacionan con su manejo. entre otras. el uso de elementos de vegetación (referido a tiras de pastizales.

lo cual puede ocurrir cuando los árboles están dispersos dentro de la parcela. El uso de suelo en el área circundante del punto de muestreo tendrá una notable influencia sobre la biodiversidad del suelo de la parcela en observación. en principio. Este es el caso cuando la cobertura de árboles es escasa (menos de 10 a 20%). el factor Ruthenberg se establece. frijol y col. un importante aspecto de la intensidad del uso del suelo. con un diámetro del cultivo menor y una decoloración generalizada en sus hojas. en el caso de cultivos migratorios o sistemas de barbecho. 2001) por signos de déficit de nutrientes en maíz. lo que resulta importante para un mapeo del uso de suelo. Si se conoce la plaga o enfermedad específica. y cultivo de crecimiento vigoroso. Existen guías disponibles para registrar deficiencias específicas de nutrientes en cultivos (ver Stocking y Murnaghan. enfermedades y sus clasificaciones. Además. deberá enlistarse su nombre. por sí misma. la primera distinción se hace en función de si éstos son continuos. permite la validación y la verificación de las observaciones en el lugar del muestreo. permite una evaluación del uso del suelo en un punto de muestreo particular. por ejemplo. y finalmente. La fragmentación del uso de suelo que puede ser evaluada a partir de estas observaciones resulta ser. dentro del contexto del uso de suelo en las áreas de los alrededores (esto ayuda a establecer si el uso de suelo en la parcela en observación es representativo o no). Esto permite la inclusión de elementos de vegetación leñosa en la descripción que no están capturados en el sistema de descripción de uso de suelo. Patrones de distribución en el campo y árboles en la finca Las observaciones relacionadas con el tipo de campo y con los elementos de vegetación leñosa dentro de la parcela bajo observación y sus alrededores están incluidas. Queda fuera del marco de este capítulo proporcionar información más detallada sobre plagas. Las observaciones del estatus del cultivo deberán acompañarse de observaciones acerca de la incidencia de plagas y enfermedades e incluir el porcentaje del cultivo afectado. dentro de una proporción espacial entre barbecho y el suelo cultivado en el uso de suelo actual. Respecto a la distribución de los campos (evaluación del patrón de distribución). se esperaría encontrar barbecho como parte del patrón de uso de suelo.crecimiento vigoroso. cercas vivas y otros elementos de vegetación importantes. plantas de menor vigor. y la severidad de la infección en términos del grado en el cual la planta es afectada. están disD escripción y clasificación de uso de suelo en puntos de muestreo 319 . todos a nivel parcela o paisaje.

superficies artificiales. industrial. mediana. queda una opción para especificar los porcentajes del área usando varias categorías: tierras cultivadas y áreas manejadas. forma y patrón de los campos y finalmente. Los distintos componentes de uso del suelo pueden describirse con mayor detalle. Clasificador espacial Distribución espacial de la parcela [continua. utilizando las clases mayores de cobertura de suelo del LCCS. en donde se especifican los cultivos principales. etc.7 Características de la parcela y distribución del uso de suelo. La segunda distinción se refiere al tamaño. vegetación acuática (semi) natural. agrupada.tribuidos en forma de racimos o dispersos (ver Tabla 11. áreas vacías o cuerpos de agua artificiales y cuerpos de agua naturales (hielo y nieve). áreas acuáticas cultivadas o de inundación regular. irregular] Patrón de la parcela [regular. Tabla 11. irregular] No continuo Parte de las tierras cultivadas [% de cultivo y área de manejo] Parte de la cobertura vegetal [% de área (semi) natual] Parte del área acuática cultivada [% de área acuática cultivada] Parte acuática no cultivada [% de área acuática no cultivada] Área urbanizada [% de superficie artificial] Atributo técnico 2 Uniforme clases de tamaño (mayoría del campo) [pequeña. dispersa] Atributo técnico 1 Continuo Distribución del tamaño de la parcela [uniforme. son las características del suministro de agua y la permanencia del cultivo. lo que parece relevante especialmente en el caso de áreas cultivadas terrestres. El patrón del campo se relaciona a la forma del lugar y al arreglo espacial del mismo. Residencial. áreas terrestres seminaturales. grande] Cultivo principal (lista de los cultivos de cuatro parcelas vecinas ) Cultivo principal (lista de cultivos de cuatro parcelas vecinas) Cobertura del suelo (cobertura dominante de áreas no cultivadas) Tipo de cultivo o actividad Tipo de área acuática Tipo de área urbanizada (ej.7).) 320 Manual de biología de suelos tropicales .

nueces. a partir de los claD escripción y clasificación de uso de suelo en puntos de muestreo 321 . En el caso de porcentajes bajos de cobertura de árboles y árboles dispersos dentro del campo o alineados en forma de cerca viva. aunque estos elementos pueden ser característicos del uso y cobertura del suelo y tener mayor influencia sobre la presencia de la biota específica del suelo. presas. Es importante derivar las clases de manera sistemática. La Tabla 11. Se hace referencia a éstos como árboles en una finca (TROF).8 especifica los atributos utilizados para describir los TROF. como estanques. es importante registrar la localización del punto de muestreo respecto al lindero del campo. natural (especificar tipo. Se entiende que los tramos de bosque y otra vegetación leñosa fueron ya cubiertos por el método de clasificación para uso de suelo. La información sobre los árboles pertenecientes a la familia leguminosa es útil en relación con la ocurrencia de las bacterias formadoras de nódulos. si es posible)] El último elemento que debe ser registrado es la presencia de elementos permanentes de vegetación leñosa en el paisaje. Más información trata de la cobertura o densidad del componente árbol. Las “zonas verdes” se refieren a árboles espaciados en filas dispuestas como empalizadas. DESCRIPCIÓN Y CLASIFICACIÓN DE USO DE SUELO Definición y descripción de clases de uso de suelo No es el propósito de este capítulo describir cómo las clases de uso de suelo se definen. Los atributos técnicos permiten una descripción del tipo de árbol (ya sea por especie u otro nivel taxonómico) y el propósito de tener árboles (por ejemplo. El primer atributo describe la distribución espacial de los árboles. para leña o material de construcción). este podría no ser el caso. para madera. Como se ha mencionado.7 Continúa. para cosechar frutas.Tabla 11. Clasificador espacial Atributo técnico 1 Atributo técnico 2 Suelo desnudo [% de áreas desnudas] Cuerpos de agua [% de Tipo de cuerpos de agua [arcuerpos de agua] tificial. especificado en términos del número de árboles por hectárea o longitud de los elementos lineales de la vegetación leñosa. pantanos.

por ejemplo. distintos grados de cobertura de árboles pueden observarse dentro de la clase “plantación de árboles” (o aun dentro de las plantaciones de teca). Por otra parte. el diseño de la clasificación jerárquica y el atributo de los valores de clase. “cultivo único”.Tabla 11. principalmente árboles de sombra. Esto se traduce en “plantación de árboles”. son explicados a continuación. lo que determina el nivel de detalle con que se definen las clases. de manera que un conjunto de clases definido para un área en particular puede ser fácilmente mapeado en el conjunto de clases utilizados para otra área y viceversa. Nivel 5 Clasificador Tipo de TROF [sin TROF. principalmente madera. no necesariamente tienen que implicar una definición de un conjunto adicional de clases en el siguiente nivel de la clasificación jerárquica. zonas verdes] Atributo técnico 1 Cercas vivas: especies de árboles Árboles dispersos dentro de la parcela Propósito [principalmente frutas y nueces. Los principios de la definición de usos de clase de suelo. cercas vivas. una clase de uso de suelo podría ser definida en función de los siguientes valores de atributos: “cultivo de árboles”. utilizando reglas de decisión. “cultivo de temporada” y “cultivo permanente”. Las clases se definen por la combinación particular de clasificadores y atributos (determinados por el valor de los mismos). pero esto pue322 Manual de biología de suelos tropicales . relacionados con observaciones de campo.8 Características de los árboles en la finca (TROF). barreras contra el viento u otros elementos leñosos. No todos los atributos o clasificadores tendrán que tomarse en cuenta. árboles dispersos dentro de la parcela. Si únicamente se consideran los primeros tres niveles en la clasificación jerárquica. otros] Barreras contra el viento u otros arreglos lineales: especies de árboles Empalizadas: tipo o especie dominante Atributo técnico 2 Cobertura (% de linderos que constituyen cercas vivas) Densidad (número de árboles por ha) Longitud total por ha (m/ha) sificadores y atributos presentados aquí. “parcela de tamaño grande”. Si se contemplan atributos adicionales del cultivo principal (por ejemplo. cuando se toman en cuenta atributos técnicos adicionales. es posible distinguir entre una plantación de teca y otra de hule. tipo de cultivo).

No obstante. La Tabla 11. La Tabla 11. Una clasificación jerárquica se establece de manera similar. el factor “tiempo de cultivo” puede tener prioridad sobre el cultivo principal como la característica dominante. en donde el factor “tiempo de cultivo” sería el parámetro en la jerarquía agregada y no.de no ser relevante para definir clases separadas de plantaciones de árboles. en áreas donde los cultivos migratorios o permanentes se practican uno al lado del otro. la jerarquía considera el cultivo principal como la puerta de entrada. un “campo grande”. combinados a través de operadores Booleanos (es decir. ver Huising (1993). y “un cultivo permanente”. sin embargo.10.1 a la 11. hay que tomar en cuenta los valores especificados para los diferentes clasificadores y atributos técnicos. O. Esto se refiere a los niveles de la clasificación jerárquica. como han sido presentados arriba.9 proporciona una lista generalizada de los clasificadores y atributos de clases de acuerdo con el nivel la clasificación jerárquica. Por ejemplo: SI (<forma de vida> igual a ‘árbol’ y <tamaño de parcela> igual a ‘grande’ y <combinación de cultivos> igual a ‘único’ y <factor tiempo de cultivo> igual a ‘permanente’) ENTONCES <clase> = ‘plantación de árboles’. Más bien. plantación de árboles). Las clases se asignan de acuerdo con las reglas de decisión y al mismo tiempo las clases se definen. lo que D escripción y clasificación de uso de suelo en puntos de muestreo 323 .9 contiene una vista global de la estructura de la clasificación principal. Debido a la estructura anidada. Para una explicación de clasificación y jerarquías agregadas. Para información precisa habrá que referirse a las Tablas 11. tal y como se observa en la Tabla 11. Debido a que el sistema que se presenta trata de áreas cultivadas y manejadas. no todos los atributos pueden ser fácilmente organizados en una tabla. Y. esta característica es general en áreas grandes y no en parcelas. “sin irrigación”. en la jerarquía de clasificación para observaciones en parcela. XO y NO). Las reglas de decisión generalmente toman la forma de un conjunto de condiciones SI – ENTONCES que aplica los atributos.8. se retiene la información sobre el porcentaje de cobertura como un valor de atributo en particular para cada observación individual (instancia u ocurrencia) del objeto clase (es decir. y por ello podría usarse para realizar ejercicios de mapeo a pequeña escala. Para ilustrar la definición y descripción de la clase. y no a los niveles de generalización (el segundo eje en el sistema de clasificación). decidiendo la presencia de un clasificador sobre otro. Los clasificadores especifican un “cultivo de árboles”.

permitirá una distinción entre hule de “jungla”. 2002) o en lugares donde se cultivan únicamente árboles de hule. Si se utiliza la información sobre la especie de árbol. si la información es correcta y se considera importante en el contexto de la clasifica324 Manual de biología de suelos tropicales .significa una plantación grande de árboles. La Tabla 11.11 muestra los datos para una parcela imaginaria de maíz. Las diferencias entre la intensidad de uso de suelo. De manera alternativa. el segundo nivel indica que entre el maíz se encuentran otros cultivos y. La principal categoría de uso de suelo a la que esta parcela en particular pertenecerá puede definirse como “cultivos permanentes a pequeña escala con maíz como cultivo principal”. porque la preparación del campo.200 mm de lluvia por año. por lo tanto. se clasificará como “extensivo”. el tercer nivel.. con relación a la variedad de plantaciones. por ejemplo. el manejo de plagas. que la parcela es cultivada de manera permanente con un pequeño periodo de barbecho cada dos años. podría basarse en la clase de atributo nivel 1 “densidad de árboles” o en el atributo nivel 2 “combinación de cultivo de árboles”. Tomando en cuenta la información del cultivo principal (clasificadores del nivel 1) se describirá la parcela como grande (con 10. se podría definir una subclase añadiendo la descripción “intercalada con un cultivo de leguminosas” para distinguirla del maíz como único cultivo. En cuanto a los clasificadores del nivel 5. Posteriormente. frecuentemente no son relevantes para cultivos de plantación. El primer nivel especifica que se trata de una pequeña parcela cuyo cultivo principal es el maíz.000 m² por tamaño de la parcela). Algunos de los clasificadores de suelo y atributos de suelo y cultivos. o si forma parte de un paisaje dominado por plantaciones de cultivos de árboles. enfermedades y la fertilización del suelo no tienen lugar. El manejo de estas plantaciones. una plantación de más de 10 años de teca (que forma un dosel cerrado). se pueden distinguir plantaciones de árboles destinadas a la producción de madera para tablas o para otros fines y si se utiliza la información sobre el propósito. de cacao y otras. se pueden distinguir plantaciones de frutales. con 100 árboles por hectárea y que recibe 1. Se pueden tomar en cuenta medidas para el control de malezas mediante corte o también el uso de químicos. lo cual únicamente tendrá sentido si existe una gran variación de dichas características dentro del área y si éstas reflejan diferentes regímenes de manejo. es importante informar sobre el uso del suelo circundante. Esto. a un sistema agroforestal en donde los árboles de hule (Hervea brasiliensis) crecen dentro de la selva (Joshi et al. si la plantación de árboles bajo estudio es un pequeño bosque aislado dentro de un ambiente dominado por cultivos anuales. por ejemplo.

Nivel 2 cultivo combinado Cultivos simples o múltiples Suministro de agua Factor tiempo de cultivo Nivel 3 prácticas culturales Cobertura del cultivo Nivel 1 características del cultivo y el campo Clasificador Forma de vida del cultivo principal Tamaño del campo Segundo Densidad o espacio entre tipo de cultivo plantas Tercer tipo de cultivo Cantidad de agua suministrada Número de Clase de cobertura del cultivos cultivo Tiempo de secuencia Arreglo espacial Tipo de irrigación Duración del período de barbecho Índice Ruthenberg Clase de tamaño del campo D escripción Modo de preparación del campo Tipo de tracción Frecuencia Tipo de operación Alcance de la operación Frecuencia Modo de deshierbe Manejo de plagas y enfermedades Prácticas de fertilización Tipo de fertilizante Volumen aplicado Atributos Nivel de especie 1 Tipo de cultivo (categoría) Forma del campo Tipo de barbecho Tipo especifico de barbecho Atributos Nivel de especie 2 Cultivo especifico (categoría o especies) Atributos Nivel de especie 3 Cultivo variedad (especie o variedad.9 Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo.) Nivel 4 manejo Modo de cosecha y clasificación de uso de suelo en puntos de muestreo Clasificador Medios de limpieza Atributos Nivel de especie 1 Grado de limpieza Modo de limpieza 325 .Tabla 11.

Nivel 2 cultivo combinado Tipo de equipo Ubicación.Tabla 11. 3 Atributos Nivel de especie 4 Nivel 5 Configuración espacial del campo y árboles en la finca Clasificador Configuración espacial de los árboles en la finca Atributos nivel 1 Propósito de los árboles en la finca Atributos nivel 2 Tipo de especies de árboles dominantes . Modo de equipamiento Aplicación Nivel 3 prácticas culturales Tipo de arado Alcance de la operación Eficiencia Clasificación de la aplicación Tipo de fertilizante Tipo de químicos Tipo de herbicida Volumen Volumen aplicado Volumen aplicado aplicado Patrones de distribución del campo Cobertura de árboles (copa) Densidad de árboles o longitud de barreras Patrones de distribución del tamaño del campo Partes del área terrestre cultivadas y manejadas Partes terrestres no cultivadas Arreglo espacial del campo Forma de vida del cultivo principal Otros tipos de uso o cobertura Clasificación de la aplicación Clasificafión de la aplicación Tipo de equipo 326 Eficiencia Nivel 1 características del cultivo y el campo Atributos Nivel de especie 2 Manual de biología de suelos tropicales Atributos Nivel de especie.9 Continúa.

Tabla 11. Tamaño o clases de tamaño del campo Tipo de cultivo principal % cobertura Nivel 5 Configuración espacial del campo y árboles en la finca Atributos nivel 3 Especies de árboles D escripción y clasificación de uso de suelo en puntos de muestreo 327 .9 Continúa.

200 mm** n/a n/a Nivel 1 Características del cultivo y el campo Clasificador Árboles Atributos técnicos Nivel 1 Perenes.Tabla 11. se puede describir las plantas debajo de los árboles y estas plantas pertenecerán a la categoría de vegetación (semi) natural.Tectona grandis nico nivel 3 * En este caso. de hoja ancha leñoso >10 años Manual de biología de suelos tropicales Atributo téc. . para lo cual se utilizan otros parametros.10 Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca. aunque no se discuten en este capítulo. ** En el caso de sistemas de temporada de ser posible debe especificarse la cantidad de lluvia. aunque esto por lo general se describe en las características del sitio. Nivel 2 Combinación de cultivos Único 328 Nivel 3 Prácticas culturales De temporada n/a n/a n/a n/a Permanente n/a Grande Regular Cerrado Vegetación natural* 10. si es relevante.Teca nico nivel 2 Atributo téc.000 m2 100 árboles/ ha n/a n/a 1.

infraestructura 329 n/a .16 1 cultivo adicional Simultaneo 2 filas alternadas NA Intermitente De temporada Permanente Mejorado Nivel 1 Características del cultivo y el campo Nivel 3 Prácticas culturales Clasificador Gramíneas Pequeño Atributos nivel de especie 1 Cereales Cuadrada D escripción Mecánica y química Labranza frecuente (2x) y fumigación una vez (1x) Aspersor de mochila VB (Roundup) Continuo n/a n/a Pequeño Uniforme 90% Regular Hierbas y gramíneas Chícharos. habas. maíz 10% n/a n/a n/a n/a Ninguno Fertilizante químico Directamente hoyos Manual VMB (muy bajo) 50 kg CAN/ha n/a Atributos nivel de especie 2 Maíz Mucuna (abono verde) Atributos nivel de especie 3 Nivel de manejo 4 n/a Tracción animal n/a 2 bueyes n/a Arado de vertedera n/a Nivel 5 Configuración espacial del campo y árboles en la finca No TROF y clasificación de uso de suelo en puntos de muestreo n/a n/a Caminos .11 Ejemplo de clasificadores y valores de atributos para parcelas de maíz.000 m2 Mediano a grande 75 x 25 cm Frijoles NA 0. Nivel 2 Combinación de cultivos Múltiple 2.Tabla 11.

pero una definición de un índice o medida de la intensidad de uso de suelo no es fácil. manejo de plagas. Esto podría traducirse. Los clasificadores de nivel 5 y los atributos describen que el suelo es cultivado de manera continua. que las parcelas son generalmente pequeñas. más intenso será su uso). con cultivos anuales. La información específica se refiere a la densidad de la planta.ción. con un bajo volumen de herbicidas. Giller et al. en “un manejo caracterizado por el uso de tracción animal y bajo insumos agroquímicos”. El grado de interferencia con (perturbación o alteración) el ecosistema natural sería una buena medida de la intensidad del uso de suelo. (1997) definieron un índice de intensidad de uso de suelo que considera la frecuencia de la ocupación de suelo (según lo expresado en el índice Ruthenberg). al arreglo específico de la combinación del cultivo y a qué especie es utilizada para mejorar el barbecho. que indica patrones de uso de suelo fragmentados y un uso intensivo del suelo. Manejo y nivel de insumos: la información en el manejo del cultivo y el suelo habla de que el nivel de perturbación del suelo se considera intermedio (habiendo sido arado dos veces con el uso de tracción animal) y que el insumo de químicos ha sido bajo. Esta sección pretende demostrar cómo un conjunto de clases podrá definirse y organizarse en una estructura jerárquica y que el sistema es bastante flexible en cuanto a la selección de clasificadores y atributos considerados para su clasificación. La norma general es que los sistemas culturales y manejados son más intensivos que los naturales (cuanto más insumos de manejo se requieran para mantener los sistemas. con escasa o sin presencia de árboles. dependiendo de las reglas de clasificación. el manejo tiene por objetivo modificar o establecer condiciones que propicien la producción de un cultivo. el criterio para mejorar el barbecho podría considerarse en la definición de las subclases. sin que esto quede reflejado en la definición de las clases. Parece que existe un consenso sobre los factores que determinan la intensidad del uso de suelo.. insumos de ener330 Manual de biología de suelos tropicales . Un esquema de clasificación estándar no funcionará porque la definición de un conjunto de clases depende del contexto y del propósito específico de la clasificación. uso de nutrientes. principalmente. sin el uso de fungicidas o pesticidas y únicamente con muy baja cantidad de fertilizantes. Ordenamiento de las clases de uso de suelo respecto a la intensidad de su uso En sistemas agrícolas.

de la misma manera como lo ilustran Kuechler y Zoonneveld (1988). Además. Existen dos principales ejes a lo largo de los cuales se mide la intensidad del uso: el primero. Lo anterior permite un arreglo de los componentes de la vegetación (objetos) a lo largo de dos gradientes. En ambos casos. se refiere a la permanencia (o frecuencia) de operaciones y el segundo. El segundo gradiente D escripción y clasificación de uso de suelo en puntos de muestreo 331 .gía y manejo de agua. El primer gradiente representa la presencia (proporción en el espacio o tiempo) de vegetación seminatural. puesto que es difícil asignar un peso adecuado a las variables explicativas. Han existido varios intentos por definir una medida de intensidad de uso de suelo. el componente de la cobertura de la vegetación (semi) permanente es un indicador útil. puesto que cada índice es una expresión particular de la intensidad del uso de suelo. a la intensidad (o amplitud) de las operaciones. Es decir. los esfuerzos para crear un índice universal o una medida de la intensidad de uso de suelo serán inútiles. pero éstos no han sido del todo exitosos. aunque no directamente relacionado con la influencia de la operación del manejo. en el caso de cultivos migratorios. La presencia de vegetación permanente en el sistema de cultivo limitará las posibilidades para cultivar el suelo o la proporción del suelo que puede ser cultivado. como factores relevantes. También. Esto se hace considerando aquellos atributos (y clasificadores) que expresen un aspecto en particular de la intensidad de uso de suelo. indicando que el sistema con una proporción mayor de vegetación permanente (ya sea como elementos de vegetación natural o cultivada) representa una intensidad menor de uso o un grado menor de perturbación. la proporción del tiempo durante el cual la vegetación del suelo se restablece de manera semipermanente. la presencia de vegetación permanente disminuirá la influencia de la variación climática en el ecosistema del suelo. Para los propósitos de investigar tendencias en la pérdida de la diversidad del suelo en relación con un incremento en la intensidad de su uso. se requieren categorías de clases de uso de suelo en términos de la intensidad de uso de suelo (o alternativamente una definición de clases de uso de suelo que reflejen diferentes niveles de la intensidad de uso de suelo). reflejando el grado en el que estos factores tienen un efecto en los ecosistemas (el grado en el que se altera o perturba el ecosistema natural) y debido a que algunas veces los datos requeridos para una evaluación cuantitativa de la intensidad del uso de suelo no son accesibles. se traduce directamente en la frecuencia del cultivo. que en el entorno de márgenes de selva se traduce en elementos de vegetación leñosa. con la relevancia de que un índice en particular dependiente del contexto o propósito para el cual se está desarrollando.

dentro de cada una de las clases definidas. a árboles plantados o cultivados (árboles cultivados) o elementos de vegetación no leñosos (por ejemplo. como se ha especificado en el atributo técnico 1. cultivos anuales y pastizales) en el caso de elementos de vegetación cultivados. este eje también expresa una partición en el espacio entre los elementos de vegetación natural y cultivada.5). la permanencia se expresa con el factor “tiempo de cultivo” y el sistema de clasificación permite un arreglo de clases de uso de suelo. dentro del sistema de cultivo. para el sistema de cultivo permanente. y presencia o ausencia del componente arbóreo.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. El continuo puede representarse gráficamente con un triángulo en donde los tres ángulos representan los valores extremos de la cobertura del suelo que solo pueden estar constituidos por árboles naturales (es decir.“sistemas de barbecho”-“cultivos permanentes” (véase Tabla 11. los objetos de uso de suelo son ordenados a lo largo del segundo gradiente de intensidad de uso de suelo. En segundo lugar. de acuerdo con el componente Figura 11. La localización a lo largo de los dos ejes. lo que resulta relevante en el caso de sistemas particulares de uso de suelo. se determina basándose en los clasificadores y atributos del sistema de clasificación.representa la cobertura de vegetación leñosa. en el siguiente nivel de especificación. de acuerdo con el incremento en la intensidad: “sin cultivar”. selva). Se puede hacer una subdivisión adicional basándose en la duración del periodo de barbecho. Además de servir como una partición en el tiempo.“cultivos migratorios”. como en el sistema de “hule de la selva” mencionado arriba. Los objetos se refieren a árboles que existen en la naturaleza (en el caso de vegetación natural). En primer lugar. pero sobre todo. sólo de árboles plantados (plantación) o sólo de cultivos anuales o pastizales. Cultivos anuales-campo Componente de le vegetación leñosa y semileñosa (natural) Componente de la vegetación leñosa cultivada Componente de la vegetación leñosa no cultivada Componente árbol Selva Tiempo de cultivo-permanencia Plantación 332 Manual de biología de suelos tropicales .

de gramíneas y con formas de vida herbáceas. “lúpulo y otras enredaderas perenes herbáceas” y “cultivo de cobertura”. el orden de intensidad de uso sería el siguiente: “cultivo herbáceo”. Si únicamente se toma en cuenta la forma de vida del cultivo principal. como un nivel más de intensidad. Respecto a los cultivos sin gramíneas. el rango se lleva a cabo basado en las características de manejo (el cuarto nivel en el sistema de clasificación).1).1). Una diferenciación adicional para cultivos que no son árboles se basa en la permanencia o duración del cultivo. sin cultivo. Existen dos aspectos que deben ser considerados en relación al manejo: uno se relaciona con el grado de perturbación física debida a las operaciones de manejo y el otro se relaciona con el grado de interferencia química con el sistema (uso de agroquímicos). tracción animal o medios mecánicos).1) junto con las características de la cobertura del cultivo (es decir.árbol o arbusto en el sistema de cultivo (referido a las proporciones en el espacio o en el tiempo). operación de cultivo) y con el grado de uso de agroquímicos (para el control de malezas y manejo de plagas y enfermedades) tal y como se indica en la Figura 11. porcentaje de la cobertura del cultivo. las plantaciones de árboles se consideran menos intensivas que cuando se trata de arbustos pequeños como el del café o té. En el caso de cultivos de árboles (sistema basado en árboles) se puede considerar el número de estratos de la vegetación y el porcentaje de cobertura del suelo para una categoría posterior. Los clasificadores y atributos del nivel 4 (especialmente relacionados con las operaciones de cultivo. Una vez más. los cultivos de árboles se consideran menos intensivos cuando se comparan con cultivos de arbustos. También se podrían considerar operaciones de deshierbe con “deshierbe mecánico”. se deberá considerar la intensidad de las operaciones.3). la clase “bambú” aparece antes que las clases de “pastos”. Las clases se ordenan de acuerdo con este gradiente utilizando las características del cultivo principal (Tabla 11. Una asignación de la intensidad de clases se basa en el valor del clasificador en las operaciones de cultivo (es decir. como se ve reflejado en la información sobre la categoría del cultivo (ver atributo técnico 1. dentro de las clases resultado de los dos pasos explicados arriba. Por ejemplo. las cuatro clases de intensidad se definen de acuerdo con el grado de mecanización (es decir.2) y combinaciones de cultivo (Tabla 11. “plátano y otras plantas herbáceas similares”. D escripción y clasificación de uso de suelo en puntos de muestreo 333 . manual. Respecto al tipo de cultivo de gramíneas. “cereales” y “arroz” (ver Tabla 11. Tabla 11.2. En el tercer paso. tiene que considerarse la información relacionada con los árboles en la finca (Tabla 11. A un nivel más general. Si la cobertura de los árboles es escasa. deshierbe y de manejo de plagas y enfermedades) son utilizados para definir las clases de intensidad. Tabla 11.5).

que representa el nivel más bajo de perturbación. pero una diferencia más. la clase de uso de suelo más intensiva pertenece a “cultivos migra334 Manual de biología de suelos tropicales . son considerados de manera conjunta. y no reconoce que puede haber una superposición considerable en términos de intensidad de uso de suelo entre las clases. el arado de cincel y. BAJO NIVEL DE INSUMOS QUIMICOS INTENSIDAD MEDIA: ALTO GRADO DE MECANIZACIÓN. INTENSIDAD MEDIA: BAJO GRADO DE MECANIZACIÓN. podría basarse en el volumen de aplicación (aplicación selectiva o localizada.3.Figura 11. En cuanto al orden de categoría respecto del uso de agroquímicos. ver Tabla 11.3. El procedimiento jerárquico descrito arriba producirá ramificaciones claramente separadas en la clasificación del árbol. por último. Para poder llegar a una clasificación final de clases de uso de suelo en términos de intensidad de uso. tipo de equipo o maquinaria usada en el caso de plagas y enfermedades y el volumen de aplicación. considerando una plantación de árboles (cultivo permanente bajo manejo extensivo) representará un sistema menos intensivo que un cultivo manejado intensivamente bajo un sistema de barbecho corto. El arado de vertedera tiene un efecto más profundo en el suelo (remoción completa). Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. Como se ilustra en la figura 11. estas clases tienen que relacionarse entre sí. únicamente se considera el “uso” o el “no uso” de agroquímicos. seguido por el arado de disco. Esto se puede observar en la figura 11. La superposición será considerable entre las clases de sistemas de barbecho y sistemas de cultivos permanentes. los clasificadores para el control de malezas y manejo de plagas y enfermedades. en el primer paso de la clasificación. A nivel más general. Al final.6b). una evaluación por pares de clases de uso de suelo individuales en la región de superposición dará la clasificación final en términos de la intensidad de uso de suelo. el arado escarificado. ALTO NIVEL DE INSUMOS QUIMICOS Uso de agroquimicos INTENSIDAD ALTA: ALTO GRADO DE MECANIZACIÓN.2. BAJO NIVEL DE INSUMOS QUIMICOS Otra diferencia podría establecerse en función del tipo de animales o maquinaria usada (de acuerdo con los caballos de fuerza) y el tipo de arado empleado. ALTO NIVEL DE INSUMOS QUIMICOS Grado de disturbio físico INTENSIDAD BAJA: BAJO GRADO DE MECANIZACIÓN.

sistema de barbecho (barbecho > 8-9 meses) Fmcm: cultivo de intensidad media. sistema de barbecho (barbecho 4-5 meses) Pte: cultivo de árboles extensivo. sin distinguir. Donde: Fn: selva natural Fl: selva explorada Slce: cultivo extensivo. en esta fase. que se considera la forma de vida de la vegetación dominante o cultivo. cultivo permanente Pcmi: cultivo de intensidad media. cultivo migratorio (barbecho < 1–2 años) Flce: cultivo extensivo. considerando que la cobertura de árboles en plantaciones puede ser entre el 60% al 70% de la intensidad de uso. bajo cultivo migratorio (1-2 años < barbecho < 8-10 años) Ssce: cultivo extensivo. sistema de barbecho (4-5 meses < barbecho < 8-9 meses) Fsci: cultivo intensivo. cultivo permanente Pchi: cultivo intensivo. Esto quiere decir. cultivo permanente Pti: cultivo de árboles intensivo. si proviene de orígenes culturales o (semi) naturales (por ejemplo. donde se determina el orden a lo largo del gradiente de intensidad de uso de suelo descrito anteriormente. en primera instancia. si el suelo está en barbecho el 60% del tiempo y la vegetación de ese suelo es pasto.3 Clasificación del uso del suelo en términos de la intensidad de uso. que corresponde al 66% del tiempo que la tierra no es cultivada. se aplican los mismos criterios que en el segundo y tercer pasos de la clasificación. bajo cultivo migratorio (periodo de barbecho > 8-10 años) Smce: cultivo extensivo. cultivo permanente Pge: pastizales extensivos. este pasto se considera el tipo de vegeD escripción y clasificación de uso de suelo en puntos de muestreo 335 . cultivo permanente torios” y es seguida por el de menos intensidad de uso “cultivo permanente”. Para establecer una comparación de clases de uso de suelo individual. en las regiones superpuestas entre la categoría mayor de uso de suelo. cultivo permanente Pgi: pastizales intensivos.Figura 11. lo que se toma como el límite superior para la clase “cultivos migratorios”.

. in C.. V. es decir.. J. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. 2005). A.. de acuerdo con los sistemas de uso de suelo en el trópico húmedo a diferencia del proyecto ASB (Bignell et al. selva manejada y selva explotada. S. Agradecimientos Al profesor Ken Giller por sus comentarios y al Dr. Peter Okoth por las discusiones en la preparación de este capítulo. y Jansen. Igualmente. J. si se compara con un área de cultivo permanente bajo manejo intermedio o bajo (Pcmi). Columbia University Press. y Swift. L. F. FAO. D. H. G. S. De esta manera. Craig. Techniques and Equipment.New York. De Freitas. Woods. New York. Vosti.. REFERENCIAS Bignell. (2002) ‘Aerial application’. J. Susilo. M.. in D. Management and Conservation Service. con la introducción de una noción de que la extracción de productos de la selva sirve como un indicador para la intensidad de uso. Sanchez and P. aun en el caso de que sean manejados intensivamente (Pgi) tendrán una clasificación más baja en términos de intensidad de uso de suelo. N. se hace una distinción entre selva natural. I. (2000) Land Cover Classification System (LCCS): Classification Concepts and User Manual. FAO. Tondoh. Nwaga. A. Strategies and Methods of Introduction.. “sistemas de barbecho” refiriéndose al componente de cultivo. los pastizales permanentes. M. Respecto a la selva. 336 Manual de biología de suelos tropicales . Dibog. A. P. P. un cultivo con un manejo intensivo bajo un sistema de barbecho corto (Fsci) puede subir una posición. Di Gregorio. y Dorr. Rome. P.. Pimentel (ed) Encyclopaedia of Pest Management. Moreira. (2002) Soil Management and Conservation for Small Farms.-X.tación dominante). Marcel Dekker Inc. si se compara con un cultivo anual con un sistema de barbecho corto (Fsc). B. Huang. F. (2005) ‘Belowground diversity assessment: Developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. Palm. FAO Soils Bulletin 77.. En el segundo ejemplo se considera la intensidad de manejo (en relación con el cultivo más demandante del sistema. L. D. E. GCP/RA/287/ITA Africover – East Africa Project and Soil Resources. J. Rome. Pashanasi. A. más que al barbecho en sí) para permitir a la clase bajo consideración subir una o dos posiciones en el orden de clasificación.

G. Applied Soil Ecology. A. Springer Verlag. Clarendon Press. N. Berlin WOCAT. A.. M. MacArthur. R. E. Moreira. y Zonneveld. vol. Vincent. van Noordwijk... N.asp. (2002) Jungle Rubber: A Traditional Agroforestry System Under Pressure. in H. y Swift.. 6. G.. M. Bardgett and D... Joshi. H. J.edu/mgmt/2004/ world. P.V. A. Stocking. y Kiefer. Molenaar. Amsterdam.. London.. Dordrecht. Taylor & Francis Ltd. ILACO (1985) Compendium for Agricultural Development in the Tropics and Sub-Tropics. ICRAF-Southeast Asia Regional Research Programme. M. M. World Overview of Conservation Approaches and Techniques.. Hopkins (eds) Biological Diversity and Function in Soils. A pattern recognition approach to land use inventory at the sub-regional scale using remote sensing and GIS applying an object oriented and data-driven approach’. vol. Bogor. M. M. Lillesand. van Noordwijk. (1987) Remote Sensing and Image Interpretation.edu/pnw/weeds. (1997) ‘Agricultural intensification. Wichman Verlag.wocat. G. Wibawa.-M. Wageningen Agricultural University. P. D. Kuechler..shtml. www. www. Huising. R. Boutin. Iowa State University (2004) ‘Weed Science’. pp. (eds) (1988) Vegetation Mapping. E. D. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica. Vink. W. K. Kluwer Academic. Baere.D. M. J.. Oregon State University (2005) Pacific Northwest Weed Management Handbook. Elsevier Science Publishers B. Heipke (eds) Digital Photogrammetric Systems. The Netherlands. ippc.. object dynamics and consistency rules’.. 10. A. R. Oxford. (1980) Farming Systems in the Tropics. y Huising. W. Izac. Cambridge. H.Giller. Ebner. Earthscan Publications Ltd.iastate. E. Lavelle. Swift. Fritsch and C. I. D.. Bignell. Usher. The Netherlands. D.. (2005) ‘Soil biodiversity in rapidly changing tropical landscapes: Scaling down and scaling up’.org/swcmeas. H.. Giller. M. E. 3rd edition. Handbook of Vegetation Science. www. Karlsruhe. London. I. (2001) Handbook for the Field Assessment of Land Degradation. N. New York. Lavelle. W.. M. Manurung. E. John Wiley & Sons. S. T. L. Molenaar.. (1991) ‘Formal data structures.orst. Cambridge University Press. J. Indonesia. P. K. J. The Netherlands. J. Ruthenberg. M.. Zandstra. (1998) An introduction to the Theory of Spatial Object Modelling for GIS. soil biodiversity and ecosystem function’. Thesis. D escripción y clasificación de uso de suelo en puntos de muestreo 337 . B. in M. Barois. D. y Williams. Karanja. (1975) Land Use in Advancing Agriculture. y Collinsons..weeds. Akiefnawati. Barrios. P. S. Ph. 3–16. and Murnaghan. F.

.

Sabah. Departamento de Fitopatología. Departamento de Fitopatología. World Agroforestry Centre (ICRAF).hu. R. S. Brazil. Barross str. Nairobi. Universidade de Brasilia (UNB). P. Departamento de Zoología. Universiti Malaysia Sabah. csuzdi-alef@nhmus. 13.904-970. Kenya. d.904-979. Bangalore. E. Brazil.org. Huang. Universidade de Brasilia (UNB). Cx Postal 4457. Departament of Agricultural Microbiology. C. DF. Institute for Tropical Biology and Conservation.br. lmabreu@gmail.gov. Bignell. Manaus. GKVK Campus. D. CEP 69011-970. DF. dbagyaraj@vsnl. India. Instituto Nacional de Pesquisas da Amazõnia (National Institute for Amazonian Research-INPA).Colaboradores L. Csuzdi. Instituto de Ciências Biológicas. cares@unb. Malaysia. AM. Coe. beth@inpa. 339 . Hungary. Constantino. Universidade de Brasilia. Franklin. Gigiri. r. Brazil. Campus Universitario Darcy Ribeiro. Cx Postal 478. H-1088 Budapest.ac.bignell@qmul. (finado). Instituto de Química. E. J. D.com. Coordenação de pesquisas em Entomologia. E. constant@unb. CEP 70. DF.uk.com. M. Belo Horizonte MG. Bagyaraj. PO Box 30677-00100. Brazil. United Nation Avenue.coe@ criar.br. Systematic Zoology Research Group of Hungarian Academy of Sciences and Hungarian Natural History Museum. Brazil. Instituto de Ciencias Biológicas. Brasilia.br. Abreu. University of Agricultural Sciences. Universidade Federal de Minas Gerais. Cares. R. J. CEP 70910-900 Brasilia. 88999 Kota Kinabalu. CEP 70. Cx Postal 4457. Brasilia.

tondohj@ yahoo. ludwig@ufla. CEP 37200-000. Cx Postal 478. swiftmj2003@ yahoo.huising@cgiar. United Nations Avenue. van Noordwijk. fxsusilo@tlkom.com. 46. MG. Universidade Federal de Lavras. Raya Jakarta-Bogor Km. c/o ICRAF. Indonesia. J. Blumenau. H. Universidade Federal de Lavras.net. Lavras. J. Bogor. Cibinong. Departamento de Fitopatologia. Kenya.id. Departamento de Biología (Biology Department). W. X. Universidade Federal de Lavras. F. Jr. m. B.br. Bandar Lampung 35145. Rahmadi. J. Côte d’Ivoire. UFR des Sciences et de la Nature. Centre de Recherche en Ecologie. Zoology Division. Louzada. j. Susilo. Faculty of Agriculture. Tropical Soil Biology and Fertility Institute of CIAT.com. Brazil. Universidade Federal de Lavras. F. 69011-970. LIPI JI. Silva. PO Box 30677-00100 Nairobi.com. L. World Agroforestry Centre SE Asia.go. CEP 89010-971. Jalan Sumantri Brojonegoro nº 1. Indonesia. J. Universidade Federal doAmazonas. Cx Postal 1507. C.com. M. nmarques@ufam. 801. PO Box 30677-00100.. Pfenning. E. Department of Plant Protection.org. Côte d’Ivoire. Tropical Soil Biology and Fertillity (FSBF) Institute of CIAT. morais@inpa. fmoreira@ufla. CEP. Lavras . Brazil. SC. CEP 37200-000. M. Karyanto. Universidade Regional de Blumenau.gov. Cx Postal 3037. Brazil.br. Cx Postal 3037. L. Lavras. Abidjan. United Nations Avenue. A. M.br. Abidjan 02. Universitas Lampung.edu. Skonate2@yahoo. Tondoh. Cx Postal 3037. AM. S. Nairobi. Gigiri.br. Université d’Abobo-Adjamé. S. Huising. 02 BP 801. C. c/o ICRAF. CEP 37200-000. CEP 37200-000 Lavras MG. University of Lampung. Instituto Nacional de Pesquisas da Amazônia (Nationale Institute for Amazonian Research-INPA). Departamento de Ciência do Solo (Soil Science Department). CEP 69070-000 Manaus. Jalan Suantri Brojonegoro nº1. Indonesia.rahmadi@lipi. cahyo.com. Brazil. Morais.br. Université d’Abobo-Adjamé. sturmer@furb. Faculty of Agriculture. N. Brazil. Konaté.van-noordwijk@cgiar. Bandar Lampung 35145.E.fr. J. Coordenação de Pesquisas en Entomnologia. 16001 Indonesia. MG. Departamento de Ciências Naturais. S. N.P. Faculdade de Ciências Agrárias. Brazil. Kenya. RC Biology. M. jlouzada@gmail. asgknila@yahoo. AM Brazil. Swift.br. Manaus. A. Cx Postal 3037. Gigiri. Moino. PO Box 161. 340 Manual de biología de suelos tropicales . Stürmer. Moreira. Departamento de Entomología. alcmoino@ufla.

zanetti@ufla. Lavras. Zanetti. Cx Postal 37. Brazil. MG.br. CEP 37200-000. Universidade Federal de Lavras. Departamento de Entomologia (Enthomology Department).R. C olaboradores 341 .

.

164. 288. 280 África 141–142 agroecosistemas 43. 99. 217. 246 agroquímicos 313.85 ácido láctico 156 aditivos 279. Véase análisis de correspondencia ácaros oribátidos 150 ácaros 149-159 acceso a puntos de muestreo 84. 194-197. 191. 177-214. 243. de uso de suelo 302 B bacteria 39. 93. 302-329 atributos de tamaño de unidades de muestreo campo o parcela 304-307 cuadrícula 81-82 atributos técnico. 40. 251-252 bienes y servicios.314. 263 análisis de conglomerados (cluster) 267 análisis de correspondencia (AC) 266 análisis de varianza (ANOVA) 265 análisis filogenéticos198. Véase atributos atributos técnicos específicos. 126.127. 290 bacterias fijadoras de nitrógeno (BFNFNL) 177-213 Basidiomycota 248. 132 mesofauna 159. 290-294 alimentación especializada o incidental 111 almacenamiento de las muestras 78. 334 aislamiento 190. 132 343 .160 nematodos 171-172 AC. 247–248 arado 311. 252-153 Asia 140–141 atributos 297. 334 Ascomycota 248. 151. 291 análisis automatizado del espaciador intergénico ribosomal (ARISA) 261. Véase servicios ecosistémicos biomasa 127.Índice analítico A abundancia macrofauna 98.

319-320. 302. 316 cultivos puros 198 cultivos secundarios 307 cultivos trampa 231-232 curvas de acumulación de especies 113. uso de suelo 81 categorías tróficas 110-112. Véase disturbio datos requeridos y análisis 49-50. 188. 37-38. 265 curvas de rarefacción 265 Cylindrocladium spp. 251 ciclo de nutrientes 34 clasificación de uso de suelo 332. 303 DGGE. Véase colonizadores cálculo. jerarquía 323 clasificadores 297. 125-132. 129. 302-304 densidad. 171-172 cercas vivas y otros elementos de vegetación 319-321. conservación y manejo sostenible de la biodiversidad del suelo 344 Manual de biología de suelos tropicales cuadrícula estratificada 84-85 cultivo post inundación 308 cultivos de sotobosque 308 cultivos migratorios 309. 301. 302. 101. 158-160. 313-315 determinación a priori 65. 300. 325-329 caracterización cultural 189. 226-232 hongos 244. 304307. 265-267 macrofauna 98-100. cultivo 305-307 depredadores 37. 254-255 D D. 298. 307 características del cultivo 301. 245. 58. 243. 325-329 conjunto mínimo de datos 129-132 contaminación 78 control microbiano 287 cosecha 311. 58 . cultivo 305. Véase PCR competitivo CSM-BGBD. 190 caracterización de sitios 87-88 caracterización genética 197 cartografía.biopesticidas 288 bioturbación 34 C C. 310. 149-162 colonización 219-224 colonizadores (c) 172-174 combinación de cultivos 308-311. 331-332 Chromista 247 Chytridiomycota 248. Véase taxonómica clasificación. Véase enumeración cobertura. 96. 164 descomposición 29-35. 97. 304-324. 197. Véase electroforesis en gel con gradiente de desnaturalización diapausa 289 disección 157 diseños multiescala 64 diversidad BFNFNL 178-182. 317 cPCR. 246 descriptores genéricos 194 desmonte de la tierra 311. 334335 clasificación de procesos 93. 102 clasificación. 265-267. 94. Véase Proyecto. 110 nematodos 171-172 uso de suelo 42-43. 325-329 colecciones de recursos genéticos 267 Collembola 123. 124. 194 HMA 219-222.

317 fertilizantes inorgánicos 315 fijación de nematodos 165-169 G glomerales 220 Glomeromycota 247 gradientes. 190. 85-86 escarabajos 100-113.6567. 229-231. Véase ensayo de reducción de acetileno escala 62 escalas espaciales de muestreo 42-50. 189. 36. 257 esporas de HMA 226-228 método de Berlese 152-154 método de extracción Winkler 92. 112125. 287. 191 enumeración 168. 70. 330-333 familia Acaulosporaceae 238 familia Archaeosporaceae 239 familia Gigasporaceae 240 familia Glomeraceae 236 familia Pacisporaceae 239 familia Paraglomeraceae 239 fase de pupa 284 fauna de la hojarasca 37. 113. 115-117. 128 fertilizantes 314-316. 116-125. 152-155 enfermedad 35. 315. 98 estándares para BFNFNL descripción de especies 194-196 estatus de los cultivos 318 estratificación en el muestreo 55-57. 110-111. muestreo 80-81 gremios 114-115 grupos funcionales 29-41. 114-118. 128 especies epigeas 78. 132 nematodos 165-166 extracciones núcleo por núcleo 154 F factor tiempo de cultivo 309. 193 equidad 266 ERA. 71 etiqueta 97. 163-165 grupos funcionales de la biota del suelo 38-41 H herbívoros 37 hidróxido de potasio (KOH) 156 hipótesis de CSM-BGBD 57 Í ndice analítico 345 . 312. 322-323. 99. 226-228. 94-100 esquemas de puntos de muestreo 72-75 estacionalidad 88. 319 enfoque sesgado 65 enfoques transversales 57 ensamble de especies 110 ensayo de reducción de acetileno (ERA) 185. 128 especies trampa 185-186 esporas 88. 140 especies anécicas 100.E eficiencia en la labranza 312-314 electroforesis en gel con gradiente de desnaturalización (DGGE) 259-260. 283 extracción DNA 197. 263 embudo de extracción 149. 104. 128 especies clave 129 especies endógenas 99. 218. 162. 288 esquemas de muestreo alternativos 5789. 317. 130.99-100. 192 .

Véase Sistema de clasificación de cobertura de suelo límites. 259-260. 87-88. 229-230 hongos 255-256 lombrices de tierra 98-100 macrofauna 105-110.93–100. 187. 41 HMA 217–241 patógenos de plantas y saprofitos 41. 166-168 organismos entomopatógenos 290. 91. 140-144 mesofauna 156-159 moscas de la fruta 284-285 nematodos 163-165. 100-113. 263-264 índice fitoparasítico (IFP) 172-174 índice de madurez (IM) 172. 193 insectos 287-294 intensidad de uso de suelo agrícola 42. 317 J jarras de Leonard 186. 301. 243-280 hongos fitopatógenos 41 hongos micorrizógenos 217-241 hongos micorrizógenos arbusculares (HMA) 41. 313. 302-304 manejo de la biota del suelo 47-49 muestreo 79-80 replicación y tamaño de muestra 60–65 I identificación grupos funcionales en macrofauna 112-113 HMA 226-228. 304. Véase hongos micorrizógenos arbusculares hongos entomopatógenos 287-294 esquema de medición por puntos 74 grupos funcionales 39.173 índice de riqueza de género 171 índice de Shannon–Wiener 266 infiltración de glicerina 168 ingenieros del ecosistema 34. 44. 243-280 hongos saprofitos 41. 217. 91-92. 297-336 investigaciones piloto 60 irrigación308. 243-280 hongos antagonistas 41 hongos del suelo. 114-118. 91. 100–113 . 305-306. 293. muestreo de 63. 310 limpieza de malezas 313-315 listas de especies 107-109 lombrices de tierra 40. 334 labranza mínima 312 LCCS.HMA. 140 hospederos promiscuos 178-185. 129 inoculación 47. Véase también taxonomía IM. 193 jerarquía clasificación 323 clasificación de uso de suelo 300-302. 185–187 huella molecular 196-198. Véase índice de madurez imágenes satelitales 67. 64. 46 datos requeridos 48-50 descripción y clasificación 299. 217-241 hormigas 40. 306 índice de diversidad de Shannon 171 346 Manual de biología de suelos tropicales L labranza 312. 37. 53. 330-336 inventarios 41-50. patógenos de plantas 41.

260. 197. 67-68 muestreo sistemático 67-68 N nematodos 163–176. 261. 193 muestras control 193. 39.84–85 nematodos 165 punto de muestreo 62-63 muestreo aleatorio 55–56 muestreo en cuadrícula clasificación de uso de suelo 304 CSM-BGBD 79–80. 114-118. 48-49 monolitos 94–100. 131 monolitos complementarios para lombrices de tierra 97 moscas de la fruta 281-286 muestras compuestas 61–65. 290 método de filtración de partículas 252– 254. 334 media poblacional 25 medidas de conservación 318 “medio 79” 214 medio “S” 293 medio selectivo. 131 número de muestras 81–83 esquema de puntos de muestreo 72–75 muestreo estratificado 67. para hongos 252-255 mesofauna 39. 73. 130 métodos de extrapolación 105 métodos de montaje 157–158. 58 mecanismos de control 313-315 mecanización 311. 91-148 manejo 311-319. 97 muestreo no aleatorio 67 muestreo secuencial 64 muestreo simple aleatorio (MSA) 55. 73 microhabitat 47. 214 muestreo dentro de una parcela 65 muestreo animales 39 BFNFNL185–189. 287–295 nematodos bacteriófagos 164 nematodos omnívoros 164 Í ndice analítico 347 .M macrofauna 39.256–259.149-160 método de Berlese 149-160 método de Berlese modificado 154-155 método de centrifugación en azúcar 166 método de de extracción 190. 249. 40. 75-77. 118.118125. 321-330 materia orgánica 29-35 materia orgánica del suelo (MSO) 34. 56. 263-264 método de la cuadrícula de intersección 227-228 método de partículas de suelo251–253 método de reacción en cadena de la polimerasa (PCR) 196.114–118.84–85 paisajes 61-63 aleatorio y sistemático 67-68 muestreo en transectos monolitos para lombrices de tierra 97 macrofauna 75. 193–195 clasificación de usos de suelo 297-336 diseño y estrategias 53-90 hongos 249 inventarios de biodiversidad 42-47 macrofauna 91-148 mesofauna 149-162 moscas de la fruta 282-285 muestreo adaptativo 64. 126. 82–83. 40. 263 método de Seinhorst 168 método de Seinhorst modificado 169 método Winkler 92. 40. 73. 98-100. 54. 229–230 métodos TSBF 93–94 microfauna 37-38.

79–89. 83–84. 317. Véase Método de reacción en cadena de la polimerasa permanencia de la vegetación 330–332 persistencia (p) 172. Véase persistencia paisajes 44–47. 85–86. 330 PCR competitivo (cPCR) 262 PCR cuantitativo 261-262 PCR. 319 plantaciones 322–324 348 Manual de biología de suelos tropicales plantaciones de teca 328 plantas hospederas 178–182. 132 Pythium spp.nematodos parásitos de plantas 164 nematos micofagos 164 nicho. muestreo 81. 191 nivel de nicho 47. 249–255 proceso de aclarado 156-157 procesos de degradación 44 procesos de rehabilitación 44 productores primarios 37 programa Africover 299 propágulos infectivos 219-224 protozoa 247 proyecto.218. 7980. 49 nitrogenasa 184. 314 Phytophthora spp. separación de 85-86 puntos. subparcela o microhabitat 47.185–198. 250 plagas 35. 126. 38. 315. 165. 325. 102 nivel de parche 46–47. 41 procedimientos basados en cultura 333–245. 49 nivel neotropical 142.140–144 nomenclatura 106. 48. muestreo 60-62 polimorfismo de conformación de cadena única (SSCP) 261. 263 polimorfismo de longitud de fragmentos de restricción (RFLP) 260 polimorfismo de longitud de fragmentos de restricción terminal (T-RFLP) 260. 78. 244. 126 número más probable (NMP) 218. 298 prueba de hipótesis 55–57. 250 . Conservación y manejo sostenible de la biodiversidad del suelo (CSMBGBD) 45–47. 81. 145. 219 población. 219224 O observación directa 302 observaciones secundarias 303 Oomycota 250 organismos entomopatógenos 287–295 organismos mutualistas 39 P p. 184–186. 64-65. 174 pesticidas 286. 57. 63 prueba piloto 60 pseudo-replicas 62 puntos de medición 53 puntos de muestreo 74 puntos de muestreo. 48-49.61-62 parcelas de muestreo y clasificación de uso de suelo 46–47. 49. 307–311. 329 preparación de la tierra 311-312 primers específicos para “hongos” 257258 principales grupos funcionales 35-38. 263 prácticas culturales 301.147–148 nivel regional 44. 328. 300–336 patógenos fúngicos de plántulas 255 perturbación (P) 56.

145. 147 termitas que se alimentan de madera 111 termitas que se alimentan del suelo 110 TGGE. 103105. 36-41 técnica de infección de plantas 178. 130-132. cultivos 310-311 roundup 314 T tasas de aplicación 303. 284 neotropical 145 Véase también identificación visión general 29. 227 tipos de anidación 112-113 trampa de especies múltiples 185. 263 tinción de raíces 224–226. 149 trampa 118-125. 79 solución de nutrientes Jensen’s 215 solución Nesbitt 158 SSCP.124. Véase electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) 259–260. 325. 256–265 termitas 40. 155158 técnicas específicas de DNA 197. 251 Ricinius communis 254–255 riqueza de especies 265–267. 103. 304–319. medición del estatus de los cultivos 318-319 resguardo de especímenes 192-193. 297–299 rizosfera 249 rotación.R reactivo de Melzer 230-231 reglas de decisión para la clasificación de usos del suelo 323 rendimiento. 300–302. 188189 técnicas de cebo 119. 41. 149 trampa White 293 Í ndice analítico S secuencia de cultivos 107 secuenciación 16S rDNA 196 selección subjetiva 67 servicios ecosistémicos 29–36. 91.249–252. 100–113. 263 técnicas de preservación 267 técnicas de preservación 93-94. 30–33. 82.279–280 técnicas de lavado para partículas del suelo 252. 334. 229-230 macrofauna 105 mesofauna 158-159 moscas de la fruta 281. 123. 314–316. Véase Polimorfismo de conformación de cadena única sustancias químicas 156-158 349 . 163 sistema de clasificación de cobertura de suelo (LCCS) 299 sistemas de barbecho 309–310. 126. 329 sitios de muestreo 60-63. 317 taxonomía BFNFNL 177–182 HMA 219-222. 328. 124. 140. 253-255. 130-132. 285 respuestas multivariadas de interés 63-64 RFLP ver polimorfismo de longitud de fragmentos de restricción rhizobia 177-183 Rhizoctonia spp. 93-95.267 técnicas de procesamiento de muestras 78.187 trampas McPhail 282 BFNFNL 190 pitfall 118-125. 335–336 sistemas de cultivo 42.

331–333 ventanas para muestreo 60. 70–72. 300. 83. 159-160 transformadores procariotas 38 T-RFLP. 58 hongos 243 inventarios 87-88 muestreo 65-67. 87 variabilidad intragrupo 51 vegetación leñosa 319. 298.trampas sin cebo 118 transecto de entrenamiento 102 transformación de datos 126. 64. 48 W WOCAT World Overview of Conservation Approaches and Technologies 318 Z Zygomycota 248 350 Manual de biología de suelos tropicales . efectos de mitigación 301. 320–322 vegetación semi-permanente 331 vegetación. 83-84 Véase también intensidad de uso de suelo área de uso de suelo 46. Véase polimorfismo de longitud de fragmentos de restricción terminal trituradores 260 V valores cp 171-174 variabilidad 70-72 variabilidad de datos 44.7981. 132 U uso de suelo a priori definición de clases descriptivas 65. 61–62. 303 BFNFNL 186 cartografía 81 definición de clases 321–324 descripción y clasificación 297–336 diversidad 42.

proagraf. Badillo. 91190. de C. Av. P. Col. México.000 ejemplares . Xalapa. Moreira.mx Se tiraron 1. Muestreo y caracterización de la biodiversidad bajo suelo . Bignell se terminó de imprimir durante el mes de mayo de 2012 en los talleres gráficos PROAGRAF.V. S. Jeroen Huising y David E. E. 20 de Noviembre No 649.Manual de biología de suelos tropicales. C. Tel/FAX (228) 890 6204/815 1876 www. S.com.A. Veracruz. editado por Fátima M.

Sign up to vote on this title
UsefulNot useful