Manual de biología
de suelos tropicales

Esta publicación presenta parte de los resultados del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity”, implementado en siete países tropicales: México, Brasil, Costa de Marfil, Kenia, Uganda, India e Indonesia. El proyecto es coordinado por el Tropical Soil Biology and Fertility Institute del CIAT (TSBF-CIAT) con co-financiamiento del Global Environment Facility (GEF), y con apoyo para su implementación del Programa de Naciones Unidas para el Medio Ambiente (PNUMA-UNEP). Las opiniones expresadas en esta publicación pertenecen a los autores del libro y no necesariamente concuerdan con las de PNUMA-UNEP o GEF. La traducción y publicación de este libro en español fue posible gracias al apoyo financiero del Proyecto Internacional “Conservation and Sustainable Management of Below-Ground Biodiversity” y al Instituto Nacional de Ecología (INE). También queremos agradecer todas las facilidades proporcionadas por Tiberious Brian Etyang del Tropical Soil Biology and Fertility Research Area of CIAT (TSBFCIAT) Nairobi, Kenia, a Teotonio Soares de Carvalho de la Universidade Federal de Lavras, Brazil, al Dr. José Antonio García Pérez por sus valiosos consejos y sugerencias, y a Caridad González Lerma por cuidar los últimos detalles.

Manual de biología de suelos tropicales
Muestreo y caracterización de la biodiversidad bajo suelo
Fátima M. S. Moreira, E. Jeroen Huising y David E. Bignell (editores )

Secretaría de Medio Ambiente y Recursos Naturales (S emarnat) Instituto Nacional de Ecología (INE)

Título original de la obra: A Handbook of Tropical Soil Biology Sampling and Characterization of Below-Ground Biodiversity © Earthscan en el Reino Unido y Estados Unidos en 2008 Hardcover ISBN: 978-1-84407-621-5 Paperback ISBN: 978-1-84407-593-5

Revisión de capítulos por especialistas en el tema: Dra. Isabelle Barois Boullard, Instituto de Ecología, A.C. Dra. Simoneta Negrete Yankelevich, Instituto de Ecología, A.C. Dra. Rocío Vega Frutis , Instituto de Ecología, A.C. M.C. José Antonio Gómez Anaya , Instituto de Ecología, A.C. M.C. Francisco Franco Navarro, Colegio de Posgraduados Dra. Esperanza Martínez-Romero, Centro de Ciencias Genómicas, UNAM Dra. Lucia Varela Fregoso, Hongos y Derivados, S.A. de C.V. Dr. Juan Rull Gabayet, Instituto de Ecología A.C. Dra. Dora Trejo Aguilar, Universidad Veracruzana

Primera edición: 2012
D.R. © Instituto Nacional de Ecología

Periférico Sur 5000. Col. Insurgentes Cuicuilco, Deleg. Coyoacán, 04530, México, D.F. www.ine.gob.mx

Coordinación General de la Publicación en Español: Isabelle Barois Boullard Coordinación editorial y formación: Raúl Marcó del Pont Lalli Corrección de estilo: Adriana Victoria Arcos Méndez Revisión y preparación de originales: Martín De Los Santos Bailón Colaboradora en la traducción al español: Judy Shirley Adaptación del texto: Mariluz Pérez Lorenzo Diseño portada: Álvaro Figueroa Foto de la portada: Claudio Contreras Edición para internet: Susana Escobar Maravillas Forma sugerida de citar el libro: Moreira, F., E. J. Huising y D. E. Bignell. 2012. Manual de biología de suelos tropicales. Muestreo y caracterización de la biodiversidad bajo suelo. Instituto Nacional de Ecología, México, 337 pp., México.
Ninguna parte de esta publicación, incluyendo el diseño de la portada, puede ser reproducida, traducida, almacenada o transmitida de forma alguna ni por ningún medio, ya sea electrónico, químico, mecánico, óptico, de grabación o de fotocopia sin permiso previo de los editores. Pequeños párrafos, tablas o figuras, pueden reproducirse dentro de lo estipulado en la Ley Federal de Derecho de Autor y el Convenio de Berna, o previa autorización por escrito de la editorial. ISBN: 978-607-7908-31-9 Impreso y hecho en México

Índice

1 2 3 4

Listado de tablas Listado de figuras Prólogo a la edición en español Prólogo Prefacio Lista de acrónimos y abreviaturas El inventario de la biodiversidad biológica del suelo: conceptos y guía general Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo Macrofauna Collembola, acari y otra mesofauna del suelo: el método Berlese

9 10 13 17 21 25 29 53 91 149

5 6 7 8 9 Nematodos del suelo Bacterias formadoras de nódulos en leguminosas Hongos micorrizógenos arbusculares (HMA) Hongos del suelo saprófitos y patógenos de plantas Muestreo. preservación e identificación de moscas de la fruta 163 177 217 243 281 287 10 Hongos y nematodos entomopatógenos 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo Colaboradores Índice analítico 297 339 343 .

6b 11.1 5.6a 11.1 7. labranza y deshierbe Clasificadores y atributos para el manejo de plagas y enfermedades.4 11.7 11.1 8.2 4.9 11.11 Número de especies descritas en las principales categorías taxonómicas de plantas.2 5.2 1. a través de una gradiente de perturbación de la selva.1 3.1 3. Género.1 1. unidades de referencia.1 11. en la provincia de Jambi del centro de Sumatra Composición química para aclarar y montar especímenes Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina Familias y valores cp utilizados para el índice de madurez Familias y valores cp utilizados para el índice fitoparasítico Filum/Orden.5 11.Listado de tablas 1. procesos asociados de cambio y componentes relevantes de la biodiversidad Grupos de organismos del suelo colectados utilizando diferentes métodos de captura Ejemplo de lista de especies Densidad numérica (individuos m-2) de termitas en siete localidades. amplificados del DNA total Clasificadores y atributos técnicos para el cultivo principal Tamaño del campo y características de la cobertura del cultivo Atributos de cultivos combiandos Características del suministro de agua Factor tiempo de cultivo Clasificadores y atributos relacionados con la limpieza de la parcela.10 11. fertilizantes y cosecha Características de la parcela y distribución del uso de suelo Características de los árboles en la finca (TROF) Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca Ejemplo de clasificadores y valores de atributos para parcelas de maíz 26 33 44 72 103 122 154 167 168 169 174 210 253 295 297 298 298 299 303 307 310 312 315 318 319 .2 11.1 5.8 11.3 6.1 11. Especie de bacterias formadoras de nódulos en leguminosas Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes. biota del suelo y principales grupos funcionales a los que pertenecen Principales grupos funcionales de la biota del suelo Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo.3 2. Familia.3 11.

35 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula.3 2. con puntos de muestreo adicionales. esto aumentará la precisión de la estimación de la pendiente. d) reconociendo los límites como otra categoría.1 2. 116 Sacabocados de metal. dispuestas a lo largo del gradiente. 70 Esquema alternativo para muestrear macrofauna.5 3. 94 Extracción de termitas de una muestra de suelo en una charola de aluminio.2 2. 81 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). hormigas. clasificados de acuerdo con dominios y reinos. b) si se incluyen de manera deliberada valores de MOS más extremos.6 3.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. b) ilustración de la división de una cuadrícula entre seis. El muestreo se puede ampliar si se usa uno o dos transectos para termitas.2 2. dando un estimado pobre de la pendiente. 71 Ejemplos de diferentes configuraciones de ventanas de muestreo. c) incrementando la replicación. 148 .3 3. 59 Esquema de muestreo por puntos para toda la biota. arañas y otros artrópodos.1 3.6 3. 93 Separación a mano de lombrices de tierra en charolas de plástico. según se requiera. mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra. utilizando una pequeña cuchara o cuchillo de campo.4 3.1 1. 32 Principales grupos funcionales. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. b) tres cuadrículas que muestrean tres diferentes parches de selva. utilizando permutaciones de datos al azar. hecha con un vaso. 115 Trampa pitfall improvisada. tres y dos ventanas.5 2.7 4. a) cuadrícula completa.4 2. 91 Esquema de alineación de monolitos complementarios de lombrices de tierra. para muestrear la mesofauna en la hojarasca y en el suelo mineral. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. b) se utilizan guantes como precaución contra enredaderas. 109 Esquema de una trampa pitfall con cebo. 77 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. 54 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo.Listado de figuras 1. estudiados en el proyecto CSM-BGBD. por estratificación. hormigas y escarabajos.2 3. tamaños y procesos de ecosistemas relacionados. utilizando un transecto de 50 m. cuatro palitos pequeños y una cubierta de celofán. 99 Ejemplo de curva de acumulación de especies con una desviación estándar. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado.

bajo condiciones de congelación. 152 5. hecho de aluminio. 187 6.5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos. y a la derecha.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. 151 4.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) disolución seriada de la suspensión acuosa que contiene al hongo. 149 4.1 Evaluación de bacterias formadoras de nódulos en leguminosas.2 Cultivos purificados de Beauveria bassiana. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. 216 10. b) sistema Berlese– Tullgren en operación. Las cajas Petri no deben contener más de una tercera parte de líquido.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas. 189 7.2 a) contenedor de apoyo para embudos Berlese–Tullgren. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. 282 10. 166 5. juego de tamices de metal (de malla de 45 arriba y de 400 abajo).4. de 50cm de altura. b) inoculación de la suspensión (alícuota de 0.3 a) Nematodos recuperados mediante el lavado de malla de 400.4 Embudo Berlese modificado.7 Charola con montajes permanentes de especímenes de nematodos. 166 6. 282 10. 284 .3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). 165 5. c) larvas que muestran la patología típica de infección por nematodos. d) almacenaje de conidios en tubos Eppendorf. c) incubación bajo condiciones controladas en una cámara DBO. creciendo en medio ADP.3 Producción de acetileno en campo o laboratorio. 184 6. 163 5.3 Embudos Berlese llenos de suelo y hojarasca. fijadoras de nitrógeno en diversos sistemas de uso de suelo. 180 6.5 Equipo básico requerido para extracciones núcleo por núcleo Berlese-Tullgren.1 A la izquierda.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos 165 5. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa. suspensión de suelo en reposo. resumida en seis pasos. b) muerte de nematodos en agua caliente. 162 5.1 ml) en una caja Petri con medio de cultivo. 163 5.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. con embudo superior de 40 cm de diámetro. 151 4. d) emergencia de juveniles infectivos en la trampa White.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos.

11. y presencia o ausencia del componente arbóreo. 322 324 325 .2. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos.11.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural.3 Clasificación del uso del suelo en términos de la intensidad de uso. 11.

la elaboración de la estructura del suelo y el mantenimiento del régimen hídrico la desarrollan los ingenieros del ecosistema. Como lo afirmó el Dr. es la que menos se conoce. termitas. que pueden incorporar y asimilar estos conocimientos en beneficio de la biodiversidad del suelo. hongos y protozoarios y los reguladores biológicos como los ácaros. la captura de carbono y la reducción de emisiones de gases traza (CO2. El conocimiento de esta biodiversidad se ha dejado de lado durante mucho tiempo por la dificultad para abordarla. escarabajos y pequeños mamíferos. en términos generales. Cabe mencionar que un tipo de organismo puede participar en varios grupos funcionales. la sostenibilidad y el desarrollo de sus comunidades rurales. CH4) son realizados principalmente por el grupo funcional de los ingenieros químicos del ecosistema. José Sarukhán. las bacterias. hormigas. Por otra parte. colémbolos y nematodos.Prólogo a la edición en español Este prólogo es el segundo elaborado para esta misma obra y se presenta para su versión en español. por la importancia que reviste su divulgación en un idioma que puede ser leído por un amplio grupo de países de América Latina. el ciclaje de nutrientes. “¡Se sabe más de las estrellas que de los organismos del suelo!”. fundador de la Comisión Nacional para el Conocimiento y Uso de la Biodiversidad de México. la regulación de la dinámica de la materia orgánica del suelo. la fijación de nitrógeno. es decir. N2O. 13 . La biodiversidad del suelo alberga más del 25 % de la que existe en todo el planeta y. que son las lombrices de tierra. pero ahora sabemos que interviene y participa ampliamente en los servicios ambientales que brinda el suelo: por una parte.

De manera global. así como preservar y restaurar la fertilidad natural de los suelos. más aun. con repercusiones a nivel global. pero su impacto y repercusiones sobre los procesos de funcionamiento. generan y provocan el avance de la frontera agrícola y la intensificación productiva. esta biodiversidad le da estabilidad al paisaje. reduciendo la materia orgánica contenida y alterando gravemente sus redes biológicas y funcionales. el equilibrio y la funcionalidad de los suelos modificados por las prácticas agrícolas. Mientras leemos estas líneas. Y aunque es difícil cuantificar el valor económico de estos servicios. combinada con las necesidades alimenticias de una población humana en continuo crecimiento. son fundamentales. Ante este panorama. La pérdida de la fertilidad. sobre el verdadero impacto que están teniendo las prácticas de manejo. entendidas ahora bajo el concepto de calentamiento global. lo que visto desde el punto de vista antropogénico. que se estiman en miles de millones de euros anuales. fibra y combustible. particularmente en los ecosistemas tropicales. que han sido desarrolladas y probadas en siete países y tres continentes. Y si bien se ha avanzado mucho al respecto. se requieren muchos años más de investigación taxonómica y funcional para comprender y manejar los procesos edáficos. que se encuentran entre los más afectados por la deforestación y el 14 Manual de biología de suelos tropicales . son grandes pero se desconocen en buena medida los mecanismos y procesos que se afectan. actualizada y rápida. Este manual reúne técnicas de muestreo en campo. En este sentido. se reconoce la necesidad de estimular la formación de profesionales en taxonomía y sistemática de la biodiversidad del suelo. su biodiversidad. las técnicas de muestreo y estudio de la materia orgánica y los organismos del suelo que permitan obtener información veraz. pues permitirán diseñar y establecer estrategias para mantener la sustentabilidad. pesticidas y técnicas mecánicas de cultivo modifican fuertemente las condiciones originales del suelo. las condiciones de la biota del suelo continúan alterándose aceleradamente en todo el mundo debido a las actividades humanas. Durante años los estudios del suelo fueron enfocados al conocimiento de la física y química del suelo. y se dejó de lado el estudio de la biología del suelo y. permite el control de plagas y fomenta la producción de las plantas y de los animales. el uso de fertilizantes. particularmente en las regiones tropicales. tanto del punto de vista morfométrico como molecular para lograrlo. conocer y aprender a manejar dicha biodiversidad resulta fundamental para conservar o restaurar la fertilidad del suelo. conservación y equilibrio del ecosistema. contribuye a nuestro alimento. silvícolas y ganaderas en el mundo.

Esto es así porque. Cabe mencionar que la mayoría de los autores que colaboraron para desarrollar este manual residen justamente en países tropicales. Fondo para el medio ambiente. La información contenida en este manual es útil para investigadores. profesores y profesionales involucrados en el manejo productivo de los suelos y también en su conservación. inglés. estudiantes. permitiendo llevar a cabo evaluaciones sobre la diversidad y salud del ecosistema que sirvan como base para el diseño de prácticas de manejo sustentables. Su elaboración tiene como finalidad no sólo ser una herramienta de utilidad en el trabajo técnico. Las técnicas y métodos de muestreo presentados en este manual no constituyen sólo una recopilación de los procedimientos originales ya conocidos. en México. mejorados y actualizados durante el desarrollo del proyecto Conservación y manejo sostenible de la biodiversidad debajo del suelo (CMS.BGBD. mientras que al final se encuentra un capítulo integrador que permite relacionar los inventarios de los organismos del suelo con una clasificación del uso de suelo para estimar el impacto del manejo del suelo sobre su biodiversidad. Al inicio del manual se incluyen dos capítulos que ofrecen una guía para establecer un método de muestreo representativo que permita evaluar y comparar la biodiversidad del suelo en diferentes sitios. ahora este manual se encuentra disponible en tres idiomas. incluso en plantaciones agrícolas con manejo de bajo insumos. pues en este caso fueron probados. La información de este manual se ha organizado de acuerdo con la funcionalidad de los grupos del suelo. las consecuencias de un mal manejo de suelos pueden provocar consecuencias dramáticas. sino constituir un apoyo en el camino hacia la sustentabilidad y la relación armónica entre el hombre y la naturaleza.cambio en el uso del suelo. lo que demuestra la mayor presencia y formación de especialistas nacionales preocupados por sus recursos naturales. De manera especial queremos P rólogo a la edición en español 15 . Agradecemos a todos los especialistas que revisaron la traducción de los textos que correspondían a su especialidad y competencia. implementado por el PNUMA y ejecutado por el TSBF a nivel internacional y por el Instituto de Ecología A. financiado por el GEF. por sus siglas en inglés) . portugués y español. Con esta versión en español.C. para que su alcance e impacto sea más amplio. Estas técnicas de muestreo básicas han demostrado ser poderosas herramientas para llevar a cabo investigación básica y aplicada. generando información útil no sólo para investigadores o especialistas sino para toda persona interesada en el estudio de la conservación y la productividad del suelo.

y en particular a Raúl Marcó del Pont y su equipo. por su trabajo editorial y su paciencia ejemplar. Isabelle Barois Boullard Coordinadora de la traducción y del proyecto CSM-BGBD en México 16 Manual de biología de suelos tropicales .agradecer al Instituto Nacional de Ecología.

sólo en tiempos recientes se ha planteado que los suelos contienen un componente biológicamente activo. surge la gran necesidad de aplicar los conocimientos referentes al papel que desempeña la biodiversidad bajo suelo para su sustentabilidad. los suelos en todo el mundo enfrentan una grave crisis. la mejor muestra –y la más actual– para poder evaluar la biodiversidad del suelo en ecosistemas que están siendo rápidamente alterados como consecuencia de los cambios en el uso del suelo. celebrada en el año 2006.Prólogo Durante mucho tiempo la sociedad ha reconocido su dependencia respecto del suelo. Este manual es. es el cambio de uso de suelo asociado a la intensificación agrícola. Esto. sin embargo. Sea como fuere. se enfatizó la importancia de la diversidad bajo suelo y se exhortó a abrir nuevas líneas de investigación multidisciplinaria. Dicha intensificación es necesaria para asegurar el suministro global de alimentos. Una línea de investigación surgida a partir de entonces es la de cómo evaluar y manejar diversidad bajo suelo en sistemas de agricultura que faciliten la productividad agrícola y sustentabilidad de suelo a largo plazo. Mediante la aprobación de la Iniciativa Internacional para la Conservación y el Uso Sustentable de la Biodiversidad del suelo en la Convención sobre Biodiversidad Biológica. tiene como consecuencia 17 . sin embargo. Ante esta situación. en la medida que esto ocurra. Un aspecto a destacar del cambio global en las regiones tropicales. la regulación biológica del suelo se verá afectada e incluso sustituida por fertilizantes y cultivos mecánicos. sin lugar a dudas. a su vez.

sino también en países de primer mundo. La biodiversidad tropical ha sido subestimada y es posible que las verdaderas densidades de especies sean mayores que en otras latitudes. Del mismo modo. desde los invertebrados más grandes hasta las bacterias. El propósito de este manual es proveer de métodos estándares internacionales para el inventario de comunidades bajo suelo y la caracterización del uso de suelo en el trópico húmedo. la provisión de nutrientes en las plantas y el control de patógenos en plantas como contribuciones específicas de los organismos del suelo a la fertilidad de éste. En última instancia. vitales para poder alcanzar la meta: productividad agrícola sustentable. asociada a la deforestación y al proceso de Intensificación agrícola en los márgenes de los bosques. así como la conservación de la biodiversidad en todo el mundo y no. Un metro cuadrado de bosque templado puede contener hasta mil especies de invertebrados y. La relación entre la diversidad de especies y la diversidad funcional de la biota del suelo sigue siendo incierta. la capacidad de retención de agua del mismo. estas herramientas pueden ser utilizadas para aprovechar los organismos del suelo en el manejo de los ecosistemas. El objeto explícito en este caso es práctico: proveer de una herramienta definitiva para establecer una línea de base y luego documentar la pérdida de biodiversidad de suelo. pero constituye uno de los principales objetos de investigación en todos los niveles. problema cuya solución implica un gran reto: ¿es posible. la reducción de las emisiones de gas invernadero. no solamente en regiones en vías de desarrollo. por lo que representa el resultado publicado de más de una década de intensa discusión y un amplio trabajo de campo por parte de un gran número de expertos investigadores de muchos países. un número mayor de diferentes tipos de microorganismos. las relaciones entre la biodiversidad del suelo y la ocurrencia y magnitud de los procesos ecológicos son inciertas. quizás.una reducción de la biodiversidad del suelo. únicamente. en bioprospección y para promover mejoras sustentables en la pro18 Manual de biología de suelos tropicales . manejar la biodiversidad del suelo para poder incrementar la productividad agrícola en regiones que están siendo degradadas? La respuesta a esta pregunta atañe a toda la humanidad porque la tierra está siendo degradada. desde luego. el mantenimiento de la estructura física del suelo. en los trópicos. cubre casi la totalidad de la gama de biodiversidad biológica. tanto en el laboratorio como en el campo. Dichos conocimientos son. además. Durante mucho tiempo los ecologistas han debatido sobre la importancia de la diversidad biótica del suelo: el secuestro de carbono en suelos. entonces.

ducción agrícola. Tal selección es inevitable cuando se trata del suelo. los métodos han sido desarrollados y monitoreados en condiciones de campo. sin embargo. Una de las más importantes es que la mayoría de los colaboradores pertenece a los países que se encuentran más afectados por la deforestación y el cambio en el uso de suelo. considerado importante o esencial en la función del suelo y. ofrece la ventaja de traer consigo los medios para poder hacer una evaluación aproximada de la salud del suelo. por lo tanto. tanto nacionales como extranjeros. si es que aún estamos a tiempo de parar la pérdida de la biodiversidad tropical. Durante los últimos cincuenta años se han publicado. en doce localidades como puntos de referencia. Finalmente. cada una con amplia identidad taxonómica. En segundo lugar. sino también para biólogos en general. En la medida de lo posible esto aplica a la identificación: las claves recomendadas son los más funcionales. especialistas en agricultura y empleados técnicos de todos los niveles. El proceso responde a una necesidad selectiva. distribuidos en siete países y tres continentes. el presente manual contiene notables diferencias respecto de los anteriores. los autores han incluido la revolución en metodología molecular que ha incursionado en las ciencias biológicas durante los últimos diez años. consecuentemente. manuales metodológicos de muestreo para organismos del suelo. representan a instituciones académicas y gubernamentales en las que se requiere poner en práctica nuevas políticas para el manejo del suelo que han de ser validadas. se aconseja referir los especímenes a especialistas. los métodos presentados en este manual contemplan también los ecosistemas terrestres en general. no obstante. Muchas de las técnicas asociadas con una evaluación de diversidad dentro de grupos específicos microbianos han surgido a partir de P rólogo 19 . porque la verdadera biodiversidad es tan amplia que queda fuera del marco de cualquier sistema científico para que se pueda documentar totalmente. por lo que algunos taxa han sido excluidos. son de interés no sólo para expertos en taxonomía. con cierta frecuencia. Otro aspecto notable de este manual es que la biota del suelo está agrupada en ocho categorías. Inevitablemente. esto implica la reconciliación de los intereses y preocupaciones de los agricultores pobres. a muchos servicios ambientales que los suelos proveen. no obstante. pero que también corresponde a un grupo funcional mayor. dentro del alcance de la población que se encuentra relacionada con su productividad. también donde es necesario. los objetivos nacionales de desarrollo y calidad de nuestro ambiente. especialmente en el caso de los pueblos más pobres del mundo.

discusiones entre colaboradores y durante talleres específicamente pensados para la publicación del presente manual. Diana H. Wall Natural Resource Ecology Laboratory Colorado State University Mayo de 2008 20 Manual de biología de suelos tropicales .

El proyecto se inició en 2002 con el objeto de generar información y conocimientos que puedan ser utilizados para un mejor manejo y conservación de la BGBD en espacios de agricultura tropical. que permitan la comparación de resultados de inventario en áreas específicas de países tropicales con validez científica y estadística. constituye una actualización de los métodos y protocolos que fueron inicialmente propuestos por investigadores afiliados al Instituto de Biología y Fertilidad del Suelo Tropical del CIAT. recibe apoyo para su financiamiento del Fondo Global del Medio Ambiente (GEF por sus siglas en inglés). institución que pertenece al Centro Internacional de Agricultura Tropical (CIAT). para mantener la productividad agrícola y reducir la extensión de la agricultura en paisajes naturales. del Programa de Naciones para el Medio Ambiente (PNUMA/UNEP). Brasil. y para su puesta en marcha.Prefacio Este manual es uno de los resultados del proyecto PNUMA/GEF “Conservación y Manejo Sostenible de Biodiversidad Bajo Suelo” (CSM-BGBD) que surge como respuesta a la necesidad de crear métodos estándares e instrucción práctica para el inventario de la biodiversidad bajo suelo. a la Red de Macrofauna financiada por la Unión Europea (EU). al NERC por el Reino Unido (UK). India e Indonesia. y. El manual describe métodos de muestreo y laboratorio para evaluar la biodiversidad de una gama de grupos funcionales básicos de biota de suelo. Kenia. sobre todo. al (TIGER). Costa de Marfil. Uganda. Este proyecto es ejecutado por el Instituto de Biología y Fertilidad del Suelo Tropical (TSBF). asimismo. al PNUD/ 21 . El proyecto se lleva a cabo en México.

HMA y Ectomycorrhiza. provee detalles adicionales en el caso de grupos funcionales específicos: como el uso de trampas Winkler para hormigas y trampas Pitfalls para escarabajos en muestras de hojarasca. hongos entomopatógenos. lombrices de tierra. Brasil. Hall. editado por G. dentro del alcance de laboratorios nacionales. S. 2003 (Sumberjaya. bacterias formadoras de nódulos en leguminosas (BFNFNL) y sus plantas hospederas. al igual que en varios talleres temáticos de taxonomía específica (técnicas moleculares con énfasis en T-RFLP. en términos de grupos funcionales. al igual que métodos que no han sido considerados en las publicaciones mencionadas. y en varios talleres llevados a cabo desde el inicio del proyecto. además. elaborado por Anderson e Ingram (1993). Los métodos que se describen en este manual reflejan una amplia gama de actividades del proyecto CSM-BGBD. en su caso. Los métodos fueron discutidos y posteriormente perfeccionados en reuniones anuales celebradas entre los años 2002 y 2005. en especial. en el de 2004 (Embu. diciembre 2004. Los métodos para algunos de los grupos funcionales de organismos de suelo fueron incluidos en un manual pionero. Londrina. Cali. Una 22 Manual de biología de suelos tropicales . Ésta fue la contribución. termitas y hormigas. editado por Swift y Bignell (2001). La definición de métodos estándares aprovecha la experiencia obtenida con la implementación de los métodos utilizados en los siete países participantes en el proyecto. Bangalore. Manaus. termitas.UNDP-GEF con el apoyo financiero destinado al Proyecto Alternativas de RozaTumba-Quema (ASB). agosto 2004. al programa DIVERSITAS. También cubre. febrero 2005. la gama completa -geográfica y biogeográfica. Kenia. por parte de la UNESCO. Los métodos para una evaluación de biodiversidad de suelo fueron descritos en el ASB (Nota de Lectura 6B). Indonesia) y. saprófitos y patógenos y una amplia gama de artrópodos mayores. Países Bajos). Un manual formal de técnicas para organismos de suelo y organismos que viven en agua dulce y sedimentos marinos fue publicado en 1996. Dado que muchas especies aún son desconocidas o no se han descrito. como es el caso de aquéllos que se refieren a la mesofauna. Nairobi. India 2005. tales como el registro de huellas genéticas del BFNFNL. en donde también se habla del principio de grupos funcionales del inventario de organismos de suelo. Brasil mayo/2004 y Nairobi. Kenia).dentro del trópico húmedo. Colombia. ampliamente. Los métodos estándares propuestos contienen avances tecnológicos recientes en genética molecular. una evaluación de la diversidad de especies resulta un proceso poco práctico. octubre 2003). cuya evolución se muestra en los reportes de 2002 (Wageningen. o la actualización de métodos para evaluar la diversidad de nematodos.

en contra de una productividad sustentable. estos cambios de uso de suelo. restablecer la BGBD no implica precisamente devolver los servicios del ecosistema. La hipótesis actual es que una intensificación en el uso de suelo trae consigo una reducción de la biodiversidad del suelo y a su vez. la erosión puede llegar a nulificar todos los demás procesos degenerativos. llega a influir sobre la abundancia y diversidad de dichos organismos. no necesariamente se lograría restaurar la BGBD. de manera que causará un impacto inmediato en la BGBD que fácilmente se antepondrá al efecto combinado de todos los factores mencionados. Quedan muchas interrogantes en cuanto al manejo de BGBD. así. tenga implicaciones en la BGBD. Es por esto que el control de la erosión y la rehabilitación de suelos fuertemente erosionados deberá considerarse parte de las estrategias para conservar y sustentar un buen manejo de la BGBD. interpretar esos procesos en el contexto ecológico. frecuentemente provocan una reducción de materia orgánica del suelo que forma el sustrato básico para la mayoría de los organismos que en él habitan y. Además. hay otros asociados con un incremento en la intensidad del uso de suelo. La mayoría de los organismos del suelo se encuentran en los primeros 20 centímetros de su perfil. por lo tanto. Al mismo tiempo. van acompañadas por reducciones drásticas en la diversidad de plantas. esto se traduce en una alteración del suelo como hábitat. la erosión del suelo significa la más catastrófica de las alteraciones. Para responder a algunas de las preguntas mencionadas se requiere: P refacio 23 . La conversión de uso de suelo y la intensificación de su uso. provoca una pérdida de servicios del ecosistema. Además de estos efectos. nivel de nutrientes y densidad). por lo tanto. Aun si se pudiera regresar a sus condiciones originales. generalmente. dejándolo como estaba antes de ser alterado.mejor opción sería investigar la pérdida de grupos funcionales básicos dentro de la BGBD que muestran un cambio en el uso de suelo o una intensidad del mismo. poco se sabe de las relaciones entre ambos factores o sobre los mecanismos por los cuales ocurren cambios en la BGBD. como consecuencia del labrado o del creciente uso directo de agroquímicos. que se espera. sin embargo. La premisa es que la diversificación agrícola (en varios niveles) genera biodiversidad en el suelo y que la producción agrícola sustentable (en los márgenes de la selva tropical) se mejora significativamente. Los efectos en BGBD son condiciones compuestas por el medio ambiente y por características físicas y químicas del suelo (por ejemplo: pH. así se podrían entender las consecuencias de una pérdida en el BGBD y.

E. Hall. Se espera que los métodos descritos en este manual sean útiles para el diseño y la ejecución de estudios para inventario y monitoreo de la BGBD en todos los niveles.• Una caracterización de la biodiversidad del suelo en un amplio rango de uso de suelo de varias intensidades. mediante la introducción y/o manejo de biota de suelo (se experimenta con varios manejos alternativos). 2nd edition. y observar cómo esta relación se modifica y se altera por las condiciones prevalecientes en el medio ambiente (incluyendo condiciones de suelo). Swift. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. S. E. www. e Ingram. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. J. M. • Identificar “puntos de entrada” para mejorar el manejo de la tierra. un conocimiento más amplio de prácticas existentes y un uso más efectivo de tecnologías disponibles que no requieran altos insumos. experimental o de muestreo) hasta un paisaje natural. M. Bogor. International Centre for Research in Agroforestry. ASB Lecture Note 6B. desde bosque natural hasta agricultura de monocultivo. I. S. South East Asian Regional Research Programme. CAB International. G. Wallingford. CAB International. D. caracterizada por un cultivo continuo y un elevado uso de químicos y mecanización.pdf. Fátima M. 24 Manual de biología de suelos tropicales . J. (ed) (1996) Methods for the Examination of Organismal Diversity in Soils and Sediments. desde una parcela (agrícola.fao. Jeroen Huising y David. Moreira. y Bignell. Bignell ReFERENCIAS Anderson. Indonesia. • Establecer una relación entre la biodiversidad de la superficie y bajo del suelo en los actuales y alternativos sistemas de uso de suelo. S. Wallingford. Estos “puntos de entrada” pueden incluir un mejor entendimiento del uso de prácticas indígenas.

Lista de acrónimos y abreviaturas AC ADP AFLP AHM AM ANOVA ARISA B BFNFNL cPCR CSM-BGBD BGBD DGGE ea EBI ERA FID FURB GEF Análisis de correspondencia Agar dextrosa y papa Polimorfismo en el tamaño de fragmentos amplificados Agar con harina de maíz Agar extracto de malta Análisis de varianza Análisis automatizado del espaciador intergénico ribosomal Bacteriófagos Bacterias fijadoras de nitrógeno. formadoras de nódulos en leguminosas Reacción en cadena de la polimerasa competitiva Conservación y Manejo Sustentable de Biodiversidad Bajo Suelo Biodiversidad Bajo Suelo Electroforesis en gel con gradiente de desnaturalización Equivalente de ácido European Bioinformatics Institute Ensayo de reducción de acetileno Detector de ionización de flama Universidade Regional de Blumenau Global Environment Facililty 25 .

GF HMA ia ICRAF IFP IM INPA ITS KOH LCCS M MAS MOS NCBI Nd NMP P Pc PCA PCR PFGE PNUMA PP RAPD Rep-PCR RFLP RIA SR SSCP TGGE TRF T-RFLP TROF TSBF-CIAT 26 Grupo funcional Hongos micorrizógenos arbusculares Ingrediente activo World Agroforestry Centre Índice fitoparasítico Índice de madurez National Institute for Amazonian Research (Instituto Nacional de Pesquisas da Amazônia) Espaciadores de trascripción interna Hidróxido de potasio Sistema de clasificación de cobertura de suelo Micófagos Muestreo aleatorio simple Materia orgánica del suelo National Center for Biotechnology Information Nivel de dilución Número más probable Perturbación Porcentaje de colonización Análisis de componentes principales Reacción en cadena de la polímerasa Electrofóresis en campos pulsados Programa de las Naciones Unidas para el Medio Ambiente Parásitos de plantas DNA polimórfico amplificado al azar De fragmentos repetidos palindrómicos-éxtragenicos Polimorfismo de longitud de fragmentos de restricción Resistencia intrínseca a los antibióticos Sensores remotos (imagen) Polimorfismo de conformación de cadena sencilla Electroforesis en gel con gradiente de temperatura Fragmentos de restricción terminal Polimorfismo terminal de la longitud del fragmento de la restricción Árboles en finca Tropical Soil Biology and Fertility Institute of the International- Manual de biología de suelos tropicales .

UC UFAM UFC UFLA UFMG UnB VA VB Center for Tropical Agriculture Unidad de colonización Universidad Federal de Amazonas Unidades formadoras de colonias Universidad Federal de Lavras Universidad Federal de Minas Gerais Universidad de Brasilia Volumen alto Volumen bajo A crónimos y abreviaturas 27 .

.

000 en el caso de procariontes. cuando se hace una evaluación biológica de la salud de los suelos (Lawton et al. Lavelle. con más de 1. La clasificación taxonómica de organismos vivos aún se encuentra en una situación polémica (Margulis y Schwartz.. 2004). 2004. Moreira et al. Bignell. la biota (relativa a agentes no bióticos y entre ellos mismos) será evaluada por su contribución relativa a los procesos del ecosistema (sensu Daily.. 1990) y muchos fila. contri29 . especialmente cuando se trata de los taxa a ser creados en altos niveles y los números de tales categorías altas (como reinos) a ser consideradas. David E. 2005. 1998. Moreira y E. 1996. 1997. cualquiera que sea el sistema de clasificación utilizado. Ya que no es ni práctico ni coherente tomar en cuenta todos los organismos presentes. 1997. Wall.Capítulo 1 El inventario de la biodiversidad biológica del suelo: conceptos y guía general Mike J..2004). Bardgett. 1998).5 millones de especies de eucariontes y con una riqueza de especies estimada muy por encima de 10.. 2006). 1998. la diversidad de la biota del suelo es elevada en todos los niveles de análisis (véase Swift et al. En la Tabla 1. Cavalier-Smith. 1979. Swift. Sin embargo..1 se enlistan los principales fila de organismos eucariontes y procariontes que son o pueden ser representativos en la comunidad del suelo. Jeroen Huising Organismos y servicios del ecosistema del suelo El suelo es un hábitat que alberga una amplia gama de organismos dentro de los tres dominios taxonómicos (sensu Woese et al. S. Fátima M.Estos procesos apoyan a los servicios del ecosistema. Brussaard et al. Wall.

000–40.000 Filum Cycadophyta (gimnospermas) 185 Filum Coniferophyta (gimnospermas) 550 Filum Gnetophyta 70 Filum Anthophyta (angiospermas) 235.000 Clase Malacostracad (incluye orden Decapoda con un esqueleto externo calcificado) Orden Isopoda (ácaros de la madera y >11.000 Dicotiledoneas 130. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Dominio Eucarionte 255.000 cochinillas) Filum Mandibulata (Artropoda) Grupo funcionalb 1 1 1 1 1 1 1 1 1 2.800 y Enchytraeidae) Clase Hirudinea (sanguijuelas) 500 45.000 Clase Oligochaeta(lombrices de tierra 8.000 Filum Annelidad (lombrices segmentadas) Clase Polychaeta 9. 4 4 común localmente 5 - 30 Manual de biología de suelos tropicales .4 muy raro en el suelo 3.000 Monocotiledoneas 65.000 >10 millones Reino Animalia [37 fila] 750 Filum Tardigradad (osos de agua) d 99.4 2. biota del suelo y principales grupos funcionales a los que pertenecen.000 Reino Plantae [12 fila] Filum Bryophyta (musgos) 10.000 hepáticas) Filum Filicinophyta (helechos) 12.000 Filum Hepatophyta (plantas 6.000 Filum Crustacead [>6 clases] 25.Tabla 1.000 Clase Gastropodad (incluye babosas y caracoles) 18.000 Filum Mollusca 35.1 Número de especies descritas en las principales categorías taxonómicas de plantas.

180. 9 6 2.000 langostas) Orden Thysanoptera (trips) 6. 3. afidos.000 Clase Chilopoda (ciempiés) 2.9 Sólo en la rivera 4.1 Continúa. grillos.000 Orden Collembola (colémbolos) 7.800 Orden Hemiptera (chinches) >80.000 etc. 7.800 Orden Orthoptera (saltamontes. 7 2. >125. 7 4. escamas) Suborden Heteroptera 25. 9 3. 9 4.000 Orden Dermaptera (tijerillas) 1. 9 2.000 gegenes. mosquitos pequeños) Orden Hymenoptera (hormigas. 6.162 ciempiés) Clase Diplopoda (milpiés) 10.000 quitos.000 abejas.500 Clase Symphyla 200 Clase Pauropoda 700 El Grupo funcionalb 4 4.000 Orden Diptera (moscas. 115. 7 31 inventario de la biodiversidad biológica del suelo . peri55. polillas. abejorros) Familia Formicidae (hormigas) 11.000 Orden Isoptera (termitas) 2.6 4 2.Tabla 1.000 Suborden Homoptera (cigarras.) Orden Trichoptera 12. 9 2.826 Orden Lepidoptera (mariposas. mosquitos. 9 2. 23. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos de critas en el taxón (todos organismos de suelo/nombre común los hábitats) Subfilum Hexapoda (Insectos) >900. 6 2. 4 2. 6. 4. 9 2. 6 4. pulgones.000 Orden Archaeognatha (pececillos de 350 cobre ó bristetails) Orden Thysanura 700 Orden Blattoptera (cucarachas) 4. 4. 4. 6 2.500 Orden Diplura (doble cola) 659 Orden Protura 500 Subfilum Myriapoda (milpiés y 15.000 Orden Coleoptera (escarabajos) >350. 9 2. avispas. 9 2.

9 1 32 Manual de biología de suelos tropicales .Tabla 1. 9 2. garrapatas) 45.7 7 1.000 Filum Diatomacead (diátomos) Filum Oomycota (Oomycetes) Cientos Filum Rhodophyta (alga roja) 4.000 Filum Plathyheminthesd (Helmintos. 7. 7 Muy raros en suelo 2. lom15.1 Continúa. 6. Categorías taxonómicasa (número Número de especies destotal de fila existentes) ejemplos critas en el taxón (todos de organismos de suelo/nombre los hábitats) común Subfilum Cheliceratad [3 clases] >100. 9 6 6 6 7 Parásitos artrópodos 4. 7. alfilerillos) 25.000 Filum Discomitochondria (flagelados 800 y zooflagelados) 10. incluidas planarias) Número sin Reino Protoctistac [30 fila] determinar Filum Rhizopoda (amibas) Número sin determinar 4000 Filum Dinomastigotad (dinoflagelados) Filum Ciliophora (ciliados) 10. 4.6 7 1.455 Orden Palpigradi (micro-escorpiones) 80 Orden Acari (ácaros.000 Order Scorpionida (escorpiones) 2000 400 Filum Gastrotrichad (gastrotricha) d 1000 Filum Acanthocephala (lombrices con cabeza espinuda) 2000 Filum Rotiferad (animales de ruedas) 900 Filum Nemertinad (gusanos planos) Filum Nematoda (nematodos.235 (Pseudoescorpiones) Orden Araneae (arañas) 40.000 Orden Pseudoscorpionida 3.000 briz redonda.100 Grupo funcionalb 6 2.000 Clase Arachnida [11 órdenes] 93. 6. 7 1 5. lombrices enterobius.

000 1.Grupo funcionalb critas en el taxón (todos los hábitats) 16.ncbi.. 8 5. 1997. desde el más bajo hasta el más alto nivel: dominio.. Dichos procesos pueden ser agrupados de acuerdo a cuatro funciones agregadas del ecosistema: El inventario de la biodiversidad biológica del suelo 33 . (2006).250 >30. d) Incluye organismos acuáticos y del suelo.nlm.342. respectivamente. 8 10 1. 8 5.nih. 9.398f 1 sólo parásitos 5.1 Continúa. 1996. Brussard et al. de acuerdo con Woese et al.. 1998. 8. clase. género y especies. buyendo al mantenimiento y a la productividad de los mismos. c) Considerados por algunos autores como Protistas o Protozoos y Chromistas. por su influencia en la calidad y salud del suelo (Hoavelle.gov. Clasificación. Kibblewhite et al.Tabla 1. 10 Nota: a) Considerando las categorías taxonómicas. consultado el 13 de mayo de 2007). de acuerdo con la Tabla 1. cuando éstos se incluyen. 5.. Hongos de acuerdo con James et al. excluyendo organismos no clasificados. familia. reino. filum. f) National Center for Biotechnology Information: (www.500 1. sin cultivo y no especificados. orden. e) Rappé y Giovannoni (2003).000 1.2 (de este capítulo). Fuente: Moreira et al. (1990).9 5 5. Procariotas (Dominio Archaea y Bacteria). 2006.000 >344f >8. b) Grupos funcionales. la riqueza correspondiente arrojará 3090 y 79. Reinos de Eucariotas clasificadas de acuerdo con Margulis y Schwartz.000 >70.100 204 >22. 2008). Categorías taxonómicasa (número total de fila existentes) ejemplos de organismos de suelo/nombre común Filum Chlorophyta (alga verde) Reino Fungi [6 fila] Filum Microsporídia Filum Chytridiomycota (Hongos quitridios) Filum Zygomycota (mohos) Filum Glomeromycota (hongos micorrízicos arbusculares) Filum Basidiomycota (incluidos hongos y algunas levaduras) Filum Ascomycota (incluidas levaduras) Dominio Archaead [4 fila] Dominio Bacteriad [52 fila]e Número de especies des.

drenaje. nematodos. porosidad y contenido de carbono. mediante la formación de asociaciones simbióticas como las micorrizas y la fijación de N2 en nódulos de raíces. poros. La descomposición de materia orgánica. se mantienen físicamente activos dentro del suelo formando canales. y moviendo partículas de un horizonte a otro. en gran parte realizada por animales del suelo como ácaros. Algunos grupos de bacterias del suelo están involucrados en transformaciones elementales autotróficas. colémbolos y ácaros. el carbono orgánico es liberado en la atmósfera. que no dependen directamente de la materia orgánica como fuente de alimento. estabilidad de agregados 34 Manual de biología de suelos tropicales . y dispersan los propágulos microbianos. Estas fracciones de MOS varían en su estabilidad y longevidad. lombrices de tierra. lo que controla el resto de la biota. estos grupos son afectados indirectamente por factores como el contenido de agua. Juntos. por la biota del suelo. siempre que no se incluya a los ingenieros del ecosistema (véase más abajo). sin embargo. Así. los cuales trituran los residuos de plantas y animales. Ciclo de nutrientes. pero también es incorporado en diferentes reservorios en forma de materia orgánica (MOS). termitas. lombrices de tierra y termitas. Bioturbación. hormigas y algunos otros de la macrofauna del suelo. es esencial para todo tipo de agricultura y silvicultura. tales como protoctistas. los microorganismos y los animales involucrados se llaman “descomponedores”. Microorganismos específicos del suelo también incrementan la cantidad y eficiencia de absorción de nutrientes por la vegetación.1. es decir. El ciclo de nutrientes. el paso que marca la operación del proceso se determina mediante micropredadores. crean y modifican microhábitats para otros organismos más pequeños y determinan propiedades del suelo como aireación. Estos procesos de “bioturbación” influyen y determinan la estructura física del suelo y la distribución de materia orgánica del suelo. aunque el atributo “transformadores de hojarasca” es el más utilizado hoy en día para describirlos. 2. estabilidad del suelo. sin embargo. milpiés. 3. que ocurre principalmente por actividad enzimática de bacterias y hongos. estrechamente asociado con la descomposición orgánica. Como resultado de la descomposición. Aquí también los microorganismos son mediadores de la mayor parte de las transformaciones. principalmente como CO2 o CH4. Las raíces de plantas. Animales más grandes mejoran algunos procesos porque proveen nichos para un crecimiento microbiano dentro de sus intestinos o excremento. aunque en un tipo de suelo y medioambiente determinados existe un equilibrio entre el contenido del MOS y las entradas y salidas de carbono en el sistema. agregados y montículos.

hongos y animales invertebrados capaces de invadir plantas y animales. Lavelle et al. Para poder interrelacionar El inventario de la biodiversidad biológica del suelo 35 . pueden ser asignados dentro de una o más de las cuatro categorías funcionales genéricas descritas. 4. y hasta humanos. como miembros de la comunidad del suelo. 1997). brotes intensivos de enfermedades en el suelo y plagas. y de causar enfermedades y muerte. En los agroecosistemas. son relativamente raros. 1994. se le ha denominado “ingenieros del ecosistema del suelo” (Stork y Eggleton. incluyendo complejos organominerales estables durante meses o periodos más largos (Lavelle et al. Enfermedades y control de plagas. en el cambio climático. bioturbación y ciclo de nutrientes determinará el equilibrio entre la cantidad de carbono secuestrado en el suelo (véase arriba) y entre las emisiones de gases invernadero (principalmente CO2. Los organismos del suelo juegan un papel importante en la regulación de la composición atmosférica y.1 muestra la contribución de la biota del suelo a servicios ambientales. este rango de interacciones puede encontrarse reducido. 1992. que incluyen microbívoros y micropredadores que se alimentan de las plagas microbianas y de animales. En ecosistemas naturales. A este conjunto de organismos. tales como los causados por un contenido de MOS más bajo.y capacidad de retención de agua. debido a una diversidad biológica disminuida y/o en cambios ambientales del suelo.. bacterias. La bioturbación juega un importante papel en la regulación del equilibrio del agua en el suelo (infiltración. debe hacerse notar que la interacción entre la descomposición de materia orgánica. La Figura 1. Jones et al.. pero tales epidemias sí son comunes en la agricultura. por tanto. todos los organismos enlistados. N2O). Grupos funcionales de la biota del suelo En principio. La estructura y las propiedades del suelo también están influenciadas por la producción de excretas de animales. como resultado de los procesos anteriores. y también una amplia variedad de interacciones antagonistas microbianas. respectivamente. En suelos saludables. Especialmente. 1997). capacidad de almacenaje y drenaje) y tiene una fuerte influencia sobre la susceptibilidad a la erosión. basándose en la función particular que desempeñan o en el proceso específico del suelo del que son mediadores. La biota del suelo incluye un amplio rango de virus. NOX. CH4. las actividades de plagas potenciales y patógenas son reguladas por interacciones con otros miembros de la biota del suelo.. por lo tanto.

Mantenimiento de estructura del suelo 2.. Ciclaje de nutrientes Transformadores de nutrientes: Descomponedores Transformadores de elementos Fijadores de nitrógeno Micorrizas Ingenieros del ecosistema: Megafauna Macrofauna Hongos Bacteria Biocontroladores: Predadores Microherbívoros Hiperparásitos Figura 1.36 Funciones agregadas del ecosistema 1.1 La relación entre las actividades de la comunidad biológica del suelo y gama de bienes y de servicios ambientales que puede esperar la sociedad de suelos agrícolas. Transformaciones C Ensamblaje funcional Descomponedores: Hongos Bacterias Microherbívoros Detrívoros Procesos de entrega basados en el suelo Mantenimiento de la estructura del suelo Ciclaje de nutrientes Mantenimiento de la estructura del suelo Dinámica de la MOS Descomposición Ciclaje de nutrientes Regulación de población biológica Provisión de hábitat Regulación de población biológica 4. Fuente: Kibblewhite et al. 2008 Servicios agrícolas Procesos de entrega basados en el suelo Alimentos y fibras Captura y ciclaje de nutrientes Descomposición de la MO adicionada Dinámica de MOS Mantenimiento de la estructura del suelo Regulación de la población biológica Manual de biología de suelos tropicales Servicios no agrícolas Calidad y suministro de agua Control de erosión Regulación de la composición atmosférica y del clima Degradación y disminución de contaminantes Control de enfermedades y plagas no agrícolas Conservación de la biodiversidad . Regulación de la población biológica 3.

también de acuerdo con sus características taxonómicas. con los servicios del ecosistema (Setäla et al. No existe acuerdo preciso en la definición de grupos funcionales. transformadores de hojarasca.2 Principales grupos funcionales de la biota del suelo. 3. 1. 1998) pero también calificado en función de la respuesta fisiológica. Transformadoras de hojarasca (mucha macrofauna y mesofauna. Microsimbiontes (hongos micorrícicos. en última instancia. y que son los responsables de la mayor parte del flujo de energía en la red alimenticia de los descomponedores. rizobia): microorganismos asociados con raíces que facilitan la absorción de nutrientes. ni de cuántos de estos grupos deberán definirse dentro de un ambiente de suelo típico. por ejemplo. 5. el Tabla 1.organismos específicos del suelo (biodiversidad colectiva) con las categorías genéricas funcionales y. Ingenieros del ecosistema (macrofauna como termitas y lombrices de tierra): organismos que causan un impacto físico mayor en el suelo mediante su transporte. por lo tanto. construcción de estructuras agregadas y formación de poros. Microrreguladores (microfauna como nemátodos): animales que regulan ciclos de nutrientes mediante forrajeo y otras interacciones con los microorganismos descomponedores. muchas hormigas.. haciéndolo más accesible para los descomponedores o favoreciendo el crecimiento microbiano de excretas en forma de gránulos. translocando compuestos orgánicos sintetizados arriba del suelo. morfológica. 6. y chupadores de sabia. que incluyen minadores de hojas y de tallos. Predadores (mucha macrofauna y mesofauna): animales que regulan a los herbívoros. de comportamiento bioquímico o ambiental y. Esta actividad puede ocurrir a varias escalas espaciales. Pueden incluir predadores. normalmente definido por criterio trófico (Brussaard. El inventario de la biodiversidad biológica del suelo 37 . Herbívoros: animales que consumen y parcialmente digieren tejidos vivientes de plantas. de alguna manera. 4. descomponedores y microrreguladores por depredación. incluyendo el ciclaje de nutrientes. Productores primarios (plantas superiores e inferiores): organismos fotosintéticos que asimilan bióxido de carbono del aire y penetran en el suelo mediante sistemas de raíces. 1998) es necesario tomar en cuenta el concepto de grupos funcionales básicos. 8. 2. 7. ingenieros del ecosistema. Descomponedores (hongos o bacterias degradadores de la celulosa): microorganismos que poseen las enzimas polímero-degradadoras. alguna microfauna): invertebrados que se alimentan de desechos orgánicos originados por microbios y por trituradores de este material.

uno de los principales desafíos es seleccionar un subgrupo de la biota del suelo que refleje adecuadamente el espectro taxonómico anticipado y que.. concepto es heurístico y puede modificarse en función del propósito analítico necesario. enlistadas en la Tabla 1. al mismo tiempo. existen pocos estudios sobre la salud del suelo agrícola. Los grupos taxonómicos propuestos a continuación son seleccionados de acuerdo con su significado funcional diverso. en donde el espectro taxonómico completo ha sido objeto de un muestreo representativo en el mismo lugar y al mismo tiempo (Bignell et al.2 y se usan para anotar las categorías taxonómicas.2). Transformadores procariontes: Archaea y bacterias que transforman de manera específica el carbono (metanotrofa) o elementos nutricionales como N. aislado e identificado (Figura 1. en cuanto a la fertilidad y calidad del suelo. 38 Manual de biología de suelos tropicales . cuyos métodos de inventario y caracterización se describen en los siguientes capítulos. parasitoides e hiperparásitos de plagas y enfermedades). no obstante. Éstas están representadas formalmente en la Tabla 1. 2005). (razón por la cual se emplea el término “taxa seleccionado”) y por su facilidad relativa a ser muestreado. 9. no relacionados. existe un argumento válido que establece por lo menos diez categorías. Éstos son grupos taxonómicos que fueron tomados en cuenta en el proyecto Conservation and Sustainable Management of Below-Ground Biodiversity (CSM-BGBD). invertebrados. Por esta razón y porque muchos componentes de biota de suelo son taxonómicamente difíciles de identificar. no obstante. S o P (nitrificación y fijación de nitrógeno). mientras que otros son muy específicos en cuanto a su taxonomía. plagas) especies de control biológico también pueden incluirse (ej.2 Continúa. 2003). 1994) y especies clave (sensu Davic. también es importante buscar dentro de los grupos funcionales para descubrir los taxa que alcancen el criterio de ser considerados como ingenieros del ecosistema (sensu Jones et al.. Plagas y enfermedades del suelo (hongos patógenos. incluya todos los grupos funcionales considerados como importantes. La importancia funcional de cualquier especie o de grupos de especies. probablemente se relaciona con su abundancia relativa y con la biomasa. 10.: depredadores.1.Tabla 1. Grupos selectivos de biota de suelo En el diseño de trabajo de campo. a veces. Véase que algunos grupos funcionales incluyen una amplia gama de taxa relacionados y.

promotores de crecimiento Nota: la fauna se clasifica de acuerdo con el ancho de cuerpo: macrofauna >2.Figura 1. antagonistas.2 Principales grupos funcionales. clasificados de acuerdo con dominios y reinos.0 mm. y microfauna <0.0 mm. patogénos y antagonistas IV Omnipresentes con diversidad alta indeterminada Descomponedores. un grupo que incluye muchos organismos con papeles especiales y una diversidad de descomponedores genéricos MICROBIOTA GENERAL Microfauna.MICROFAUNA Y MESOFAUNA Nematodos Ácaros Colémbolos Otros Biomasa alta II Alta diversidad y biomasa Micropredadores. trituradores de hojarasca. patógenos.1 mm. transformadores procarióticos. tamaños y procesos de ecosistemas ANIMALES. especialmente protoctistas Archaea y Bacteria El inventario de la biodiversidad biológica del suelo 39 .1-2. Por su parte. parásitos de Micropredadores.transformadores de hojarasca plantas HONGOS Y BACTERIAS MUTUALISTAS Hongos micorrizógenos Bacterias formadoras de nódulos en leguminosas Omnipresentes con especificaciones típicas de variedad de hospederos (a varios grados) III Omnipresentes Microsimbiontes mejoran la absorción por la raíz y la fijación de nitrógeno Hongos saprotróficos.MACROFAUNA Lombrices de tierra I Escarabajos Otros Hormigas Termitas Diversidad y biomasa alta Diversidad alta Ingenieros del ecosistema. mesofauna 0. trituradores de hojarasca. macropredadores ANIMALES. nematodos y protoctistas pueden considerarse como componentes de la microbiota general. transformadores de hojarasca. estudiados en el proyecto CSM-BGBD.

1). ácaros. también actúan como reguladores de las poblaciones de biota del suelo. arañas. y la pérdida de especies endémicas. 5 Microfauna: nematodos y protoctistas que. al compararse con otros grupos taxonómicos superiores (Tabla 1. b) ocupan espacios que existen en pequeños poros. b) el ciclo de nutrientes. por ejemplo. nematodos y. hormigas y escarabajos que intervienen en: a) la porosidad y la textura del suelo. escarabajos. que intervienen en la porosidad del suelo y en sus nutrientes. a escala pequeña. Algunas especies de ácaros y formas de larvas de muchos artrópodos de suelo son lo suficientemente pequeñas como para clasificarse dentro de la microfauna. bacteriófagos. la distribución geográfica. e) 40 Manual de biología de suelos tropicales . c) normalmente representan una riqueza genérica y de especies muy alta d) juegan un papel importante en la regulación de abundancia y actividad microbiana. la trituración y digestión de materia orgánica. probablemente. microfauna y microsimbiontes. milpiés (Diplópoda) y otros tipos de larvas de insectos que actúan como transformadores de hojarasca con una importante acción trituradora sobre el tejido de plantas muertas y sus depredadores (ciempiés. micófagos. En este contexto. lombrices de tierra. Enchytraeidae. la introducción de especies exóticas e invasivas. de la mesofauna. de esta manera contribuyen en procesos orgánicos de trituración a pequeña escala y ejercen un importante papel regulatorio dentro de la biota del suelo. en los que viven dependientes de películas de agua. por ejemplo. 3 Otra macrofauna: cochinillas (Isópoda). arácnidos grandes y otros tipos de insectos). todos ellos conforman un gran número de especies.Además. 4 Mesofauna: colémbolos y ácaros que actúan como transformadores de hojarasca y micropredadores (forrajeros de hongos. 2 Macrofauna: termitas. Los grupos incluidos en la selección son: 1 Macrofauna: lombrices de tierra. al cavar sus túneles y mediante la ingestión de materia mineral y orgánica. omnívoros y depredadores. mediante el transporte. bacterias y depredadores de otros animales del suelo). también representan factores de interés y preocupación. a) influyen en la tasa de recambio por su papel como forrajeros de raíces (parásitos de plantas). c) el control biológico como depredadores. al construir galerías y al cavar túneles e ingerir suelo. Algunas especies también resultan perjudiciales porque se convierten en plaga. hormigas. protoctistas. varios de estos grupos taxonómicos son muy importantes por sí mismos como contribuidores a la diversidad biótica en general.

el concepto de especies también es muy variable. 8 Hongos fitopatógenos. 6 Hongos micorrizógenos arbusculares: se asocian con las raíces de las plantas y mejoran la disponibilidad de nutrientes. que dependen de grupos funcionales. Los métodos empleados para la extracción de diferentes grupos de organismos del suelo también son muy diferentes de un grupo a otro. entre bacterias. lo anterior aplica para los trituradores de materia orgánica (véase transformadores de hojarasca en Tabla 1. y contribuyen al potencial control biológico de plagas y enfermedades. En la biota del suelo. de esta manera. rotación de carbono orgánico en descomposición. Estos factores.2). 7 Bacterias formadoras de nódulos en leguminosas y. Se espera que los servicios de ecosistema. Aún sigue siendo una pregunta sin respuesta la relación existente entre diversidad de especies. utilizando el concepto de grupos funcionales clave como los descritos anteriormente. bacterias que nitrifican y denitrifican (como parte de los transformadores procariotas). por ejemplo. en NH3. En muchos Fila. otros fijadores de nitrógeno microsimbiontes que transforman el nitrógeno atmosférico N2. bacterias involucradas con el compuesto El inventario de la biodiversidad biológica del suelo 41 .como insectos patógenos. que es asimilable para las plantas. En los casos de Archaea y bacteria. la caracterización molecular y bioquímica reemplaza al enfoque de identificación tradicional. representan un importante control biológico. requieren de un enfoque selectivo para llevar a cabo un inventario de la biodiversidad bajo suelo. diversidad funcional (el número de grupos funcionales). aunados a la inmensa escala de diversidad encontrada en el suelo. la mayoría de las especies aún son desconocidas. Métodos para inventario de la biodiversidad bajo suelo: principios generales La metodología actual no permite la identificación de todas las especies en el suelo. compuestos por relativamente pocas especies y/o especies altamente especializadas. sean los más vulnerables ante situaciones de estrés y perturbación que afectan a dichos grupos funcionales. composición funcional (la naturaleza de los grupos funcionales) y ocurrencia e intensidad de los procesos ecológicos. Hasta donde se conoce. reducen ataques patógenos en plantas y mejoran la tolerancia al estrés del medio ambiente. saprotróficos y antagonistas: que determinan o median (en diferentes casos) la viabilidad de cultivos. hongos y animales invertebrados. y enfermedades de las plantas. en ocasiones.

En el prefacio se plantea una breve descripción del proyecto. para el cual se han desarrollado y probado los métodos. para su aplicación en paisajes con diferentes usos de suelo. cobre y azufre quimiolitotrofos. cuando se adopta el concepto de los grupos funcionales principales. aunque se dan referencias de claves para la identificación de especies de varios grupos funcionales.C1 y en las transformaciones de hidrógeno (metanogénicas y metilotróficas). Inventario de biodiversidad bajo suelo en escalas de espacio y tiempo Cambio de uso de suelo como la causa principal del cambio de diversidad biológica del suelo Un inventario puede demostrar si la biota del suelo responde a intervenciones humanas como prácticas agrícolas. Los métodos estándar son necesarios para describir los ecosistemas de manera consistente. la fragmentación de hábitat y el manejo de cultivos en la diversidad biológica del suelo. de manera que sea posible evaluar. Este manual aborda métodos para el inventario y caracterización de la biodiversidad del suelo. La evaluación de la composición de la comunidad biótica depende de la identificación de los especímenes recolectados. en términos de una dis42 Manual de biología de suelos tropicales . escogidos y modificados. deforestación. preguntas como las anteriores deberían ser consideradas en la definición del propósito del objetivo de la investigación de la biodiversidad bajo suelo. Si éste es el caso. puesto que se reflejarán en los métodos a utilizarse. especialmente. hierro. Por lo tanto. el impacto que provoca la intensificación agrícola. esto conlleva a una serie de interrogantes como ¿cuál es el número mínimo de especies dentro de los grupos funcionales que garanticen la resistencia del suelo contra el estrés del ecosistema natural y antropogénico. centrándose en los grupos funcionales que permitan la evaluación de la diversidad. por ejemplo. hongos micorrizogenos (entre los microsimbiontes) y bioturbadores (ingenieros del ecosistema). lo que exige un alto nivel de conocimientos taxonómicos. que para algunos grupos y en algunos países es un desafío importante. Los métodos han sido desarrollados. En este manual no se abordan problemas taxonómicos. abundancia y composición de las especies. contaminación y cambio climático. las consecuencias pueden ser negativas. y en relación con que “especies clave (si existen) en los grupos funcionales?. Esto debería servir como respuesta a un gran número de preguntas en contextos similares.

de los que puedan realizar las funciones biológicas esenciales. Se presume que de esa forma se reducirá la diversidad bajo suelo y que. pérdida del potencial para la limpieza de los residuos y contaminantes. Sin embargo. lo cual implica una reducción de la biodiversidad bajo suelo y. 2008). Una solución alternativa sería intensificar y. incluso puede producirse la pérdida de la productividad primaria. si se acompaña de la extinción de especies individuales. escalas que determinan la predicción de servicios ecosistémicos. retener una buena cantidad de diversidad sobre el suelo. la biodiversidad y complejidad arriba del suelo favorecen el restablecimiento o protección de la diversidad de organismos bajo suelo. tales como cultivo mecánico. El mantenimiento de una variedad de cultivos y otras plantas es aceptado como una práctica que protege al agricultor contra los riesgos a corto plazo. un gran número de agricultores tienen acceso limitado a insumos. muchas veces enlazadas entre sí.. Dichas funciones regulatorias frecuentemente se describen como “sustitutos” por insumos. puede causar pérdidas de función y reducir la habilidad de los sistemas agrícolas para soportar periodos inesperados de estrés. Este hecho puede considerarse tanto a nivel de campo como de paisaje. la biodiversidad arriba del suelo se verá reducida. debería reflejar un consenso de la teoría ecológica y del pensamiento actual sobre estructuras de la comunidad en diferentes escalas espaciales y temporales. en la medida que proceda la intensificación. fertilizantes químicos y pesticidas (Kibblewite et al. varias frecuencias). los procesos de disturbio -y recuperación. por ende. Para qué muestrear. El principio central es que el significado funcional de la diversidad biológica cambia de acuerdo con las escalas de El inventario de la biodiversidad biológica del suelo 43 . debido a cambios en la fertilidad del suelo y/o incrementos de enfermedades en el mismo. dónde y cuándo Aunque éste es un manual de instrucción práctica. El suministro global de alimentos depende de la agricultura intensiva.minución de los servicios del ecosistema. especialmente en suelos degradados. para mejorar la complejidad estructural y diversidad funcional. en la medida de lo posible. interrupción de los ciclos elementales globales y respuesta ante los efectos de los gases invernadero y de la erosión. también se manifiestan en diferentes escalas espaciales y temporales (por ejemplo. además. la regulación biológica de los servicios de ecosistema basados en el suelo. En los trópicos. produciendo efectos indeseables. al mismo tiempo. especialmente. a pesar de que la producción se ha intensificado. la complejidad de los agroecosistemas ha sido drásticamente reducida.que afectan la biodiversidad bajo suelo.

incluso.. espaciales y temporales. si uno o más grupos funcionales importantes estuvieran ausentes o permanecieran en baja presencia en una de las localidades o si el ecosistema original de bosque se hubiera reducido a una presencia mínima en uno de los lugares. en otro lugar.. si el objetivo del inventario es conservar la biodiversidad bajo suelo. la erosión de finas partículas de suelo y la reducción al mínimo de materia orgánica compleja que. mientras que en el caso de la zona de uso de suelo. se puede esperar una variación grande. entonces. o bien. La formación del suelo. pero en el caso de dos campos colindantes. el inventario de especies de lombrices de tierra. dónde y cuándo se mide. 2004). como se podría esperar. Por ejemplo. puede quedarse corto en relación con el propósito de evaluación de la diversidad de toda el área. esto quiere decir qué se mide. puede que se deba al drenaje o manejo previo del lugar. mientras se mantuviera en un paisaje mixto. probablemente es cuestión de saber cuáles microorganismos existen en cada una. en un lugar específico. constituye uno de los servicios del ecosistema que integra procesos en todas las escalas. los materiales parentales y los suelos serán los principales determinantes de todos los servicios del ecosistema a nivel paisaje. El clima. en un mismo paisaje. en última instancia podría. en caso de rehabilitación. no obstante. a escala regional. se pensaría que el material parental y el clima fueran los factores determinantes en el proceso de formación del suelo. Entre dos paisajes o dos regiones. los números o diversidad pueden mantenerse estables. a la existencia de termitas o cualquier otro ingeniero del ecosistema que haya presentado mayor actividad en un lugar que en otro. los ciclos de vida de diferentes 44 Manual de biología de suelos tropicales . Asimismo. Lavelle et al. Esto quiere decir que. del campo hacia setos que delimitan el terreno. en número y diversidad de lombrices de tierra al moverse de un lugar a otro. al punto de llegar a hacerla ser irrecuperable. o bien. la pérdida progresiva de macroporos. En términos generales. El objetivo debería ser reducir la variabilidad intragrupo y maximizar la variabilidad entre grupos.espacio y tiempo (Swift et al. la diferencia que puede ocurrir en la descomposición o la fijación de nitrógeno simbiótico entre dos paladas de suelo del mismo campo. De la misma manera. de manera general. puede haber una influencia biótica significativa. a los servicios del ecosistema en diferentes tipos de comparaciones. Las escalas temporales son importantes en los procesos de degradación. por ejemplo. con el propósito de lograr lo anterior. 2002. El mayor reto. es cómo definir estos “grupos” en relación con niveles de escala. tomando en cuenta los aspectos de la biodiversidad que puedan afectar. destruir la capacidad productiva. que combina estos elementos dentro de un sistema de uso de suelo.

Los principales conceptos teóricos que corresponden a estos criterios son: apertura y conectividad. son usados en el proyecto CSM-BGBD (véase prefacio) y están considerados como ejemplo. 2004). vegetación y tipo de suelo. tamaño y forma de estos gradientes y fragmentaciones. geología. derivados de la base mineral y vegetal. al igual que en los protocolos de medición. a escala de paisaje. también tendrán una importante influencia en la biodiversidad. en este caso. como se indica más adelante. en el caso del ecosistema de suelo y sedimentos (Wall. por los gradientes o transiciones de las condiciones de humedad o por los gradientes de las propiedades del suelo. por lo tanto. se enfatiza en el capítulo 2 de este manual. la distribución espacial de la biodiversidad bajo suelo estará fuertemente influenciada por los gradientes de altitud y temperatura. de gran relevancia en ese nivel. como puede ser dentro de los bosques). deberá capturar la distribución.taxa de biota varían de horas a años y pueden incorporar estados obligados de inactividad. Paisaje. al igual que los procesos de cambio relacionados. mientras que las fecundidades también varían y. comparado con los efectos que produce la vegetación misma. será un determinante más de dicho nivel. En el nivel más alto. El inventario de biodiversidad bajo suelo. Las características espaciales de la distribución de uso de suelo (“parches” de uso de suelo. también será diferente de un organismo a otro.3 muestra un resumen de niveles jerárquicos modificados a partir de los propuestos por Lavelle et al. A nivel paisaje es difícil evaluar el efecto de la biodiversidad bajo suelo sobre algunos servicios del ecosistema. La protección y conservación de los principales agroecosistemas y hábitats representa la mejor El inventario de la biodiversidad biológica del suelo 45 . que afectan a la biodiversidad bajo suelo (y servicios ambientales asociados) y el componente de la biodiversidad bajo suelo. ampliamente discutidos. incluyendo el descubrimiento de especies invasivas exóticas es. (2006). como calidad y suministro de agua o control de erosión y no parece que éste juegue un papel importante. el tiempo requerido para que una población creciente alcance un tamaño crítico mínimo donde es autosuficiente. La Tabla 1. cada proyecto necesitará determinar su propia escala en función de sus objetivos. No obstante. Los cuatro niveles de escala espacial en muestreo. El impacto en el diseño de muestreo. 1. El patrón de uso de suelo superpuesto en función de dichos efectos de clima. La biodiversidad bajo suelo. más útil como indicador de la respuesta del suelo al manejo. para explicar las posibles variaciones en la biodiversidad bajo suelo.

A este nivel. aunque sean provocados por cambios en la composición funcional y actividad de los ingenieros del ecosistema o del arado del suelo. normalmente. Área de uso de suelo. por ejemplo. En este nivel. El terreno o parche. 2007. en el caso del inventario de biodiversidad bajo suelo. es en este nivel donde la biodiversidad bajo suelo debería estudiarse de manera minuciosa. 2006 y Tittonell et al.. La intensificación de uso de suelo. la estructura comunitaria y sus interacciones son reguladas por la arquitectura del suelo del lugar en específico (Lavelle et al. que implican una pérdida de sus aportes e impactos. tramos de bosque y otros elementos de manejo de paisajes. de manera que la relación entre el patrón de distribución espacial de la biota sobre el suelo con la de bajo suelo son particularmente interesantes. se asocia con la extracción de elementos vegetales como árboles. 2006). Estas áreas muestran. incluyendo a las raíces de suelo.. Los gradientes de las propiedades de suelo sí ocurren en este nivel. Las áreas de uso de suelo se definen en función de su uso y régimen de manejo (Huising. también lo es la abundancia de especies relativas.. una combinación específica de tipos de cobertura. rompevientos. tal es el caso de un área con plantaciones comerciales de té o la caracterizada por la agricultura de autoconsumo. cercos vivos. tendrán un 46 Manual de biología de suelos tropicales . de cientos de años. Vanlauwe et al. sobre todo. respecto al cambio de uso de suelo. son visibles en escalas de tiempo más cortas que pueden abarcar desde pocos años hasta varias décadas. por lo tanto. pertenecientes a varios niveles tróficos y grupos funcionales que gobiernan la estabilidad de redes alimenticias y la provisión de funciones de apoyo. 1993). pero son asociados con el manejo. cuando se trata de agrosilvicultura. y para la manera en cómo funciona el sistema. Cambios en la arquitectura del suelo.opción para dicha intervención. 3. éste es el caso de algunos árboles donde ciertos organismos de suelo hacen uso de sus nichos. Parcela o parche. la composición y actividades funcionales de la biota son de gran interés y. A nivel de parcela. La biodiversidad sobre el suelo se determina por la variedad de cultivos encontrados en el área y por los elementos vegetales asociados con barbechos. describen los gradientes de la fertilidad del suelo en función de los recursos destinados al terreno. los cambios relacionados con el uso y cobertura del suelo. típicamente. queda dentro de los dominios funcionales de los ingenieros del ecosistema. incluso. La escala de tiempo de estos procesos (cambio de la composición de uso de suelo y configuración de paisaje) para ser observable necesitaría de varios o. si no es demasiado grande. Las interacciones laterales son componentes muy importantes para la biodiversidad bajo suelo. 2.

Las “intervenciones” enlistadas en la Tabla 1. sino más bien ilustrativa. puede servir para corregir desequilibrios en la composición funcional o para mejorar algunas funciones en particular. 2001. Cambios estructurales en la comunidad biótica (conexiones en la cadena alimenticia. condicionados por los organismos de suelo en la producción de servicios de apoyo tales como mantenimiento de la estructura de suelo y la descomposición de materia orgánica introducida. por lo tanto. también despiertan gran interés. La redundancia funcional entre los transformadores primarios (especies o familias diferentes que cumplen una misma función). son segregados en los dominios funcionales: rizósferas.. la competencia y la eficiencia son de particular relevancia y. como en la cadena alimenticia. pero un entendimiento de los procesos e interacciones es vital. subparcela o microhabitat. El inventario de la biodiversidad biológica del suelo 47 . la inoculación con especies microbianas.efecto sobre las interacciones tróficas y. La lista de intervenciones y mediciones correspondiente a la biodiversidad bajo suelo. principalmente. reflejándose la dependencia de los organismos más pequeños en los ingenieros del suelo para el suministro de sus sustratos (véase Lavelle y Spain. A nivel parcela. Las opciones para intervenciones de manejo en una escala de subparcela son actualmente limitadas. la introducción de depredadores para el control de una enfermedad en particular. para mayores detalles y terminología). el grado de diversidad genética. Éstos existen en la escala de los horizontes de suelo. en relación con esto.3 son parcialmente derivadas del concepto “el manejo jerárquico de la biota del suelo”. tienen escalas de tiempo relativamente cortas y mostrarán variaciones estacionales. dado que ésta es la unidad fundamental de la función del suelo. pertenecientes a grupos funcionales definidos o a niveles tróficos dentro de la cadena alimenticia. etc. dentro de los microorganismos. Este nivel se refiere a los microhábitats que alojan a los microbios y a los componentes de la microfauna del sistema de suelo que los regulan. Cualquier tipo de inoculación causará un impacto directo sobre la diversidad bajo suelo y. drilósferas. del agregado individual y de la partícula individual. por ende. Nicho. en la estructura de la red alimenticia. El manejo de materia orgánica y el uso de agroquímicos causarán un mayor impacto en la estructura de la red alimenticia. no es necesariamente exhaustiva. Tal intervención debería apoyarse en el inventario y la abundancia relativa de especies. los procesos involucrados. termitósferas. según lo describe Swift (1998). 4. composición funcional) pueden necesitar de varios años.

3 Niveles jerárquicos de inventario y manejo de biodiversidad bajo suelo. y prácticas de conservación del suelo.relacionada con diversidad arriba ingenieros de clasificación). funcional. del suelo. mancífico (depentenimiento de de especies y régimen de especialmente diente del nivel áreas de refugio manejo. de un país. suelo caracteríssuelo. manejo ecosistemas: integrado de patrón de distrirecursos naturales bución espacial. 3–20 tipos de Intensificación Diversidad Área con uso de áreas de uso de de uso de suelo. saje. Capa de nivel de agregación Paisaje Tipo de unidad Medida/ parámetro de biodiversidad Área caracterizada Sin especificar: Cambio de uso de Diversidad biopor un mosaico de tal vez. parches de selva. cuenca mayor. varias suelo: protección lógica de suelo: uso de suelo y de por bioma o por de usos de suelo y especies exótiecosistemas como región dentro elementos de pai.Proceso/ ses o unidades intervención Área de uso de suelo 48 Manual de biología de suelos tropicales . de relevancia específica para la biodiversidad y mantenimiento de la provisión de servicios de ecosistema. unidades de referencia. corredores biológicos. procesos asociados de cambio y componentes relevantes de la biodiversidad. de detalle de la biológicas y bio.existiendo una superposición entre niveles de escala dentro de los parámetros a medir. Número de cla. dentro de degradación diversidad y tico y patrón de composición cobertura de suelo un paisaje espe.de suelo.cas e invasoras. Tabla 1. por ejemplo.

microhábitat horizontes de suelo. por suelo. Nicho Por ejemplo. etc. de agentes de control biológico. utilizando los métodos previstos en este manual. na. Biomasa y actiManejo de vidad microbiabiota clave. los datos tendrán que ser acumulados en cada punto de muestreo. que consisten en el uso oportuno de tiempo y recursos. parcelas de vegetación. selva. • Abundancia (total) y biomasa (en el caso de animales) de taxa.área de uso de jo particular. erosión. composición labranza mínima. materia orgánica. etc. Por regla general. funcional. especies. provee los siguientes datos e información. • Abundancia y biomasa de los grupos funcionales (GF). El inventario de la biodiversidad biológica del suelo 49 . dentro mejoramiento de y entre grupos funcionales y sistemas de cultivo y manejo de niveles tróficos. diversidad introducción genética. • Proporciones relativas de GF. el inventario bajo suelo de la biodiversidad. inoculación con microsimbiontes. para lo cual se indican en los capítulos 3 y 9 los mejores métodos. Datos requeridos Los métodos expuestos en este manual. cepas para microsimbiontes). rizósfera. Capa de nivel de agregación Parcela. inoculación. drilósfera. ejemplo. dependiendo del tipo de análisis realizado: En cuanto a la biodiversidad: • Riqueza taxonómica a nivel de especie.3 Continúa. 10 a 100 por Área con un uso particular y mane. Sin tomar en cuenta los objetivos específicos y el diseño experimental de cualquier estudio. o a nivel más alto o más bajo (por ejemplo. campo agrícola. proveen un gran número de parámetros para la evaluación de la biodiversidad bajo suelo.Tabla 1. parche Tipo de unidad Número de cla.Proceso/ ses o unidades intervención Medida/ parámetro de biodiversidad Intensificación de Abundancia manejo de suelo y relativa de cultivos.

F. C. vol 26. M... response 11. D. D. P. Hawksworth. T.. D. Klopatek. uso del suelo. vol 9. pp. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives.. P. Promedio de datos climáticos y precipitación real hasta la fecha de muestra. New York. V. P. pp. Huising. Hattori. J. Moreira. Lavelle. Referencias Bardgett. Freckman. R. C. X. P. Columbia University Press. P.. pp. (1997) ‘Biodiversity and ecosystem functioning in soil’. D. Brussaard. Prácticas actuales de manejo de suelo y cultivos.. Proceedings of the Royal Society of London Series B. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica.... vol 5. (1998) ‘A revised six-kingdom system of life’.. (1998) ‘Soil fauna. Folgarait. F. E. D. (ed) (1997) Nature’s Services. functional groups and ecosystem processes’. Cavalier-Smith.• Índices cuantitativos generales de riqueza y equitatividad.. vol 7. Historia precisa del uso de suelo desde su estado de selva no perturbada hasta otro tipo de vegetación pre-cultural. Ambio. A pattern recognition approach to land use inventory at the sub-regional scale 50 Manual de biología de suelos tropicales . Fragoso. y Virginia. Didden. D. Hole. Palm. L. guilds. Brussaard. V. (2003) ‘Linking keystone species and functional groups: A new operational definition of the keystone species concept’. C. pp. En cuanto al suelo. L. 123–135. 1251–1262. S. Nwaga. Daily.. (2005) ‘Belowground diversity assessment: developing a key functional group approach in best-bet alternatives to Slash-and-Burn’.. issue 1. Tiedje. Applied Soil.. D.. Malloch. Tondoh. Susilo. A. Biological Reviews. Island Press. G. 75–112. intensidad de uso y cobertura de suelo: • • • • • • Cultivo aparente o uso de barbecho. Oxford University Press. y Swift.. (2004) ‘Only six kingdoms of life’. J. A. Washington DC. vol 271. V. (2005) The Biology of Soil.Ecology. F. R. Soderstrøm. 563–570. in C.. W.. L. Bignell. Behan-Pelletier.. D. (1981) ‘Effects of animals on soil’. Brown. pp. Geoderma. J.. T. A. Dibog. vol 73. Vosti. E. Cavalier-Smith. D. B. Gupta. J. Oxford. Propiedades físicas y químicas básicas: pendiente y aspecto del suelo. Pashanasi. S.. Características de vegetación.... Sanchez. Conservation Ecology. 203–266.Rusek. T. Bignell. Davic. J. B. Huang. R.

R. H. Brown. M. J. V.. 373–386.. G. Volters. V. (1997) ‘Soil function in a changing world: The role of invertebrate ecosystem engineers’. Oikos. S. Moreira. Wall (ed) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. W.. K.. Abe. B. Freeman. y Shachak. in D. pp. P. E. Wageningen Agricultural University. E. (2001) Soil Ecology.. N.. Mycologia. P. A. Higashi (eds) Biodiversity. Boulton. Ineson. J.. y Brussaard. pp. Garey... Larsen. (2008) ‘Soil health in agricultural systems’. M. J.. P. Philosophical Transactions of the Royal Society Series B. y Schwartz. S. 159–193. Behan-Pelletier. 860–871. Bloemers.. Lavelle. P. L..using remote sensing and GIS applying an object oriented and data-driven approach’. M. Ritz. 3rd edition. y Rossi. Jones. Levin y M.. C. M.S.. y Watt.. Aubert. El inventario de la biodiversidad biológica del suelo 51 ... Lavelle... Eggleton.. Bureau. D. Biology International. Lawton.. The Inventory of Soil Biological Diversity 15ES_HTSB_11-6 13/6/08 18:14 Page 15 European Journal of Soil Biology. y Paul.. Bignell. S3–S15. A. New York..D. E. P. Brown.. Island Press. James. H. an Ecological Perspective. Wallingford. D..vol 69. (1998) Five Kingdoms – An Illustrated Guide to the Phyla of Life on Earth. F. Lepage. 685–701. R. S. P. M. (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. pp. G. D. P.. Mora. Kluwer Academic Publishers. vol 42. Thesis. Blouin. indicator taxa and effects of habitat modification in tropical forest’.pp. M. Siqueira. Mawdsley.. J.. Dordrecht Lavelle. H. Stork. in T. D. Lawton.. M. F. S. H. W. Decaëns. vol 98. T. The Netherlands. H. J. E. P. E. G... vol 363. G. Barot. K. S. (2006) ‘Soil invertebrates and ecosystems services’. vol 33. Nature (Lond). Bignell. Srivastava. Washington.. P. O.. L. J-P. P. Hunt.J. European Journal of Soil Biology. Bignell. Berlin. Hawkins.. Mozley-Standridge. W.. P.. S. J. J. P. F.. 3–16.. E. J. H. pp. 72–76.. G. E. (1996) ‘The role of species in ecosystems: Aspects of ecological complexity and biological diversity’. Lavelle. D. CAB International. DC Lavelle. G. (1994) ‘Organisms as ecosystem engineers’. pp. Margerie. M. y Vilgalys.Griffith. M. Powell. Longcore. St John. Giller. Lawton. V.. M. (2004) ‘Connecting soil and sediment biodiversity: The role of scale and implications for management’. T. y Swift. Spain. M. pp. S. Hodda. T. V. y Dillion. M. (2006) ‘A molecular phylogeny of the flagellated fungi (Chytridiomycota) and a proposal for a new phylum (Blastocladiomycota)’. Letcher. Hammond.... Roger. vol 33. Heal. A. Ph. Y. A. C. M. V. K. R. Holt. D. D. Austen. Margulis. A. vol 391. P. B. N. (1998) ‘Biodiversity inventories. Springer. (1996) ‘Diversity of soil fauna and ecosystem function’. Kibblewhite. Porter. W.

P. vol 9. Setäla. E. y Van Noorwidjk. Moreira. Swift. S. 25–31. Woese. Lopes.. and Eucarya’. Wall. pp. S. de Ridder. Kandler. 23–32 Swift. Guilherme. Island Press. (1990) ‘Towards a natural system of organisms: Proposal for the domains Archaea.. Blackwell. N. vol 7. SBCS/UFLA/DCS. Vanlauwe B. y Huhta.. G. 4576–4579. pp. J. Bacteria. Stork. J. Tittonell. M. C. M. S. y Giller. Oxford. y Giovannoni. y Wheelis. inJ. Siqueira. vol 104. (2006) ‘Within-farm soil fertility gradients affect response of maize to fertilizer application in western Kenya’. Tittonell. P. pp. Izac. pp. V. E. Applied Soil Ecology.Rappé. Agricultural systems.. M. American Journal of Alternative Agriculture. J. N. P. Soil Biology and Plant Nutrition interrelationships. S. M.. Vanlauwe. Washington. J. pp. y Eggleton. (ed) (2004) Sustaining Biodiversity and Ecosystem Services in Soils and Sediments. H. M. O. Carvalho (eds) Soil Fertility. M. (1998) ‘Functional diversity of decomposer organisms in relation to primary production’. y Mukalama. 376–390. 11–24. 52 Manual de biología de suelos tropicales . (1998) ‘Towards the second paradigm: Integrated biological management of soil’. R. M. Swift. B. J. O. N. vol 76. A. A. (1992) ‘Invertebrates as determinants and indicators of soil quality’. R. vol 87. J. D. Mikola. Ecosystems and Environment.. 369–394. Heal. E. G. y Anderson. 171–182. vol 94. O. H. J. (2002) ‘Biodiversity and ecosystem services in agricultural landscapes – are we asking the right questions?’ Agriculture. Annual Review of Microbiology. Laakso. (1979) Decomposition in Terrestrial Ecosystems. (2003) ‘The uncultured microbial majority’. Lavras. Faquin. K. J. A. pp. M. 113–134. Furtini Neto y J. Nutrient Cycling and Agroecosystems. pp. L. M. vol 57.. Proceedings of the National Academy of Sciences USA.. F. V. N. Brazil. W. L. (2007) ‘Heterogeneity of crop productivity and resource use efficiency within smallholder Kenyan farms: Soil fertility gradients or management intensity gradients’. pp.

Souleymane Konaté. Southwood y Henderson. el problema gira en torno a cómo escoger el número y localización de los puntos de muestreo en el paisaje en cuestión. La base del problema radica en el muestreo. Entonces ¿para qué se necesita otro capítulo que discuta las técnicas de muestreo de la biodiversidad del suelo? A pesar de los conocimientos y experiencias en rela53 . Huang (†) INTRODUCCIÓN Gran parte de este manual contiene instrucciones de cómo tomar mediciones una vez que se tiene un sitio de muestreo. Ronald Zanetti. una gran experiencia al respecto. Susilo. Cares. Meine van Noordwijk y Shiou P. mismos que se describirán en los siguientes capítulos. se necesita determinar en dónde va a estar localizado todo el estudio. S. Juvenil E. En cuanto al argumento es más complicado que una mera elección al azar. Richard Coe. Jeroen Huising. Louzada. en otra. En algún punto entre estos dos. 2000. Moreira.Capítulo 2 Diseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo E. Hay numerosos textos que describen la teoría y su aplicación (ej. Julio N. que aplica en todos los casos (Cochran. se encuentra el problema de la elección de los sitios. 2007). Además. Existe una larga tradición de muestreo en la ecología de campo y. también incluye cómo determinar la localización de estos sitios de muestreo: lo que se discutirá más abajo. en los cuales se llevarán a cabo los protocolos de medición. Francis-X. Gregoire y Valentine. se cuenta con una teoría de muestreo bien establecida. 1977). En una primera escala. en un punto predeterminado del paisaje. El problema de localizar los puntos de muestreo se presenta a diferentes escalas. Fátima M. por tanto. es necesario escoger el lugar dónde se tomarán las muestras de suelo para los análisis químicos.

o qué es una réplica. Por ejemplo. Son varias las razones para ello: 1 La aplicación de una teoría completa o de métodos tan extensivos como los utilizados en otros estudios. pueden discrepar en lo referente al carácter práctico del estudio que está siendo diseñado. entonces esta variación es desconocida. se presenta un ejemplo del enfoque utilizado en el proyecto CSM-BGBD. 5 Los investigadores toman diferentes posturas filosóficas relacionadas con el enfoque de muestreo. Por ejemplo. OBJETIVOS DEL ESTUDIO Y BASES DEL MUESTREO La mayoría de los autores que escriben sobre diseños de investigación puntualizan que el diseño se determina en función de los objetivos. (1989) lo explican con detalle en el contexto de muestreo ecológico. el acceso a sitios de muestreo ideales puede ser restrictivo. o bien. es posible que no sea fácil tomar tantas muestras como se desearía. Ford (2000) hace referencia a una amplia discusión de los objetivos de investigación en ecología. 2 La aplicación de una teoría de muestreo puede requerir de información con la que no se cuenta hasta que los datos han sido colectados. Sin embargo. Comúnmente hay malos entendidos de algunos de los principios básicos. Si datos similares no han sido colectados antes. 4 Los objetivos del estudio determinan el diseño.ción con el tema. estos podrían no estar completamente desarrollados o los objetivos múltiples podrían sugerir diferentes enfoques para el muestreo. Muchos de los debates sobre los métodos apropiados de muestreo se deben a diferencias de opinión en cuanto a los objetivos exactos del estudio. Kenkel et al. el tamaño de muestra requerido depende de la variación entre las muestras. están los que “Ven lo que está ahí. 54 Manual de biología de suelos tropicales . entonces tratan de entenderlo” y aquéllos que “empiezan con una hipótesis y tratan de probarla”. en cualquier proyecto habrá desacuerdos y discusiones en cuanto a las estrategias de muestreo. 3 Puede haber límites en cuanto a la teoría. En este capítulo se describen algunas opciones para muestrear la biodiversidad del suelo y las ventajas o desventajas de los diferentes enfoques. tales como por qué el trabajo de muestreo debe ser de manera aleatoria. debido al tiempo y al costo. A continuación.

Otra alternativa al MAS consiste en usar un muestreo sistemático usando una cuadrícula. entonces. esto es atractivo. Otra alternativa es formular algunas hipótesis predictivas para explicar los patrones en la biodiversidad. intentando describir patrones (por ejemplo. entonces los nichos raros deben ser incluidos. Piense en un nicho raro en el paisaje (por ejemplo. existirá solamente una pequeña porción del área de estudio ocupada por este tipo de nichos. y luego diseñar un estudio cuyo objetivo específico sea probar estas hipótesis. análisis de conglomerados y ordenación) y luego explicarlos (por ejemplo. Un ejemplo de un objetivo que requiere diferentes enfoques de muestreo son los inventarios. existe una estimación del error de muestreo basada en el diseño). situado en el lindero entre el bosque y la pradera. se han hecho imD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 55 . indica cómo la precisión de la estimación puede ser controlada mediante la elección de la muestra. incluyendo los del proyecto CSM-BGBD. Por supuesto. por lo que prefieren mantener la mente abierta y partir de la observación. Intuitivamente.El muestreo aleatorio simple (MAS) constituye el punto de partida para la discusión sobre cómo muestrear. Cuando el objetivo es identificar todas las especies de un grupo dado en el área de estudio entonces el MAS resulta inapropiado. lo que se discutirá en la sección de muestreo aleatorio y sistemático. La media de la muestra es una estimación imparcial de la media poblacional. su imaginación y descubrimientos potenciales podrían estar restringidos. dividir la población en sub-poblaciones o estratos. no importará si los nichos raros son omitidos o no. y la precisión aumenta con un tamaño de muestra fijo. existen pocos estudios ecológicos cuyo objetivo sea estimar la media poblacional. y en cada estrato tomar una muestra aleatoria). intentan entender los patrones en la biodiversidad. pero si el propósito es realizar un inventario de especies. Si el objetivo del estudio es estimar la biomasa media de escarabajos en general. en ecología. La teoría. argumentando que si se empieza partiendo de un objetivo limitado. Los seguidores del primer enfoque pueden argumentar que no quieren ser prejuiciados por hipótesis previas. y su error estándar puede ser estimado sin hacer supuestos acerca de la variación dentro de la población (técnicamente. La mayoría de los estudios. o el número promedio de especies de hongos en 1 cm3) el MAS adquiere propiedades relevantes. No obstante. Si el objetivo es estimar la media poblacional (la biomasa media de escarabajos por m2 dentro del área de estudio. encontrando correlaciones con variables ambientales). Un enfoque de muestreo consiste en colectar datos usando el método de MAS o mediante una cuadrícula. a través de la estratificación (es decir. el caso de las orillas de un estanque.

entonces es probable que: • La mayoría de los sitios de muestreo tengan valores de P y MOS alrededor de la media con. está determinada por el nivel de Perturbación (P) y el nivel de Materia Orgánica del Suelo (MOS) y se colectan los datos por medio del MAS o por muestreo de cuadrícula. Si las hipótesis implícitas se hacen explícitas el diseño de los estudios pueden ser mejorado. 2 De hecho. aunque ésta sea implícita. tienen valores bajos de MOS. por ejemplo. entre un número infinito de factores. parcelas con un valor alto de P. haciéndolo más eficiente. frecuentemente. existen tres razones para tratar de diseñar un estudio con objetivos específicos que incluyan hipótesis comprobables: 1 Los descubrimientos inesperados usualmente tienen la naturaleza de formulación de hipótesis observacionales que sugieren explicaciones. es posible mejorar el diseño del estudio.portantes descubrimientos por casualidad. Se requiere de estudios minuciosamente planeados para poder probar dichas explicaciones. Si suponemos la hipótesis de que la biodiversidad del suelo en parcelas agrícolas. pocos puntos con valores altos o bajos. son los puntos más extremos los que proporcionan más información (Figura 2. • La MOS y la P pueden estar correlacionadas. cada investigador debería estar abierto a la posibilidad de observaciones no anticipadas y explicaciones verdaderamente nuevas. La estratificación puede usarse para incrementar el número de puntos con MOS más extremos y mejorar la estimación de la relación sin incrementar el número de muestras. no obstante. 56 Manual de biología de suelos tropicales . además. separar los efectos de las dos variables. frecuentemente. Sin embargo. Por ejemplo. deberían ser medidos en los sitios de muestreo. 3 Si se parte de hipótesis específicas. sin seguir estudios planeados. los que proponen el enfoque “no hipotético” en realidad parten de alguna forma de hipótesis. sin alguna noción de los factores ambientales que puedan controlar la biodiversidad. Entonces es difícil y hasta imposible. si se trata de entender la relación entre la biodiversidad del suelo y la MOS o la P.1). el estudio podría ser diseñado para incluir específicamente algunas muestras con valores altos de P y de MOS y otras muestras con valores bajos de P y de MOS. No obstante. Este último punto subraya o enfatiza gran parte de lo que sigue en este capítulo. relativamente. es imposible elegir cuáles.

Cuando se determina la distancia entre los sitios de muestreo y el tamaño total del área de estudio. y sus efectos combinados pueden ser estimados. La única manera cierta para determinar el efecto de un cambio. puesto que se desconoce el tiempo necesario para el monitoreo. entonces se abren nuevos debates con una probabilidad de mejorar el diseño del estudio. que indiquen lo que pasaría con la biodiversidad del suelo si los usos de suelo cambian en el futuro. pero aún puede resultar útil cuando se enfoca con un diseño de muestreo. en lugar del experimental. como el que se observa en la Figura 2. sin embargo. generalmente. sin embargo. Lo anterior. muchas veces es la única opción disponible. puede que sea imposible o inútil producir un solo índice de biodiversidad del suelo.Entonces. es hacer justamente el cambio y esto precisamente constituye la base de un enfoque experimental. Aunque la validez de este enfoque puede ser cuestionable. En la práctica. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 57 . Se espera que las correlaciones entre la intensidad de usos de suelo y la biodiversidad del suelo reflejen alguna conexión causal. Si tenemos que utilizar un diseño de estudio observacional. dicha investigación iría acompañada de un experimento. se aplican los mismos principios de diseño. En el presente estudio. lo ideal sería llevar a cabo un estudio longitudinal. Si éstas se seleccionan explícitamente. no siempre resulta viable. tampoco es viable en un proyecto de duración fija y corta. Las discusiones en este capítulo sólo consideran esquemas alternativos de muestreo para datos colectados por el método transversal. como en muchos otros.1 y las relaciones pueden ser más complejas que el caso de dos líneas rectas. el investigador hace una selección de las escalas importantes para su estudio. se utiliza una aproximación transversal. Este planteamiento es muy amplio. Otro ejemplo de una hipótesis implícita en muchos de los estudios es la escala espacial en la que ocurren los patrones interesantes. los efectos de ambas variables. El objetivo global del proyecto CSM-BGBD fue comprobar la hipótesis de que un incremento en la intensidad del uso del suelo cambia la biodiversidad del suelo (más específicamente. considerando un rango de usos de suelo en un momento específico de tiempo. en donde las parcelas sean monitoreadas a través del tiempo para observar si los cambios en la biodiversidad del suelo pueden ser correlacionados con cambios en el uso del suelo. En términos ideales. señala una pérdida de biodiversidad del suelo).

Paso 1: Defina objetivos Como se indicó en la sección de objetivos del estudio y bases de muestreo. dando un estimado pobre de la pendiente. tiempos y disponibilidad de expertos. esto aumentará la precisión de la estimación de la pendiente. serán diferentes para cada estudio y darán a cada investigación un aspecto único. Asimismo. la necesidad de transportar con rapidez las muestras desde el campo hasta el laboratorio. por estratificación. con base científica y de las propiedades que ofrecen los diversos métodos.Figura 2. no obstante. probablemente arrojará la mayoría de los valores de MOS cercanos a la media. b) si se incluyen de manera deliberada valores de MOS más extremos. por ejemplo. podría surgir una serie de restricciones adicionales. los objetivos determinan todos los aspectos del diseño. Escríbalos y compártalos con otros para 58 Manual de biología de suelos tropicales . el acceso limitado a localidades deseadas para muestrear. Sin embargo. desde un principio deberán ser expresados de manera clara y precisa. por lo tanto. Requiere de un entendimiento profundo. o bien. Los detalles de cómo dichos factores prácticos y teóricos pueden mezclarse. ENFOQUES PRÁCTICOS El diseño de un esquema de muestreo exitoso y práctico es todo un arte. es posible que se especifiquen algunos pasos del proceso en general que se deben seguir en cualquier estudio. es necesario que se combine con las restricciones prácticas impuestas por costos.1 Diseños para estimar la relación entre biodiversidad del suelo y MOS: a) muestreo aleatorio o en cuadrícula.

que pueda discutir algunas sugerencias. Paso 4: Elabore un diseño Elabore un diseño tentativo utilizando una combinación de principios generales. Consiga el mayor número de comentarios y sugerencias de los expertos en la materia. datos meteorológicos (ej. siempre deberá plantear un proyecto realista.. o bien. Después deberá comprobar con cuidado que: a) los resultados realmente logren los objetivos y b) que el diseño de muestreo simulado realmente pueda mostrar estos resultados. ¿Cuáles cumplen con sus objetivos y proveen evidencia para su hipótesis?. Escriba el diseño con tantos detalles como sea posible. Estos expertos pueden ser investigadores que trabajan sobre temas similares en otros lugares. otros que tienen experiencia en los métodos que va a utilizar. mapas de cobertura del terreno). indican la estratificación por altitud o nos permiten entender los problemas de acceso). Estos incluyen: mapas topográficos (ej. diseños utilizados en otros estudios y su imaginación.. Paso 2: Consulte otros estudios Consulte los estudios relacionados con su investigación. para ayudar a decidir cuáles son las temporadas idóneas para el muestreo de campo). Paso 3: Reúna datos relacionados Reúna información o antecedentes que serán necesarios para diseñar los detalles del muestreo. Una herramienta que ayuda a refinar los objetivos es la presentación de resultados simulados. Si bien puede haber aspectos sobre los cuales tenga poca idea. mapas de uso de suelo (ej. Cada estudio cuenta con aspectos únicos y siempre habrá estudios previos de los cuales puede aprender: ésto le permitirá entender qué aspectos de los métodos utilizados han tenido éxito y cuáles limitan la eficiencia y calidad de los resultados. para identificar los principales usos del suelo que se incluirán en el estudio). D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 59 .1 es un ejemplo simple. su propia experiencia. Anote específicamente el tamaño de las muestras utilizadas y la variación de los resultados... anótelas y numérelas. Imagínese que ha finalizado el estudio y ha obtenido resultados ¿Qué tablas y gráficas le gustaría presentar?. La Figura 2. imágenes de detección remota (ej. otros que han trabajado en el mismo sitio.

Paso 7: Revise los pasos En cualquier paso. éstos pueden ser personas que han trabajado con temas similares. JERARQUÍA. que han usado métodos similares o que han trabajado en la localidad o simplemente. En cada área. uno o más sitios de estudio (etiquetadas como “ventanas”) fueron seleccionados. El proyecto CSM-BGBD es un buen ejemplo. Dentro de cada país. Un buen estadista. Trate de incluir un estadista con experiencia en investigación en ecología. Asimismo.Paso 5: Revise su diseño Comparta su diseño con otros investigadores para que expresen su punto de vista y sus comentarios. revise los objetivos a la luz de nueva información. también permita estimar el tiempo del muestreo y el procesamiento de las muestras. un error común es obtener información que sugiere que los objetivos son inalcanzables. pero deberás seguir adelante. considerará algunos aspectos que pueden pasar desapercibidos por el ecólogo. procedimientos de manejo de datos. En particular. procese algunos datos hasta llegar a un análisis estadístico. De ser posible. Una investigación piloto abre la posibilidad de evaluar el aspecto práctico del esquema de muestreo. puesto que involucra varios países. permita probar y refinar los protocolos de medición. lo que puede ser útil para ayudar a decidir el tamaño final de la muestra. De nuevo.. probablemente. esto dará una indicación de la variabilidad. REPLICACIÓN Y TAMAÑO DE MUESTRA La mayoría de los diseños de estudio son jerárquicos y el problema de muestreo no sólo consiste en seleccionar el sitio de muestreo dentro del área de estudio. puede ser que tenga que retroceder a un paso anterior para volver a intentar. fueron seleccionadas una o más áreas de estudio. etc. que expresan su opinión acerca de su tema. Dentro de cada sitio de estudio alrededor de 100 puntos de muestreo fue60 Manual de biología de suelos tropicales . Paso 6: Realice una prueba piloto Pruebe su enfoque.

dicha selección se deberá basar en los objetivos del estudio y en la aplicación de algunos principios. El objetivo de la investigación es encontrar algunos patrones. relacionados con los usos de suelo. Lo primero es centrarse en la idea de una teoría de muestreo de una “población”. La selección de algunos países puede estar basada en función de su política o de los intereses de algunas agencias financiadoras e investigadores que dirigen el proyecto. estrictaD iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 61 . Por lo tanto. evaluada mediante un análisis estadístico) que las muestras de bosque contienen mayor diversidad que las de los campos cultivados. Si se desean resultados que apliquen a los límites del bosque de África del Este en general. En cada capa jerárquica. ya que estos patrones pueden utilizarse para hacer predicciones y pueden reflejar algunas reglas o procesos. en algún nivel. pero. El muestreo implica que el conjunto sobre el que nosotros queremos hacer inferencias (“la población”) necesita ser delimitado antes de que un esquema de muestreo pueda ser planteado. Como ejemplo.ron seleccionados y en cada punto se tomaron muestras (el protocolo de medición determina más capas en la jerarquía. ¿cuáles son? En los niveles más altos. Los patrones de interés son los que mantienen una consistencia a través de un número de casos. lo que requerirá de una muestra de fincas pertenecientes a esta localidad. que trata de mantener la consistencia de patrones y relaciones. Suponga que cuenta con diez muestras tomadas de un bosque y diez en las cercanías de campos cultivados y que las muestras de bosque tienen consistentemente una alta biodiversidad del suelo ¿qué podría concluir? Si las muestras fueron seleccionadas de manera apropiada. se podría estudiar la biodiversidad del suelo en fincas alrededor de los límites del bosque en el monte Kenia. tales como los patrones de la diversidad del suelo. sólo podemos hacer afirmaciones sobre el monte Kenia con base en los datos obtenidos y no es posible extrapolarlos a otros lugares. como consecuencia de la extracción de cuatro muestras tomadas para la caracterización del suelo y sub-muestras de éstas para los análisis químicos). La segunda idea es la de replicación. es necesario repetir observaciones con el fin de determinar si los patrones son realmente consistentes. puede concluir (con un grado conocido de incertidumbre. aunque. La terminología es confusa y no tiene nada que ver con una población biológica. se plantean las mismas preguntas: ¿cuántas unidades deberían de ser seleccionadas?. La intención es saber a qué se refieren sus resultados. entonces también se necesitará una muestra de otros bosques. las respuestas no necesariamente estarán basadas en la ciencia. Sin eso.

Nótese que no es necesario muestrear todos los usos de suelo en cada ventana. muestras múltiples de un mismo bosque no sirven al mismo propósito. utilizando más ventanas y más pequeñas (Figura 2. Por ejemplo. El que muestras repetidas dentro de un bosque sirvan para ser interpretadas de igual manera que las muestras de diferentes bosques depende de las propiedades de los datos y no.2a. la 62 Manual de biología de suelos tropicales . Dicha cuadrícula es una “ventana” con 77 puntos de muestreo (intersecciones) definidos. determina el nivel jerárquico donde se requiere tener réplicas. Sin embargo.mente hablando.2d). para poder examinar las diferencias en la biodiversidad del suelo. por lo que no pueden ser considerados representativos del uso de suelo. a través de un diseño que replique bosques y otros elementos de uso de suelo. entonces en algún momento se perderán las ventajas posibles de muestrear por cuadrícula y se terminará con un diseño que podría parecer un muestreo aleatorio de sitios individuales.2c). del diseño de muestreo. como los sitios de estudio pueden proveer un nivel de replicación. En la Figura 2. las unidades de nivel más alto. Dentro de un estudio jerárquico. sólo podrá concluir que ese bosque en particular es más diverso y no. Algunas de las implicaciones de estas ideas en el muestreo de cuadrícula son ilustradas a través de un ejemplo simplificado que se muestra en la Figura 2. patrones consistentes entre sitios. representan una “regla” aplicable ampliamente. los bosques en general. ha sido construida una cuadrícula de tal manera que incluya los dos usos de suelo. por lo tanto. deberá buscar una consistencia en varias de ellos. etiquetados como: “bosque” y “agricultura”. La palabra “escala” es confusa y controversial en la ecología (Peterson y Parker. probablemente. Una respuesta a esto es definir una nueva categoría de “límites de bosque” y asegurar ventanas en los tres sitios de muestreo (Figura 2. puesto que representan “pseudo-réplicas”. Si este proceso de reducir el tamaño de las ventanas mientras se incrementa su número se continúa.2. pero queda claro que la escala en que se anticipan o hipotetizan los patrones. La replicación puede aumentarse y abarcar más área total observada. Una crítica a este tercer tipo de diseño es que todos los sitios de muestreo en tierras agrícolas quedan cerca de un límite de bosque. varios bosques son muestreados. Dentro de cada sitio de estudio se podrán establecer conclusiones más contundentes si por ejemplo. Si busca una conclusión válida para los bosques. El objetivo es muestrear un paisaje con dos usos de suelo. 1998). Un enfoque más certero es asegurar una replicación válida y algunos resultados genéricos.2b se pueden observar tres ventanas más pequeñas para muestrear tres diferentes parches de bosque y no uno solo. En la Figura 2.

Figura 2. Los dos ejemplos del párrafo anterior son análisis que utilizan factores del paisaje. Una hipótesis diferente sería “la biodiversidad del suelo en parcelas agrícolas decrece con la reducción de la cobertura del bosque en el paisaje”. En este caso. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 63 . El mensaje es claro: “el nivel de paisaje” no está bien definido y. Lo anterior. los objetivos de un proyecto de biodiversidad del suelo pueden incluir “análisis del paisaje”. utiliza datos en el nivel de parcela y el otro. c) incrementando la replicación. pero no es relevante para afirmar la consistencia del patrón a través de la unidad de 1 km² necesaria para examinar las hipótesis. sin embargo. no queda claro el diseño de muestreo que se necesita. la escala espacial en que se evaluó la cobertura del bosque. se requerirá de más muestras. factores del paisaje como la fragmentación del bosque. Entonces la hipótesis necesita una muestra de una unidad de 1 km². afectan los procesos. se basan en datos de diferentes niveles jerárquicos: uno. b) tres cuadrículas que muestrean tres diferentes parches de selva. se necesita definir el significado de “en el paisaje”. Para poder evaluar la biodiversidad del suelo dentro de un 1 km². datos en el nivel de unidades de 1 km². por lo tanto.2 Cuatro enfoques para utilizar muestreo en cuadrícula en un paisaje con dos usos de suelo. suponiendo que fue definida como áreas de 1 km². con réplicas en cada distancia. En otras áreas de la ecología. con la definición de algunos sitios dentro de cada unidad. selva y agricultura: a) una cuadrícula sencilla que incluye un parche de selva. Ahora es la réplica quien determina la necesidad de varias áreas en cada nivel de cobertura de bosque. si se intenta hacer un “análisis en el nivel de paisaje”. con varios niveles de cobertura de bosque. es decir. hipótesis puede ser “la biodiversidad del suelo en parcelas agrícolas decrece con el aumento a la distancia del límite del bosque”. d) reconociendo los límites como otra categoría. puede ser investigado con parcelas (sitios de muestreo) en un intervalo de distancias. La réplica dentro de la unidad es importante para determinar la precisión con que la biodiversidad del suelo es medida para cada unidad.

en la práctica. ningún estudio real ha multiplicado las respuestas de interés. al igual que el software para iniciar el análisis. Aunque sean teóricamente atractivos. de tal manera que los patrones. es improbable su viabilidad. puedan ser investigados. Una variedad de diseños a multi-escala han sido utilizados en estudios ecológicos. es improbable que sean prácticos para los estudios de biodiversidad del suelo porque el trabajo necesita planearse en distintas fases de campo y de laboratorio. medida de diferente manera. No obstante. muchas veces no es posible especificar un tamaño de muestra que resulte importante. Si bien existe cierta atracción por esta idea. Enfoques secuenciales (Pedigo y Buntin. sin embargo. Por lo tanto. como la diversidad de diferentes grupos funcionales. los métodos estándares están disponibles para ayudar a seleccionar el tamaño de muestra. Cuando la investigación es dirigida a medir respuestas económicas para decisiones de manejo (por ejemplo. 1996) permite que el diseño responda a patrones que se detecten. Los métodos estándares presumen que existe una respuesta medible de la biodiversidad del suelo que se puede utilizar para obtener el tamaño de muestra. a diferentes escalas. cuando el objetivo de la investigación es detectar y entender algunos procesos. se incluyen ambos 64 Manual de biología de suelos tropicales . Los métodos requieren conocimiento de dos cosas: de la magnitud de las diferencias (por ejemplo. la diversidad del suelo entre dos usos de suelo) que es importante detectar. y la variabilidad entre réplicas del mismo uso de suelo. Los patrones a escala fina requieren puntos muy cercanos. 1993) permiten continuar con el muestreo hasta que algunos criterios se cumplan. El muestreo adaptativo (Thompson y Seber. dada la necesidad de planear campañas de campo por adelantado. Otra complicación surge a partir de las respuestas multivariadas de interés. biomasas y proporciones de estos grupos funciones o especies. La idea de estos diseños es elegir posiciones de muestreo.Una vez que se sepa lo que hay que replicar. la respuesta de un cultivo a un fertilizante) entonces es viable especificar la respuesta mínima que es importante detectar. pero saber qué relevancia tendrá en nuevos ambientes puede ser desconocida. el tamaño de muestra se ha basado en una combinación de información de métodos formales (lo que puede indicar los órdenes de magnitud requeridos). y estudios previos similares y pilotos. Patrones a escala más grande. pero normalmente resulta difícil especificarlos. números. requieren puntos más lejanos. Una estimación aproximada de la varianza puede ser obtenida de estudios previos. Queda claro que la decisión sobre el tamaño de muestra depende de esto. con muchas mediciones que sólo están disponibles después de un largo periodo de muestreo en campo. etc. Por lo tanto.

Stein y Ettema. Necesitará muestrear dentro de toda esta parcela. Algunas veces se piensa que este enfoque puede estar “sesgado” porque los tipos de uso de suelo para tomar las muestras se determinan a priori. <10 m) no se han examinado. existen dos razones para ello: una. entonces los resultados pueden estar sesgados. quizá en un área del orden de 100 m². Normalmente. requieren establecer comparaciones en diferentes usos de suelo. En este sentido. la segunda. se requiere tomar muestras (ver esquema de puntos de medición abajo). el número promedio de escarabajos por m2) sin tomar en cuenta un diseño. No obstante. se sugiere que un buen enfoque en los objetivos de un estudio mejorará la eficiencia en su diseño e incrementará la posibilidad de lograrlos. todas las mediciones se realizan a nivel de parcela. lo que asegura que se obtengan muestras realmente representativas. podrá alterar otros grupos. sino de una parcela. puesto que habría demasiadas muestras para procesar si no fuera así. En cada sitio de muestreo seleccionado. muestras de cada uno de ellos. Así. simplemente es práctica. no en función de un punto. 2002. y los diferentes usos de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 65 . El objetivo de descubrir y entender los efectos del uso de suelo en la biodiversidad del suelo..y los diseños eficientes tienen una estructura en forma de conglomerado (Urban et al. de manera deliberada. Un buen enfoque para mejorar el diseño de muestreo es el uso de la “estratificación”. normalmente sólo resulta posible examinar un grupo en una muestra de suelo dada y la extracción de la muestra de un grupo. ENFOQUE DE OBJETIVOS: ESTRATIFICACIÓN En la introducción de este capítulo. antes de cuantificar la biodiversidad del suelo. pero únicamente un volumen de suelo muy limitado puede ser examinado en la mayoría de las mediciones de biodiversidad del suelo y se toman varias muestras para poder representar toda la parcela. de tamaños adecuados. los estratos son áreas con diferentes usos de suelo y la idea es obtener. Si los datos se usan para hacer afirmaciones sobre el área de estudio en general (por ejemplo. para cada uso de suelo. Piense en un lugar seleccionado. lo que quiere decir que se mezclan varias muestras de suelo. dentro de cada parcela se reúnen las muestras. esto significa que la variación y los patrones en la escala dentro de la parcela (por ejemplo. esto quiere decir que se tiene que medir en el mismo lugar. seguramente las relaciones entre ellos son importantes. responde a la necesidad de contar con mediciones iguales de diferentes grupos funcionales del suelo. 2003). Cuando varios grupos de especies están siendo evaluados.

¿dónde se encuentra el límite entre “pastizales con árboles” y “bosque secundario”?. ni aquellas zonas de transición que puedan ser importantes. el mejor diseño es tener N/2 en cada uno de los dos grupos. éstos deberán ser incluidos específicamente en el muestreo. pero si el objetivo es investigar los efectos de uso de suelo. Si se cuenta con un total de N muestras para comparar dos usos de suelo entonces. tiene sentido excluir tales sitios. Si los objetivos incluyen investigación en límites entre áreas de diferentes usos de suelo o de nichos raros.suelo pueden no estar representados en las muestras. entonces existen dos prerrequisitos: 1 Se necesita saber cuáles son los usos de suelo a comparar y contar con definiciones precisas de ellos. de no ser así. con frecuencias proporcionales a su ocurrencia en el área de estudio. Se requiere de un mapa de uso de suelo del área bajo estudio. El primer aspecto hace que algunos investigadores se sientan incómodos ante la idea de que una predefinición de uso de suelo para la investigación excluya el descubrimiento de patrones potencialmente importantes. por ejemplo. puesto que no habrá certeza en cómo clasificarlas. entonces probablemente muchos de los sitios de muestreo seleccionados terminarán siendo posiciones ambiguas en lo que se refiere a la definición de uso de suelo. Por ejemplo. el diseño no es parcial para el objetivo de comparar los usos de suelo y además es eficiente. no es deseable excluir algunos usos de suelo. Resulta más eficiente incluirlas en un número 66 Manual de biología de suelos tropicales . a partir de las cuales no se podrán establecer conclusiones. La predefinición. ¿cuándo se debe uno de mover a lo largo de un gradiente para incrementar la cobertura de árboles? Aquí tenemos otra ganancia potencial en la eficiencia del pensamiento a través de estos requerimientos en el diseño y no sólo en la etapa de análisis. si el objetivo es hacer un inventario del paisaje. sin embargo. En un enfoque estratificado. 2 Las localizaciones de estos usos de suelo deben ser conocidas. al igual que la necesidad de definir con precisión. Sin embargo. Si un diseño de muestreo no toma en cuenta el uso de suelo. rasgos lineales. es probable que la muestra incluya únicamente algunas observaciones de estas categorías. Por supuesto. podemos elegir un tamaño idóneo de muestra para cada uso de suelo. tiene que considerarse en algún momento. en ausencia de alguna otra información. Con un enfoque de muestreo estratificado. las áreas ambiguas pueden ser excluidas del muestreo. Si se emplea este enfoque.

El uso de un software para ayudar en la aleatorización y un GPS para localizar los puntos de muestreo en el campo. o en imágenes de SR y utilizar esto para definir los estratos. Por ejemplo. Aunque a veces es necesario. El muestreo aleatorio estratificado requiere hacer lo mismo en cada estrato. cuando se toman muestras en lugares considerados interesantes o importantes. y seleccionar los sitios de muestreo de manera aleatoria. no es una limitante. que frecuentemente sirven como base para seleccionar unidades de muestreo a niveles jerárquicos más altos. y b) la selección de un punto no cambie la probabilidad de incluir cualquier otro punto. excluirlas (dándoles un equivalente de tamaño cero). no son usos de suelo per se. Si se toma un tamaño de muestra subjetivo igual a 1. Ello queda. influenciadas por el uso de suelo. algunas veces por una buena razón. puede ser útil hacer un monitoreo rápido de la MOS. resultan muy útiles en la práctica. abierto al debate cuando los resultados son presentados. si los objetivos lo requieren. Nótese que muchos de estos argumentos también aplican cuando los factores hipotéticos que influyen sobre la biodiversidad del suelo. tales como la MOS o la frecuencia de fuego. si los objetivos no lo requieren. ya que existe la posibilidad de la interpretación de imágenes por sensores remotos (SR). Para la implementación del MAS es necesario delimitar el área de estudio. El no contar con un mapa de usos de suelo. Un enfoque común no aleatorio es una selección subjetiva de los sitios de muestreo. esto es equivalente a limitar el área de estudio. MUESTREOS ALEATORIO Y SISTEMÁTICO Las razones esenciales para utilizar el muestreo aleatorio simple (MAS) fue descrito anteriormente y son detalladas en textos tales como Cochran (1977). por ejemplo. Sin embargo.suficientemente grande. el que estos no tengan una resolución idónea. cuando una “ventana” única se coloca en un área. por lo tanto. entonces dicha área queda representada por esa ventana y el hecho de D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 67 . o bien. los estudios ecológicos no siempre usan un muestreo aleatorio. de la propiedad inherente del diseño. calibrarlo en un mapa de uso de suelo. de tal modo que: a) cada punto tenga las mismas posibilidades de ser seleccionado. sino variables ambientales. Cuando se usan variables como la MOS en la estratificación. la limitante de este enfoque es la posible falta de “representatividad” del área de muestreo (la medida en que los resultados pueden razonablemente ser asumidos para aplicarlos a una población más grade) porque ésta depende de la percepción del ejecutor y no.

que esa área sea o no, representativa dependerá únicamente de la habilidad del ejecutor. El muestreo sistemático tiene muchas aplicaciones en la ecología, usando transectos de una dimensión o cuadrículas de dos dimensiones. En el caso de los transectos, las muestras son seleccionadas en puntos que se encuentran a una distancia fija entre sí, a lo largo de una línea predeterminada. Para un muestreo de cuadrícula, una cuadrícula rectangular (usualmente) es definida en el área y las muestras son tomadas en cada punto de intersección. Las ventajas potenciales de este tipo de muestreo sistemático se derivan de la teoría y de la práctica. Las ventajas de la práctica incluyen:
• La facilidad de localizar puntos de muestreo, describir su ubicación y los medios de llegar a los puntos de muestreo; por ejemplo, el protocolo puede ser algo tan simple como “desde el punto de partida, camino al norte y muestreo cada 50 m”. • La facilidad de planear el trabajo de campo; por ejemplo, de estimar el tiempo requerido para muestrear un número fijo de puntos. La razón estadística para utilizar muestreos sistemáticos es que pueden ser eficientes (Webster y Oliver, 1990). Si se considera un estudio con el propósito de calcular la media o el total de algún parámetro (por ejemplo, el carbono total en el suelo en el área de estudio o la media de escarabajos por m2). Si la cantidad medida no es constante, una muestra que utilice la cuadrícula dará una mejor estimación que una simple muestra al azar del mismo tamaño, lo que frecuentemente es el caso de variables ambientales y biológicas. La eficiencia se basa en el hecho de que puntos cercanos son similares, por tanto, no proporcionan mucha información nueva; mientras que en la cuadrícula las muestras están de manera uniforme en toda el área de estudio. Por razones similares, el enfoque de cuadrícula resultará útil para compilar el inventario de un área bajo estudio, salvo que puede excluir nichos raros (véase abajo). Sin embargo, hay aspectos negativos: • Algunos puntos de la cuadrícula tendrían que ser excluidos del estudio, tales como caminos o cuerpos de agua. • Las cuadrículas incluyen muestras de diferentes usos de suelo, con un tamaño más o menos proporcional en cada tipo de uso de suelo. En particular, tipos de uso de suelo raros pueden ser omitidos, lo que se puede compensar moviendo
68
Manual de biología de suelos tropicales

la ventana y añadiendo puntos, aunque el proceso podría llegar a ser arbitrario y subjetivo. • Algunas veces no es posible caracterizar el uso de suelo claramente en cada punto de muestreo. Estos puntos están relacionados con el problema discutido en la sección “enfoque de objetivos: estratificación”. Si el objetivo del estudio es comparar clases de uso de suelo, entonces el muestreo por cuadrícula, a veces, no los captura de forma óptima, de manera que las cuadrículas y los transectos probablemente son más apropiados para muestrear la biodiversidad del suelo, cuando a) no existe ningún objetivo explícito o hipótesis que involucre comparaciones o relaciones con variables ambientales, o b) la hipótesis se refiere a una unidad espacial de un nivel más alto que la escala en que el muestreo por cuadrícula o por transecto fue hecho. Por ejemplo, Swift y Bignell (2001) recomiendan transectos de 40 m de largo, pero éstos quedan dentro de cada clase de uso de suelo. Cuando se comparan usos de suelo, se hacen réplicas de los transectos y se asignan aleatoriamente los estratos definidos por diferentes usos de suelo. De esta forma, el muestreo sistemático por cuadrícula o transecto, normalmente, es combinado con un muestreo aleatorio. Por ejemplo, puede haber varias cuadrículas definidas como se aprecia en la Figura 2.2d, con una localización y orientación hecha al azar. De manera similar, el punto de inicio y la orientación de los transectos que se repiten pueden ser hechos aleatoriamente. Los transectos también pueden ser útiles cuando se alinean con gradientes ambientales considerados importantes; esto se conoce como “gradsectos” (Wessels et al., 1998). Con la aleatorización en algún nivel en la jerarquía, es posible hacer un análisis estadístico basado en las propiedades aleatorias del diseño; por ejemplo, si un número de cuadrículas pequeñas es colocado aleatoriamente en el área de estudio, entonces contamos con las réplicas necesarias para establecer una consistencia, a través de patrones encontrados. El análisis estadístico elegido para una muestra tomada en un diseño sistemático no puede estar basado en la aleatorización, porque los sitios no fueron seleccionados de manera independiente dentro de cada cuadrícula. Existen dos posibles enfoques para el análisis: el primero asume que los datos se comportan de forma aleatoria (por ejemplo, las propiedades estadísticas son las mismas, como si el punto hubiera sido localizado aleatoriamente); el segundo, es utilizar un modelo explícito de patrones espaciales. En la mayoría de los análisis que buscan relaciones entre variables ambientales y la biodiversidad del suelo se usa el primer análisis,
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

69

principalmente, porque las alternativas son complejas. Las consecuencias de suponer esto son raramente investigadas. Es claro que la distancia y el tamaño total de la cuadrícula determinan la escala de los patrones que pueden ser detectados. No es posible observar patrones (por ejemplo, agregación de la biodiversidad del suelo) a escalas espaciales menores que las distancias entre los puntos de la cuadrícula; de la misma manera, tampoco será posible detectar patrones más grandes que el tamaño total de la cuadrícula. Sólo se pueden reconocer los patrones cuando existen varias repeticiones dentro de la misma cuadrícula. Es este aspecto de escala de patrones, definido por los objetivos del estudio, el que debería determinar los espacios y el tamaño total de la cuadrícula. Algunas veces se sugiere que los espacios deben ser de tal manera que los puntos vecinos no estén correlacionados. Esta noción de correlación espacial es importante, pero también confusa. La correlación entre las mediciones de una determinada distancia, no es una cantidad absoluta, pero es una medida relativa a un promedio (técnicamente, el problema tiene que ver con el recambio). Para poder ver esto, piense en analizar datos de una sola ventana en Kenia, donde los puntos de una distancia de más de 200 m entre sí, pueden no indicar similitud en la biodiversidad del suelo, pero si juntamos los datos con otra base de datos global se esperaría encontrar similitud, no sólo en los puntos que pertenecen a una misma ventana, sino entre todos los puntos dentro de Kenia. HABLANDO DE VARIABILIDAD La experiencia de estudios pasados sugiere que se debería de esperar un alto nivel de variación en muchas de las mediciones principales de la biología del suelo. Aún cuando se trata de distancias cortas, se puede esperar una variación grande en número y diversidad de diferentes grupos funcionales. En paisajes agrícolas tropicales la variación dentro de una categoría de uso de suelo puede ser debida a las prácticas de manejo, la variación en las características de la vegetación, las diferencias históricas en el uso de suelo de la parcela, efectos de borde, posición topográfica y características biofísicas. Si los métodos formales para determinar los requerimientos del tamaño de muestra fueran seguidos, probablemente indicarían un tamaño de muestra mucho más grande de lo es viable o costeable, ¿Qué se debe hacer entonces? Primero, ¡no tiene sentido no hacer nada! Simplemente, si se sigue con un tamaño de muestreo preconcebido, no se alcanzarán los objetivos; si el plan original fue
70
Manual de biología de suelos tropicales

trabajar con diez muestras por cada uso de suelo dentro de un sitio de referencia, y las indicaciones son que se necesitan alrededor de 100 muestras por cada uso de suelo, no tiene sentido continuar, puesto que se terminarán obteniendo resultados vagos y no concluyentes, los cuales se traducirán en errores estándares altos y sin efectos significativos cuando se analizan los datos. Tres son las posibles opciones: 1. Incrementar el tamaño de muestra. 2. Utilizar métodos de muestreo para reducir la variabilidad. 3. Reducir la amplitud del estudio. La primera opción no resulta práctica en la mayoría de los casos, pues siempre hay limitaciones de tiempo, dinero, recursos y experiencia. Existen varios métodos para reducir la variabilidad de las muestras; los más útiles consisten en la estratificación y la congruencia. Nótese que el uso del término “estratificación” se usa para el muestreo, pero es diferente a cómo se aplica en “enfoque de objetivos: estratificación” (arriba). Si algunas fuentes de variabilidad pueden ser previstas, éstas pueden ser usadas para definir estratos y removerlas del análisis. Por ejemplo, si el sitio de estudio cubre un rango de altitudes, se puede esperar una variación en la biodiversidad del suelo dependiendo de la altitud. La estratificación, entonces, divide el sitio de estudio en zonas de altitud y los sitios de muestreo dentro de cada una de ellas. En esta fase del análisis de datos, la variación de los usos de suelo se compara dentro y entre estratos para no oscurecer los resultados. Este enfoque requiere que algunos (no todos) de los diferentes usos de suelo estén localizados dentro de zonas de altitud. Si el uso de suelo únicamente varía con la altitud, entonces los dos factores están confundidos y sus efectos en la biodiversidad del suelo no se distinguen. Dado que existe una variación ambiental, la variabilidad en la biodiversidad del suelo estará en respuesta a la variación ambiental. Consecuentemente, los estratos pueden ser útiles para definir puntos de muestro cercanos geográficamente. Las ventanas en la figura 2.2 pueden ser vistas de esta manera. Comparar conlleva la idea de la estratificación a un extremo. Imagine que si dos de los usos de suelo a comparar son bosque y campos de maíz, se puede esperar que la biodiversidad del suelo dependa de muchas variables ambientales, tales como el clima, topografía, y geología. Estas variables ambientales varían típicamente de manera irregular, con sitios cercanamente similares. De esta manera, si seleccionamos parcelas de bosque y maíz que están cercanas, las diferencias entre ellas, principalmente, se deberán al uso de suelo y no, a otros factores, lo que nos
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

71

permite eliminar las variables que “meten ruido” en el análisis. Entonces, el enfoque sería identificar y muestrear, por ejemplo, diez pares de sitios, donde cada par esté formado por parcelas de bosque y maíz cercanas, situadas a cada lado de un lindero de uso de suelo. Formalmente, cada par constituye un estrato de tamaño 2. Más de dos usos de suelo pueden incluirse en el diseño. Las ideas de diseño para experimentos de bloques incompletos son relevantes para seleccionar pares de usos de suelo similares. Controlar la variabilidad mediante la reducción del área de estudio, muchas veces es la mejor solución. El área podría ser reducida, si se reduce el tamaño del sitio de muestreo, reduciendo naturalmente la heterogeneidad, lo que puede ser insatisfactorio porque también reduce la generalidad de los resultados. Si únicamente tomamos muestras en un área pequeña, entonces no existe una base para asumir que se han encontrado patrones ampliamente aplicables. Otras maneras de reducir el ámbito del sitio de estudio son: No incluir todos los usos de suelo encontrados en el área de estudio, sino una selección que cubra un gradiente de intensidades de uso de suelo o que represente alguna transición típica en el uso de suelo. Ajustarse a la definición de una clase de uso de suelo. Por ejemplo, en lugar de tomar un “campo de maíz” como uso de suelo, se podrá limitar la atención a campos de maíz que han sido cultivados continuamente durante los últimos diez años, que no han sido fertilizados en los últimos tres años y que son trabajados con azadón. Evitar tomar muestras en sitios ambiguos, como aquellas que se encuentren cerca de linderos. Mientras esto ayudará a detectar y medir el efecto de la intensidad de uso de suelo en la biodiversidad del suelo, pueden ser inconsistentes con los objetivos del inventario de las especies. Un compromiso entre los dos objetivos puede ser necesario. Esto es común en el diseño de proyectos y, en resumidas cuentas, no se puede esperar encontrar todo en un tamaño limitado de muestra. ESQUEMA DE MEDICIÓN DE PUNTOS Una vez localizados los puntos de muestreo, tiene que ser definido un protocolo de medición, lo que implica la necesidad de un muestreo adicional. El esquema básico
72
Manual de biología de suelos tropicales

de muestreo por puntos adoptado por el CSM-BGBD se presenta en la Figura 2.3, que a la vez se complementa con la Tabla 2.1. Aunque el esquema de medición utilizado para el muestreo de grupos funcionales que son descritos por los procedimientos del proyecto alternativas de roza, tumba y quema (Swift y Bignell, 2001), es diferente de lo que fue propuesto por Swift y Bignell para adecuarse al enfoque basado en la cuadrícula. Por ejemplo, los pocos monolitos en cada punto de muestreo son compensados por el gran número de puntos de muestreo, que resulta en aproximadamente el mismo número de eventos de muestreo. No obstante, los resultados preliminares han indicado que con un pequeño monolito por punto de muestreo no todas las especies pueden ser capturadas. Si éste es el objetivo para llevar a cabo el muestreo, se prevén opciones adicionales para incluir monolitos más grandes. Macrofauna: un solo monolito, trampas de caída (pitfall) y, por lo menos un transecto de 20 m son colocados en cada sitio de muestreo. El muestreo por transectos se amplía para incluir hormigas y escarabajos, en adición a las termitas. En un esquema alternativo adicional los monolitos pueden ser excavados para mejorar el muestreo de lombrices de tierra y se puede introducir un sistema simple para tomar muestras de termitas. Nótese que en las parcelas pequeñas, los sistemas de cultivo pueden estar altamente disecados o los terrenos son difíciles, por lo tanto, no es necesario que el transecto sea lineal. Un transecto puede tener un ángulo de 90 grados, y muestrear parcelas de forma irregular o para evitar arroyos, fuertes pendientes o rocas. Los árboles caídos deben incluirse en el transecto si estos quedan sobre la línea (Swift y Bignell, 2001). Mesofauna: 12 extracciones de suelo tomadas en círculos concéntricos alrededor de un solo monolito a 3 y 6 metros de radio, y extraídas utilizando el método Berlese. Adicionalmente, las trampas pitfalls sin cebo abiertas durante un periodo de 24 horas sirven para colectar mesofauna y macrofauna que viven en la superficie. Las trampas pitfalls generalmente son apropiadas para hormigas, algunos escarabajos, algunos saltamontes, milpiés y arañas. Muestras de suelo extraídas con sacabocado por el método de Berlese contienen colémbolos, ácaros y en sitios húmedos enquitreidos. Microfauna: muestreos con sacabocado de manera similar en 12 extracciones de suelo de dos círculos concéntricos, a 3 y 6 metros de radio del monolito. La “microfauna”, principalmente se refiere a nematodos, aunque también a pequeños ácaros (y larvas de ácaros) extraídos de las muestras de suelo; por el método Berlese pueden cuantificarse.
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

73

Figura 2.3 Esquema de muestreo por puntos para toda la biota. El muestreo se puede ampliar si se usa uno o dos transectos para termitas, hormigas y escarabajos, mediante un muestreo casual para termitas (1 hora) y por monolitos adicionales para capturar más lombrices de tierra.

Monolito Núcleo de suelo para mesofauna Núcleo de suelo para nemátodos y microbios Muestras para análisis físicoquimicos Transecto 1 m2 para muestra de hojarasca (Winkler) Trampa pitfall

Microsimbiontes y hongos del suelo: muestreos de manera similar mediante 12 extracciones de suelo con sacabocado, puestas en dos círculos concéntricos alrededor de un solo monolito, a 3 y 6 metros de radio. Parámetros físicos y químicos del suelo: cuatro extracciones de suelo con sacabocado puestas en un círculo de 6 metros de radio de un monolito. En el caso de estudios de co-ubicación, una extracción adicional de suelo puede tomarse de la pared exterior de la zanja del monolito (véase Capítulo 3, muestreo de macrofauna). En un esquema alternativo (Figura 2.4) los usos de suelo pueden ser muestreados por una combinación de monolitos principales y subsidiarios, transectos de 50 metros, cuadrantes de hojarasca espaciadas y trampas pitfalls. El muestreo casual alrededor de los transectos puede ser empleado y también trampas Malaise colocadas para capturar insectos voladores mayores. El protocolo difiere de la propuesta anterior, en lo concerniente a los puntos del transecto, cuadros de hojarasca, trampas pitfalls y monolitos subsidiarios colocados en líneas paralelas de 50 m, con una separación lateral de 10 m. Este protocolo debe ser tomado básicamente como una extensión del propuesto anteriormente y se considera aplicable en donde se le dé más importancia al muestreo de todas las especies que existen dentro del área y en los casos donde la frecuencia de muestreo es baja (número de parcelas muestreadas) por las razones explicadas anteriormente. Estas modificaciones
74
Manual de biología de suelos tropicales

resultan más adecuadas cuando se encuentran diferentes usos de suelo en todos los sitios. CONSIDERACIONES PRÁCTICAS EN LA ORGANIZACIÓN DEL TRABAJO DE CAMPO La colecta de muestras o la medición directa en el campo deberían, en la medida de lo posible, realizarse de forma secuencial y durante una sola salida. En el caso de parámetros físicos y químicos del suelo que permanecen estables en el tiempo, el muestreo puede hacerse en un momento diferente. Lo anterior, por supuesto, no se aplica en el caso de características dinámicas del suelo, por ejemplo, el contenido de agua en el suelo.
Figura 2.4 Esquema alternativo para muestrear macrofauna, utilizando un transecto de 50 m.
Extracción Winkler Transecto Mini-monolito

Trampa pitfall Monolito adicional
12 muestras de suelo (12 x 12 x 10 cm)
MS MS MS MS

Monolito principal 10 m

10 m 10 m 5m 50 m
MS MS MS

MS MS

Monolito adicional

MS MS MS

30 cm Hormigas de hojarasca Hormigas endogeas Termitas

2m

D iseño

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

75

Tabla 2.1 Grupos de organismos del suelo colectados utilizando diferentes métodos de captura.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Manual de biología de suelos tropicales
Suelo Mesofauna Descripción X X X X X X X X

76
Trampas pitfall con cebo* - 3 trampas por punto de muestreo. Las trampas se deben quitar después de 48 horas en campo. Transectos semi-cuantitativos 2 x 20 m uno por punto de muestreo, perpendicular a la pendiente Trampas Winkler para muestras pequeñas de hojarasca (1 x 1 m) a lo largo del transecto, 3 Winkler por punto de muestreo Núcleos de suelo con hojarasca (3.5 x 3.5 x 5 cm),12 submuestras por punto de muestreo (profundidad de 0-5 cm). Para mesofauna se hace una muestra compuesta (1er opción), o 4 muestras compuestas por 3 submuestras de cada cuadrante (segundo opción) o 3 muestras compuestas por 4 submuestras. Núcleos de suelo para microbios de 0-20 cm de profundidad sin hojarasca. En círculos a 3 y 6 m, del punto de muestro, una muestra compuesta de 12 submuestras por punto de muestreo.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

Trampa (pitfall)

X

X

X

Transecto

X

X

Trampa Winkler

X

X

X

Embudo de Berlese

X

X

X

Varios

Tabla 2.1 Continúa.

Hormigas

Termitas

Escarabajos

Lombrices de tierra

Otra macrofauna

Nematodos

Microbios

Monolito X

X

X

X

X

X

X

Mesofauna

D iseño
Suelo Descripción Monolito (25 x 25 x 30 cm), incluyendo hojarasca, una muestra por punto método TSBF. Muestra de suelo, una muestra compuesta de suelo por al menos 4 submuestras para análisis físicos y químicos, profundidad 0-10; 10-20; 20-30 cm.

Componentes de la diversidad/grupos de organismos del suelo

Símbolo del Método

y estrategias de muestreo para la evaluación de la biodiversidad del suelo

*Nota.- El cebo sugerido para las trampas pitfall es excremento de monos o de humanos, el cual es muy efectivo para extraer escarabajos coprófagos (Coleoptera) y, al mismo tiempo, no interfiere con la captura de escarabajos saprofíticos (Scarabaeidae, Aphodidae, Trogidae) y predadores (Sistiridae, Staphilinidae). El excremento de omnívoros, resulta más adecuado, en el caso de áreas de selva tropical porque los omnívoros predominan en estos ambientes

77

La colecta de muestras de los principales grupos funcionales de organismos del suelo, requiere de la colaboración de mucha gente en cada punto de muestreo, con el riesgo de lastimar el cultivo en pie, al igual que afectar el inventario, especialmente de aquellos organismos con alta motilidad o sensibles a la intromisión humana. Por ejemplo, las lombrices de tierra epígeas y algunos tipos de termitas comedoras de tierra son sensibles al disturbio, y especialmente a las pisadas, por lo que se alejarían rápidamente. Por lo tanto, es importante reducir el número de personas involucradas en la colecta de las muestras, aunque se necesita un número suficiente de manos para poder manejar y procesar las muestras. Durante el entrenamiento de técnicos y asistentes de campo, es necesario prestar atención a los riesgos que pudieran surgir en cada grupo específico de organismos de suelo. El riesgo de contaminación cuando se trata de microorganismos debe ser entendido y la importancia de utilizar procedimientos adecuados para evitar la contaminación debe ser enfatizada, especialmente en las personas inexpertas. El mismo principio rige cuando existe la posibilidad de que dichos organismos escapen de los sitios de muestreo, como consecuencia de una severa perturbación. Otra preocupación es el gran volumen de suelo que será colectado durante el muestreo y la necesidad de reducir dicho volumen para transportarlo. Desde este punto de vista, la extracción de especímenes de las muestras se hace mejor en, o cerca, del sitio de muestreo. También, en el sitio de muestreo se deben agrupar todas las muestras y extraer sub-muestras para su posterior análisis. El tiempo y la temperatura a la que se almacenan las muestras juegan un papel importante, dado que muchos organismos del suelo pueden morir a temperatura ambiente, en la superficie del suelo, o cuando son guardados en bolsas o contenedores durante unas cuantas horas. Para poder evitar dichos riesgos es importante identificar una instalación local adecuada antes de colectar las muestras o, hacer la extracción inmediata in situ de los especímenes. En algunas ocasiones, por ejemplo, el embudo de Berlese para la mesofauna y de Winkler para la extracción de hormigas y escarabajos de la hojarasca, pueden instalarse en el campo para su uso inmediato; en otros casos, cuando los organismos necesitan ser cultivados in vitro o cuando las propiedades del suelo necesitan ser determinadas, es necesario disponer de un transporte rápido para su traslado hacia el laboratorio. Bajo ninguna circunstancia las muestras deberán permanecer bajo el sol, ni aun cuando el protocolo de extracción requiera de un secado final de la materia. Otros detalles sobre las precauciones a tomar en cuenta y consejos
78
Manual de biología de suelos tropicales

sobre la logística general, se pueden encontrar en los capítulos que tratan grupos y métodos específicos.

MUESTREO EN EL PROYECTO CSM-BGBD
La jerarquía de muestreo
En el proyecto fueron seleccionadas áreas de siete países tropicales, con el propósito de evaluar la pérdida de biodiversidad del suelo con el incremento en la intensidad del uso de suelo. Los sitios se localizaron en las principales regiones biogeográficas de los trópicos, desde la selva tropical húmeda Amazónica hasta la selva montañosa del Himalaya, en la India; áreas que presentan una biodiversidad global importante. Cada sitio incluyó un intervalo de usos de suelo desde selvas prístinas relativamente no perturbadas, hasta tierras agrícolas sometidas a uso intensivo, para determinar tendencias comunes, que puedan ser observadas en el cambio de la biodiversidad del suelo en relación con la intensidad del uso del suelo. El uso de métodos estándares de muestreo en los países y sitios de estudio, permite hacer comparaciones entre los sitios. Se adoptó un enfoque para el muestreo dentro de los sitios que hace uso del muestreo por medio de ventanas. Una ventana es (usualmente un rectángulo) una parcela de tierra que incluye en el estudio varios usos de suelo locales y se consideran “representativos” de los sitios de estudio. Típicamente, las ventanas miden entre 2 y 5 km²; estas ventanas de muestreo varían en tamaño y número debido a la configuración del uso del suelo en cada sitio, y sólo se presentó un caso donde el acceso fue problemático. Por ejemplo, se utiliza una ventana más grande para incluir los usos de suelo relevantes en el área y hasta seis ventanas más pequeñas se distribuyen dentro del área para los diferentes usos de suelo requeridos. Una cuadrícula regular (con espacios variables, véase a continuación) se utiliza para identificar un conjunto de posibles puntos de muestreo dentro de cada ventana; los puntos corresponden a las intersecciones de las líneas en la cuadrícula. El muestreo de cuadrícula se usó por las razones descritas anteriormente, eficiencia estadística y para racionar el trabajo de campo. Además, el inventario es de naturaleza exploratoria, sin tomar en cuenta la hipótesis general formulada, pues quedan pendientes las siguientes preguntas: ¿cuáles de los factores que determinan las prácticas intensivas de uso de suelo influyen en la distribución y riqueza de la biota del suelo? y, ¿a qué escala los patrones de distribución espacial se manifiestan? Este
D iseño
y estrategias de muestreo para la evaluación de la biodiversidad del suelo

79

enfoque es similar al usado para el proyecto de BioAssess, financiado por la Unión Europea, cuyo objetivo, similar al de éste proyecto, fue evaluar la biodiversidad en función de la intensidad del uso del suelo en paisajes agrícolas (véase Ponge et al., 2003; Federoff et al., 2005). La biodiversidad del suelo se muestrea en el nivel de parcela (punto de muestreo o sitio). La cuadrícula define una serie de parcelas, con un objetivo de cerca de 100 a 200 parcelas por ventana. La parcela es un área de, por lo menos, 25 x 25 m determinada por el área mínima requerida para colectar todas las muestras necesarias y realizar su medición, tal y como se describió anteriormente. El principio de co-ubicación es adoptado para análisis de muestras físicas y químicas del suelo y para los inventarios de la biodiversidad del suelo. Al mismo tiempo las ventanas permiten comparar la biodiversidad del suelo entre los componentes del paisaje.

Localización y definición de las ventanas de muestreo y cuadrícula
La posición de las ventanas dentro del sitio de estudio se hace de tal modo que abarque los diferentes usos de suelo. Generalmente, una ventana no puede abarcar los diferentes usos del suelo, por lo que son necesarias otras ventanas más pequeñas. La Figura 2.5 describe las distintas configuraciones utilizadas. La Figura 2.5a ilustra el uso de una ventana de 9 x 11 puntos de muestreo (además de algunos puntos adicionales de muestreo). La figura 2.5b ilustra el uso de 6, 3 y 2 ventanas separadas. En el caso donde se usan seis ventanas separadas, una ventana medirá 1 km², dependiendo de la distancia entre los puntos de la cuadrícula. En sitios caracterizados por fuertes pendientes se esperaría que el gradiente del uso del suelo esté orientado en la misma dirección, y las ventanas estarán entonces localizadas a lo largo del gradiente (Figura 2.5b). En los linderos de la selva en los trópicos, frecuentemente se observa que el patrón de distribución de usos de suelo refleja un gradiente de intensidad de uso de suelo, con un uso más intensivo a mayor distancia de la selva. En tales casos, las ventanas de muestreo se localizan a lo largo de tal gradiente. Se necesita, por lo tanto, contar con suficientes conocimientos de la región antes de seleccionar los sitios de muestreo. Cuando algunos gradientes no son obvios, la selección de las ventanas deberá cubrir dos o tres de los usos de suelo más importantes y, por tanto, también las transiciones observadas con mayor frecuencia de un tipo a otro tipo de uso de suelo. Por ejemplo, en los márgenes del bosque puede darse la transición de bosque a pastizal, bosque a tierras de cultivo o bosque a grandes plantaciones, en donde
80
Manual de biología de suelos tropicales

una ventana cubre cada transición típica de uso de suelo. antes que un cambio de uso de suelo per se. lo que facilitará la selección de las ventanas. el área ocupada por cada uso de suelo. Mapas detallados de uso de suelo y de vegetación también son adecuados para este propósito. b) ilustración de la división de una cuadrícula entre seis. De esta forma. con puntos de muestreo adicionales. variaciones topográficas o climáticas. Número de parcelas de muestreo y tamaño de la cuadrícula El número total de puntos de muestreo por área de referencia se mantiene fijo entre 100 y 120. utilizando un papel traslúcido sobre la fotografía. Figura 2. Cuando se encuentran disponibles mapas digitales de uso de suelo. Esto permitirá un análisis comparativo de transiciones de uso de suelo (por medidas relativas). mientras minimiza los cambios en la biodiversidad del suelo que surgen de los diferentes usos. Cuando únicamente están disponibles materiales análogos.5 Ejemplos de diferentes configuraciones de ventanas de muestreo. Para la selección de las ventanas de muestreo se utilizaron fotos aéreas o imágenes de satélite de alta resolución. a) cuadrícula completa. se introduce un elemento de replicación. dentro de una ventana definida puede ser determinada utilizando software de Sistemas de Información Geográfica (SIG) estándar. tres y dos ventanas. dispuestas a lo largo del gradiente. según se requiera. Lo anterior se obtiene mediante varias configuraciones de ventana(s) D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 81 . se hace una selección manual por interpretación visual.

que para incrementar la confiabilidad de los datos del esquema basado en transectos. por lo menos. Mientras el tamaño de muestra sigue siendo más o menos igual en los transectos y cuadrículas. en el caso de por lo menos algunos de los grupos funcionales (ej.. el esfuerzo de muestreo promedio probablemente varía. y el procedimiento recomendado por el proyecto ASB (Swift y Bignell. el proyecto BioAssess (Ponge et al.. En este sentido Swift y Bignell (2001) argumentan. La captura adicional de especies requiere de un esfuerzo de muestreo considerable. descritos anteriormente. más puntos en la misma parcela). dando un total de 90 a 105 monolitos muestreados (y el mismo número de muestras agrupadas para evaluar los microsimbiontes) aproximadamente igual al número de puntos en la cuadrícula. La principal diferencia con el enfoque de muestreo de cuadrícula. con un transecto extendido en el caso de algunos grupos (por ejemplo. termitas). Eggleton et al. De esta manera. En un muestreo basado en transectos la idea de replicación recomendada por Swift y Bignell (tres transectos por cada uso de suelo) casi nunca se logra. Con 100 a 200 puntos por área de referencia generalmente se llega al punto donde la curva de acumulación de las especies para grupos de macrofauna es asintótica. Se añaden puntos de muestreo donde el uso de suelo es altamente variable. 2002. es que únicamente se toma un monolito y una muestra agrupada para los microsimbiontes por parcela. en parte por consideraciones logísticas. 2001) tendrá un esfuerzo de muestreo comparable. Los resultados del inventario del proyecto CSM-BGBD indican que es necesario un esfuerzo mínimo de muestreo de 100 a 120 puntos para poder capturar la mayoría de las especies dentro del sitio. otra opción es ensamblar de una manera sinóptica por combinación de transectos a lo largo de diferentes años o en proyectos no relacionados (ej. un transecto de 40 x 5 m. el número de puntos de muestreo deberá incrementarse de 5 a 8 por transecto (es decir.de muestreo y las dimensiones de las cuadrículas. suponiendo que existan entre seis y siete usos de suelo distintos por cada área de referencia (correspondientes a seis o siete clases de usos de suelo generalmente definidos en el sistema de clasificación de usos de suelo) donde cada uso de suelo es muestreado por tres transectos. 2003). el diseño 82 Manual de biología de suelos tropicales . En este último. Por ejemplo. El número total de puntos de muestreo concuerda con otras estrategias de muestreo propuestas en ejercicios similares de evaluación de la biodiversidad. cada uso de suelo es evaluado en.. del cual un mínimo de cinco monolitos son cavados para muestrear la macrofauna y cinco muestras conjuntas para los microsimbiontes. Davies et al. termitas y hormigas). 2003) recomienda un número similar de puntos de muestreo.

el número de puntos por categoría de uso de suelo aumenta.de muestreo se ajusta a los objetivos del inventario del área de estudio. La colecta de muestras rara vez es el paso que limita la evaluación de la biodiversidad porque la extracción. etc. pero aun así se requiere de una campaña organizada en el campo y de instalaciones establecidas para poder procesar y analizar las muestras. un promedio alrededor de 15 puntos por clase de cobertura de suelo resultan de muestrear la cuadrícula. Si la capacidad para procesar y analizar esta cantidad de muestras no está disponible. En números pequeños o en una distribución irregular de puntos de muestreo en los diferentes usos de suelo. historia. normalmente no todas las especies son capturadas y hará más difícil demostrar las diferencias en biodiversidad del suelo entre los tipos de usos de suelo que normalmente se caracterizan por una alta variabilidad en la riqueza de especies. restringir el número de usos de suelo de manera que el esfuerzo total sea compatible con la capacidad de procesamiento. Dado el alto nivel de variación en las medidas de los componentes de la biodiversidad del suelo. 1998). es importante considerar el número mínimo de puntos requeridos para cada categoría de uso de suelo. Número de puntos de muestreo por categoría de uso de suelo Con seis o siete tipos de uso de suelo en cada área determinada. La experiencia del proyecto CSM-BGBD indica que el procesamiento de 100 a 120 muestras es viable con los recursos generalmente disponibles.. si esta prueba confirma alta variabilidad en la biodiversidad del suelo dentro de las D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 83 . identificación y catalogación de especímenes son los pasos que requieren mayor tiempo en el proceso (Lawton et al. El número de muestras requeridas por uso de suelo deben ser representativas de la biodiversidad del suelo presente y entonces. Se le da prioridad al tipo de agricultura de subsistencia a la hora de incrementar el número de muestras porque es precisamente en esta categoría dónde se espera que ocurra una mayor variación debido al manejo. basándose en otros datos o en un estudio piloto. Se aconseja hacer una prueba piloto para informar el diseño de muestreo. el procedimiento correcto para reducir el número total de puntos de muestreo deberá ser estimado. en lo que concierne a la evaluación de la diversidad de especies. Reducir el número de puntos de muestreo por categoría de uso de suelo mientras se mantiene el número de categorías de uso de uso de suelo investigado puede comprometer el objetivo de obtener resultados estadísticamente verificables. Con menos categorías de uso de suelo presentes.

La definición de un sistema de clasificación de uso de suelo se detalla en el Capítulo 11. mientras se cumplen los requerimientos para el número mínimo de puntos de muestreo para cada categoría de uso de suelo. Esto implica adoptar un nivel más alto de detalle en el sistema de clasificación de uso de suelo y. La segunda opción es seleccionar puntos adicionales dentro de las ventanas entre los puntos existentes de la cuadrícula para aquellas categorías de uso de suelo que están siendo muestreadas. se necesita una 84 Manual de biología de suelos tropicales . entonces se hace un ajuste de la definición de clases de uso de suelo. se puede partir de una cuadrícula vacía (que únicamente contenga posibles puntos de muestreo). Para este propósito. de tal manera que se cumpla el criterio para un mínimo número de puntos de muestreo en cada uno de los tipos de uso de suelo. de forma separada hasta que se cumpla con el requerimiento del número mínimo de puntos de muestreo. Posteriormente.categorías de uso de suelo.5a. Esta estrategia implica incluir ventanas de muestreo irregulares. Para poder seleccionar o eliminar sitios de muestreo (parcelas) es necesario conocer los usos de suelo en cada punto de la cuadrícula y se requiere de un inventario de uso de suelo previo al muestreo de la biodiversidad del suelo. Este procedimiento permitirá eliminar los puntos que caigan en tipos de uso de suelo no especificados.6. de acuerdo con los principios detallados en “Hablando de variabilidad” (arriba). seleccionar las clases de uso de suelo que cubren un claro gradiente en intensidad de usos de suelo. Adaptación del enfoque de muestreo a condiciones de campo Hay dos estrategias disponibles para asegurar una representación de los usos de suelo y clases de cobertura en el muestreo. posteriormente. Esta opción se puede observar en la Figura 2. deberán hacerse algunos intentos para aleatorizar la selección de los puntos originales para ser divididos en dos. se aplica un procedimiento no-sesgado para restar un número de puntos que permitan contrarrestar el incremento en el número total de puntos de muestreo que resulta de ampliar la cuadrícula. donde la distancia mínima entre puntos necesita ser respetada. se define una cuadrícula mayor (resaltando el número de intersecciones). Cuando éste no es el caso. Aunque la inserción de puntos adicionales es conveniente. De la misma manera. Una estrategia es usar una “cuadrícula estratificada” según lo ilustrado en la Figura 2. con el propósito de seleccionar aleatoriamente puntos de muestreo para cada categoría de uso de suelo. El enfoque de la cuadrícula asume un acceso libre al terreno o parcela donde se localizan los puntos de muestreo.

en lugar de utilizar una cuadrícula regular que cubriera un área mayor. Por ejemplo: en un área determinada en México. con D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 85 . Los patrones de distribución de los organismos del suelo puede correlacionarse con la topografía. Distancia entre los puntos de muestreo La distribución de los organismos del suelo puede reflejar gradientes. En este caso las tierras seleccionadas fueron aquéllas que pertenecían a agricultores que sí permitieron el acceso y se adoptó un patrón específico para muestrear dentro de estas tierras.Figura 2. debido al aislamiento de las comunidades. En el área determinada en La Amazonia en Brasil. por ejemplo.6 Ilustración de los puntos de muestreo seleccionados mediante una cuadrícula estratificada. de una a tres ventanas fueron colocadas en cada comunidad disponible. estrategia de muestreo alterna. aquéllos de carbono orgánico y prácticas de cultivo. el acceso a las tierras de los agricultores estuvo restringida. colocando una cuadrícula fija dentro de dichas ventanas.

con muchos grupos diferentes de organismos del suelo estudiados. También se registra una distribución parchada en una escala miniatura de centímetros a metros.los parches de vegetación. que las termitas siguen patrones espaciales en un intervalo de hasta 330 m y que la distribución de especies de nematodos muestra tamaños de parches entre 6 a 80 m. los espacios en la cuadrícula fueron reducidos en el área determinada en Brasil. atravesar de un punto a otro. o bien. en la Amazonia.5 ha) y donde no es posible atravesar (ej. Sin embargo. la investigación de la distribución de patrones específicos no representa un objetivo deseado. con parcelas muy pequeñas (menos de 0. dependiendo de los organismos implicados. el muestreo en cuadrícula permite examinar patrones espaciales a escalas entre la distancia inter-muestra y el tamaño de la cuadrícula. Ettema y Wardle (2002) mencionan que la biomasa microbiana y los colémbolos son espacialmente dependientes en intervalos de más de 200 m. anidadas en estructuras más grandes. Una distancia de 200 m parece aceptable porque permite un área relativamente mayor de muestreo a través de la cuadrícula y es probable que refleje los usos de suelos más dominantes en la muestra. si las parcelas individuales miden más de dos a cuatro hectáreas. con la ubicación de árboles individuales. en la mayoría de los casos. En el caso del proyecto de la biodiversidad del suelo. 86 Manual de biología de suelos tropicales . Por otro lado. a 100 m. al mismo tiempo permite. Por estas razones. 2001). En la literatura se pueden encontrar varios ejemplos de la estructura espacial de la biota de suelo sobre distancias de menos de un centímetro hasta de cientos de metros en el campo. con gradientes de recursos del suelo. se pueden reducir los espacios en la cuadrícula. razón por la que no fueron considerados esquemas de muestreo adecuados para llevar a cabo un análisis de la distribución espacial. Al mismo tiempo reduce la dependencia espacial de las observaciones para la mayoría de los principales grupos de organismos del suelo. la distribución y agrupación de organismos de suelo también son gobernadas por fuerzas intrínsecas de procesos poblacionales tales como dispersión. en el caso de paisajes altamente fragmentados. reproducción y competencia (Lavelle y Spain. vegetación secundaria muy densa dentro de parcelas barbechadas). tales como las lombrices de tierra. Existen varias teorías para explicar la riqueza extremadamente alta de las comunidades del suelo y el bajo grado de especialización en recursos. No obstante. se debe considerar aumentar la distancia entre los puntos.

temperatura y humedad media. en términos de los factores que determinan la biodiversidad del suelo. como parte del proceso del inventario. deberían registrarse para la ventana e incluso para el área seleccionada. cationes D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 87 .Inventario de uso del suelo y caracterización del sitio La hipótesis central plantea que la mayor variación en la biodiversidad del suelo está asociada con la diferencia en la intensidad de usos de suelo. Por lo tanto. a fin de permitir un análisis completo de los datos para identificar los parámetros que explican la variabilidad en la biodiversidad del suelo. Sin embargo. Existn un número de factores interrelacionados: bióticos y abióticos (ej. El conjunto básico de las propiedades físicas y químicas del suelo debería incluir densidad aparente. y debido a que las características completas del sitio no pueden ser obtenidas solamente por la apariencia del uso del suelo. con referencia especial al uso del suelo también es importante de conocer (aunque no siempre se cuenta con este dato). las condiciones bióticas y abióticas. junto con la altitud. uso de químicos. y de las características del suelo. duración de secas y la precipitación acumulada hasta la fecha de muestreo. la información sobre la precipitación anual. especialmente en sistemas tan diversos como los representados en los trópicos. la diversidad del suelo es inventariada independientemente a lo largo de un gradiente de intensidades de usos de suelo para cada área seleccionada. pF (tensión de humedad del suelo). lo indicado será incluir una descripción detallada de uso y cobertura del suelo.) que afectan la distribución de organismos del suelo y se asume que las principales categorías de uso de suelo proporcionan una diferencia significativa. así como las características de uso y manejo del suelo pueden variar considerablemente entre regiones. textura (la proporción arcilla/arena/limo). C y N total. pendiente y aspecto. La definición de clases de uso de suelo resulta importante y se discute en el Capítulo 11 de este manual. Debido a que se sabe muy poco sobre la importancia relativa de los factores antes mencionados. asumir que una categoría de uso del suelo está en una escala correcta para acomodar su variación puede ser incorrecto. descrita a nivel de las principales categorías de uso de suelo. Es posible que la variabilidad en abundancia y diversidad de organismos del suelo dentro de una categoría de usos de suelo pueda ser mayor que la variabilidad entre categorías de uso de suelo. materia orgánica del suelo) y características de manejo (tipo de labranza. Al mismo tiempo. La historia del sitio. diversidad de plantas. etc. pH. días de lluvia.

La producción de esporas responde a la fenología de las plantas y. la evolución de las estructuras y ciclos reproductivos (como la formación de esporocarpos) se sincronizan con los cambios estacionales que ocurren dentro del hospedero y son mejor observados durante y hacia finales de la época de lluvias. área basal. Épocas de muestreo Los organismos del suelo responden a cambios estacionales. características como la altura media del dosel. por ejemplo. También. la actividad de las lombrices de tierra es mayor al final de la época de lluvias (Tondoh y Lavelle. Sin embargo. 2005). los inventarios deberían elaborarse durante la época de lluvias y también en la época de seca. y los resultados del inventario de la riqueza de especies y abundancia (relativa) mostrarán marcadas diferencias entre las épocas. pero inmediatamente adyacentes a la zanja de cada monolito (la zanja exterior probablemente sea el mejor lugar). En los casos de hongos fitopatogénos y hongos ectomicorrízicos. la época seca será la más apropiada para muestrear. CIC.intercambiables. en el caso de cultivos anuales las esporas son más abundantes durante la época seca. Al3+ y H+. 1993). por esta razón se hace el muestreo al final de la época de lluvias 88 Manual de biología de suelos tropicales . Además. por ejemplo. ayudan a elegir sitios a lo largo de un gradiente de diversidad botánica que tiene alguna relación con sus posiciones actuales en las cronosecuencias e intensidades de perturbaciones. Una descripción de los sitios puede ser completada por el tipo de vegetación. Para el muestreo de otras variables relacionadas con la caracterización del sitio. P. dependiendo de los métodos utilizados. El Capítulo 11 proporciona más detalles sobre los requerimientos respecto de usos de suelo específicos. ver Anderson e Ingram (1993). cuando el método depende del conteo e identificación de esporas. el porcentaje de cubierta vegetal. no siempre suele ser factible. puesto que de esta manera surge la posibilidad de correlacionar las propiedades del suelo con la presencia o ausencia de un taxa en particular y grupos funcionales (véase Anderson e Ingram. Respecto de hongos micorrizógenos arbusculares. en la práctica. en áreas de bosque. especies de plantas y la riqueza de géneros. acumulación y abundancia de hojarasca. debido a la senescencia de las raíces. La diversidad y abundancia de especies de leguminosas son de particular importancia en relación con la presencia de las bacterias formadoras de nódulos en leguminosas. Idealmente. lo que puede ser diferente. Muestras de suelo son tomados de suelos no perturbados. cobertura dominante/abundancia de flora en el nivel del suelo.

Chapman and Hall/CRC Press. Lo último puede realizarse con el objetivo específico de investigar cambios temporales en la biodiversidad del suelo. T. New York. pp. Mawdsley. F. pp. Kluwer Academic Publishers. Bloemers. H. Kenkel. T. Fernández-González. (1989) ‘On sampling procedures in population and community ecology’. CRC. Juhfisz-Nagy. Pedigo. Ecosystems and Environment. L. Bignell. S. M. G. 195–207. pp. (2005) “Small-scale response of plant species to land-use intensification”. (1977) Sampling Techniques. J. Cochran W. P. (2001) Soil Ecology. D. T.E. Ponge. S. S. P.. e Ingram. Trends in Ecology and Evolution.. Columbia University Press. vol 105. y Madong. Ford.con la opción de tomar muestras adicionales durante la época de secas.. Hauser. F. P. J. Eggleton.. B. Dordrecht Lawton... (eds) (1998) Ecological Scale: Theory and Applications. Ecosystems and Environment.. D. vol 90. Wiley. M. y Hernandez. CAB International. E. indicator taxa and effects of habitat modification in tropical forest’. Lavelle. D.. Davies. A. T. Jones. A.. P. Dubs.. vol 83. D iseño y estrategias de muestreo para la evaluación de la biodiversidad del suelo 89 . (2000) Scientific Method for Ecological Research. y Spain. Wallingford.... L. 2nd edition. Bignell. Cambridge. y Buntin.. Vegetatio. D. 3rd edition. (2002) ‘Termite diversity across an anthropogenic disturbance gradient in the humid forest zone of West Africa’. A. New York.. M... 89–202. Srivastava. Larsen. vol 17.. L.. pp. Nature (Lond). G. REFERENCIAS Anderson. y Wardle. Dibog. pp. G. I. Holt. New York. pp177-183. Boulton. Eggleton. B. (2003) ‘Evolution of termite functional diversity: Analysis and synthesis of local ecological and regional influences on local species richness’. D. E. y Watt. G. (2002) ‘Spatial soil ecology’. G. D. vol 391. Peterson. E. Stork. 72–76. (eds) (1993) Handbook of Sampling Methods for Arthropods in Agriculture. y Valentine. Agriculture. V. L. (1998) ‘Biodiversity inventories. P. D . P. Gathorne-Hardy.. F. D. H. 847–877. Eggleton. Norgrove. (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. J. P.. y Parker. C. D. Federoff. Journal of Biogeography. Hodda. B. A. N. P. 283–290. Hammond. Agriculture. T. y Lavelle. E. J.. F. (2007) Sampling Strategies for Natural Resources and the Environment. vol 30. L. Gregoire. R. y Podani. London. R. Cambridge University Press. N. C. N. Ettema. D. J-F.

vol 9. Sousa. J. Stein. Thompson. (2003) ‘Collembolan communities as bioindicators of land use intensity’. Goslee. D. Tondoh. A. Dubs. vol 94. South East Asian Regional Research Programme.. (2003) ‘An overview of spatial sampling procedures and experimental design of spatial studies for ecosystem comparison’. J. New York. S. Grimbeek. vol 35. y van der Linde. F.. pp. Pierce. y Bignell. R. D. (2002) ‘Extending community ecology to landscapes’. P. 1093–1121. pp.org/SEA/Publications. y Lavelle. E. pp.. E. E. 200–202. F.worldagroforestrycentre. 90 Manual de biología de suelos tropicales . J. 813–826. Ecoscience. K. Southwood. van. Agriculture. 3rd edition. P. y Ettema. (eds) (2001) Standard Methods for the Assessment of Soil Biodiversity and Land-use Practice. K. Gillet. Bogor. J. Journal of Tropical Ecology.. M. pp. Eudrilidae) in Ivory Coast’.. y Lookingbill. P. M. E. Haese. M. R. y Lavelle. (2000) Ecological Methods. (1998) ‘An evaluation of the gradsect biological survey method’. (1996) Adaptive Sampling. A. pp. 493–500. S. Indonesia. (1990) Statistical Methods in Soil and Land Resource Survey. International Centre for Research in Agroforestry. Soil Biology & Biochemistry. S. P. Ecosystems and Environment. y Oliver. S. Federoff. Urban. D. vol 7. C. Blackwell Science. y Henderson. A. Swift. Oxford University Press. Jaarsveld. J. K. ASB-Lecture Note 6B . Wiley. Wessels. F. Oxford. A. J. T. A..Ponge. Biodiversity Conservation. y Seber. G.. Oxford. vol 21. T. L.. Webster. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. www. 31–47.

debido a su biomasa. Francis-X. e influyen de manera notable en las propiedades físicas y químicas de los suelos. los invertebrados más importantes en el suelo de regiones templadas. Otros son trituradores que deshacen la materia orgánica y un buen número de estos grupos son macropredadores. Julio Louzada. o que tienen una anchura o diámetro de más de 2 mm. Reginaldo Constantino. hormigas y escarabajos. indicativos de la biodiversidad de suelo y de los efectos del cambio de uso y prácticas de manejo del mismo. sin embargo. Bignell. Csaba Csuzdi. Susilo. Jérôme Ebagnerin Tondoh y Ronald Zanetti INTRODUCCIÓN Este capítulo describe los métodos para realizar el inventario de la macrofauna del suelo. Agus Karyanto. que habitan especialmente en ambientes tropicales. Una diversidad de organismos de suelo se incluye en esta categoría (capítulo 1). se consideran un componente determinante de la biota del suelo. probablemente. Souleymane Konaté.Capítulo 3 Macrofauna David E. en la creación de macroporos y en la transformación y redistribución de materia orgánica. Además. Mucha macrofauna desempeña un importante papel en los ecosistemas del suelo. Las lombrices de tierra son. 91 . en ambientes tropicales. termitas. los grupos de macrofauna frecuentemente son utilizados o propuestos como indicadores de la calidad biológica del suelo. predominan las termitas y las hormigas. aunque éste se concentra en los grupos más significativos: lombrices de tierra. por tanto. sobre todo. como ingenieros del suelo. el grupo macrofauna incluye aquellos animales del suelo que miden más de un centímetro de largo. Debido a su importante papel en los procesos del ecosistema y a su sensibilidad ante condiciones ambientales.

cada uno de los métodos descritos es idóneo para un grupo en particular: los monolitos son especialmente escogidos para el inventario de lombrices de tierra. por ende. podrán ser utilizados más ampliamente. en cada una de las siguientes secciones que describe un método en particular. Nuevos esquemas son propuestos en el diseño de monolitos para mejorar el muestreo de lombrices de tierra. Éstos están basados en monolitos de suelo y. en la generalidad de la macrofauna. el método de transecto es más adecuado para un inventario de termitas. sin embargo. Para poder contar con datos de diversidad y abundancia de lombrices de tierra. En el capítulo 2. demuestra cómo ha crecido durante los últimos años nuestra percepción de la importancia de estos organismos. Generalmente. que sirvan como indicadores para monitorear el cambio de efecto de uso de suelo. con la extracción de los insectos de los marcos de hojarasca por el método Winkler (Bestelmeyer et al.generalmente alta. 1993) consolidados y mejorados por Swift y Bignell (2001). 2000). abundancia y biomasa. algunos grupos representativos de macrofauna específica son capturados. No obstante. utilizando cualquiera de los métodos enlistados en el capítulo 2. tal y como fueron aplicados en el proyecto CSM-BGBD. cuyo énfasis se concentra en un grupo específico de organismos asociados y. Se entiende que los métodos propuestos son aplicados en ambientes tropicales. el punto de partida de desarrollo de los protocolos han sido los procedimientos de Anderson e Ingram (1989. los que generalmente se refieren como métodos “TSBF”. este capítulo se estructura de acuerdo con el método utilizado y no tanto en función del grupo funcional. y no simplemente tres páginas que fueron impresas en los métodos originales “TSBF”. Como en el caso de otros grupos de biota de suelo. por lo tanto. 92 Manual de biología de suelos tropicales . al mismo tiempo. en el caso de termitas. el hecho de que se pueda dedicar un capítulo entero al muestreo de macrofauna. y la extracción Winkler es el método más idóneo para la captura y extracción de hormigas de muestras de hojarasca. forman un importante componente de la red alimenticia en el suelo. mientras que las trampas pitfall con cebo son apropiadas para la captura de escarabajos. se explica que no existe un sólo método para llevar a cabo un inventario de un grupo específico de macrofauna. se requiere de métodos estándares en el muestreo para diversidad. En este capítulo se describen métodos propuestos para realizar un inventario de macrofauna. Un avance mayor consiste en utilizar el principio de transecto para hormigas y escarabajos. en un transecto corto (20-40 X 2m) al que ahora han sido añadidas trampas pitfall (principalmente para escarabajos) y otras guías para muestreo casual.

Este transecto también puede ser utilizado para hormigas y escarabajos. La muestra de suelo en botes se debe guardar alejada del sol directo y deberá ser revisada antes de 24 horas. con la adición de trampas pitfall (Swift y Bignell. la anchura aproximada del monolito más dos anchuras de zanja. de manera que puedan trabajar varios asistentes en la misma muestra de suelo o en muestras diferentes. Para revisar el suelo es conveniente utilizar la superficie de una mesa grande de campo para llevar a cabo la extracción. una charola de plástico grande de cocina. serán milpiés y lombrices de tierra con bajas densidades de población. sirve como un buen recipiente para la M acrofauna 93 . es decir. véase el capítulo 2. esto se puede hacer de manera sencilla. HOJARASCA Y LOMBRICES DE TIERRA EN PARTICULAR. 10-20 cm y 20-30 cm. Primero se coloca un marco de 25 x 25 cm para marcar la posición del monolito y cualquier hojarasca o madera dentro de él es removida e introducida en una charola (Figura 3. Se utiliza un transecto adicional de 20 x 2 m para muestrear las termitas. éstos. en su mayor parte. aunque es mejor si se muestrea la hojarasca delimitada por marcos dispuestos en una línea paralela.1a y 3. Se divide el bloque del monolito en tres capas. hay que meter la muestra en un bote de 19 L y llevarla al laboratorio. En el caso de la hojarasca. son dictados por Anderson e Ingram (1993). 2001) y las extracciones con trampas Winkler (Bestelmeyer et al.50 m². aislando el monolito como un pilar no perturbado (Figuras 3. Se aísla el monolito utilizando una pala a unos pocos centímetros fuera del marco y luego se cava una zanja a su alrededor de 25 cm de ancho y 30 cm de profundidad.1b). UTILIZANDO MONOLITOS DE SUELO Macroartrópodos de hojarasca y de suelo. 2000).INVENTARIO DE MACROARTRÓPODOS DE SUELO. pero que representan una biomasa importante.1c y 3. con un reborde. Si no hay mucho tiempo o si la luz es insuficiente (colectar en selva cerrada es difícil porque la luz disminuye muy temprano). Para la discusión del número y posicionamiento de monolitos. todos los invertebrados mayores de 10cm de largo. En una variante del método. excavados de la zanja y la hojarasca pueden ser colectados. con dimensiones de 50 x 50 x 20 cm de profundidad para lombrices de tierra. utilizando un machete o parang tomado de forma horizontal y agarrado por ambos lados. de 0-10 cm. Monolito TSBF Los procedimientos generales.1d). preferentemente en el lugar y bajo sombra.. junto con monolitos extraídos del suelo. Se revisa manualmente la hojarasca y cada capa de monolito por separado. Su abundancia y biomasa podrán ser calculadas con base en las muestras de 0.

• El microhábitat en cuestión (madera nueva. cuando se hace la extracción durante un tiempo determinado. Para evitar confusión en lugares ricos. las pequeñas ramas deberán romperse y ser golpeadas en la charola para que se desprenda cualquier insecto que contengan. Protocolo de muestreo alternativo para evaluar la abundancia y diversidad de lombrices de tierra en ecosistemas tropicales Introducción Este protocolo alternativo combina el llamado monolito de suelo TSBF (25 x 25 x 30 cm) y tres grandes monolitos (50 x 50 x 20 cm) para evaluar la abundancia y diversidad de lombrices de tierra a nivel local y de paisaje en ecosistemas tropicales. como en el caso de un transecto. 94 Manual de biología de suelos tropicales . El tamiz retiene las hormigas que pueden ser aspiradas. suelo. Las lombrices de tierra y moluscos. deberán preservarse en alcohol al 80%. En otros casos. hojarasca. Se diseccionarán los pedacitos de madera en diferentes piezas para ver si hay termitas. sin embargo.3 ó 4). Las hormigas.). las etiquetas deberán escribirse en el momento en que los especímenes sean introducidos en los tubos o frascos. al igual que obreras. etc. en el caso de las termitas. La información es importante para establecer la naturaleza de los organismos encontrados (especialmente la diversidad de grupos funcionales) y para construir una curva de acumulación de especies.revisión. suelo de raíz de árbol. en una charola. se incluirán soldados. Se añadirá una etiqueta dentro del alcohol o formaldehído. en la que se anotan los datos siguientes (con lápiz o tinta indeleble. montículo. no usar bolígrafo o pluma): • Fecha y clave de identificación del lugar. pasándolo a través de un tamiz de malla grande. Las hormigas pueden ser extraídas tomando un puñado de suelo. madera podrida. el periodo destinado deberá incluir el tiempo para el llenado de la etiqueta. el número de la sección en el transecto en donde se encontró el espécimen (1. de 5 mm. generalmente. termitas y escarabajos colectados. Se deberá utilizar un tubo o frasco por cada especimen o población encontrada (o colonia aparente). las etiquetas se pueden hacer cuando se ha completado la extracción en cada sección del transecto.2. • En el caso de transectos o monolitos alineados. hormigas o escarabajos. se conservan en formol (formaldeído) al 4% para evitar la supuración de la mucosa. madera seca.

véase Bhadauria et al. 2004). La ilustración C muestra un monolito grande (50 x 50 x 30 cm) y la D un monolito pequeño (25 x 25 x 30 cm) y la excavación de la zanja. 1993) para macroinvertebrados. por lo menos.1 Delimitación y excavación de un monolito pequeño (25 x 25 x 30 cm). (2002) y Mathieu et al. Por más de una década. (2003). Barrios et al. siendo la unidad de muestreo. los monolitos se distribuyen a lo largo de un transecto corto (40 m) con. para ejemplos de América del Sur. En todos los casos. Dlamini y Haynes (2004) para el muestreo de lombrices de tierra en África. M acrofauna 95 . A B C D Nota: las ilustraciones A y B muestran la colocación de un marco de madera para delimitar el monolito y la limpieza de hojarasca suelta. véase Gilot et al. cinco monolitos por parcela bajo estudio. (1995). satisface el requerimiento de rapidez y la necesidad de tomar en cuenta la heterogeneidad del suelo a nivel parcela. antes de muestrear el monolito. (2000) para Asia y Decaëns et al. (1994. Haymes et al. (2004). la mayoría de los estudios sobre lombrices de tierra han sido elaborados utilizando el método TSBF (Anderson e Ingram.Figura 3. un monolito cuadrado de suelo de 25x25 cm y de 30 cm de profundidad.

por ejemplo. el reto será desarrollar un protocolo de muestreo rápido para muestrear a nivel paisaje. (1999) y Agosti et al. ha sido reportada para monitorear la dinámica de población de la lombriz peregrina Hyperiodrilus africanus (Tondoh y Lavelle. Decaëns y Jiménez. el muestreo debería realizarse al final de la temporada de lluvias.. han propuesto protocolos de muestreo más exhaustivos para muestrear termitas y hormigas. Fragoso et al. en cada punto de muestreo se extrae un pequeño monolito de 25 x 25 x 30 cm que se rebana en tres capas: 0-10 cm. Como las prácticas agrícolas contemporáneas muestran un mosaico de tipos de uso de suelo. Este esquema de muestreo estratificado. 2002). utilizando grandes monolitos de suelo de 1 m² x 40 cm de profundidad. 1999. 2005). respectivamente. cuando se sabe que las lombrices de tierra son más activas (Tondoh y Lavelle. Las lombrices de tierra son colectadas a mano. Se pueden usar argumentos similares para justificar un muestreo más extensivo de lombrices de tierra. Protocolo de muestreo De manera ideal. Vincent.A pesar del éxito relativo del método TSBF para estimar la abundancia y diversidad de los macroinvertebrados del suelo.. se estudió la demografía de lombrices de tierra. 1978). Decaëns y Jiménez. 2005). 2001. pero consumen mucho tiempo y resultan tediosos. Eggleton et al. una combinación más eficiente de 100 x 100 x 40 cm para grandes y de 25 x 25 x 30 cm para monolitos pequeños de suelo. 10-20 cm y 20-30 cm. aunque pocas investigaciones se han enfocado a la evaluación de la abundancia y diversidad de lombrices de tierra en paisajes agrícolas. Lavelle. Los monolitos de tamaño medio (50 x 50 x 40 cm) fueron utilizados por Ortiz-Ceballos y Fragoso (2004) para evaluar el impacto de una cobertera en poblaciones de lombrices de tierra. bajo diferentes prácticas de manejo de suelo (Fragoso et al. Tal avance será crucial para desarrollar indicadores de degradación de suelo (Moreno y Halffter. Recientemente.. cubriendo grandes áreas. 1998) porque las lombrices de tierra son reconocidas por presentar sensibilidad ante la perturbación antropogénica (Fragoso et al. Se seleccionan cinco puntos de muestreo al azar. la carencia relativa de centros de colonias y su distribución altamente parchada. que combina pequeños y grandes monolitos. 1997. 1997. en cada tipo de uso de suelo. Originalmente. 2002). permite tomar en cuenta la variación a 96 Manual de biología de suelos tropicales . debido a su especificidad de grupo funcional. Burel et al. aunque pequeños monolitos han sido utilizados con éxito para identificar cambios importantes en la diversidad de lombrices de tierra a nivel parcela. (2000). 1969.

3) y son almacenadas en una solución de formol al 4% para su posterior identificación. a lo largo de un transecto. Monolitos grandes (50x50x20 cm) Monolito pequeño (25x25x30 cm) nivel parcela de las poblaciones. 1993). mientras la variación a nivel paisaje se hace con un muestreo en los usos de suelo más representativos. En cada punto seleccionado. 1993). las lombrices de tierra son muestreadas. 2005). De manera adicional. El transecto aparece representado esquemáticamente en la Figura 3. como en los pequeños monolitos. Las lombrices de tierra se colectan a mano (Figura 3. Los individuos después son identificados. en intervalos de 5 m. M acrofauna 97 . con un punto de partida elegido al azar. cuando se considere apropiado (TSBF modificado. de acuerdo con el procedimiento de TSBF (Anderson e Ingram. contados y pesados. Monolitos adicionales son extraídos para poder tomar en cuenta la heterogeneidad a nivel de la parcela. Cada monolito mayor se separa en dos capas (0-10 y 10-20cm) y no en tres. perpendicular a la pendiente. Anderson e Ingram. porque la mayoría de los especímenes (57-99%) son localizados en los primeros 20cm durante la temporada de lluvias (Tondoh y Lavelle.Figura 3.2. se extraen tres grandes monolitos de 50 x 50 cm y de 20cm de profundidad.2 Esquema de alineación de monolitos complementarios de lombrices de tierra.

Desgraciadamente. la revisión de Eisen (1900) y estudios seleccionados de varios autores (Righi. debido a la carencia de guías comprensivas para su identificación. las monografías de Gates (1972). 1987) y Csuzdi (1996) y. Las especies de lombrices de tierra peregrinas comunes. sin embargo. La abundancia de lombrices de tierra se estima 98 Manual de biología de suelos tropicales . 2005) son los principales puntos de referencia. cuando sea necesario. Identificación de lombrices de tierra y estimaciones de su abundancia Especímenes de lombrices de tierra. 1994. previamente agrupados como morfoespecies. las especies nativas requieren de la pericia específica del país. Fragoso y Rojas-Fernández. 1995. Zicsi. Sims e Easton (1972).Figura 3. pueden ser identificados a nivel de familia. por lo tanto. 1971. se debe consultar la descripción original de especies. son identificables a nivel especie utilizando las guías y descripciones dadas por Blakemore (2002). que se encuentran distribuidas en toda la región tropical.3 Separación a mano de lombrices de tierra en charolas de plástico. 2001. utilizando las claves desarrolladas por Blakemore (2005). Para la identificación de lombrices de tierra de la India y del Sureste de Asia. no existen a la fecha monografías disponibles para la identificación de lombrices de tierra de América Central y América del Sur. Easton (1979) y Julka (1988) son las apropiadas. Para las especies africanas de Eudrilidae y Acanthodrilidae (Benhamiinae) se pueden utilizar las revisiones de Sims (1980.

La estructura de las comunidades de lombrices de tierra puede ser caracterizada por la densidad y biomasa de lombrices nativas y exóticas La importancia de la diversidad funcional en las lombrices de tierra ha sido ampliamente documentada (Lavelle. M acrofauna 99 . se lleva a cabo mediante la identificación en cada tipo de uso de suelo de especies nativas y exóticas o peregrinas. 2) la diversidad promedio expresada en términos de la media de número de especies por cada tipo de uso de suelo y 3) el índice ShannonWiener de diversidad (Pielou.como el número de individuos por m² y la biomasa como g de individuos por m². regional y continental. Desde el punto de vista ecológico. a nivel de la superficie del suelo. El primer nivel de diversidad taxonómica trata del número y de la identidad de especies de lombrices de tierra. 1981): 1. Fragoso et al. 1997). 1977. 2. producen excretas dentro del perfil del suelo y sobre la superficie. 1983. El análisis de comunidades de lombrices de tierra. las comunidades de lombrices de tierra pueden dividirse en tres grupos (Bouché. Los servicios que proveen las lombrices de tierra al ecosistema se relacionan con el impacto de su actividad en el sistema de suelo (Lavelle et al. La diversidad de lombrices de tierra se estudia en dos niveles complementarios: diversidad taxonómica y funcional (Bouché. La relación nativas vs exóticas puede utilizarse como un índice para calcular la extinción de especies nativas o como un claro indicador de la invasión de especies exóticas o peregrinas. Fragoso et al. Blanchart et al.. Lavelle. Como resultado de su actividad. Se pueden utilizar tres categorías de expresión de la riqueza de especies: 1) el número de especies registrado en todos los monolitos. Dentro de un ecosistema dado. mientras que las especies exóticas son. introducidas por interferencia humana. en casi todos los casos. 1997). El aspecto funcional de la diversidad resulta de gran interés para evaluar la relación entre diversidad y servicios del ecosistema. 1997). no pigmentadas y que viven dentro del suelo. 1997 y Lavelle et al. 1977.. 1987). con pigmentación y que viven en la hojarasca. Lombrices endógeas: de tamaño medio... 1996).. El segundo nivel de diversidad taxonómica trata de la biogeografía de lombrices de tierra (Fragoso et al. dos grupos de lombrices de tierra pueden ser distinguidos de acuerdo con su origen: especies nativas o exóticas. éstas han sido llamadas peregrinas para indicar su amplia distribución a niveles regionales y continentales (Lee. en cada tipo de uso de suelo. 1997. con este enfoque. 1977). Lavelle 1983. Especies nativas son las caracterizadas por una distribución restringida a nivel local.. Lombrices epígeas: de tamaño pequeño.

se basa en un transecto de 100 m. Lombrices anecicas: de tamaño grande. tal y como se describe y desarrolla más adelante. sin pigmentación y viven en el suelo. 50 o 20 x 2m. Equipo requerido Brújula. 1997) porque son activas mezclando y cavando el suelo. aunque se considera que. fue desarrollado para bosques o localizaciones recientemente derivadas como en la agricultura de roza. cinta métrica de 30 m o preferiblemente cuerda de nylon o mecate. Cada persona lleva un machete o parang afilado. pero comen en la superficie.3. presentan una alta resolución. para el proyecto CSM-BGBD y a 50 m en el esquema alternativo de muestreo (véase Capítulo 2). MÉTODOS DE TRANSECTO PARA TERMITAS. una 100 Manual de biología de suelos tropicales . Swift y Bignell (2001). y sigue las descripciones formales de Jones e Eggleton (2000). modificando así las propiedades hídricas y químicas del mismo. Los datos obtenidos son cualitativos (identificación y número de especies) y/o semi-cuantitativos (abundancia relativa de especies y/o grupos funcionales específicos). tumba y quema.. relativamente. A las lombrices de tierra se les puede asignar una categoría ecológica o grupo funcional y posteriormente comparar dichos grupos con base en su densidad y biomasa. por lo que los transectos se tratan separados de los monolitos y de las trampas pitfall. marcada en secciones de 5 m. aunque se ha acortado a 20 m en el protocolo estándar. ESCARABAJOS Y LOMBRICES de tierra Introducción Este método utiliza un transecto de 100. El método. Sus actividades forman una red densa de túneles dentro del suelo. HORMIGAS. utilizando cinta naranja o amarilla fluorescente o a prueba de agua y un palo de 2 m. La mayoría de las lombrices de tierra que pertenecen a los tipos endógeos y anecicos son destacados ingenieros del ecosistema (Lavelle et al. Este método se considera de bajo impacto y resulta idóneo para ser usado por aquellos que no son especialistas en termitas y puede ser completado en cada punto de muestreo por dos personas en un día (dos días para un transecto de 100 m).

para evitar pisadas excesivas en un solo lugar. para evitar obstáculos naturales. de modo subjetivo. 50 o 100 m junto al monolito. pero los dos “brazos” principales de la línea del transecto deberán encontrarse. No obstante. para poder replicar un monolito) los transectos deberán posicionarse para evitar interferencia mutua y separarse. a una distancia suficiente para evitar cualquier perturbación durante el muestreo. por lo menos. un cuchillo de campo de hoja fija. el transecto se puede desviar hacia un lado. con alcohol al 80% (se necesitarán más para hábitats ricos en termitas). sin embargo. a 15m de distancia. dos pares de pinzas. Frecuentemente se necesita evaluar. de área basal muy grande. se pueden colocar dos transectos de 50m (o de 10 m) para que queden en paralelo. en cada sección de 5m. El tiempo requerido para realizar transectos de 20 m es de 30 minutos de muestreo por dos personas. una charola de plástico o metal con reborde alto. Las líneas de transecto no necesariamente tienen que ser rectas. siempre que no se crucen con ellas mismas. Se debe asegurar que las líneas de pitfall se mantengan sin perturbación en todo momento. Es necesario anotar el punto de partida. dirección del transecto con la brújula y cualquier cambio de dirección. tales como pendientes. Si la línea atraviesa un árbol. ese tiempo podrá reducirse si se trabaja con varios equipos de dos personas. alrededor de 40 frasquitos de aproximadamente 1 x 5 cm. de manera simultánea. Si se emplean otros transectos en la misma parcela (por ejemplo. cuando se trata de decidir sobre la línea ideal. en diferentes secciones. pueden inclinarse para alcanzar ángulos de hasta 90°. estrechas zanjas con arroyos o cortes en el dosel. siempre que por lo menos una parte del sistema de raíces quede dentro de la cinta de muestra de dos metros de ancho. Un equipo de dos personas será capaz de muestrear entre 8 y 12 secciones por día (2 a 3 transectos). puede ser útil para picar madera o suelo. Se coloca el transecto de manera que visualmente atraviese los alrededores de manera homogénea. un transecto puede curvarse sucesivamente por dos ángulos de 90° para que corra hacia atrás hasta su punto de partida. Alternativamente. el transecto puede incorporar otros fenómenos naturales del ambiente biótico que contribuyen a su heterogeneidad física.cuchara de albañil. acantilados o caminos en uso que no sean hábitats adecuados para termitas. Procedimiento Se traza una línea de transecto de 20. En una parcela pequeña. especialmente en los casos de pequeñas parcelas. evitando grandes arroyos. El muestreo se estratifica por M acrofauna 101 . de alrededor de 8-10 cm.

lombrices de tierra y. incorporada en el suelo de superficie. un transecto de entrenamiento. es aconsejable comprobar la periferia y la base de la estructura. posiblemente. Los palitos deberán romperse en pedazos y golpearse moderadamente en las charolas para desplazar cualquier termita u hormiga que contengan. por lo tanto. El suelo. Los pedazos más grandes de madera deberán cortarse tomando en cuenta que pueden estar infectados en alguna parte. nidos subterráneos epígeos y arbóreos y montículos de una altura de hasta 2 m sobre la superficie del suelo (incluyendo nidos de bolsitas suspendidos en la vegetación).nichos. frecuentemente contiene termitas. Normalmente se requiere de un corto periodo de entrenamiento u orientación para que colectores sin experiencia puedan muestrear con la misma eficiencia que un experto. de 50 ó 100 m. sin olvidarse de las ramificaciones o de los helechos que pueden acumular suelo que contenga termitas. Los siguientes micronichos son investigados con detalle: hojarasca y la superficie del suelo hasta una profundidad de alrededor de 5 cm. por esta razón y para poder minimizar la necesidad de tener que trabajar con escasa luz. Es imposible muestrear con lluvia fuerte. debería muestrearse la primera vez bajo la supervisión de un colector experimentado. madera en todas sus etapas de descomposición. la hojarasca y los restos de madera pueden diseccionarse rápidamente en charolas. En la mayoría de las localizaciones no es necesario colectar cada termita y las especies más comunes podrán ser ignoradas después de muestrearse inicialmente para poder buscar las formas más raras o crípticas o para buscar soldados en especies que tengan una relación relativamente baja de soldado/obrero (tomando en cuenta que algunas especies no tienen soldados). junto con sus cámaras centrales. o cubierta de pedazos de suelo. otros invertebrados.4). Los colectores deberán trabajar de manera constante (no frenética) en cada uno de los periodos de muestra de 30 minutos y tratar de mantener el mismo nivel de eficiencia de muestreo en cada sección del transecto. Otras especies pueden habitar montículos y nidos o podrán coexistir con los que están construyéndolos. escarabajos y lombrices de tierra en nichos crípticos o cuando escasea la luz. acumulaciones profundas de hojarasca y suelo entre grandes raíces que funcionan como retenedores. se recomienda completar no más de 12 secciones en un día. esto ayuda mucho a ver las termitas (Figura 3. nidos de termitas o pistas de tierra en troncos de árboles y otra vegetación. por ello se permite interrumpir la labor 102 Manual de biología de suelos tropicales . El tronco de un árbol vivo puede ser investigado para ver si contiene túneles de termitas a una altura accesible. Idealmente. La madera podrida. sin necesidad de usar una escalera o tener que trepar (alrededor de 2 m). También resulta de ayuda descansar unos minutos entre secciones.

para dividir cada sección en dos subsecciones de 2. sección a sección. se puede usar un pincel de artista humedecido con alcohol para depositar el espécimen en el frasco colector. una docena de lugares separados en cada sección del transecto. sin dañarlos. el otro examina el suelo y las raíces de los árboles. hasta que mejoren las condiciones climatológicas. En los transectos donde se encuentran pocas termitas. es importante observar el protocolo de muestreo con precisión. en el M acrofauna 103 . Alternativamente. Nota: las pinzas finas son idóneas para atrapar insectos con cuidado. por lo menos. cada persona trabaja en una cinta de un metro de ancho. Se debe destinar un tubo de especímenes para cada población (o colonia aparente). previo acuerdo. Esto dependerá de la naturaleza del lugar y de la topografía. a pesar de que se trate de una pequeña cosecha.4 Extracción de termitas de una muestra de suelo en una charola de aluminio. Se recomienda que el suelo se extraiga en. en lo posible.5 x 2 m.Figura 3. sin interrumpir el trabajo. por ejemplo. El trabajo puede dividirse entre los colectores. contener soldados y obreros. en lados opuestos de la línea. de manera que mientras uno muestrea la madera. Procesamiento de especímenes Los especímenes representativos de las termitas encontradas deberán ser preservadas en alcohol al 80% y.

• Número de sección en el transecto donde se encontró el espécimen (1. se añade alcohol fresco y se escriben las etiquetas nuevas). se podrán escribir etiquetas o notas. para los taxónomos expertos. se podrá construir una curva de acumulación por especies basada en especímenes o simplemente por especies. 3. madera podrida. Los especímenes pueden resultar dañados o afectados en su color por el suelo o basura contenido en el frasquito. razón por la cual deben limpiarse lo antes posible (se separan las termitas del suelo o de la hojarasca. por lo tanto. los siguientes datos: • Fecha y clave del transecto. reduciendo así las posibilidades de cometer errores en la numeración. En otros lados. se deberán escribir las etiquetas (o las notas de campo) tan pronto como se hayan colocado las termitas en los tubos de especímenes. al completar cada sección del transecto. por lo que se podrán leer con mayor facilidad. Al tratar cada sección de 5 m. con lápiz o tinta indeleble y no. madera seca. lo que facilitará el trabajo. Todas las notas de campo se guardan en la libreta y. Las termitas deberán separarse en unidades taxonómicas reconocidas. etc. como una muestra independiente. en lugares ricos en termitas. los treinta minutos para el trabajo deberían incluir el etiquetado. Se generan diez secuencias al azar de las secciones por 104 Manual de biología de suelos tropicales . La información referente al micronicho en donde se encuentra cada espécimen es importante para poder establecer la naturaleza de la comunidad de termitas (especialmente la diversidad funcional del grupo) y para construir una curva de acumulación de especies. • El micro hábitat en cuestión (madera fresca. con pluma o bolígrafo.). los números de las etiquetas estarán relacionados.cual se introducirá una etiqueta. Alternativamente. suelo. sin embargo. 2. que se cortarán y pegarán en una libreta de campo. Para evitar la confusión. utilizando una impresora láser. donde se anotan. todas las etiquetas seguirán el mismo patrón. en orden secuencial. suelo a raíz de árbol). hojarasca. montículo. por morfoespecies o especies nombradas. el mismo día en que son colectados o tan pronto como sea posible. razón para destinar un mínimo de dos días a cada transecto de 100 m (proporcional para transectos más cortos). en el campo únicamente se añaden las etiquetas a los frasquitos y se toma nota en la libreta de campo de los números por sección y del transecto. se podrán imprimir etiquetas numeradas. Lo anterior hace que el procesamiento sea más eficiente.

Chao y ACE. para cada selección de las diez secuencias. M acrofauna 105 . La colección entera deberá ser preservada durante un tiempo después de la identificación para su posterior confirmación y se debe de depositar. el resto. será identificar cuáles son las que están presentes en la muestra. lo que resulta muy laborioso en términos de tiempo. en el lugar 2. entre otros (Magurran. o bien. parcialmente compuesta por especies identificadas y. a nivel especie. es decir. debería subir y posteriormente inclinarse. También es importante que las morfoespecies “A”. un subjuego en una colección de una institución nacional. 2004). Una curva ideal debería ser asintótica. en el lugar 1. de manera permanente. sin reemplazo. Una manera más realista sería obtener la lista final. Las muestras y los especímenes necesitan ser etiquetados y organizados cuidadosamente. se separaran en morfoespecies. El número de especies encontradas en cada sección se usa para calcular el número acumulativo de especies.medio de un trazo (en cada secuencia) de 20 secciones al azar. Las especies y morfoespecies encontradas por transecto pueden ser desde sólo unas cuantas hasta más de 50. es importante utilizar el mismo esfuerzo de identificación y métodos. Cuando se comparan datos de diferentes hábitats o localidades. finalmente. la identificación consiste en la determinación de la posición de un espécimen en la clasificación existente. pero esto muchas veces no es posible para algunos grupos de organismos de suelo. La identificación de organismos de suelo. se identificaría a nivel género y. Identificación El primer paso para compilar una lista de especies y organizar los datos del ensamble de las especies encontradas. 2000. Una taxonomía pobre podría resultar en una baja o sobreestimación de diversidad y similitud de especies y hacernos llegar a establecer conclusiones erróneas. 2004) que son implementados por el software libre EstimateS (Colwell. se calcula la media acumulativa de especies de los diez juegos de 20 secciones para cada sección y se construye una curva de acumulación de especies. Lo ideal sería que todos los especímenes fueran identificados hasta especie. indicando que se encontrarían pocas o nuevas especies con transectos adicionales en el área. tales como Jackknife de primer orden y Jackknife de segundo orden. normalmente requiere una pericia taxonómica alta. género y especie. trabajando desde niveles altos como órdenes hasta familia. dependiendo del lugar y de la región biogeográfica. sean las mismas que “A”. en un museo. La riqueza específica del lugar puede ser estimada utilizando métodos de extrapolación.

compare). pero no es obligatorio. Se trata de una lista organizada en orden alfabético. fueron identificadas plenamente a nivel especie. El dato de autor y año de publicación no forma parte de un nombre de especies y su uso es opcional. A y Termes sp. se utilizan con la misma connotación o de manera similar. 2000). Lista de guías y catálogo de identificación Se puede consultar una lista integrada de claves de identificación para termitas. el Código Internacional de Nomenclatura Botánica (Greuter et al. ocasionalmente. 1999). Tal abreviación se usa para indicar que la identificación es incierta. aunque frecuentemente se recomienda.Los métodos comunes de identificación de la fauna del suelo incluyen: a) uso de claves de identificación publicadas. No obstante. Termes sp. excluyendo animales. B fueron identificadas únicamente a nivel género y morfoespecie. (abreviación del latín confer. corniger y N. tienen un significado y su uso se determina de acuerdo con las reglas de nomenclatura. La abreviación “cf” en el caso de Coatitermes y Armitermes. similis. Los paréntesis. c) comparaciones con colecciones de referencia y d) envío de especímenes a un experto taxónomo. para plantas. En el caso de animales. 1992). Consulta un catálogo taxonómico que te permita comprobar la validez y cómo se deletrean los nombres. por lo tanto. el Código Internacional de Nomenclatura de Bacterias (Sneath. Se utilizan. N. hormigas y escarabajos en el apéndice 1 y listas más especializadas en las publicaciones 106 Manual de biología de suelos tropicales . de manera particular. para grupos de organismos diversos o poco conocidos. Otras abreviaciones.1 presenta un ejemplo de una lista de especies. será el Código Internacional de Nomenclatura Zoológica (Comisión Internacional de Nomenclatura Zoológica. b) comparaciones con descripciones. a modo de rutina. Nota que las abreviaciones “sp” y “cf” no aparecen en cursivas. La Tabla 3. Se muestran tres niveles de identificación. los Códigos de Nomenclatura contemplan reglas muy estrictas de formato para nombrar autores. y para bacterias. nunca se deben utilizar nombres manuscritos no publicados. lo cual generalmente resulta más práctico que un “orden taxonómico” subjetivo. El paréntesis que abarca el nombre de los autores indica que la especie fue originalmente descrita en otro género y después se transfirió al género actual. El formato de los nombres deberá seguir el código respectivo de nomenclatura. si existen. técnicas moleculares para la identificación de microorganismos. que deberán ser respetadas: los géneros y especies se imprimen en cursiva. por ejemplo.

7 Angularitermes sp. 18 Angularitermes sp.Tabla 3. peruanus Caetetermes taquarussu Constrictotermes cavifrons M acrofauna 107 . 9 Angularitermes sp. 19 Araujotermes nanus Armitermes holmgreni Armitermes minutus Armitermes teevani Atlantitermes osborni 1 1 1 13 9 13 46 2 2 1 15 7 1 1 1 1 1 2 2 6 1 7 3 4 1 3 1 2 1 1 5 1 1 1 1 1 4 14 1 6 1 6 25 8 1 1 2 19 20 3 1 9 4 10 71 47 3 10 1 2 16 7 1 3 Armitermes cf. 5 Angularitermes sp. Angularitermes sp. 10 Angularitermes sp. 12 Angularitermes sp. 6 Angularitermes sp. 8 Angularitermes sp. Especie Selva Barbecho Cultivo Agroforestal Pastizales 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Kalotermitidae Angularitermes nasutissimus Angularitermes sp. 4 Angularitermes sp. 11 Angularitermes sp. 17 Angularitermes sp. 2 Angularitermes sp. 16 Angularitermes sp. 13 Angularitermes sp. No.1 Ejemplo de lista de especies. 15 Angularitermes sp. 14 Angularitermes sp. 3 Angularitermes sp. 1 Angularitermes sp.

Especie Selva Barbecho Cultivo Agroforestal Pastizales 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 Coptotermes testaceus Cornicapritermes mucronatus Cornitermes pugnax Cornitermes sp. No. I 5 1 10 9 10 1 22 4 1 1 1 3 85 1 6 29 1 35 6 1 89 4 2 8 3 2 7 4 1 10 7 1 18 2 2 3 15 1 12 17 21 1 56 29 6 2 11 1 9 1 5 29 1 1 2 16 1 1 1 37 19 1 Nasutitermes sp. J Nasutitermes surinamensis Nasutitermes unduliceps 1 Nasutitermes wheeleri Neocapritermes pumilis Neocapritermes sp. A Nasutitermes sp.1 Continúa. Curvitermes odontognathus Cylindrotermes flangiatus Cylindrotermes parvignathus Embiratermes parvirostris Heterotermes tenuis Labiotermes psilus Microcerotermes strunckii Nasutitermes callimorphus Nasutitermes corniger Nasutitermes gaigei Nasutitermes guayanae Nasutitermes octopilis Nasutitermes sp. Neocapritermes talpa 1 2 6 1 1 1 108 Manual de biología de suelos tropicales .Tabla 3.

80 14.6 4 Muestras Especies Transectos Índice Shannon(H) Índice Simpson Rarefacción (100 muestras) Estimación de Chao 86. No.1 25.3 50.7 Estimación de Jackknife 1 74. 2 Ruptitermes sp.4 3 2 1 229 35 18 2.3 52.2 18.6 81.04 .4 1 5 2 2 1 3 8 7 471 50 39 2.41 0. 1 6 8 1 1 1 2 1 1 1 2 3 9 3 6 5 1 1 5 1 1 1 9 9 259 52 20 3.80 . Ruptitermes sp.90 25. 1 Ruptitermes sp.Tabla 3.81 14.96 34. 3 Subulitermes baileyi Subulitermes microsoma Syntermes molestus Syntermes spinosus Syntermes territus Termes hispaniolae Termes medioculatus Triangularitermes sp.8 72. 3 Triangularitermes triangulariceps Velocitermes sp.8 203 18 13 2. Especie Selva Barbecho Cultivo Agroforestal Pastizales 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 Neocapritermes taracua Neocapritermes villosus Obtusitermes sp.91 .4 M acrofauna 109 .3 25.3 17.90 26.01 .1 Continúa.1 3 119 15 10 2. Planicapritermes planiceps Rhinotermes hispidus Rhinotermes marginalis Rotunditermes bragantinus Rugitermes sp.

los cuales no están disponibles para el público en general. antes de tomar las muestras. junto con su calidad. aparentemente. cuentan con sus propios manuales. pueden consultarse en la lista de literatura. otra información puede ser obtenida del transecto. Si los detalles bibliográficos no están incluidos en la tabla. El mejor enfoque para identificación. Algunas veces se refieren a “comunidades de especies”. Una de las principales propiedades de un ensamble es “la diversidad de especies”. Las termitas pueden colocarse dentro de las siguientes categorías tróficas: • Las que se alimentan del suelo. Interpretación de resultados Los ensambles de especies son grupos de especies relacionadas taxonómicamente. en los apéndices 2 y 3. varían entre el taxa y entre regiones. Casi siempre la muestra no contiene todas las especies presentes en el hábitat.taxonómicas para termitas. por lo que muchos museos o instituciones científicas dedicadas a la taxonomía y conservación de la biodiversidad. pero este término no es correcto. formar un grupo funcional (GF) uniforme y su composición también puede verse afectada por los métodos de muestreo utilizados. en relaciones ecológicas actuales. la disponibilidad de claves adecuadas publicadas. Los ensambles de diferentes hábitats o localidades pueden compararse con varias estimaciones o índices y agruparse de acuerdo con sus similitudes. desde muestreo en campo hasta identificación y análisis de datos. por ende. La caracterización de un ensamble de especies involucra varios pasos. Lo más importante es la diversidad funcional del grupo. de un hábitat o área geográfica específica. Las termitas distribuidas en el perfil de suelo. esto se obtiene como resultado de la anotación del número de especies y morfoespecies. es necesario extrapolar de la muestra y utilizar estimaciones comparables de la diversidad local. por lo tanto. la cual se puede definir y estimar por varios métodos. la capa de hojarasca orgánica y/o montículos epigeos se alimentan del suelo mineral. al final del presente capítulo. Invariablemente. Aunque la información básica generada es la de riqueza especifica. Existe también una “literatura gris” extensiva de reportes de talleres. pues dichos ensambles son delimitados por una clasificación taxonómica basada en historia y filogenia y no. Los ensambles pueden o no. que se centran en una sola región. con un grado de selección de limos y fracciones de ar110 Manual de biología de suelos tropicales . será el entrenamiento o bien que el procesamiento de especímenes esté a cargo de un taxónomo con experiencia. conferencias y documentos producidos por proyectos de desarrollo internacional sin una distribución global.

Este grupo incluye algunos Macrotermitinae subterráneos y constructoras de montículos y otras Nasutiterminitinae y algunas otras que se alimentan en la superficie del suelo. normalmente compuestas por obreros y soldados forrajeros. todavía unidas del árbol viviente y árboles muertos en pie. 1996).• • • • cilla. normalmente cortan el material antes de consumirlo o lo llevan a sus nidos.. provenientes de pasajes subterráneos o la formación de columnas descubiertas de individuos. Las termitas que buscan hojas muertas. todos menos los que se encuentran en una fase de descomposición terminal. la cual se ha vuelto fácilmente desmenuzable y que se asemejan al mismo suelo o que predominan dentro del suelo. reconocida por Collins (1989). briofitas y líquenes en la corteza de los árboles (por ejemplo. hojarasca y superficie del suelo y porque hace agujeros que se abren en la superficie. Este grupo es sinónimo de “alimentadores medios” sensu DeSouza y Brown (1994). y menos tejidos de plantas reconocibles que en otros grupos (Sleaford et al. debajo de troncos o en suelo adherido a la superficie de troncos en estado de putrefacción. algas. Las termitas que se alimentan de madera y que cavan túneles en piezas más grandes de madera. Las que se alimentan de madera. o mezclada con hojas podridas en complejos de limo . Las termitas de alimentación especializada o incidental. Aunque el material digerido es altamente heterogéneo. al igual que otros que se han caído y se conservan aún frescos. Esta categoría sigue la lista de alimentación de termitas de acuerdo con Wood (1978). Las que se alimentan del suelo y de madera. Este grupo incluye termitas con nidos arbóreos. junto con por lo menos una termita inferior del sur de África Hodotermes mossambicus con un hábito similar. pastos vivos o secos y pequeños pedazos de madera. El término “madera” incluye ramas muertas. pero que se alimentan en otro lado y muchas Macrotermitinae que cultivan jardines de hongos. o bien. Este tipo de termita forrajera usualmente es más conspicua que otros tipos alimenticios. subterráneos o epígeos. Ruptitermes y otras especies de Constrictotermes en América del sur que se M acrofauna 111 .raíces. pero no en la misma categoría de “alimentadores de madera podrida”. quedan proporciones más altas de materia orgánica del suelo y sílica. incluye especies que se alimentan de hongos. Las que forrajean la hojarasca (Termitas forrajeras). Las termitas que se alimentan de madera muy podrida. por razones de las numerosas galerías o placas de suelo que construye encima de la madera. que pueden volverse centros de colonias. Hospitalitermes hospitalis en el sureste de Asia.

es posible comparar ensambles de termitas en base a tipos de nidos. especialmente bajo condiciones desfavorables. La forma de distribución de dichas categorías indica la estructura de la comunidad de termitas. aunque el excremento se puede considerar como forma de basura descompuesta) y también ciertas habitantes secundarias de montículos de termitas que se alimentan de los forros hechos de rica materia orgánica. las comunidades de selva son frecuentemente dominadas por las que se alimentan de suelo. Eggleton y Bignell. • Las que anidan de manera hipogea. La identificación del grupo funcional puede hacerse de acuerdo con el color abdominal en especímenes vivos (las alimentadas de suelo y suelomadera son más oscuras). Termitas cuyos centros de colonia quedan bajo el suelo. pero la perturbación o un periodo de secas. etc. las que se alimentan de excrementos o las carroñeras de cuerpos de vertebrados (probablemente consumidos oportunamente. Algunas veces la madera muerta es gradualmente reemplazada por material acartonado o por panales de hongos. Las categorías no son mutuamente excluyentes y muchas especies toman sus alimentos de por lo menos dos fuentes diferentes.Gay y Calaby. el lugar de su descubrimiento (en madera.alimentan de líquenes). que habitan dentro de los nidos de Constrictotermes). una aproximación útil se obtiene dividiendo las especies en “alimentadas de suelo” o geófagas (alimentadas de suelo. en África oeste y central. en Australia. la mayoría de la Apicotermitinae se alimentan de suelo o de suelo y madera). Los centros son pocos definidos y amorfos (especialmente en 112 Manual de biología de suelos tropicales . Ophiotermes y Tuberculitermes. Las termitas cuyos centros de colonia normalmente se concentran en troncos muertos o árboles en pie. Inquilinitermes. incrementa las proporciones de otros grupos funcionales. otros aspectos biológicos como el lugar donde anidan (las que anidan en árboles normalmente no se alimentan de suelo). y suelo y madera) como las definidas arriba. las Macrotermitinae no se alimentan del suelo. la ausencia de soldados (generalmente indica las que se alimentan del suelo) y la afiliación taxonómica (por ejemplo. aunque ninguna especie es realmente fitófaga. suelo. Si se dificulta la selección de un grupo funcional. 1970. y “las que no se alimentan de suelo” (todas las demás). según las siguientes categorías: • Las que anidan en madera. encontrada en las cámaras interiores como inquilinas obligadas (Por ejemplo: Ahamitermis y Incolitermis.). Algunas termitas también se alimentan de tejido de planta viva. de manera similar. generalmente. 1997.

Estos montículos. adiciones y ocupación por parte de habitantes secundarios. usualmente construidos con material de apariencia acartonada (cartón). En la mayoría de los casos. utilizando permutaciones de datos al azar. Nidos que se sujetan a árboles y que se localizan en diferentes alturas. pero con una tendencia a volverse más irregulares con el paso del tiempo por razones de erosión. • Montículos epigeos. estos nidos están conectados con el suelo mediante pistas cubiertas que pueden ayudar a distinguir algunos nidos de termitas arbóreas de los de hormigas.5 Ejemplo de curva de acumulación de especies con una desviación estándar. hechas de acuerdo con especificaciones típicas de la especie. que se forman por sí solos o que se asocian con los contrafuertes de los árboles. M acrofauna 113 . Figura 3. Este grupo incluye especies que son habitantes secundarias facultativas de montículos epigeos. aunque algunas forman nidos subterráneos complejos (por ejemplo Marcotermitinae).los Apicoterminotenae que no tienen soldados). con estructura interna poco obvia. Termitas cuyos centros de colonia se sitúan arriba del suelo. pero excluyen montículos arbóreos. • Montículos arbóreos. normalmente están bien definidos y constituyen estructuras altamente complejas.

tienen diferentes sig114 Manual de biología de suelos tropicales . se pueden obtener utilizando permutaciones (reiteraciones) de los datos al azar (Figura 3. en la secuencia en que fueron anotadas en el campo. 2000). producción de excretas por cada tipo de uso de suelo. con desviaciones estándar. Las curvas de acumulación de especies pueden ser obtenidas reiterativamente mediante remuestreo al azar de los monolitos de suelo o por secciones de transectos. la curva es asintótica y tiende a inclinarse. UTILIZANDO EL MÉTODO WINKLER Introducción Las hormigas pueden clasificarse en grupos funcionales o gremios. La prueba Kruskal-Wallis ANOVA puede utilizarse para probar si existe un efecto significativo de los tipos de uso de suelo en relación con la abundancia de lombrices de tierra. tales como el de componentes principales (PCA). hasta 500 veces. Otro método será normalizar la densidad y la biomasa de las lombrices de tierra antes de llevar a cabo el análisis paramétrico de varianza (ANOVA). tiempo (o persona por tiempo). o área. Los análisis de multivariados. en relación con el número de unidades de muestreo.0b1 (Colwell. en el caso de lombrices de tierra. con un 5% de nivel de probabilidad. en todos los paisajes agrícolas (Thioulouse et al.5) u otros métodos que normalmente requieren de programas computacionales especializados. es únicamente una gráfica del número de especies acumuladas. Las curvas más sofisticadas. Aunque algunos autores consideran estos nombres como sinónimos. La relación entre abundancia de lombrices de tierra y el índice de uso de suelo se comprueba utilizando regresiones. En el caso de un esfuerzo de colecta grande. número de especies y. Para más análisis estadísticos. trampa. el de correspondencia (AC) y el de co-inercia pueden ser útiles para determinar factores que afectan la densidad y la diversidad de lombrices de tierra. OTRA MACROFAUNA Y MESOFAUNA EN HOJARASCA.Curvas de acumulación de especies Las curvas de acumulación de especies son gráficas que representan la relación entre el esfuerzo de muestreo y el descubrimiento de las especies en un hábitat o región. muestra. utilizando el software de EstimateS versión 6. HORMIGAS. 1997).. La forma más simple de estas curvas es conocida como la curva del colector. mediante la prueba Fisher. El esfuerzo de muestreo puede ser medido por espécimen. se establece la comparación de la media del índice Shannon-Wiener.

• Especies dominantes: especies muy abundantes y agresivas que influyen sobre la distribución y el comportamiento de otras especies de hormigas. • Especies especialistas en clima y suelo: estas especies (Melophorus spp.. Los siguientes son ejemplos de gremios en la selva brasileña de la Costa Atlántica (Delabie et al. • Especies oportunistas: escasamente competitivas. • Especies crípticas: especies de hormigas forrajeras que normalmente anidan bajo el suelo (en la capa de suelo y hojarasca).. Crematogaster y Pheidole.. Bothroponera y Odontomachus).. hormigas no especialistas que frecuentemente viven en ambientes perturbados (Rhytidoponera spp. de modo que minimizan el contacto con otras hormigas que no ocupan este hábitat (Brachyponera spp. • Especies forrajeras solitarias de tamaño relativamente grande: predadoras solitarias que manifiestan muy poca interacción con otras especies de hormigas (especies dentro de los géneros Myrmecia. las pertenecientes al género Camponotus. originalmente diseñado para hormigas australianas. en su mayoría. Aphaenogaster spp. • Especies generalistas myrmicines: especies que pertenecen al género Monomorium.).nificados: los gremios son un grupo de especies que utiliza el mismo tipo de recurso para su supervivencia (Terborgh y Robinson. son cosmopolitas. pues es la más usada en diferentes paises. 1986). se recomienda utilizar el de Andersen (1997). que pueden coexistir con la dominante Iridomyrmex spp..) muestran adaptaciones fisiológicas. y Notoncus spp. M acrofauna 115 . Meranoplus spp. 2000).. Paratrechina spp. mientras que los grupos funcionales se refieren a especies que utilizan estrategias similares para explotar el recurso y pueden estar formados por más de un gremio. Eurhopalothrix spp. no especialistas y altamente competitivas. debido al tamaño relativamente grande de su cuerpo y a su comportamiento sumiso. Ejemplo: Iridomyrmex spp. morfológicas y de comportamiento que reducen su interacción con la dominante Iridomyrmex spp. • Especies subordinadas asociadas: incluyen. Aunque han sido varias las propuestas de esquemas de clasificación de grupos funcionales.).

por ejemplo. para trabajo de campo práctico. la empleada en el taller CSM-BGBD (2005): 116 Manual de biología de suelos tropicales . probablemente comedoras de larvas de termitas del género Syntermes (Delabie. Atta. • Especies de hormigas legionarias: también conocidas como “formigas da correição”. b) verdaderas omnívoras: Brachymyrmex. Paratrechina. por ejemplo. Myrmicocrypta. donde son forrajeras. • Especies de hormigas subterráneas: dependen de gotitas de aguamiel y comen secreciones de azúcar de otros insectos. Solenopsis (especies grandes) y Wasmannia. carroña y restos de plantas para cultivar sus hongos. ejemplos: Eciton. son altamente agresivas y presentan una influencia competitiva sobre otras especies. son generalistas o especialistas dentro de las especies predadoras. • Especies de hormigas arbóreas dominantes: especies omnívoras que anidan en árboles. Utilizan hojas frescas. predadoras especialistas que comen otras hormigas. Anochetus e Hypoponera. • Especies de hormigas dominantes en suelo u hojarasca: hormigas forrajeras de hojarasca y suelo o de la superficie. es conveniente escoger las clasificaciones más cortas.• Especies omnívoras: especies que se alimentan de varias fuentes. ejemplos: Gnamptogenys (hormigas y otros insectos depredadores). ejemplo: Amblyopone (predadoras de termitas) y Thaumatomyrmex (predadoras de miriápodos) y Strumigenys (predadoras de colémbolos). se subdividen en dos grupos: a) predadoras generalistas grandes. ejemplos: Acromyrmex. Campanotus. • Especies predadoras generalistas: especies que se alimentan de diferentes tipos de presas. Pheidole y Solenopsis. ejemplo: Acropyga. Labidus (predadoras generalistas) y Neivamyrmex y Normamyrmex. • Especies predadoras especialistas: especies que se alimentan de un solo tipo de presa. forrajean toda la vegetación arriba de la superficie y en la hojarasca. Pachycondyla y Centromyrmex (inquilinas de nidos de termitas). • Especies cultivadoras de hongos: especies que utilizan hongos simbióticos. ejemplo: Azteca y Crematogaster. Cyphormyrmex. 1995). ejemplo: Odontomachus y Ectatomma. incluyendo los restos de animales muertos. ejemplo: Megalomyrmex. Sericomyrmes y Trachymyrmex. normalmente miembros de Attini. Apterostigma. Mycocepurus. • Especies predadoras de suelo: especies que se establecen en el suelo y en la hojarasca. También existen otras clasificaciones funcionales.

b) transportar al laboratorio dentro de una bolsa segura. • Herbívoras. • Carnívoras (especialistas o generalistas). que se encuentra en. Procedimiento de muestreo El procedimiento completo se lleva a cabo en tres fases: a) tamizar en campo para separa la hojarasca fina (con hormigas) de la materia más gruesa. Esto debe hacerse con suficiente habilidad. de manera que se puedan separar los fragmentos más gruesos. Se utiliza un marco para delimitar un área de un 1 m2 y se remueve la hojarasca a mano. con el centro de colonia epigeo o arbóreo.• Carnívoras (especialistas o generalistas). el contenido de las bolsas de campo se transfiere a redes. ventilado y bajo condiciones ambientales. sobre una sábana blanca. estas redes se fijan dentro de la trampa Winkler. por lo menos. Se coloca un frasco con alcohol al 70% en la base de la trampa Winkler. La fracción fina queda en el fondo de la bolsa del tamiz. cuando los Winklers no se encuentren disponibles. preferentemente colocados a lo largo de la línea de transecto. hacia arriba. lentamente las hormigas y otros insectos migran hacia afuera y se caen en el alcohol. con el fin de maximizar la recuperación de los especímenes (Delabie. los cuales son colgados en un lugar cubierto. Se recoge primero la hojarasca. se mantiene la trampa durante por lo menos 72 horas. conforme se seque la hojarasca. • Herbívoras. Se tamiza cada muestra de hojarasca para remover pedazos grandes. con un centro de colonia subterránea. Este procedimiento permite separar la macrofauna pequeña y alguna de la mesofauna M acrofauna 117 . con un centro de colonia subterráneo. • Carnívoras (especialistas o generalistas). en alcohol al 70%. véase también el Capítulo 2). c) extraer las hormigas dentro de la trampa Winkler. con un centro de colonia epigeo o arbóreo. con el centro de su colonia en las capas superficiales de hojarasca. junto a la coordenada GPS y al monolito (Ilustración 1. Se almacenan los especímenes en tubos cerrados y etiquetados. junto con las hormigas y se transfiere a bolsas en campo. realizando movimientos laterales. de manera que no escape ningún insecto. tres cuadrantes de 1 m2. con guantes de cuero. • Herbívoras. posteriormente. con un centro de colonia en las capas superficiales de hojarasca. cerrado pero ventilado. Una vez en el laboratorio. se puede pasar la hojarasca burda por una malla de 2 mm. trabajando desde el borde hacia el centro. como complemento o alternativa. 1999).

deberá ser pesada al final de la extracción. se pueden recolectar los especímenes de la sábana. Se achica el fondo de la bolsa para que se pueda colocar un frasco de aproximadamente 200 ml de capacidad. contenida en la trampa Winkler. plástico o aluminio para delimitar el área de muestreo. • Redes. tarros. después de limpiar la hojarasca suelta en el punto donde se va a colocar la trampa. de aproximadamente 34 cm de ancho x 55 cm de largo.. ESCARABAJOS. 2000) es la siguiente: • Marco con una medida de 1 x 1 m de madera. de alrededor de 5 mm. 25 cm de ancho y 20 cm de profundidad central. dichas trampas están hechas de envases profundos relativamente pequeños. se marca un límite de búsqueda de 30 minutos por cada metro cuadrado de hojarasca muestreada. de 25 cm de ancho y 37 cm de largo. las cuales serán llenadas holgadamente con la hojarasca trasportada en las bolsas del campo y se colocaran en el centro de la trampa Winkler para dar paso a los invertebrados. el cual contiene alcohol al 70%. OTRA MACROFAUNA Y MESOFAUNA QUE SE ENCUENTRAN EN LA HOJARASCA: TRAMPAS PITFALL CON Y SIN CEBO Introducción Las trampas pitfall o de caída constituyen un método efectivo de recolección de muestras de los invertebrados meso y macro que viven en la hojarasca. Como variación de este método. que entre dentro de una bolsa resistente de nylon o tergal. hasta el lugar donde se encuentren las trampas Winkler. la parte superior del envase puede situarse a 1 cm más arriba de 118 Manual de biología de suelos tropicales .del material orgánico y. por ejemplo. La hojarasca seca. las cuales se usarán en campo para transportar el material tamizado. en este caso. utilizando un aspirador manual (pooter). botellas de plástico.5 m de largo. • La trampa Winkler consiste en una bolsa porosa de algodón o nylon. que se entierran de manera que la parte superior del envase quede exactamente al ras del suelo. • Tamiz de malla grande. vasos. La lista completa de los materiales para la extracción con trampas Winkler (Bestelmeyer et al. de aproximadamente 1. • Bolsas de nylon.50 m de largo. latas. tazas. a prueba de insectos y mide 1. una por cada trampa. de esta manera.

ortópteros juveniles.6 Esquema de una trampa pitfall con cebo. Nota: frascos con diámetro de 10 a 20 cm generalmente son efectivos. éstas ofrecen ventajas adicionales: se puede muestrear. mientras que los insectos alados se escapan). No obstante. normalmente. las dimensiones no son fundamentales. M acrofauna 119 . Las trampas pitfall no son cuantitativas y dado que. las pitfall son proclives a sufrir daños ocasionados por mamíferos y aves. Las pitfall son baratas. miriápodos. se pueden utilizar específicamente para atrapar animales nocturnos. El diámetro más pequeño ofrece la ventaja de sufrir menos perturbación al momento de insertar la trampa. la macrofauna y parte de la mesofauna (especialmente. de manera simultánea. ahogándose en agua contenida en el fondo de la trampa. hormigas. Una típica trampa pitfall puede observarse en la Figura 3.la superficie y se construye una rampa de suelo suelto a su alrededor. pero la trampa debe ser lo suficientemente amplia como para poder colectar un número razonable de especímenes y suficientemente profunda Figura 3. Las trampas normalmente se limpian y se recolocan una vez al día.6. puesto que en ambas existe un alto grado de autocorrelación entre muestras adjuntas. arañas y otros arácnidos grandes tienden a dominar. por lo que se utilizan frecuentemente en los trabajos de inventario de la biodiversidad. al igual que a actos de vandalismo. presentan algunas desventajas: sobre todo que no muestrean todos los grupos taxonómicos con la misma eficiencia (escarabajos. se encuentran dispuestas de manera lineal (para facilitar la instalación y el retiro) sufren la misma desventaja que los transectos. colémbolos). Las trampas se colocan bajo cubierta para evitar que entre la lluvia y funcionan como colectores de artrópodos que viven en el suelo y que caen en el envase. Además. de fácil instalación.

Los clavos galvanizados o de madera son la mejor opción para elevar el techo hasta dos Figura 3. ésta descansará sobre palitos o clavos. éstos pueden ser improvisados en el campo. una caja Petri de vidrio invertida. es lo ideal. hecha con un vaso. sin embargo. cuatro palitos pequeños y una cubierta de celofán. 120 Manual de biología de suelos tropicales .para impedir la fuga.7 Trampa pitfall improvisada. Un aditamento usual a las trampas es un techo inclinado para protegerlas de la lluvia. Entre 1 o 2 cm de agua en el fondo y un poquito de detergente serán suficientes para ahogar o inmovilizar a la mayoría de los animales y el detergente contrarrestará las propiedades hidrofóbicas de muchas cutículas de artrópodos.

de manera alternativa. el techo debería ser opaco para evitar un efecto invernadero dentro de la trampa. de manera que permitan el acceso a las trampas. con una respuesta negativa a la luz. por lo que el techo se mantendrá más estable. madera u otro material lo suficientemente pesado como para que no lo eleve el viento o que pueda ser afectado por la lluvia o el sol y que además no sea comestible para las termitas. En estudios referidos a riqueza de especies. aunque su aplicación más común es en un sustrato de suelo para la fauna de artrópodos activa en la superficie del suelo (Figura 3. El uso de envases de color fuerte o con dibujos puede mejorar la captura de parasitoides u otros insectos voladores que serán atraídos por los colores. 2001). madera podrida y turba. hojarasca. con la excepción de agua y roca. combinados con un poco de glicerina) para mejorar su conservación. una solución de hidrato de cloruro al 5% o una mezcla de ácido láctico/ácido acético (10% de cada uno de ellos. de manera que no atraiga insectos voladores. también crea un microhábitat como si fuera una cueva. En otras palabras.o tres centímetros. Se puede argumentar que cuando se trata de sol directo.7). Estudios que se enfocan a la abundancia. éste deberá ser gris claro. retardando así la descomposición. ¿cuál sería el número apropiado de trampas pitfall requeridas para colectar el 85% o más de las especies capturables en una unidad vegetal dada? En el muestreo basado en transectos (Swift y Bignell. las pitfall normalmente se colocan en paralelo y M acrofauna 121 . dentro de un rango de unidades vegetales. Pueden emplearse para muestrear artrópodos en madrigueras. lo que resulta atractivo para los artrópodos diurnos activos en la superficie. plástico. Las trampas pitfall pueden usarse en cualquier sustrato a nivel del suelo. pero deberán evitarse siempre que se pueda. el número de especies obtenidas por medio de las trampas pitfall se incrementa cuando éstas son colocadas en un máximo de unidades vegetales. El número de réplicas puede basarse en curvas de acumulación de especies y ha de ser seleccionado para lograr un 85% o más de las especies buscadas. muestran que un nivel de captura aproximada puede obtenerse mediante la replicación de trampas pitfall. El vidrio pesa más que el plástico. pueden ser útiles para la estimación de la diversidad alfa. En algunas variaciones de este procedimiento se añade sal como conservador. pero se puede utilizar. al mismo tiempo que ayuda a mantener el contenido fresco. El techo puede hacerse también de loseta de cerámica. Colocación de trampas Mientras las pitfall son estrictamente no cuantitativas. ajenos a la fauna del suelo.

sugerido por Southwood (1978) hace uso de tablas de madera o de algunos obstáculos similares de hasta 30 cm de alto. colocados en la superficie del suelo. ello depende del largo del transecto. extracciones de núcleos de mesofauna y de microsimbiontes y. las partículas más grandes. Instalaciones de las trampas pitfall Las trampas pitfall deben ser introducidas en el suelo con el borde superior del envase al ras del mismo o de la superficie de la hojarasca. La colecta de las pitfall es sensible a la perturbación. Se usa el relleno para construir una rampa. con el fin de hacer un hoyo del tamaño del vaso a introducir. 2 Se coloca la trampa pitfall en el hoyo y el borde externo se llena de tierra procedente de la excavación. Se debe tener especial cuidado para evitar remover suelo y raíces. deberán ser extraídas a mano. No se especifica el número. es decir. ordenar el lugar entero. Un esquema variable de muestreo con pitfall. pero esto no trata de ser prescriptivo. 3 El suelo fino. especialmente a pisadas. se sugiere que las pitfall sean colocadas a lo largo de la línea de transecto y a un lado de los cuadrantes de 1 m² del muestreo para hojarasca. las pitfall pueden ser distribuidas de la misma manera que en el muestreo casual para hormigas y termitas. finalmente. capítulo 2. puede soplarse hacia afuera. se aplana con cuidado para mantener el mismo nivel que el borde de la trampa. Se muestrea. Cuando una parcela es botánicamente compleja y varias unidades vegetales pueden ser reconocidas. de manera que los animales caminen sin obstáculos hacia el borde de la trampa.a cada lado. se canalizan los animales móviles hacia la base de la “V” o embudo. cualquier microhábitat de interés podrá ser investigado. por lo tanto. podrá hacerse en cualquier momento. a una distancia de alrededor de 5 m. según el orden de vulnerabilidad decreciente: primero las pitfall (de un día para otro) seguidas por los transectos. De esta manera. una precaución sensata sería. que cae en la trampa durante su colocación. donde se puede colocar una colección de pitfall de manera cercana (véase "cercas movibles”). 122 Manual de biología de suelos tropicales . en forma de “V” o de embudo. En el sistema de muestreo recomendado para el proyecto CSM-BGBD. El número recomendado es de 3 a 5 trampas por cada punto de muestreo. Un muestreo ocasional. fuera del área principal de actividad. de manera que se minimice al máximo la perturbación del microhábitat adjunto. el monolito. 1 Se utiliza una cuchara de albañil para cortar y sacar las raíces y suelo.

El mantenimiento y el procesamiento de especímenes El mantenimiento de las trampas se lleva a cabo de la siguiente forma: se quita el techo y se levanta el vaso interior que contiene el cebo (en el caso de que lo contenga. 5 Se llenan las trampas hasta alrededor de ¼ de su capacidad con agua y suficiente sal como para lograr una solución saturada (en caso de escoger una solución salina). lo que dificulta que sean manipulables y visibles bajo M acrofauna 123 . El detergente facilitará la inmovilización por ahogamiento de animales activos. trampa y fecha de recolección. Se extraen los elementos grandes. ver abajo). la sal y el detergente. resulta útil para identificar la localización de la trampa y para prevenir pisadas accidentales. si se les introduce directamente en alcohol. se agita suavemente el contenido restante del vaso para levantar los especímenes del fondo y se filtra con una red de acuario. El lavado de ejemplares en agua fresca es esencial porque el detergente y la suciedad forman una película sobre los insectos. dejando así 2. Los especímenes deberán procesarse el mismo día en laboratorio o la base de campo. se utiliza por separado un colador de 53 µm. un palito. durante varios minutos. utilizando un frasco para enjuague o pipeta de agua. Se añade un poquito de detergente como agente tensoactivo. esta película es difícil o hasta imposible retirar una vez que los ejemplares quedan conservados. animales más grandes. Se transfieren los especímenes en bolsas de plástico o frascos desde la red. Se retira cualquier basura grande restante y se trata de retirar al máximo la tierra u otra basura orgánica.4 Se insertan tres soportes de techo en el suelo alrededor de la trampa. Para poder retener los colémbolos. a no ser que la frecuencia de mantenimiento sea de 24 horas o menos. que hayan caído en la trampa. etc. arriba del substrato. lo que servirá para separar los últimos ejemplares. con el fin de remover la suciedad. utilizando un flujo suave de agua. siempre se necesitará sal u otro tipo de conservador en climas tropicales. 7 Se coloca un indicador con el número de lugar y trampa (en tinta indeleble o lápiz) cerca de la trampa. situado en su parte superior. enjuagando el contenido de cada bolsa en la red. palitos. Cada trampa se debe procesar de manera separada y se coloca en la bolsa o frasco una etiqueta con la identificación del lugar. tales como hojas. colocado verticalmente con un pedazo de cinta o banderín amarillo o naranja. 6 Se coloca el techo sobre los soportes.5 cm de cada soporte visible.

El cebo puede ser estiércol. porque la capacidad de captura de las pitfall está en función del tamaño de su circunferencia. La principal modificación en el diseño consiste en agrandar su diámetro. El cebo deberá separarse del líquido conservador. Las muestras almacenadas deberán quedarse en una bolsa doble o frasco. por supuesto. o sustancias sintéticas atractivas (por ejemplo. carroña. el porcentaje de todas las trampas estará ocupado por una sola especie) porque no se puede determinar 124 Manual de biología de suelos tropicales . se invierte el contenido de la red en una bolsa de especímenes y con un atomizador o piseta. Después de siete días se debe cambiar el alcohol y. esto se lleva a cabo con la suspensión del cebo en un pequeño bote colocado en la boca del envase principal. frutos caídos u hongos en descomposición que resultan indistintamente atractivos para los detritívoros y algunos otros tipos de artrópodos. Para el procesamiento de ejemplares de colémbolos véase Capítulo 4 (Mesofauna). en espera de futuros procedimientos. y se introducen las etiquetas (escritas con tinta indeleble o con lápiz). se lava suavemente el contenido de la red y los lados de la bolsa o frasco con el fin de que los ejemplares caigan hasta el fondo. Se pueden preparar trampas pitfall adicionales (opcional) con un contenido de 120 ml de etanol al 95% + glicerina (9:1) que se dejan en campo durante 72 horas. El excremento humano fresco también es apetecible para una gran variedad de escarabajos y. se refrigeran o se congelan las muestras. El hecho de usar cebos atractivos implica un mejoramiento general para la captura de una gran variedad de artrópodos. se encuentra fácilmente disponible. Después de este lavado. rojo o azul) para atraer moscas o parasitoides. cebos de color (amarillo. lleno de alcohol. si es posible. Para mejorar la capacidad de captura con trampas pitfall Es posible mejorar la capacidad de captura con las trampas pitfall haciendo varios cambios en el diseño de la trampa o usando cebo atractivo para artrópodos. Se cubre con alcohol la muestra hasta la altura de los ejemplares que se encuentran dentro de la muestra. se usa alcohol al 95% en el caso de colémbolos y al 70% para otros especímenes. Se recomiendan dos trampas de este tipo más tres de diseño convencional por cada punto de muestreo. Las trampas con cebo no podrán utilizarse en una evaluación semi-cuantitativa como medio de captura (por ejemplo.microscopio. feromonas). Una variante de este proceso es usar dos filtros para colémbolos (malla 53 µm y 38 µm) se utilizan para separar estos animales de la otra fauna (ver Capítulo 4). El uso de cebos resulta controversial porque el muestreo se sesga hacia los animales con un marcado olfato.

• Bolsas de plástico para muestreo con sello (tipo ziplock son las más convenientes para el almacenamiento de especímenes de campo) o frascos. • Soportes del techo: clavos de madera o galvanizados de 152 mm (seis pulgadas). se hace una lista de especies. • Cubeta o envase para agua. sin embargo. • Red de acuario o similar (de malla fina). M acrofauna 125 . transectos. Para completar la lista. siempre que sea posible agruparlas en familias o subfamilias. La presencia y el peso de hongos cultivados por las termitas (si los hay) también deberán anotarse. se puede estimar el peso fresco para ejemplares conservados. no. • Agua: agua de la llave o de una fuente natural. esto es aplicable para las lista de especies de la localidad. • Lápiz de grafito (ej. • Techo de 200 x 200 mm (uno por trampa). utilizando el nombre genérico y por orden alfabético. por lo menos.el área en donde se llevó a cabo el muestreo y la captura no sólo depende de la abundancia de animales. Lista de materiales requeridos • Trampas pitfall: vasos de plástico de 1000 ml (con dimensiones de 180 mm de diámetro superior x 120 mm de profundidad). Si no se cuenta con una balanza disponible en el campo. 2 o 6B) • Etiquetas tipo tarjeta. trampas pitfall junto con un muestreo casual. se combinan los resultados de los monolitos. REGUISTRO E INTERPRETACIÓN DE DATOS Parámetros Registre el número y peso fresco de todos los organismos e identifique. sino también de la movilidad relativa. loseta de color gris claro. pesados después de un secado con papel absorbente. • Detergente puro: detergente líquido no perfumado para platos. hasta el nivel de determinación taxonómica y funcional más alta posible. • Indicadores de plástico o de madera. • Alcohol al 70 al 90%. trampas Winkler. • Sal.

Sitio Media aritmética individuos m-2 (n=5) BS1.772 0-20 2-534 95% de confianza 3-64 43-148 24-78 1-50 * Datos retrotransformados. Fuente: datos de especies de Jones et al. La abundancia se estima como número o individuos por m2. Las especies identificadas únicamente a nivel género. Es importante que la designación de letra sea consistente entre las localidades. Cassava 26 Media aritmética Nivel del estrato (Promedio de todas individuos m-2 (n=5) las localidades) 46 0–10 cm 106 10–20 cm 55 20–30 cm 49 Media geométrica individuos m-2 (n=5)* 971 65 47 11 25 2 10 Media geométrica individuos m-2 (n=5)* 15 80 44 4 95% de confianza 347-12. Selva primaria 2. Paraserianthes 512 BS8. deberán enlistarse sin letras: Ejemplo Colobobsis sp. Tabla 3. la especie A es la misma especie en toda el área de muestreo.046 2-9. con la excepción de las lombrices de tierra y milpiés.892 BS3. Árboles talados 163 BS6. Hule 128 BS10. Selva de hule 211 BS12. a través de un gradiente de perturbación de la selva. Incorpore la lista de especies en una tabla que muestre las localidades donde fue encontrada cada una..827 22-977 5-16. Alang-alang 3 BS14. 2003.445 2-1.2 Densidad numérica (individuos m2) de termitas en siete localidades. B.Las especies plenamente identificadas deberán enlistarse con su nomenclatura binomial (género y especie) y la autoridad que las describió completas: Ejemplo Dorylus laevigatus Smith. en la provincia Jambi del centro de Sumatra. de cada monolito y de cada estrato. los cuales se muestrean en el mo126 Manual de biología de suelos tropicales . Por ejemplo. y Crematogaster sp. A. se multiplica el número crudo de cada monolito x 16. Las morfoespecies deberán enlistarse por letra: Ejemplo Crematogaster sp.

También partiendo de que un transecto completo representa una muestra única y grande. Algunos indicadores de la abundancia relativa se pueden obtener a partir de la frecuencia de encuentro de diferentes especies (número de secciones de un transecto en donde se localizó la especie con respecto al número total muestreado. junto con las medias geométricas.nolito y la zanja (véase monolitos arriba). tal y como se muestra en la tabla 3.). o sea. Se aplican estadísticas descriptivas al juego de datos transformados.2). existe un método alternativo que consiste en calibrar la biomasa viva con el ancho de cabeza. y prepare una tabla resumida. Se estima la biomasa en g.. derivar en índices de diversidad de especies y de equitatividad. también es posible que el número total de encuentros. se calculan las medias aritméticas. resulta más conveniente M acrofauna 127 . véanse las discusiones en Eggleton y Bignell (1995). 1996). finalmente. Eggleton et al. Se citan las medias para datos no transformados. Se evita el uso del peso seco debido a las diferentes temperaturas de los hornos que usan algunos investigadores y por el contenido variable de agua de los diferentes tipos de organismos. se utiliza peso fresco o la masa de un espécimen parcialmente seco. datos transformados y los límites de confianza para log10(x+1). En casos difíciles. Cuando no hay demasiados ceros (muestras sin organismos) este procedimiento debería normalizar los datos y producir varianzas homogéneas de grupo a grupo. o para otros grupos individuos separados a lo largo del transecto completo. Donde se dispone de especímenes de insectos de varios tamaños. El peso de los desconocidos puede entonces estimarse desde la curva. Para la información completa obtenida de transectos. Este concepto no se puede aplicar de la misma manera para las pitfall. en especímenes representativos que cubren todo el rango de tamaños. por lo tanto. Para poder estimar el 95% de límite de confianza. En el caso de transformaciones a log de los datos. etc. los datos primarios deberán transformarse en log10(x+1). (1997). el número de veces que se descubren colonias separadas en el caso de hormigas o termitas. puedan ser parámetros útiles de población. incluyendo el 95% de los límites de confianza y con los datos transformados se obtiene una media geométrica. se determina la abundancia para cada taxón. (2005).m-2 de manera similar a como se calcula la abundancia. también para cada grupo taxonómico superior y se combinan los datos de todas las especies. número de pitfall respecto al total. se puede probar una transformación loglog. Woodcock (2005) y Jones et al. es posible asignar dominancia y. si es posible. Jones e Eggleton (2000). Los datos transformados pueden usarse para histogramas y comparaciones de lugar a lugar (Eggleton et al.

Especies epigeas que viven y se alimentan en la superficie del suelo. escarabajos. ingiriendo grandes cantidades de materia mineral. menos informativa. abundancia y biomasa en forma gráfica. la clasificación de lombrices de tierra (ya mencionada) puede aplicarse a todos los invertebrados del suelo. caracoles y pequeñas lombrices de tierra completamente pigmentadas. Las lombrices de tierra y las termitas que no se alimentan de suelo constituyen los principales grupos dentro de esta categoría. Para poder establecer una comparación. Se prepara una tabla resumida. milpiés. las cuales pueden ser incluidas en una o más 128 Manual de biología de suelos tropicales . sin embargo. una variedad de artrópodos (hormigas. pero también algunos arácnidos. de manera que monitorear datos sin estimaciones de biomasa proporciona información incompleta y. La macrofauna activa en la superficie incluirá a los organismos muestreados en las trampas pitfall. elementos minerales y materia orgánica se redistribuyen con esta actividad y también se acompañan de efectos físicos sobre la estructura del suelo y las propiedades hídricas. Análisis Los análisis se deben llevar a cabo por grupo funcional. Especies anécicas son las que retiran hojarasca de la superficie del suelo a través de su actividad alimenticia.trabajar en (mg+1) y luego se transforman y se expresa en gramos. cucarachas. y liberar nutrientes. puesto que no implica pesar especímenes individuales o hacer otras medidas para estimar la biomasa. Cantidades considerables de suelo. el efecto de estos invertebrados es fraccionar y despedazar la hojarasca. Nota: determinar solamente la abundancia resulta fácil. Especies endógeas que viven en el suelo y se alimentan de materia orgánica y de raíces muertas. en su mayoría. Ensambles pueden ser comparados por la proporción relativa de especies o unidades taxonómicas (morfoespecies). cochinillas y grillos). muchas tasas de procesos en el ecosistema son proporcionales a la biomasa y no a la abundancia. Los dos grupos principales son las lombrices de tierra y las termitas que se alimentan del suelo. Se debe mostrar riqueza de especies/morfoespecies. pero no redistribuyen activamente materiales de las plantas (aunque el material despedazado sea más fácilmente transportado por el viento o el agua que el material de donde deriva). ciempiés. como arriba. es decir. por tanto. Este grupo incluye. definido por su hábito alimenticio y su distribución en el perfil del suelo.

Este grupo incluye invertebrados grandes (> 1cm) y medianos (0. Simpson. Transformadores de hojarasca (normalmente artrópodos no sociales o semisociales. Nota: los términos “ingeniero de ecosistema y especies claves” con frecuencia son utilizados. de forma incorrecta. ACE. ICE y EstimateS. como sinónimos. utilizando las siguientes categorías: Los ingenieros del ecosistema (normalmente hormigas. termitas y escarabajos capturados con cebo. lombrices epigeas y ácaros grandes) ingieren una mezcla de materia orgánica y biomasa microbiana y forman heces holorgánicas de corta vida. normalmente procedentes de varios grupos de artrópodos). CONJUNTO mínimo DE DATOS El conjunto mínimo de datos puede ser expresado por cada punto de muestreo.categorías funcionales. según se explica a continuación.2 a 1cm). Los grandes invertebrados (> 1cm. y forman heces longevas y estables.2 cm. pero ocasionalmente más pequeños) ingieren una mezcla de materia orgánica y minerales. 1998). Jackknife. Se recomienda probar la clasificación de un grupo funcional (GF) adicional para la macrofauna. pero algunos animales más pequeños (varios ácaros) pueden tener funciones análogas. M acrofauna 129 . Los índices de diversidad y de similaridad útiles incluyen: ShannonWiener. Jacquard y Sorensen (véase Southwood. 1978 y Krebs. Macropredadores (especies predadoras >0. Las especies clave (termitas y posiblemente algunos transformadores de hojarasca) proveen oportunidades físicas de nichos para organismos de nivel más bajo y determinan la estructura de la comunidad de estos organismos. Lista por familia de los otros escarabajos. termitas y lombrices anécicas y endógeas). que son complejos organominerales. Conjunto mínimo de datos por punto muestreado De todo el muestreo Lista de especies/morfoespecies para hormigas. La riqueza de especies actual puede ser estimada por medio de Sob. por categoría de uso de suelo y por ventana de muestreo.

). La abundancia relativa para cada GF está dada por el número de encuentros de divididos entre el número total de encuentros de todos los GFs. el número de encuentros.). Todas las termitas (y por GF 1. Se hace un cálculo para cada GF.Lista de los otros invertebrados en la resolución taxonómica la más alta posible. etc. etc. Para cada taxón se indica el método de muestreo empleado: C = casual T = transecto W = Winkler P = pitfalls M= monolito (Para el monolito no observar estratificaciones de 3 x 10 cm. Todas las lombrices de tierra (además por GF 1. Todos los escarabajos Otros invertebrados Todos los invertebrados. En el caso de las hormigas. GF 2. GF 2. en su defecto las que se alimentan de madera o de suelo). con la excepción de lombrices de tierra).) también pueden estimarse. etc. números totales por cada grupo funcional (GF1. etc. 130 Manual de biología de suelos tropicales . Nótese que un encuentro es un evento en una sección de 5 m del transecto. Desde el transecto o los transectos Abundancia relativa de termitas. GF2. Abundancia total en número m2 de forma separada para: Todas las hormigas (y por grupo funcional GF1.. De las trampas Winkler Frecuencia de especies por muestra. Datos de abundancia para hormigas y escarabajos (número de individuos m²). por lo tanto. Se pueden juntar los datos obtenidos de diferentes transectos en puntos de muestreo separados. GF2. varía de 0 a 4 para transectos de 20 m y de 0 a 20 para transectos de 100 m. utilizando todas las secciones de transectos disponibles para el muestreo.

. o en su defecto las que se alimentan de madera o de suelo). GF 2. todos los escarabajos. Lista de familias para los demás escarabajos Lista de invertebrados en la resolución taxonómica la más alta posible Para cada taxón se indica el método de muestreo empleado. M acrofauna 131 . W= Winkler. lombrices de tierra y escarabajos capturados con cebos. todas las lombrices de tierra (y por grupos GF 1. P= Pitfalls y M= Monolito De los monolitos Es necesario proveer la abundancia media como: a) Número de individuos m² ±SD b) Media geométrica ± 95% de intervalo de confianza c) Media aritmética ± 95% de intervalo de confianza donde n = número de puntos por uso de suelo. GF 2. De todo el muestreo Listas de especies/morfoespecies para hormigas. etc. termitas. etc. separado para hormigas (y para grupos funcionales GF1. como % ± SD. etc. otros invertebrados y todos los invertebrados (igual a lo indicado para datos mínimos por punto de muestreo). GF 2.). todas las termitas (y para los grupos GF 1. De los transectos Abundancia relativa media de termitas GF 1. donde n = número de puntos por uso de suelo. GF 2. T = Transecto.). etc.De las trampas pitfall Se desglosa los taxa no muestreados por otros medios (únicamente). Conjunto mínimo de datos por uso de suelo Las categorías de uso de suelo son anotadas y cuando esto no es posible se clasifican de acuerdo con la intensidad de uso de suelo. utilizando las mismas claves que las especificadas anteriormente: C= Casual.

incluyendo los resultados de intensificación de uso de suelo. Abundancia media de escarabajos como individuos m² ± SD. La frecuencia de especies por muestreo presenta un parámetro alternativo. Lawton et al. se dice que la abundancia de individuos no se debe usar en el caso de hormigas porque son insectos sociales que se organizan en colonias formadas por miles de individuos que se alimentan en grupos. GF 2. será sobreestimada (Colwell y Coddington. Desafortunadamente.De las trampas Winkler Abundancia media de hormigas (y como GF 1. 132 Manual de biología de suelos tropicales . existen contra argumentos de que los insectos sociales pueden evaluarse correctamente en cuanto a su abundancia y biomasa. se argumenta que los organismos se deben asignar únicamente como ingenieros del ecosistema. si el régimen de muestreo es suficientemente robusto (incluyendo réplicas adecuadas. si el muestreo se hace en una colonia.. El uso de datos crudos de abundancia y de biomasa en la interpretación de la función del ecosistema resulta controversial. etc. no obstante. ejemplo Diversidad β. 1996) y que la biomasa es tan importante para la determinación del impacto ecológico que no se puede prescindir de ella o sustituirla. cuando su abundancia o biomasa lo justifique. De manera similar. donde n = número de puntos por uso de suelo. el cálculo retrospectivo hasta llegar a la densidad numérica. en base de lugar a lugar. muestreo anidado y estratificado ejemplo Eggleton et al. Por ejemplo.) como individuos m² ± SD. Conjunto mínimo de datos por ventana de muestreo De todos los métodos de muestreo Recambio de especies a lo largo del gradiente como la β de Whittaker. 1995. Para todas las abundancias medias totales y las abundancias medias relativas de los GF Correlación con parámetros individuales del gradiente. la escala del esfuerzo requerida para poder evaluar la biomasa es enorme (véase Eggleton y Bignell. 1994)..

. H. y Valentin. Ecology and Systematics from Various Regions of the World. R.. vol. Ito (eds) A Series of Searchable Texts on Earthworm Biodiversity.. pp. Ramakrishnan. CAB International. R. J. e Ingram. N. Lebissonnais. DC. www. D. vol. K. S. pp. pp. C.. (2002) Cosmopolitan Earthworms – An Eco-Taxonomic Guide to the Peregrine Species of the World. 433–460. y Saha. (2002) ‘Effects of land-use system on the soil macrofauna in western Brazilian Amazonia’. in U. Ecological Bulletins.. K. REFERENCIAS Agosti. Yokohama National University.338–347. 24. Brown. Journal of Biogeography. Wallingford. lo que compromete la caracterización de la heterogeneidad del paisaje porque restringe el número de puntos de muestreo que pueden ser utilizados. E. Y.. N. Kippax. Kaneko and M. D. S. pp.. M. Bestelmeyer.jp/eng/index.. pp. COE Soil Ecology Research Group. (1997) ‘Functional groups and patterns of organization in North American ant communities: A comparison with Australia’. R. Soil Biology and Biochemistry. M. (eds) (1989) Tropical Soil Biology and Fertility: A Handbook of Methods. Pashanasi. Biology and Fertility of Soils. P. P. T. (2005) ‘Introductory key to revised earthworm families of the world’. (1977) ‘Stratégies lombriciennes’. Japan. e Ingram. Environmental & Ecology. Andersen. y Lavelle.. y Srivastava. Barrios. T. Leeanne. L.. Alonso L. Majer.ac. D. M. Delabie. (eds) (2000) Measuring and Monitoring Biological Diversity. Blakemore. J. E. Agosti.htm. Blanchart. Bouché. Bhattacharya. 3...bio-eco. R. J. 2nd edition. vol. 2045–2054. B. pp. T. G.. Persson (eds) Soil Organisms as Components of Ecosystems. M acrofauna 133 . Braudeau. 29. Wallingford. vol. 122–132. P. W. J. S.1998). 1st edition. J. R. 35. E. 143–147. 431–439. T. vol. E. Lavelle. Blakemore. in N.. M. J. I.. Standard Methods for Ground-living Ants. Brandão. J. vol. CAB International. y Schultz T.T. Constantino. C. Bhadauria T. I. Soil Biology and Biochemistry. Lohm and T. Halder. VermEcology. India’. (2000) ‘Soil microarthropods of a rubber plantation and a natural forest’. Australia. Anderson. B. C.eis. Smithsonian Institution. Anderson. J. F.. (1997) ‘Regulation of soil structure by geophagous earthworm activities in humid savanna of Côte d’Ivoire’. Washington. 32. 25. Alonso.ynu. (2000) ‘Diversity and distribution of endemic and exotic earthworms in natural and regenerating ecosystems in the central Himalayas. (eds) (1993) Tropical Soil Biology and Fertility: A Handbook of Methods. A.

T. pp. 12. Elsevier Science Publishers. H. Nairobi. J. vol. European Journal of Soil Biology. K. CSM-BGBD (2005) Global workshop on ant and termite sampling and identification. Colwell. Alonso and T. http://viceroy. 345. Delabie. pp.. Baudry. (1995) ‘Inquilismo simultâneo de duas eespécies de Centromyrmex (Hymenoptera. and Rippstein. 301–312 Decaëns. Paillat. Thenail. D. pp. Formicidae. pp... (2000) ‘Statistical Estimate of Species Richness and Shared Species from Samples. J. Delabie. y Jiménez.. P. J. A. Decaëns. Leith and M.. (1989) ‘Termites’.. 47–60. J. N. J. J. J. Agriculture.. P. 19. C. Colwell.. K. Brunel. in H. Petit. R. Termitidae. vol. J. Version 7. (1999) ‘Comunidades de formigas (Hymenoptera: Formicidae): Métodos de estudo e estudos de casos na Mata Atlântica’. J. N. 605–609. G. H. A. M. 72. J. K. Amsterdam. 103..edu/EstimateS. pp. Plant and Soil. 58–68. vol. uconn. C.. vol. A.edu/estimates. Acta Oecologia. 240. Tropical Soil Biology and Fertility Institute of CIAT. (1996) ‘Revision der Unterfamilie Benhamiinae MICHAELSEN. Delabie. Barros. Revista Brasileira De Entomologia. Ecosystems and Environment. Decaëns. T. P. C. y Nascimento. D. 1897 (Oligochaeta: Acanthodrilidae)’. in D. Butet. Werger (eds) Tropical Rain Forest Ecosystems. pp. Jiménez. y Lefeuvre. Colwell. F. J. 157–168. S. F. Ponerinae) em cupinzeiros de Syntermes sp. C. Sociedade Nordestina De Zoologia. Schultz 134 Manual de biología de suelos tropicales . Blanchart. pp133-143. vol. C. Clergeau. y Lavelle... Collins. (1994) ‘Estimating terrestrial biodiversity through extrapolation’. Mitteilungen aus dem Zoologischen Museum in Berlin. Majer. Nasutermitinae)’. (2000) ‘Litter ant communities of the Brazilian Atlantic rain forest region’. Version 6. C.ucon..5: Statistical Estimation of Species Richness and Shared Species from Samples. C.. R.Burel. Feira De Santana. J. A. (1994) ‘Impact of land management on soil macrofauna in the Oriental Llanos of Colombia’. Kenya. Morvan. D. Escobar.. Philosophical Transactions of the Royal Society (Series B). Fragoso.. y Coddington. http://viceroy. pp. Le Coeur. (2002) ‘Earthworm communities under an agricultural intensification gradient in Colombia’. T. 30. (2004)‚‘Soil macrofauna communities in permanent pastures derived from tropical forest or savannas’. Software and User’s Guide’. (Isoptera. Delettre. R. (1998) ‘Comparative biodiversity along a gradient of agricultural landscapes’. 347–367.. E. Jiménez. J.eeb. 101–118. Y. H. Agosti. São Paulo. Csuzdi.0b1’. Resumos Feira De Santana. I.-C..eeb. T. S. G. vol.. 39. vol. Dubs. Agosti. J. E.. L. E. Lavelle. Chauvel. vol. G. Encontro De Zoologia Do Nordeste. (2005) ‘EstimateS.

. Bulletin of the British Museum (Natural History) Zoology.. D. 111. vol. Philosophical Transactions of the Royal Society of London. y Bignell. Jeeva. Applied Soil Ecology. A. G. Ecotropica. New Acanthodriline genera and species (Megascolecidae. pp. Homathevi. Metapheretima. E. Lawton. D. 119–128. (1997) ‘The incidence of secondary occupation of epigeal termite (Isoptera) mounds by other termites in the Mbalmayo Forest Reserve. y Bignell. vol. y Maryati. Philosophical Transactions of the Royal Society of London. South Africa’. pp. abundance and biomass of termites under differing levels of disturbance in the Mbalmayo Forest Reserve. P. D. O. vol. Easton. vol. 1791–1802. Southern Cameroon. pp. (2004) ‘Influence of agricultural land use on the size and composition of earthworm communities in northern KwaZulu-Natal. 51–68. Megadrilogica. Oligochaeta)’. E. and its biological significance’. 197–206. Smithsonian Institution.. (1997) ‘The species richness and composition of termites (Isoptera) in primary and regenerating lowland dipterocarp forest in Sabah. 354. N. Harrington and N. MacDonald. D. E. P. East Malaysia’. G. 3. DeSouza. pp... Mawdsley. T. 1–12. 10. J. 77–88. y Brown. (1994) ‘Effects of habitat fragmentation on Amazonian termite communities’. Journal of Tropical Ecology. W. (1979) ‘A revision of the ‘acaecate’ earthworms of the Pheretima group (Megascolecidae: Oligochaeta): Archipheretima. R. Journal of African Zoology. vol. R. Homathevi. (1994) ‘Earthworms from Southeastern Mexico. J. pp. Dlamini. Eggleton. Bignell. Davies. M acrofauna 135 .. y Maryati. H. Haynes. 2. T. Pleinogaster and Polypheretima’... V. Eggleton. Eggleton. Southern Cameroon’. 27. R. G. Jones. 351. Planapheretima. Jones. D. pp. C. (1995) ‘Monitoring the response of tropical insects to changes in the environment: troubles with termites’. P. P. vol. Jeeva. pp. 1–128. Wood. 6. Eggleton. F. Sands. D. F. London. R.. P. Eisen. E.. A. A. Eggleton. pp. Washington. D.(eds) Measuring and Monitoring Biological Diversity: Standard Methods For Groundliving Ants. forest disturbance and greenhouse gas fluxes in Sabah. R. T.. C. Davies. (1999) ‘Termite assemblages. Series B.. DC. Bignell. in R. Proceedings of the Californian Academy of Sciences. y Rojas-Fernandez.. J. 35. Series B. M. vol. E. 489–498. M. pp. y Bignell. vol. Stork (eds) Insects in a Changing Environment. East Malaysia’. Academic Press. D. G. Fragoso. E. vol.. N. C. K.. P. (1996) ‘The diversity. G.. (1900) ‘Researches in American Oligochaeta with especial reference to those of the Pacific Coast and adjacent islands’. 87–276.

. Blanchart. Ecosystems and Environment. 453–464 International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature. in P.. y Guillaume.. R. P... Journal of Applied Ecology. (1995) ‘Biological activity of soil under rubber plantation in Côte d’Ivoire’. L. Gates. D. E. y Kumar.. (2005) ‘Methods for sampling termites’. Megadrile Oligochaeta (Earthworms) Family Octochaetidae. J. Wallingford. Blanchart.. (1997) ‘Agricultural intensification. J. (2003) ‘Effect of agricultural land use on soil organic matter status and the composition of earthworm communities in KwaZuluNatal. B.Fragoso. Koeltz Scientific Books. 37. pp. G. S. Verkerk. A. H. Silva. Brussard and P. S. South Africa’. Agriculture.. pp. H.. 136 Manual de biología de suelos tropicales . J. Haynes. Kouassi. Jones. P. Konigstein. Susilo.. W.. E. Skog.-M... Julka. L. Leather (ed) Insect Sampling in Forest Ecosystems. J.. Gillison. y Eggleton. y Eggleton. Jiménez... T. C. G.. D. B. P. H. Martinez. vol. 191–203. y Graham. 1–326. vol.. Lavelle. J. P. M. K. P. Turland N. Jones. F. T. pp. pp. vol. E. R. V. B. Jones. Indonesia’. D. Fragoso. P. vol. Senapati. 380–391. J. (1999) ‘Earthworm communities of tropical agroecosystems: Origin. vol. (1988) The Fauna of India and the Adjacent Countries. T. Gay. Brown. C. y Eggleton. (2000) International Code of Botanical Nomenclature (St Louis Code). Greuter. Suryo. an introduction to the systematics and biology of Megadrile oligochaetes with special reference to South-East Asia’. C. E. McNeill. Pashanasi.. Applied Soil Ecology. A. F. y Hawksworth. in S. y Tondoh. Senapati. J. P. 17–35. Gilot. (2000) ‘Sampling termite assemblages in tropical forests: Testing a rapid biodiversity assessment protocol’.. J. Academic Press. D. M. 6. D. Keli... y Calaby. H. Acta Zoologica Fenica. J.. M. (1972) ‘Burmese earthworms. 40. W. J. G. Blanchart. T. pp... Calcutta. vol. Zoological Survey of India. structure and influence of management pratices’. Lavelle. Lavelle. P. 186–189. London. T. Nicolson. H. pp. Decaëns. Burdet. J. Journal of Applied Ecology. F.. F. Dominy. 95. 4th edition.. (1970) ‘Termites of the Australian region’. G. D. E. Bignell. R.. Blackwell.. Transactions of the American Philosophical Society. Weesner (eds) Biology of Termites. J. C. New York. 196.. International Trust for Zoological Nomenclature. C. C. T. 62. in K. Oxford.-X.. Hendrix (eds) Earthworm Management in Tropical Agroecosystems. Lavelle. Trehane. soil biodiversity and agroecosystem function in the tropics: The role of earthworms’. Demoulin. Krishna and F.. (2003) ‘Termite assemblage collapses along a land-use intensification gradient in lowland central Sumatra. J. CAB International. Barrie. Patron.. E. Filgueiras. P. E. M.

A. 438–445. G.. y Rouland-Lefèvre. y Halffter. A. S. y Watt..-P. 485–607. Biology and Fertility of Soils. 213–226. (1983) ‘The soil fauna of tropical savannas. Righi. indicator taxa and effects of habitat modification in tropical forest’. (2004) ‘Earthworm populations under tropical maize cultivation: The effect of mulching with velvet bean’. Elsevier Publishing Company. Roger. (2000) ‘Assessing the completeness of bat biodiversity inventories using species accumulation curves’. P. P. 37. P. J.Krebs. II The earthworms’.. Srivastava. (1987) ‘Peregrine species of earthworms’. K. in A. (1998) ‘Biodiversity inventories. A. vol. C. 4. E. Boulton. 300–305. G. P. M. D. S. I. y Halffter. E. M.. Hammond. (1978) ‘Les vers de terres de la savane de Lamto (Côte d’Ivoire): Peuplements. populations et fonction dans l’écosystème’. Biodiversity and Conservation. Bloemers. Rossi. 20. M. 149–158. y Dhillion. 10. vol. E. R. pp. E. Mawdsley. 159–193. Grimaldi. pp. E. vol. Wolters. A. Blackwell Science. Biology and Fertility of Soils. M acrofauna 137 . Bignell. Studies on Tropical Andean Ecosystems. T... Unione Zoologica Italiana 2. Laboratoire de Zoologie. 2. 33.. J. London. Nature (Lond). G.. (2001) ‘Spatial and temporal analysis of. Journal of Theoretical Biology. C. Stork. pp. Larsen. C. Acta Oecologia – Oecologia Generalis. pp. Ecole Normale Supérieure 12. B. and diversities of bats in a fragmented landscape’. vol. Holt. pp367–382 Ortiz-Ceballos. D. (2004) Measuring Biological Diversity. Bourlière (ed) Tropical Savannas. M.. Lavelle. P. Oxford. O. 13.. E.. G. N. 1–95.. C. pp. Heal. Omodeo (eds) On Earthworms: Selected Symposia and Monographs. Lepage. D. Journal of Applied Ecology.. vol.. E. pp. 40. Bonvicini and P. Lavelle. pp. (1996) ‘The measurement of diversity in different types of biological collections’.. France. (2004) ‘A multi-scale study of soil macrofauna biodiversity in Amazonia pastures’. Université Paris VI. Lavelle. Moreno.. 117–133. P. European Journal of Soil Biology. Thèse de Doctorat.. Mathieu. (1998) Ecological Methodology. C. 2nd edition. vol. Lavelle. M.. vol. (1997) ‘Soil function in a changing world: The role of the invertebrate ecosystem engineers’. J. Eggleton. (1971) ‘Sobre a familia Glossoscolecidae (Oligochaeta) no Brasil’. 39. Lavelle. B.. H. vol. P. (1995) ‘Colombian earthworms’. Pielou. 72–76. and Fragoso. N. P. Modena. Pearson Education.. Magurran. Mucchi. G. J. Lawton. Hodda. Bignell. C. D. vol. V. vol. Righi. F. pp. Moreno. Arquivos de Zoologia. D. (1981) ‘Strategies de reproduction chez les vers de terre’. pp. in F. P. Mora. 391. Lee. Amsterdam.

ASM Press. Pagliani and P.. Journal of Tropical Ecology. Cambridge. Cambridge University Press. Blackwell. France. Woodcock. Blackwell Science. Sneath. in J. 4.fao. Tondoh. (1978) ‘Food and feeding habits of termites’. Omodeo (eds) ‘On earthworms. M. Herndon. London. vol. Kikkawa and D. in A. (1997) ‘ADE: A multivariate analysis and graphical display software’. W. D. y Eggleton. 75–83. Chapman and Hall. 21. 169–268. E. (2005) ‘Pitfall sampling in ecological studies’. in M. Vincent. Sims. P.org/ag/agl/agll/soilbiod/docs/manual-soil%20bioassessment. (eds) (2001) ‘Standard methods for the assessment of soil biodiversity and land-use practice’. V. B. S. E. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition’. R. P. E. Southwood. E. W.. J. suborder Lumbricina (Haplotaxida: Oligochaeta)’. y Lavelle. Leather (ed) Insect Sampling in Forest Ecosystems. Oxford. 113–131. (1992) International Code of Nomenclature of Bacteria: Bacteriological Code. P. (1978) Ecological Methods with Particular Reference to the Study of Insect Populations. vol. Dolédec. T. T. Statistics and Computing. Oxford. Chessel. 103–124. 33. 493–500. (1996) ‘A pilot analysis of gut contents in termites from the Mbalmayo Forest Reserve. A. Anderson (eds) Community Ecology. ASB Lecture Note 6B. (1980) ‘A classification and the distribution of earthworms. pp. International Centre for Research in Agroforestry. M. Thioulouse. South East Asian Regional Research Programme. Cameroon’. 1990 Revision. Eudrilidae) in Ivory Coast’. Unione Zoologica Italiana 2. A. y Bignell. R. R. (2005) ‘Population dynamics of Hyperiodrilus africanus (Oligochaeta. 138 Manual de biología de suelos tropicales . Modena. G. Ecological Entomology. y Olivier. Terborgh. Opuscula Zoologica Budapest. G. Thèse de 3e cycle. (1986) ‘Guilds and their utility in ecology’.. Sims. Sleaford. A. Regenwürmer aus Südamerika’. (1987) ‘A review of the Central African earthworm family Eudrilidae (Oligochaeta)’. R. in S. vol. pp. Indonesia. W. Swift. Wood. S. 279–288. pp. vol. M. 2nd edition. D. E. J. Biological Journal of the Linnean Society. www. Zicsi. VA. (1972) ‘A numerical revision of the earthworm genus Pheretima auct. Bulletin of the British Museum (Natural History) Zoology. (1969) ‘Recherche sur le peuplement en Oligochète de la savane de Lamto (Côte d’Ivoire)’. P. J. H. Pattern and Process. pp. Bignell. y Easton. 39. 7. F. R. y Robinson. pp.pdf. Bogor. Mucchi. J. Brian (ed) Production Ecology of Ants and Termites. vol.. selected symposia and monographs’. D. 1995) (Oligochaeta: Glossoscolecidae). Université Paris VI. 21. pp. vol. (2001) ‘Revision der Untergattung Martiodrilus (Maipure Righi.Sims.

Zicsi. 95–130. vol. pp. (2005) ‘Über den heutigen Stand der Regenwurmfauna (Oligochaeta) Ekuadors mit einem Bestimmungsschlüssel der Glossoscoleciden-Arten’. M acrofauna 139 . Regenwürmer aus Südamerika 39. 92. A. Berichte des Naturwissenschaftlicher-Medizinischer Vereins in Innsbruck.

(2003) Termitas del S. Bien ilustrada con sinopsis genérica. Kirton (ed) Malaysian Forest Records. pero no cubre toda la diversidad de animales que se alimentan del suelo. Forest Research Institute of Malaysia. Notas Clave de géneros de hormigas de Borneo (útil en el S. F. ‘A review of the South-east Asian Nasutitermitinae (Isoptera Temitidae). vol. pp. with descriptions of one new genus and new species and including a key to genera’ Journal of Natural History. (1992) ‘Termites of peninsular Malaysia’ en L. Hormigas Neotropicales Fernández.G. Disponible y económica. taxonomía y la importancia económica de las hormigas. ‘The termites (Isoptera) of Gunung Mulu National Park with a key to the genera know from Sarawak’. Universidad Malasis Sabah. de fácil manejo. útil para Sumatra. vol. (1984). Región y autor Hormigas del S. E. S. 140 Manual de biología de suelos tropicales . Publicación clave para géneros de la región Neotropical. F.Apéndice 1.E. de Asia Hashimoto. 2003. Clave moderna y de fácil interpretación. de Asia Thapa. 1-398. pp. pp 95162. (2001). Gathorne-Hardy. ‘Termites of Sabah’ Forest Record 12. Bogota. R. Y. P. dentro del clado Termes. escarabajos y hormigas. Título y referencias ‘Manual for Bornean Ant (Formicidae) Identification’. 12-26 octubre. Bien ilustrada clave de fácil identificación para los soldados. 35 pp. N. XXVI. Tho. (1984) Collins. Claves de identificación de termitas. incluyendo Indonesia). Incluye una revisión de la biología ecología. 1485-1506. 65-87. Y. 36. Preparado por “Tools for Monitoring Soil Biodiversity in the ASEAN Region”. M.R. Clave un poco obsoleta de géneros de termitas del Norte de Borneo. Borneo Java y Sulawesi. ‘Introducción a las hormigas de la región Neotropical’ Instituto de Investigaciones de Recursos Biológicos. de Asia. pp1-244. vol. Fácil de usar. pp. (2 003). y Homathevi. Colombia.E. Trabajo estándar. 30. Alexander von Humboldt. Kepong. Sarawak Museum Journal. 1-374. protocolos de muestreo por región.

2–38. Nigeria. Escarabajos de Asia Chung. M. 3. Lo que opera actualmente sobre esta subfamilia en África. Clave de géneros de imagos y soldados. (2006). Universiti Malaysia Sabah. vol 8. CAB International). Octubre 2003. ‘A review of the termites of the genus' Antitermes the Ethiopian region. (1961). pp. (1959). Webb. La autoridad estándar del momento para este genero. Supplement 4. Y. Bien ilustrada. Training course on Arthropod preservation. Sands W. R. Hormathevi. Sabah Forest Record 12 pp. “Termites of Sabah”. G. R. Coleoptera. Notas Clave inédita de géneros de termitas en el S.Apéndice 1. Región y autor Homathevi. (2003). Continúa. (1965). 1–384. R. 129-156 Keys to the Genera of the African Termites. pp. Escarabajos en general. 36 p. tanto para imagos como soldados. (1990). pp.Cox. 1-28. incluyendo Indonesia. curation and data management. preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Universiti Malasia Sabah. Ibadan University Press. corta y bien ilustrada de familias con una sinopsis diagnóstica de más de 100 familias y casi 50 subfamilias. A. Explicación detallada de la IIE Guides to insects of importance morfología y agrupaciones de to Man. Bulletin of the British Museum (Natural History). 1–172. M acrofauna 141 . G. London pp. (2003) Título y referencias ‘Manual for Bornean Termites (Isoptera)’ preparado por ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. Un poco anticuado. W. 12–26.. A. A. 2006. (1981). 1-374. Coleoptera. 2003. C. L. Bulletin of the British Museum (Natural History). con muchas referencias que incorporan descripciones taxonómicas recientes. Claves hasta especies. C. R. Thapa. Clave bien ilustrada a nivel género de soldados. Termitas africanas Sands. de Asia. International Institute of Entomology (and Institute of escarabajos. Booth. B. Universiti Malaysia Sabah. de fácil manejo.E. Clave moderna. ‘A revision of the termite subfamily Nasutitermitinae (Isoptera. Termitidae) from the Ethiopian region’. Trabajo estándar. S. y Madge R. The Natural History Museum. fácil de usar. ‘Manual for Bornean beetle (Coleoptera) family identification’. Adaptación de Chung. pp. 18-22 Septiembre. 12–26 Octubre 2003.

(1971). L. vol. ‘Taxonomy and phylogeny of termites’. de difícil manejo. “The Identification of Worker Castes of Termite Genera from Soils of Africa and the Middle East”. (1980).. Termitas neotropicales Constantino. Wallingford. London. Estudio prestigiado. E. 187–323. Their Recognition and Control. Symbioses Ecology. muy útil para termitas subterráneas crípticas. soldados mayores y soldados menores. 1–40. Occasional Papers of the National Museums of Rhodesia. en: T. Clave de especies para imagos. (2002). Título y referencias Quel est ce termite Africain? Zooleo. ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. Mitchell B. D. vol 67. ‘Report on a survey of the termites of Zimbabwe’. Natural Science 6. incluye detalles del enrollamiento del intestino y de cómo está conformada la válvula entérica para identificar algunas Apicotermitinae. Incluye una sinopsis de familias y subfamilias en forma de clave con notas e identifica caracteres diagnósticos. E. Harris W. especialmente Apicotermitinae y todas las que se alimentan del suelo. pp. (1998). pp. Zootaxa. R. pp 1–23. 24. Termites. pero útil para confirmaciones. anticuada. (2000). G. no muy útil como clave. Lo que opera actualmente este género. y Eggleton P. Abe. (1966). 1. J. Series B. utilizando imagos. más 32 referencias. únicamente para géneros principalmente en el contexto africano. Sands. S. Región y autor Bouillon. Continúa. 500 pp. (1970) A revision of the termites of the genus Macrotermes from the Ethiopean (Isoptera: Termitidae) Bulletin of the British Museum (Natural History) Entomology vol. A. Longman. obreros y soldados. 1–115. Kambhampati. Clave hasta género para soldados y muchos géneros ilustrados de manera detallada a nivel de especies (en francés). Clave completa muy ilustrada y detallada. Clave corta. Kluwer Academic Publishers. Notas Clave a nivel familia de imagos y soldados. 142 Manual de biología de suelos tropicales . 365–444.Apéndice 1. pp. Estudio comprensivo que incluye claves hasta géneros de soldados. y Mathot. A. Bignell and M. CAB International. pp. pero recomendada para formarse. W. Sociality. Higashi (eds) Termites: Evolution. V. Ruelle.

'Ant subfamilies’. M. vol. P. Documento de base. P. Listas de material requerido para un muestreo de hormigas con precios en $US del 2001. Excelente para entrenaPest Research. imagos y soldados. India. (1997). Continúa. 'Guidelines for data collection for ants’. M acrofauna 143 . (2001). S. Zoological Survey of India. 801 pp. O. pero sí un listado Checklist of the Species of Termites que identifica la distribución entre (Isoptera) Recorded from East Africa. The Fauna of India and Adjacent Countries: Isoptera (Termites). Kenia. Tanzania y Zanzibar. C. (J. Department of Entomology.Apéndice 1. Ward. y Williams. B. con una amplia bibliografía. Bibliografía completa. géneros y especies para imagos y soldados. Williams R. (1989). 672 pp. Entomology department. (sin fecha). Sands W. M. C. O. B. Los volúmenes I y II contienen claves hasta familias. (sin fecha). Documentos variados Roowal. K. y Chhotani. L. No publicado. (2001). Calcutta. Fisher. C.Uganda. Clave detallada y de fácil manejo A Key to the Genera of the Termitinae by the Soldier Caste. subfamilias. eje de muchas claves privadas de museos nacionales. Región y autor Claves inéditas de termitas y listas de comprobación Wanyoni. vol. II. Fisher. Centre for Overseas para géneros de África del Oeste y Central. Calcutta. Harvard University. Harvard University. E. Chhotani. reporte detallado con definiciones de características morfológicas. Centre for Overseas Pest Research. Guías para caracterización del sitio y anotaciones relacionadas con el muestreo de hormigas. ‘Equipment specifications’ Department of Entomology. Título y referencias Notas No es una clave. ed) International Centre of Insect Physiology and Ecology. B. Sinopsis ilustrada de subfamilias y su distribución. No publicado. I. utilizadas en taxonomía. Los volúmenes I y II cubren todo el The Fauna of India and Adjacent subcontinente de la India. R. M. Darlington. incluye claves hasta familias y subfamilias. ‘Taxonomy of Termites’. (Family Termitidae) Zoological survey of do Sri Lanka. miento avanzado. (2003). incluyenCountries: Isoptera (Termites). UC Davis. (1983). B. A.

Continúa. termitas. T. pero sin ilustraciones. “Glossary of morphological characters used in ant taxonomy”. lectura obligatoria. Department of Entomology. Universiti Malaysia Sabah. sin fecha). Región y autor Jones. lombrices de tierra diplópodos. Título y referencias ‘Tools for the Rapid Assessment of Soil Invertebrate Biodiversity in the ASEAN Region’. Isópteros y arañas (Araneae). prepared for ‘Tools for Monitoring Soil Biodiversity in the ASEAN Region’. escarabajos del suelo. Harvard University Entomology. Harvard University 144 Manual de biología de suelos tropicales . Completo. 2003. D. No publicado. Notas Revisión moderna y completa de la naturaleza de la biodiversidad del suelo y métodos de evaluación rápidos para hormigas. 12–26 October. 1–39. pp. Bibliografía amplia y actual. (ed) 2003. (Anónimos.Apéndice 1.

Revisión de mapas de distribución de especies del Nuevo Mundo con clave de soldados y alados. Emerson (1952). Fontes (1985). Neocapritermes Parvitermes Krishna y Araujo (1968). Referencia Contenido RHINOTERMITIDAE Heterotermes TERMITIDAE Amitermes Anoplotermes Atlantitermes Cornitermes Cyranotermes Cyrilliotermes Labiotermes Light (1932). Revisión y claves. Scheffrahn y Krecek. Constantino (1990). Revisión mundial con revisión de claves de las especies antillanas con claves hasta la diagnosis de los soldados. Cancello (1986). Constantino et al. con claves. Revisión de Labiotermes sensu stricto. Las claves hasta género son dadas en Krishna (1961.Apéndice 2. Emerson (1952). Revisión y claves. Revisión y claves. Claves de soldados de especies de Las Antillas (anticuado). Emerson y Banks (1965). Revisión y claves. Revisión y claves (anticuado). Clave de soldados. Clave de soldados de Paracomitermes (anticuado). Scheffrahn and Krecek (1993). Snyder (1926). únicamente Kalotermitidae). Clave de soldados de América del Sur. Constantino y DeSouza (1997). Clave de soldados. Clave de alados (anticuado). 2002). M acrofauna 145 . Revisión y claves de soldados (en portugués). Araujo (1954). Mill (1983) y Constantino (1999. Clave de soldados. Nasutitermes Parvitermes Procornitermes Holmgren (1910). Constantino (1997). Género KALOTERMITIDAE Cryptotermes Eucryptotermes Procryptotermes Bacchus (1987) Scheffrahn y Krecek (1999). (2006). Revisión y claves (anticuado y en alemán). Claves de soldados de especies de Las Antillas (anticuado). Constantino (2001). Trabajos taxonómicos con claves de especies de algunos géneros neotropicales. Scheffrahn y Krecek (2001).

Apéndice 2. Revisión y claves. Emerson (1945) . Revisión y claves (anticuado). Claves de soldados (anticuado). Revisión y claves de soldados (en portugués). Contenido Revisión y claves. Rhynchotermes Rotunditermes Syntermes Fontes (1985). Cancello (1986). 146 Manual de biología de suelos tropicales . Continúa. Fontes y Bandeira (1979). Claves de soldados. Constantino (1995). Género Procornitermes Referencia Emerson (1952).

(2001) ‘Key to the soldiers of South American Heterotermes with a new species from Brazil (Isoptera: Rhinotermitidae)’. 1–33. vol. Constantino. y Vasconcellos. Zootaxa. Acioli. L. Goeldiana Zoologi. M. Termitidae.Apéndice 3. (2002) ‘An illustrated key to Neotropical termite genera (Insecta: Isoptera) based primarily on soldiers’. pp. 1–11. A. 10. vol. (1952) ‘The Neotropical genera Procornitermes and Cornitermes (Isoptera. (1986) ‘Revisão de Procornitermes Emerson (Isoptera. A. Bulletin of the American Museum of Natural History. 1–44. F. (1954) ‘Notes on the genus Paracornitermes Emerson 1949 with description of two new species (Isoptera. Constantino. 427–472. Nasutitermitinae)’. American Museum Novitates. O. Termitidae. E. pp. pp. no 2208. Schmidt. Revista Brasileira de Entomologi. Papéis Avulsos de Zoologia (São Paulo). Termitidae. 36. N.. 463–472. (1987) ‘A taxonomic and biometric study of the genus Cryptotermes (Isoptera: Kalotermitidae)’. 99. vol. Constantino. Carvalho.. vol. vol.. (1945) ‘The Neotropical genus Syntermes (Isoptera: Termitidae)’. Cuezzo. Nasutitermitinae)’. A. 1. vol. E. R. R. 1–40. 31. pp. A. Constantino. C. vol. paper 1340. vol. pp. 181–189. with a new species from Brazil (Isoptera: Termitidae: Nasutitermitinae)’. Nasutitermitinae)’. F. 125–131. E. R. y Banks. pp. (2006) ‘A taxonomic revision of the Neotropical termite genera Labiotermes Holmgren and Paracornitermes Emerson (Isoptera: Termitidae: Nasutitermitinae)’. pp. Zootaxa. Nasutitermitinae)’. 189–236. paper 67. pp. 83. A. y DeSouza. R. (1997) ‘Key to the soldiers of Atlantitermes Fontes 1979. Cancello. E. S. Emerson. 2. 205–213. Emerson. 30. 455–518. (1997) ‘Notes on Eucryptotermes with a new species from central Amazonia (Isoptera: Kalotermitidae)’. K. A. Bulletin of the American Museum of Natural History. distribution and ecology (Isoptera. Termitidae)’. pp. R. 7. A. Emerson. 475– 540. Sociobiology. Tropical Zoology. Bacchus. Termitidae. pp. (1965) ‘The Neotropical genus Labiotermes (Holmgren): Its phylogeny. (1995) ‘Revision of the Neotropical termite genus Syntermes Holmgren (Isoptera: Termitidae)’. R. R. pp. Insect Systematics and Evolution. Constantino. Constantino. H. Literatura especializada en termitas neotropicales Araujo. pp. 1–91. Constantino. vol. University of Kansas Science Bulletin. Tropical Pest Bulletin. 55. vol. (1990) ‘Notes on Cyranotermes Araujo with description of a new species (Isoptera. M acrofauna 147 . F. S. R.. pp.

303–408. Snyder. vol. y Krecek. vol. y Bandeira. R. vol. E. (1968) ‘A revision of the Neotropical genus Neocapritermes (Isoptera. 107–110. 3. vol. pp. Fontes. K. vol. Mill. 68. pp. Krishna. 94. Jahrbuch der Hamburgischen Wissenschaftlichen Anstalten. R. pp. 111–171. pp. vol. L. Scheffrahn. (1999) ‘Termites of the genus Cryptotermes Banks (Isoptera: Kalotermitidae) from the West Indies’. vol. Termitidae. (1932) ‘Contribution toward a revision of the American species of Amitermes Silvestri’. Holmgren. 148 Manual de biología de suelos tropicales . 530–539. R. Scheffrahn. vol. y Araujo. (1983) ‘Generic keys to the soldier caste of New World Termitidae (Isoptera: Insecta)’. 179–190. Florida Entomologist. Bulletin of the American Museum of Natural History. E. H. y Krecek. Krishna. J. vol. Revista Brasileira de Entomologia. (1961) ‘A generic revision and phylogenetic study of the family Kalotermitidae (Isoptera)’. L. 335–414. F. R. vol. 138. 23. H. pp. pp. 7–25. Proceedings of the US National Museum. L. 27. Annals of the Entomological Society of America. (1910) ‘Versuch einer Monographie der amerikanische Eutermes – Arten’. R. (1979) ‘Redescription and comments on the Neotropical genus Rotunditermes (Isoptera. 171–325. S. pp. R. N. pp. 5. 76. G. Bulletin of the American Museum of Natural History. pp. Light. 122. a new subterranean termite (Isoptera: Termitidae) from Cuba and the Dominican Republic’. H.Fontes. 13. 84–138. A. Revista Brasileira de Zoologia. (1985) ‘New genera and new species of Nasutitermitinae from the Neotropical region (Isoptera. T. Nasutitermitinae)’. Termitidae. Insecta Mundi. K. University of California Publications in Entomology. vol. (1993) ‘Parvitermes subtilis. Termitidae)’. pp. A. J. pp. 9. Systematic Entomology. (1926) ‘Termites collected on the Mulford Biological Exploration to the Amazon Basin 1921–1922’. Scheffrahn. Nasutitermitinae)’. 1–76. 603–607. (2001) ‘New world revision of the termite genus Procryptotermes (Isoptera : Kalotermitidae)’. J. y Krecek.

Acari (ácaros).0 mm. sin embargo. En cada punto de muestreo. Cahyo Rahmadi. mientras las trampas pitfall se utilizan para colectar los que habitan en la superficie del suelo. Elizabeth Franklin. 149 . Los núcleos de suelo. los núcleos de suelo se localizan en dos círculos concéntricos. Francis-X. por debajo de la hojarasca de la superficie y en la hojarasca en sí. a 3 m y 6 m de radio del monolito. bien por el método Berlese-Tullgren o por el de Berlese modificado.Capítulo 4 Collembola. localizadas a por lo menos 14 m del centro del monolito. Enchytraeidae. Susilo y Jose Wellington de Morais INTRODUCCIÓN La mesofauna está conformada por animales cuyo tamaño de cuerpo oscila entre 0. Pauropoda y otros Nematodos son típicos representantes de la mesofauna. formas de larvas de especies de macrofauna también caen dentro del rango de tamaño de mesofauna. El muestreo de la mesofauna (y otra biota del suelo) se encuentra integrado como parte de la estrategia global del inventario de la biodiversidad bajo del suelo. y se complementan con pitfall.2 y 2. en principio. respectivamente. y cuya abundancia no puede ser evaluada con exactitud por medio de la selección manual del suelo. La mesofauna se colecta utilizando dos métodos de muestreo: a) una muestra compuesta que contiene varios núcleos de suelo y hojarasca extraída de la superficie. sirven para colectar mesofauna que habita en el suelo mineral. Protura. b) del contenido líquido de las trampas pitfall. descrito en el Capítulo 2. acari y otra mesofauna del suelo: el método Berlese Agus Karyanto. Collembola (colémbolos).

constituyen un componente integral de la estructura del suelo. 1990). a finales del siglo XIX. su abundancia. con una diversidad de especies también muy alta y. En este sistema circula agua caliente entre las paredes dobles de latón del embudo (o embudos). después de muertos. Se sugiere que para un muestreo normal ambas extracciones de embudo y pitfall deben emplearse de manera conjunta.El método Berlese es un sistema de extracción por embudo para separar los pequeños artrópodos del suelo. asimismo. Estos ácaros se alimentan de materia de plantas vivas o muertas y de carroña. sin embargo. y algunos son predadores. 2004). no resulta útil para colectar ácaros oribátidos (Acari: Oribatida) porque estos animales. a su vez. son sedentarios (con la excepción de algunas familias como Galumnidae y Scheloribatidae). Los ácaros oribátidos (también conocidos como Cryptstigmata a los que se refieren como ácaros escarabajos o ácaros de caja) son artrópodos numéricamente dominantes en los horizontes orgánicos de la mayoría de los suelos. Debido a su papel regulador en la descomposición y el reciclaje de nutrientes. normalmente. El método pitfall (Capítulo 3. En 1918. 1990). su densidad puede alcanzar cientos de miles de individuos por m². forrajean en hongos y algas. fue desarrollado por Antonio Berlese. por ejemplo. reemplazando la envoltura de agua por un foco de luz eléctrica. MÉTODOS DE MUESTREO Los protocolos aquí descritos abordan principalmente los de los ácaros y colémbolos presentes en los horizontes minerales y en la hojarasca. se pueden encontrar entre 50 y 100 especies (Norton. se convierten en un importante desecho nitrogenado. al igual que en la formación de la estructura de suelo. Sus heces fecales proporcionan una amplia superficie para la descomposición primaria por hongos y bacterias y. de manera que la muestra se seca lentamente. en contraste con los grupos más oportunistas como los colémbolos. Tullgren modificó el método Berlese. se alimentan de nematodos vivos (Siepel. Lo anterior es aplicable para los grupos mayores de microartrópodos del suelo o a partir de las proporciones de abundancia y diversidad entre los grupos de mesofauna del suelo. en suelos no perturbados. El principio es colectar pequeños núcleos o bloques y combinarlos para hacer una sola muestra compues150 Manual de biología de suelos tropicales . composición de especies y diversidad en un hábitat específico son buenos indicadores de un suelo “sano” (Minor.) es suficientemente eficaz como para poder capturar colémbolos que viven en la superficie del suelo (edáficos).

evitando que la temperatura se eleve. De manera alternativa. La muestra compuesta de suelo se divide en 10 bolsas de nylon. acari y otra mesofauna del suelo 151 . se colocan todos los costales de tela bajo techo. ésta deberá situarse en el asiento del pasajero. Este aparato mide 3. Enseguida se empacan las muestras en una caja de cartón. las muestras del suelo pueden ser colectadas en muestras de 3. Al llegar al campo de base o laboratorio. de acuerdo con su localidad de muestreo. se debe evitar que la muestra se exponga a sol directo durante el encostalado en el campo. para evitar que la mesofauna muera. utilizando una pequeña cuchara que tome un volumen constante de aproximadamente 100 ml. De manera alternativa. No se debe usar un costal de plástico porque la temperatura del suelo puede aumentar sustancialmente. donde serán identificadas. tanto la luz solar como el calor del motor.5 x 5 cm de profundidad. Así. el suelo deberá someterse de inmediato a su extracción. también se deben proteger de la lluvia durante el traslado. con o sin hojarasca.5 x 3. son dañinos para los animales que se encuentran en la muestra. De la misma manera. porque la tela permite que circule el aire. Las muestras de suelo. C ollembola . El siguiente paso es almacenar las muestras en cajas grandes para transportarlas hasta el laboratorio. se colectan en el campo. se etiquetan y se transfieren a un costal de tela de 30 x 35 cm de tamaño. para ello es recomendable utilizar un vehículo con aire acondicionado. se utilizan tres o cuatro muestras compuestas y no sólo una. el suelo de 12 sub-muestras se coloca entonces en una bolsa de 5 kg como una muestra compuesta. la fauna también puede morir. Una vez en el laboratorio.5 cm de ancho y 10 cm de alto. con un promedio de un kilo por bolsa. utilizando un sacabocados. y toma muestras a una profundidad de hasta 5cm que posteriormente se transfieren a un recipiente de plástico de 300 ml de volumen (Figuras 4.5 x 3. con una capa de papel para mantener un ambiente de humedad estable dentro de la caja. Si se transporta la muestra sin aire acondicionado.ta.1a y b). Dichas muestras deben permanecer alejadas del calor del motor del vehículo y de su sistema de escape. porque si éstas se mojan o humedecen demasiado. lo que provocaría la muerte de la mesofauna antes de su extracción. Ahora las muestras estarán listas para su traslado al laboratorio. la cual es entonces sub-muestreada por extracción por el método de BerleseTullgren. Se ha observado que los costales de tela son muy eficientes para almacenar temporalmente y transportar las muestras durante largas distancias y tiempos.

se debe incrementar el calentamiento de manera gradual cada día. aunque también se podrían usar los de 40 W. para evitar que otros insectos voladores pasen a formar parte de la muestra. La manera ideal es utilizar un contenedor de madera de alrededor de 160 x 50 cm. Morais y E. cerca del área de referencia. éstos se suspenderán a 14 cm por encima del tamiz. Cortesía de: J. a) se deposita el contenido de cada núcleo en un vaso de plástico etiquetado. se mantiene el aparato en el laboratorio del campo de base.2) es utilizado para extraer la mesofauna activa que habita en las muestras de suelo y en la hojarasca. utilizando para ello focos eléctricos (los de 25 W son ideales). Se coloca un tamiz (de 8 cm de diámetro y 5 cm de altura) con muestras de suelo y hojarascas encima del embudo.Figura 4. dividido en compartimentos superiores e inferiores. dejando los focos encendidos cada vez 152 Manual de biología de suelos tropicales . A B EXTRACCIÓN Método Berlese-Tullgren El aparato Berlese-Tullgren (Figura 4. utilizando una pequeña cuchara o cuchillo de campo. cada compartimento contará con un marco para sostener los embudos de plástico (Figura 4. b) se utilizan guantes como precaución contra enredaderas. hormigas. Franklin. arañas y otros artrópodos. deberá contener cuatro agujeros de 4 mm de diámetro para permitir que animales mayores escapen hacia abajo.W.1 Sacabocados de metal para muestrear la mesofauna en la hojarasca y en el suelo mineral.2 a) al igual que puertas. de 1. Se calientan ligeramente los embudos. El tamaño de malla del tamiz.5 mm.

la cual contiene un conservador. Figura 4. para una mayor efectividad. el embudo deberá presentar una superficie lisa y una fuerte pendiente. si se dejan durante más tiempo nacen los C ollembola . El principio básico del aparato Berlese-Tullgren es que los organismos de suelo responden al incremento de temperatura o sequedad en el suelo migrando hacia abajo hasta que finalmente caen a través de la malla. evitando así que las especies que se mueven con mayor lentitud queden atrapadas en las capas secas y duras del suelo. la temperatura de la muestra se aumenta gradualmente de 27°C hasta aproximadamente 40-45°C. Nota: nótese que las patas están sumergidas en agua para evitar la invasión de hormigas y de otros insectos.2 a) contenedor de apoyo para embudos Berlese–Tullgren. acari y otra mesofauna del suelo 153 . de modo que los animales que caen por la malla lo hagan de manera rápida hasta llegar a la botella que los recibe. en una botella que los recibe hasta la base del embudo. Las muestras se quedan en el aparato hasta que estén completamente secas. Cortesía de: J. Morais y E. hasta que mantengan un peso seco constante que generalmente tarda unos 8 días. por un periodo de hasta 8 días.W. para evitar que el material de la muestra se seque demasiado rápido. b) sistema Berlese–Tullgren en operación. Franklin. Se ajusta la posición de la lámpara para asegurar que la temperatura del suelo suba gradualmente. por lo tanto. Típicamente. es decir.durante mayor tiempo. esto inmovilizará a la mesofauna antes de que se escape.

Son baratos y sencillos. especialmente si el embudo Berlese no está perfectamente cerrado. aun en regiones remotas (Frankin y Morais. en cierta manera. En la presencia de luz. al 96%. al tiempo que utilizan el mismo principio para extraer un solo núcleo o una muestra conglomerada mayor. el tiempo de espera será de 7 a 14 días. el equipo completo requerido es barato y puede ser fácilmente improvisado (Figura 4. el tiempo de incubación (tiempo necesario para extraer la fauna del suelo) es aproximadamente de 4 a 5 días. que se muestra en la figura 4. generalmente. por lo que las muestras serán menos representativas. Asimismo.3. en este caso.. Una ventaja de dichos sistemas es que se pueden operar a diferentes escalas. A pesar de una eficiencia menor. Para evitar lo anterior.5). El método Berlese modificado Cuando no se cuenta con electricidad. lo único que se requiere es un embudo más grande y un tiempo de secado más largo. éste se cerrará con una tapa para prevenir la entrada de otros insectos. es el adecuado para el secado sin electricidad. Un sistema Berlese que opera sin luz muchas veces permite una mejor extracción.huevos y las formas inmaduras se vuelven adultos. el de Berlese. el sistema Berlese-Tullgren y. es uno de los más usuales para la extracción en la evaluación de la diversidad y densidad de microartrópodos del suelo (André et al. El envase receptor se llena con etanol al 96% para su conservación y durante intervalos de 4 a 5 días se cambia el envase receptor. pueden moverse con facilidad desde el lugar del muestreo y ser ajustados para acomodar un gran número de muestras. 2006). con la colocación de una bombilla de 10 a 40W. dependiendo de las condiciones de humedad inicial del suelo. cuando se compara con otros métodos de muestreo. el agujero de ventilación de la tapa deberá cerrarse durante la noche. 154 Manual de biología de suelos tropicales . en donde se coloca un tamiz con una malla de 2 x 2 mm (malla 13). se utiliza formol al 4% o etanol. un embudo de aluminio modificado de Berlese. el embudo se coloca sin luz y el proceso de calentamiento-secado se lleva a cabo simplemente a temperatura ambiente. Como líquido conservador. El uso de un foco puede atraer insectos nocturnos. 2002). aunque tomará más tiempo. El aparato Berlese sensu stricto puede transformarse en un modelo Berlese-Tullgren. arriba de las muestras de suelo.

4 Embudo Berlese modificado. Y. los especímenes de mesofauna son montados sobre laminillas. El proceso de montaje debe realizarse bajo un microsC ollembola . hecho de aluminio. de 50cm de altura. Fuente: cortesía del Dr. Figura 4. con embudo superior de 40 cm de diámetro.3 Embudos Berlese llenos de suelo y hojarasca.Figura 4. PROCESOS DE ACLARADO Y MONTAJE DE ESPECÍMENES Para su identificación. R. después de su aclarado. Suhardjono LIPI Bogor. acari y otra mesofauna del suelo 155 .

normalmente. Los especímenes pueden ser aclarados con un 15% de KOH. Proceso de aclarado El aclarado consiste en volver más transparente el tejido de los especímenes. la observación de la morfología. requiere de un microscopio compuesto. (2008) propusieron una solución de KOH 10% durante 1 a 5 minutos. copio de disección. como algu156 Manual de biología de suelos tropicales . Cortesía de: M.R... normalmente se usa una solución de Nesbitt (su composición se describe a continuación). Los taxa con cutículas delicadas. este método es más barato. Coelho. hasta neutralizar la reacción. y da buenos resultados (Greenslade et al. durante unos minutos. Un método más simple de aclarado es utilizando ácido láctico. durante dos a cinco minutos. en donde se sumergen y calientan durante los diferentes periodos de tiempo. Para ello. dependiendo del pigmento y de la grasa del cuerpo del animal.5 Equipo básico requerido para llevar a cabo extracciones Berlese-Tullgren núcleo por núcleo. se transfieren los especímenes a una solución de cloral fenol. con o sin calentamiento. dependiendo del tamaño. fácil y seguro. 2008). mediante el lavado y removido de las grasas y pigmentos del cuerpo. Después de la inmersión en KOH. aunque el hidróxido de potasio (KOH) y el ácido láctico son alternativas efectivas. aunque Greenslade et al.Figura 4.

Montaje No existen métodos totalmente satisfactorios para el montaje (Greenslade et al. En el caso de especímenes mutilados. En cada caso se debe regular y controlar el tiempo. los colémbolos Poduromorpha se deben colocar en posición dorso-ventral. es aconsejable montar todas las partes del cuerpo en una sola preparación. estos especímenes deberán sumergirse en una mezcla de 50% de ácido láctico/etanol durante unas horas. porque el ácido láctico continúa aclarándolos y ablandándolos. 2008). Normalmente. los especímenes deben transferirse a otro medio.. si no se hace. Para dicho montaje se requiere de una solución Berlese. La disección se realiza en varias partes del cuerpo. Los ácaros esclerotizados pueden ser aclarados con lactofenol (compuesto por ácido láctico. tales como cabeza. cristales de fenol y agua destilada. sin calentamiento. se recomienda la disección en el caso de Symphypleona y de las Paronellidae y Entomobrydae mayores (6 a 8mm). mientras que para los Entromobrymorpha. para que puedan ser bien identificados.1). como característica clave. Las especímenes son montados en laminillas y secadas en el horno a 70°C durante. también pueden usarse para el proceso de montaje (Tabla 4. muchos ácaros oribátidos se guardan en viales etiquetados. Después de su identificación. con el propósito de identificarlos viendo la quetotaxia de cada parte. fúrcula. Algunos grupos necesitan ser disecados o disectados antes del montaje. De nuevo. los especímenes pueden destruirse o desarticularse. en el C ollembola . utilizando el ejemplo de los colémbolos. Protura y Pauropoda no deben meterse en una solución concentrada de ácido. con alcohol 70%. por ejemplo. por lo menos. mientras que las partes del cuerpo de los Symphypleona grandes se montarán de la siguiente manera: cabeza (dorsoventral). La posición de los especímenes sobre el portaobjetos difiere entre los órdenes: por ejemplo. tubo ventral y en los segmentos V y VI abdominales. siete días.nos Diplura. abdomen grande (látero-lateral). el medio líquido Hoyer. Para un almacenaje permanente. Las partes diseccionadas del cuerpo de los Entromobrymorpha deberán colocarse de forma dorso-ventral sobre el portaobjetos. la posición indicada es látero-lateral. abdomen pequeño y fúrcula (dorsoventral). acari y otra mesofauna del suelo 157 . en proporciones 50:25:25) o simplemente con ácido láctico (frío o caliente). Los ácaros también pueden aclararse y conservarse trasladándolos del alcohol a un medio de Hoyer. patas. al que se añade un 5% de glicerina. Symphypleona y Neelipleona. Otras soluciones.

nz/key. de donde se pueden obtener guías de ayuda para la identificación. El espécimen se traslada a unas gotas de ácido láctico o glicerina en un portaobjetos excavado. una identificación más allá de este nivel.ncsu.5 ml de ácido hidroclórico 20 ml de agua destilada. IDENTIFICACIÓN DE ESPECÍMENES Y ANÁLISIS DE DATOS Identificación La mayoría de los invertebrados del suelo pueden identificarse hasta orden o familia con la ayuda de trabajos estándares de referencia. www. Montaje de especimenes: medio líquido de Hoyer Nota: montaje Berlese: calentar a 70°C durante 7 días. El medio líquido de Hoyer es un agente temporal y no se endurece con calentamiento.htm o http://soilbugs. 30 g de goma arábiga. Para aclarar especimenes solución Nesbitt’s 10% KOH ó NaOH Montaje de especimenes : medio líquido de Berlese 25 ml de agua destilada. pero las preparaciones pueden hacerse semipermanentes sellando el recubrimiento con barniz de uñas transparente. hacia el borde de la depresión.1 Composición química para aclarar y montar especímenes. sin embargo.cals.massey.ac. Tabla 4. 15 g de goma arábiga. 50 g de hidrato de cloro. esta última dirección también concentra la literatura principal. se hace un montaje temporal. ofrecen una buena discusión de fondo acerca de cómo aclarar y montar ácaros. 200 g de hidrato de cloro y 20ml de glicerina. en el caso de la mayoría de los grupos de artrópodos de suelo.edu/course/ent591k/kwikey1. 158 Manual de biología de suelos tropicales . tales como los de Bachelier (1978) y Dindal (1990).php. 5 ml de glicerina. la pericia taxonómica quizás sea el factor determinante en la selección de una taxa para su estudio posterior. 40 g de hidrato de cloro y 2. 10 g de glucosa y 5 ml de ácido acético glacial.caso de ácaros de suelo. Krantz (1978) y Norton (1990). El espécimen puede rodarse suavemente hasta conseguir la orientación deseada. Se encuentran disponibles varias páginas en la web. aunque también se puede usar para otros grupos de mesofauna. A nivel de especies. Trave (1965). Por ejemplo. donde se indican las características distintivas de varios grupos de invertebrados. resulta difícil. Se coloca de manera parcial un cubreobjetos sobre la depresión y se empuja el espécimen por debajo del recubrimiento. 50 ml de agua destilada.

una vez conocida su morfología y características básicas (Crossley y Coleman. de especies para algunos grupos como Nematoda.. es utilizado para estimar su abundancia. Enchytraeidae. a nivel familia. algunos géneros y listas de especies terrestres conocidas. Los recursos para la identificación de ácaros. 2008. El libro contiene claves de identificación para todas las clases. acari y otra mesofauna del suelo 159 . Diptera y Hymenoptera. Asimismo. Los subórdenes de ácaros y muchas familias de colémbolos son de fácil identificación. Desafortunadamente. al igual que referencias de la taxonomía actual de estos grupos. Pauropoda. al igual que una lista de comprobación y bibliografía de especies descritas en esta área. Scorpiones. la identificación de colémbolos. Symphyla. Isopoda. son combinadas para crear una muestra compuesta que se somete a extracción. Protura. se encuentra disponible en Greenslade et al. Araneae. Collembola. algunas veces. por lo que es recomendable tanto para principiantes como para profesionales. Balogh y Mahunka (1983) y Balogh y Balogh (1992). Publicaciones de Yoshii (1981a. órdenes. Pseudoscorpionida. son escasas las guías específicas para este grupo en los trópicos. Coleoptera. Las muestras colectadas. utilizando pequeños núcleos o bloques. Balogh y Balogh (1990) ofrecen una breve caracterización y claves de identificación para ácaros oribátidos que habitan en la región neotropical. Chilopoda. El libro se escribió para un fácil manejo. 1982a. taxonomía y ecología de grupos de la biota del suelo. en las familias Entomobryidae y Paronellidae. Balogh (1972). la identificación a nivel género y/o especies. Un estudio completo de la biología. Mites. por ejemplo. quienes ofrecen guías y figuras a nivel genérico para ácaros que pertenecen a la suborden Oribatida. C ollembola . es mostrado en Dindal (1999). Análisis de datos El número de individuos en cada orden y en cada lugar.1982b y 1983) pueden utilizarse para identificar colémbolos a nivel especies. Diplura. Adis (2002) ofrece guías ilustradas para principiantes y cualquier persona interesada en Arachnida y Myriapoda Neurotropicales. La base de identificación y clasificación se encuentra resumida en las referencias que se citan a continuación.permitiendo así. Opiliones. familias. están disponibles en Kranz (1978) y Dindal (1990). 1999). 1981b. ya que contiene guías de identificación ilustradas. por lo menos. a nivel genérico. Bachelier (1978) ofrece buena información de fondo dentro de las amplias unidades taxonómicas de artrópodos del suelo e incluye guías ilustradas para varios grupos. Isóptera. hasta nivel de familia y.

con numerosas especies raras. incluir la riqueza de especies en el caso de los taxa seleccionada para la identificación a nivel especies. pueden ser calculados utilizando el programa EstimateS (Colwell. Este índice resulta especialmente útil para eliminar invertebrados hiper-diversos. tales como colémbolos. ácaros oribátidos y hormigas. Sofia-Moscow. 160 Manual de biología de suelos tropicales . Ph. de acuerdo con su función ecológica mayor (detritivoros. etc. 1988). Los datos obtenidos deben. H. El programa DIVERS. los taxa escasamente conocidos también se pueden clasificar a niveles taxonómicos más altos (orden o familia). G. Bachelier. basada en la correspondencia estadística entre combinaciones de singletons y de otras especies raras (estimador de abundancia Chao-SØrensen) fue desarrollada por Chao et al. reality or conning?” Oikos. La comparación de la composición de taxa entre usos de suelo debería llevarse a cabo utilizando un análisis jerárquico de agrupación y la unión promedio de agrupaciones de los datos transformados. un nuevo estimador estadístico que toma en cuenta especies compartidas no detectadas. J. del paquete de metodología ecológica para Windows. Este estimador. también pueden detectar los efectos de la perturbación con poca pérdida de información y llegar a ser una herramienta preliminar para describir patrones y sucesiones en ecosistemas del suelo perturbado por humanos (Caruso y Migliorini. vol. Se ha demostrado que datos a nivel género y familia. El número de individuos normalmente se transforma de forma logarítmica log: x’=log10 (x+1) para evitar dar mayor peso a las especies dominantes en el análisis de datos (Ludwig y Reynolds. (2002) Amazonian Arachnida and Myriapoda. André. por lo tanto. 96. pp. Pensoft. Paris. son écologie et son action“. Initiations et Documents Techniques. predadores. y Lebrun. ejemplo: ácaros oribátidos. X. (2002) “Soil biodiversity: Myth.). Ducarme. 2006). no 38. fitofagos. Este procedimiento mejora la eficiencia de la extracción porque maximiza las posibilidades de captura de grupos o especies representativos. 2005. puede usarse para calcular los índices de riqueza de especies.. Dado que los grupos de lugares similares ofrecen una fauna similar y que la mayoría de animales del suelo pueden distribuirse en los grupos funcionales básicos (Ruf et al.. 3–24. 2006. M. (1978) “La faune des sols. o bien.. ORSTOM. 2003). También puede llevarse a cabo un análisis adicional como rarefacción y estadística multivariada. 2006).utilizando el método Berlese-Tullgren. junto con otros índices de diversidad. REFERENCIAS Adis.

K. C ollembola . Franklin. M.. D. Balogh and S. accessed 10 January 2008. Dindal (ed) Soil Biology Guide. Hungarian Natural History Museum Press.nz/~maminor/mites. no 1. P. New York. T-J. Bedos. CABI Publishing. J. Minor. Oregon. A. Ludwig. M.edu/estimates. vol.eeb. Budapest. Boca Raton. Chazdon. CRC Press. M. pp. S. Caruso. (2005) ‘A new statistical approach for assessing compositional similarity based on incidence and abundance data’. (1983) Primitive Oribatids of the Palaearctic Region. John Wiley & Sons. Elsevier. Elsevier. 8. vols 1 and 2. Amsterdam.. J. Balogh. in M. pp. 779–803. Chao. K. Norton. vol. New York. 59–65. S Moreira. in F. (1990) ‘Acarina: Oribatida’. 2. Colwell. D. O.. G. Fauna Malesiana. F. y Reynolds. (1978) A Manual of Acarology. (2008) Handbook to Collembola of Indonesia. R. Dindal. W. Brussaard (eds) Soil Biodiversity in Amazonian and Other Brazilian Ecosystems. Budapest. E. http://viceroy. y Morais. Leiden (in press). E. (2006) ‘Soil Mesofauna in Central Amazon’. A. (1990) ‘Oribatid Mites of the Neotropical Region II’. acari y otra mesofauna del suelo 161 . 30. R. Mahunka (eds) The Soil Mites of the World. (1999) ‘Microarthropods’. Akadémiai Kiadó. J. 361–371. y Shen. no. Ecology Letters. uconn. (1988) Statistical Ecology: A Primer on Methods and Computing. W. (2006) ‘Micro-arthropod communities under human disturbance: Is taxonomic aggregation a valuable tool for detecting multivariate change? Evidence from Mediterranean soil oribatid coenoses’. Deharveng. pp. Version 8 User’s Guide and Application’. D. R. Wallingford. pp. L. pp. R. y Balogh. R. Acta Oecologica. K. J. y Shen. Y. Greenslade. John Wiley and Sons. (1992) The Oribatid Mite Genera of the World. Crossley.ac. Colwell. L. (2006) ‘EstimateS: Statistical estimation of species richness and shared species from sample. Chao. A. J. Sumner (ed) Handbook of Soil Science. in D. y Balogh. y Coleman. Colwell. Balogh.. R.. 148–159. L.. P. A.massey. A. P. L. Amsterdam. 2. Brill. J. vol. T-J. www. Krantz. (1972) The Oribatid Genera of the World. in J. John Wiley and Sons. html. y Migliorini. 62.. y Mahunka. (2004) ‘Soil mites and other animals’. 46–53. pp. no. (2006) ‘Abundance-based similarity indices and their estimation when there are unseen species in samples’. New York. (1990) Soil Biology Guide. J. Balogh. J. Biometrics. Siqueira and L.Balogh. L. Oregon State University Book Store Inc. T. Chazdon. R. y Suhardjono. 142–162.

pp. R. (2003) “A biological classification concept for the assessment of soil quality: “Biological soil classification scheme” (BBSK)’. H. Nothridae) and Platynothrus peltifer (Koch) (Acari. pp. Entomological Report from the Sabah Forest Research Centre No. Dreher. Entomological Report from the Sabah Forest Research Centre No. 7. Soils. J. Beck. R. Revue d’Écologie et de Biologie du Sol.. 1–70. 3. J. Yoshii. 1–70. pp. 263–271. d’observation et de conservation des Oribates (Acariens) et autres microathropodes”. J. Hund-Rinke. no. Japan International Cooperation Agency. y Spelda.. R. K. pp1–38. Japan International Cooperation Agency. Oribatida. 23–47. L. Oribatida. Römbke. vol. Fert. Yoshii. (1983) ‘Studies on Paronellid Collembola of East Asia’. 2. (1981a) ‘Paronellid Collembola of Sabah’. 8112. (1981b) ‘Neanurid Collembola of Sabah’. 98. pp.. 4. Japan International Cooperation Agency. Yoshii.. 5. 1–3. 9. Entomological Report from the Sabah Forest Research Centre No. (1990) ‘Niche relationships between two panphytophagous soil mites. 1–38. Ecosystems and Environment. (1982a) ‘Lepidocyrtid Collembola of Sabah’. Agriculture. pp. 6. EX-1 JR. vol. de triage. A. Biol.Ruf. pp. Entomological Report from the Sabah Forest Research Centre No. Travè. 81-12. pp. vol. Yoshii. (1965) “Quelques techniques de récolte. Japan International Cooperation Agency. 1–28. no. (1982b) ‘Studies on the Collembolan Genera Callyntrura and Dicranocentroides’. 2. R. 139–144. Yoshii. Nothrus silvestris Nicolet (Acari. 162 Manual de biología de suelos tropicales . Japan International Cooperation Agency. Entomological Report from the Sabah Forest Research Centre No. P. R. Siepel. EX-1 JR. Camisiidae)’.

los cuales se consideran uno de los grupos de animales más abundantes y más diversos en el planeta. Derivado de su evolución. 1990). 1980. son conocidos como una amenaza para la salud humana. ellos son responsables del 10 a 15% de la respiración de los animales del suelo (Sohlenius. Huang (†) INTRODUCCIÓN Los nematodos del suelo son pequeños invertebrados dependientes del agua. en todas las latitudes del planeta y desde fondo del mar hasta la cima de las montañas. Cares y Shiou P. 1982). De esta manera. protozoarios. algas. ellos juegan un papel importante como agentes de ciclado de nutrientes y como reguladores de la fertilidad del suelo mediante el flujo de energía y la movilización y utilización de nutrimentos (Procter. sin embargo.Capítulo 5 Nematodos del suelo Juvenil E. otros nematodos y microinvertebrados. animal y de plantas. La palabra nematodo deriva del griego “nema” que significa “forma de un hilo”. mientras que las formas de vida libre se alimentan de microorganismos (bacterias y hongos). Los nematodos en una primera aproximación. Debido a su gran capacidad de adaptación. los nematodos parásitos tienen la capacidad de colonizar y alimentarse de tejidos de plantas y animales. los nematodos se adaptaron a la exploración de una amplia variedad de fuentes de alimento. además de estos bene163 . los nematodos están presentes en cualquier lugar donde exista carbono orgánico. Petersen. ya que poseen un cuerpo alargado y cilíndrico. Aunque la biomasa de nematodos en el suelo es pequeña (10¹ a 104 mg peso seco m-2).

Los nematodos del suelo viven en grupos o gremios. Los micófagos. Los nematodos depredadores tienen la cavidad bucal equipada con una o más estructuras en forma de dientes (Ilustración 2d). compuestos por lo general de cinco grupos funcionales principales: parásitos de plantas. bacteriófagos. los nematodos están bien representados a lo largo de la red trófica del suelo. poseen un estilete que les permite alimentarse de otros nematodos. Los omnívoros tienen la cavidad bucal armada con un estilete hueco (Ilustración 2e). herbívoros y también como depredadores al alimentarse de otros nematodos. se alimentan de las hifas de hongos saprofíticos. los nematodos bacteriófagos pueden incrementar su población ante cualquier perturbación del suelo o bien. micófagos. 2001). pueden alimentarse de bacterias y esporas de hongos. los califican como poderosos bioindicadores de condiciones ecológicas (Huang y Cares. por lo que pueden fungir como micófagos. Su omnipresencia y abundancia en todo tipo de suelos y hábitats acuáticos. así como su ciclo de vida corto y sensibilidad ante alteraciones ambientales. tal es el caso de los nematodos entomofílicos Deladenus siricidicola o los entomopatógenos Steinernema carpocapsae y Heterorhabditis bacteriophora. Los nematodos bacteriófagos. depredadores y omnívoros (Ilustración 2).ficios para el ecosistema. el aparato bucal incluye un estilete tipo aguja (lustración 2a). benéficos y micorrízicos. o en algunos casos. con la capacidad de alimentarse de cualquier fuente. mediante el cual puede causar pérdidas significativas en varios cultivos. equipados en su mayoría con un estilete pequeño y delicado (Ilustración 2b). también participan en importantes servicios del agroecosistema al fungir como agentes de control biológico de plagas de insectos. microinvertebrados y protozoarios. influir en la nodulación por parte de bacterias tipo Rhizobium. una condición que puede interpretarse como indicador de la fertilidad del suelo (Ferris et al. en la mayoría de los casos la identificación de los diferentes grupos funcionales puede lograrse en base a la morfología de su aparato bucal. algunos nematodos micófagos son pueden comportarse como parásitos facultativos de plantas. bajo condiciones de enriquecimiento de nutrimentos. bacteriófagos. En el caso de nematodos parásitos de plantas. 2006). mismos que carecen de estilete (Ilustración 2c). son polífagos. así como alimentarse y diseminar bacterias benéficas y fitopatógenas. Aunque la identificación de estos organismos requiere de intenso entrenamiento. patogénicos. en algunos casos. mientras otros ocupan áreas más restringidas. pueden regular el nitrógeno y el fósforo disponible para las plantas. Se distinguen también entre ellos mismos por su 164 Manual de biología de suelos tropicales . Como típicos estrategas r. Algunos nematodos viven en un amplio rango de ambientes. Por tal motivo.

una ausencia de dauerlarva y sensibilidad ante contaminantes y otros factores de perturbación. y los nematodos se colectan directamente en un tamiz de 400 mallas (tamaño de malla de 37 µm) (Figura 5. Las muestras son transportadas al laboratorio en una caja aislada y almacenadas a 4° C hasta su extracción. muestran la presencia de dauerlarva e incrementan sus poblaciones cuando existen condiciones ricas en alimentación. los nematodos colonizadores (similares a los estrategas r) típicamente poseen un tiempo de generación corto. producen muchos huevecillos pequeños. pero más grandes. poseen una baja movilidad. los nematodos persistentes (similares a estrategas k) se caracterizan por necesitar un largo tiempo de generación. producen pocos huevillos. A esta última suspensión de nematodos se le pueden eliminar aún más partículas de N ematodos del suelo 165 . tomando en cuenta su diversidad. se trazan dos círculos concéntricos. por tal motivo. Por otra parte. además son los más resistentes a la perturbación del suelo y a contaminantes químicos. y ocho puntos en el círculo grande. abundancia y estructura de comunidad. EXTRACCIÓN DE NEMATODOS La muestra de suelo se mezcla completamente y se toma una submuestra de 300 ml. un análisis apropiado de la comunidad de nematodos. puede presentar un índice de sistemas de uso de suelo y cambios de uso de suelo y medir los niveles de perturbación provocados por contaminantes y otros factores. lo cual deberá hacerse con la mayor rapidez posible. se agita durante 30 segundos y se deja reposar otros 2 minutos para que las partículas del suelo se sedimenten. Esta suspensión se pasa a través de tamices de 40 a 60 mallas (tamaño de malla de 250 a 350 µm. MUESTREO DE SUELO En cada punto de muestreo dentro de un sistema de cuadrícula (véase Capítulo 2). respectivamente.sensibilidad a la perturbación del suelo y a los contaminantes químicos.1). con un radio de 3 m y 6 m. Los doce núcleos de suelo se depositan en una bolsa de plástico que deberá sellarse para evitar su desecación y además protegerla de la luz solar. Para colectar el suelo se utiliza un nucleador de acero y las muestras se toman en cuatro puntos equidistantes en el círculo pequeño. la cual se vacía a una cubeta con 2 litros de agua. todos los núcleos de suelo se deben tomar a una profundidad de 20 cm. respectivamente). Según lo propuesto por Bongers (1990) y Bongers y Borgers (1998).

contenida en el vaso. En este procedimiento. FIJACIÓN Y CONTEO DE NEMATODOS Los nematodos extraídos se matan con agua caliente a 50-60°C durante un máximo de un minuto (Figura 5. La suspensión. éstos se dejan reposar durante 30 minutos y se remueve el exceso de sobrenadante utilizando una pipeta o por medio de succión al vacío (preferentemente).1 A la izquierda. dejando así una suspensión de nematodos de 10 a 20 ml.2a) y se centrifuga de nuevo a 1. 1964). Una vez calentados los tubos.suelo mediante un método modificado de centrifugación con flotación de azúcar (Jenkins.500 rpm durante 5 minutos y el sobrenadante se descarta.3b) y. los nematodos se colectan a partir del sobrenadante utilizando un cernidor con tamaño de malla de 37 µm (Figura 5. Los especímenes que se hallan sobre la malla se lavan y arrastran con agua.2b). Posteriormente. se añade un volumen igual de solución Golden Figura 5. posteriormente se fijan con solución Golden 2X (Hooper. Posteriormente. el sedimento o botón dentro del tubo de centrífuga se resuspenden en solución de sacarosa (456g L-1) (Figura 5. suspensión de suelo en reposo.3a). para luego colectarse en un vaso de precipitados (Figura 5. la suspensión acuosa se centrifuga primero a 3. 1970). se distribuye en tubos de ensayo para su fijación.000 rpm durante uno a dos minutos. 166 Manual de biología de suelos tropicales . y a la derecha. juego de tamices de metal (de tamaño de malla 45 arriba y 400 abajo).

de alícuotas de 1 ml. La rejilla que contiene a los tubos se sumerge en un recipiente con agua. a b Figura 5. el número total se obtiene de multiplicar la media de tres conteos de manera que el número total representará el número medio de 3 conteos de submuestras x 15. depositada en el fondo del tubo de centrífuga b) tamizado de la suspensión de nematodos después de la flotación con sacarosa.Figura 5.3 a) Nematodos recuperados mediante el lavado de malla de 400. b) muerte de nematodos en agua caliente. 2X. con lo que se obtiene una concentración final de formol 3.2 a) Adición de solución de sacarosa para resuspender la mezcla de suelo y nematodos. N ematodos del suelo 167 .2%. La suspensión resultante se ajusta a un volumen de 15 ml y se cuenta el total de nematodos en la población mediante la toma al azar.

5.INFILTRACIÓN CON GLICERINA Y OBSERVACIÓN DE NEMATODOS El método de Seinhorst (Seinhorst. 1991. Bongers. la caja se coloca en un desecador a 43°C durante la noche (Figura 5. 1991. se coloca una tira de cinta adhesiva para evitar que el cubreobjetos aplaste a las especímenes. Andrássy. utilizando un microscopio compuesto (se requiere un aumento de 400 a 1. en esas condiciones se retira la tapa de la caja para que se reduzca por lo menos a la mitad de su volumen. mientras que la composición de las soluciones se puede observar en la Tabla 5. 1961. 1991.6). Antes de colocar el cubreobjetos de vidrio sobre la gota. La identificación de nematodos por caracteres morfológicos se basa en la literatura taxonómica especializada (Goodey. 1996. Raski. 1988. Estos pasos se repiten tres veces. El procedimiento se ilustra en la Figura 5. 1991. 1951. 1992. al final. Loof. Se hace una selección al azar de aproximadamente 100 nematodos montados para su identificación a nivel de género. 1991. 1991. Cares y Huang.. la caja se retira del desecador y se deja evaporar a la misma temperatura durante un mínimo de cuatro horas. Goseco et al. Jairajpuri y Ahmad. Maggenti.000 x). Decraemer. Smart Jr y Nguyen. 1984) (Figura 5. Thorne. 1993. se tapa la caja y se deja nuevamente en el desecador durante la noche.7). Después de este proceso. May et al. Al segundo día. Smart Jr y Nguyen. utilizando una gota de glicerina deshidratada como medio de montaje. 1991. La modificación consiste en reducir a 3 ml el volumen de la suspensión (Figura 5. los nematodos de la caja se montan en laminillas. 1991.1974. 1959) suele modificarse para evitar la laboriosa tarea de pescar individualmente cada nematodo y elaborar numerosas preparaciones permanentes. 2000. 1991. 2001). Fortuner. Baldwin y Mundo-Ocampo. 1988. Geraert. Anderson y Potter.. El volumen de la caja se reestablece con solución Seinhorst II.1) y el volumen resultante se vacía por completo en una caja Petri de 5 cm de diámetro. Nickle y Hooper.5. luego se añaden 7 ml de la solución Seinhorst I (Figura 5.4). la preparación se sella utilizando bálsamo de Canadá (Huang et al. Tabla 5. 1991. 168 Manual de biología de suelos tropicales .1. aunque en la última ocasión no es necesario añadir solución Seinhorst II pero sí incubar a la misma temperatura durante otras 48 horas para evaporar todo el alcohol. 1994. 1983. Hunt.

5 Esquema del método de Seinhorst modificado (proceso de infiltración en glicerina) para una muestra masiva de nematodos.4 Remoción del exceso de agua sin perturbar el fondo de la suspensión de nematodos Figura 5. Nematodos en: Golden (3 ml) + Seinhorst I (7 ml) Evaporación a 43°C durante 4h para reducir el volumen a la mitad Completar volumen con Seinhorst II Desecador a 43°C durante la noche Desecador a 43°C durante la noche Desecador a 43°C durante la noche Evaporación a 43°C durante 48 horas. Las cajas Petri no deben contener más de una tercera parte de líquido.Figura 5. Evaporación a 43°C durante 4 hrs para reducir a la mitad del volumen Completar volumen con Seinhorst II Evaporación a 43°C durante 4h para reducir el volumen a la mitad Desecador a 43°C durante la noche N ematodos del suelo 169 .

Figura 5. Nota: el fondo del contenedor se mantiene a 43°C. Foto Francisco Franco. Foto: Marcella A.6 Cámara de desecación con cajas Petri que contienen nematodos para infiltración en glicerina. Teixeira.7 Charola con montajes permanentes de especímenes de nematodos.Figura 5. 170 Manual de biología de suelos tropicales .

N ematodos del suelo 171 . donde S = número de géneros y N = número total de nematodos].1 Composición de reactivos utilizados en la fijación de nematodos e infiltración en glicerina. pueden utilizarse para calcular índices de diversidad y equitatividad. su número poblacional se divide entre dos para cada hábito. Índice de Diversidad de Simpson [Ds = 1 – Σ(pi)². donde pi = porcentaje de género ‘i’ en la abundancia total]. bacteriófagos. Golden X Formol (+ 40% formaldehído) Glicerina Agua destilada Alcohol 96% Glicerina Agua destilada 8 partes 2 partes 90 partes Seinhorst I 20 partes 2 partes 78 partes Golden 2X 16 partes 4 partes 80 partes Seinhorst II 95 partes 5 partes ÍNDICES Y PARÁMETROS PARA LA CARACTERIZACIÓN DE POBLACIONES DE NEMATODOS Los nematodos identificados a nivel de género pueden dividirse en cinco grupos tróficos: parásitos de plantas. micófagos. Índice de Diversidad de Shannon [H’ = .Tabla 5. abundancia total y abundancia relativa de cada uno de los géneros. Si un nematodo posee dos tipos de hábito alimenticio. todos ellos basados en los criterios de Yeates et al.Σpi log2 pi]. cuando un nematodo tiene dos tipos de hábitos alimenticios. Índice de Riqueza de Género [d = (S – 1)/log N. empleando las fórmulas que se mencionan líneas adelante. (1993). Equitatividad del Índice de Diversidad de Simpson [Es = Ds/Ds max’ donde Dsmax = 1 – 1/S Equitatividad del Índice de Diversidad de Shannon (J’= H’/H’max’ donde H’max = Log2 S]. depredadores y omnívoros. Los datos de frecuencia y abundancia de los diferentes grupos tróficos se usan para calcular el Índice de Diversidad Trófica y varios cocientes que consideran la abundancia relativa de los grupos tróficos. Los datos sobre frecuencia absoluta.

1988.3). Σ(vi x fi) (donde vi = valor c-p de 1 a 5 para el género ‘i’. Índice de Diversidad Trófica [T = 1/ Σ(pi)². Krebs. Magurran. 1994]. En base a estos conceptos. y fi = frecuencia relativa del género ‘i’). siempre están activos. los persistentes cp5 se distinguen por tiempos generacionales largos.2) y el Índice Fitoparasítico (IFP) (que incluye únicamente parásitos de plantas) (Tabla 5. la producción de pocos huevecillos pero muy grandes. baja movilidad. pero excluyendo a los nematodos cp1) para evaluar factores de estrés inducidos por contaminación. véase Norton. respectivamente). Bongers (1990) dividió a los nematodos del suelo en una serie desde los colonizadores (c) hasta los persistentes (p) (similar a los estrategas r y k. Yeates (1994) amplió el Índice de Madurez para incluir a todos los nematodos del suelo (mIM). 1990). Porcentajes de criconematidos y de dorylaimidos en la población. y el cociente IFP /IM como un indicador de fertilidad del suelo. Los colonizadores cp1 se caracterizan por tener tiempos generacionales cortos. Por el contrario. Para medir el nivel de perturbación del suelo (Bongers. La relación micófagos/bacteriófagos (M/B) y (micófagos+bacteriófagos)/parásitos de plantas [(M+B)/PP]. asignándoles un “valor cp” en una escala de 1 a 5. donde pi = abundancia relativa de un grupo trófico . presentan dauerlarvae o estadios de sobrevivencia y crecen bajo condiciones de riqueza de alimento. producen muchos huevecillos pequeños. el Índice de Madurez (IM) (que incluye únicamente nematodos de vida libre) (Tabla 5. 1978.2 Familias y valores cp utilizados para el índice de madurez* Familia Neotylenchidae Anguinidae Aphelenchidae Aphelenchoididae Rhabditidae 172 valor cp 2 2 2 2 1 Familia Achromadoridae Ethmolaimidae Cyatholaimidae Desmodoridae Microlaimidae valor cp 3 3 3 3 3 Manual de biología de suelos tropicales . Tabla 5. ausencia de dauerlavae y elevada sensibilidad ante la presencia de contaminantes y otros factores de perturbación (Bongers y Bongers. 1998). se han utilizado varios índices para la evaluación del suelo. Bongers y Bongers (1998) propusieron IM2–5 (igual que IM.

. Tabla 5.3 Familias y valores cp utilizados para el índice fitoparasítico cp2 Tylenchidae Psilenchidae Tylodoridae cp3 Dolichodoridae Hoplolaimidae Pratylenchidae cp4 Trichodoridae cp5 Longidoridae N ematodos del suelo 173 Nota:*modificado de Bongers (1990).2 Familias y valores cp utilizados para el índice de madurez* Familia Alloionematidae Diploscapteridae Bunonematidae Cephalobidae Ostellidae Panagrolaimidae Myolaimidae Teratocephalidae Diplogasteridae Neodiplogasteridae Diplogasteroididae Tylopharyngidae Odontopharyngidae Monhysteridae Xyalidae Linhomoeidae Plectidae Leptolaimidae Halaphanolaimidae Diplopeltidae Rhabdolaimidae Chromadoridae Hypodontolaimidae Choanolaimidae valor cp 1 1 1 2 2 1 2 2 1 1 1 1 1 1 2 3 2 3 3 3 3 3 3 4 Familia Odontolaimidae Aulolaimidae Bastianiidae Prismatolaimidae Ironidae Tobrilidae Onchulidae Tripylidae Alaimidae Bathyodontidae Mononchidae Anatonchidae Nygolaimidae Dorylaimidae Chrysonematidae Thornenematidae Nordiidae Qudsianematidae Aporcelaimidae Belondiridae Actinolaimidae Discolaimidae Leptonchidae Diphtherophoridae valor cp 3 3 3 3 4 3 3 3 4 4 4 4 5 4 5 5 4 4 5 5 5 5 4 3 Nota: *Bongers (1990).Tabla 5.

R. 8. Cares. 163–183. New York. in W. (1990) ‘The maturity index: An ecological measure of environmental disturbance based on nematode species composition’. S. Schoorl. 3. M. Andrássy.and non-cyst-forming nematodes’. Bibliotheekuitgave no. The Netherlands. 174 Manual de biología de suelos tropicales . Revisão Anual de Patologia de Plantas. J. Bongers. M. Bongers. pp. Bongers. Applied Soil Ecology. y Mundo-Ocampo. T. Revisão Anual de Patologia de Plantas. 275–362. 46. S. W. J. M. 9. Cares. Merlinius. pp. Marcell Dekker. y Huang. vol. O. vol. 177–235. y Potter. P. (1991) ‘Heteroderinae cyst. (1994) De Nematoden van Nederland. y Huang. 14–19. no. R. pp. E. London. R. 529–586. Siqueiera and Brussaard. S. Nickle (ed) Manual of Agricultural Nematology. J. (2001) “Taxonomia de fitonematóides. J. 185–223. J. pp. J. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian amazon and savanna vegetation’. P. Bongers. in W. T. The Netherlands. Eötvös Lorand University. Schoorl. in F. 2nd edition. Chave sistemática simplificada para gêneros Parte I”. Koninklijke Nederlandse Natuurhistorische Vereniging. vol. CABI Publishing. L. (eds) (2006) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. pp. Chave sistemática simplificada para gêneros Parte II”. (1998) ‘Functional diversity of nematodes’. (1991) ‘Stunt nematodes: Tylenchorhynchus. Koninklijke Nederlandse Natuurhistorische Vereniging. G. E.3 Continúa cp2 Ecphyadophoridae Paratylenchidae Anguinidae cp3 Heteroderidae Hemicycliophoridae cp4 cp5 Nota: * modificado de Bongers (1990). pp. y Huang. I. Pirola. 10. y Bongers. New York. Nickle (ed) Manual of Agricultural Nematology. 83. T. E. Moreira. Pirola. Cares. Baldwin. Bibliotheekuitgave no 46. and related genera’. 239–251.Tabla 5. (1988) De Nematoden van Nederland. T. Marcel Dekker. REFERENCIAS Anderson. Oecologia. P. (2000) “Taxonomia atual de fitonematóides. (1983) A taxonomic review of the suborder Rhabditina (Nematoda Secernentia). V. pp. Budapest. vol.

fixing. in W. J. R. W. pp. Marcel Dekker. Jenkins. (1964) ‘A rapid centrifugal flotation technique for separating nematodes from soil’. 48. New York. R. C. Nickle (ed) Manual of Agricultural Nematology. (1951) Soil and freshwater nematodes. West Lafayette. R. Marcel Dekker. E. pp. Longidoridae. New York. Ferris. V. G. F.. R. Harper Collins College Publishers. C. J.Decraemer. Fortuner. T. Journal of Nematology. pp. J. F. pp. y Cares. Marcell Dekker. New York. Huang. Brill. R. Marcel Dekker. Nickle (ed) Manual of Agricultural Nematology. R. W. Marcel Dekker. S. S. M. (1991) ‘Stubby root and virus vector nematodes: Trichodorus. pp. J. (1991) ‘Nemata: Higher classification’. no 9. CAB International. M. Paratrichodorus. vol. Southey (ed) Laboratory Methods for Work with Plant and Soil Nematodes. M. (1970) ‘Handling. T. P. Jairajpuri. 662–665. Wallingford. 4th edition. 13–29. Goseco. 1st edition. Ministry of Agriculture. pp. (1992) Dorylaimida: Free-living. in W. CAB International. (1991) ‘Tylenchidae in agricultural soils’. O. 16. F. (2001) ‘A framework for soil food web diagnostics: Extension of the nematode faunal analysis concept’. no 1. 147–190. D. 341–342. Purdue University. R. New York.. Plant Disease Reporter. London. 795–826. y Ferris. in J. J. E. Purdue Nematode Collection Department of Entomology. W. y Goede. in W. P. in W. 18. (1974) Revision in Leptonchoidea (Nematoda: Dorylaimida). Goodey. y Silva. (1984) ‘Preparing nematode permanent mounts with adhesive tapes’. Fisheries and Food. Siqueira and L. J.. and Monotrichodorus’. (2006) ‘Nematode communities in soils under different land-use systems in Brazilian Amazon and savanna vegetation’. 587–626. R. (1991) ‘The Hoplolaimidae’. E. Leiden. C. C. and Ahmad. A. 1949’. 163–183. A. Brussaard (eds) Soil biodiversity in Amazonian and other Brazilian ecosystems. G. Predaceous and Plant Parasitic Nematodes. 669–720. 363–422. Moreira. R. S. E. Huang. Hunt. D. M. (1991) ‘The family Pratylenchidae Thorne. and Trichodoridae: Their systematics and bionomics. New York. Wallingford. Nickle (ed) Manual of Agricultural Nematology. Loof. Allotrichodorus. in F. vol. pp. H. Maggenti. staining and mounting nematodes’. Nickle (ed) Manual of Agricultural Nematology. in W. R. pp. Nickle (ed) Manual of Agricultural Nematology. N ematodos del suelo 175 . (1994) Ecology: The Experimental Analysis of Distribution and Abundance. Indiana. pp. no 3. (1993) Aphelenchida. 34–39. M. S. Ferris. Technical Bulletin No 2. Ltd. pp. Bittencourt. Applied Soil Ecology. Methuen and Co. Bongers. Hooper. Krebs. New York. Geraert. vol.

315–331. Yeates. 176 Manual de biología de suelos tropicales . pp.’. K. Oikos. University of Florida. Cornell University Press.. (1988) Ecological Diversity and its Measurement. Nickle. vol. de Goede.Magurran. J. D. (1991) ‘Tylenchulidae in agricultural soils’. P. (1988) Illustrated Key for Identification of Common Nematodes in Florida. and Dolichodorus spp. 186–194. y Loeffer. pp. H. J. New York. 3. vol. S. Yeates. A. 465–508. R. W. G. and insect nematodes’. W. (1996) Pictorial Key to Genera of Plant Parasitic Nematodes. Pedobiologia. G. B. W. Nickle (ed) Manual of Agricultural Nematology. B. Nickle (ed) Manual of Agricultural Nematology. New York Petersen. 5th edition. C. W. T. and Nguyen. vol. (1959) ‘A rapid method for the transfer of nematodes from fixative to anhydrous glycerin’. (1980) ‘Abundance. John Wiley and Sons. Norton. vol. 306–329. in W. 39. Marcel Dekker.. C. 2. (1978) Ecology of Plant Parasitic Nematodes. in W. (1991) ‘Sting and awl nematodes: Belonolaimus spp. y Nguyen. K. M. Sohlenius. 38. no. 22.. 1. New York.. S. G. (1991) ‘The Aphelenchina: Bud. 761–794. H. Lyon. Journal of Nematology. Raski. W. 67–69. 97–101. Cambridge University Press. Bongers.. R. biomass and contribution to energy flow by soil nematodes in terrestrial ecosystems’. D.. McGraw Hill Co. C. G. L. leaf. in W. Procter. Cambridge. 4. B. Seinhorst. G. New York. R. C. K. D. 627–668. Marcell Dekker. Journal of Nematology. Thorne. Marcel Dekker. no.an outline for soil ecologists’. y Georgieva. vol. D. G. pp. (1961) Principles of Nematology. pp. May. Mullin. Freckman. 1–7. W. 25. H. pp. Oikos. R. G. (1982) ‘Structure and size of soil animal populations’. Nematologica. J. pp. pp. New York. (1990) ‘Global overview of the functional roles of soil-living nematodes in terrestrial communities and ecosystem’. New York. pp. F. R. vol. y Hooper. pp. Smart Jr. no. Gainesville. E. Smart Jr. D. 34. (1994) ‘Modification and quantification of the nematode maturity index’. (1993) ‘Feeding habits in soil nematode families and genera . Nickle (ed) Manual of Agricultural Nematology.

por un marco.Ilustración 1. f y g) Se fijan las redes al interior de la trampa Winkler previamente colgadas en un espacio bien aireado con un frasco colocado en el fondo. b) Colecta de la hojarasca utilizando guantes de cuero. e) Cada muestra de hojarasca tamizada se transfiere a una red. que contiene alcohol al 70%. Sistema de extracción de hormigas y escarabajos con trampas Winkler a) Delimitación de un metro cuadrado de hojarasca. i . c) Introducción de la hojarasca en un tamiz para separar los fragmentos más gruesos. desde el borde hacia el centro. d) Transferencia del material tamizado a bolsas de nylon en campo.

C) bacteriófago. Fotos: Juvenil Cares.Ilustración 2. Fotomicrografías de la región anterior en las que se muestra el aparato bucal (flechas) de nematodos de suelo pertenecientes a diferentes grupos funcionales: A) parásito de plantas. D) depredador. B) micófago. A y B: Estoma con estilete C: Estoma sin estilete D: Diente dorsal E: Odonto estilete ii Manual de biología de suelos tropicales . E) omnívoro.

Ilustración 3. cr CL CL d) Características de dos aislamientos de Bradyrhizobium (CL de crecimiento lento) y de R. PAB vol 319.. b) Plantas de Prosopis juliflora en agar inclinado con solución de nutrientes. tropici (CR crecimiento rápido) creciendo en YMA f) Perfiles de Rep-PCR de e) Perfiles de proteínas totales obtenidos por electroforesis diferentes cepas. en gel de poliacrilamida. 2009. a) Siratro en bolsa de plástico con solución de nutrientes Pheseolus vulgaris c) Pruebas en plantas de Pheseolus vulgaris para ver la eficiencia de aislamientos en Jarras de Leonard. I lustraciones a color iii . Moreira excepto e) de Lima et al. Fotos: F. Pasos de la metodología para caracterizar a las bacterias fijadoras de nitrógeno y formadoras de nódulos en leguminosas (BFNFNL) aplicada en el proyecto CSMBGBD.

Esporas y estructuras producidas por especies de hongos micorrizógenos arbusculares de la familia Gigasporaceae: a) espora de Gigaspora albida mostrando la célula suspensora bulbosa (flecha). Fotos: Sidney Stümer. Esporas y estructuras producidas por especies de HMA de la familia Acaulosporaceae: e) espora de Entrophospora colombiana mostrando la pared de la espora. f) espora de Entrophospora colombiana mostrando las dos cicatrices (flecha). obsérvese el escudo redondo de germinación de color café que contrasta con el color hialino de la espora. g) espora de Acaulospora scrobiculata mostrando la cicatriz (flecha) que queda en la espora después de que se suelta el sáculo esporífero. típica de la familia. h) esporas de Acaulospora sp.Ilustración 4. pared germinal 1 (gw1) y pared germinal 2 (gw2) con su capa más interna en reacción con el reactivo Melzer. iv Manual de biología de suelos tropicales . c) detalle de la ornamentación de la pared de la espora (verrugas) de Scutellospora coralloidea. d) células auxiliares nudosas diferencias por miembros del género Scutellospora. mostrando algunos sáculos esporíferos todavía fijados a la espora (flecha). b) espora de Scutellospora scutata con la célula suspensora bulbosa (flecha).

Esporas y estructuras producidas por especies de HMA de la familia Glomeraceae: a) Espora de Glomus clarum mostrando la hifa de sostén. f) Detalle de Archaeospora Leptoticha mostrando salientes y depresiones en las capas 2 y 3 de la pared de la espora (flecha). L2 y L3) (obsérvese que la capa L2 está ornamentada con pequeñas crestas). L2 y L3).Ilustración 5. b) Espora de Glomus sp. h) Espora de Paraglomus brasilianum mostrando la estructura de la pared de la espora formada por tres capas (L1.caf. g) Espora de Paraglomus occultum mostrando la estructura de la pared de la espora formada por tres capas (L1. obsérvese que la capa más profunda de la pared de la espora se separa y se asemeja a la pared germinal. excepto de Paraglomus occultum y P. d) Esporocarpo de Glomus sp. brasilianum que fueron tomadas de http:// invam. mostrando la pared de la hifa de sostén de manera continua con la pared de la espora. Esporas y estructuras producidas por especies de HMA de la familia Archaeosporaceae (e y f) y Paraglomeraceae (g y h): e) espora de Archaeospora Leptoticha con sáculo esporífero. I lustraciones a color v .edu. c) Esporocarpo de Glomus clavispora.wvu. Fotos: Sidney Stümer.

d) esporangio de Phytophthora. e) Oogonio y anteridio de Pythium. f) Pythium liberando zooesporas. c) cultivo puro en cebo. b) muestra de agua con cebo. Aislamientos de hongos zoospóricos de muestras del ambiente (Oomycota y Chytridiomycota): a) muestra de suelo con cebo. vi Manual de biología de suelos tropicales .Ilustración 6.

Fotos: Lucas M. h) colonias de hongos en medio de cultivo para retardar el crecimiento. Abreu. f) medio de cultivo en placas. d) continuando con el procedimiento de lavado.Ilustración 7. I lustraciones a color vii . c) suelo pre-lavado. Técnica de lavado del suelo para el aislamiento de microhongos del suelo: a) Pre-lavado. g) placa con partículas de suelo para su incubación. b) tamices con diferentes mallas. e) partículas de suelo lavado.

E) Adulto de mosca de la fruta y detalle del aculeo. D) Extracción del aculeo. A C Banda costal Banda “s” Banda “s” D B E Cabeza Punta del oviducto Mesonoto Aculeo Mediotergio Abdomen Terminalia viii Manual de biología de suelos tropicales . C) Patrones alares típicos con bandas. B) Trampa MacPhail con cebo. A) Larvas y pupas de la mosca de la fruta en el suelo.Ilustración 8.

provienen de una diversidad que se encuentra en el suelo. Moreira LA IMPORTANCIA ECONÓMICA Y ECOLÓGICA DE LA SIMBIOSIS DE BACTERIAS FORMADORAS DE NÓDULOS EN LEGUMINOSAS (BFNFNL) La fijación biológica de nitrógeno es uno de los procesos más importantes para mantener la vida en el planeta. En el año 2006. se utiliza en algunos países con un pequeño y selecto grupo de leguminosas con el propósito de reemplazar el uso de fertilizantes químicos de nitrógeno. al mismo tiempo.Capítulo 6 Bacterias formadoras de nódulos en leguminosas Fátima M. un conocimiento de la diversidad de BFNFNL en el suelo deberá ser el primer paso para el manejo y la conservación de este recurso genético de tanto valor. debido a las múltiples interacciones que se dan entre organismos del suelo y plantas. En Brasil. considerando un área de 21 millones de hectáreas. por lo tanto. la biodiversidad del suelo puede afectar el comportamiento de la formación de nódulos de manera positiva o negativa. se ahorraron alrededor de US$ 3.3 billones de gastos en fertilizantes mediante la aplicación de esta biotecnología. 1975). en el caso de la soya. 177 . la inoculación con cepas de Bradyrhizobium reemplaza completamente la aplicación de fertilizantes sintéticos. pues proporciona alrededor del 70% de todo el nitrógeno requerido en los ecosistemas naturales y agroecosistemas (Burns y Hardy. usadas para la inoculación. donde se cosecharon cerca de 57 millones de toneladas de soya. manteniendo así la armonía con el medio ambiente. S. La inoculación con cepas de BFNFNL altamente eficientes y adaptadas a las condiciones ambientales dominantes. Las cepas.

El término rhizobia se deriva de Rhizobiaceae (Conn. leguminosarum biovars phaseoli. forman nódulos en las raíces (y algunas veces en los tallos) de algunas especies de leguminosas y en las raíces de Parasponia spp. Jordan.. el nombre ”rhizobia” ya no resulta idóneo para describir bacterias formadoras de nódulos.TAXONOMÍA ACTUAL DE BFNFNL Las bacterias fijadoras de nitrógeno. 1997 van Berkun et al. 1993 Amarger et al.proteobacteria (por ejemplo. Especie de bacterias formadoras de nódulos en leguminosas. viceae R. galegae R. 1989 Martinez-Romero et al. 2001. Jourand et al. 1991 Segovia et al. 2004 Rivas et al. Género. Methylobacterium Methylobacteriaceae y Dovosia Hyphomicrobiaceae) también pueden formar nódulos en leguminosas (Moulin et al. Sy et al.. Chen et al. 2001. conocidas anteriormente como rizobios. etli biovar mimosae 178 Manual de biología de suelos tropicales Frank. 1889. trifolii. giardinii R. mongolense R. una taxa a nivel familia de bacterias creada expresamente para acomodar organismos que pueden formar nódulos en leguminosas. Las citas referidas describen a las especies y/o comprueban su capacidad de nodulación. 1984 Lindström. gallicum R.. Familia. 1938). 1879. giardinii biovars phaseoli. (Ulmaceae). Tabla 6.1). por esta razón. 1998 Wang et al.Familia/Género/Especie α-Proteobacteria-Orden Rhizobiales Referencia Rhizobiaceae Rhizobium R.. aunque se continúa usando en alguna literatura.1 Filum/Orden. huautlense R. hainanense R. 1997 Chen et al. 1997 Amarger et al. Una extensión reciente de conocimientos acerca de las bacterias formadoras de nódulos en leguminosas fue el descubrimiento que estableció que las bacterias pertenecientes al β-proteobacteria (género Burkholderia y Ralstonia/Cupriavidus) y a otras familias de la α. tropici R. 2001. 2002.. 1998 Wang et al. etli R. 1999a . Filum/Orden. 2003) (Tabla 6.

2008 Berge et al.Familia/ Género/Especie R. sullae R. oryzae R. 2008 Peng et al. 1999 Wei et al. lusitanum R.1 Continúa. de Lajudie et al. Chen et al. xinjiangense E. teranga E. 2008 Ren et al. 1988 de Lajudie et al. indigoferae R. 1994. multihospitium R. meliloti E. medicae E. kummerowiae E. arboris E. saheli E. 2003 Scholla & Elkan. 1996 Nick et al. fredii E. vignae R. 2002 Wei et al. 2006 Hunter et al. selenireducens R. tubonense Ensifer (Sinorhizobium) E. morelense E. 1999 Nick et al. loessense R. 1984. Chen et al. 2002 Wang et al. 2003 B acterias formadoras de nódulos en leguminosas 179 . 2009 Li et al. 1994 de Lajudie et al. 2009 Tian et al. 2008 Ramirez-Bahena et al. americanum Referencia Tan et al. 1984. kostiense E. mesosinicum R. tibeticum R. 2009 Lin et al. Filum/Orden. 2002 Wei et al. 2011 Zhang et al. 1926. daejeonense R. de Lajudie et al. alkalisoli R. 1994 Rome et al. 1988. 2007 Gu et al. 1994 Chen et al. 2001 Squartini et al. 2005 Valverde et al. 2003 Quan et al.Tabla 6. fabae R. Young. 2008 Han et al. 2009 Hou et al. 2002 Toledo et al. Jordan et al. yanglingense R. pisi R. 1988. miluonense R. alamii R. 2011 Dangeard.

1982. 1982. van Berkun et al. 1991. elkanii B. kummerowieae Bradyrhizobiaceae Bradyrhizobium B. 1984. japonicum B. Young. Young et al. adhaerens E. doebereinerae Phyllobacteriaceae Mesorhizobium M. (2010) Merabet et al. denitrificans** Xanthobacteraceae Azorhizobium A.Familia/Género/ Especie E. jicamae B.1 Continúa. chiapanecum E. 2009 Ramírez-Bahena et al.Tabla 6. numidicus Allorhizobium* A. liaoningense B. iriomotense Bradyrhizobium (Blastobacter) B. loti M. huakuii 180 Referencia Casida. 1984 Kuykendall et al. 2003. 1997 Manual de biología de suelos tropicales . 2001 Cummings et al. 2007 Rincon-Rosales et al. (2010) de Lajudie et al. 2003 Lloret et al. 2002. 2005a Ramírez-Bahena et al. Jarvis et al. Willems et al. garamanticus E. 1997 Chen et al. Jarvis et al. 2009 Islam et al.canariense B. 2009 Merabet et al. 2008 van Berkun & Eardly. 1992 Xu et al. 1998a. 1988 Moreira et al. pachyrhizi B. 2002 Vinuesa et al. 2006** Dreyfus et al. 2008 Jordan. Jarvis et al. mexicanus E. 1995 Yao et al. (Rhizobium) undicola Agrobacterium* A (Rhizobium). 2009 Lin et al. 2006 Jordan et al. caulinodans A. yuanmingense B. Filum/Orden.adiobacter/ tumefasciens Shinella S.

1995. temperatum M. 2007 Imran et al. 1997 De Lajudie et al. 2010 Rivas et al. 1997 Nour et al. 2005 Mantelin et al. nodulans Brucellaceae Ochrobactrum O. 1997 Chen et al. 2009 Vidal et al. amorphae M. 1999b Velásquez et al. tianshanense M.Tabla 6. 2008 Han et al. 2008 Han et al. 2007 Gu et al. 2001 Gao et al. chacoense M. septentrionale M. gobiense M. 1995. 2010 Valverde et al. shangrilense M. Jarvis et al. 2005 Zurdo-Pineiro et al. 2004 Trujillo et al. 2006 Sy et al. ifriqiyense*** P. albiziae M. 2009 Nandasena et al. neptuniea Referencia Nour et al. 2001. Jarvis et al. 2006 Mantelin et al. metallidurans M. 2009 Nandasena et al. Jarvis et al. lupini O. trifolii P. 2009 Chen et al. 2008 Li et al.alhagi Phyllobacterium P. mediterraneum M. 2003 B acterias formadoras de nódulos en leguminosas 181 . leguminum*** Methylobacteriaceae Methylobacterium M.Familia/Género/ Especie M. 1998b Wang et al. cytisi O. opportunistum M. ciceri Hyphomicrobiaceae Devosia D. plurifarium M. tarimense M. 2004 Gao et al. Filum/Orden. Jourand et al. 2002. ciceri M. 2004 Wang et al. caraganae M.1 Continúa. australicum M. 1994.

.Familia/Género/ Especie D. adiobacter). Vandamme & Conye 2004 Notas: * Se propuso incluir a las especies Agrobacterium como A.1 Continúa. 2001) y A. El alcance de la simbiosis con BFNFNL entre leguminosas queda todavía sujeta a investigación. 2006 Chen et al. yakushimensis β-Proteobacteria Orden Burkholderiales Burkolderiaceae Burkholderia **** B. dolosa (B. 2002 Vandamme et al. Filum/Orden.cepacia genomovar VI) B. (Ralstonia) taiwanensis ***** Referencia Bautista et al. 1999. únicamente el 57% del género y el 20% de las espe182 Manual de biología de suelos tropicales .. Vermis et al. larrimoorei (Young 2004) en Rhizobium. del trópico. pero descubrieron que pueden formar nódulos en leguminosas y la propusieron para que se incluyera en el género Bradyrhizobium. 2010 Moulin et al.. Las leguminosas contienen alrededor de 20 mil especies.Tabla 6. 2004) y más tarde del género Cupriavidus (Vandamme y Conye. Hasta 1989. 2001. 2002 Achouak et al. tuberum B. pero su capacidad de nodular no fue comprobada. Arubi y A. rhizogenes. Vandamme et al. sabie Cupriavidus (Ralstonia) C. en su mayoría herbáceas) (Lewis et al. 2004 Chen et al. A. mimosarum B. ** Estos autores no describieron estas especies. 2005). 2002 Vandamme et al. tumetaciens (syn. Mimosoideae (3270 spp. pero descubrieron que pueden formar nódulos en leguminosas ***** El género Wautersia (Vaneechoutte et al.. **** Estos autores no describieron el género. A.800 spp. caribensis B. 2007 Chen et al. plantas leñosas. subtrópico y zona templada) y Papilionoidae (13. phymatum B. nodosa B. distribuidas en las subfamilias Caesalpinoideae (2250 spp. vitis y (Young et al. *** Fueron aislados de nódulos. 2004) fueron propuestos para acomodar dichas especies de Ralstonia. 2002.. 2001 Vandamme et al. 2008 Chen et al. en su mayoría plantas tropicales leñosas).

Faria et al. Odee et al. Moreira et al.. en ecosistemas naturales (por ejemplo. El cultivo posterior y caracterización de BFNFNL y de los nódulos. 1992. de leguminosas hospederas.. en selvas tropicales). Para poder aislar o enumerar BFNFNL en una población microbiana diversa. muestran una B acterias formadoras de nódulos en leguminosas 183 . 2007). únicamente el 25% de las especies existentes han sido examinadas. en 1984 (véase Tabla 6. la taxonomía del BFNFNL estaba basada en cepas aisladas de cultivos de zonas templadas. Mimosoideae y Papilionoidae.. ha ocurrido una revolución en la taxonomía con 90 especies y 10 géneros adicionadas a las 4 especies y a los 2 géneros originales enlistados por Jordan. es posible que nuevas simbiosis se identifiquen en el futuro. tradicionalmente. se requiere de un método que separe claramente BFNFNL de otras especies bacterianas y que permita un muestreo fácil y sistemático de los nódulos. respectivamente (Faria et al... y que han sido desarrolladas nuevas técnicas de genética molecular. aunque este método puede resultar difícil en el caso de hospederas perennes o leñosas (Moreira et al. ahora que se encuentran disponibles las que han sido aisladas de otras especies y regiones. 2004) y Mesorhizobium thiogangeticum (Ghosh et al. Bradyrhizobium betae (Rivas et al. Tres especies de los géneros descritos de BFNFNL no fueron incluidas en la tabla porque no fueron aisladas de nódulos ni la capacidad de nodulación se comprobó hasta el momento: Rhizobium cellulosilyticum (García-Fraile et al.1).. 1992). El proceso de infección de la planta es el resultado de la formación de nódulos en sí.. para poder estimar la población de BFNFNL en el suelo. se estima que hoy en día. 1982.. Aunque se han llevado a cabo búsquedas extensivas para nuevos géneros y especies formadoras de nódulos. puede proveer información sobre la composición taxonómica de poblaciones de BFNFNL y determinar el grado de especificidad entre cepas específicas y candidatos hospederos. Aunque algunas plantas hospederas se consideran muy promiscuas. especialmente en Brasil (Magalhães et al. 90 y 97% entre Caesalpinoideae. Sin embargo. 2006) EVALUACIÓN DE DIVERSIDAD DE BFNFNL EN EL SUELO Los estudios sobre poblaciones y diversidad de BFNFNL dependen de un aislamiento exitoso de nódulos de raíces y ocasionalmente de tallos.cies habían sido examinadas por la formación de nódulos y los porcentajes de las especies que sí podían formar nódulos se encontraron en porcentajes de 23. y se esperan más revisiones en un futuro. 1995). 1989). De esta manera. los nódulos pueden muestrearse en plantas cultivadas en el campo (colecciones in situ). como la que surge en el suelo. 1989. por ejemplo..

2009). por Bradyrhizobium spp.baja especificidad. Para poder evaluar la diversidad de BFNFNL en el suelo. atropurpureum y que el frijol Phaseolus vulgaris. De manera similar. 2006 y 2008. 1966. también cabe la posibilidad de que sea nodulado por especies de rápido crecimiento como Rhizobium (Pereira. Resultados preliminares de Taita. entre otras (Moreira et al. 1987 demostraron que Vigna unguiculata. indican que M. por ejemplo: Macroptilium atropurpureum es uno de los hospederos ampliamente conocido (Vicent.. Lewin et al. normalmente considerada como hospedero de Badyrhizobium.. en la mayoría de los casos. Antes de escoger las plantas hospederas para realizar un bioensayo. Resultados obtenidos en Brasil (Alto río Solimões) muestran que caupí (Vigna unguiculata) captura más especies que M. ningún hospedero promiscuo puede ser nodulado por todas las especies o cepas existentes de BFNFNL y. 1997. cultivados en muestras de suelo tomadas del campo o inoculadas con suspensiones del suelo (Moreira et al... Odee et al. en Kenia. 184 Manual de biología de suelos tropicales . 1988a). aisladas e identificadas. Lima. más variedad resultará de cepas de BFNFNL. únicamente. con los que se muestrea con el bioensayo. atropurpureum fue nodulado. se recomienda llevar a cabo experimentos preliminares para cada tipo de suelo. donde sea posible. pero. de hecho. Moreira. punto de referencia CSM-BGBD. Pereira.. 2007) y Burkholderia. 1970). Por lo anterior. 2000). acetileno a etileno (Dilworth. de crecimiento lento.. 2009). entre otros sustratos. y. debería incluirse una especie leguminosa nativa como trampa hospedera. de manera contraria.. la comparación de BFNFNL. de rápido crecimiento. El bioensayo para BFNFNL puede hacer uso de hospederos promiscuos. no existe ninguna cepa de BFNFNL que sea lo suficientemente promiscua como para nodular a todas las especies leguminosas. Aunque algunas de las asociaciones mencionadas pueden ser relativamente específicas. en la mayoría de los casos.. aisladas de nódulos formados de manera natural. es deseable hacer uso de una variedad de especies de plantas hospederas candidatas y cuantas más sean empleadas. Las especies encontradas posteriormente deberían compararse con las especies que forman nódulos en el lugar. siratro (Macroptilium atropurpureum) atrapa BFNFNL en los 98 puntos de muestreo del proyecto CSM-BGBD (Lima et al. 2002. tiene una especificidad muy baja y puede ser nodulada por Rhizobium spp. 2000. La nitrogenasa es la enzima responsable de la reducción del gas nitrógeno a amoniaco. También reduce. se reporta que suele estar nodulado por la especie Bradyrhizobium (Woomer et al.. 1993. representa una comprobación útil de la exactitud del procedimiento en el laboratorio. de manera natural. Lima et al.

1. como trampas para aislar las BFNFNL de las muestras del suelo. Bajo estas circunstancias. tal y como se describe a continuación. dado que la anatomía de los nódulos varía ampliamente en forma y en tamaño. con una solución nutritiva. cuyos seis pasos a seguir se muestran en la ilustración 3a hasta la 3f. se encuentran resumidos en la Figura 6. el personal que no posee la suficiente experiencia podrá confundirlos con estructuras no inducidas por BFNFNL. 1966). Es por ello que se emplea una única especie promiscua como trampa. Aunque el uso de ERA para obtener estimaciones cuantitativas de fijación de nitrógeno a la nutrición de la planta ha sido ampliamente discutido (Boddey. con esto se B acterias formadoras de nódulos en leguminosas 185 . Paso 2A: para el proyecto se utiliza el método convencional de uso de especies promiscuas. Esta reacción se utiliza como técnica para medir la actividad de la nitrogenasa. 1987). El ensayo también puede usarse para confirmar una nueva simbiosis de BFNFNL o en el caso de nódulos no usuales (Moreira et al. Cuando se llevan a cabo varios experimentos. resulta muy útil para la detección simple de fijadores de nitrógeno. Una descripción previa fue hecha por Moreira en 2004. el uso de especies múltiples no es viable con un gran número de puntos de referencia (por ejemplo 100). y estará limitado por el tiempo disponible y las facilidades que ofrezca el laboratorio. es que destaca por su gran sensibilidad y velocidad. Paso 1A: recoger muestras de suelo del campo.. METODOLOGÍA APLICADA EN EL PROYECTO CSM-BGBD: UNA REVISIÓN GENERAL Los pasos utilizados en la metodología para la caracterización de BFNFNL. 1992). Los nódulos sin actividad de la nitrogenasa pueden estar senescentes o ser inefectivos. sin embargo. 1987. La actividad de la nitrogenasa constituye una información invaluable porque en muchos casos es imposible verificar que los nódulos aún son efectivos y viables (color interior rojo). dentro de cámaras de crecimiento o invernadero. es barato y fácil de realizar aun en condiciones de campo. Por ejemplo. resulta idóneo Macroptilium atropurpureum (siratro). puesto que deben quedarse intactos para su aislamiento posterior o secarse cuando requieran ser almacenados durante un largo periodo. Giller. la gran ventaja de un ensayo de reducción de acetileno (ERA). ya que posee pequeñas semillas y resulta fácil de manipular bajo condiciones controladas en bolsas de plástico y jarras de Leonard.Schollhorn Burris. deben utilizarse semillas de la misma procedencia. aplicados en el proyecto CSM-BGBD. dado lo afanoso del procedimiento.

colectadas bajo condiciones asépticas Área de referencia /Uso del suelo/ Puntos de muestreo 1B. peso de materia seca y peso seco de planta (contenido N). con la muestra de suelo. Frijol (opcional) 4. c) 2 B. Captura de BFN. capturadas con suspensiones de suelo 1:1. capturando BFN: técnica de infección de planta: inoculación de especies promiscuas. Nota: 1A. b). Ensayo de reducción con acetileno (opcional) 3 B. Aislamiento de NLB de nódulos ** en YMA/79 con azul de bromotimol (Ilustración 3. peso seco de materia aérea de planta. Siratro* 2. Dos controles sin inoculación (con o sin mineral N) más un control con un tipo eficiente (Ilustración 3. (Ilustración 3. dos controles sin inoculación (con o sin mineral N). Origen del hospedero. 3A.Figura 6. f (ii). secuencia del gen (16S rRNA para todos los géneros. Caupí (opcional) 3.55% 1. eficiente. d) caracterización de cultivo 3 A. Claves de identificación de plantas. * Puede usarse para conteo NMP (opcional). Almacenaje en frascos con gel de sílice o CaCl2 4. 2e) 1C. representativos de grupos previos. 6. Nódulos de especies de plantas locales 5. Caracterización de cultivos (son necesarios los experimentos preliminares con suelo de selvas y cultivos de leguminosas para determinar el número de aislamientos requeridos para caracterizar las comunidades de simbiontes en su conjunto. contenido de N por planta (opcional). solución de nutriente de suelo o NaCl a 0. índices de diversidad. Capítulo 2). cuando se aprecian diferencias significativas entre tratamientos 4. Especies nativas (opcional) Bolsas de plástico (Ilustración 3. Bioensayos con aislados: verificación (postulados de Koch) y propiedades simbióticas (número de nódulos y peso seco de materia). 2A. en caso necesario. 12 muestras compuestas de suelo por punto. basados en una 186 Manual de biología de suelos tropicales . especialmente para Bradyrhizobium). otros genes. tales como dnaK. 2A. ** Algunos nódulos pueden guardarse en gel de sílice para su aislamiento. tamizar según características de cultivo y REP-PCR o perfiles de proteína (Ilustración 3.1 Evaluación de bacterias formadoras de nódulos en leguminosas. fijadoras de nitrógeno en diversos sistemas de uso de suelo. Jarra de Leonard. resumida en seis pasos. La eficiencia de poblaciones nativas es evaluada con la floración. Caracterización de aislados verificados. agar inclinado (Ilustración 3. 1A. Eficiencia de poblaciones nativas: número de nódulos. a). Doce muestras en cada punto de muestreo (véase esquema global CSM-BDBG. utilizando la técnica de infección de planta. más un control de una cepa conocida.

en el tamizado de la colección entera de aislamientos (para conseguir racimos) y elementos repetitivos extragénicos palindrómicos/secuencias de DNA (REP-PCR) (u otros métodos como perfiles de proteínas por electroforesis con SDS-PAFE/poliacrilamida gel puede ser complementario). incluyendo algunas especies nativas que. Después de las tres especies mencionadas (siratro. Bradyrhizobium. Las muestras de suelo en macetas pueden usarse únicamente cuando haya disponibilidad en los laboratorios y se deben seguir todas las técnicas asépticas normales de la microbiología. Incluye características de cultivos obtenidos en el paso número 4. las cuales se describen a continuación. basados en características de cultivo (si este es el caso) y/u otro método deben ser secuenciados para 16SrRNA y otros genes como dnaK (por ejemplo. aún dispersos. Cuando un equipo puede manejar más de una trampa de especies. debido a diferentes relaciones simbióticas (diferentes especies de plantas) y condiciones ambientales. Dada la complejidad del primer ejercicio. otros factores limitantes como deficiencias de macro y micronutrientes. incluso puede indi- curva de extinción de especies). aunque también se puede aplicar a otros géneros). Paso 3 A: aunque la eficiencia bajo condiciones controladas no refleja lo que está pasando in situ. B acterias formadoras de nódulos en leguminosas 187 . caupí y frijol) se pueden seleccionar otras. Las especies-trampas pueden usarse para capturar y contar BFNFNL o simplemente para capturarlas. Las dos especies fueron escogidas por ser bastante promiscuas y porque se cultivan en muchos países. ni forma parte de la metodología estándar. por supuesto. Representantes de racimos. Para poder capturar BFNFNL. es fácil de medir y proporciona información útil sobre la variabilidad y eficiencia de las poblaciones nativas. pueden cultivarse especiestrampas en bolsas de plástico. deberán corregirse para los ensayos. sobre poblaciones de BFNFNL donde se utiliza el frijol común como especie-trampa. pueden ser diferentes en cada país. jarras de Leonard o en macetas que contengan las muestras de suelo. aunque sería imposible estandarizar esta selección. éste no es obligatorio. Los suelos con un alto contenido de N deberán evitarse. esto puede servir como un punto de referencia. Se selecciona Phaseolus vulgaris con base en que en varios países existen datos. para trampas promiscuas adicionales se recomienda usar Vigna unguiculata (como segunda especie) y Phaseolus vulgaris (frijol) como tercera especie. Las semillas que se encuentren disponibles en la localidad proveerán información útil para agricultores del lugar. acidez y un alto contenido de Al.evita cualquier variación de NFNLB debida a las plantas. El criterio para la selección debe basarse en que la especie-trampa sea ecológica y económicamente relevante para el país.

proporcionarán los datos de la diversidad. Paso 1B/2B. hará posible la mejor evaluación de diversidad y de eficiencia de la especie-trampa. es decir. los nódulos deberán muestrearse a partir de plantas que nodulen y representen niveles secuenciales de diluciones (Moreira y Pereira. Cuando se usa la técnica de infección por planta. y los de plantas. 2001) porque los tipos de BFNFNL capturadas pueden variar también con la dilución (Bala et al. 3B: se recomienda también que las BFNFNL sean aisladas de especies leguminosas (nativas e introducidas) que nodulan naturalmente. 2005). Las curvas de muestreo (acumulación o escasez) pueden revelar el número de aislados requeridos para evaluar correctamente la diversidad. Paso 1C: las especies de leguminosas en un área específica. Una comparación de BFNFNL aisladas de nódulos del campo y de nódulos introducidos en una especie-trampa. pertenecientes a los diferentes sistemas de uso de suelo en cuestión. se necesitarán más aislamientos para obtener una buena resolución. 188 Manual de biología de suelos tropicales . de ocho metros de radio alrededor de cada punto de muestreo. Paso 4: después de la aparición y crecimiento de nódulos. Se sabe que la diversidad genética en poblaciones naturales de las NFNLB del mismo lugar puede presentar diferencias entre los aislados de nódulos. 2001).. tal y como se explicó anteriormente. y quizá más de 100 por uso del suelo (Jesús et al. 2001). de esta forma estarán disponibles para futuros aislamientos. las BFNFNL deben ser aisladas. deben ser inventariadas para que las relaciones con poblaciones naturales de BFNFNL puedan determinarse. por lo menos. los aislados de estos nódulos. con una inoculación de suspensiones de suelo. Este número se encuentra en el punto (asíntota) donde la curva alcanza su mayor nivel.car la existencia de cepas eficientes en las poblaciones del suelo. en caso de no alcanzarlo. junto con los de nódulos recogidos de plantas nativas que naturalmente forman nódulos. cultivadas en una serie de diluciones de suelo. en condiciones de laboratorio (Bala et al. para una especie hospedera en particular. formados en el campo. esto indica que no se han detectado todas las especies y que muestras adicionales (aisladas de nódulos) deberán ser analizadas.. Los nódulos se almacenan en sílica gel (Figura 6. Se necesitará aplicar las curvas de muestreo a todos los aislados. se necesitan entre 30 y 50 nódulos.2).. a los del bioensayo y a los nódulos colectados en campo. lo que permite la construcción de curvas de muestreo para evaluar si la diversidad en un lugar ya ha sido completamente caracterizada. Considerando que estas curvas se obtienen con base en el número de diferentes cultivos que todavía pueden mostrar características genéticas variables. En la literatura se ha discutido que. en los diferentes sistemas de uso de suelo. por ejemplo.

El aislamiento de BFNFNL de nódulos deberá hacerse en el medio 79 con azul de bromotimol (Fred y Waksman, 1928). El medio 79 se conoce también como YMA (Vincent, 1970) (anexo 6.1); esto permite la caracterización completa del cultivo (tasa de crecimiento, cambio de pH, producción de exo-polisacáridos, morfología de colonia, color, tamaño, etc.). Para obtener grupos a partir de estas características de cultivo. La diversidad genética de poblaciones de BFNFNL puede evaluarse al agrupar los perfiles que resultan de rep-PCR, utilizando un software como Gelcompar (Brujin et al., 1997) o mediante el uso de otra técnica: perfiles de proteínas por electroforesis con gel de SDS-Poliacrilamida; que dan una buena resolución a nivel cepa (Paso 6); sin embargo, esto puede ser opcional, de acuerdo con los recursos disponibles en cada país y debe llevarse a cabo después del paso 5 para evitar perder el tiempo con contaminantes. Finalmente, los representantes de cultivos de los clados generados mediante el agrupamiento por Rep-PCR u obtenidos mediante otros métodos se secuenciarán para obtener el gen 16SrRNA (Paso 6). Cuando existen recursos suficientes, dnaK u otros genes involucrados en el mantenimiento de la bacteria, tales como atpD, rpoB, recA, glnII (Parker, 2004; Vinuesa et al., 2005b; Gaunt et al., 2001), pueden ser probados para algunas cepas de género que no hayan sido bien discriminadas por 16 SrRNA, como en el caso de Bradyrhizobium.
Figura 6.2 Trabajo de campo: a) toma de muestras de gas del ensayo de nitrogenasa por reducción de acetileno y b) almacenaje de nódulos hasta su aislamiento en el laboratorio. Fuente: Moreira y Pereira, 2001.
1 ml de C2H2 Muestra de gas Tapón de goma (a) Vial (10 ml) 30 minutos a 1 hora Tapón de goma Tubo al vacío

Nódulo Nódulo efectivo Nase C2H2+2H++2e 2C2H4 Tubo de ensayo 8.5 ml (b)

Tapón de rosca Tapón de rosca, nódulo, algodón y sílica gel o CaCl2

B acterias

formadoras de nódulos en leguminosas

189

REQUERIMIENTO DE MATERIALES PARA TRABAJO DE CAMPO Y LABORATORIO Trabajo de campo: para muestrear suelo: alcohol al 95%, agua para eliminar el suelo del equipo de muestreo antes de la esterilización con alcohol, caja refrigeradora, bolsas de plástico esterilizadas (300 ml), espátula, bolsas grandes de plástico (5 l) y un pequeño sacabocados. Para muestrear nódulos: tijera pequeña, cuchara, azada y azadón, pinzas, pala, tubos de tapón de rosca, sílica gel o CaCl2 anhidro. Para resguardo de plantas: alcohol, prensa y periódico. Trabajo de laboratorio para aislar y enumerar BFNFNL: pipetas de 1 ml y 5 ml, solución para dilución, matraces Erlenmeyer de 1 L y 125 ml, agitador orbital, bolsas esterilizadas de plástico (125 ml) para crecimiento, tubos de ensayo (150 x 20 ml ó 200 x 30 mm), o botellas de cerveza recicladas, rejillas para bolsas de crecimiento o tubos, solución de nutrientes, semillas de plantas leguminosas hospederas promiscuas o nativas, temperatura ambiente controlada de luz y humedad. Trabajo de laboratorio para aislamiento de BFNFNL y caracterización de cultivos: cajas Petri, alcohol al 95%, HgCl2 al 0.1% (acidificado con HCl concentrado a 5ml/L) (Hipoclorito de Na o Ca; puede usarse H2O2 para sustituir al HgCl2), agua esterilizada, pinzas, medio de cultivo que contiene levaduras, manitol y sales minerales (hipoclorito de sodio o calcio, o H2O2 (pueden sustituir al HgCl2), agua esterilizada, pinzas, medio de agar con sales, levadura-manitol-mineral, pH6.8. Para la actividad de nitrogenasa mediante reducción de acetileno: matraces Kitasato Erlenmeyer, globo de hule, jeringas de 1 ml a prueba de gas, tubos de vacío de 5 ml, frascos de 10 ml o de mayor capacidad con tapones de goma, carburo de calcio CaC2, cromatógrafo de gases equipado con un detector de ionización de flama (FID) y columna RN Poropak para determinaciones de acetileno/etileno. Nota: los ensayos de nitrogenasa pueden llevarse a cabo en campo. MÉTODOS DETALLADOS Muestreo del suelo. Se saca una muestra de suelo a una profundidad de 20 cm, en 12 puntos, distribuidos alrededor de cada parcela de muestreo (véase Capítulo 2, Figura 2.3). Se utiliza el mismo esquema de extracción del núcleo para el muestreo en todos los grupos microbianos, incluyendo el BFNFNL. Se junta cada juego de 12 muestras, para formar una muestra compuesta de alrededor de 300 g que, posteriormente, se introduce en una bolsa plástica esterilizada. De manera alter190
Manual de biología de suelos tropicales

nativa, cuando lo permitan los recursos, se pueden obtener tres o más muestras compuestas en cada punto. Todas las herramientas: sacabocados, espátulas, azadón, etc. deberán lavarse muy bien con agua para remover partículas de suelo y ser esterilizadas mediante alcohol y flama antes y después de cada muestreo, con el fin de evitar la introducción de BFNFNL exóticas. Se deben minimizar las pisadas cerca de los puntos de extracción y la hojarasca deberá ser removida justo antes de que se lleve a cabo el muestreo. Las muestras de suelo se trasladan al laboratorio lo antes posible, utilizando un envase con aislamiento (preferiblemente debe permanecer a 4° C). Una segunda muestra compuesta de alrededor de 200 g será recogida en una bolsa de plástico no estéril para su análisis físico-químico. Muestreo de nódulos. Se deberán identificar plantas leguminosas dentro de un radio de 8 m (lo mismo que para un inventario de vegetación) en el punto de muestreo y se recogerá el material vegetal resultante. Será de gran ayuda contar con información previa acerca de cuáles son las especies que pueden nodular, de manera que se confine el muestreo a estas especies en concreto; sin embargo, hay que aclarar que existe un enorme potencial para el descubrimiento de nuevas especies de leguminosas de este tipo. En el caso de plantas herbáceas, se puede extraer todo el sistema de raíces del suelo, utilizando una azada, un azadón o una pala, cuidando no romper nódulos de manera accidental. Los nódulos de plantas leñosas deberán descubrirse extrayendo las raíces y poniendo gran atención para no dañar las ramificaciones delgadas en donde éstos normalmente se encuentran. Se debe verificar, con extremo cuidado, que las raíces delgadas pertenezcan a la planta leguminosa identificada; por este motivo, se recomienda empezar la excavación junto al tallo; se extirpan los nódulos (dejando un pedazo de raíz para facilitar la manipulación) y se guardan en tubos de tapón de rosca con un desecador (Figura 6.2b). Antes del almacenaje, las partículas de suelo deberán removerse, bien por sacudido o bien mediante lavado, retirando el exceso de agua con una servilleta. Por lo menos se recogerán 50 nódulos por cada punto de muestreo y la muestra será representativa de todas las especies nodulantes existentes en la parcela de muestreo. En ocasiones, algunos nódulos pueden ser demasiado grandes para los tubos normales de rosca: deberán ser almacenados en un recipiente de mayor capacidad. Actividad nitrogenasa. La actividad de nitrogenasa puede medirse en el campo o a partir de cada nódulo, justo después del muestreo o en el laboratorio (Figura 6.2). Se introduce el nódulo en un frasco de tapa de goma de 10 ml o de mayor capacidad, en caso necesario. Se produce acetileno en un matraz Kitasato Erlenmeyer
B acterias
formadoras de nódulos en leguminosas

191

por la reacción de CaC2 con agua (Figura 6.3). Si se lleva a cabo el trabajo en laboratorio, se obtiene acetileno de cilindros de gas comerciales. Se inyecta 1 ml de este gas en el frasco que contiene el nódulo. Después de una hora aproximadamente, se remueve 1 ml de gas de la superficie y se transfiere a un tubo al vacío para su posterior análisis de etileno por cromatografía de gases (Figura 6.2a). Especímenes de resguardos de plantas. Los especímenes de resguardos de plantas nodulantes, deberán recogerse en el área que se encuentra alrededor del punto de muestreo (radio de 8 m). Se debe poner especial atención en el etiquetado (véase a continuación) y si es posible, incluya flores y frutas. Enseguida, los especímenes se mandan al herbario para su identificación junto con una tarjeta de identificación de las mismas: Proyecto: CSM-BGBD Colector: Fátima Moreira Fecha: 2 de abril de 2005 Localidad: Benjamin Constant Altitud: 500 m Nombre vulgar de la especie: faveira Nombre científico de la especie: ¿? Número de vale: 05 Características del nódulo: crecimiento medio, tamaño 0.5 a 1.5 cm Descripción del lugar: pastizales abiertos con ganado y troncos de madera Tipo de suelo: limo arenoso
Figura 6.3 Producción de acetileno en campo o laboratorio.
Agua Globo de hule CaH2

Tubo de goma

CaC2

CaC2 + H2O ⇒ C2H2 + Ca (OH)2 Sólido Gas Sólido

192

Manual de biología de suelos tropicales

Características de la planta: herbácea con frutos maduros Otros comentarios: se recogieron semillas; flores amarillas. El conteo de BFNFNL. Se someten muestras de suelo a una serie de diluciones antes de la inoculación de las plantas hospederas candidatas (Figura 6.4). La correlación de diluciones varía entre 2.0 (1:2) y 14.5 (1:14.5), según la concentración de células esperada en la muestra. Esto significa una mayor dilución para suelos con más BFNFNL; sin embargo, aún es necesario inocular plantas hospederas en todas sus diluciones (véase a continuación). Asimismo, en cada dilución se debe emplear una réplica del bioensayo (2 a 5 veces). Las plantas se cultivan en condiciones controladas (Vicent, 1970) y después de 15 días, se les examina para ver si han formado nódulos. Las poblaciones de BFNFNL se estiman por el método del Número más Probable (Cochran 1950; Woomer et al., 1988b, 1999). En el caso de inocular las plantas únicamente para capturar las BFNFNL, las muestras de suelo deberán resuspenderse en agua esterilizada o en una solución de nutrientes (la misma que se utiliza para un medio de cultivo o crecimiento de plantas) (véase anexo 6.1 y 6.2) en una correspondencia 1:1. Las plantas pueden cultivarse en bolsas de plástico, jarras de Leonard u otro tipo de frasco. Se deben utilizar tres tipos de controles sin inoculante de suelo: el primero comprueba la presencia de contaminación durante los procedimientos experimentales. Si no se mantienen de manera correcta las condiciones axénicas, este control resultará en nódulos y el experimento se invalidará (aún cuando nódulos ocurren en una sola réplica). Se recomienda que el número de réplicas dentro de este control sea mayor que las réplicas de tratamientos de inoculación y el control debe localizarse dentro de diferentes posiciones en el protocolo. Los otros dos controles permitirán comprobar la eficiencia de las comunidades de BFN. Las comunidades que nodulan la planta hospedera indican si las condiciones del experimento (temperatura, concentraciones de nutrientes) son adecuadas para que se lleven a cabo la nodulación y la fijación de nitrógeno en las plantas y su crecimiento. El primero de los controles se complementa con nitrógeno mineral (para jarras de Leonard, 70 mg N-NH4NO3) cada semana desde la tercera hasta la penúltima, pero no se inocula. Para bolsas de plástico o recipientes de pequeños volúmenes, se utiliza una sola aplicación de 70 mg N-NH4NO3). De esta manera el caupí, que alcanza su nivel de floración en dos meses, con el uso de jarras de Leonard recibirán un total de 350 mg N-NH4NO3, mientras que los frijoles con un periodo de crecimiento de mes y medio, en jarras de Leonard, recibirán 280 mg de N-NH4NO3. El otro control se inoculará con un inoculante recomendado para esta
B acterias
formadoras de nódulos en leguminosas

193

especie de planta; por ejemplo, CIAT 899 para Phaseolus vulgaris en Brasil, pero no se añade nitrógeno. Aislamiento y caracterización de BFNFNL. Las BFNFNL son aisladas de los nódulos recogidos en campo y por bioensayo en el laboratorio. En el último caso, los nódulos obtenidos en cada dilución sucesiva pueden indicar cuáles son las cepas menos frecuentes en la muestra de suelo y cuáles, las más comunes. El primer paso será esterilizar la superficie de los nódulos con una breve inmersión en 95% de alcohol, seguida de una inmersión más larga de tres a cuatro minutos en HgCl2 (hipoclorito de Na o Ca, o H2O2 pueden usarse como sustitutos) y lavado mediante varios enjuagues con agua estéril (Vicent, 1970). A continuación se aplasta el nódulo dentro de unas gotas de agua estéril, utilizando pinzas y esto se vierte sobre un medio de agar. En el caso de los nódulos disecados, éstos deben remojarse en una solución de agua esterilizada para mejorar la absorción de la solución desinfectante. Los tiempos de inmersión en HgCl2 u otros desinfectantes, deberían ajustarse al tamaño del nódulo (más corto para nódulos pequeños). En la composición del medio de agar: levadura-manitol-sales minerales (Fred y Waksman, 1928) (Anexo 6.1), especialmente el pH y la fuente de carbohidrato pueden variarse, tomando en cuenta las condiciones específicas del suelo (Date y Halliday, 1979; Souza et al., 1984; Elkan y Bunn, 1991). Puede incluirse azul de bromotimol como indicador porque los cambios en el pH, causados por la formación de BFNFNL, pueden resultar útiles en la identificación de género. Otros caracteres incluyen: la tasa de crecimiento (tiempo TAIC de aparición de colonias aisladas), la cantidad de polisacáridos celulares, forma y tamaño de colonia, diámetro y color según lo descrito por Moreira et al. (1993) y Jesús et al. (2005). Los principales descriptores de cada género son: Allorhizobium, Rhizobium y Sinorhizobium: colonias circulares, de 2 a 4 mm de diámetro, normalmente unidas debido a la copiosa producción de polisacáridos extracelulares, convexas, semitraslúcidas, elevadas y mucilaginosas, la mayoría con el centro de color amarillo (debido al indicador de pH), de crecimiento rápido (TAIC: de 2 a 3 días). Mesorhizobium: igual que Rhizobium, pero normalmente de crecimiento más lento (TAIC: de 4 a 5 días). Bradyhizobium: colonias circulares que no exceden de un milímetro de diámetro, producción extracelular de polisacáridos de abundante a escasa (esto último, generalmente en el caso de los tipos que toman más de diez días para su crecimiento), opacas, raramente traslúcidas, blancas y convexas, granulares en textura y que producen un cambio de pH a alcalino, de crecimiento lento o muy lento (TAIC: de 6 a más días).
194
Manual de biología de suelos tropicales

Figura 6.4 Método para calcular el número más probable de células de rhizobia en el suelo mediante la técnica de infección de plantas.

Paso de dilución

Nivel de dilución

El porcentaje base de la dilución (Nd) puede variar de 1:2 hasta 1:14.5 y el numero de replicas por dilución (N) de 2 a 5. Fuente: adaptado de Woomer, 1993 y Vincent, 1970 por Moreira y Pereira, 2001.
B acterias
formadoras de nódulos en leguminosas

195

de color cremoso. 1988..5 mm de diámetro. por lo tanto. (1991) aportaron estándares mínimos para la descripción de nuevos géneros y especies. Burkholderia: con características de crecimiento muy similares a las de crecimiento rápido. 1989). se han descrito nuevas técnicas para la caracterización de los procariotes. de 0. crecimiento en diferentes fuentes de carbono (Dreyfus et al. dentro de la especie puede ser genéticamente y fenotípicamente alta. muy poca producción extracelular de polisacáridos (mucho menos que en el caso de Bradyhizobium). a veces. en sus características simbióticas. resistencia intrínseca a los antibióticos (RIA) (Kingsley y Bohlool. generalmente. bajo condiciones bacteriológicas controladas. lo que puede ser muy útil para numerosos estudios. también conocidas como huellas 196 Manual de biología de suelos tropicales . hibridación rRNA-DNA y polimorfismos en los tamaños de fragmentos de restricción del DNA. morfológicas y fisiológicas. con un poco más de producción extracelular de polisacáridos. electroforesis de enzimas metabólicas (Selander et al. con la excepción de modificación de pH porque pueden producir una reacción ácida o alcalina (dependiendo de la edad). Estas técnicas. por ejemplo Rhizobium. mediante una demostración en la que formen nuevos nódulos en una planta hospedera de prueba. Recientemente. 1988). lo que mejora no sólo la clasificación bacteriana. Las BFNFNL son bastoncillos Gram negativos que no forman esporas y que...1 se pueden observar referencias que ofrecen amplios detalles de las características de especies de NFNLB. secuencia de la subunidad pequeña del RNA ribosomal (Young y Haukka... producen un cambio de pH a alcalino. por ejemplo. donde incluyeron serología (Dudman y Belbin. al mismo tiempo. será necesario definir el nivel apropiado de diversidad que permita caracterizar géneros y especies específicos. Las cepas aisladas deben reconfirmarse como BFNFNL. contienen gránulos refráctiles de poly-β-hidroxibutirato en microscopio de contraste de fases. La diversidad de cepas. de acuerdo con los postulados de Koch.Azorhizobium: colonias circulares. patrones totales de proteína por SDS-PAGE (Dreyfus et al. Moreira et al. 1986). lipopolisacáridos celulares (De Maagd et al. 1988). composición de bases de DNA (%C + G). Cupriavidus: similar a Azorhizobium. sino también la capacidad de discriminación dentro de diferentes taxas: cada una tiene un nivel específico de resolución para la clasificación bacteriana. de crecimiento rápido a medio (TAIC: de 3 a 4 días). 1993). perfiles de plásmidos (Giller et al. 1996). En la Tabla 6. hibridación DNA:DNA.. 1988). 1983). Graham et al..

El número total de placas de 96 muestras cuesta alrededor de US $350 para la secuenciación.. la purificación y secuenciación de un fragmento de genes (una muestra) ya amplificada por PCR. incluyen: la digestión de DNA genómico con endonucleasas que cortan sitios (de restricción) poco frecuentes seguido por PFGE (Electroforesis en Gel en Campos Pulsados) y otros métodos de RFLP. en la actualidad.genómicas. tales como ARDRA (Análisis de Restricción del rDNA Amplificado). la secuenciación directa de 16S rARN u otros genes puede ofrecer ventajas económicas. RAPD (DNA polimórfico amplificado al azar): AP-PCR (PCR Con Arimers Arbitrarios). normalmente. Alternativamente. AFLP (Polimorfismo de Tamaño de Fragmentos Amplificados) para el análisis de todo el genoma. por otro lado. REP-PCR (Huellas Genómicas de Elementos Genómicos Repetidos de DNA. la secuenciación de genes específicos puede aplicarse directamente a un número de cepas determinado por las curvas de rarefacción o acumulación.) (Rademaker y Bruijn. deben tomarse en cuenta. Extracción de DNA: el DNA genómico es aislado de cultivos de fases log en 79/YMA durante diferentes periodos de incubación. si existe disponibilidad de recursos. 1997. Empresas privadas dan buenos servicios para productos PCR y su purificación y secuenciación. Los costos y beneficios de una caracterización previa y secuenciación de representantes versus una secuenciación directa de un número mayor de aislados. homología DNA:DNA) requiere de mucho tiempo y de equipo especializado y. puede costar alrededor de US $6. Se pueden utilizar el kit “Ultraclean” para el aislamiento de DNA de suelo de los laboratorios MOBIO o cualquier otro kit recomendado por el productor. si se piden las placas completas de 96 muestras. Los análisis numéricos con un número adecuado de cepas y la comparación con las cepas de BFNFNL permiten la caracterización de grandes poblaciones. Por ejemplo. Se cuantifica el DNA a A260 nm con un espectrofotómetro o se estima por comparación con diferentes estándares de concentraciones de DNA en geles de agarosa. Los métodos basados en la reacción de Polimerasa en Cadena (PCR). Bruijn et al. para cada tipo se suspende una azada con bacterias de una colonia aislada en 1 ml de agua B acterias formadoras de nódulos en leguminosas 197 . en algunos casos. La caracterización genética de DNA (secuencia del 16S. 1997). 23S rARN u otras secuencias de genes. tRNA-PCR o ITS (Amplificación y Análisis del tRNA y de Regiones Intergénicas del 16S-23S rRNA). dependiendo de la tasa de crecimiento específica para cada cepa (de 2 a 10 días). Los costos de la secuenciación de DNA se han reducido notablemente durante los últimos años y. se restringe únicamente a representantes de grupos.

2. Secuenciación 16S rDNA. La extensión final se lleva a cabo a 72°C. 0. o bien. durante 40 segundos.cme.5 mm MgCl2. apareamiento a la temperatura de 55°C. El programa para PCR incluye un paso inicial: desnaturalizar a 94°C durante 5 minutos.ebi. 1990). usando los aislamientos representativos de diferentes grupos (obtenidos bien por caracterización de cultivo. 0. por otras técnicas). Se comparan las secuencias con otras conocidas contenidas en las bases de datos. pero también con el primer reverso 1492R.uk) y el Ribossomal Database Project (RDP) (http://rdp. MANTENIMIENTO Y COLECCIÓN DE CULTIVOS PUROS Normalmente.ncbi.. del gen 16S del RNA ribosomal de Escherichia coli (Wilson et al. seguido por 30 ciclos de desnaturalización a 94°C durante 40 segundos. con extensión a 72°C durante 90 segundos. Un paso de secuenciación del PCR amplificado se obtiene con el primer 27F. 198 Manual de biología de suelos tropicales .msu.2 mm de cada dNTP.2 μm de cada oligonucleótido y dos unidades de la enzima Taq polimerasa (DNA extraído o cultivos líquidos): 6 μl. Otros oligonucleótidos pueden utilizarse si permiten la síntesis de un gen 16S rARN casi completo. el European Bioinformatics Institute (EBI) secuenciación de base de datos (www.ac. la viabilidad de dichos cultivos no es larga: los métodos como liofilización y almacenaje en un congelador (–80°C) garantizan una larga conservación de las células viables. Sin embargo.esterilizada. Análisis filogenético. los cultivos puros se mantienen en agar inclinado dentro de tubos de tapa rosca en el mismo medio de cultivo. Cuando se requiere la secuencia de todo el gen se deben elegir otros primers internos y usarse para amplificar y secuenciar el fragmento del gen que falte después de utilizar 27F y 1492R.jsp). Estos pares de oligonucléotidos corresponden a posiciones 8-27 y 1507-1492. Los genes casi completos del 16S rDNA se amplifican con un par de oligonucleótidos 27F (pA: 5`AGAGTTTGATCCTGGCTCAG) y 1492R (5´GGTTACCTTGTTACGACTT). lo que produce una suspensión ligeramente turbia que posteriormente se hierve durante cinco minutos para lisar las células.nlm. perfiles REP-PCR. similares a los presentados en la Figura 6. tales como la del National Center for Biotechnology Information (NCBI) (www. Las concentraciones finales en las mezclas de reacción (100 ml) son: 1 x PCR Buffer. 2. durante 7 minutos.edu/index.nih. respectivamente. La purificación de los productos PCR se hace con filtros Microcon™ (Millipore) o mediante otros métodos de purificación. se utiliza un volumen de esta suspensión como templado para el PCR.gov/).

I. Sprent. from Phaseolus vulgaris nodules’. pp996–1006. Bautista. and Rhizobium giardinii sp. Elliot. vol 32... (1997) ‘Rhizobium gallicum sp.. J. M. N. Sprent. Roncato.W y Vandamme. y Vandamme.787-749. (2010) ´Devosia yakushimensis sp. pp. R. REFERENCIAS Achouak. E. A.. J. De Faria. New York.. y Yakta. pp627-632. B acterias formadoras de nódulos en leguminosas 199 . pp2174-2179. C. vol 16. y Hardy. Sheu. Y. Chou. nov..) Ohwi´ International Journal of Systematic and Evolutionary Microbiology vol 60.G.. A. G. W. R. vol 47. Amarger.... K.. (2001) ‘Genetic diversity of rhizobia varies from natural populations with the soil dilution sampled’. Murphy. James. T. Heulin. M. pp209–266.. L. Lodhi. pp841–843. M. J.P. Y. Bala.. C.. R. Berge. M. Burns. M. V. nov. International Journal of Systematic Bacteriology.. E.. G. W. W. T. Marlet. Macheret. Esperanza Martínez. Christen.V.. sp. International Journal of Systematic Bacteriology. C. P. J.. Elliot. P. G.H. V. (1982) ‘Ensifer adhaerens gen. Monsalud. I. Springer-Verlag.. K.. (1999) ‘Burkholderia caribensis sp. Young.. y Laguerre. y Achouak. Cnockaert.. F. isoled from root nodules of Pueraria lobata (Willd. E. S. Giller.. isolated from root nodules of Mimosa caesalpiniifolia´ International Journal of Systematic and Evolutionary Microbiology vol 58. O. (1987) ‘Methods for quantification of nitrogen fixation associated with Graminae’. S. vol 33.. Chen. De Faria. P. nov.. E. (2009) ´Rhizobium alamii sp. Casida Jr.. M. Brandelet. M. A. M. Santealla. an exopolysaccharide-producing bacterium isolated from vertisol microaggregates in Martinique‘. (1975) Nitrogen Fixation in Bacteria and Higher Plants. W. pp339–345. David Odee y Nancy Karanja.. Barakat..AGRADECIMIENTOS Agradecimientos especiales por sus comentarios y revisiones a los Drs.. R.. N.pp367-372. M. James. Lin. Chou. nov.. nov. W. R. G. K. an exopolysaccharide-producing species isolated from legume and non-legume rhizospheres´ International Journal of Systematic and Evolutionary Microbiology vol 59. Critical Reviews in Plant Sciences. Christien. K. N. y Heulint. nov.: A bacterial predator of bacteria in soil’.H. (2007)´ Burkholderia nodosa sp. nov.. J.. . Chen.... nov. nov. J. Boddey. (2008) ´Burkholderia sabiae sp.. Soil Biology and Biochemistry. S. Bontemps. International Journal of Systematic and Evolutionary Microbiology vol 49. R.

F. W.. A. (2009) ´Nodulation of Sebania species by Rhizobium (Agrobacterium) strain IRBG74 and other rhizobia´Environmental Microbiology. isolated from wild Alhagi sparsifolia in north-western China´. International Journal of Systematic Bacteriology. W.. Y.. pp392–397. Faria.P. P. Wang. Vos. L.. (2010) ´Mesorhizobium alhagi sp. W.. G.. vol 47. (1997) ‘Rhizobium hainanense sp. (1988) ‘Numerical taxonomic study of fast-growing soybean rhizobia and a proposal that Rhizobium fredii be assigned to Sinorhizobium gen. S. isolated from nodules of Mimosa species and sputum of a cystic fibrosis patient’. Zhu.. 6. from Taiwan and South America’.. X.. X. L.. Tan. Li. Bontemps.W y Wei. vol 57. vol 45. Andrews.K. International Journal of Systematic and Evolutionary Microbiology vol 51. pp1–275. Chou.. Z. T. Mergeay. W. Chen. T. Yuan. Young.. y Li. S.. E. pp870–873. nov. P. Young. vol 11. X. pp275–280. Laevens. Biometrics.. J. P.. T.. isolated from the root nodules of Astragalus sinicus’. J. W. Gyaneshwar. (1991) ‘Rhizobiumhuakuii sp. E. P. M. T. Humphry. H.M.G. Wang.M. W. y Vandamme. E. isolated from nodules of Mimosa spp. (1926) ‘Recherches sur les tubercles radicaux des légumineuses’. Farruggia.. Chen. nov. International Journal of Systematic and Evolutionary Microbiology. pp1847–1851. James. Chen. Y. Y. W. X. Dangeard. S.. D. vol 38. Wang. Yan.. J. y James. S. M. Coenye... Cochran.. Sprent. Chen.. Shen. Elliot.P. J. F. International Journal of Systematic Bacteriology.F.. E. Y. (2006) ‘Burkholderia mimosarum sp. D. pp2510-2525. L. y Li. S. Odee. L..W. Chen. y Li. Botaniste (Paris). M. M. N. Li. pp153–159. W.. International Journal of Systematic Bacteriology.. Qi. Lee. People’s Republic of China’. J. Chen. International Journal of Systematic and Evolutionary Microbiology vol 60 pp958962. H.. I. Li. Y. M.isolated from root nodules of the woody Brazilian legumes Mimosa bimucronata and Mimosa scabrella´ International Journal of Systematic Bacteriology... y Wang. pp1729–1735. vol 56. nov..T. Barrios.. vol 16. Coenye. a moderately and slowly growing root nodule bacterium isolated from an arid saline environment in Xinjiang. nov. vol 41. Sprent. P. nov. nov.’. Gao. (1995) ‘Characteristics of Rhizobium tianshanense sp. vol. pp10551059. 200 Manual de biología de suelos tropicales . E..P. G. Moreira... S. T. X. P. M. pp105-116. Cummings. y Vandamme. M.. Chen. (2001) ‘Ralstonia taiwanensis sp. K. International Journal of Systematic Bacteriology. G. nov.I. W. C. L..S. (1950) Estimation of bacterial densities by names of the “most probable number”. Viniesa. E.. J. isolated from tropical legumes’. J. J. G.. Chen.

F.. J. Collins. De Bruijn. C. J. E. A. Balows. Applied and Environmental Microbiology. International Journal of Systematic Bacteriology... pp1277–1290. vol 48.. International Journal of Systematic Bacteriology. D. (1988) ‘Recognition of individual strains of fast-growing rhizobia by using profiles of membrane proteins and lipopolysaccharides’. New York. Coopman.. Molouba. in A. J. in G.. M. Elkan. (1998a) ‘Allorhizobium undicola gen. A. Maestrojuan. Biochemica et Bioophysica Acta. Date. De Lajudie. Dworkin. Davey. P. isolation. A. B.. E. Dilworth. Ragatz. R.. G. vol 44. H. A. G. M. Willems. y Gilles. B. M. nov. Dreyfus. y Gillis. W. vol 127.. Millcamps. nitrogenfixing bacteria that efficiently nodulate Neptunia natans in Senegal’. and Sinorhizobium teranga sp. L. Neyra. pp715–733. Dordrecht. M. D. B... pp89–98. y Stoltzfus. sp. (1966) ‘Acetylene reduction by nitrogen fixing preparations of Clostridium pasteurianum’. Dudman.. J. sp. nov. vol 48. L. (1979) ‘Selecting Rhizobium for acid. A. R. Struffi. Journal of Bacteriology. J. y Halliday. D... Willems. Marcel Dekker Inc. van Rossum.. Moreira. Rademaker. McSpadden-Gardener. U.. in C.. Neyra. B acterias formadoras de nódulos en leguminosas 201 . A. K.Date.. L. a stem-nodulating nitrogen-fixing bacterium isolated from Sesbania rostrata’. G. Torck.. infertile soils of the tropics’. M.. De Maagd. y Belbin.. Truper (eds). M.. Dreyfus. K. vol 277. y Gillis. y Lugtenberg. F. that uses a qualitative coding of immunodiffusion reactions’. Elkan (ed) Symbiotic Nitrogen Fixation Technology... Kluwer Academic Publishers. J. F.. Elmerich. nov. y Gillis. y Halliday. cultivation and maintenance of rhizobia’ . nov. G. Nick. Laurent-Fulele. Newton (eds) Biological Nitrogen Fixation for the 21st Century. M. M. Kersters. pp3782–3785. B. R. (1997) ‘Molecular approaches in microbial ecology to assess genomic diversity and stress-induced gene expression in plantassociated diazotrophs’. The Prokaryotes. Kondorosi and W. B. Springer-Verlag. International Journal of Systematic Bacteriology. nov. J. M.. De Lajudie.. nov. W. (1987) ‘Collection. vol 170.. Schlegel and H. Torck. (1991) ‘The Rhizobia’. pp369–382. A. pp285–294. vol 38. M. pp62–64. Collins.. H. vol 54.. Dreyfus. De Lajudie.. C. M. M. Garcia. P. Schultz.. Hoste. U. L. Dewettinck. H. B. y Bunn. nov. R..’. P. F. (1988) ‘Characterization of Azorhizobium caulinodans gen. Kersters. pp1825–1830.. B. Collins... Sinorhizobium saheli sp. 2nd Edition. Berlin. K. Lindstrom. R.’. J. E.. International Journal of Systematic Bacteriology. D. nov. Nature. D. (1998b) ‘Characterization of tropical tree rhizobia and description of Mesorhizobium plurifarium sp. (1994) ‘Polyphasic taxonomy of rhizobia: Emendation of the genus Sinorhizobium and description of Sinorhizobium meliloti com. Willems. M. P.. A. (1988) ‘Numerical taxonomic analysis of some strains of Rhizobium spp. Dreyfus.. Pot.

. E. W. B. pp2003–2012. P.X. Wang. S. L. International Journal of Systematic Bacteriology. J. E. M. Martínez-Molina. Willems. L... Sadowsky.. Qiu. Sprent. nov. Kan. vol 21. pp783–784. J. (2008) Rhizobium miluonense sp. K. Giller. Han.. A. Mateos. T. 394–399. vol 51.T. W. Fred.. y Young. pp2037–2048. P.. K. New Phytologist.. Turner.. B. W. B. Young. Cooper. (2001) ‘Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia’. Z. y Chen. Keyser.. nov. International Journal of Systematicand Evolutionary Microbiology. S. pp 607–619. P.. J.. S. Barnet. E. Strijdom. y Waksman. A. y Velázquez. vol 19. International Journal of Systematic and Evolutionary Microbiology.. (2007) Rhizobium cellulosilyticum sp. R. C. A. pp 841–848. Tian. Y.F. W. pp 582–587.. de Ley. y Young. Rivas. vol 7.. P. P.F. vol 37. M. H. pp332–346. nov. (2006) ´Mesorhizobium thiogangeticum sp. Lindstrom. B. W. S. Rigottier-Gois... C. M. Gu. P. P. S. Wang.. Z... vol 56. Bradley. H. J. R.. nov. Terefework. J. X.H. International Journal of Systematic and Evolutionary Microbiology. M. (1989) ‘Occurrence of nodulation in the Leguminosae’.F. vol5. E.. Graham. Frank. Ghosh.P. A. isolated from Astragalus adsurgens growing in the northernregions of China’. E. Giller. International Journal of Systematic and Evolutionary Microbiology. Y. Chen.and stem-nodulating bacteria’. T. M. pp91-97. E. Sui. vol 41... W. B. (2004) ‘Mesorhizobium septentrionale sp.nov. and Mesorhizobium temperatum sp. Botanik Zeitung. Peix. isolated from sawdust of Populus alba’. S. I. vol 111. Lloyd-Macgilp. Gaunt.. R. Berichte der Deutschen Botanischem Gesellschaft. New York and London. W. K. y Hirsch.X. J. S. Jarvis.. F. (1928) Laboratory Manual of General Microbiology. Soil Biology and Biochemistry. E. (1889) ‘Ueber die Pilzsymbiose der Leguminosen’.T. Y.. E. J. P. L. Inc. L... vol 57. G. McGrath. (1987) ‘Use and abuse of the acetylene reduction assay for measurement of “associative” nitrogen fixation’. Roslycky. Soil Biology and Biochemistry. (1991) ‘Proposed minimum styards for the description of new genera and species of root. X. Gao. Frank. a symbiotic bacterium isolated from Lespedeza root 202 Manual de biología de suelos tropicales .. E. W. W. Martens.Faria. W. Lewis. R. H. Tan. J. y Sutherly. y Roy... a novel sulfur-oxidizing chemolithoautotroph from rhizosphere soil of an Indian tropical leguminous plant´. J.. pp376–387. Turner... (1989) ‘Absence of nitrogen fixation in clover grown on soil subject to long-term contamination with heavy metals is due to survival of only ineffective Rhizobium’. García-Fraile. B. D. McGraw-Hill Book Company. H.. y Chen. pp 844-848.. (1879) ‘Ueber die Parasiten in den Wurzelan-schwillungen der Papilionaceen’.. L.M.

T. pp2610-2618.F. A. M.. C. W. van Berkum.. W. Nakagaka. vol58. Han. Fernyez. W.X. Kuykendall.X.. K.’. D. pp2646-2653. (2009) ´Rhizobium tibeticum sp.J.. W.... Chen. Li. a new species of legume root nodule bacteria’. Imran. Biotechnol. Hafeez. vol 60: 1548 .pp3051-3057.J. Tian C.. J. International Journal of Systematic Bacteriology.. X.. Malik. X..Z..) Vassilcz´. Rhizobium ciceri. Y.F.. Nour. F. in China ‘. Y. B. P. R. C. Y..L.. E. Pankhurst. pp1416-1429. Yan. International Journal of Systematic and Evolutionary Microbiology. Biosci. and Mesorhizobium tarimense sp. F. International Journal of Systematic and Evolutionary Microbiology. pp1364-1368. China‘. M. T. y Chen. E. y Chen.X. y Moreira. Y. E.G. Han.vol 59. Wang. Han. J.R.. L. (1997) ‘Transfer of Rhizobium loti. Sui... J.. L. nov. L. International Journal of Systematic Bacteriology. Hou.. y Stackebrandt. W. Rhizobium mediterraneum and Rhizobium tianshanense to Mesorhizobium gen.. Jesus.. Chen. L.. E.X. vol 55. D. R.X.. P.. T.. Gu.T.C. e Seky. (2005) ‘Leguminosae nodulating bacteria diversity from three different land use B acterias formadoras de nódulos en leguminosas 203 . International Journal of Systematic and Evolutionary Microbiology.International Journal of Systematic and Evolutionary Microbiology. nov. Wang. Chen. nov.J. nov.I.T. S. B.B.F. T. W. Kawasaki. Y... Biochem vol 72. Wu. China‘. E. Florentino. A. Frühling. y Chen. W. y Manter D. (2008) Mesorhizobium gobiense sp.(2008) ‘Rhizobium multihospitium sp. M. B. isolated from wild legumes growing in desert soils of Xinjiang. Y. Muramatsu. nov.X.s. S. D. A. Schumann.J. nov.T. Chen. J. I. nov. Lu. Jarvis. pp1693-1699. C. nov. W.. y Chen. Wu. Jia.K. a novel rhizobial species nodulated with Caragana spp. isolated from nodules of Cicer arietinum´.H. X. nov. M. Zhang. Rhizobuim huakuii. A.. Jarvis.. W. W.G. Islam. International Journal of Systematic and Evolutionary Microbiology. pp455-460. vol 58.F. M. Guan...F. y Gillis. E.. Rodrigues. vol 32. Gao. International Journal of Systematic and Evolutionary Microbiology. X. P. Hunter... Wang. C. Wang. Mesorhizobium caraganae sp. (2008). Gu. Cleyet-Marel.. y Patel. pp378–380. vol58. (2008) ‘Bradyrhizobium iriomotense sp. Oliveira...nodules‘.1553.. J. W.... W. Gu. 895–898... vol 47.T. M.X. isolated from multiple legume species native of Xinjiang. a symbiotic bacterium isolated from Trigonella archiducis-nicolai (irj.: a selenite-reducing (alpha)-Protobacteria isolated from a bioreactor´Current Microbiology. Chen. H. M. (1982) ‘Rhizobium loti. Isolated from a Tumor-Like Root of the Legume Entada koshunensis from Iriomote Island in Japan‘. Dong. (2010)´Ochrobactrum ciceri sp. E.. S. (2007) ´ Rhizobium selenireducens so.H. L. vol 58.

NGR234 selected using the widely compatible legume Vigna unguiculata’. Li.Y. D. y Lock. Kingsley. B.. (1992) ‘Genetic diversity in Bradyrhizobium japonicum and a proposal for Bradyrhizobium elkanii sp.. F... A. pp518–526. Willems. X. J. Guan.F. L. vol 29.H. S.. Gillis. Plant Molecular Biology. L. Canadian Journal of Microbiology. pp447–459.. W. P.Y. Li. Kew. H. Meyer.. Han. R.. S. J. Chen. (Cicer arietinum L.. y Chen. Royal Botanic Gardens. y Udell.T. y de Lajudie... W.F.. Wong. He. Sy.. E. pp30123018. y Broughton.... (2005) Legumes of the world. a symbiotic bacterium isolated from root nodules of the herbal legume Kummerowia stipulacea ‘. Dénarie. Kuykendall. C. Y. isolated from Caragana intermedia growing in saline-alkaline soils in the north of China´.X.X. vol 59: 1919 . vol 8. M. vol 38. (2008) ´ Shinella kummerowiae sp. Jourand. Sui.. legume root-nodule-forming and nitrogen fixing bacteria’. immunodiffusion and intrinsic antibiotic resistance’. Jordan. B. A. A. Wang. D.H..... D. E. Wang E. T. nov..X..’. International Journal of Systematic and Evolutionary Microbiology.H. (1983) ‘Characterization of Rhizobium sp.T. 204 Manual de biología de suelos tropicales .. J. International Journal of Systematic and Evolutionary Microbiology.. y Chen.. B. W. Wang.X. Williams and Wilkins.X. in N. Schrire.. Lin. Giraud. Lin. (2009)´Rhizobium alkalisoli sp. L. Chen. pp501–505. M.) by immunofluorescence.X. C. Dowling.Q.Q. W. International Journal of Systematic and Evolutionary Microbiology. Saxena. y Chen. F. D. Canadian Journal of Microbiology. isolated from root nodules of three different legume´.R.F. International Journal of Systematic and Evolutionary Microbiology. H. Bena.L.. y Bohlool. Pesquisa agropecuária Brasileira. Hu.X. Sui. W. G. nov. for a group of aerobic facultatively methylotrophic. T.. W.systems in Brazilian Western Amazon’. M. (2004) ‘Methylobacterium nodulans sp. Nelson. Wang. Rosenberg. Wang E. G. pp2269–2273. B. B. Dreyfus. Lewis.. Hu. H. F... isolated from root nodules of Caragana species ‘. nov..T. International Journal of Systematic and Evolutionary Microbiology. vol 58. T. B. vol 59. (2009) ´ Mesorhizobium shangrilense sp. nov. (1987) ‘Multiple host-specificity loci of the broad host-range Rhizobium sp.L. Stanley. J. y Chen.T. pp769–776. vol 59. W. pp1409-1413. D. Mackinder... Devine. D. W. D. vol 54. L. D. vol 40. nov. Wang E. (2009)´Rhizobium mesosinicum sp. Manen. X. Tang. C. pp3006-3011. E.1923.nov. London. Krieg and J. Chen... N. P. Han. (1984) ‘Rhizobiaceae Conn 1938’. Lewin... Holt (eds) Bergey’s Manual of Systematic Bacteriology...

Kenya. A. (2007)´Ensifer mexicanus sp. nov´. C. Llorente.. F. (1989) ‘Rhizobium galegae.. International Journal of Systematic Bacteriology. P. pp827-839. Lima. International Journal of Systematic and Evolutionary Microbiology. L. (1991) ‘Rhizobium tropici. Rogel-Hernández. beans and Leucaena trees’.. y de Lajudie.. J. Barberi. M.S.R. Brasil. P. A. pp509-514. S.127-145... M. S. F. K. O. International Journal of Systematic Bacteriology. Merabet. Martínez-Romero. Bonneau. C.. vol 39. M.. Sy. a new species of legume root nodule bacteria’. and Phyllobacterium brassicacearum sp. J. G. Mars. E. (2007) ‘Densidade. Ferreira. eficiência e diversidade de bactérias fixadoras de N2 que nodulam o siratro (Macroptilium atropurpureum) de solos sob diferentes usos na Amazônia Ocidental’. M. a new species nodulating Phaseolus vulgaris L. Segovia. Jeder. H. vol 319. L. y Moreira. (2009) ´Nitrogen-fixing bacteria communities occurring in soils under different uses in the Western Amazon Region as indicated by nodulation of siratro (Macroptilium atropurpureum)´ Plant and Soil.Lima.A. M.M. y Döbereiner. A. Conservation and Sustainable Management of Below-ground Biodiversity CSM-BGBD. S. Silva. L. and Ensifer garamanticus sp.A. Rincon.. de Lajudie.. Lotus creticus. M. Graham.. F.S.. Magalhães. PP.. A.. Domergue..C. Mercante. pp280-290. Zakhia. PhD Thesis.M. Le Roux. Acta Amazônica.A. P. Moreira... Lindström.. Systematic and Applied Microbiology. J. Coopman. Nairobi. A. A. Minas Gerais.´.. nov. R. Annual meeting report 4. vol 41. International Journal of Systematic and Evolutionary Microbiology. F. Universidade Federal de Lavras. Magalhães. nov. nov.. K.. nov.F.. S. A. Béna. A. pp417– 426. F. B acterias formadoras de nódulos en leguminosas 205 . Nóbrega. Phyllobacterium ifriqiyense sp. Oliveira..M. Ormeno-Orrillo. Argyrolobium uniflorum and Medicago sativa (Tunisia) and description of Ensifer numidicus sp. a new specie nodulating Acacia angustissima (Mill. nov. y Martínez-Romero. D. L.674. Zakhia. Bekki. Willems. A.S. B. vol 12. vol 30.) Kuntze in Mexico.. E. (2006) ´Emended description of the genus Phyllobacterium and description of four novel species associated with plant roots: Phyllobacterium bourgognense sp. Franco. Fischer-Le Saux.. (2004) ‘Methodology for the inventory of nitrogen-fixing Leguminosae nodulating bacteria’.M. vol 60: 664 ... E. (2010) Multilocus sequence analysis of root nodule isolates from Lotus arabicus (Senegal). R. Phyllobacterium leguminum sp. Martínez-Romero. nov. y Pardo.S. F.. Martens. y Cleyet-Marel.. Mahdhi. vol 56. (1982) ´Ocurrência de nodulacão en leguminosas florestais notivas de terra firme da região de ManausAM´... M. pp365–367. Mantelin.

International Journal of Systematic and Evolutionary Microbiology. O. in F.) Pers. Swift and D. Martínez-Romero.. Systematic and Applied Microbiology. y Marsh.org/AG/agl/agll/soilbiod/docs/manual-soil%2)..Moreira. Willems. vol 49.. isolated from Biserrula pelecinus L.. (2009) Mesorhizobium australicum sp. y Lidstrom. vol 29. M.. Wallingford. M. M. J. 206 Manual de biología de suelos tropicales .. S. D. M.. in M. (2008) ‘Bactérias fixadoras de nitrogênio que nodulam Leguminosae’. A. M. nov. Editora. Pitard.. nov. X. A. F. Siqueira and L... pp2140-2147. S. Pedrosa. J. pp948–950. Zhang. Moulin. 768pp. Silva. Gillis. pp197–206. vol 411. S. S. and Mesorhizobium opportunistum sp. (1994) ‘Genotypic y phenotypic diversity of Rhizobium isolated from chickpea (Cicer arietnum L. S. (2006) ‘Azorhizobium doebereinerae sp. nov. vol 121. (2001) ‘Microsymbionts: rhizobia’. y Howieson. (1992) ‘Occurrence of nodulation in legume species in the Amazon region of Brazil’. L. M.. O. J.P.. Memorias da XXI Reunión Latinoamericana de rhizobiologia. L. Brussaard (eds) Biodiversidade do solo em ecossistemas brasileiros. UFLA. International Centre for Research in Agroforestry.. B. L. vol 40. S. M. Suomalainen.. Eardly. F. Tiwari. M. Moreira. P. Cruz.G. A. (2002) ‘Burkholderia spp. New Phytologist. Gillis. pp345–354. (1993) ‘Characterization of rhizobia isolated from different divergence groups of tropical Leguminosae by comparative polyacrylamide gel electrophoresis of their total proteins. F. isolated from leguminous trees in Sudan and Kenya’. A. Munive. K. Lavras. E. in F. S. Nandasena. (2006) ‘Nitrogen-fixing Leguminosae nodulating bacteria’. C. T. M. vol 59. M. Nature. F. Pot. M.W. J. Nick. Marsh... (1999) ‘Sinorhizobium arboris sp. (2001) ‘Nodulation of legumes by members of the b sub-class of Proteobacteri’. y Fernandez. México. K. y Bolvin-Masson. J. Paulin. Tiedje.. Bogor. Moreira. D.. microsymbiont of Sesbania virgata (Caz.. L. B. G. S. B. CAB International. O. Nour. are among fast growing symbiotic diazotrophs isolated from diverse land use systems in Amazônia and from Brazilian Leguminosae forest species’. Indonesia (available at http://fao. de Lajudie. pp1359–1368. K. T. F. M. S.. vol 16. R. Dreyfus. Moreira. y Young. C. F.. nov.nov. Moreira. G. E. S. F. y Pereira. S. y Faria. Cleyet-Marel. S. International Journal of Systematic Microbiology.G. Effosse. in Australia´. J.. S. F. Brussaard (eds) Soil Biodiversity in Amazonian and other Brazilian Ecosystems. Moreira. Bignell (eds) Standard Methods for Assessment of Soil Biodiversity and Land Use Practice. y Franco. Kersters. R. M. Moreira. M. Moreira. P.. Cocoyoacan.. 280pp. pp563–570. Canadian Journal of Microbiology. Faria. P. O’Hara.’. F. pp135–146. M.)’.. M. Siqueira and L... A. Moreira.. M. Beck. and Sinorhizobium kostiense sp. Systematic and Applied Microbiology. G. W.

. Quan. New York. W. E. vol 45. M. Li. Pereira. Camacho.. Sutherland.) and description of Rhizobium mediterraneum sp. D. Ramírez-Bahena. C. W. L.. pp2543–2549. Systematic and Applied Microbiology. D. Z. Universidade Federal de Lavras. leguminosarum. International Journal of Systematic and Evolutionary Microbiology.. Plant and Soil. M.. M. A..’.. (2008) ´Rhizobium oryzae sp. vol 55. F. J. W.H. Caetano-Anollés. vol 188. Rodríguez-Navarro. (1997) ‘Phenotypic characteristics and composition of rhizobia associated with woody legumes growing in diverse Kenyan conditions’. International Journal of Systematic and Evolutionary Microbiology.. A. G. W. Applications. isolated from effective nodules B acterias formadoras de nódulos en leguminosas 207 . M. P. Bae. Plant and Soil. and P.Nour. in G. E.. Peix.. y Sprent.N. R.. y de Bruijn. isolated from a cyanide treatment bioreactor’. T. Odee. Rivas.. pp334–342.nov. D. Cleyet-Marel. (2009)´ Bradyrhizobium pachyrhizi sp. McInroy. J. Brazil. Z.F. Im. nov. I.. M. Baek. J. Normy. E. Zhang.. nov. Martínez-Molina. Rhizobium phaseoli Dangeard 1926AL and Rhizobium trifolii Dangeard 1926AL. Odee.. (1995) ‘Natural rhizobial populations and nodulation status of woody legumes growing in diverse Kenyan conditions’. Reclassification of the strain R. Rademaker. nodule bacteria from four Papilionoid legume trees in Costa Rica’. (1997) ‘Characterization and classification of microbes by rep-PCR genomic fingerprinting and computer-assisted pattern analysis’. PhD Thesis. W. E. M. P.. Mateos.. García-Fraile. y Fernandez. (2005) ‘Rhizobium daejeonense sp. Sutherland. and Overviews. vol 27. isolated from the wild rice Oryza alta´. P. A.M.. J. E. (1995) ‘Genomic heterogeneity of strains nodulating chickpea (Cicer arietnum L. Makatiani. y Lee.H.. W. International Journal of Systematic and Evolutionary Microbiology. M. y Tan. Yuan. J. A. John Wiley and Sons Inc. J. y Velázquez. E. International Journal of Systematic Bacteriology. J. Rivas. P. (2008)´Revision of the taxonomic status of the species Rhizobium leguminosarum (Frank 1879) Frank 1889AL. S. Peix. Valverde. Peng. M. vol 58. Gresshoff (eds) DNA Markers: Protocols. S. R. J. (2004) ‘rRNA and dnaK relationships of Bradyrhizobium sp. H. Parker. Q. pp640–648... (2000) ‘Diversity of rhizobia isolated from different land use systems in Amazon region’. Igual.... pp2158-2163.F. and Bradyrhizobium jicamae sp. H. y Sprent. nov. Chen. I. A. nov. R.. P. G. Ramírez-Bahena. J. trifolii is a later synonym of R.. G. vol 173. pp211–224.. pp65–75. pp2484-2490. nov. Lavras. D. Willems. M. y Velázquez. Martínez-Molina.. M... vol 58. Mateos. leguminosarum DSM 30132 (=NCIMB 11478) as Rhizobium pisi sp. S. Kimiti..

Applied and Environmental Microbiology. G. pp5217-5222. E. including Sinorhizobium chiapanecum sp. E. Rivas. Normy. H.. FEMS Microbiology Ecology Vol 68.. R. vol 68. M.. Willems. F. y Burris. Proceedings of the Federation of American Societies for Experimental Biology.’.of Pachyrhizus erosus’.nov. pp873–884. pp255. F... Brunel.L. (2009)´ Rhizobia with different symbiotic efficiencies nodulate Acaciella angustissima in Mexico. Velázquez.. F. (1966) ‘Study of intermediates in nitrogen fixation’.X. y Elkan. Sui. J. K. vol 46.. pp580-586. T.. pp374–377. B. Scholla. an aquatic legume from India’.F. L. Selyer. Ponce. R.. García-Benavides.. nov.. Willems. M.. E. vol 59. vol 34.. E. M. M. Mateos.T. a fast-growing species that effectively nodulates soybeans’. D.... Mateos.. Musser... vol 24. S. Rincón-Rosales. pp1271-1275. R. L. vol 61. J. vol 51. J.. y Cleyet-Marel. R. R. International Journal of Systematic Bacteriology. y Martínez-Romero. A. y Whittam. M. that nodulates and fix nitrogen in symbiosis with Neptunia natans. vol 26. International Journal of Systematic and Evolutionary Microbiology. D. Caugant. Palomo. Dazzo. W. Martinez-Molina.. N. A.) Druce’.. N. 208 Manual de biología de suelos tropicales . (1993) ‘Reclassification of American Rhizobium leguminosarum biovar phaseoli type I strains as Rhizobium etli sp. (1996) ‘Sinorhizobium medicae sp.. D. F. E. Kroppenstedt. E. pp484–486. P. M. vol 54. H. Subba-Rao. H. R. nov. E. (2002) ‘A new species of Devosia that forms a unique nitrogen-fixing root-nodule symbiosis with the aquatic legume Neptunia natans (L. Rivas. D. International Journal of Systematic and Evolutionary Microbiology. P. Applied and Environmental Microbiology. y Velázquez.’..W. P.. S. Ochman. Young.F..... International Journal of Systematic Bacteriology.. J. A. y Martinez-Molina. y Martínez-Romero. P. (1984) ‘Rhizobium fredii sp. W. Martínez-Molina. H. M. nov. pp5217–5222. Vizcaíno. pp47–53. Mateos. (2003) ‘Description of Devosia neptuniae sp. y Vizcaíno. nov. pp972–980. Systematic and Applied Microbiology.H. Rome. X. a symbiotic bacterium isolated from multiple legume species´. N. vol 43. y Chen. R. Rivas. C.f. Fernadez. International Journal of Systematic Bacteriology. E. Llorente. N. P. which has common symbiotic genes with Sinorhizobium mexicanum´. Gillis.. Gilmour.. N.. p710 Segovia. Schollhorn. P. R. Wang.. (2011)´Rhizobium vignae sp. E.. nov. (2004) Bradyrhizobium betae sp. M. isolated from annual Medicago spp. W. P. Gillis. A. (1986) ‘Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics’. Chen. Gillis. Subba-Rao. Ren. isolated from roots of Beta vulgaris affected by tumour-like deformations´ International Journal of Systematic and Evolutionary Microbiology.. Dazzo. Willems. nov.

. E.. X.. pp214–220. (2001) ‘Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes’.. E. F. A. Kan. T. nov. Bao. pp1132–1136. P. Chen. Reinhold-Hurek. Velázquez.. s/n.. y Eardly. C.. G. y Chen. International Journal of Systematic and Evolutionary Microbiology‘. N. (2008) ‘Rhizobium favae sp. Mateos.. Y. H.F.. E. W. G. Abril... Selnska-Pobell.. A. International Journal of Systematic and Evolutionary Microbiology. y Nuti.Souza.. a bacterium that nodulates Vicia faba. M. vol 55. Gillis. International Journal of Systematic Bacteriology. Boivin-Masson. D. y Martínez-Molina.. (2006) ‘Rhizobium lusitanum sp..T. B. A. (2002) ‘The aquatic budding bacterium Blastobacter denitrificans is a nitrogen-fixing symbiont of Aeschinomene indica’. pp1267–1276. Dazzo. Fernández-Santos. Campbell. L. L.. Van Berkum.. G. P.. Lloret. F. Peix. Trujíllo... nov. E. International Journal of Systematic Bacteriology. B. Journal of Bacteriology. Matínez-Molina. Gu. W. Igual.. nov. I. R. Tian. A. M.. (2005) ‘Nodulation of Lupinus albus by strains of Ochrobactrum lupine sp. T. R. E.’. S. Van Berkum. Giacomini. Pesquisa Agropecuária Brasileira – Ediçao Especial 19. X.’. (1998) ‘Rhizobium mongolense sp. pp. S. P. (2001) ‘Rhizobium yanglingense sp. vol 56. E. is one of three rhizobial genotypes identified which nodulate and form B acterias formadoras de nódulos en leguminosas 209 . vol 51. P. y Chen. vol 68. Mateos. A.T. Planchuelo. (2005) ‘Phylobacterium trifolii sp. A. B. isolated from arid and semi-arid regions in China’... L. vol 183.. M. de Lajudie. Giraud.F. Tan.. Cervantes. A. Willems. M. (formely ‘Rhizobium hedysari’). Applied and Environmental Microbiology.nov. Wu. E.X. Vizcaíno. Han.. vol 26.M. 58: pp 2871-2875. nodulating Trifolium and Lupinus in Spanish soils’. A. E. J. P. y Martínez-Romero. y Oliveira. y Dreyfus.. F. Z. pp1985– 1989. F.. E. y Eardly. Beyene. P. Wang. Joury.J. E. Wang. pp54–64. P. Neyra.. Gu. M.G... Rivas. nov. Valverde. Velázquez. in Mexico’. a new Sinorhizobium species nodulating Acacia spp. M. Magalhaes. Y.. E. E. 2631-2637. nov. (1984) ‘Avaliaçao do crescimento de rhizobium de leguminosas florestais tropicais em diferentes meios do culura’. L.. Casella. Willens. A. A. P. F..G... nov.. A. y Mateos. F. Systematic and Applied Microbiology.nov. a bacterium that nodules Phaseolus vulgaris´. C. N.. Struffi. y Velazquez. Ludeña... the root-nodule microsymbiont of Hedysarum coronarium L. International Journal of Systematic and Evolutionary Microbiology. (2003) ‘Sinorhizobium americanum sp. Rivas. J. vol 52. pp901–914.. A. P. Prin.X. Applied and Environmental Microbiology. C. Tola. pp1318–1327. Vendramin.... B. (2002) ‘Rhizobium sullae sp. A. Sy. vol 71. B... W. D. Garcia. Valverde. Döring.. Squartini. Toledo. D. E.

(2004) ‘Wautersia gen. pp850-855.. and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al. W. M. (Aeschynomene indica) with Blastobacter denitricans and to transfer Blastobacter denitrificans (Hirsh and Muller. Igual. M. pp507–512. Léon-Barrios. Van Berkum.. A. J.. a new genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species. B. y Willems.. 1990) comb. a novel species that nodulates Prosopis alba in the Chaco Arido region (Argentina)’.. vol 54.. P. Nelis.. Willems. H. J. B.. (2001) ‘Mesorhizobium chacoense sp. pp689691.. y Vandamme. T. E.. T. J. de Vos. J. Willems. M. P. Jarabo-Lorenzo. International Journal of Systematic and Evolutionary Microbiology. Vincent. C. D. vol 29. Escarré. nov. vol 59. Vaneechoutte. vol 25. T. M. J.. vol 51. (2005a) ‘Bradyrhizobium canariense sp.J.’. Normy.. 1985) to the genus Bradyrhizobium as Bradyrhizobium denitrificans (comb. E. K. P. y CleyetMarel. C. E. Gillis. Berge. P. International Journal of Systematic and Evolutionary Microbiology. E. P. Mauré. Werner. nov. G. P. nodulate the roots of tropical legumes’. N. M.. Vermis. y Martinez-Molina. y Verschraegen.J. R. a metal-resistant symbiont of Anthyllis vulneraria growing on metallicolous soil in Languedoc. (1970) A Manual for the Practical Study of Root-Nodule Bacteria. D. O. y Martínez-Romero. Munoz. nov. Vidal. (2004) Proposal to accommodate Burkholderia cepacia genomovar VI as Burkholderia dolosa sp. Systematic and Applied Microbiology. Mateos.. International Journal of Systematic Bacteriology. International Journal of Systematic Bacteriology vol 54. J. A. A. Chen.... Béna..C. E. y Conye. L. Chantreuil.) Ledebour]’. Vandamme. nov... M. A. A... vol 48. Oxford. Brunel. (2006) ‘Proposal for combining Bradyrhizobium spp. Silva. P. E.. nov. LiPuma...)’. (2009)´Mesorhizobium metallidurans sp. Velazquez. Abril. Toro. nov. International Journal of Systematic and Evolutionary Microbiology. Pérez-Galdona. pp2285–2289. Goris. sp.. Leibold. F.. (2002) ‘Burkholderia tuberum sp. G. nov. Fernyez. France´. nov. pp207–215... M. P. pp1011–1021. nov. Blackwell Scientific Publications.nitrogen fixing symbioses with Medicago ruthenica [(L. J. Vandamme. de Baere. y Eardly. and Burkholderia phymatum sp. (2004) ‘Taxonomy of the genus Cupriavidus: A tale of lost and found’.. International Journal of Systematic and Evolutionary Microbiology. Mahenthiralingam. pp13–22.... Systematic and Applied Microbiology. an acid tolerant endosymbiont that nodulates endemic genistoid legumes 210 Manual de biología de suelos tropicales . Coenye. Vinuesa. Falsen.. Kamfer.-M. nov. P. Cervantes... M. C.. vol 54. P. pp317–327..

X. G. E. Cevallos.X. pp29–54. International Journal of Systematic and Evolutionary Microbiology. Han. Wang. International Journal of Systematic Bacteriology. X. J. nov.. F. Dorado... Sui.. nov. (2002) ‘Rhizobium indigoferae sp. G. Wei. H. pp1192-1199. vol 52. Wang. E. International Journal of Systematic Microbiology. Wang. E. nov. W. W. Sui. T. Vinuesa. y MartínezRomero. Beyene. A. T.. and Sinorhizobium kummerowieae sp. E. M. y Chen. vol 48. H. T. pp569–575.. (1999a) ‘Rhizobium etli bv.. A. pp51–65. M.. Q. T. Chen. vol 49. D. nov. P.. T. E. Chen. (2003) ‘Characterization of rhizobia isolated from legume species within the genera Astragalus and Lespedeza grown in Loess Plateau region of China and description of Rhizobium loessense sp. vol 53. Willems. M. X. pp687–699. pp1479–1491. T. y Martínez-Romero. Z. Wang. E. M. Wang. Silva. J. M. X. (2005b) ‘Population genetics and phylogentic inference in bacterial molecular systematics: The roles of migration and recombination in Bradyrhizobium species cohesion and delineation’. mimosae. Wei.. genistearum. vol 49.. E. Martínez-Romero. E.. X. Chen. vol 57..Q. (2007)´Mesorhizobium albiziae sp.. X. E.. International Journal of Systematic Bacteriology. O... B. Sui. vol 34. y Chen.T.. y MartínezRomero. H. y Martínez-Romero.(Papilionoideae:Genisteae) from Canary Islands. E.H.. Wang. y Chen. vol 55. a symbiont of Sesbania herbacea that has a close phylogenetic relationship with Rhizobium galegae’.. nov.. pp1575–1583 B acterias formadoras de nódulos en leguminosas 211 . E. pp1687–1693. P. Wang... E. Tan. Wang.. (1999b) ‘Diversity of rhizobia associated with Amorpha fruticosa isolated from Chinese soils and description of Mesorhizobium amorphae sp. along with Bradyrhizobium japonicum bv.. International Journal of Systematic and Evolutionary Microbiology. Liu. E. C. E. E. and Kummerowia stipulacea’. International Journal of Systematic and Evolutionary Microbiology. van Berkum... a novel bacterium that nodulates Albizia kalkora in a subtropical region of China´. Wang.. Rogel-Hernández... G. Beyene. T. y Martínez-Romero. vol 52. Y. Werner.. a Leucena leucocephala-associated bacterium that is highly resistant to multiple antibiotics’. nov.F. D. D. a novel biovar isolated from Mimosa affinis’. P.’. nov’. W. X.. W. Zhu. A. H. A.. (2002) ‘Sinorhizobium morelense sp. Fernández-López. van Berkum... W. Santos. W. Rinhold-Hurek. S. Zhu. pp2231–2239.. Molecular Phylogenetics and Evolution. E. (1998) ‘Rhizobium huautlense sp. Bradyrhizobium genospecies a and Bradyrhizobium genospecies b’. Chen. International Journal of Systematic Bacteriology. respectively isolated from Indigofera spp. Tan. International Journal of Systematic and Evolutionary Microbiology. Z.

C. K.. pp1207–1217. vol 28. Woomer. pp172–178. Wilson.. (2003) ‘Description of new Ensifer strains from nodules and proposal transfer Ensifer adhaerens Cassida 1982 to Sinorhizobium as Sinorhizobium adhaerens comb. y Fan. Agronomy Journal. pp706–711. W. (1995) ‘Bradyrhizobium liaoningense sp.. B.. M.. H. M. Kan. C. vol 54 pp149... pp349–353. Z. Request for an opinion’. P. pp1494–1497. B. Wang. J. International Journal of Systematic Bacteriology. Ingram (eds) Tropical Soil Biology and Fertility: A Handbook of Methods. y Bohlool. (1988b) ‘Reliability of the most-probable technique for enumerating rhizobia in tropical soils’. CAB International. Woomer. R. (2004) Renaming of Agrobacterium larrymoorei Bouzar and Jones 2001 as Rhizobium larrymoorei (Bouzar and Jones 2001) comb. pp2107–2110.´ International Journal of Systematic Evolutionary Microbiology. J.. nov. R. y Bohlool. Blitchngton. vol 45. M. vol 54. Young. (2003) ‘The genus name Ensifer Casida 1982 takes priority over Sinorhizobium Chen et al 1988 and Sinorhizobium morelense Wang et al 2002 is a junior synonym of Ensifer adhaerens Casida 1982. (1988a) ‘Ecological indicators of native rhizobia in tropical soils’.. P.Willems. J. nov. Toro. in J. E. Yerson and J. B. Bennet. R. S. L. (1993) ‘Most Probable Number Counts of Rhizobia in Soils’. E.. F. W. P. Wallingford. y Chen. M.. P.. P. nov. M. vol 53. 212 Manual de biología de suelos tropicales . International Journal of Systematic and Evolutionary Microbiology. X. W. pp2219–2230. (1990) ‘Amplification of bacterial 16S ribossomal DNA with polymerase chain reaction’. E. Cui. H. B. P. pp1942–1946. MartínezRomero. y Yost. J. Woomer. Y. International Journal of Systematic Bacteriology.. Applied and Environmental Microbiology. vol 54.. (1990) ‘Agroclimatology and modeling – overcoming the inflexibility of most-probable-number procedures’.’. Young. Singleton.. (2002) ‘Characterization of rhizobia that nodulate legume species within the genus Lespedeza and description of Bradyrhizobium yuanmigense sp. Goris.. A. vol 82. Yao. L. B. y Gillis. Xu. I. vol 53. M. P. International Journal of Systematic and Evolutionary Microbiology. Woomer. Ge. nov. Vos. isolated from the root nodules of soybeans’. Li. Muñoz-Adelantado. pp1112– 1116. T. y Green. Applied and Environmental Microbiology. Is the combination “Sinorhizobium adhaerens” (Casida 1982) Willems et al 2002 legitimate? Request for an opinion’. Journal of Clinical Microbiology. J. Singleton. Fernández-Lopez. vol 52. Z. N.

P. (1996) ‘Diversity and phylogeny of rhizobia’. nov. D. y Chen. Martínez-Romero. International Journal of Systematic Evolutionary Microbiology. Hou.A. y Velázquez..J.X. K. R.. rubi.F. M. B.Young.X. vol 61. (2001) ‘A revision of Rhizobium Frank 1889. N.. J. Wang. isolated from nodules of Cytisus scoparius in Spain´ International Journal of Systematic Evolutionary Microbiology. (2011)´Rhizobium tubonense sp. Li.. W. New Phytologist. Y.. and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. M. Palomares. pp784-788. Zhang. Martínez-Molina. E.. pp89–103.. R. J. L. R.L.C.. vol 57.. R. rhizogenes... Chamber.vol 133. pp512-517. Young J. nov.. M. Mateos.. Vizcaíno.. P. A. A. Kerr.. pp87–94. y Sawada. with an emended description of the genus. Trujillo. Zurdo-Piñeiro. Kuykendall. (2007)´Ochrobactrum cytisi sp. Rivas. B acterias formadoras de nódulos en leguminosas 213 . vitis’. J. y Haukka. isolated from root nodules of Oxytropis glabra´International Journal of Systematic Evolutionary Microbiology.. E. undicola and R. X. E.. . vol 51. Zhang. Carrasco. W. R. E. 1998 as new combinations: Rhizobium radiobacter. H.E.T. E.

K2HPO4 (10%) (o 0. KH2PO4 (10%) (o 0.1 gl–1) 4ml sol.1 Composición de medio 79 para el crecimiento de Bfn Medio 79 (Fred y Waksman.2 gl–1) 1ml sol. Medio sólido: 15g Agar Medio semisólido: 1.75g Agar Autoclave a 120°C durante 15 minutos. NaCl (10%) (o 0.5% azul de bromotimol en 0. para hacer 1000 ml con agua destilada pH 6.4 gl–1) 2ml sol. 0.4 gl–1) 5ml sol. Cuando pH <5. 214 Manual de biología de suelos tropicales .0.2 N KOH.1 gl–1) 100ml extracto de levadura (o polvo 0.8–7. 1928) (similar a medio YMA – Vincent. 1970): 10g manitol o sacarosa 1ml sol.APÉNDICE 6. MgSO4. 7H2O (10%) (o 0.0 se reemplaza azul por Azul de Bromotimol por Verde de Bromocresol y se aumenta agar hasta 20 gl–1.

. También después se usa la solución con sirato en bolsas de plástico... Control Se proveen los controles con nitrógeno a una concentración final de aproximadamente 70 ppm N (0..7H2O (2%) NaCl (2%) CaHPO4(10%) FeCl3.. por lo tanto.6H2O 1... Si al final del experimento esto resulta insuficiente para el crecimiento sostenido y el color verde de las plantas control..000 ml pH = 6.. 0. Diluir solución a 1:4...7....03 g ZnSO4. pues las dosis elevadas inhiben la nodulacíon....... los controles nitrogenados no presentan nódulos..86 g MnSO4. o entre 7 a 10 días después de plantar. Sin embargo......7% KNO3) pueden ser tóxicas.5H2O ........08 g Na2MoO4.......... Esto puede añadirse a la solución de nutrientes al principio del experimento... 0.. sin inoculación del suelo B acterias formadoras de nódulos en leguminosas 215 ....7H2O .4H2O ..7 % o FeCl3 1% Solución de micronutrientes* Agua destilada (completar a) Volumen 10 ml 10 ml 10 ml 10 ml 10 ml 1 ml 1.. 2.09 g El mismo protocolo que para agar con semillitas.05% KN03 o NH4 NO3). 0.. los controles absolutos.. Vicent (1970) recomienda la mezcla para una solución de nutrientes...H2O .22 g CuSO4.. es decir..... * Solución de micronutrientes (para 1 l de agua)...... H3BO3 ..APÉNDICE 6......2 Solución de nutrientes Jensen’s para el crecimiento de espe- cies de leguminosas en bolsas de plástico y jarras de Leonard Componentes K2HPO4 (2%) MgSO4....... ajustar con KOH. 2.... entonces la concentración puede aumentar o hacer una suplementación dividida. las concentraciones más altas (>0.. Normalmente... diluida de la misma manera.

son necesarios para comprobar las condiciones asépticas del experimento. es el uso de una cepa eficiente como un control positivo para la nodulación y la fijación de nitrógeno. 216 Manual de biología de suelos tropicales . Otro control importante. no mencionado por Vincent. éstas deberán utilizarse. Si existe la disponibilidad de las cepas recomendadas.

1981. Stürmer INTRODUCCIÓN Actualmente. pH desfavorable del suelo y al choque por trasplante que sufren las plantas no micorrizadas (Mosse et al. producción de cultivos redituables o plantaciones forestales industriales provoca cambios en las características quí217 . Bagyaraj y Sidney L. En los trópicos. 1991). huertos y cultivos agrícolas (Brundrett.. altas temperaturas. patógenos de la raíz. La conversión de estos dos ecosistemas en agro-ecosistemas ya sea para agricultura de subsistencia. En la mayoría de los suelos tropicales. tales como fosfato. la agricultura se practica en áreas previamente ocupadas por dos principales ecosistemas naturales ricos en especies vegetales: bosques tropicales y sabanas. Además. Los HMA han sido registrados en ecosistemas naturales como desiertos. selvas tropicales. dunas de arena. Bagyaraj and Varma. se ha demostrado que las plantas micorrizadas tienen mayor tolerancia a metales tóxicos. aumenta significativamente la captación de iones relativamente inmóviles. esto limita el desarrollo de las plantas. se encuentra bien documentado que los hongos micorrizógenos arbusculares (HMA) mejoran la salud y el crecimiento de las plantas de importancia agrícola. el fósforo disponible es muy bajo. 1990. provee una mayor superficie de absorción que los pelos radiculares y. por lo tanto. sequía. La red de hifas producidas por los HMA en el suelo durante su asociación con la planta huésped. salinas y sistemas manejados como praderas. cobre y zinc. Bagyaraj. 1995).Capítulo 7 Hongos micorrizógenos arbusculares (HMA) Joseph D. salinidad. hortícola y forestal.

No obstante. La infectividad micorrízica se determina fácilmente por el método del número más probable (NMP) y puede servir para propósitos comparativos (Porter. por lo general. como los hongos dominantes. se eliminan muchas especies vegetales de todas las edades y. especialmente de los géneros Glomus y Gigaspora. También notaron un cambio en la composición de especies. Las macetas trampa preparadas con suelo de campo han sido usadas exitosamente para detectar y recobrar especies crípticas durante estudios de diversidad en huertos de manzano en regiones templadas (Miller et al. Jasper et al. usualmente. 1996). De igual forma. estas determinaciones no detectan a las especies crípticas de HMA que no están esporulando en el momento del muestreo (pero que están asociadas con las plantas hospederas) e impiden la adecuada identificación de algunas especies. pastizales (Bever et al. sin embargo.micas. Picone (2000) demostró que la densidad de esporas y la comunidad fúngica disponible para la formación de micorrizas eran relativamente similares entre praderas y bosque tropical lluvioso. 1979). (1987) observaron un descenso en el número de esporas y un cambio en la composición de especies después del disturbio en algunos lugares de Australia. en donde se detectaron 28 morfotipos de HMA con Glomus aggregatum y dos especies de Glomus no descritas. Johnson y Wedin (1997).. (1992) encontraron que el número de esporas de HMA en una plantación de Terminalia ivoriensis en Camerún disminuyó notablemente después de tres meses de una desforestación. La medición de la diversidad taxonómica de HMA se ha hecho. La medición del porcentaje de colonización (PC) (Moorman y Reeves. Aunque comúnmente no es reportado. Mason et al. En estos sitios. encontraron una riqueza similar de especies en la selva tropical seca y en praderas con dominio de una especie. las medidas de diversidad taxonómica deberían estar acompañadas de algunas evaluaciones de la actividad de la comunidad micorrízica. se siembran con una sola especie de la misma edad.. 1985). La conversión de los ecosistemas naturales para distintos usos de suelo influye en la abundancia de esporas y composición de especies de HMA. 1996) y también en desiertos (Stutz and Morton. físicas y biológicas del ambiente edáfico. 1989) son también adecuadas. 218 Manual de biología de suelos tropicales . 1979) y la determinación de las unidades de colonización (UC) (Franson y Benthlenfalvay. a través de una cuenta directa y de la identificación de esporas recuperadas del campo. generalmente. Asimismo.

Datos moleculares y morfológicos fueron usados para transferir a los miembros del género Sclerocystis a Glomus (Almeida y Schenck. Redecker et al. se propone un esquema de clasificación para estudios de diversidad que surge de los esquemas de Morton y Benny (1990). La taxonomía y clasificación de los hongos micorrizógenos han cambiado radicalmente en los últimos años. (2001). especialmente. También incluyeron en el Nuevo esquema de clasificación tres nuevos órdenes y varias familias. Recientemente.TAXONOMÍA Y CLASIFICACIÓN DE HMA Debe establecerse un esquema taxonómico antes de cualquier estudio de diversidad.1). Por lo tanto. (2001) (Tabla 7. un género nuevo llamado Pacispora fue propuesto por Oehl y Sieverding (2004). Se basa en una serie de diluciones decimales H ongos micorrizógenos arbusculares 219 . 2000) y para erigir dos nuevos géneros en dos familias distintas (Morton and Redecker. 2001). Este género es incluido en el orden Diversisporales en la filogenia molecular propuesta por Schüßler et al. Morton y Benny (1990) transfirieron todas las especies de HMA al orden Glomerales (División Zygomycota) con tres familias y seis géneros. Schüßler et al. 1990. cuando se requieren comparaciones entre los sistemas de uso de suelo. Aunque se han aplicado técnicas moleculares para aclarar la clasificación filogenética entre las especies de HMA.. MÉTODOS PARA EVALUAR PROPÁGULOS INFECTIVOS DE HMA Y COLONIZACIÓN MICORRÍZICA Número más probable (NMP) El protocolo propuesto para estimar la diversidad de HMA (descrito en el Capítulo 2) es el mismo que se sigue para todos los microorganismos y no será discutido aquí.. La formación de esporas en este género es similar a la de Glomus pero éste diferencia paredes germinales internas. la identificación de especies está basada principalmente en las características morfológicas de las esporas. con aquellos de Morton y Redecker (2001) y Schüßler et al.. El método del Número Más Probable se ha utilizado para estimar el número de propágulos infectivos de HMA en varios suelos. (2001) transfirieron todas las especies de HMA a una nueva división monofilética: Glomeromycota. Gerdemann y Trappe (1974) incluyeron todas las especies de HMA dentro del orden Endogonales en la familia Endogonaceae (División Zygomycota). colocando a este grupo de hongos en el mismo nivel que Basidiomycota y Ascomycota.

Otras estructuras subcelulares de la espora y germinación idéntica a la de Acaulospora. conectada a una hifa ramificada. Esporas con la pared esporal formada por un número variable de capas todas originadas a partir de la hifa de sostén. en agregados laxos o en esporocarpos. Las vesículas y células auxiliares no están diferenciadas. y Trappe emend. flexible. plana. Arbúsculos con troncos aplanados o cilindricos adelgazándose sucesivamente en las ramificaciones. No se observan paredes germinales diferenciadas. Germinación a través del lumen de la hifa de sostén o a través de la pared de la espora. División Glomeromycota Schüßler. Entrophospora Ames y Schneider (cinco especies) Esporas formadas dentro de un cuello de un sáculo esporífero el cual deja dos cicatrices sobre la superficie de la espora. Hifas intrarradicales raramente enrolladas. Vesículas de pared delgada y elipsoides. Scharzott y Walker Orden Glomerales Morton y Benny Suborden Glomineae Morton y Benny Familia Glomeraceae Pirozysnki y Dalpé Glomus Tulasne y Tulasne (85 especies) Esporas formadas blásticamente sobre una hifa de sostén. Hifas intrarradicales rectas o enrolladas cerca de los puntos de entrada. arbúsculos. solitarias. La micorriza se tiñe débilmente.1 Esquema taxonómico propuesto para estudios de diversidad de hongos micorrizógenos arbusculares y caracteres morfológicos que definen los géneros en Glomerales. La pared de la espora esta formada por tres o cuatro capas y no se forma una verdadera bicapa germina. 220 Manual de biología de suelos tropicales . Germinación a través de una estructura de germinación esférica. La micorriza se tiñe muy obscuro. La pared germinal más interna tiene una superficie con excrecencias. Los arbúsculos e hifas intrarradicales se tiñen débilmente. Berch (31 especies) Esporas formadas a los lados del cuello de un sáculo esporífero el cual deja una cicatriz en la superficie de la espora. Esporas con la pared esporal formada por dos capas.Tabla 7. Familia Acaulosporaceae Morton y Benny Acaulospora Gerd. hifas intrarradicales y micorriza se tiñen como en Acaulospora. Las vesículas varían en forma con protuberancias y concavidades. Familia Archaeosporaceae Morton y Redecker Archaeospora Morton y Redecker (una especie) Esporas formadas terminalmente de una hifa de sostén o como una ramificación de una estructura que semeja un sáculo esporífero. Se presentan especies dimórficas formando esporas acaulosporoides y glomoides. Vesículas.

Vestberg & Schüßler (ocho especies) Especies generalmente dimórficas con asociaciones micorrizicas produciendo morfotipos acaulosporoide y glomoides. y Trappe (cinco especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. Scutellospora Walker y Sanders (30 especies) Esporas formadas terminalmente sobre una célula esporógena bulbosa. Blaszkowski. se diferencia una capa delgada con verrugas esparcidas y crece un tubo germinativo a través de la pared esporal. Esporos acaulosporoide formado un apéndice hifal emergiendo lateralmente del cuello de un sáculo esporífero. Las paredes de la hifa de sostén son continuas con la primera y segunda capa de la pared esporal. Arbúsculos e hifas intrarradicales similares en morfología a las de H ongos micorrizógenos arbusculares 221 . células auxiliares finamente papiladas o equinuladas. Las estructuras subcelulares de la espora y la germinación como en Glomus. Esporas con la pared esporal formada por dos capas permanentes. Arbúsculos con troncos hinchados angostándose abruptamente en las ramificaciones. Vestberg & Schüßler Ambispora Walter. Germinación de la espora directamente de la pared germinal a través de la pared de la espora. y germinan atreves de hifa suspensora. No se forman vesículas. La segunda capa de la pared germinal generalmente reacciona con el reactivo de Melzer. Al germinar. Familia Pacisporaceae Walker. Pared de la espora generalmente formada por tres capas distintas y la pared germinal compuesta también por tres capas. Vesículas y arbúsculos las raíces teñidas en azul franco con azul tripano. Las vesículas y células auxiliares no están diferenciadas. no se diferencian paredes germinales. Suborden Gigasporineae Morton y Benny Familia Gigasporaceae Morton y Benny Gigaspora Gerd. Esporos glomoides de forma aislada en el suelo o agregados en racimos. Hifas intrarradicales frecuentemente enrolladas. Los arbúsculos y las hifas intrarradicales se tiñen débilmente. cerca de los puntos de entrada. Schüßler y Schwarzott Pacispora Sieverding y Oehl (siete species) Esporas formadas terminalmente de una hifa de sostén (como en Glomus). especialmente.Tabla 7. a menudo nodosas o con proyecciones. Familia Paraglomeraceae Morton and Redecker Paraglomus Morton y Redecker (dos especies) Esporas formadas terminalmente de una hifa de sostén como en Glomus. No se forman vesículas. células auxiliaries que van de casi lisas a nodosas.1 Continúa Familia Ambisporaceae Walter.

. Como el resultado es un solo número. y puede llevarse a cabo por cualquiera que esté familiarizado con la morfología de la micorriza. 1990. La ventaja es que. se puede utilizar cualquier otro hospedero. como el sorgo y el Paspalum.caf. Esporas con una pared formada por dos capas permanentes y de una a tres paredes germinales internas.wvu. Si no contamos con semillas de cebolla.1 Continúa Gigaspora. de suelo en donde la presencia o ausencia de colonización micorrízica se registra y da como resultado el número más probable de propágulos infectivos. Sin embargo.5 cm) y gradillas bolsas de plástico (30 X 20 cm) diluyente esterilizado (arena: mezcla de suelo 1:1) semillas de cebolla. pero el número calculado tiene hasta un 95 por ciento del nivel de confianza (Adelman y Morton. Oehl y Sieverding. ya que es dependiente de la micorriza y las raíces son fáciles de teñir.Tabla 7. Spain et al. 222 Manual de biología de suelos tropicales . La planta hospedera recomendada para el ensayo del NMP es la cebolla. 2006 y http://invam. el método es apropiado para comparaciones entre sistemas con diferente uso del suelo si los ensayos del NMP se establecen de forma simultánea. que se diferencia sobre la superficie de la última pared germinal. El tubo de germinación crece a partir de un escudo flexible plano. Una de las desventajas de esta prueba es que se requiere mucho tiempo para la preparación del bioensayo.edu. se pueden utilizar gramíneas C4. el análisis de las raíces de las plantas trampa para comprobar la colonización es fácil y rápido. basándose en una tabla estadística. Materiales necesarios • • • • tubetes para plantas (150 X 2. Fuente: compilado de Morton y Benny. si tiene cierta dependencia micorrízica. cada una con dos capas. 2004. 1986).

2. H ongos micorrizógenos arbusculares 223 .Procedimiento 1. lavar el suelo de las raíces y teñirlas con azul de tripán (véase más abajo). Distribuir el suelo de cada dilución en los tubetes para plantas. 4. 10-3 y 10-4). tres réplicas fueron positivas en la dilución 10-3 y dos réplicas fueron positivas en la dilución 10-4. El número de tubetes positivos (los que contienen colonización) en diluciones diferentes se utilizan para calcular los valores de NMP. 3. Esto significa que las cinco réplicas fueron positivas para la colonización micorrízica en las diluciones 10-1 y 10-2. El procedimiento para el cálculo del NMP. Pesar 30 g de suelo de campo en una bolsa de plástico y añadirle 270 g del diluyente esterilizado. se obtiene la siguiente secuencia de números de tubetes positivos: 5. Agitar bien para obtener una dilución decimal. Para el cálculo del NMP. Utilice las tablas de Cochran (1950). El primer número (N1) corresponde al número de tubetes positivos para la colonización micorrízica en la dilución que muestra el mayor número de tubetes positivos (se toma la serie menos concentrada. Agitar bien para obtener una dilución 10-1. si es necesario). Al cosechar. N2 = 3 y N3 = 2. de Fisher y Yates (1963) o Alexander (1965). dejar una sola planta por tubete y dejarlas crecer en un invernadero o en una cámara de crecimiento durante seis semanas. determinar la presencia o ausencia de colonización micorrízica en cada réplica. hacer cinco replicas por cada dilución. Después de emerger. Los otros dos números (N2 y N3) son los correspondientes a las próximas dos diluciones. se ilustra con el siguiente ejemplo. la combinación sería: N1 = 5. Supongamos que. 3. En este ejemplo. 7. Sembrar las semillas de cebolla en cada tubete. 6. sólo tres números de una secuencia dada son necesarios. 10-2. 5. Retirar 30 g de la dilución anterior y colocarlo en otra bolsa que contiene 270 g del diluyente estéril. hacer más diluciones decimales hasta la dilución 10-4 (o más. Bajo un microscopio de disección. si el número de tubetes positivos es el mismo en diluciones posteriores). 2. considerando las cinco réplicas (tubetes) para cada una de los cuatro diluciones (10-1. si no se dispone de las semillas de cebolla puede utilizar cualquier otro hospedero (ver arriba). 5.

5 g/l) • H2O2 alcalinizada (3 ml NH4OH al 20%. 50 ml de de HCl al 1%) • azul de tripano 0. el suelo tiene 1. Para obtener el NMP de propágulos infectivos de HMA en la muestra. este valor debe de ser multiplicado por la dilución media. (500 ml de glicerol. Por lo tanto. no altera la morfología de la raíz. Kormanik y McGraw (1982) eliminan el fenol en las soluciones para tinción y decoloración. 224 Manual de biología de suelos tropicales . Por lo tanto. El método más ampliamente utilizado es el descrito por Philips y Hayman (1970). (en este caso 10-3). para detectar y medir la colonización micorrízica. Procedimiento 1.4. en contraste con las asociaciones ectomicorrízicas. se propone para la tinción de raíces el método de Philips y Hayman (1970) modificado por Koske y Gemma (1989). Materiales necesarios • solución de KOH al 10% (hidróxido de potasio) • solución de HCl al 1% (ácido clorhídrico) • solución acidificada de glicerol. 2.Usando la tabla del NMP el valor dado para esta combinación de tubetes positivos es 1. 450 ml de H2O. mientras que Koske y Gemma (1989) modificaron el procedimiento mediante la eliminación de ácido láctico de estas soluciones sin interferir con la intensidad de la tinción.05 % en solución de glicerol (0. Tinción de raíces para observar la colonización micorrízica La colonización de las células corticales de la raíz por HMA. Lavar las raíces para eliminar residuos de suelo y enjuagar con varios cambios de agua. 30 ml de H2O2 al 3%. las raíces son sometidas a un procedimiento de clareo y tinción. Sumergir las raíces en KOH a 90°C por una hora o a 120°C por 15 minutos en autoclave. 567ml de agua).4 X 10-3 propágulos infectivos g–1. Teniendo en cuenta el costo de los productos químicos y el ahorro al reducir el número de productos químicos sin interferir con la calidad de la tinción.

Esta medida estima el crecimiento de un aislamiento de un hongo o de una comunidad fúngica dentro de la corteza de la raíz. Sumerga las raíces en HCL al 1% por cinco minutos. 6. 40ml de glicerol y 40 ml de agua destilada). las raíces pueden guardarse en agua adicionada con unas gotas de azida de sodio al 0. se realiza con frecuencia en raíces colectadas de campo (sacadas directamente del suelo o de plantas individuales) o en plantas experimentales. la solución de glicerol acidificada puede ser reemplazada por una solución de lactoglicerol (20 ml de ácido láctico.1 x 1. • Agujas de disección. la solución de agua oxigenada alcalinizada debe de prepararse justo antes de su uso. Si las raíces están demasiado pigmentadas se deben sumergir en agua oxigenada alcalinizada durante 10-30 minutos. Medición de la colonización micorrízica La determinación de la colonización micorrízica de la raíz. Material necesario • Cajas de Petri cuadriculadas en la base con cuadrados de 1. Elimine el HCl. Eliminar el KOH y enjuagar las raíces con agua (dos o tres veces) para quitar el exceso de KOH. Para almacenar por un tiempo largo. El método de intersección de cuadrante (Giovannetti y Mosse. Descargue la solución colorante y mantenga las raíces en glicerol acidificado (sin azul de tripano) o agua a temperatura ambiente o 4°C. Tiña las raíces en una solución de glicerol ácido con azul de tripano a 90°C por una hora o a 120 °C por cinco minutos. 7. Enjuagar nuevamente las raíces con agua. crecidas bajo condiciones del invernadero. 4. El paso 4 puede ser omitido si las raíces no están muy pigmentadas. 8. 1980) que se presenta a continuación. No enjuague las raíces en esta paso ya que éstas deben estar acidificadas para una tinción adecuada.1 cm. Para los pasos 2 y 7. Comentarios: si lo desea. es usado comúnmente para medir la longitud de la raíz y el porcentaje de la colonización micorrízica. H ongos micorrizógenos arbusculares 225 .3.01%. un baño de agua a 90°C es apropiado para mantener las muestras. 5.

seguido por centrifugación en un gradiente de sacarosa. Comentarios: los datos obtenidos en el paso 3. usando la relación entre el peso seco de la planta y la submuestra. representan la longitud total de la raíz en cm. Para más detalles ver http://invam. La morfología del micelio interno y externo durante la asociación micorrízica es prácticamente indistinguible entre las especies del mismo género y entre géneros. Por lo tanto. las esporas son la única parte del organismo del hongo que puede utilizarse para delimitar las especies.. el número total de raíces que interceptan las líneas de la cuadricula. Es posible calcular la longitud total de la raíz y la longitud de la raíz micorrízada de la planta completa. también se pueden utilizar para determinar las longitudes tanto de la raíz completa como de la raíz micorrizada.Procedimiento 1. 1963). De esta manera.1 cm. En una caja de Petri extienda al azar las raíces teñidas. 2. con estructuras micorrízicas. Métodos para evaluar la diversidad de HMA Extracción de esporas del campo La Identificación de las especies de HMA está basada en el análisis de estructuras subcelulares de las esporas asexuales. 226 Manual de biología de suelos tropicales . el total de la longitud de la raíz micorrizada será el número de intersecciones. Calcule el porcentaje de colonización micorrízica (% CM) utilizando la siguiente fórmula: % CM = (Número total de intersecciones con raíces micorrizadas/ Número total de intersecciones entre la raíz y las líneas de la cuadrícula) X 100.wvu. Registre: a) el número total de intersecciones de las raíces y las líneas de la cuadricula y b) el número de intersecciones con raíces micorrizadas. 3.caf. Si se toma una muestra pequeña de toda la raíz. Bajo el microscopio de disección explore las líneas horizontales y verticales de la cuadrícula.edu/ methods/mycorrhizae/rootlengths. En contraste. 4. con las líneas de la cuadricula separadas en 1. las estructuras subcelulares de las esporas están altamente conservadas y son fenotípicamente estables independientemente del ambiente y la planta huésped (Morton et al. se teñirá y se medirá en el microscopio con este método. Si toda la raíz se extiende en la caja de Petri. Las esporas se extraen del suelo mediante un tamizado húmedo (Gerdemann y Nicolson.htm. 1995).

Figura 7.9%. después de expander las raíces. • Vasos de precipitados. • Tubos para centrífuga y centrífuga. Nota. cajas de Petri. Materiales necesarios • Un juego de tamices anidados que tengan al menos 710 µm y 45 µm de abertura de malla.1 provee una ilustración del método de intersección de línea. vidrio de reloj. el numero de intersecciones entre una raíz y las líneas horizontales y verticales tendríamos: • 25 intersecciones (Línea horizontal) • 18 intersecciones (Línea vertical) y • 12 intersecciones (Puntos negros) presentando colonización micorrizica. H ongos micorrizógenos arbusculares 227 . • Soluciones de sacarosa (20 % y 60%). • El porcentaje de colonización micorrízica= (12/43) x 100=27. el largo de la raíz = 43 cm (25 + 18) y el largo de la raíz micorrizada=12 cm (Seis intersecciones positivas sobre líneas horizontales y seis intersecciones positivas sobre líneas verticales). Ejemplo. • Por lo tanto.1 Caja Petri con raíces teñidas para marcar la micorrización distribuida uniformemente por el método de intersección de línea. • Cubeta de plástico o un vaso de precipitados grande. En el diagrama las infecciones de micorrizas son representadas con puntos negros.Figura 7.

Los tamices recomendados (con mallas de 710 µm y 45 µm) son adecuados para recuperar la mayoría de especies.000 rpm durante 60 segundos. 6. Coloque el material retenido en el tamiz de 710 µm en una caja de Petri grande y observe bajo el microscopio de disección para observar esporas grandes (esporas de Gigaspora y Scutellospora) y esporocarpos. se puede agregar una pequeña cantidad de pirofosfato de sodio a 0. 2. agregue 15 ml de la solución de sacarosa al 20% en un tubo de centrífuga de 50 ml y después. 4. comprada en el supermercado.1M (Fogel y Hunt. La solución de sacarosa se hace con azúcar comercial. Coloque el material retenido en el tamiz de 45 µm en una vaso de precipitados con una pequeña cantidad de agua. 3. 5. Esto separa a las esporas por tamaños pero incrementa la cantidad de trabajo ya que el material retenido en cada tamiz debe centrifugarse por separado. 7. Vacíe el sobrenadante en el tamiz de 45 µm y lave con agua corriente para quitar el exceso de sacarosa. 1979) para dispersar las partículas de arcilla y liberar las aberturas del tamiz. 500 ml de agua. después transfiera este material a un tubo de centrífuga que contenga un gradiente de sacarosa de 20–60%. es preferible vaciar la suspensión de suelo a través de un tamiz de 1 mm antes de pasar por el tamiz de 710 μm. En este momento. 228 Manual de biología de suelos tropicales .Procedimiento 1. Colocar 100 g de la muestra de suelo en la cubeta /vaso de precipitados y suspender en. si hay demasiados pedazos de raíz y otros desechos. en el fondo. Transferir las esporas y el material retenido en el tamiz 45 µm a una caja de Petri y bajo el microscopio colecte las esporas en un vidrio de reloj limpio. Sin embargo. Agitar hasta que las esporas queden suspendidas y dejar reposar 30 segundos . Comentarios: en el paso 3. ya que el tamaño de las esporas de HMA para la mayoría de las especies está en un intervalo de 40 a 600 μm. Las esporas pueden separarse de los residuos orgánicos y recogerse de la caja de Petri usando unas pinzas finas o una pipeta Pasteur adelgazada en la punta. 8. Los suelos con alto contenido de arcilla pueden obstruir los tamices. Para preparar el gradiente de la sacarosa. Pasar la suspensión repetidamente a través de dos tamices anidados con abertura de malla de 710 µm y 45 µm. las esporas se pueden separar por morfotipos de acuerdo con su color y tamaño y si las esporas están en buen estado se pueden identificar hasta género y especie. se pueden anidar otros tamices entre los dos recomendados. Centrifugue a 2. al menos. agregue otros 15 ml de la solución al 60% .

1979. b. 1982) se publicaron antes de algunas revisiones de taxonomía recientes e importantes. usando como referencia al Manual para la identificación de HMA (Schenck y Pérez. Janusz Blaszkowski (Department of Plant Pathology of the Agricultural University of Szczecin. Algunas claves de identificación para HMA (por ejemplo Hall y Fish. Koske y Walker (1985) proponen una clave para algunas especies de Scutellospora con esporas con paredes ornamentadas. La identificación de especies de HMA se puede hacer por comparación con la descripción original de la especie. café. c y d) y Acaulosporaceae (e. Fotografías de esporas de especies representativas de diferentes géneros se muestran en las ilustraciones 4 y 5.Identificación de especies y montaje de preparaciones En la mayoría de los casos. USA) sitio web (http://invam.ar. c) un detalle de la ornamentación de H ongos micorrizógenos arbusculares 229 . 2.szczecin. Sin embargo. Joseph Morton en la INVAM (Colección Internacional de hongos micorrizógenos arbusculares.agro. de 160 especies de HMA descritas en total. 3 y 4 se proporcionan los nombres de las especies y los autores. este manual incorpora en un solo volumen toda la descripción de las especies hasta 1990. Por otro lado. alberga todos los problemas inherentes a esas descripciones (falta de estandarización de las estructuras subcelulares de las esporas. W.V. La fotografia a) muestran una espora de Gigaspora albida con la hifa de sostén bulbosa típica de esta familia.edu) y por Dr. en estos sitios web se describen 79 y 55 especies respectivamente. 1990) y comparando con las descripciones e ilustraciones de las especies proporcionadas por el Dr.pl/~jblaszkowski.caf.. El manual de Schenck y Pérez es una copia de las descripciones originales de las especies y por lo tanto. En los anexos 1. la INVAM y el sitio de Blaszkowski poseen excelentes fotografías con detalles de la estructura subcelular de las esporas. y por consiguiente. g. contrastando con el color hialino de las esporas). a la vez que Bentivenga y Morton (1995) proponen una clave para identificar las cinco especies de Gigaspora.wvu. West Virginia University. el tamaño de las esporas y una descripción estandarizada de las especies de HMA. Trappe. deben ser montadas en portaobjetos y observadas en un microscopio compuesto. falta de buenas fotografías para las comparaciones y las descripciones están hechas con esporas extraídas del suelo de campo por lo cual pueden no incluir características taxonómicas importantes). b) espora de Scutellospora scutata con la hifa de sostén bulbosa (note el escudo de germinación redondo. La ilustración 4 muestra las esporas y las estructuras producidas por las especies de la familia Gigasporaceae (fotografías a. Poland) en http://www. las esporas extraídas del campo no son identificables bajo el microscopio de disección. f. y h).

y d) células auxiliares nodosas que diferencian a los miembros de Scutellospora. se observan. color. Una espora de Entrophospora colombiana mostrando las dos cicatrices características se ve en la foto f). esporas de Acaulospora sp. Archaeosporaceae (e y f) y Paraglomeraceae (g y h). forma. La foto b) muestra la pared de la hifa de sostén continua con la pared de la espora de un Glomus sp. reacción al Melzer. Las esporas necesitan montarse en líquidos de montar permanentes como son el PVLG (alcohol polivínilico lactoglicerol) y PVLG mezclado con reactivo de Melzer. cubreobjetos y etiquetas • Agujas de disección 230 Manual de biología de suelos tropicales . la foto g) ejemplifica la estructura de la pared formada por tres capas (L1. En el microscopio compuesto pueden observarse algunas características taxonómicas importantes como son la presencia y tipo de ornamentación sobre la pared de la espora. b. La foto e) muestra un espora de Archaeospora leptoticha con el sáculo esporífero. Materiales necesarios • Portaobjetos. Foto a): espora de Glomus clarum indicando la hifa de sostén (note que la capa más interna de la pared de la espora se desprende y se ve parecida a la pared germinal. presencia de hifa de sostén. la foto f) muestra un detalle de Archaeospora leptoticha en donde se observan protuberancias y depresiones de las capas 2 y 3 de la pared esporal (indicada con flechas). c. de células suspensoras y del sáculo esporífero (raramente observado en esporas recolectadas directamente del campo). La ilustración 6 muestra a las esporas y estructuras producidas por especies de la familia Glomeraceae (a. mostrando algunos sáculos esporíferos adheridos a las esporas. también con la pared formada por tres capas (L1.la pared de las esporas (verrugas) de Scutellospora coralloidea. d). finalmente. número de paredes germinales y grosor de la pared de la espora. en la foto d). L2 y L3) de Paraglomus occultum y en la foto h) se muestra una espora de Paraglomus brasilianum. En la foto e) se muestra una espora de Entrophospora colombiana (familia Acaulosporaceae) con la pared de la espora. L2 y L3) (la capa L2 está ornamentada con pequeñas crestas). Un esporocarpo de Glomus clavispora se observa en la foto c) y un esporocarpo de Glomus sp. Las características taxonómicas importantes que pueden observarse bajo el microscopio de disección son tamaño de las esporas. La fotografía g) representa una espora de Acaulospora scrobiculata que muestra la cicatriz que queda en la espora después de que el sáculo esporifero se desprende. la pared germinal 1 (gw1) y la pared germinal 2 (gw2) con su capa más interna reaccionando al reactivo de Melzer. en la foto h).

Coloque suavemente un cubre objeto sobre la gota de PVLG y otro cubreobjetos sobre la gota de PVLG + Solución de Melzer. 2. En un porta objetos. 10 ml de glicerol. 6. rompa cada espora individualmente bajo el microscopio de disección. 100 ml de agua destilada. Comentarios: el paso 2 es crucial para el montaje de las esporas sobre el portaobjetos. 5. 16. 1. H ongos micorrizógenos arbusculares 231 .6 g de alcohol polivínilico (PVA) • Reactivo de Melzer (100 g de hidrato de cloral. Usando una aguja de disección. Guardar las preparaciones a temperatura ambiente durante cinco días y luego incubar a 40-60ºC. Procedimiento 1. 4. 100 ml de ácido láctico. Mezclar el reactivo de Melzer con el PVLG (1:1) para preparar la solución de PVLG + Melzer. ofrecen esporas nuevas y saludables que pueden ser utilizadas para establecer cultivos puros de HMA. las esporas se deslizan hasta los bordes cuando se coloca el cubreobjetos en la parte superior de cada gota. 7. colocar una gota de PVLG y una gota de la solución de PVLG + Melzer. género y especie (si se conoce). 3. El método propuesto se basa en los protocolos de Stutz y Morton (1996). tenga cuidado de no agregar demasiada agua).• Solución de PVLG (100 ml de agua destilada.5 g Iodo. si se agrega demasiada agua. en el momento del muestreo. Además. Este paso es importante para exponer las paredes germinales y sus capas. Colocar las esporas al centro de cada gota usando un pinza fina o una micropipeta (en este caso. durante dos días para endurecer el medio de montaje. 5 g de yoduro de potasio. y fecha. mezcle las esporas en la solución de PVLG y de PVLG + Solución de Melzer y deje secar la superficie de la gota por lo menos cinco minutos. Establecimiento de cultivos trampa Los cultivos trampa se utilizan con más frecuencia en estudios de diversidad de HMA porque revelan las especies que no están esporulando en el campo. Con una aguja de disección. Etiquetar las preparaciones incluyendo número de muestra.

R. durante el muestreo de suelo de campo. Bever et al. otras plantas hospederas pueden utilizarse. M. 703–714. 3. vol. Part 2: Chemical and Microbiological Methods. J. Comentarios: es importante que. B.5 kg y sembrar abundantemente con una mezcla de semillas de sorgo y frijol (40-50 semillas por maceta). Wisconsin. in A. y Schenck. Madison. según lo explicado arriba. se incluyan las raíces de las plantas ya que también sirven como propágulos para iniciar los cultivos trampa. (1990) ‘A Revision of the Genus Sclerocystis (Glomaceae. extraer las esporas e identificarlas.Soil Biology and Biochemistry. Cubrir las semillas con la mezcla de suelo y arena. pp . Alexander.5 kg Bandejas o bolsas de plástico Semillas de Sorghum sudanense (Sorgo) y Vigna unguiculata (Frijol) Procedimiento 1 En una bandeja de plástico (o en una bolsa de plástico). (1996) utilizan un procedimiento diferente para establecer cultivos trampa. J. N. vol. homogeneizar el suelo de campo con arena estéril (50% de suelo de campo y 50% de arena). si el sorgo y frijol no están disponibles. Klute (ed) Methods of Soil Analysis. Soil ScienceSociety of America. pp.Materiales necesarios • • • • Arena estéril Macetas de plástico de 1. llamado “cultivos trampa de trasplante”. 82. 232 Manual de biología de suelos tropicales . 18. (1986) ‘Infectivity of vesicular-arbuscular mycorrhizal fungi: Influence of host-soil diluent combinations on MPN estimates and percentage colonization’. y Morton. 1467–1472. Almeida. T. M. colecte uno o dos núcleos de suelo de 50 ml de cada maceta. donde las plantas intactas colectadas del campo se trasplantan a una maceta con un sustrato libre de HMA y se evalúa la esporulación después de tres a cuatro meses. 7–13. pp. Glomales)’. Mycologia. Se recomienda cualquier gramínea C4 y/o leguminosa como hospederas. Después de tres a cuatro meses. REFERENCIAS Adelman. 2 Colocar esta mezcla en macetas de plástico de 1. (1965) ‘Most-Probable-Number Method for Microbial Populations’. En el paso 2. T. bajo condiciones del invernadero.

71–82. (1996) ‘Host-dependent sporulation and species diversity of arbuscular mycorrhizal fungi in a mown grassland’. R. 84. A. Brundrett. K. D. pp . Arora. 14. Bever. Antonovics. New York. y Mosse. (1979) ‘Fungal and arboreal biomass in a Western Oregon Douglas-fir ecosystem: Distribution pattern and turnover’. F. New Phytologist. y Fish. R. pp. W. 35. 84. vol. Transactions of the British Mycological Society. G. 641–652. y Trappe. 261–270. Jasper. (1989) ‘Infection unit method of vesicular-arbuscular mycorrhizal propagule determination’.. pp. Oliver and Boyd. 754–756. H. vol. 235–244. (1974) ‘Endogonaceae in the Pacific Northwest’. y Bethlenfalvay. Advances in Microbial Ecology. pp. S. Mycol ogi a. pp. A. J. (1979) ‘A key to the Endogonaceae’. Robson. in D. (1987) ‘The effect of surface mining on the infectivity of vesicular-arbuscular mycorrhizal fungi’. (eds) (1963) Statistical Tables for Biological. Gerdemann. 53. D. B. y Hunt. 75–78. vol. A. Advances in Ecological Research.. pp. 489– 500. (1950) ‘Present status of biometry’. (1990) ‘Ecology of vesicular-arbuscular mycorrhizae’. (1963) ‘Spores of mycorrhizal Endogone species extracted from soil by wet sieving and decanting’. vol. 6.. D. I. (1995) ‘A monograph of the genus Gigaspora. y Varma. incorporating developmental patterns of morphological characters’. J. 9. y Morton. 73. Transactions of the British mycological Society. pp. y Yates. (1991) ‘Mycorrhizas in natural ecosystems’. Rai. P. R. 87. G.Bagyaraj. M. Bentivenga. 245–256. Canadian Journal of Forest Research. Journal of Ecology. J. Australian Journal of Botany. J. W. T. L. 1–76. Mukerjii and G.. J. pp. Fisher. pp. Agricultural and Medical Research. pp. Biometrics. R. 46. vol. Gerdemann. L. 171–213. G. 720–732. pp. vol. Bagyaraj. P. (1980) ‘An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots’. vol. H ongos micorrizógenos arbusculares 233 . A. vol. y Nicolson. W. D. J. Edinburgh. 119–142. K. Fogel. B. pp. 5. M. M. (1995) ‘Interaction between arbuscular mycorrhizal fungi and plants: Their importance in sustainable agriculture and in arid and semiarid tropics’. A. B. vol. vol. J. vol. Soil Science Society of America Journal. Giovannetti. Mycologia Memoir. B. 21. Cochran. Morton J. J. C. y Schultz. Franson. J. G. R. Knudsen (eds) Handbook of Applied Mycology: Soil and Plants. D. y Abbott. Hall. J. Marcel Dekker Inc. vol. K.

E. and interpretation of diversity in arbuscular endomycorrhizal fungi (Glomales. y Redecker. pp. y Walker. B. Canadian Journal of Botany. P. Mosse. F. pp. pp. J. 171–182. vol. vol. F. 92. 471–491. D. Read. A. 158–161. 78. Mason. Stribley. Kormanik. II: A bioassay to determine the effect of land disturbance on endomycorrhizal populations’. C. Morton.. Koske. vol. Acaulosporaceae and Gigasporaceae. D. J. B. S25–S32. (1985) ‘Mycorrhizal fungi at eighteen apple rootstocks plantings in the United States’. 702–720. E. J. J.. in D. 55. y Le Tacon. (1995) ‘Discovery.Johnson. Moorman. C. Miller. 66. 261–267. vol. J. F. D. Koske. 77. (2001) ‘Two new families of Glomales. pp. D. pp. y Wedin. Bentivenga. Zygomycetes)’. y Bever. Transactions of the British mycological Society. H. T. P. vol. 37. in N. Domoto. pp. S. 7. J. vol. with two new genera Archaeospora and Paraglomus. 234 Manual de biología de suelos tropicales . y Gemma. C. A. y Walker. P. Lewis. J. Glomales. New Phytologist. Mycological Research. N. A. (1990) ‘Revised classification of arbuscular mycorrhizal fungi (Zygomycetes): A new order. Archaeosporaceae and Paraglomaceae. (1981) ‘Ecology of mycorrhizae and mycorrhizal fungi’. D.. pp. Mycologia. based on concordant molecular and morphological characters’. nutrients and mycorrhizae during conversion of dry tropical forest to grassland’. M. E. pp. 1). pp. y Last. American Phytopathological Society. D. T. B.. vol. (1982) ‘Quantification of vesicular-arbuscular mycorrhizae in plant roots’. y Hayman. Journal of Applied Botany. y Sieverding E. G. with an emendation of Glomaceae’. measurement. Morton. N. vol. Schenck (ed) Methods and Principles of Mycorrhizal Research. J. 100. R. A. P. (1985) ‘Species of Gigaspora (Endogonaceae) with roughened outer walls’. C. pp. Advances in Microbial Ecology. vol. Ecological Applications. CAB International Wallingford. (2004) ‘Pacispora. Glomineae and Gigasporineae. M. pp. H. (1970) ‘Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection’. Mycologia. 73 (suppl. 5. and two new families. Mycotaxon. B. S. 93. vol. P. A. 137–210. 181–195 Morton. 14–18. B. Alexander (eds) Mycorrhizas in Ecosystems. Oehl. (1989) ‘A modified procedure for staining roots to detect VA mycorrhizas’. Fitter and I. Musoko. (1997) ‘Soil carbon. y Benny. two new suborders. O. American Journal of Botany. y Reeves. a new vesicular-arbuscular mycorrhizal fungal genus in the Glomeromycetes’. St. 486–505. R. D. 379–391. C. (1979) ‘The role of endomycorrhizae in revegetation practices in the semi-arid West. P. D. (1992) ‘Short-term changes in vesicular-arbuscular mycorrhizal spore populations in Terminalia plantations in Cameroon’. 72–82. pp. Paul. y McGraw. vol. L. Philips.

17. Trappe. Australian Journal of Soil Research. Schenck. C. J. with a discussion of the genus Archaeospora. Schübler. vol. (1982) ‘Synoptic key to the genera and species of Zygomycetous mycorrhizal fungi’. T. D. Phytopathology. pp. D. Schwarzott. C. vol. vol. 1102–1108. J. W. C. (1979) ‘Most Probable Number method for enumerating infective propagules of vesicular arbuscular mycorrhizal fungi in soil’. 163-182. pp. pp515–519. 72. pp. (2000) ‘Diversity and abundance of arbuscular-mycorrhizal fungus spores in tropical forest and pasture’. Gainesville.. y Bruns. 734–750. 282–285. vol. Mycological Research. J. Mycologia. the Glomeromycota: Phylogeny and evolution’. y Morton. 2006.L. 105. (1996) ‘Successive pot cultures reveal high species richness of arbuscular endomycorrhizal fungi in arid ecosystems’. H ongos micorrizógenos arbusculares 235 . (2001) ‘A new fungal phylum. D. B. 1883–1889. USA. vol. 74. N. Biotropica. Y. J. Appendicispora: a new genius in the arbuscular micorrhiza-forming Glomeromycetes. Synergistic Publications. Stutz. y Pérez. Canadian Journal of Botany. 92. Porter. pp. F. Spain. B. M. A. E. pp. M. Redecker.Picone.. y Oehl. Mycotaxon vol 97. Morton. 1413–1421. pp. (2000) ‘Molecular phylogeny of the arbuscular mycorrhizal fungi Glomus sinuosum and Sclerocystis coremioides’. C. 3rd Edition. vol. (1990) Manual for Identification of VA Mycorrhizal Fungi. y Walker.. J. Sieverding. 32.

Bhattacharjee y Tewari G. delhiense Mukerji. coronatum Giovannetti G. monosporum Gerdemann y Trappe G. microcarpum Tulasne y Tulasne G. género Glomus Género/Especies Glomus G. proliferum Dalpe y Declerck G. pansihalos Berch y Koske G. claroideum Schenck y Smith G.1. pubescens (Sacc. australe (Berkeley) Berch G. arborense McGee G. aurantium Blaszkowski. maculosum Miller y Walker G. manihotis Howeler. y Bakshi G.) Gerd. Tadych y Madej G. G. Sieverding y Schenck G.. Gemma y Olexia G. pallidum Hall G. corymbiforme Blaszkowski G. ambisporum Smith y Schenck G. Bhattacharjee y Tewari G. Blanke. przelewicensis Blaszkowski G. y Broome) Redecker y Morton G. magnicaule Hall G. citricola Tang y Zang G. mortonii Bentivenga y Hetrick G. mosseae (Nicol. cerebriforme McGee G. G. y Ellis) Trappe y Gerdemann 236 Manual de biología de suelos tropicales . y Trappe G. boreale (Thaxter) Trappe y Gerd. antarticum Cabello G. microaggregatum Koske. constrictum Trappe G. caledonium (Nicol.Apéndice 7. nanolumen Koske y Gemma G. canadense (Thaxter) Trappe y Gerd. aggregatum Schenck y Smith G. y Gerd. invermaium Hall G. albidum Walker y Rhodes G.) Trappe y Gerd. G. laccatum Blaszkowski G. macrocarpum Tulasne y Tulasne G. coremioides (Berk. multicaule Gerd. melanosporum Gerd. y Trappe G. Renker y Buscot G. minutum Blaszk. Especies de HMA de la familia Glomeraceae. y Schenck G. clarum Nicol. botryoides Rothwell y Victor G. lacteum Rose y Trappe G. clavisporum (Trappe) Almeida y Schenck G. liquidambaris (Wu y Chen) Almeida y Schenck G. callosum Sieverding G. multisubstensum Mukerji. y Trappe G. y Gerd. convolutum Gerd.

tortuosum Schenck y Smith G. y Trappe) Almeida y Schenck G. halonatum Rose y Trappe G. y Trappe emend. y Gerd. Walker y Dalpe G. viscosum Nicol. dimorphicum Boyetchko y Tewari G. glomerulatum Sieverding G. dominikii Blaszkowski G. tubiforme Tandy G. reticulatum Bhattacharjee y Mukerji G. tenebrosum (Thaxter) Berch G. hoi Berch y Trappe G. tenerum Tandy emend. diaphanum Morton y Walker G. G. pustulatum Koske.1. G. intraradices Schenck y Smith Fuente: tomado de http://invam. deserticola Trappe.) Trappe y Gerdemann G. trimurales Koske y Halvorson G. taiwananse (Wu y Chen) Almeida y Schenck G.) Walker G. fulvum (Berk. y Bakshi) Almeida y Schenck G.Apéndice 7.wvu. pulvinatum (Henn. versiforme (Karsten) Berch G. Walker y Koske G. sterilum Mehrotra y Baijal G. heterosporum Smith y Schenck G. radiatum (Thaxter) Trappe y Gerd. sinuosum (Gerd. rubiforme (Gerd. segmentatum Trappe. etunicatum Becker y Gerdemann G. fuegianum (Spegazzini) Trappe y Gerdemann G. y Trappe G. Bloss y Menge G. G.caf. y Broome) Trappe y Gerd. fragilistratum Skou y Jakobsen G. G. G.. geosporum (Nicol. formosanum Wu y Chen G. fasciculatum (Thaxter) Gerd. Blanke. flavisporum (Lange y Lund) Trappe y Gerd. insculptum Blaszkowski G. warcupii McGee H ongos micorrizógenos arbusculares 237 . Renker y Buscot G. fragile (Berk. tenue (Greenhall) Hall G. y Broome) Trappe y Gerd. McGee G. globiferum Koske y Walker G. G. Spooner y Ivory G. vesiculiferum (Thaxter) Gerd.edu. Friese. xanthium Blaszk. Continúa Género/Especies G.

polonica Blaszkowski A. walkeri Kramadibrata y Hedger Entrophospora E. rugosa Morton A. paulineae Blaszkowski Fuente: tomado de http://invam. infrequens (Hall) Ames y Schneider4 E. bireticulata Rothwell y Trappe A. laevis Gerdemann y Trappe A. Chaverri y Rojas A. tuberculata Janos y Trappe A. morrowiae Spain y Schenck A. koskei Blaszkowski A. mellea Spain y Schenck A. Reed y Sanders A. Sieverding y Schenck A. A. rehmii Sieverding y Toro A. capsicula Blaszkowski A. denticulata Sieverding y Toro A. gedanensis Blaszkowski A. foveata Trappe y Janos A.edu.2.caf. nicolsonii Walker. sporocarpia Berch A. spinosa Walker y Trappe A. myriocarpa Spain. undulata Sieverding A. excavata Ingleby y Walker A. taiwania Hu A. elegans Trappe y Gerdemann A. thomii Blaszkowski A. Pfeiffer y Bloss A. colombiana Spain y Schenck E. Especies de HMA de la familia Acaulosporaceae. lacunosa Morton A. longula Spain y Schenck A.Apéndice 7. géneros Acaulospora y Entrophospora Género /Especies Acaulospora A. scrobiculata Trappe A. delicata Walker. baltica Blaszkowski E.wvu. schenckii Sieverding y Toro 238 Manual de biología de suelos tropicales . kentinensis Wu y Liu E. dilatata Morton A. splendida Sieverding. cavernata Blaszkowski A.

Sieverd. Paraglomeraceae (Género Paraglomus) y Pacisporaceae (Género Pacispora) Género /Especies Archaeospora Ar. y Oehl P. franciscana Sieverd. robigina Sieverd. scintillans Rose y Trappe emend. leptoticha (Schenck y Smith) Morton y Redecker Paraglomus P. emend. 2004 y http://invam.3. dominikii Sieverd. coralloidea Sieverd. occultum (Walker) Morton y Redecker Pacispora P. y Oehl P. boliviana Sieverd. y Oehl Fuente: tomado de Oehl y Sieverding. Daniels y Trappe) Morton y Redecker Ar. y Oehl P.edu. brasilianum (Spain y Miranda) Morton y Redecker P.Apéndice 7.wvu.caf. y Oehl P. trappei (Ames y Linderman) Morton y Redecker Ar. y Oehl P. H ongos micorrizógenos arbusculares 239 . Sieverd. Especies de HMA de las familias Archaeosporaceae(Género Archaeospora). y Oehl P. gerdemannii (Rose. chimonobambusae Blaszk.

y Ho) Walker y Sanders S. dipapillosa (Walker y Koske) Walker y Sanders S.) Walker y Sanders S. Gerd. castanea Walker S. coralloidea (Trappe. y Herr. albida Schenck y Smith Gi. rosea Nicol.) Walker y Sanders S. Miller y Walker) Walker y Sanders S. y Trappe Gi. erythropa (Koske y Walker) Walker y Sanders S. calospora (Nicol. persica (Koske y Walker) Walker y Sanders S.) Walker y Sanders S. pellucida (Nicol.) Gerd. heterogama (Nicol. armeniaca Blaszkowski S.4. gigantea (Nicol. y Herr.) Walker y Sanders 240 Manual de biología de suelos tropicales . fulgida Koske y Walker S. margarita Becker y Hall Gi. nodosa Blaszkowski S. Especies de HMA de la familia Gigasporaceae. alborosea (Ferr. decipiens Hall y Abbott Gi. minuta (Ferr. nigra (Redhead) Walker y Sanders S. y Gerd. Sieverding y Toro S. gilmorei (Trappe y Herd. y Herr. y Gerd. savannicola (Ferr.) Walker y Sanders S. gregaria (Schenck y Nicol. géneros Gigaspora y Scutellospora Género /Especies Gigaspora Gi. aurigloba (Hall) Walker y Sanders S. y Schenck Scutellospora S. dipurpurascens Morton y Koske S. cerradensis Spain y Miranda S. y Schenck) Walker y Sanders S.) Walker y Sanders S. hawaiiensis Koske y Gemma S. reticulata (Koske.Apéndice 7. arenicola Koske y Halvorson S. y Gerdemann) Walker y Sanders S. biornata Spain.

4.wvu.) Walker y Sanders S. scutata Walker y Diederichs S. spinosissima Walker. y Ferr. H ongos micorrizógenos arbusculares 241 . Cuenca y Sanchez S. Continúa Género /Especies S.caf. weresubiae Koske y Walker Fuente: tomado de http://invam.Apéndice 7. verrucosa (Koske y Walker) Walker y Sanders S. tricalypta (Herr.edu.

.

Las investigaciones deben ser diseñadas en forma de estudios a largo plazo donde intervengan especialistas en taxonomía y micología. (Wainwright. 1993).Capítulo 8 Hongos del suelo saprófitos y patógenos de plantas Ludwig H. por lo 243 . causando una notable reducción en las cosechas y afectando su calidad. 1997a y b). Para poder obtener una evaluación confiable de la diversidad de los hongos del suelo. principalmente para la mesofauna que habita en el suelo (Bonkowski et al.. grupos específicos o un conjunto de predictores. junto con una metodología precisa. actinomicetos (actinobacterias) y pequeños invertebrados. Las actividades agrícolas pueden afectar la diversidad de organismos presentes en el suelo. En los ecosistemas agrícolas. 2000). podrían ser una alternativa (Hyde. Cuando un estudio de largo plazo involucra varios especialistas no resulta viable. los cuales juegan un importante papel en el reciclaje de nutrientes o son mediadores del equilibrio entre los patógenos y sus antagonistas. 1988. Pfenning y Lucas Magalhães de Abreu INTRODUCCIÓN Los hongos del suelo juegan un papel clave en los procesos de descomposición que mineralizan y reciclan nutrientes de plantas. En el suelo. debido al tiempo y la limitación de los recursos. Lodge. los hongos interactúan con una compleja comunidad microbiana que incluye: bacterias. los patógenos de plantas actúan en el suelo y en la rizósfera. Los hongos son una parte importante de la cadena alimenticia en el suelo. La evaluación de la diversidad de hongos en suelos tropicales bajo diferentes usos de suelo es. El uso de organismos indicadores. existen dos condiciones básicas.

Una medida confiable de las comunidades de hongos en el suelo sin prejuicios requiere del seguimiento de un laborioso programa de aislamientos sistemáticos. Sin embargo.. han sido revisados por varios autores (Frankland et al. debido a que los medios de cultivo imponen nuevas condiciones selectivas y pueden introducir un sesgo en los análisis (Liu et al. 2004). Los procedimientos clásicos microbiológicos para estudiar los hongos del suelo se basan en cultivos que implican el aislamiento de propágulos microbianos o hifas activas que crecen en el suelo. 1992. Gray. tales como suelos que muestran limitaciones inherentes debido a la naturaleza de las especies y la inhabilidad de los medios de cultivo para copiar con exactitud los hábitats del suelo (Tsao et al. 1990. rizósfera y hongos rizoplanos. Se ha progresado considerablemente utilizando técnicas de lavado... Una visión global de los métodos para estudiar hongos patógenos de plantas en el suelo fue descrita por Singleton et al. tales como fila de Eubacterias. (1992). No obstante. Gams. 244 Manual de biología de suelos tropicales . medios de cultivo parcialmente selectivos y adictivos que reducen el crecimiento de ciertos grupos de hongos. con diferentes medios de cultivos y estrategias de aislamiento. Singleton et al. deben ser capaces de crecer en cultivos axénicos.. aún no están disponibles. y su crecimiento en un medio de cultivo axénico para su posterior identificación y cuantificación. Las metodologías para aislar y cultivar hongos de ecosistemas complejos. 1992. 2001). Los métodos utilizados para el aislamiento del suelo. 2000). 1983. 1996. un objetivo del proyecto CSM-BGBD. Muyzer et al. Cannon. Dentro de este grupo se encuentran grupos filogenéticamente diversos. Los métodos estándares aceptados para inventariar la diversidad de hongos o para evaluar su impacto en varias prácticas agrícolas u otras actividades humanas. Bridge y Spooner. 2000. Davet y Rouxel. 1993. por lo tanto. 1997). 1990.. afirmaciones genéricas de que únicamente el 1% de los “microorganismos” del suelo son cultivables aumentan la dificultad y no tienen en cuenta la inmensa diversidad biológica que realmente representan dichos microorganismos (Rondon et al.. la mayoría de los hongos que habitan en el suelo pueden ser considerados saprotróficos. puede no ser representativo de la dinámica de las comunidades del suelo. Bills et al.tanto. Incluso el análisis de abundancia relativa de especies cultivables recuperadas del suelo. un grupo monofilético de organismos de hongos obligados asociados a las raíces de las plantas (véase Capítulo 7)... que cubran las diferentes idiosincrasias de la diversidad taxonómica y grupos fisiológicos de hongos presentes en los ecosistemas del suelo. junto con muchos grupos homogéneos como el filum Glomeromycota.

Por ello. generalmente aceptados. poca información acerca de las especies de hongos involucrados en dichos procesos. animales y otros microorganismos.. El objetivo principal es contribuir al establecimiento de una serie de métodos estándares. LA IMPORTANCIA ECOLÓGICA DE LOS HONGOS DEL SUELO El suelo es un hábitat o ecosistema. además. 2006). se requieren los procesos de aislamiento e identificación tradicionales (Brodie et al. estos métodos proporcionan. exudados. es necesario adoptar métodos similares dentro de los proyectos cooperativos o multidisciplinarios para garantizar la comparación de los datos en un futuro. por lo tanto. para un mejor entendimiento de la estructura y función de las comunidades de hongos del suelo. Por esta razón.. se han aplicado métodos que dependen del análisis de la biomasa microbiana del suelo. No obstante. 2003. esta característica complica las definiciones y la metodología. cada método presenta ciertas preferencias a ciertos grupos específicos de hongos. En este capítulo se hace referencia a algunos de los métodos más comunes y también a algunas técnicas menos conocidas para la evaluación y monitoreo de comunidades de hongos del suelo. 1998. Los resultados obtenidos de un estudio de hongos del suelo dependen. principalmente. En general. pequeños invertebrados y contenidos intestinales. microorganismos. y no un sustrato. junto con minerales y agua.Otras metodologías que han sido desarrolladas se enfocan en el análisis de la actividad de los hongos y su papel en los procesos biogeoquímicos que ocurren en el suelo. Las fracciones orgánicas se componen de material de plantas en diferentes fases de descomposición. el suelo alberga una parte considerable de la biodiversidad total de hongos. Houston et al. También son tomados en cuenta los principios y aplicaciones de herramientas moleculares en los estudios de comunidades de hongos del suelo. Aunque este enfoque no es exhaustivo. por sí solos. porque el suelo representa una mezcla compleja de fracciones orgánicas e inorgánicas con agua y organismos vivos. 1973. Brodie et al.. intenta ofrecer una visión global de los procedimientos disponibles. de los métodos utilizados. se deberá tomar en cuenta que el suelo no es un sustrato. respiración del suelo.. reciclaje de nitrógeno y contenido de ácidos grasos del hongo o de observaciones directas del crecimiento del micelio en partículas de suelo (Widden y Parkinson. Malosso et al. sino un ecosistema compuesto por una mezcla de sustratos más diversos que incluyen partes de las plantas vivas y muertas. y no existe ninguna estimaHongos del suelo saprófitos y patógenos de plantas 245 . 2003). Con estos fines. raíces vivas.

por ende. aunque la mayoría ataca una amplia gama de plantas hospederas. Mazzola. 1993). 2004). 1988. 2001.. mineralizando y reciclando los nutrientes de las plantas (Wainwright. cabe mencionar que los hongos son responsables de la degradación de xenobióticos y contaminantes orgánicos introducidos en el suelo (Bordjiba et al.ción fidedigna del número de especies de hongos del suelo (Hawksworth. 1980. 1997. una mejor estructura física del suelo y el control de antagonistas de los patógenos de las plantas en el suelo. 2003). los zygomycetes usan carbohidratos simples. 2002.. Schneider. Lodge. plantas utilizadas como cubierta vegetal y la diversificación de cultivos.. causando que las plántulas se marchiten y.. Éstos pueden ser específicos. 2003. Hawksworth y Rossman. 1997).. Zak y Visser. por tanto. beneficiar directamente la agricultura sustentable. Los hongos también constituyen una parte importante de la cadena alimenticia dentro del suelo. provocan grandes pérdidas. Barratt et al. por ejemplo. 1996. Existen evidencias de que las prácticas agrícolas causan más alteraciones cuantitativas que cualitativas en la comunidad de microhongos del suelo (Pfenning. Rodrigues-Guzman. en la rizósfera o infectan tallos. Lodge. En sistemas agrícolas. tales como la incorporación de materia orgánica. 1993. pero también es posible que se mantenga o incremente con algunas prácticas agrícolas específicas. Se ha demostrado experimentalmente que la introducción de antagonistas específicos como Trichoderma spp. 246 Manual de biología de suelos tropicales . 1984. mediante el suministro de nutrientes. Algunos elementos biológicos han sido identificados como los principales factores de la supresión de enfermedades (Chet y Baker. 2007. 1997). o Coniothyrium minitans pueden reducir la incidencia de una variedad de enfermedades en el suelo (Whipps et al. Los saprófitos tienen una especificidad limitada por sustratos.. Beare et al. La supresión de patógenos de plantas puede resultar intrínseca en los suelos. 1991. los patógenos de plantas y sus antagonistas son particularmente importantes. 2001).. Los hongos del suelo juegan un papel clave en los procesos de descomposición. especialmente en el caso de la mesofauna (Bonkowski et al. El mantenimiento de la diversidad de hongos del suelo debería. 2000). mientras los ascomycetes descomponen principalmente celulosa y hemicelulosa (Domsch et al. Silva et al. Los patógenos de plantas actúan en el suelo. Con relación al papel de los organismos descomponedores. 1997).

Kirk et al. Los hongos del reino Protozoa no son numerosos. 2001.. Hongos del suelo saprófitos y patógenos de plantas 247 . 2002).. así como otros géneros patógenos de plantas. 2001). Moreira y Siqueira.ASPECTOS DE SISTEMÁTICA MODERNA Protozoa Los organismos conocidos como hongos actualmente se agrupan en tres reinos. tales como Spongospora subterranea. Plasmodiophora brassicae o Polymyxa graminis. Chromista Los hongos que son derivados de algas y que contienen celulosa como el mayor componente en su pared celular pertenecen al reino Chromista Filum Oomycota (Dick. Dentro del grupo de los Oomycetes del suelo es posible encontrar saprófitos. Por sus características biológicas requieren de técnicas específicas para su aislamiento y caracterización. Los hongos llamados mohos mucosos -un grupo de organismos heterogéneos y polifilético. otros habitan en el suelo. A pesar de que estos hongos representan un grupo delimitado de acuerdo con sus características y filogenia. 2001). aunque algunos de ellos son importantes patógenos de las plantas del suelo. Dentro de este reino se reconocen cinco fila: los géneros que pertenecen al filum Glomeromycota forman micorrizas arbusculares y no crecen en ausencia de su planta hospedera (Schußler et al. su hábitat e importancia ecológica son variables. La detección de estos organismos requiere de bioensayos o cebos. aunque también pueden encontrarse en el suelo.habitan en restos de plantas. Glomeromycota Los hongos clasificados en el reino Fungi se caracterizan por tener quitina como el mayor componente en su pared celular.. 2001. Mientras que algunos son verdaderos hongos acuáticos asociados con restos de plantas en agua o con patógenos de otros organismos acuáticos. Trabajar con este grupo de simbiontes biotróficos obligados requiere del uso de diferentes técnicas específicas. como se discutió en el Capítulo 7. Estas especies se clasifican en la clase Plasmodiophoromycetes. con un sistema de clasificación filogenético (Kirk et al. las cuales se presentan en la sesión “Procedimientos basados en cultivos”.

2006) y en la mayoría de los casos por la formación de un cuerpo fructífero. 1998) que no son consideradas en este manual. Los patógenos de plantas importantes en el suelo son especies de Rhizoctonia y Sclerotium. Especies de los géneros Absidia. Basidiomycota El filum Basidiomycota se caracteriza por el basidium. La fase asexual de los ascomycetes se llama anamórfica y es la fase más comúnmente encontrada. Varias de estas especies se conocen como trasmisores de virus patógenos de plantas (Krik et al. algunos de estos hongos habitan en el suelo. Para fines prácticos. en el suelo y en restos de plantas. Zygomycota Representan el filum Zygomycota y se consideran como hongos de azúcar por su preferencia por carbohidratos simples y por su crecimiento vigoroso en un cultivo axénico. Se caracterizan por la formación de las ascas.. por lo general. distinguir los grupos más importantes. El micelio vegetativo se desarrolla. una estructura formada durante la fase sexual de su ciclo de vida. Mucor. La evaluación de la diversidad de estos hongos y el monitoreo de su impacto en la comunidad requieren de técnicas específicas (Rossman et al. Gongronella. un meiosporangio en el que generalmente se forman cuatro esporas sexuales (Bauer et al. Mortierella o Rhizopus son muy comunes en el suelo y se encuentran en casi todos los estudios de hongos de suelo. tales 248 Manual de biología de suelos tropicales .. Muchos de ellos forman ectomicorrizas en asociación con el sistema de raíces de árboles forestales. insectos. La filogenia de este grupo aún es objeto de discusión y de revisión. Cunninghamella. Ascomycota El filum Ascomycota representa el grupo más abundante de hongos.Chytridiomycota El único grupo dentro del reino de los hongos que forma esporas flageladas es el filum Chytridiomycota.. plantas u otros hongos. 2008). pero normalmente son acuáticos y viven como saprófitos o parásitos de otros organismos como nematodos.

espátula. ascomycetes que forman un asca en un cuerpo fructífero cleistotecal. a una profundidad de 20 cm en 12 puntos distribuidos en cada parcela de muestreo de acuerdo con el esquema mostrado en el Capítulo 2. preferentemente a 4°C y congelarse lo más pronto posible para su futuro procesamiento.como plectomycetes. Debido a su pequeño tamaño y estructura poco diferenciada. MUESTREO DE SUELO Utilizando un nucleador se extraen pequeñas cantidades de suelo. pyrenomycetes y loculoascomycetes puede ser útil. tres o más muestras compuestas podrán colectarse en cada punto de muestreo. De manera alternativa. 2008).) deberán lavarse antes y después de tomar las muestras. pertenecen a los plectomycetes. La hojarasca deberá ser removida justo antes de extraer la muestra. Probablemente. debido a que la micobiota de la rizósfera es altamente influenciada por las especies de plantas. el grupo más grande de hongos encontrados en el suelo son los pyrenomycetes anamorfos (Krik et al. Hongos del suelo saprófitos y patógenos de plantas 249 . utilizando plantas altamente susceptibles. la detección y el monitoreo de los hongos de organismos protistas como Spongospora y Plasmodiophora puede llevarse a cabo mediante bioensayos. en caso de que se haya previsto realizar otros análisis físicos y químicos del suelo.. pueden resultar contraproducentes para la recuperación de especies de hongos. con el fin de evitar la contaminación entre puntos de muestreo. Todos los materiales de muestreo (nucleador. Algunos de los ascomycetes como Aspergillus y Penicillium que habitan en el suelo. las muestras del suelo deberán trasladarse al laboratorio utilizando un recipiente con aislamiento. Para la extracción del DNA. También se recogerá una segunda muestra compuesta de alrededor de 200 g. a pesar del uso de antibióticos en los medios de cultivo. etc. La rizósfera también contiene una alta concentración de bacterias que. discomycetes. Cada juego de 12 muestras se homogenizan para formar una muestra compuesta de alrededor de 500 g que se coloca en una bolsa de plástico. si los recursos lo permiten. EVALUACIÓN DE LOS HONGOS DEL SUELO: PROCEDIMIENTOS BASADOS EN CULTIVOS Todos los métodos propuestos dependen de muestras del suelo y no contemplan el uso de raíces para aislar hongos del suelo. azadón.

Oomycota: uso de cebos para el aislamiento de Pythium y Phytophthora Para poder recuperar del suelo los oomicetes es aconsejable el uso de plantas susceptibles o tejidos vegetales. Después de incubar durante tres a cinco días. en la sección de color de este manual. Chytridiomycetes) de muestras ambientales aparece en la ilustración 6. en la última ilustración F). Especies de Pythium y Phytophthora pueden causar serios daños a plantas cultivadas. Las hojas de zacate como cebo pueden ser sustituidas por pedazos de frutas o verduras como pepino. 1998. Las muestras son incubadas durante tres a cinco días a 25°C en la oscuridad. Se añaden granos de sorgo como cebo y se incuban por cinco días. Edena et al.. se observa la liberación de zoosporas de Pythium. Alícuotas de 2 g de suelo se traspasan a cajas Petri que contienen agua estéril destilada.1 para la composición del medio)..5 g colocadas en tubos de ensayo de vidrio esterilizado con 3 ml de agua estéril. 2000). la B) una muestra de agua con cebo. La ilustración A) representa una muestra de suelo con cebo. Este procedimiento deberá continuarse durante varias semanas. Se esterilizan en autoclave fragmentos de hojas de zacate y se añaden a los tubos como tejidos para recuperar el Pythium spp. Al final de dicho procedimiento se deberá observar que se obtiene únicamente un aislamiento para cada placa. la C) muestra un cultivo puro en el cebo y en la D) se observa el esporangio de Phytophthora. mientras que el oogonio y anteridio de Pythium se ilustran en E)”. las porciones de agar que contengan micelio serán transferidas a placas con agua estéril destilada y con dos mitades de semillas de sorgo. El micelio en crecimiento se verifica directamente mediante montajes con agua en un microscopio o se transfiere del cebo al medio de aislamiento (AHM) que contiene cloranfenicol (50 mg L-¹) y benomil (10 mg L-¹) (Marks y Mitchell. Los tejidos infectados deben transferirse en agua estéril con el antibiótico cloranfenicol durante unas horas.. El aislamiento de hongos zoospóricos (Oomycetes. después se comprueba la presencia de micelio en el cebo. Gams et al. Otra técnica con sustrato susceptible utiliza muestras de suelo húmedo de 0. tomate o papa. Pueden llevarse a cabo ensayos cuantitativos utilizando la frecuencia de la colonización relativa de los tejidos del cebo entre las réplicas de cada muestra de suelo. agar dextrosa y papa (ADP) o agar de papa y zanahoria (en el caso de Pythiaceae) (véase Apéndice 8. El micelio del hongo formado en el sustrato deberá traspasarse a charolas con el medio MP5 (en el caso de Saprolegniaceae) y agar con harina de maíz (AHM). Tsao et al. 250 Manual de biología de suelos tropicales . 1970. 1983. finalmente.

5 mm. (2002). Técnica de cebo Se mezcla 1 g de semillas de betabel con 100 g de suelo húmedo en cajas Petri. Como el aislamiento de colonias individuales en un medio de cultivo axénico es difícil. Método de partículas de suelo Una suspensión de 10 g de muestra de suelo y agua de la llave es agitada. la caracterización e identificación se hace directamente en el cebo.. y pedazos de frutas y verduras (Gams et al. Para su preservación. Basidiomycota – Rhizoctonia: técnica de cebo y aislamiento directo de partículas de suelo Para evaluar este género de basidiomicetes anamórficos del suelo. se recuperan las semillas con un tamiz de 1. compilados por Sneh et al. se lavan con agua destilada durante Hongos del suelo saprófitos y patógenos de plantas 251 . 1991). Después de un periodo de incubación de 24 a 48 horas. Los cebos más apropiados incluyen cáscara de camarón. A continuación. se describen varios métodos.5 mm. Después de un periodo de incubación de 48 horas a 25°C. a 25°C. se evalúa la frecuencia de la colonización en las partículas del suelo y el micelio se transfiere a ADP para su eventual caracterización (Sneh et al.. se verifica el crecimiento típico de Rhizoctonia. después decantada usando un tamiz de 0. Las partículas de suelo retenidas se secan con papel absorbente estéril y se transfieren a una caja Petri de 15 cm de diámetro que contenga un medio de agar con agua acidificada (al 2%) con 250 mg L-¹ de cloranfenicol. (1991). piel de serpiente. se presentan dos métodos de aislamiento útiles. Un método para evaluar la densidad de inóculo de Rhizoctonia spp. 1998).Uso de cebos para el aislamiento de Chytridiomycota Para evaluar los Chytridiomycota se usan las mismas técnicas empleadas para los oomicetos. en suelos de jardines de eucaliptus clonados fue descrito recientemente por Sanfuentes et al. los cebos pueden transferirse a viales. alas de insectos. posteriormente. El suelo retenido se resuspende y se pasa varias veces por el tamiz.

La frecuencia de colonización de partículas de suelo para cada especie de hongos es utilizada en ensayos cuantitativos. ha mostrado severas limitaciones debido a la continua presencia de Trichoderma spp. se secan con papel absorbente estéril para ser transferidas a un medio de agar con agua al 2%. Después de la sedimentación de las partículas del suelo durante 2 minutos. más estreptomicina plus (50 mg L-¹) para la inhibición de bacterias y ciclosporina (10 mg L-¹) o rosa de Bengala (70 mg L-¹). 0. Técnica de lavado Una muestra de 10 g de suelo mineral se agita con 200 ml de agua destilada en una centrífuga a 180 rpm durante 10 minutos. como la amplificación de DNA ribosomal de Rhizoctonia con iniciadores (en inglés.7 mm. el sobrenadante se desecha y se repite el procedimiento dos veces. De esta manera. 2002). La técnica de lavado de suelo es un método adecuado para el aislamiento de estas especies. Las partículas de suelo prelavadas son filtradas. en estos suelos. Cuando se emplea ciclosporina se logra una supresión casi completa 252 Manual de biología de suelos tropicales . utilizando un juego de tamices de 1. para la inhibición de hongos de rápido crecimiento. el empleo de técnicas de cultivo independiente. su aplicación en el estudio de suelos bajo vegetación natural. Los coloidales de suelo y granos de arena son removidos del último tamiz.20 minutos.0 mm.21 mm usando agua destilada (alrededor de 2 litros) por 2 minutos.. fitopatógenas y sus antagonistas. El crecimiento de Rhizoctonia se verifica y se transfiere micelio a ADP para su aislamiento y caracterización (Papavizas et al. Todas estas especies exhiben una fase saprotrófica en el suelo y pueden ser aisladas utilizando una metodología con placas de suelo. 1975). A pesar del uso común de varios métodos para el aislamiento de Rhizoctonia de muestras de suelo agrícola. que contenga 100 mg L-¹ de cloranfenicol. entomopatógenas. Ascomycota: técnica de lavado del suelo y filtración de partículas Éste es el mayor grupo de hongos del suelo que incluye especies saprófitas. secados con papel absorbente esterilizado y transferidos (7 partículas por placa) a 5 cajas Petri (90 mm) que contienen el medio de aislamiento AHM (30 g L-¹). primers) específicos y su análisis cualitativo e incluso cuantitativo puede resultar idóneo bajo circunstancias específicas (Lees et al.5 mm y 0.. por el grupo de investigadores involucrados en el proyecto. 0.

de zygomycetes saprotróficos. Este método se puede observar en la ilustración 7. 2004). la cual se mantiene en agitación durante unos momentos. éstos pueden contener fuentes de carbono preferiblemente metabolizados por algunos grupos fisiológicos de hongos o pueden modificarse con químicos que inhiben el crecimiento de organismos no deseados. el resultado es una estimación del número de propágulos de hongos por gramo de suelo (Bills et al. Ascomycota: medios selectivos y técnica con cebo Para un aislamiento selectivo de grupos blanco o especies de hongos del suelo. 1985). 2003). Bååth. 1994. Las alícuotas de la dilución final son distribuidas en cajas Petri que contienen un medio de agar generalmente. 1988. rutinariamente se utilizan medios selectivos. por el factor de dilución empleado. Básicamente. Se pueden lograr medidas cuantitativas multiplicando el promedio de las unidades formadoras de colonias (UFC) en las placas. 1992. estreptomicina o penicilina para inhibir el crecimiento de bacterias. Lang y Jagnow. se toma 10% de la suspensión. Gams. El método de dilución del suelo en placa Este es el método de uso más común para el aislamiento y estimación cuantitativa de bacterias y hongos. Por lo tanto. la diversidad de hongos que normalmente existen en forma de micelio que crece activamente en el suelo. Tsao et al. Gams et al. 1986. Un gran número de medios selectivos ha sido desarrollado para el aislaHongos del suelo saprófitos y patógenos de plantas 253 . La técnica es muy simple y se han descrito varias modificaciones. Un factor final de dilución de 10-4 ó 10-5 se considera adecuado para el aislamiento de hongos (Dhingra y Sinclair. 1998.. cuando se trata de estudiar este último grupo de hongos. Kacprzak y Stanczyk-Mazanek.. se debe evitar el uso de ciclosporina (Dhingra y Sinclair. 1988. una cantidad conocida de suelo es suspendida en agua estéril. Bills y Polishook. modificado con antibióticos como cloranfenicol. y que tienen poca habilidad de competir con especies de rápido crecimiento en medios axénicos son subestimados por esta técnica (Bååth. hasta lograr la dilución final.. Existe una preocupación generalizada porque el método de dilución en placas muestra un sesgo hacia los hongos que son capaces de producir grandes cantidades de esporas y que crecen muy rápido en un medio de cultivo rico. 1985. 1983). De esta suspensión se prepara una serie de 10 diluciones. Por lo tanto.

El aislamiento selectivo de los hongos del suelo también puede llevarse a cabo con cebos que son colonizados por grupos fisiológicos específicos de hongos. Thorn et al. mientras que para Fusarium spp. Procedimiento para el aislamiento para el aislamiento de Cylindrocladium y géneros afines del suelo. Tsao et al. A pesar de ello. 2001. 1991. 1975. 1977.. 1998. Edena et al. Barratt et al. En el laboratorio se utilizan hojas de ricino (Ricinus communis) como cebo para el aislamiento de hongos del complejo Cylindrocladium de manera rutinaria. 2003. Sneh et al. Ejemplos de cebos utilizados para el aislamiento selectivo de hongos del suelo son tejidos de plantas para el caso de patógenos de plantas.1987. 1983. 2000. Dackman et al. basidiomycetes y oomycetes del suelo... 1996.. quitina para los productores de quitinasa. 2003)... para el aislamiento de Rhizoctonia solani se utiliza agua-agar acidificada.. Como el Cylindrocladium y probablemente otros géneros son sensibles a la ciclosporina.miento de varios géneros de ascomycetes. Hojas jóvenes y frescas se recogen y se lavan bajo agua de la llave para posteriormente ser sometidas a una desinfección con etanol al 70% durante un minuto. La colonización del cebo por un hongo clave también puede llevarse a cabo mediante la observación directa al microscopio (Gams et al. el medio usado es Komada (Masago et al. varios materiales de plantas adecuados para su aislamiento fueron descritos en una monografía reciente (Crous. larvas de insectos para los entomopatogénos y nematodos para los hongos nematófagos (Marks y Mitchell. 2002b). 2002. 1985. deberán aislarse selectivamente usando cebos. Gonçalves et al. 2001). especies de Cylindrocladium y de las especies relacionadas Cylindrocladiella y Gliocladiospsis raramente son reportadas en muestras de suelo que emplean el método de dilución del suelo por placas. después se transfiere a un medio selectivo de agar para su posterior aislamiento de los hongos deseados. cabello para las especies queratinofílicas. 1991. el tejido cebo es incubado con una muestra de suelo durante unos días. Gams et al. en particular. Edel et al. Wellington et al.. Sneh et al. 1998)... Dhingra y Sinclair. cuyo protocolo se describe a continuación. por ejemplo.. 254 Manual de biología de suelos tropicales . En la mayoría de los casos.. Pettitt et al.. Papavizas et al.. aquéllos que contienen especies patógenas de plantas. utilizando como cebo hojas de Ricinus communis Cylindrocladium es un género conformado por especies saprotrófitas y patógenas de plantas comúnmente encontradas en el suelo.. 1970.

Hongos del suelo saprófitos y patógenos de plantas 255 . Además de las claves y monografías de alrededor de 250 géneros.seguida de hipoclorito de sodio al 3%. síntomas de podredumbre. tal como ADP y AM (agar extracto de malta) que contiene cloranfenicol (250 mg L-¹). Gliocladiospsis y otros géneros relacionados. después de tres días de incubación se lavan las hojas cuidadosamente con agua destilada y se transfieren a una cámara húmeda. durante 30 segundos). Las hojas enteras se colocan un una caja Petri de 15 cm y se cubren con una capa de suelo húmedo.. endófitos y patógenos de plantas. es recomendable para su aislamiento el uso de plántulas de tomate como cebo.. 2001. este compendio contiene claves para especies de varios géneros importantes y una recopilación de la literatura. Después de más de 20 años. 1998. (2007) aún sigue siendo una fuente importante para todos los involucrados en el estudio de hongos del suelo. durante dos minutos. El aislamiento del hongo se logra con la transferencia de esporas a un medio de cultivo. utilizando agujas finas de cristal. el amplio trabajo de Domsch et al. enseguida se lavan con agua destilada y se secan en papel absorbente esterilizado para ser transferidas a un medio de aislamiento. incluyendo hongos del suelo. por lo tanto. bajo un microscopio estereoscópico (Gams et al. Gonçalves et al. Crous. Cylindrocladiella. 2002b). IDENTIFICACIÓN DE HONGOS DE SUELO La identificación de hongos que habitan el suelo puede causar problemas para aquéllos que no tengan suficientes conocimientos de micología. Técnica de cebo para el aislamiento de patógenos fúngicos de plántulas Una amplia gama de hongos patógenos de plantas en el suelo puede causar la muerte prematura de las plántulas. Las hojas utilizadas sin desinfección previa tienden a ser degradadas con mayor rapidez y a ser colonizadas por bacterias. Las semillas de tomate se germinan en 100 g de suelo y se verifica si las plántulas manifiestan o no. que es un grupo heterogéneo que incluye saprófitos. donde diariamente se verifica la esporulación típica de Cylindrocladium. Los tejidos de plántulas infectadas se esterilizan con hipoclorito de sodio (al 2%. Las dificultades de identificar a nivel de especie se ilustran con el género Fusarium. El trabajo de Barnett y Hunter (1998) es usado para unos pocos de los muchos saprófitos.

2000). (1998). 2001. recientemente. Existen monografías disponibles para chyrids (Karling 1977) y también para el género Pythium (Waterhouse. Una lista de referencias de guías y manuales para la identificación de grupos de hongos de suelo puede consultarse al final de este capítulo. 1981) y para Phytophthora (Waterhouse.. éstos incluyen técnicas específicas de DNA. hifas anamórficas pigmentadas (Ellis. (Klich y Pitt 1988). Se pueden utilizar otras metodologías para complementar los enfoques tradicionales usados para un mejor entendimiento de la diversidad y dinámica de los hongos del suelo. sí. van der Plaats-Niterink. No obstante. Tsao et al. las monografías y claves de Hanlin (1990. 1983.. Samson et al. 1980. Nag Raj. b) pueden ser un buen punto de partida. Samuels et al. Cylindrocladium (Crous. EVALUACIÓN DE HONGOS DEL SUELO: TÉCNICAS ESPECÍFICAS DE DNA Una medida confiable de las comunidades de hongos del suelo. 2004).Monografías y páginas web se encuentran disponibles para identificar las especies de Aspergillus. Trichoderma (Bissett. 2001). 1971. 1996). Muyzer et al.. (2000) o el manual de Gams et al. 1998a.. Fusarium (Leslie et al. en ensambles de hongos a partir de muestras ambientales. Las herramientas moleculares basadas en el análisis del DNA han sido aplicadas con éxito en el estudio de complejos bacterianos y. 1983. La monografía de Sheh et al. Bills et al. algunos tipos de hongos como Basidiomycota son difíciles de aislar y pueden no esporular en un medio axénico (Thorn et al. No son específicas para el caso de hongos del suelo. c. Para más instrucciones acerca de cómo identificar hongos o grupos específicos de hongos. Erwin y Ribeiro. Si se trata de identificar ascomycetes. Penicillium (Pitt. (1991) resulta útil para trabajar con Rhizoctonia. Bridge y Spooner. 1967. 1970. Las secuencias de DNA son amplificadas directamente desde el suelo por medio de la reacción en cadena de 256 Manual de biología de suelos tropicales . (página web). 1991a. 1968.. b. 1976) y coelomycetes anamórficos (Sutton.. sin embargo. 2002b). de mucha utilidad para este tema otras recopilaciones y monografías como la de Ellis y Ellis (1985). 1993). 1993. 1984.... requiere de un laborioso programa de aislamientos sistemáticos con diferentes medios de cultivos y estrategias de aislamiento que reflejen la inmensa diversidad taxonómica y fisiológica de grupos de hongos que habitan en el suelo (Tsao et al. se puede consultar el Dictionary of the Fungi (Kirk et al. 2006). 1996)..

facilitando la amplificación de pequeñas muestras de DNA. 2001). incluso como micelio o esporas.. Bridge y Spooner. Las células de los hongos presentes en la muestra del suelo. Viaud et al. 2000. Los kits para la extracción de DNA del suelo están comercialmente disponibles. Los protocolos de extracción se basan.8S y 28S se considera que son altamente conservados entre los organismos eucarióticos y normalmente se emplean como marcadores moleculares. El total de DNA obtenido debe estar completamente purificado para eliminar sustancias húmicas y fenólicas que interfieren con el PCR.. La identificación de secuencias de DNA desconocidas también puede realizarse comparándolas con bases de datos de secuencias de nucleótidos de taxones conocidos.. El rDNA también contiene espaciadores entre las regiones codificantes conocidos como espaciadores internos de transcripción (ITS) que presentan secuencias de bases menos conservadas y que pueden utilizarse para la diferenciación entre especies relacionadas o para evaluar Hongos del suelo saprófitos y patógenos de plantas 257 . este paso se logra mediante separaciones a través de columnas de separación o con el uso de kits comerciales de purificación de DNA (Liu et al. 5. Varias copias del DNA ribosomal (rDNA) se encuentran en el genoma eurocariota. El polimorfismo en la longitud del DNA y la variación en la secuencia de las bases pueden utilizarse para agrupar organismos de acuerdo con su origen y relación evolutiva.la polimerasa (PCR) y posteriormente caracterizadas utilizando varios enfoques (Bridge y Spooner. 2001). Extracción de DNA Un paso crucial antes del PCR. 1997. en los procesos físicos de macerado asociado con calor y lisis química. La heterogeneidad encontrada a nivel de micro-escala en el suelo debe ser considerada cuando se selecciona el tamaño de la muestra de suelo sometida a la extracción total de DNA. principalmente. es la extracción del DNA directamente del suelo. Reacción en cadena de la polimerasa. debido a una variabilidad más alta dentro de la muestra (Ranjard et al. 2001). Uso de Primers específicos para “hongos” El grupo de genes para las moléculas de RNA Ribosomales 18S. tienen que estar correctamente lisadas. Las muestras muy pequeñas (menores a un gramo) deben usarse con precaución porque tienen mayor probabilidad de error.

no son adecuados para la evaluación de muestras ambientales complejas. La detección y/o cuantificación de pocas especies específicas de hongos es requerida generalmente en el campo de la fitopatología. utilizando Primers específicos para Géneros y/o especies de interés (Nechwatal et al. algunos de estos Primers específicos han mostrado que amplifican DNA no fúngico o muestran preferencia hacia la amplificación de grupos taxonómicos específicos dentro del reino de los hongos (Smit et al. 1999. conectados a vectores plásmidos y clonados en células bacterianas. los Primers que son específicos para amplificar PCR del DNA de hongos de muestras complejas de suelo. 2002). Basándose en las secuencias de genes de RNA ribosomal disponibles en bancos de datos especializados para varias especies de hongos. Filion et al.. la detección molecular de muestras de suelo puede ser mejorada mediante el uso de técnicas de cebo en conjunto con PCR. Sin embargo.. son difíciles de detectar por métodos moleculares. 2000. Como el suelo contiene un gran número de organismos. han sido desarrollados y compilados por Anderson y Cairney (2004).... Anderson et al. El DNA clonado es secuenciado y comparado con las bases de datos que contienen secuencias oligonucleotídicas del rDNA fúngico mediante análisis de software. además. Algunos hongos que están presentes en muy bajas densidades en suelos naturales. Por 258 Manual de biología de suelos tropicales . 2000. 2002. 2003). los amplicones de tamaño correcto pueden separarse en geles de agarosa. Baayen et al. consumen tiempo y. Secuenciación del DNA Para poder conocer las identidades del DNA de los hongos amplificados por PCR.divergencias genéticas intraespecíficas (Viaud et al. Para este tipo de investigación se han desarrollado varios iniciadores especie-específicos para una detección directa y el monitoreo de patógenos de estas plantas a partir de muestras del suelo (Cullen et al.. Down. 2001). extraídos de matrices de gel. Estos procedimientos son caros. 2000. 2002. purificados. Borneman y Hartin. ya que el PCR tiende a amplificar moléculas del DNA que son dominantes en el extracto del DNA total... el obtener Primers o iniciadores de rDNA de hongos específicos constituye un paso fundamental en la amplificación del PCR. tales como especies de Phytophthora. En el caso de estos hongos. Lees et al. Los Primers permiten la amplificación de una amplia gama de especies de hongos sin perder la especificidad de este grupo clave. 2003).

. generalmente. Las restricciones y limitaciones están representadas en la selección de Primers utilizados en el primer paso de amplificación después de la extracción total del DNA de las muestras... se han desarrollado técnicas moleculares de huella o rastreo molecular (en inglés fingerprint) para estudiar la diversidad a nivel de comunidad (Borneman y Hartin. 2003). pero con diferentes secuencias de pares de bases. Los iniciadores usados en el PCR. 1993). En varios estudios se ha usado esta técnica para evaluar la estructura de la comunidad de hongos y otros microorganismos. El gradiente de desnaturalización en DGGE puede variar con el uso de diferentes cantidades de urea y de formamida en la matriz del gel. el DNA se extiende a la misma longitud (como resultado del PCR). 1999. Bajo estas condiciones de desnaturalización. 2000.. Por lo tanto. Hongos del suelo saprófitos y patógenos de plantas 259 . y se llaman dominios de fusión. Los patrones de bandeo generados son utilizados para analizar complejas comunidades de hongos del suelo. Anderson et al..ello. 2002. las moléculas 18S DNA amplificadas por PCR son sometidas a una electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) o con un gradiente desnaturalizante (DGGE). 2000. Los amplicones tienen exactamente el mismo número de nucleótidos. 2004). 2000. Milling et al. al igual que para monitorear modificaciones o impactos debidos a prácticas agrícolas o actividades industriales (Smit et al. lo que determina el modo de desnaturalización y la movilidad electroforética al migrar en el gel desnaturalizante. En esta técnica. Gomes et al. moléculas de DNA con diferentes secuencias en sus pares de bases. Varias combinaciones de Primers han sido propuestas para amplificar DNA de distintos grupos de hongos como Ascomycota.. Elsas et al. Vandenkoornhuyse et al. Basidiomycota.. Viaud et al. Método de huella molecular TGGE y DGGE La electroforesis en gel con gradiente de desnaturalización fue introducida en estudios sobre ecología microbiana por Muyzer y Smalla (1998). contienen un DNA con bases repetitivas de GC que resultan menos propensas a la desnaturalización debido a su alta estabilidad química. presentan diferentes comportamientos de desnaturalización y migran hacia diferentes puntos en el gel (Muyzer et al.. 2003. pero difieren en su contenido de Guanina-Citosina (GC). parcialmente desnaturalizadas debido a las diferencias de la desnaturalización de los dominios menos estables en las moléculas.

tales como TGGE y DGGE. Zygomycota y Oomycota (Nikolcheva y Bärlocher. No obstante. Técnica PCR-RFLP La escasa variabilidad de rDNA de hongos puede resultar desventajoso en la técnica de huella molecular. 2006). la comigración de diferentes moléculas de DNA hacia un mismo punto en el gel. la restricción enzimática del DNA antes de la electroforesis puede utilizarse en una técnica conocida como polimorfismo de longitud de fragmentos de restricción (RFLP) del DNA amplificado por PCR (Viaud et al. Otra limitante es que el DNA obtenido de organismos filogenéticamente distantes puede producir productos de PCR con una movilidad electroforética idéntica (Gomes et al.. Se puede construir una base de datos de TRFs a partir de especies de hongos conocidos y utilizarla en corre260 Manual de biología de suelos tropicales . el DNA es tratado con enzimas de restricción y los fragmentos de restricción separados en un gel de acuerdo con su tamaño. los análisis bioquímicos y las técnicas de aislamiento. 2006.. Singh et a. El uso de un PCR anidado puede arrojar aún mejores resultados e incrementar la resolución en la separación de los productos del PCR (Oros-Sichler et al. el método de huella molecular.Chytridiomycota. los enfoques polifásicos que incluyen la construcción de bibliotecas de fragmentos clonados. Para incrementar el polimorfismo de la banda y mejorar la resolución. En el T-RFLP. 2000). Recientemente. la técnica puede proporcionar un estándar altamente reproducible de un gran número de muestras ambientales durante un periodo de tiempo relativamente corto. (1997) desarrollaron una versión complementaria del PCR-RFLP. 2003).. 2001). 2004). 2006). Después de la amplificación. después de la amplificación del DNA por PCR directamente extraídos del suelo utilizando Primers género-específicos (Nechwatal et al. Los fragmentos de restricción terminal (TRFs) se marcan con fluorescencia y pueden ser detectados y cuantificados en un secuenciador automático... Las especies de hongos relacionadas pueden identificarse de acuerdo con sus patrones típicos de RFLP. por ejemplo. el DNA es amplificado por PCR con uno de los dos Primers marcados con fluorescencia. son la mejor opción (Malosso et al. llamada polimorfismo de longitud de fragmentos de restricción terminal para el análisis (T-RFLP) de comunidades bacterianas de muestras ambientales. T-RFLP Liu et al.l.

los diferentes fragmentos de ITS son separados en un gel y posteriormente detectados y cuantificados en un secuenciador automático (Ranjard et al. La Tabla 8.1 muestra algunos ejemplos de técnicas moleculares empleadas para el estudio de comunidades de hongos del suelo publicadas en años recientes. Edel-Hermann et al.. Kennedy et al. 1997. Después de la amplificación. 2004. están enfocados en una o en pocas especies de hongos presentes en el suelo. Viaud et al.. los fragmentos de DNA del mismo largo. 2006). Las moléculas de una sola hebra de DNA adquieren estructuras con dobleces únicos dictados por sus secuencias nucleotídicas y migran hacia puntos específicos en el gel.. 2005). El ARISA de hongos es una técnica altamente sensible. pero disímiles en su secuencia de pares de bases pueden ser fácilmente separados en SSCP por su diferencial de migración en el gel cuando existe la conformación de una sola hebra (Lee et al. el DNA fúngico es extraído del suelo y amplificado por PCR utilizando Primers específicos para la región ITS con uno de los Primers marcados con fluorescencia. el DNA amplificado es completamente desnaturalizado antes de ser sometido a una corrida de electroforesis. Singh et al. especialmente con hongos patógenos de plantas.laciones taxonómicas con los haplotipos detectados en el análisis T-RFLP (Brodie et al. En el análisis automatizado del espaciador intergénico ribosomal (ARISA). 2005). 2001). Kennedy et al.. SSCP Otro estudio de huella molecular utiliza la migración diferencial de moléculas de una hebra de DNA en un gel para poder estudiar a las comunidades microbianas más complejas. En el polimorfismo de conformación de cadena sencilla (SSCP)... 2000. En estos esHongos del suelo saprófitos y patógenos de plantas 261 . Como consecuencia. ARISA El polimorfismo natural de la región ITS del rDNA entre especies de hongos puede utilizarse para la evaluación de comunidades de hongos de suelo. He et al. Lowell y Klein 2001. 2003. PCR cuantitativo Algunos estudios.. sin embargo. el polimorfismo intra-específico del ITS puede presentar problemas en la separación de distintas especies filogenéticas (O’Donnell y Cigelnik... 1996. 2005.

Después de esta amplificación. se deben diseñar Primers de PCR específicos para obtener la amplificación correcta del DNA de la especie clave y otros marcadores moleculares pueden ser empleados como secuencia del gen β-tubulina o el factor de elongación de traducción del gen EF 1-α (Baayen et al. 2002). a una cantidad estándar de una muestra de DNA en una serie de PCRs y con el monitoreo de productos PCRs competitivos producidos en cada reacción (Siebert y Larrick. No obstante. 2003. Esta técnica es más rápida y más sencilla que cPCR porque no existe la necesidad de construir un competidor de DNA y no se requiere de ningún análisis post-PCR (Cullen et al.. 2002. lo cual puede calibrarse y medirse con precisión. 2003). En el caso de ensayos cuantitativos. Lees et al. Baek y Kenerley. 262 Manual de biología de suelos tropicales ... 2002. por lo tanto. Filion et al. Li y Hartman. Las sondas fluorescentes son capaces de emitir fluorescencia en la presencia de DNA de dos hebras. han sido desarrolladas modificaciones del PCR convencional como PCR competitivo (cPCR) y PCR en tiempo real.. 2002. En el cPCR. Una curva estándar puede construirse con cantidades conocidas de DNA e intensidades de fluorescentes. los distintos productos de PCR son cuantificados por separado de acuerdo con sus intensidades de bandeo relativas en geles de agarosa. Después de un número definido de ciclos de PCR éstos se usan para cuantificar el DNA directamente de muestras de suelo. Filion et al. 2000. fragmentos de DNA que contienen los mismos sitios iniciadores que la muestra de DNA son añadidos en cantidades conocidas a las reacciones del PCR y coamplificados con el DNA específico.. Además de la detección molecular.. 2003).. 1992. La cantidad de DNA en la muestra puede calcularse con la adición de diferentes cantidades de DNA competitivos. Otro método empleado en aproximaciones cuantitativas es el de PCR en tiempo real. Sondas fluorogénicas o colorantes adicionados al PCRs permiten el monitoreo correcto de los productos obtenidos durante la amplificación.tudios. Mauchline et al. 1998. Mauchline et al. el incremento de moléculas de DNA durante la amplificación conlleva un incremento en la intensidad de la emisión fluorescente. la cuantificación del DNA de hongos en el suelo es requerida frecuentemente para estudios epidemiológicos y ecológicos. el PCR convencional es inapropiado para enfoques cuantitativos porque cualquier pequeña variación durante la fase exponencial en la reacción de amplificación puede alterar drásticamente las cantidades de los productos del PCR.

Suelos de bosque natural y plantaciones de pino hoop. 2005 Kennedy et al. 2004 Edel-Hermann et al. 2004 He et al. Campos de espárragos. 2005 Yergeau et al. seguido por DGGE.. 2003 Brodie et al.. Suelos con diferentes propiedades fisicoquímicas. los efectos de cambiar el suelo al añadir composta o excremento.. 2001 Ranjard et al. 2003 Gomes et al. Gradiente de pastizales semi-naturales a suelos agrícolas mejorados. Una muestra de suelo por métodos de cultivo y molecular.. 2006 Hongos del suelo saprófitos y patógenos de plantas 263 . 1999 Viaud et al.Tabla 8. Suelo estepario con pasto corto con o sin presencia de nitrógeno.. Técnica* TGGE PCR-RFLP SSCP ARISA DGGE Evaluación de comunidades de hongos en Rizósfera y suelo compuesto con trigo.. Análisis de la dinámica de comunidades de hongos del suelo vía PCR hongoespecíficos del DNA del suelo.. análisis de detección y diversidad de especies de Fusarium... Referencias Smit et al.. 2001 Elsas et al.. Tres diferentes suelos cultivados con Lolium perenne. 2000 Lowel y Klein. Suelos con diferentes propiedades fisicoquímicas. Suelos bajo cultivos de papa transgénica y no transgénica. amplificados del DNA total.1 Resumen de los métodos que utilizan clonación de DNA y secuenciación para la identificación de los haplotipos dominantes. 2000 DGGE DGGE y TRFLP DGGE y restricción de DNA amplificado DGGE T-RFLP Anderson et al. Diferentes horizontes de un suelo de selva. Gradiente de suelo desde llanuras hasta bosques de pino escocés. Rizósfera de dos cultivos de maíz durante el periodo de ciclo de vida de la planta.. 2003 Agnelli et al... 2004 Milling et al. Pastizales bajo diferentes tipos de vegetación.2005 DGGE SSCP y TGGE ARISA y T-RFLP DGGE con iniciadores específicos para Fusarium DGGE y T-RFLP Singh et al.

pero una mejor caracterización y análisis filogénico de taxas dominantes. Las técnicas de huella molecular en comunidades puede monitorear composiciones complejas de hongos de suelo. Otra limitación del enfoque molecular basada en la amplificación del DNA es la falta de conocimientos acerca de la actividad de crecimiento o grupos funcionales 264 Manual de biología de suelos tropicales . huella molecular y técnicas de clonación. pueden presentar algunos problemas debido a que los bancos de datos pueden estar incompletos y puede que las secuencias de DNA se encuentren mal identificadas. sin duda. 2002a. Muchos obstáculos para la identificación basada en cultivos han sido superados con la llegada de técnicas de aislamiento más sofisticadas como. los métodos de lavado del suelo y la filtración de partículas. contienen las mismas limitaciones que las técnicas de cultivos para hongos (Selenska y Klingmüller. como hongos micorrízicos arbusculares. lo que origina errores en identificaciones morfológicas. Sin embargo. 1992. 2004b).1 Continúa.. generalmente. no se aplica en el caso de hongos saprófitos. No obstante. 1994). 2003. Incluso la mayoría de los hongos patógenos de plantas no son parásitos obligados. de estudios sobre la diversidad bacteriana y. por ejemplo. Técnica* DGGE y ARDRA Evaluación de comunidades de hongos en Diversidad de hongos en suelos antárticos que combinan cultivo de aislamiento.. Tsai y Olson. Bridge et al. este método no se describe para cada ejemplo. exagerado. en la secuenciación de quimeras (Crous. los enfoques taxonómicos de hongos basados únicamente en datos moleculares. Referencias Malosso et al.Tabla 8. amplificación y secuenciación de contaminantes de hongos e incluso. Hawksworth. O’Donnell et al. 2006 Nota: * la clonación del DNA y la secuenciación fueron usadas por todos los autores para la identificación de haplotipos dominantes amplificados del DNA total. principalmente. 1992.. en el caso de los hongos el número de especies no cultivables es. por lo tanto. tal y como ha sido discutido. invariablemente. Lo que puede ser verdad para organismos estrictamente simbióticos. requieren de una secuenciación y comparación utilizando bancos de datos de DNA al alcance del público. CONCLUSIONES Las herramientas moleculares para ensayos de comunidades de hongos del suelo fueron extraídas.

1995). La forma de las curvas indica si el número Hongos del suelo saprófitos y patógenos de plantas 265 . constituye el primer conjunto de datos. un entendimiento más completo sobre las comunidades de hongos del suelo deberá centrarse en enfoques polifásicos con ensayos basados en cultivos y taxonomía molecular en asociación con el estudio de los procesos biogeoquímicos que ocurren en el suelo (Malosso et al. El conjunto de datos preliminares usualmente no es adecuado para hacer los análisis de ANOVA. La pendiente de las curvas muestra cuáles son las muestras con mayor riqueza de especies. Como se ha discutido... pueden añadirse al ANOVA para evaluar sus efectos y sus interacciones con otros datos cuantitativos (Setälä y McLean. Se verifica el número de cepas de cada muestra y este dato puede ser usado para comparar entre sitios. los protocolos de extracción del DNA son capaces de lisar y extraer ácidos nucleicos ya sea de micelio en crecimiento activo o de esporas latentes. La prueba de independencia de Chi cuadrada puede usarse para este análisis. dado que algunos de los datos no tienen una distribución normal. por ejemplo. el análisis de Kruskall-Wallis (Rodrigues. otros factores.de hongos del DNA total extraído del suelo. 1998). Las curvas de acumulación de especies o curvas de rarefacción pueden proporcionar comparaciones gráficas de la riqueza de especies entre muestras.. como parámetros físicos y químicos del suelo bajo análisis. Por el momento. por lo tanto. Sokal y Rohlf. 1995). de acuerdo con la acumulación de las cepas muestreadas. Por medio del ANOVA es posible derivar variaciones entre diferentes muestras y dentro de las muestras (error). 2004). un enfoque más confiable es realizar un análisis de varianza (ANOVA). donde el número total de cepas de cada muestra se usa en comparaciones pareadas. 2006. Para solucionar ese problema. las curvas que se forman con más facilidad. además del número de cepas. tales como logaritmo o raíz cuadrada pueden aplicarse antes del análisis (Houston et al. 1994. ANÁLISIS DE DATOS Una lista de especies o agregados de especies aisladas y su abundancia relativa en cada muestra. por ejemplo. 2006). Adicionalmente. Cuando están disponibles datos sobre variaciones cuantitativas entre las repeticiones dentro de las muestras. fechas de colecta o diferentes tratamientos de suelo. haciendo difícil la diferencia del crecimiento activo o grupos funcionales basados únicamente en el producto del análisis del PCR. resulta ser un análisis robusto y confiable (Sokal y Rolf. generalmente. y también dan información sobre el esfuerzo de muestreo empleado en la investigación. Otra opción consiste en llevar a cabo un análisis de varianza no paramétrico. Singh et al. las transformaciones de datos.

Curvas que no tienden a una asíntota indican que el número de especies podría aumentar si se aumenta el esfuerzo de muestreo (Bills y Polishook. Grishkan et al. La diversidad de especies de cualquier sistema está compuesta por dos componentes: la riqueza de especies (el número de especies) y la equitatividad o equidad de la frecuencia de especies (Kennedy y Smith. 2003).. Los índices de similitud (disimilitud) de diversidad para realizar comparaciones pareadas entre diferentes muestras también son usados con frecuencia (Magurran. al igual que en otras técnicas de ordenación.. 1982. 1995).). se elige un límite (por ejem266 Manual de biología de suelos tropicales . De manera general. El índice Shannon-Wiener se basa en la riqueza y equitatividad de la diversidad de las especies y se encuentra frecuentemente en la literatura (Dighton. 1988. idealmente. explican la mayoría de la variabilidad de datos. y existen casos en donde dos comunidades distintas pueden tener el mismo índice de diversidad. 1995). El porcentaje de la varianza total explicada por el primer eje del AC y la contribución de las especies y muestras a la varianza (inercia) de cada eje apoya la designación de especies que ocurren en la comunidad como clave y “casual” (Howard y Robinson. Howard y Robinson. Muchos índices se han obtenido para evaluar y comparar la diversidad de especies.de especies es estable después de la acumulación de todas las cepas. por ejemplo. El análisis de correspondencia (AC) y su versión modificada. Los índices de diversidad son puramente numéricos y no proporcionan información sobre la estructura de la comunidad. Persiani et al. 1994. 1994). 1993. Bettucci et al. el análisis multivariado no se lleva a cabo en el total de comunidad debido a la naturaleza “ruidosa” de la frecuencia y a la distribución de especies raras. análisis de correspondencia sin tendencia. La información sobre la estructura de la comunidad es mejor si se usa un análisis multivariado. las relaciones multidimensionales entre muestras y especies se reducen a un número reducido de ejes que. De esta manera. tales como los métodos de ordenación. son métodos de ordenación adecuados para la clase de datos generados de hongos y de otras comunidades.. Los resultados se muestran gráficamente y permiten el análisis de tendencias generales de la estructura de la comunidad (Gauch. común o rara y a la complejidad de los modelos matemáticos que se basan en la distribución de las especies. por ejemplo. 1998. si las curvas tienden a llegar a una asíntota. En el caso de AC. matrices de datos de gran tamaño (llenas de ceros) y datos de distribución no paramétricos. datos generados de conteos. basándose en su riqueza o equitatividad o tomando ambas variables y éstos cambian en función de la importancia relativa que se da a la especie dominante. 1995).

Hawksworth. 1% ó 5% del número total de aislamientos) y únicamente aquellas especies con una frecuencia de aislamientos igual o superior a este límite son incluidas en el análisis (Gauch. 1996). la biología molecular y la conservación de hongos han sido revisados recientemente (Hawksworth. 2002. Bettucci y Alonso. 1996. Bettucci et al.. 1982. PRESERVACIÓN Y COLECCIÓN DE RECURSOS GENÉTICOS Los inventarios de biodiversidad proporcionan argumentos y algunas bases científicas para la preservación de hábitats y el uso sustentable de suelos.. Oros-Sichler et al. Hongos del suelo saprófitos y patógenos de plantas 267 . 1995. como en el caso de la publicación de nuevos nombres (Agerer et al. por lo que proveen material de trabajo básico para quienes estudian las características y la variación. Kirsop.. Ryan y Smith. El estatus actual de las colecciones de recursos genéticos de hongos y los retos para apoyar la necesidad de la genómica de hongos. 2003). Las colecciones de referencia deberían ser apoyadas por países con una política fuerte en ciencia y tecnología dado que contienen información acerca de la distribución geográfica y de los hospederos. así como el análisis de conglomerados (cluster). 1992. 0. por lo tanto. 2002). Las colecciones de recursos genéticos hoy en día son solicitadas en todo el mundo. 2004).. son normalmente empleados para derivar resultados procedentes de los métodos de huella molecular. 1993. 2006). Los métodos de ordenación de análisis de componentes principales y análisis de correspondencia. al igual que las aplicaciones prácticas y económicas de las especies (Smith y Waller. Agradecimientos Al profesor Richard Mibey y a la Dr. Sheila Okoth por sus comentarios y discusiones durante la preparación del capítulo. con el objetivo de la preservar las especies ex situ y de suministrar a instituciones de investigación e industrias de este material. en donde las matrices son construidas con datos de presencia o ausencia de bandas distintivas (de manera ideal para especies diferentes) en los geles y la estructura de la comunidad es analizada posteriormente (Fromin et al. 2004a.5%. para la preservación a largo plazo de especímenes de resguardo será fundamental validar las entradas de secuencia y bases de datos genómicas. En el futuro. es necesario que sean recopilados.plo.

R. M. R. vol. 642-644. M. C. Pedobiologia. D.. L. 36. (1988) “A critical examination of the soil washing technique with special reference to the effect of the size of the soil particles’. vol. Bauer. E. J. Begerow. 5. soil respiration’. G.REFERENCIAS Agerer. 25. Oberwinkler. Sampaio. pp. M. R. P. y Pietramellar. M. Cigelnik.. N. Applied Soil Ecology.. M. R. y Prosser. pp. Gams. P. y Waalwijk. y Kenerley. J. 95. Roebroeck. P. vol. E... F.. forest’. the role of decomposer organisms’. Ammirati. Baayen. Weiss. G. T. pp. 1566–1569. 87–108. vol. Robson. 268 Manual de biología de suelos tropicales . Halling. D. Kroon. F. 419–428. D. S. R. Environmental Microbiology.E. 891–900. 36–47. pp. (2004) ‘Distribution of microbial communities in a forest soil profile investigated by microbial biomass. 769–779... D. H. J. M. vol. R. Environmental Microbiology. Bettucci.. Vikram Reddy... R. y Alonso. Ascher. y Watling. vol. Tian. Canadian Journal of Botany. (1998) ‘Detection and enumeration of a genetically modified fungus in soil environments by quantitative competitive polymerase chain reaction’. pp. S. D. 39. y Cairney. I.. (2006) ‘The simpleseptate basidiomycetes: A synopsis’. 104. vol.. G. Nannipieri. J. C. P. pp. P. Cortia. (2004) ‘Diversity and ecology of soil fungal communities: Increased understanding through the application of molecular techniques’. pp.. Mueller.. 859–868. Triebel. y Handley.. vol. K. G. Rambold. R. P. E.. y Srivastava. pp. Journal of Applied Microbiology. G.. Anderson. Blanz. pp.. Hawksworth. FEMS Microbiology Ecology. 5. Barratt. Anderson. D. J. Baek. G.. E.. Hallenberg. Campbell.. vol. M. vol. O’Donnell. Mycological Progress. G. pp. L. (1995) ‘The effect of wildfire on the opportunistic decomposer fungal community of Uruguayan Eucalyptus spp. Phytopathology.. C. I.. Korf. Dejardin. soil biodiversity and agroecosystem function in the tropics. 78–85.P. Greenhalgh.. C. J. A. Ennos. 41–66.. 470–480. Horak. R. W. Agnelli. P. 6. J. (2003) ‘Fungi are the predominant micro-organisms responsible for degradation of soil-buried polyester polyurethane over a range of soil water holding capacities’. (2000) ‘Gene genealogies and AFLP analyses in the Fusarium oxysporum complex identify monophyletic and nonmonophyletic formae speciales causing wilt and rot disease’. (1997) ‘Agricultural intensification. 66. C.. 90... A. C. Courtecuisse.. L. R. pp. vol. W. Bonants. Soil Biology and Biochemistry. (2003) ‘Always deposit vouchers’ Mycological Research. y Oberwinkler. Ceccherini.. I. (2003) ‘Potential bias of fungal 18S rDNA and internal transcribed spacer polymerase chain reaction primers for estimating fungal biodiversity in soil’.. A.. M. C. S. J. Bååth. 6. Beare. Summerbell. R. N.

(2001) ‘Soil fungi. 127–145. J. (2004) ‘Saprobic soil fungi’. Powell. F. 46. P. K. pp. Steiman. Edwards. vol. Cannon. 106. B. Roberts. A. 271–302. Rodriguez. M. (2000) ‘PCR primers that amplify fungal rRNA genes from environmental samples’.. y Duncan. 44. S.. pp. (2003) ‘Soil fungal community structure in a temperate upland grassland soil’. P. I. pp. B. 666–676. FEMS Microbiology Ecology. Lees. K. H. Wallingford. A. Semadi. G. (2002) ‘Detection of Colletotrichum coccodes from soil and potato tubers by conventional and quantitative real-time PCR’. B. E. 43–48.. K. D. (2001) ‘Removal of herbicides from liquid media by fungi isolated from a contaminated soil’. (1993) ‘Fungal communities of two grazing-land soils in Uruguay’. R.. (2002b) Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. MN. R. M. pp. pp.. Foster (eds) Biodiversity of Fungi: Inventory and Monitoring Methods. Bills. F. y Roquebert. y Baker. vol. (1996) ‘Filamentous fungi’. Bettucci. M. 66. y Hartin. Christensen.. Bury. Bills. Plant Pathology. R. y Polishook. Chet. Brodie. Bridge. F. pp. Bills y M. (2003) ‘On the unreliability of published DNA sequences’.. (2002) “Paraná river delta wetlands soil microfungi’. B. E. 187–198. Phytopathology. J... Dupont. M. P. J. Bonkowski. Toth. y Clipson. 70. N. 37. 160. C. Lundgren.. pp994–998. Dackman.Bettucci. O. y Panchal. (2002a) ‘Adhering to good cultural practice’. pp. 86. Jansson. vol. W... pp. D. Bordjiba. vol. P. 105–114. Elsevier. pp. Kadri. Mycologia. pp1378–1379. J.W. Hongos del suelo saprófitos y patógenos de plantas 269 . 281–292. Crous. CAB International. P.. G. vol. pp. L. 13. 72–82. y Nordbring-Hertz. M. y Thorn. 606–623. F. P. F. 4356–4360. vol. 45. D. in G. pp. G. Journal of Environmental Quality. M. Borneman. C. vol. (1987) ‘Quantification of predatory and endoparasitic nematophagous fungi in soil’. 232. vol. (1980) ‘Induction of suppressiveness to Rhizoctonia solani in soil’. St Paul. vol. Malvarez. (2000) ‘Food preference of earthworms for soil fungi’. J... M. ppv147–154. vol. in G. Pedobiologia. Pedobiologia. vol. M. Olsson. M. Plant and Soil. P. 89–93. B. (1994) ‘Abundance and diversity of microfungi in leaf litter of a lowland rain forest in Costa Rica’. S. G. Microbial Ecology. Mycological Research. y Guiraud. y Indarte. D. Crous. 30. Amsterdam. F. diversity and detection’. Hall (ed) Methods for the Examination of Organismal Diversity in Soils and Sediments. Bridge. Spooner. y Spooner. S. Pedobiologia... I. vol. y Ritz. 51. Cullen. K. Mueller. APS Press. S. pp. W. New Phytologist.. Griffith. G. vol. J. L. Applied and Environmental Microbiology. I. 418–426.

S. F. Kluwer Academic Publishers. y Boddy.. D. 343–404. Tarnawski. y Anderson. V. y Sinclair. Dordrecht. Domsch. Gillet. Aragno. Dick. J. J. Environmental Microbiology. H. Academic Press. y Alabouvette. 2nd edition.. M.. Filion. L. y Steinberg. Dhingra.. vol. y Rossi. (2000) Detection and Isolation of Soil Fungi. G. F.Davet. Steinberg. vol. pp.. A. Pérez-Piqueres. C. T. J. (2001) ‘Genetic diversity of Fusarium oxysporum populations isolated from different soils in France’. S. D. M. (1990) ‘Methods for studying fungi in soil and forest litter’. C. Journal Microbiological Methods. N. W. Dreumont. V. Grigorova y J. M. Frankland. 397– 404.. Teyssier. E. pp. (2003) ‘Direct quantification of fungal DNA from soil substrate using real-time PCR’. in R.. K. 796–798. Eching. G. 11. The Netherlands. (2002) ‘Fungal family trees: Finding relationships from molecular data’. vol. pp. (2002) ‘Statistical analysis of denaturing gel electrophoresis (DGE) fingerprinting patterns’. G. N. y Jabaji-Hare... Mycological Research. A. 133–151. vol. Dighton. FEMS Microbiology Ecology. Down. CRC Press Inc. D. Plant Pathology. A. 634–643... pp. Gautheron. Mycologist. pp. (2004) ‘Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils’. Elsas. S. Enfield. Roesti. Gams. H... G.. London. Fromin. 22. (2000) ‘An efficient baiting assay for quantification of Phytophthora cinnamomi in soil’. R. M. 53. Science Publishers. 51–58. Duarte. R. Dighton. 16. Keijzer-Wolters. N. F.. (2000) ‘Analysis of the dynamics of fungal communities in soil via fungal-specific PCR of soil DNA followed by denaturing gradient gel electrophoresis’. pp. (2007) Compendium of Soil Fungi. 49. M. G. (1985) Basic Plant Pathology Methods. y Rouxel. C. pp. O.Cuvelle. 270 Manual de biología de suelos tropicales . P. W.. Norris (eds) Methods in Microbiology. pp67–76. J. y Smit. y Galpoththage. Jourdain-Miserez. vol. vol. 47. Edel-Hermann. (1994) ‘Analysis of micromycete communities in soil: A critique of methods’. J. K.. (2001) Straminipilous Fungi. vol. J. Edel. Hamelin. pp. 61–71. FEMS Microbiology Ecology. Forestier. Edena. 515–522. Journal of Microbiological Methods. vol. M. IHW Verlag. Recorbet.. M. 43. B. 36.. vol. St-Arnaud. Boca Raton. 98. A. Hillb.

census. A.. pp13–15. Hawksworth. Nevo. (2005) ‘Analyses of soil fungal communities in adjacent natural forest and hoop pine plantation ecosystems of subtropical Australia using molecular approaches based on 18S rRNA genes’. y Aptroot. (2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the tropics. vol. L. Gams. London. G. Hawksworth. J. pp. Watling y A. L. van der Mei y A. 9–18. M. Norris (eds) Methods in Microbiology.. A. (1990) ‘Methods for studying the microbial ecology of soil’. pp. in R. Lower Nahal Keziv.. R. Rumjanek. 87. P. 4th edition. Studies in Mycology. Mycoscience. C. CBS. pp.. 161. P. y Crous. W. G. pp. western Upper Galilee. L. Isaac. O. D.. K. vol. L. 22. R. Costa. Phytopathology. Grishkan. C. Cambridge University Press. Whalley (eds) Aspects of Tropical Mycology. (2004b) ‘“Misidentifications” in fungal DNA sequence databanks’. S. (2004a) ‘Fungal diversity and its implications for genetic resource collections’. Biological Journal of the Linnean Society. 183–223. CBS. Wasser. Gray. FEMS Microbiology Letters. y Smalla. Mycological Research. L. C. Gomes. pp. L. magnitude. 641–655. Frankland. Gonçalves.. S. D. pp. 888–891. Hoekstra. E. (1997) ‘Where are all the undescribed fungi?’. Cambridge University Press. He. (2003) ‘Adaptive spatiotemporal distribution of soil microfungi in ‘Evolution Canyon’ II. Baarn. D. N. J. 50. Israel’. A. H. prophylaxis. D. E. A. Xu. Stalpers. in R. Gauch. (1992) ‘The analysis of communities of saprophytic microfungi with special reference to soil fungi’. New York. A. Academic Press. vol. D. Hawksworth.Gams. R. pertinence. (2001) ‘Evaluation of bioassays to quantify Cylindrocladium inocula soil’. Hongos del suelo saprófitos y patógenos de plantas 271 . T. 247. Cambridge. Fagbola. R. 41. Alfenas. (1991) ‘The fungal dimension of biodiversity. pp. Buchner. (1998) CBS Course of Mycology. S. A. Y. 527–539. D. (1996) ‘Microbial collections as a tool in biodiversity and biosystematic research’. A. y Rossman. vol. vol. vol. 26–35. Maffia. 310–342. New Phytologist. Dordrecht. H. W. Hawksworth.. Winterhoff (ed) Fungi in Vegetation Science. Hawksworth. Jr (1982) Multivariate Analysis in Community Ecology.. L. 91–100. Mendonça-Hagler. Stouthamer (eds) Culture Collections to Improve Quality of Life. Z. A. (1993) ‘The tropical fungal biota. J. R. W. and prognosis’. y Beharav. vol. 78. G. significance and conservation’. N. 95. Proceedings of the International Congress for Culture Collections. J. Hawksworth. y Hughes. Baarn. L. C. pp. pp. D. in S. vol. 261–264... The Netherlands. 69. 3758–3766. J. I. G. pp. vol.. Applied and Environmental Microbiology.. in W. Samson. Kluwer Academic Publishers. Grigorova y J.

y Lautenschlager. D. Microbial Ecology. vol. pp. N. pp. 37–58. pp. 630–640. D. Mycologist.. W. Isaac. Canadian Journal of Botany. A. L. Frankland. Lees. H. P. J. S. Wallingford. vol. E. Y. D. 170. y Stalpers. S. A. S. (1986) ‘Fungi of a forest soil nitrifying at low pH values’. Plant and Soil. J. Marsh. vol. 257–265.. A. B. y Hartman. J. T. glycines in soybean roots and soil’. vol. 52. Edwards. 272 Manual de biología de suelos tropicales . C. pp.. sp. Kirsop. Lee.. Whalley (eds) Aspects of Tropical Mycology. J. (1996) ‘Nonradioactive method to study genetic profiles of natural bacterial communities by PCR single-strand-conformation polymorphism’. in S. G. 74–83. L. Cheng. (2003) ‘Molecular detection of Fusarium solani f. y Jagnow. 518–527. D. Kacprzak. R. P. K. M. C. vol. Kirk. Biology and Fertility of Soils. Cambridge University Press. WFCC. Kennedy.. Sullivan. World Federation of Culture Collections. Hong Kong. Applied and Environmental Microbiology. pp. pp. P. 38. Visser. E. (ed) (1997a) Biodiversity of Tropical Microfungi. K. Watling y A. M. Lodge. 3112 –3120. Zo. (1998) ‘Microbial processes and fungal community structure in soils from clear-cut and unharvested areas of two mixed wood forests’. 9th edition. vol. G. pp293–302. Hyde. Cannon. C. (1995) ‘Soil microbial diversity and the sustainability of agricultural soils’. C. 4516–4522. A. Cambridge. J. Kennedy. 89–95. L.. David. N. vol. (2005) ‘Soil bacterial and fungal community structure across a range of unimproved and semi-improved upland grasslands’. pp. 11. S. L. Hyde. (2003) ‘Changes in the structure of fungal communities of soil treated with sewage sludge’. 62. Howard. K. 76.. Plant Pathology. 39. (1997) ‘Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16s rRNA’. Plant Pathology. y Nicholson. pp. (2002) ‘Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil’. Pedobiologia. FEMS Microbiology Ecology. J. pp. C. F. H. 176–178. 75–86. y Smith. y Clipson. Cullen.. CAB International. pp. A. D. vol. vol. S. y Kim. Li. y Robinson. (2001) Dictionary of the Fungi. W. Liu. L. A. (1997b) ‘Can we rapidly measure fungal diversity?’. vol. Applied and Environmental Microbiology.Houston. (ed) (1996) Access to Ex-situ microbial genetic resources within the framework to the convention on Biological Diversity. M. pp. 51. vol. 63. 463–473. P. y Forney. R. 38. Lang. (1993) ‘Nutrient cycling by fungi in wet tropical forests’. K. 50. J. (1995) ‘The use of correspondence analysis in studies of successions of soil organisms’. y Stanczyk-Mazanek.. Hong Kong University Press.

(1988) Ecological Diversity and its Measurement. (2004) ‘Effects of transgenic potatoes with an altered starch composition on the diversity of soil and rhizosphere bacteria and fungi’.. pp. 552–561. FEMS Microbiology Ecology.. y Smalla. y Nakanishi.. y Siqueira. (2006) “Fungal diversity in maritime Antarctic soils determined using a combination of culture isolation. vol. y Hirsch. A. vol. E. vol. G. Applied and Environmental Microbiology. Schloter. y Munch. (1977) ‘Selective inhibition of Pythium spp. A. Kerry. vol. (2001) ‘Comparative single-strand conformation polymorphism (SSCP) and microscopy-based analysis of nitrogen cultivation interactive effects on the fungal community of a semiarid steppe soil’. Moreira. (2002) ‘Mechanisms of natural soil suppressiveness to soilborne diseases’. pp. Yoshikawa. Hopkins. pp. E. vol. (2004) ‘Assessment and management of soil microbial community structure for disease suppression’. Mazzola. Muyzer. J. vol. C. D.. Smalla. M. F. 73 pp.. D. 81. 6. y Uitterlinden. Phytopathology. 85–92. A. S. M. Magurran. (2002) Microbiologia e bioquímica do solo. M..Lodge. E. P. E. M. 67. Muyzer. pp. vol. Marks. 1687–1690. G. 557–564. 42. Lavras.. H. K. A. O. C. y O´Donnell. T. Mazzola. molecular fingerprinting and cloning techniques’. Biodiversity and Conservation. H. W. Polar Biology. K. pp. L. vol. Antonie van Leeuwenhoek. M. 23–39. on a medium for direct isolation of Phytophtora spp. D.. Milling. vol. J. 1846–1853.. y Klein. F. Antonie van Leeuwenhoek. (1998) ‘Application of denaturing gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology’. vol. 127–141. Editora UFLA. pp. G. G. English. Fukada. 68. 425–428. Maidl. J. Waite. 36. Princeton University Press. Annual Review of Plant Pathology. X. (1993) ‘Profiling of complex microbial populations by denaturing gradient electrophoresis analysis of polymerase chain reacHongos del suelo saprófitos y patógenos de plantas 273 . 60. R. L. isolation and pathogenicity of Phytophthora megasperma from soils and estimation of inoculum levels’. Masago. J (1997) ‘Factors related to diversity of decomposer fungi in tropical forests’. R. (2002) ‘Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating’. de Waal. Mauchline. J. C. (1970) ‘Detection. S. Plant and Soil. pp. Brazil. N. pp.. pp. 35–59. Phytopathology. G. 681–688 Lowell. I. A. B. 266. from soils and plants’. 29. Malosso. Princeton. M. y Mitchell.

pp. K. M. y Smalla. Dow. Duncan. Persiani. 67. 871–877. y Osswald.. Applied and Environmental Microbiology. 4479–4487. C. in K. C. vol. D. 51. L. (2001) ‘Characterization of bacterial and fungal soil communities by automated ribosomal intergenic spacer analysis fingerprints. F. L. G. Ranjard. M. D. Plant Pathology. pp. (1997) ‘Soil and rhizosphere microfungi from Brazilian tropical forest ecosystems’. Wakeham.. J. 86.. y Nazaret. Oros-Sichler.. Forest Pathology. 59. Schlenzig. 31. M. E.. (2002) ‘Comparison of serological. vol. M. 695–700. vol. J. Gomes. (2006) ‘A new seminested PCR protocol to amplify large 18S rRNA gene fragments for PCR-DGGE analysis of soil fungal communities’. F. D. vol. (1994) ‘Theoretical and practical aspects of the quantification of biodiversity among microorganisms’. J. Lews. y Pineda. A.. Thioulouse. C. Lata. N. M. Papavizas.. F. O´Donnell. vol. and bait methods for detection of Pythium and Phytophthora zoospores in water’. F. 103–116. biological and methodological variability’. K.. R. (2004) “Taxon-specific fungal primers reveal unexpectedly high diversity during leaf decomposition in a stream’. pp. S. G. pp. Biological Sciences. G. 3. Philosophical Transactions Royal Society London. y Cigelnik. Adams. Rodrigues. (1998) ‘Diversity and variability in soil fungi from a disturbed tropical rain forest’. Mycologia.. Poly.... pp. J. J. Mouguel. vol. and Bärlocher. y White. pp. L. culture. y Hawksworth. citricola in soil samples from oak stands’. W. R. J. 345. Applied and Environmental Microbiology. J. 90. vol. Mycologia.. pp. 720–727. pp. Casado. F. 41–49. E. A.. pp.. D. (1994) ‘The foliar fungal endophytes of the Amazonian palm Euterpe oleraceae’. L. L. vol. J. 341–365. C.. pp. Lomsden. D. vol. (1975) ‘Ecology and epidemiology of Rhizoctonia solani in field soil’. 6... (2001) ‘A combination of baiting and PCR techniques for the detection of Phytophthora quercina and P. 274 Manual de biología de suelos tropicales . Mycological Progress. 65–73. Pettitt. O. A. 206–214. Molecular Phylogenetics and Evolution. Nikolcheva. Pfenning. B. T. Nechwatal. R. Hyde (ed) Biodiversity of Tropical Microfungi. Cooke. 85–97. G. Phytopathology. M. Neuber. A. W. Maggi. 7. vol.. Hong Kong. 65.tion-amplified genes coding for 16S rRNA’. (1997) ‘Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous’. A. pp. Ayers. L. Jung. y Kantzer. T. G. H. M. Goodfellow. vol. G. A. Journal of Microbiological Methods. Wainwright. Hong Kong University Press. O’Donnell. 63–75.. F. pp. A. K. 376–385. B. P.

y Millard. W.. J. special issue no 1. Silva. (2001) ‘A new fungal phylum. Sanfuentes. R. F. J. Smith. E. vol. L. Hongos del suelo saprófitos y patógenos de plantas 275 . pp. M. D. y Larrick. (2002) ‘Comparison of baits to quantify inoculum density of Rhizoctonia spp.. Y. Schneider. NC. T. MN. A. B. (1991) Identification of Rhizoctonia Species. vol. their importance in tropical plant pathology’. 1. (2004) ‘Decomposition rate of organic substrates in relation to the species diversity of soil saprophytic fungi’. 53–78. 177–183. J. the Glomeromycota: Phylogeny and evolution’. M. S. 66. Smit. P. St Paul. Mycological Research.. 12. vol. (1995) Biometry: The Principles and Practice of Statistics in Biological Research. Reid. 57. F. APS Press. Nature. Paterson. vol. J. 17. M.. y van Elsas. P.. A. 1413–1421 Selenska. D. Fitopatologia Brasileira. vol. y Klingmüller. pp. Sneh B. (1999) ‘Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes enconding 18S rRNA and temperature gradient gel electrophoresis’.. E. 3rd edition. E. 98–107. L. M.. vol. y Smith. 105.. Setälä. Freeman. pp. P.. S. J. M. Acta Zoológica Mexicana. 41–46. R. 557–558. B. G. C. K. Mihail. Canhos. MN. L. S. y McLean. Potts.. (1992) Methods for Research on Soilborne Phytopathogenic Fungi. D. Rossman... P. A. E. pp. W. Sokal. Glandorf. vol. pp. Singleton. W. St. Oecologia. Umbuzeiro. 31. A. Soil and Sediment contamination. (2001) “Biodiversidad de los hongos fitopatógenos del suelo de Mexico’. 1351–1362. L. 108. R. Parkway Publishers. A. C. E. pp. Schuessler. Siebert. pp. H.Rodrigues-Guzman. Singh. G.. APS Press. Paul. y Rush. vol. Maffia. R. (2004) ‘Fungal genetic resource centres and the genomic challenge’. y Thorn. biochemical and molecular fingerprinting methods’. 2614–2621. y Waller. 72–82. (1992) “Direct recovery and molecular analysis of DNA and RNA from soil’. (1984) Suppressive Soils and Plant Disease. W. L. O´Dell.. Tulloss. J. M. pp. Microbial Releases. Paul. 345-356. V. Applied and Environmental Microbiology. Alfenas. y Walker C.. y Esposito. M. pp. J. P. Mycological Research. vol. in Eucalyptus clonal garden soils’. Ord. R. H. European Journal of Soil Science. (2006) ‘Investigating microbial community structure in soils by physiological. 5–12.. 359. E. (1992) ‘Competitive PCR’. (1992) ‘Culture collections of microorganisms. MN. y Rohlf. pp. H. A. A. y Silveira. St. APS Press. Boone. Leeflang. E (2003) ‘Filamentous fungi isolated from estuarine sediments contaminated with industrial discharges’. y Ogoshi. D. Schwarzott. Ryan. Australasian Plant Pathology. New York. Munro. D.. Pfenning. 139. B. (1998) Protocols for an All Taxa Biodiversity Inventory of Fungi in a Costa Rican Conservation Area. vol. D. pp. Burpee.

McQuilken. 924–931. 90. y Hunter. 51. Transactions of the British Mycological Society. pp. G. 1070–1074. D. S. pp. (1996) ‘An appraisal of soil fungal diversity: The crossroads between taxonomic and functional biodiversity’. p. W. Yergeau. Erwin. y Visser. E. y Olson. 4288–4292. I. pp. MN. Science. E. 295. vol. J. 1027–1032. Viaud. pp. Mycological Research. C.. S. Zak. S.. Leyval. Paul. Reddy. M. vol. (1984) ‘A revision of the genus Trichoderma. E. MN. Current Opinion in Microbiology. pp. 37. vol. y Paul. C. Infrageneric classification’. 295–301. J. P. (1973) ‘Fungi from Canadian coniferous forest soils’. 58. M. Pesticide Science. Tsai. II. Journal of Microbiological Methods. Applied Environmental Microbiology. P. (1991a) ‘A revision of the genus Trichoderma. Filion. 143– 154. pp. P. (2000) ‘Diversity of soil fungi studied by PCR-RFLP of ITS’. Bissett. (2002) ‘Extensive fungal diversity in plant roots’. Applied Environmental Microbiology. Bissett. y Budge. Vandenkoornhuyse. Whipps. 2275–2290. M. y Parkinson. H. 6. pp. pp. Ecology and Pathology. pp. y Brygoo. L. Biodiversity and Conservation. St Paul. R. y Bartnicki-Garcia. Widden.. 309– 317. nov. Wellington. S. Berry. M. 2051. APS Press. vol. 276 Manual de biología de suelos tropicales . 5. (2005) ‘A PCR-denaturing gradient gel electrophoresis approach to assess Fusarium diversity in asparagus’. 104. (2003) ‘Resolving functional diversity in relation to microbial community structure in soil. vol. pp. pp. M. P. M. Straczek. vol.. H. 69. J. B. 169–183. APS Press. A. V. vol. its Biology. A.. D. H. 62. 4th edition. vol. 62. Tsao. Wainwright.. Vujanovic. Harris. Y. exploiting genomics and stable isotope probing’. A. Baldauf. y Krsek. C. Canadian Journal of Botany.Thorn.’.. M. L. A. M. vol. 159–170. 2357–2372. J. Canadian Journal of Botany. Taxonomy. (1993) ‘Use of fungal antagonists for biocontrol of damping-off and Sclerotinia disease’. E. vol. (1992) ‘Rapid method for direct extraction of DNA from soil and sediments’.. St.. Manuales para identificación Barnett. Y. J. y Young. J. H. Section Longibrachiatum sect. (1988) ‘Metabolic diversity of fungi in relation to growth and mineral cycling in soil: A review’. y St-Arnaud. P. (1998) Illustrated genera of imperfect fungi. (1983) Phytophthora. (1996) ‘Isolation of saprophytic basidiomycetes from soil’. Canadian Journal of Botany. C. Pasquier. P. B... D. vol. vol. 60.

. (2006) The Fusarium Laboratory Manual. Domsch. Croom Helm. Eching. R. (2000) ‘Cloning the soil meHongos del suelo saprófitos y patógenos de plantas 277 . M.. Klich. (1976) More Dematiaceous Hyphomycetes. M. y Ellis. Canadian Journal of Botany. Betterman. 2nd edition. I... J. D. J. y Aptroot. S... The Netherlands. (1977) Chytridiomycetarum Iconographia. II. St Paul. Illustrated genera of Ascomycetes.. I. Lynch. Tiong. C. vol. M. Brady. (1971) Dematiaceous Hyphomycetes. K. M. Ellis. Karling.. T. A. Loiacono. (2001) Dictionary of the Fungi. C. vol. MN. Additional notes on section Longibrachiatum’. Co. III.. Wallingford. A. Erwin. 9th edition. y Goodman. y Ribeiro. IHW Verlag. Leslie. M. B. St Paul. Rondon. Ellis. Hanlin. Osburne. St Paul MN. W. Australia. (1993) Coelomycetous Anamorphs with Appendage-bearing Conidia. Canadian Journal of Botany. CSIRO. Waterloo. A. (1998) CBS Course of Mycology.. H.. H. T. 69.. B. R.. J. Mycologue Publications. Vaduz. Handelsman. R. F.. vols I and II. London. Liles. MacNeil. R. C. R. St Paul. (1998b) Combined Keys to Illustrated Genera of Ascomycetes. Liechtenstein Kirk.. J. pp. F. North Ryde. P. vol. K. MN. (2007) Compendium of Soil Fungi. St Paul. Kew. B. S. y Stalpers. L. American Phytopathological Society. J. W.T. (2002b) Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. Hanlin. J. S. (1985) Microfungi on Land Plants: An Identification Handbook. pp. Cannon. (1988) A Laboratory Guide to Common Aspergillus Species and Their Teleomorphs. American Phytopathological Society. APS Press. CMI. I. David. Australia. vol. expanded reprint (Richmond Publ. J. S. B. A. P. R. M. J.. J. MN. MA. Minor. London. R. CSIRO. Gams. 69.. (1996) Phytophthora diseases worldwide.. North Ryde. D. J. (2000) A Laboratory Guide to Common Penicillium Species. W. P. Gilman. A. Cramer. y Pitt. O. T. J. Nag Raj.Bissett. y Bullock. 1990. y Anderson. IV. P. Malden. S. 2418–2420. Bissett. R.. Hoekstra. 2373–2417. J. A. Ellis. B. (1991b) ‘A revision of the genus Trichoderma. APS Press. (1998a) Illustrated Genera of Ascomycetes. L. 1997). Summerell. M. A. Hanlin. Crous. F. MN. ‘A revision of the genus Trichoderma. M. T. (1991c). I. Baarn. CBS. Blackwell Publishers. American Phytopathological Society. P. T. Kew. August. K. M. Pitt. Clardy. A. 4th edition. CAB International.. Section Pachybasium’. CMI. E. Gams. C. London. Grossman. M. 3rd edition.

(2000) Introduction to Food and Air-borne Fungi.uncw. vol. Waterhouse. M. 1–59.. (undated) ‘Trichoderma Online’. taxonomy. Waterhouse. Sneh. D. Waterhouse. CBS. 6th edition.edu/people/padgett/book. APS Press. (1980) The Coelomycetes. 1–50. D. accessed November 2002. Farr. C.. Hoekstra. W. B. pp. y Bartnicki-Garcia. y Filtenborg. G. (1983) Phytophthora: Its biology. y McCray. C. Tsao.ars-gring.. P. 110. G. Mycological Papers. 109. Systematic Botany & Mycology Laboratory. R. Applied Environmental Microbiology. ARS.gov/ taxadesciptions/keys/Trichodermalndex. vol. www. Seymour. M. vol. E. MN. Sutton. Frisvad. Samson. G. pp. J. A. St Paul. L. (1967) ‘A key to Pythium Pringsheim’. y Padgett. ecology and pathology. 122. C. The Netherlands. y Ogoshi. A. B. Kew. L. D. Chaverri. H. S. Sitios web Johnson. London. Jr.. E. Mycological Papers.. E. CMI. vol. G.. Erwin. S. Burpee. 66. pp. (2002) ‘Biology and systematics of Saprolegniaceae’. pp1–15.. (1970) ‘The genus Phytophthora de Bary: Diagnoses or descriptions and figures from the original papers’. Baarn. Samuels. M. B. http://nt. R. T. F. (1968) ‘The genus Pythium Pringsheim: Diagnoses or descriptions and figures from the original papers’. 278 Manual de biología de suelos tropicales . Mycological Papers. APS Press. P. 2541–2547. USDA. MN.cfm. (1991) Identification of Rhizoctonia species. O. St Paul. J.tagenome: A strategy for accessing the genetic and functional diversity of uncultured microorganisms’.

Apéndice 8.0g MgSO4 x 7H2O 0. si es necesario penicilina 0.0g agar 18g agua destilada 900 ml PARP harina de maíz 17g pimaricina 10mg ampicilina 250mg rifampicilina 10mg pentacloronitrobenceno 100mg himexazol 50mg AHM + p. molida 100g agar 18g penicilina 0.1 Medios de cultivo y aditivos: cebos Las recetas son para un litro.agar papa zanahoria papa 20g zanahoria 20g agar 18g CA – agar zanahoria zanahoria.s zanahoria.0g peptona 1.s. –agar con harina de maíz harina de maíz 8.p.2g agar 18g OA – agar harina de avena Copos de avena 30g Agar 15g ADP – agar dextrosa y papa papa.0g penicilina 0.2g sacarosa 0. MA2% .02g estreptomicina 0.2g pimaricina 0.0g agar 18g Antibióticos. cubitos 200g dextrosa 20g agar 18g PCA.02g estreptomicina 0.5g KCL 0.1g agar 18g MP5.p. (1998) y Erwin y Ribeiro (1996).1g Hongos del suelo saprófitos y patógenos de plantas 279 .2g pimaricina 0.02g estreptomicina 0.2g pimaricina 0. molida 100g agar 18g CA + p.1g V8 agar V8 100 Ml CaCO3 2.0g KNO3 1.agar extracto de malta extracto de malta 20g agar 18g SNA – agar sintético pobre en nutrientes KH2PO4 1.agar maltosa peptona maltosa 4. basados en Gams et al.5g glucosa 0.

papa.Cebos El uso de cebos es imprescindible para la recuperación de zoosporas formadas por hongos de sustratos complejos como el suelo. granos de polen de Pinus. los de origen animal son esterilizados usando luz UV por una hora. Los cebos de vegetales pueden ser lavados. epidermis de cebolla. Sustratos celulósicos: semillas de Sorghum. alas de insectos. exoesqueleto de camarones. Dependiendo del tipo de hongo pueden ser utilizados cebos específicos. hojas secas de maíz. papel celofán. trozos de manzana. Sustratos queratinosos: cabellos de niños rubios. zanahoria o pepino. Sustratos quitinosos: piel de serpiente. 280 Manual de biología de suelos tropicales .

las moscas de la fruta son consideradas una de las más preocupantes. excepto en la Antártida (White y ElsonHarris. Se trata de insectos multivoltinos con un potencial biótico relativamente alto y una gran capacidad para infestar diferentes especies de frutos nativos y exóticos. con una punta larga y delgada. Algunos estudios han acentuado aspectos ecológicos y etológicos de las moscas de la fruta. y a la familia Tephritidae. Bactrocera. Las características taxonómicas que permitan distinguir sexos entre pupas y larvas aún no se han determinado (Salles. al final del abdomen. ya que representan plagas primarias para la mayoría de los cultivos frutales. 1972. que se extienden globalmente. volviéndola 281 . en su mayor parte. Las moscas de la fruta muestran un comportamiento y una taxonomía complejos (Bateman. preservación e identificación de moscas de la fruta Neliton Marques da Silva INTRODUCCIÓN Entre las plagas de la fruta de América tropical. Su clasificación se basa exclusivamente en los caracteres morfológicos del adulto. y su sexo es fácilmente distinguible debido a que las hembras tienen un prominente ovopositor. Ceratitis. Steck y Wharton. 1996. Zucchi et al.Capítulo 9 Muestreo.. Los daños que producen las moscas de la fruta se dan durante la fase inmadura. Se distinguen cinco géneros importantes de esta plaga: Anastrepha. 1988).. debido al gran impacto económico que causan. Rhagoletis y Dacus. 2000). enfocados a las fases de pupa y larva (Silva et al. 1992). 1996). éstas pertenecen al orden Díptera. el periodo durante el cual la larva destruye la pulpa de la fruta.

dependiendo de la temperatura y de la humedad. hongos y nematodos. la mosca de la fruta se puede considerar un organismo del suelo. durante una parte de su ciclo de vida. En el caso de la mosca adulta. por ello. azúcar al 10% o jarabe de caña de azúcar al 10%. las larvas se mueven sobre la superficie del suelo buscando condiciones adecuadas para su desarrollo y penetran hasta una profundidad aproximada de 10 cm para entrar en la fase de pupa. resulta de suma importancia que en el diseño de la estrategia del manejo integrado de plagas se tome en cuenta la biodiversidad del suelo como un factor fundamental que influye en la mortalidad de larvas y pupas. Estos antagonistas juegan un papel importante en el control biológico de las moscas de la fruta. Antes de llegar al estado adulto. esta técnica representa una relación ambigua entre la mosca y su hospedero. junto con el suelo. y constituye una de las fases más vulnerables al estrés abiótico y a muchos enemigos naturales. De manera alternativa. que también forman parte de la biota del suelo (véase Capítulo 10).5 y 9). se puede utilizar jugo de fruta al 10%. que es diurna y responde a estímulos visuales y olfativos. en su mayor parte depredadores y entomopatógenos como bacterias. pues sólo permanece ahí durante una etapa de su vida. los procedimientos para muestrear varían de acuerdo con la fase y el propósito. Esta profundidad varía dependiendo de las condiciones físicas del suelo. la mosca de la fruta es un habitante temporal del suelo. Los cebos deberán reemplazarse cada semana y los especímenes capturados. El desarrollo de la pupa ocurre en el suelo. sobre todo. la humedad y la textura. normalmente. MUESTREO DE LA MOSCA DE LA FRUTA El muestreo de adultos de moscas de la fruta se lleva a cabo utilizando trampas McPhail (Ilustración 8b) con atrayente alimenticio. el parasitoide adulto puede emerger en el suelo. Debido a que el ciclo de vida involucra las partes aéreas de la planta hospedera. puesto que ésta sólo se puede establecer usando frutos infectados.inservible para cosecha o consumo. de ahí que. en función de la temperatura. La fase pupal dura de 8 a 10 días. Después de que la fruta infestada cae. las larvas migran de la fruta para pupar en el suelo (Ilustración 8a). 200 ml de proteína hidrolizada de maíz (5% en agua preservada con tetraborato de sodio con un pH entre 8. ramas o semillas en donde las larvas de la mosca residían previamente. sin embargo. el uso de trampas con cebos alimenticios es lo más recomendable. 282 Manual de biología de suelos tropicales . por lo tanto. removidos. Aun cuando las larvas son parasitadas dentro de los frutos.

la trampa puede utilizar como soporte tres palitos.Las trampas se instalan en el centro del dosel de los árboles y su localización será tomada con GPS. la densidad deberá ser de tres a cinco trampas por hectárea o estar de acuerdo con el tipo de uso de suelo existente en el predio. o bien. hasta tres por hectárea son las recomendadas para plantaciones herbáceas. La etiqueta deberá incluir la información básica de muestreo y el número de la trampa. es decir. Muestreo. esto se puede llevar a cabo en el campo o en el laboratorio. El número de trampas por unidad de superficie puede variar de acuerdo con los objetivos del proyecto. si lo hay. Cuando el objetivo es el manejo integrado. primero será necesario separar las moscas de la fruta de otros especimenes.5 mm para remover las moscas y separarlas de otros grupos taxonómicos utilizando unas pinzas curvas. Hasta cinco trampas por hectárea pueden ser instaladas en áreas con arbustos o árboles (jardines caseros). preservación e identificación de moscas de la fruta 283 . Trampa No 5 • • • • • También deberá ser registrada la identidad de individuos de otros grupos taxonómicos capturados en las trampas. En el caso de plantas herbáceas. el contenido de la trampa deberá pasarse por una malla de nylon de 1. una trampa cada cuatro hectáreas resulta suficiente. Si el objetivo es monitorear plagas. Por ejemplo: Manaus-AM Brasil 04° 05`S. Se anota el sexo y se colocan en frascos de vidrio (de alrededor de 50 ml) etiquetados. cada tipo de uso de suelo existente debe ser monitoreado con la misma densidad de trampas. con alcohol al 70% para su identificación posterior. colocarse sobre un árbol adyacente. M. dispuestos en forma de trípode. Las trampas deberán ser colocadas de manera equidistante. 60° 04´W 23/Marzo/2006 Silva. N. COLECCIONANDO LOS ADULTOS CAPTURADOS Debido a la probabilidad de que distintos grupos taxonómicos de insectos sean capturados. Cuando los cebos son reemplazados. mientras que.

Los adultos emergidos serán retenidos. durante 48 horas para permitir el endurecimiento cuticular y la pigmentación completa de los patrones alares (Ilustración 8c): características de gran importancia para la identificación taxonómica. Estas jaulas deberán ser examinadas diariamente. Las fechas de emergencia. Posteriormente. OBTENCIÓN DE LAS PUPAS La vermiculita o arena fina deberá pasarse por una malla galvanizada. La determinación de la relación de sexos hembra-macho (SR) para moscas adultas y parasitoides se hace de acuerdo con Silveira-Neto (1976) en función de la siguiente ecuación: Número de hembras SR= Número de hembras + Número de machos IDENTIFICACIÓN DE ESPECIES La identificación taxonómica de especies de Tephritidae se basa en un examen ventral de la región apical.5 mm. para separar las pupas que posteriormente serán colocadas en jaulas. Después de emergidas. de 1. se protegen con bolsas de tela y se transportan en cajas térmicas hasta el laboratorio. las charolas se cubren con una tela de gasa y se aseguran con ligas de plástico para prevenir que se escapen las moscas adultas al emerger. las moscas adultas son alimentadas con una solución de miel disuelta en agua al 10% que será cambiada cada día. se depositan en charolas de plástico con una capa de vermiculita o arena fina como substrato de pupación. con sus respectivas etiquetas de identificación. se pesan. Los frutos deberán ser colectados directamente de los árboles o inmediatamente después de caer al suelo. Finalmente. el número y el sexo deberán quedar registrados con relación a las moscas o parasitoides.MUESTREO DE LA FRUTA Para poder establecer la relación entre las especies Anastrepha con sus plantas hospederas. Los frutos muestreados se separan por especie. para permitir la salida de las moscas adultas y/o parasitoides. se recogen frutos al azar en diferentes agroecosistemas y en diferente estado de de maduración. Finalmente. el aculeo de la hembra bajo un microscopio estereoscó284 Manual de biología de suelos tropicales . se cuentan y se separan para cada sitio de muestreo. los especimenes recuperados son fijados en una solución de alcohol al 70%.

(1993) “Levantamento e análise faunística de moscas-das-frutas (Diptera: Tephritidae) em quatro locais do Estado do Amazonas’. REFERENCIAS Bateman. 487–575. La identificación de especies del género Anastrepha se logra para las hembras adultas. tergito medio. pp. R. Salles. Muestreo. N. (2002) “Ocorrência e flutuação populacional de espécies de moscasdas-frutas eparasitóides com ênfase para o Gênero Anastrepha (Diptera: Tephritidae) na Amazônia Brasileira’. como lo describe Zucchi (1988). A. M. daciformis. PhD thesis. L. Zucchi (1978 y 2000) y Norrbom (1985). São Paulo. H. pp. A. in A. vol. coloración de cuerpo. Annual Review Entomology. Es recomendable que se depositen ejemplares de referencia en colecciones de museo. Escola Superior de Agricultura “Luiz de Queiroz”.pico (40X) o mediante el montaje sobre laminillas para examinar estas estructuras. como las de Lima (1934). São Paulo. 1868 (Diptera: Trypetidae)’. Brazil. Norrbom. L. Steyskal (1977). Ronchi-Teles. Silva. 4. comparando el patrón alar. Foote. M. especialmente. es necesario extraer completamente el aculeo de la funda del ovipositor con ayuda de agujas o pinzas (Ilustración 8d). (1934) “Moscas-de-frutas do gênero Anastrepha Schiner. Brazil. preservación e identificación de moscas de la fruta 285 . PhD Thesis. Stone (1942). The Pennsylvania State University. Departamento de Zoologia. utilizando un microscopio de transmisión (100X). abdomen y. Silva (1993). A. 493–518. (2000) ‘Biologia e ciclo de vida de Anastrepha fraterculus (Wied. mesonoto. Memórias do Instituto Oswaldo Cruz (Rio de Janeiro). A. o que éstas sean incorporadas a la colección institucional del laboratorio. Vanzolini (ed) A Catalogue of the Diptera of the Americas South of the United States. las características morfológicas del aculeo (Ilustración 8e) con especímenes de museo o usando claves taxonómicas. no. PhD Thesis. 17. Pennsylvania. vol. En primer lugar. Manaus. Foote (1967). Holos. Lima. Ribeirão Preto. Zucchi (eds) Moscas-das-frutas de importância econômica no Brasil: Conhecimento básico e aplicado. Malavasi and R. B. robusta and schausi species groups of Anastrepha Schiner (Diptera: Tephritidae)’. Secretaria da Agricultura. A. Ronchi-Teles (2002). C. Federal University of the Amazon (UFAM) and National Institute for Agricultural Research (INPA). (1985) ‘Phylogenetic analysis and taxonomy of the cryptostrepha. 28. (1972) ’The ecology of fruit flies’. (1967) ‘Family Tephritidae’. University of São Paulo.)’. in M.

6. (1978) “Taxonomia das espécies de Anastrepha Schiner 1868 (Diptera: Tephritidae) assinaladas no Brasil’. (1992) Fruit Flies of Economic Significance: Their Identifications and Bionomics. M. M. (1988) ‘Description of immature stages of Anastrepha interrupta. 439. O.. and Silveira Neto. A. L. N. Nakano. R. A. J. R. White. R. Zucchi. Zucchi. (eds) (1976) Manual de Ecologia dos Insetos.. in A. Zucchi. CRC Press. Tephritidae) no Brasil: taxonomia. in H. Silveira Neto. M. Campinas. S. limae. A. A. N. Zucchi. 81. (1977) Pictorial Key to Species of the Genus Anastrepha (Diptera: Tephritidae). PhD Thesis. A. Wallingford. y Elson-Harris. N. São Paulo. Barbin. Malavasi and R. V. MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. United States Department of Agriculture Miscellaneous Publications. A. pp. D. in G. vol. Brazil’.. M. A. CAB International. 286 Manual de biología de suelos tropicales . MacPherson (eds) Fruit Fly Pests: A World Assessment of their Biology and Management. J. J. Silva. y Nova. CRC Press. Ceres. grandis (Diptera: Tephritidae)’. (1996) ‘The natural hosts plants of Anastrepha (Diptera: Tephritidae) in the State of Amazonas. 994–1003. M. Fundação Cargill.Silva. y Wharton.. Escola Superior de Agricultura ‘Luiz de Queiroz’. (1988) “Moscas-das-frutas (Dip. in G. A. (1942) ‘The fruit flies of the genus Anastrepha’. (2000) ‘Taxonomia’. I. M. R. São Paulo. A. R. Steyskal. S.. A. Holos Zucchi. S. Entomological Society of Washington. distribuição geográfica e hospedeiros”. no. Steck. Zucchi (eds) Moscas-dasfrutas de importância econômica no Brasil: Conhecimento básico e aplicado. Ribeirão Preto. 1–112. and A. (1996) ‘Anastrepha species (Diptera: Tephritidae) from the Brazilian Amazon: Distribution. Steck and B. y Silveira Neto. Washington DC. hosts and lectotype designations’. Boca Raton. A. de Souza (ed) Moscas-das-frutas no Brasil. C. Boca Raton. G. Steck and B. University of São Paulo. pp. Annals of the Entomological Society of America. vol. R. A. Stone.

el primero para llevar a cabo el proceso de infección y el segundo. Si se asume que cada especie de insectos es susceptible a por lo menos un microorganismo patogénico. para resistir la enfermedad. sin intervención humana. Los principales microorganismos utilizados. Jr y Ricardo Sousa Cavalcanti INTRODUCCIÓN Existe alrededor de medio millón de especies de insectos descritas en la tierra. La patología de insectos es la ciencia que estudia las enfermedades de insectos. con el fin de utilizarlas como mecanismos de control de especies que son plaga. Esto es similar a la dinámica natural que sucede en el campo entre el patógeno y su hospedante. ello da la idea de la potencial importancia del estudio de estos patógenos de insectos en el contexto de control de plagas y de biodiversidad. y que han demostrado su 287 .Capítulo 10 Hongos y nematodos entomopatógenos Alcides Moino. Las enfermedades son procesos dinámicos en donde el patógeno (microorganismo) y el hospedante (insecto) están adaptados morfológica y fisiológicamente. 1992). el 10% pueden considerarse plagas agrícolas forestales o urbanas. prevenir su ocurrencia en insectos benéficos. pero sí manteniéndolas en niveles por debajo del umbral de daño económico. frecuentemente hospedante-específico. El control microbiano es una forma de control biológico cuyo principio es el uso racional de entomopatógenos sin que necesariamente se eliminen las poblaciones de plagas. De éstas. aproximadamente. o bien. aunque la cifra verdadera de diversidad puede ser mucho mayor (Groombridge.

a pesar de ello. baja persistencia e inactividad a bajas temperaturas (en el caso de los nematodos). aparece una nueva generación de estadios infectivos (Kaya y Gaugler. se han utilizado como biopesticidas para su uso contra poblaciones de plagas. 2006). se producen miles de nuevas esporas que se dispersan y continúan su ciclo de vida en nuevos hospedantes. Existen dos familias.. como es el caso de Lecanicillium logisporum. Roy et al. 1994. los virus. Leger. Myers y Rothaman. 1993). Una vez muertos los insectos. Se conocen cientos de especies de hongos entomopatógenos que atacan una amplia gama de insectos y ácaros. la Sterneinematidae y la Heterorhabditidae que son parásitos obligados de insectos y que son la base de varios plaguicidas biológicos diseñados específicamente para su uso en contra de plagas del suelo como los gorgojos y las larvas de mosca. La mayoría de los patógenos poseen una estrategia de transmisión de “sentar y esperar” (sensu Ewald. 1995): los organismos producen fases infectivas que son liberadas al ambiente cuando muere el hospedante 288 Manual de biología de suelos tropicales . las bacterias. en donde pueden ser excepcionalmente virulentos (o decir. invadiendo su cuerpo y matándolo de cuatro a diez días posteriores a la infección. 1997.5 mm de largo. causar la muerte rápida del hospedante y provocar grandes niveles de mortandad en las poblaciones de éste) y causar epizoóticas periódicas (Chandler et al. los basados en toxinas). Después de una a dos semanas posteriores a la invasión del hospedante. Un pequeño número de especies generalistas con capacidad para ser cultivadas y producidas de manera masiva. y convirtiéndose posteriormente en adultos. debido a su alto costo. los nematodos y los protozoarios. penetrando directamente la cutícula o a través de las aperturas naturales como los espiráculos. 1995). pobre persistencia (especialmente bajo condiciones tropicales) y su baja eficacia cuando se compara con los insecticidas químicos (por ejemplo. Los nematodos entomopatógenos miden alrededor de 0.. permitiendo que los nematodos crezcan y maduren sobre el tejido en descomposición. Los hongos producen esporas que germinan al contacto con el hospedante.potencial en el control microbiano de insectos son: los hongos. Los estadios juveniles parasitan a sus hospedantes. las bacterias que se introducen junto con el parásito se multiplican rápidamente y matan al hospedante. con varios grados de especificidad con su hospedante (Hajek y St. éstos aparentemente son componentes diversos y universales de las biotas del suelo. ambos presentan desventajas debido a su alto costo. aunque esta tecnología no se ha adoptado por completo en la práctica. A pesar del éxito limitado de hongos y nematodos entomopatógenos como productos biocidas.

lo que les permite mayor distribución geográfica de la población y alta movilidad. son susceptibles a hongos y nematodos. Metarhizium anisopliae. Los hongos de mayor interés por su potencial como patógenos de insectos son: Beauveria bassiana. 2001). Entomophaga. aunque su eficiencia competitiva en comparación con otros saprótrofos de vida libre puede ser baja. H ongos y nematodos entomopatógenos 289 . flavoviride. Lecanicillium lecanii. se producen asexualmente estructuras reproductivas conocidas como esporas o conidias que ayudan a la diseminación del patógeno. Después de la infección exitosa de un hospedante. Los hongos poseen una gran variabilidad genética y un amplio rango de hospedantes. y hongos del orden Entomophthorales (Zoophthora. En el caso de los hongos entomopatógenos esto se apoya en evidencia molecular que muestra que poblaciones en suelo no son totalmente clonales. el suelo es. Las fases de diapausa y latencia reducen la dependencia en la movilidad de su hospedante y pueden complementarse con la capacidad para vivir saprotróficamente en suelo.. sugiriendo de nuevo que los patógenos se distribuyen ampliamente en el suelo. Nomuraea rileyi. Con frecuencia no hay correlación entre la densidad del hospedante y la ocurrencia de la enfermedad. Paecilomyces spp. sin duda. Neozygites). Esta capacidad es una adaptación a sus hospedantes artrópodos que son más grandes y con patrones de distribución en parches. BIOLOGÍA DE HONGOS Y NEMATODOS ENTOMOPATÓGENOS Hongos Los hongos son microorganismos unicelulares (levaduras) o multicelulares (especies filamentosas). debido a que ofrece un microambiente estable con una estructura de poros favorable para nematodos y recursos orgánicos para hongos.y tienen la capacidad de entrar en un estado de letargo o diapausa y permanecer latentes hasta que haya nuevos hospedantes disponibles. el reservorio de las fases infectivas. que constan de células alargadas provistas de una pared que contiene celulosa y quitina. Cordyceps spp. Aunque los artrópodos que viven por encima del suelo. Aschersonia aleyrodis. Entomophthora. Estas estructuras vegetativas son llamadas hifas. como los que habitan debajo de éste. Hirsutella thompsonii. M. además de otros carbohidratos y proteínas... ello a pesar de la ausencia de fases sexuales manifiestas y que el significativo flujo de genes ocurre localmente (Bidochka et al.

los nematodos entomopatógenos presentan una estrecha asociación (simbiosis) con bacterias específicas. A continuación se describen dos técnicas básicas para el aislamiento de hongos y nematodos entomopatógenos a partir de muestras del suelo. Los nematodos transportan internamente bacterias específicas que son liberadas en el interior del cuerpo del insecto después de que el nematodo penetra a través de aberturas naturales como boca. La población microbiana en cualquier ambiente natural es muy grande y por lo tanto. 1998A) Las muestras de suelo se colectan a una profundidad de 0 a 20 cm y se colocan en bolsas de plástico debidamente etiquetadas. 1986. Alves et al.. en el suelo). 1993.Nematodos Los nematodos entomopatógenos son organismos pseudocelomados vermiformes muy similares a los que parasitan plantas y que pueden asociarse con los insectos de tres formas: forecia (adherencia pasiva y transporte). en el caso de los hongos. la identificación se fundamenta en medidas hechas a partir de estructuras presentes en los estadios juveniles infectivos. aislar poblaciones. parasitismo obligado y parasitismo facultativo. en el caso de los nematodos. es muy común encontrar también hongos. cuando un insecto muerto es recogido para el cultivo de inóculo infectivo. De igual manera.. espiráculos y ano. cuando el objetivo del muestreo es evaluar la biodiversidad (por ejemplo. 290 Manual de biología de suelos tropicales . Los principales grupos de nematodos de interés pertenecen al orden Rhabditida. METODOLOGÍA PARA EL AISLAMIENTO DE HONGOS ENTOMOPATÓGENOS (Chase et al. se basa en caracteres morfológicos del organismo en cultivo y en la estructura de los conidióforos y conidias. En cada sitio de muestreo. La identificación correcta de un agente entomopatógeno. Sin embargo. las cuales son los agentes primarios que inician la infección en el hospedante. Estas bacterias se multiplican dentro del insecto y lo matan al causarle septicemia (infección generalizada). también pueden obtenerse resultados semejantes y se requerirá de medidas adicionales para identificar patógenos con potencial.. Liud et al. y dentro de éste a las familias Steinernematidae y Heterorhabditidae. bacterias y otros microorganismos saprotróficos que no tienen potencial como agentes específicos para el control de plagas. para lograr una buena identificación es necesario aislar el microorganismo en cultivos puros o al menos. Por lo general.

Samson et al. Esto suele ser efectivo especialmente con Metarhizium anisopliae. 550 mg de dodina (N-dodecilguanidina acetato). A partir de estas alícuotas se preparan diluciones 10-1 sucesivamente. El crecimiento de los hongos y su esporulación se evalúan de 7 a 15 días posteriores a la inoculación. De las diluciones 10-3 y 10-4 se toman 0. El medio ADP se prepara de la siguiente manera: 15 g de agar. Después de la incubación. la identificación de los cultivos de interés (principalmente Metarhizium anisopliae. tales como conidióforos. se esteriliza durante 20 minutos a 120°C y se filtra. Después de este paso se toman 0. Estas muestras pueden tomarse mediante el método de extracción de núcleos (véase Capítulo 4: Mesofauna).0 mg de tetraciclina y 10 mg de cristal violeta.1 ml de la última dilución y se colocan sobre la superficie del medio de cultivo contenido en una caja Petri.1ml y se colocan en medio de cultivo selectivo (el cual contiene el fungicida dodina) y en medio ADP (Agar-Dextrosa-Papa). Beauveria bassiana y Paecilomyces spp. 200 g infusión de papa (preparada a partir de papas rebanadas y hervidas para extraer el almidón). con la subsecuente purificación de los cultivos (Figura 10. 5..2) y almacenaje de conidios en condiciones de congelación utilizando tubos Eppendorf para tal fin. 1998b. se añade agua destilada hasta alcanzar el volumen original de 1 litro y posteriormente se añaden 20 g de agar. El medio selectivo de dodina se prepara de la siguiente manera: 20 g de harina de avena + 1 litro de agua destilada. aunque puede prescindirse de él. utilizando agua destilada esterilizada hasta alcanzar una dilución 10-4. y agua destilada hasta completar el volumen total de un litro. 1998).. conidias y fiálides (Alves et al. El fungicida dodina se añade en pequeñas concentraciones (cerca de 10 mg ml-¹) al medio selectivo con el fin de aislar hongos entomopatógenos a partir del suelo y preservar los aislamientos menos susceptibles al fungicida. H ongos y nematodos entomopatógenos 291 .) puede llevarse a cabo usando un microscopio compuesto y claves de identificación basadas en caracteres morfológicos de las estructuras reproductivas.1).se toma una muestra compuesta a partir de seis submuestras tomadas en puntos localizados alrededor de un monolito central (véase Capítulo 2). el volumen añadido se reparte sobre la superficie utilizando una asa de Drigalski (ya sea de acero inoxidable o vidrio). En el laboratorio se debe mezclar muy bien la muestra compuesta y tomarse alícuotas de 1g de suelo. Las cajas se incuban a 27°C (Figura 10. 20 g de dextrosa.

Nota: la separación de contaminantes se logra recogiendo una pequeña porción de cualquiera de las colonias del hongo de interés con una aguja. 292 Manual de biología de suelos tropicales .1 ml) en una caja petri con medio de cultivo. d) almacenaje de conidios en tubos Eppendorf. y transfiriéndola a una caja Petri nueva con medio de cultivo ADP (tres puntos de inoculación por caja). bajo condiciones de congelación. c) incubación bajo condiciones controladas en una cámara DBO. creciendo en medio ADP. Figura 10. b) inoculación de la suspensión (alícuota de 0.2 Cultivos purificados de Beauveria bassiana.1 Procedimiento de aislamiento de hongos entomopatógenos en medios de cultivo a) dilución seriada de la suspensión acuosa que contiene al hongo.Figura 10.

FeSO4. y pueden adquirirse comercialmente. CaCl2 0.1mM. Después de dos días. ZnSO4.6mM. Las larvas muertas se colocan en una trampa White (Chen et al.1M NaCl. La mortandad de las larvas se evalúa después de cinco a siete días. El medio “S” consiste en un litro de solución madre (0.4M. el cual cae hasta tocar el líquido en el borde de la caja inferior.0. H ongos y nematodos entomopatógenos 293 . utilizando la técnica de trampas de insectos con cinco larvas de Galleria mellonela (L. Las larvas se colocan en cajas de plástico de 500 ml. Figura 10. MgSO4 0.7H2O 0. La identificación se lleva a cabo con base en las claves específicas de identificación para cada familia de nematodos (Steinernematidae y Heterorhabditidae) (Alves et al. Posteriormente. Las larvas de insectos infectadas se colocan en el centro del papel filtro. 1998b. Los nematodos se almacenan en envases cerrados de 50 ml a 11°C o cercano a esa temperatura.3mM. 0. Los ejemplares de nuevas especies pueden someterse a un análisis molecular para así comparar los patrones de DNA.4M. 2002)... 1μM colesterol) a la que se le añaden 26 ml de una solución nutritiva fresca que contiene citrato de K 0. CuSO4 0 1μM. La detección de nematodos se lleva a cabo mediante bioensayos.05M KH2PO4. La suspensión se deja reposar para permitir que los nematodos queden en el fondo. éstos deben colectarse y colocarse en agua destilada dentro de un frasco Becker.METODOLOGÍA PARA EL AISLAMIENTO DE NEMATODOS ENTOMOPATÓGENOS (Bedding y Arkhurst.3M. Adams y Nguyen. Las larvas de este lepidóptero son conocidas como mealworms (o gusanos de la harina). 1974) Se recogen las muestras de la misma forma que fue descrita anteriormente. Una trampa de White se puede construir utilizando dos cajas Petri: una caja de 5 cm de diámetro se coloca invertida dentro de una caja de 9 cm que contiene agua esterilizada o medio “S” esterilizado y cubierta con un círculo de papel filtro de 9 cm. que contienen las muestras de suelo y se mantienen cerradas a 23°C en oscuridad. si se encuentran estados infectivos en el líquido. la suspensión se lava adicionando una solución de formaldehído (1%) o solución de Ringer para obtener una concentración final de 10.000 estados infectivos ml-¹.3) para colectar los estadios juveniles infectivos a partir de los cuerpos muertos.7H2O 0. 2004. pH 6.) (Lepidoptera: Pyralidae). Na EDTA 0.

Almeida. Lavender. M.. A. pp. (1998b) “Chaves para identificação de patógenos de insetos”. Alves (ed) Controle Microbiano de Insetos. vol. Piracicaba Brazil. REFERENCIAS Adams. y Nguyen. Kamp. K. M. T. Alves. L. (2002) ‘Taxonomy and Systematics’. L. A. A. 21.. M. S. B. B. Bedding. y Castello Branco Jr. Piracicaba Brazil. 2nd edition. FEALQ. J. B. J. b) larvas de Galeria mellonella muertas después del contacto con la muestra de suelo. C.Figura 10. Alves (ed) Controle Microbiano de Insetos. Ferraz. in S. Nematologica. y Alves. Fotos: R. c) larvas que muestran la patología típica de infección por nematodos. J. 109–110. B. d) emergencia de juveniles infectivos en la trampa White. B. B. CAB International. J. y De Croos.. S. J. A.. M.. B. Wallingford. (1974) ‘A simple technique for the detection of insect parasitic nematodes in soil’. (1998a) “Técnicas de laboratório”. E. F. Deckoning. Gaugler. (2001) ‘Habitat association in two genetic groups of the insect-pathogenic fungus Metarhi294 Manual de biología de suelos tropicales . N..3 Procedimiento para el uso de la trampa White para el aislamiento de nematodos entomopatógenos: a) caja Petri con papel filtro (Cámara seca). 2nd edition. Gaugler (ed) Entomopathogenic Nematology. A. Alves. J. R. FEALQ. y Akhurst. in S. A. Bidochka. Moino Junior. in R. R. C.

y St. vol. D. G. 133-141. K. Chase. Springer-Verlag. Hay. 69. vol. Groombridge. (1994) ‘Interactions between fungal pathogens and insect hosts’. y Gaugler. Annual Review of Entomology. D. vol. S. y Ferguson. A.. Chen.. R. R. Applied and Environmental Microbiology. vol. A. Kaya. E. pp. W... C.. vol. 5. F. Milner. from soil’. C. 39. C. (1995) ‘The evolution of virulence: A unifying link between parasitology and ecology’. (1997) ‘Sampling and occurrence of enomopathogenic fungi and nematodes in UK soils’. 194–198. y Rothaman. 81. A. McRae. H. 62.P. pp. L. vol. 1335–1342. 67. Meyers. J. 659–669. Roy. Samson. (1995) ‘Virulence and transmission of infectious diseases in humans and insects: Evolutionary and demographic patterns’. Hajek. S. Advances and Perspectives. A. World Conservation Monitoring Centre. Annual Review of Entomology. Journal of Parasitology. Ewald. Trends in Ecology and Evolution. Chen. pp.. Liu. (1988) Atlas for Entomopathogenic Fungi. vol. (2006) ‘Bizarre interactions and endgames: Entomopathogenic fungi and their arthropod hosts’. Z. 248–251. 285–292. K. V. Eilenberg. Chapman and Hall. M. Chandler. 331–357. E. J. (2004) Nematology. W. B. L. D. E. 51. Osborne. vol. J. pp. Hajek. Leger. Z. Y. y Dickson. 38. pp. pp. P. E. J. 181–206. pp. New York. y Read.. Florida Entomologist. H.. P. y Pell. (1993) ‘Entomopathogenic nematodes’. y Lutton.. X. Journal of Invertebrate Pathology.zium anisopilae: Uncovering cryptic species’. H. J. vol. Wallingford. A. R. J. H ongos y nematodos entomopatógenos 295 . R. (ed) (1992) Global Biodiversity: Status of the Earth’s Living Resources. 10. 293–322. G. CAB International. y Latgé. (1986) ‘Selective isolation of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae from an artificial potting medium’. pp. R. Annual Review of Entomology. London. Y. pp. Evans. Applied Soil Ecology. D. Steinkraus. H. (1993) ‘The use of Dodine in selective media for the isolation of Metarhizium spp.

.

entrevistas o preguntas. dependiendo de los datos disponibles.Capítulo 11 Descripción y clasificación de uso de suelo en puntos de muestreo para elaborar un inventario de la biodiversidad del suelo E. Cuántas clases de uso de suelo pueden ser definidas con respecto a la intensidad de usos de suelo se ilustra a continuación. en los puntos de muestreo. Este método ofrece varios niveles de detalle que describen las características. en función del propósito y del contexto de la clasificación misma. lo cual requiere solamente el valor adecuado por evaluar en el campo. los dominios de los valores de los atributos se especifican. pero las clases finales de uso de suelo dependerán de la selección de dichos atributos a considerar para la clasificación. 297 . cuando se precise un alto nivel de detalle. se necesitarán mediciones reales. Esto se lleva a cabo mediante la observación directa. En la mayoría de los casos. La clasificación de uso de suelo se facilita por una estructura jerárquica donde se ordenan los atributos. Solamente en algunos casos. Jeroen Huising RESUMEN DE LA METODOLOGÍA PARA LA DESCRIPCIÓN DE USO DE SUELO Este capítulo muestra una lista estructurada de atributos de uso de suelo que sirve como guía para la observación de características de uso de suelo en el campo.

proporciona una estructura para la clasificación de usos de suelo. basadas en un común denominador en todas las áreas bajo estudio. Este capítulo presenta una estructura que provee el registro sistemático de las características de uso de suelo. especialmente en las regiones tropicales. Los procesos dominantes que determinan la presencia e incidencia de la biota del suelo y la escala espacial donde éstos se manifiestan no se conocen completamente. La idea general es que el contenido de un estudio depende de la naturaleza de la región (Vink. de modo que se puedan reflejar las diferencias en la intensidad de uso de suelo. 2005). de manera que se puedan definir las clases de uso de suelo. el enfoque que se describe a continuación se aleja de la idea de que las clases de uso de suelo sean definidas de acuerdo con la identificación de las características relevantes de uso de suelo (atributos) que permiten una 298 Manual de biología de suelos tropicales .. Para comprobar esta hipótesis. En lugar de utilizar clases predefinidas de uso de suelo. a través de puntos de referencia de los países tropicales involucrados. y al mismo tiempo. Las clases de uso de suelo predefinidas no son necesariamente aplicables o relevantes para todas las áreas involucradas porque será muy difícil definir un grupo estándar de clases de usos de suelo. y es por lo tanto. dada la variación en los cultivos y sus posibles combinaciones. implica que las clases de uso de suelo no están definidas a priori. razón por la cual fue adoptado un sistema regular en cuadrícula para muestrear la biodiversidad del suelo con un inventario detallado de su uso y cobertura en los lugares de muestreo. 1975). se considera uno de los factores determinantes de la abundancia y riqueza de poblaciones de organismos del suelo. Lo último. la hipótesis central del proyecto CSM-BGBD (Giller et al. la historia de uso de suelo y las prácticas de manejo de los mismos. Dicha estructura necesita ser flexible. lo que facilita el análisis de los factores determinantes actuales y una clasificación a posteriori. en cuanto al uso de varios recursos como fotos aéreas o imágenes satelitales para el propósito de la clasificación.ANTECEDENTES Y PRINCIPIOS DE DISEÑO Propósito de la clasificación del uso de suelo y de su cobertura vegetal El uso de suelo. y en particular la intensidad de su uso. se requiere de un sistema que permita el registro de las características de uso de suelo en las parcelas de muestreo y su clasificación posterior. pero dependen de los clasificadores o atributos seleccionados para la asignación de la clase de usos de suelo a cualquier observación particular.

Lo anterior. sin incluir elementos relacionados con el manejo de ganaD escripción y clasificación de uso de suelo en puntos de muestreo 299 . El sistema de clasificación de uso y cobertura del suelo ayuda a la armonización de los procedimientos para la recolección de datos y al manejo de los mismos. Un segundo objetivo para los inventarios de uso de suelo es proveer información básica para definir los usos de suelo alternativos y las prácticas de manejo que mejoran la sustentabilidad de la producción agrícola y conservan la biodiversidad del suelo. sistemas acuáticos y principalmente áreas sin vegetación. para el propósito actual. El objetivo del inventario para proveer datos que permitan evaluar cambios en la biodiversidad del suelo en relación con el uso del suelo. Los objetivos mencionados arriba fueron también citados en el programa Africover.discriminación entre clases de usos de suelo. El enfoque del inventario de uso de suelo aquí descrito se apoya principalmente en ese sistema de clasificación.. No obstante. El método no incluye una estructura para la descripción de los atributos ambientales. 1975). Asimismo. aunque atributos relacionados con la historia del uso de suelo o condiciones ambientales podrían ser adicionados o modificados del sistema de clasificación. Para la clasificación y descripción de las áreas de vegetación (semi) natural se puede seguir el LCCS. el manejo de los cultivos y del suelo) son de particular importancia porque impactarán notablemente sobre la distribución de los organismos del suelo. ej. La estructura de las descripciones del uso de suelo actual no ha sido hecha para registrar el uso de suelo histórico. como clima. El método que se presenta pretende ser de utilidad para la descripción de uso de suelo a nivel parcela. los fenómenos relacionados con la forma en que se está utilizando el suelo (p. áreas cultivadas y manejadas) mientras que el marco del LCCS incluye sistemas terrestres vegetales (semi) naturales. que desarrollaron el Sistema de Clasificación de Cobertura de Suelo (LCCS) por Di Gregorio y Jansen (2000). Las clases de usos de suelo obtenidas de esta manera pueden ser utilizadas para la extrapolación de los resultados más allá de los lugares de estudio. ej. especialmente en su intensidad. La descripción detallada de uso y la cobertura de suelo deberán formar parte del inventario. generalmente se traduce en el registro de la ocurrencia de cultivos. los métodos descritos en este capítulo se aplican únicamente en paisajes agrícolas terrestres (p. es diferente al monitoreo usado con frecuencia que incluye en la descripción de uso de suelo y el estudio de las condiciones naturales y socioeconómicas del suelo como un primer objetivo (Vink. etc. forma del paisaje. aunque contiene elementos añadidos relacionados con el manejo de suelo y cultivos.

basada en la interpretación de fotografías aéreas con el propósito de elaborar mapas de uso y cobertura del suelo. ni incluye elementos relacionados con el sistema de cultivo. por lo tanto. son rígidos y de capacidad limitada para incorporar nuevas clases. Concepto y principios de diseño Los conceptos y principios de diseño del LCCS adoptados utilizan criterios diagnósticos ordenados de manera jerárquica para permitir un sistema de clasificación consistente con límites claros para las clases. el sistema de clasificación de uso de suelo y de su cobertura del US Geological Survey. descrita por Lillesand y Kiefer (1987). Cuantos más clasificadores se añaden. Obsérvese. Existen cinco niveles en la jerarquía de clasificación: Nivel 1: Características relacionadas principalmente con el cultivo y el campo Nivel 2: Características relacionadas con la combinación de cultivos. El principio básico se apoya en el uso de clasificadores que refieren a criterios de diagnósticos o atributos independientes. no son exhaustivos (es decir. aunque se reconoce que para los estudios a una escala mayor o para considerar opciones alternativas de uso de suelo. utilizados para definir una clase. Nivel 3: Características relacionadas con aspectos culturales como irrigación y cultivo de temporada. El método que se describe a continuación. Nivel 4: Características relacionadas con el manejo de prácticas del suelo. dispuestos en un sistema jerárquico. son limitados cuando se les compara con otros sistemas. La jerarquía de clases es construida sobre un conjunto de clasificadores.do. más detallado queda el nivel de clasificación. Dicho sistema a menudo carece de una definición clara de los límites de clases. resultarían de gran utilidad. representan un subconjunto de un rango de posibles usos y coberturas de suelo) y debido a que no existe un sistema de clasificación de referencia. no resulta apropiado para la descripción y mapeo de áreas más grandes. donde cada jerarquía se relaciona con diferentes niveles de detalle temático y espacial. porque esto no está particularmente relacionado a nivel de parcela. a no ser la cobertura del suelo per se. Muchos sistemas de clasificación utilizan a priori definiciones descriptivas de uso de suelo y clases de cobertura del suelo. Nivel 5: Características de uso de suelo del área directamente circundante a Manual de biología de suelos tropicales 300 . por lo tanto. Estos “sistemas” de clasificación básicamente representan leyendas. por ejemplo.

la parcela de muestreo. patrones de campo) y los cultivos asociados. son características que no se evalúan en los primeros niveles de clasificación. Estos tres primeros niveles forman la base para la clasificación de uso de suelo y la colecta de datos en relación con dichas características se sugiere representan los datos mínimos requeridos. El tamaño del campo generalmente es indicador del tamaño de la finca. incluyendo arreglos espaciales de los campos agrícolas. Otros aspectos que se deben considerar son la distribución. que muchas veces es referencia de la clase social y del tipo de manejo (Huising. barreras de viento y otras estructuras semipermanentes. se refieren a las operaciones realizadas en una parcela en particular. la clase mayor es definida por el tipo de cultivo principal (p. lo que sirve para D escripción y clasificación de uso de suelo en puntos de muestreo 301 . Este último determina si el campo forma parte de un sistema de cultivo migratorio. pero que se consideran importantes en relación a la intensidad del uso y pueden tener un impacto directo sobre la biodiversidad del suelo. El quinto nivel en los sistemas de clasificación se relaciona con elementos de vegetación leñosa (semi) permanentes dentro de la parcela y en los campos aledaños. Por ejemplo. un sistema de barbecho o un sistema de cultivo permanente. Dichos clasificadores. pero con algunos antecedentes de uso de suelo y de los sistemas de cultivo habituales. “cultivo de árboles” para un sistema basado en árboles). Asimismo. o basados en los datos proporcionados por el agricultor. En el siguiente nivel de la clasificación jerárquica se consideran las prácticas culturales relacionadas con el suministro de agua y factores de cultivos de temporada. ej. se han añadido clasificadores que relacionan el manejo del suelo y cultivos que permiten la determinación del nivel de intensidad de uso. Las características no siempre son fácilmente observables. Esto puede ser señal de cultivos simultáneos o. Las subclases pueden definirse basándose en otros cultivos que forman parte del sistema del cultivo general. cercas vivas. como setos. especialmente en relación con elementos leñosos de la vegetación que no se reconocen como cultivo y en relación con cultivos en campos adyacentes. el deshierbe y la fertilización del mismo. Esta información puede ayudar a determinar si la parcela bajo consideración representa una característica (o patrones) del uso de suelo o tipo de cobertura. 1993). éstos pueden ser evaluados. tales como la preparación del suelo. normalmente. junto con el tamaño de las áreas de los campos. Las características de rotación de cultivos se consideran en otros estudios. el manejo de los campos agrícolas (es decir. en secuencia. Estos elementos de vegetación se relacionan con características permanentes en el paisaje.

son consideradas observaciones a nivel de parcela. pueden añadirse sin mayores consecuencias para el sistema de clasificación. Estos nuevos atributos ofrecen información más específica sobre el objeto de observación. el cultivo principal se puede describir como maíz (Zea mays). Los valores de datos posibles (dominios de valor) para la mayoría de los atributos son dados para proporcionar una descripción estándar de las características de uso de suelo. Éstas sirven para guiar las observaciones en el campo en los puntos de muestreo y sus áreas circundantes. En el caso de algunos de estos atributos. el cultivo principal puede describirse a un nivel más general (de género) como Zea o a un nivel de familia como Gramineae (pastos). sirven para trazar la cartografía del uso de suelo (mediante la interpolación de puntos de observación que complementan un mapa). no son independientes y pueden involucrar algún tipo de medición con un nivel más alto de detalle. por lo tanto. que pueden incluir. el patrón del campo ofrece información sobre la fragmentación del suelo y constituye otro aspecto de la intensidad de uso de suelo que puede impactar directamente sobre la biodiversidad del suelo. el valor de clase a un nivel más detallado de generalización puede ser inferido. Además de este eje existe uno más en la clasificación jerárquica que hace referencia al nivel de precisión con que se describen las características de uso o añade información específica (detalles técnicos) de las características de uso de suelo descritas. por ejemplo. la descripción cuantitativa de la intensidad del uso del suelo. por lo tanto. Los niveles de clasificación definen un eje de la clasificación jerárquica en donde atributos adicionales (conjuntos de ellos) en cada nivel subsecuente definen las subclases (que representan un mayor nivel de detalle). Los atributos técnicos específicos permiten una definición más precisa de clases de uso de suelo asociados. información más específica se remite a variedades y esto representaría un mayor nivel de detalle (especificidad). por ejemplo. como los refiere el LCCS. 1998) y Huising (1993).identificar posibles asociaciones de usos de suelo que. Si se conoce el valor de clase a un nivel más específico. Estos atributos técnicos específicos. Además. Registro de datos en campo y observaciones adicionales En las siguientes secciones se presenta la lista de atributos para la descripción de usos de suelo. La transformación de las listas de atributos a formatos para registrar los datos en el campo resulta fácil. Por otro lado. a su vez. Los principios de las clasificaciones jerárquicas son explicados por Molenaar (1991. Los atributos. los dominios de valor no son específicos para permitir la definición de 302 Manual de biología de suelos tropicales .

El sistema para describir el uso de suelo muestra varios niveles de detalle. o bien. Sin embargo. no se obtiene a través de observaciones directas en el campo. Si éste no es el caso. Sin embargo. con los conocimientos de un sistema habitual de cultivo y las prácticas de manejo en el área. basados en la definición de la clase adoptada (ver Tabla 11. o bien. la información puede generalizarse para la clase de “fertilizante aplicado” (implicando el uso de fertilizante inorgánico). a partir de la observación directa en el campo. basada en observaciones secundarias. clases de tamaño estándar definidas en campo con límites fijos no podrán ser significativas por esa razón. una tasa particular de aplicación (baja. características culturales) obtenida de un informante o derivada de la información general de las prácticas culturales en el área. pero éstos deberán añadirse a los niveles más bajos de la clasificación jerárquica para evitar que interfieran con la estructura de la misma. media o alta. La situación contraria sería con el conocimiento de la práctica común en el área. si la información sobre la tasa de aplicación de un fertilizante inorgánico en particular no se considera confiable o correcta. Por ejemplo. simplemente. Los atributos pueden agregarse para facilitar la descripción de características específicas de un área en particular. los datos relacionados con niveles muy detallados de observación son muy difíciles de obtener. La información en el cuarto nivel.6b). a personas externas. media o alta) puede ser asumida. relacionada con el manejo. esto no es prescriptivo en el sentido de que los datos necesitan ser colectados en todos los niveles de detalle. sino que requiere del acceso a fuentes adicionales de información (a través de entrevistas a los agricultores. se debería poder inferir información sobre el manejo de la parcela en particular. junto con la información relacionada con el tercer nivel (es decir. sus fuentes no son totalmente confiables.valores de datos en los rangos de observación y distribución de los valores de datos. Las clases de datos deben indicar una discriminación relevante (significativa) de objetos y el subconjunto de clases debe ser extensivo (no exclusivo). La información de estas fuentes de datos puede resultar incorrecta. A priori. El nivel de detalle al cual la información es reunida depende del propósito del inventario de uso de suelo y de la posibilidad de obtener D escripción y clasificación de uso de suelo en puntos de muestreo 303 . es aceptable clasificar la tasa de aplicación como baja. utilizando otros recursos. como documentos). A menudo. pero ello se compensa con la aplicación de la jerarquía en la precisión de los datos (referidos anteriormente como el segundo eje en el sistema de clasificación). Las observaciones para los tres primeros niveles del sistema de clasificación se pueden hacer directamente en el campo.

por lo tanto. la información sobre el tipo de lindero se debe registrar. no se incluyen en las listas de atributos que se detallan a continuación. la cobertura del dosel deberá clasificarse como “abierta” o “cerrada”. El sistema para la descripción de uso de suelo requiere de una estructura que pueda implementarse a detalle y que se considere viable bajo las condiciones reales. dependiendo de la experiencia del encargado del proyecto. sin embargo. la explicación de posibles datos atípicos). sí pueden aportar información para el análisis de datos. será siempre una ventaja. Estas observaciones no se consideran como clasificadores y. además de los datos administrativos como hora. al mismo tiempo. como un mecanismo para la validación de los datos en atributos y clasificadores e incluso para los resultados de clasificación finales. Se deberá registrar la localización específica del punto de muestreo dentro del campo (por ejemplo. donde el cultivo de árboles se considera como el principal. siempre y cuando la cobertura del suelo no se clasifique como escasa. Se recomienda revisar el trabajo de Stocking y Murnaghan (2001) para los indicadores relevantes de observaciones en el campo. Si bien estas observaciones no se incluyen en la clasificación del uso de suelo. fecha. Para este propósito. el centro o los linderos). OBSERVACIONES DE USO DE SUELO: CLASIFICADORES Y ATRIBUTOS Observaciones respecto del cultivo principal y tamaño del campo El primer nivel del sistema de clasificación se reserva para las observaciones del cultivo principal. pueden ser incorporadas fácilmente a las libretas de campo en caso necesario.la información requerida. (por ejemplo. nombre del encargado del proyecto y nombre de la persona que toma los datos. para la selección entre un cultivo de árboles y un cultivo anual en el mismo campo. Estas observaciones secundarias sirven. el segundo. como el elemento de vegetación más dominante. Este tipo de información deberá registrarse en la libreta de campo. El hecho de que el encargado del proyecto se encuentre familiarizado con el uso de suelo y con las prácticas de manejo en el área. ya que puede tener un efecto en la distribución de la biodiversidad del suelo. El uso de una cuadrícula regular para el muestreo permite que se tomen puntos de muestreo en cualquier lugar dentro de la parcela y posibles efectos de borde deben tomarse en cuenta. Si la selección se realiza entre dos 304 Manual de biología de suelos tropicales . Observaciones secundarias pueden relacionarse con el estatus del cultivo o con la presencia de maleza.

“forrajes o fibras”. ancha] Propósito [vivero. En el caso de un cultivo de árboles o arbustos se puede añadir información sobre el aspecto (es decir. Se prevé para una descripción de un segundo y tercer cultivo. La categoría de cultivo herbáceo representa un nivel adicional en la clasificación jerárquica (nivel de especificación) y. 1 año. de la edad de la plantación. o gramíneas] Atributo técnico 1 Atributo técnico 2 Cultivo de árboles o arbusto Tipo de cultivo (especies y Fenología de la hoja [siem. deciduo] Tipo de hoja [aguda. La clasificación se basa en la forma de vida del cultivo.1 Clasificadores y atributos técnicos para el cultivo principal Nivel 1a – Clasificador Forma de vida [árbol. una especificación con más detalle indica si el cultivo pertenece a la categoría de “raíces o tubérculos”.1. proporcionando una mayor especificación de la forma de vida a nivel de detalle.1 los valores posibles (clasificadores o atributos) se enlistan entre corchetes. para madera o leña). entre 1 y 3 años. “leguminosas o vegetales”. En el caso de cultivos herbáceos. se puede añadir un cuarto nivel que ofrezca información sobre la variedad específica del cultivo. árboles de sombra] Duración del cultivo [Estación (parte del año). Los atributos técnicos son específicos para cada una de las diferentes formas de vida. Cuando se considera relevante. más de 10 años] 305 D escripción y clasificación de uso de suelo en puntos de muestreo . arbusto. el propósito) y duración del cultivo. En la Tabla 11.o más cultivos de la misma forma de vida. El valor de dominio no se especifica aquí.variedades) pre verde. dependiendo. por lo tanto. el cultivo con el mayor porcentaje de cobertura califica como el cultivo principal. porque su apariencia (características de vegetación) puede ser muy distinta. cosecha de toda la planta (p. entre 3 – 10 años. pero en lugar de dejarlo abierto. no se enlista bajo el título “Atributos técnicos 1” en la Tabla 11. nueces y otros. La información más concreta sería entonces el tipo específico de cultivo. es conocido el tipo de cultivo. ej. es mejor definir una lista de Tabla 11. Generalmente. por ejemplo. cosecha de frutas. hierba.

fibras] (si se conoce. 1993) con la opción de utilizar diferentes definiciones para cada una de las distintas regiones en donde se esté llevando a cabo el estudio.2). caña. cereales. puesto que ello dependerá del contexto de estudio. 2000). aunque está más relacionada con las características del cultivo que con las características del campo. La definición de clases de tamaño de campo “pequeña”. véase la lista LCCS (Di Gregorio y Janssen. no obstante. con las características de campo.plátanos y otras plantas herbáceas arbóreas. IV. III-cultivos de cobertura. La cobertura del cultivo se anexa aquí. Aquí se incluye la “cobertura de los cultivos”. pero manteniendo la distinción conceptual entre pequeño. especificar el tipo de cultivo) Atributo técnico 2 Tipo de cultivo (especies o variedades) Tipo de cultivo Tipo de cultivo nombres permitidos para los tipos de cultivo. La cobertura del cultivo se usa generalmente como un parámetro para la interpretación de 306 Manual de biología de suelos tropicales . aunque esto se relaciona más con las características del cultivo que.lúpulo y otras enredaderas perennes] Herbáceas Categoría de cultivos [raíces y tubérculos. mediano y grande.herbáceas.Tabla 11. sirve como indicador del grado de organización y mecanización de las prácticas de manejo. La forma del campo se añade principalmente como una preocupación respecto a posibles efectos de borde y. con el propósito de evitar cualquier confusión. “mediana” o “grande” no aparece. además. II. a manera de ejemplo. El siguiente nivel en la clasificación jerárquica se determina por las características espaciales de la parcela en observación (Tabla 11. ésta queda fuera del marco de este capítulo. pastos] Si no son gramíneas Categoría del cultivo [I. forrajes. es mejor definir clases significativas basadas en un estudio piloto del rango de tamaño de campo presentes en el área de estudio (Huising.1 Continúa Nivel 1a – Clasificador Atributo técnico 1 Gramíneas Tipo [bambú. legumbres y vegetales. arroz.

mediana (60 – 30%). mediana. Una cubierta “abierta” significa que la distancia entre los perímetros de las copas puede ser hasta dos veces mayor que el diámetro medio del dosel. su densidad puede medirse directamente en términos del número de plantas por unidad de medida (m² o ha) o en términos de espacio entre plantas (el espacio entre surcos y la distancia entre las plantas). En el caso de cultivos anuales. circular. rectangula [chica. Nivel 1b -Clasificador Atributo técnico 1 Tamaño de campo o parce. se refiere a que se produce un empalme entre las copas. Esto puede servir para entender la importancia relativa del cultivo en sistemas de cultivos múltiples.Forma [cuadrada. escasa (20-10%)] Observaciones relacionadas a combinación de cultivos y prácticas culturales Las combinaciones de cultivos se consideran el segundo nivel. Para coberturas no permanentes. proporciona información acerca de la densidad del cultivo y es un indicador útil de la intensidad del uso de suelo. la distribución espacial en el campo puede especificarse.imágenes de percepción remota. Tabla 11. a las diferencias en las etapas de crecimiento y otros factores. la cobertura del cultivo puede resultar difícil de interpretar debido a la variación en la arquitectura de las plantas. en los casos donde un clasificador de segundo nivel “combinación de cultivos” indica que existe un segundo o tercer cultivo creciendo en el campo. pero dependería mucho del tipo de cultivo. multiangular. Se pueden hacer distinciones de acuerdo con el número de cultivos y con su secuencia. abierta (70-60 – 20-10%). y especialmente en el caso de los cultivos anuales. Las clases de densidad podrían especificarse. los límites de clases son ligeramente diferentes (ver Di Gregorio y Janssen. Por lo tanto. En el caso de formas de vida permanentes. En el caso de un segundo o tercer cultivos. baja (30 -15%)] Cobertura permanente: [cerrada (> 70-60%). el tipo de cobertura “cerrada”. grande] lar. 2000). en tira o irregular] Tamaño del campo (metros cuadrados) Atributo técnico 2 Cobertura del cultivo Cobertura no permanente: [alta (> 60%). generalmente. Además.2 Tamaño del campo y características de la cobertura del cultivo. El segundo y tercer cultivo pueden describirse por los mismos D escripción y clasificación de uso de suelo en puntos de muestreo 307 . esto se refiere a que en una misma parcela y durante una sola temporada se realizan uno o varios cultivos.

traslapar. como por ejemplo. La descripción para las características del suministro de agua es muy sencilla (ver Tabla 11. La vegetación del sotobosque también puede referirse a vegetación (semi) natural. Tabla 11. El segundo tipo de cultivo se añade como un segundo atributo técnico. los cultivos de árboles (hule) en un campo grande (plantación). Se realizan previsiones al tercer nivel de clasificación. El nivel tres en el sistema de clasificación se refiere a las prácticas culturales. igual que para el cultivo principal. en los varios niveles de especificación. El segundo (o tercer) cultivo o elemento de la vegetación puede incorporarse en la descripción de clase del sistema de uso de suelo como elemento descriptivo o como atributo. múltiple (intercalado)] Atributo técnico 1 Cultivos múltiples No. en donde la especificación de la forma de vida. secuencial] Atributo técnico 2 (Segundo tipo de cultivo) Simultáneo o traslapado Arreglo espacial [una o dos filas intercaladas. plantaciones. Un segundo tipo de cultivo puede referirse a un cultivo de sotobosque como el cardamomo.3 Atributos de cultivos combiandos. definidas como características de suministro de agua y características relacionadas con el barbecho.atributos. serían suficientes. con un sotobosque herbáceo cerrado. fragmentadas o dispersas] Tabla 11. Es necesario registrar cuando se practica una rotación de cultivo en particular. por ejemplo. la totalidad de su cobertura (es decir. el porcentaje de cobertura del cultivo adicional o añadido) puede alcanzar fácilmente el 100%. de cultivos adicionales [1. relacionadas con el “factor de tiempo del cultivo” para especificar esta información. en cuyo caso. Nivel 2 – Clasificador Combinación de cultivos [simple (monocultivo). también en estos casos. franjas alternas.4).4 Características del suministro de agua Nivel 3a – Clasificador Suministro de agua [lluvia. junto con la fenología y tipo de hoja. postinundaciones. irrigación] Atributo técnico 1 Irrigación Tipo de irrigación [superficial. 2 o más] Secuencia [simultáneo. no habría un arreglo especial. aspersión o goteo] Atributo técnico 2 Demanda de agua por irrigación [mm de agua suministrada por temporada de crecimiento o cultivo] 308 Manual de biología de suelos tropicales .

El cultivo migratorio se define como suelo cultivado durante menos del 33% del tiempo (Ruthemberg et al. aunque no lo mismo. Leguminosas. de la siguiente forma: “después de que un campo ha sido inundado con agua de lluvia. u otro tipo) Índice de cultivo (valor del índice de cultivo Ruthenberg) Intermitente No. largo] Permanente Permanente [continuo o intermitente] Atributo técnico 2 Índice de cultivo (valor del índice de cultivo Ruthenberg) Si es mejorado: Tipo de cobertura (ej. Los sistemas de barbecho se definen como suelo cultivado entre el 33% y el 66% del tiempo y en los cultivos permanentes. de cultivos en dos años D escripción y clasificación de uso de suelo en puntos de muestreo 309 . la lluvia infiltrada en el suelo se usa intencionalmente como reserva para los cultivos”. mejorado] Duración del barbecho[corto. Los cultivos migratorios típicamente se refieren a situaciones donde los agricultores abren nuevas parcelas para el cultivo.5. en principio. permanente] Atributo técnico 1 Cultivo migratorio Período de barbecho [corto. natural. El barbecho se refiere al periodo (estación de crecimiento) durante el cual se deja descansar el suelo. barbecho. y debido a que no trae consecuencias en la intensidad del uso de suelo. Se hace una distinción entre cultivos migratorios.5 Factor tiempo de cultivo. Esto es similar. mientras que en el sistema de barbecho Tabla 11. El factor de tiempo del cultivo indica la fracción de tiempo durante la cual el suelo es usado para el cultivo. Los atributos técnicos se especifican en la Tabla 11.El cultivo post inundación se define.. 1980). el suelo está cultivado por más de 66% del tiempo.Clasificador Factor tiempo de cultivo [cultivo migratorio. mediano. mediano. de acuerdo con el LCCS. esta distinción no se mantiene. sin embargo. Nivel 3b . se debe hacer la distinción entre si esto se hace con el objetivo de restaurar la fertilidad del suelo o debido a que las condiciones no permiten cultivar (bajas temperaturas o disponibilidad de agua limitada). en términos prácticos. barbechos y cultivos permanentes. o largo plazo] Barbecho Tipo de barbecho[suelo desnudo. al empleo de técnicas de cosecha de agua (tratado por separado en la sección relacionada con el manejo de suelos y cultivos).

dejándola descansar durante diferentes periodos de tiempo para restaurar la fertilidad del suelo. El barbecho medio refleja la situación donde el suelo descansa durante seis a siete meses. pero < 8–9 meses. con un periodo de > 8–10 años. Barbecho medio. La definición de estos límites de clases se basa en la experiencia en el campo. pero < 8–10 años. pero eso no resulta lo suficientemente largo para clasificarlo como cultivo migratorio. Los barbechos se consideran como “mejorados” en el momento en que se planta o se siembra para cambiar la composición de la vegetación de barbecho o para mejorar su calidad. Estas son evaluaciones parcialmente cualitativas y. forrajes. Periodo medio: 4–5 meses. se hace una distinción entre la duración del periodo de barbecho: Barbecho corto. éstos se pue310 Manual de biología de suelos tropicales . resulta relevante anotar la duración de dicho periodo. Barbecho largo. Para sistemas de barbecho.cultivan la misma parcela o área de suelo. con un periodo de > 1–2 años. lo cual es muy común en algunos lugares donde uno o dos cultivos “cortos” ocurren durante un año o donde el agricultor deja un periodo de barbecho más largo. por ejemplo. Periodo largo: > 8–9 meses El barbecho de periodo corto se refiere a situaciones donde normalmente existen dos temporadas de cultivo en un año y el suelo se deja descansar durante el resto del periodo. durante el segundo año. se sobreponen los límites de clases y se especifican para cubrir la variación específica de un periodo de barbecho para cualquier área que probablemente sea dependiente de las condiciones socioeconómicas y biofísicas habituales. pero necesita confirmarse y puede ajustarse con base en los datos reales sobre la duración de los periodos de barbecho en el área en cuestión. Si se requiere de datos más precisos. por ello. No se hace ninguna distinción referida al tipo de cultivo o propósito. con un periodo de < 1–2 años. la clasificación del periodo de barbecho es la siguiente: Periodo corto: < 4–5 meses. por lo tanto. En el caso de cultivos migratorios. Bajo la presión de una población en aumento. el periodo de barbecho típicamente tiende a reducirse. El periodo largo de barbecho es la situación típica en donde el suelo se deja en barbecho durante un año o más.

plagas y enfermedades. por lo tanto. 1980): CIr = Tc/(Tc + Tf) En donde: Tc = duración del cultivo (tiempo). el manejo del suelo y de los cultivos se consideran representativos de un nivel separado en el sistema de clasificación (Tabla 11. donde potencialmente existe un alto impacto en la biodiversidad del suelo. Los datos deberán especificar el número de años del ciclo de rotación de cultivos y la secuencia de los cultivos en el ciclo. Alternativamente. Características de manejo del suelo y de cultivos Las prácticas culturales mencionadas incluyen: “manejo de agua” como una operación de manejo. una opción para combinar ambos clasificadores dentro de uno que describa el grado de mecanización. como un clasificador podría ser excluida de la clasificación porque la preparación del suelo es generalmente la D escripción y clasificación de uso de suelo en puntos de muestreo 311 . tal y como se observa en la Tabla 11. el manejo de las malas hierbas. sin embargo. el “factor tiempo de cultivo”. Se añade la “preparación del suelo” por su relevancia en los márgenes de la selva en los trópicos. el mejor momento para incluir una descripción de las secuencias de los cultivos sería en el segundo nivel de la clasificación jerárquica donde “la combinación de cultivos” puede describirse como “secuencial”. por lo que no han sido incluidas en el sistema de clasificación. tal y como se muestra en la siguiente fórmula (Ruthenberg et al.den calcular utilizando el índice de cultivos de Ruthenberg. De manera alternativa.5. se podría prever. fertilización y cosecha. Tf = duración del barbecho o duración del tiempo en el que no se cultiva el suelo..6a). En cuanto a la preparación del suelo y la cosecha. es un factor que deberá tomarse en cuenta en relación con la biodiversidad del suelo. el principal aspecto que se debe considerar sería si esto se realiza por medios mecánicos o no. Hasta este momento no se han considerado las rotaciones de cultivo. Si se practica una rotación de cultivos. Los mayores componentes de las prácticas de manejo discutidas se refieren a técnicas para la preparación del suelo o su cultivo. puesto que el barbecho a menudo forma parte de un sistema de rotación de un cultivo en particular. Esto es. la cosecha.

en el sentido de que una mayor o menor eficiencia no causará mayor o menor impacto en el suelo y los organismos que se encuentran en él. plagas y enfermedades es el uso de agroquímicos. se basa en el tipo de tracción utilizada: animal o mecánica. la profundidad del arado. en lugar de labrar el campo entero o donde el grado de perturbación se minimiza con el uso de equipos especializados. La principal preocupación relacionada con el control de las malezas. Opcionalmente. La “eficiencia” en términos de horas por hectárea requerida para la operación se añade como un atributo opcional. las opciones son: arado de vertedera. La labranza mínima se refiere a aquellos sistemas donde el arado y la siembra son típicamente una combinación de una sola operación.primera operación para ser mecanizada y tiene un profundo efecto en la biodiversidad del suelo. aquí se incluye su compatibilidad con los métodos que incorporan el uso de combustibles fósiles en los cálculos de la intensidad del uso de suelo. porque esto dependerá de las condiciones locales. La eficiencia se refiere más a lo económico que a lo ambiental. comparado con animales “ligeros” o maquinaria de igual consideración. El uso de combustibles puede fácilmente estimarse si se conoce su eficiencia. tipo de equipo y tipo de tracción. arado de disco. pero al contrario. o arado de cincel. Se añade un atributo técnico que describe el tipo de arado usado. De acuerdo con el orden mencionado. tales como tipo de suelo. refiriendo su capacidad. estos arados se presentan desde el menos eficiente en remover el suelo y dejará más estructura intacta en el suelo. tomando en cuenta el impacto directo del peso del animal o la maquinaria y el impacto generado por los diferentes tipos de equipo operados por maquinaria o animales de diferentes capacidades. 2000). tales como la unidad de sembrado directo (ripper-planter) utilizada en la agricultura de conservación (de Freitas. sin embargo. el suelo (y otras condiciones ambientales) afectarán la eficiencia de la operación. se podría considerar combinar ambos (mecánica y química) dentro de un clasificador que describa el uso de agroquímicos (excluyendo fertilizantes orgánicos). en caso afirmativo. Se presume que animales “pesados” o maquinaria pesada causan un mayor impacto en el suelo. por ejemplo. sería más sencillo 312 Manual de biología de suelos tropicales . Por lo tanto. ya que no resultará un indicador directo del grado de perturbación del suelo. Una distinción más detallada de acuerdo con los requerimientos reales de poder o capacidad en términos de caballos de fuerza no se considera relevante. El tipo de animal o el tipo de maquinaria empleada es indicado en el siguiente nivel de detalle. Se hace una distinción basada en si el suelo ha sido labrado o no. donde la labranza del suelo se restringe a hacer agujeros para sembrar. Se debe mencionar aquí si se practica la labranza mínima. el uso de combustibles debería añadirse como atributo en el siguiente nivel más alto de especificación.

manual (azadón).. mecánico. labranza mínima/unidad de das (pesada)] sembrado directo (ripperplanter)] Eficiencia (horas/ha) Deshierbe [Sin deshierbe. Nivel 4 – Clasificador Limpieza [Sin limpiar. cuatro rue. químico] Tipo de deshierbe [con azadón. Respecto al deshierbe manual se hace una distinción Tabla 11. con la mano] D escripción y clasificación de uso de suelo en puntos de muestreo 313 . etc. En el caso de medidas de control culturales (y biológicas). la rotación de cultivos. mecánico. por ello. reducida o mínima] Eficiencia (horas/ha) Tipo de arado [vertedera. biológico o cultural. por ejemplo. estas han sido registradas de las prácticas de uso de suelo en los niveles previos del sistema de clasificación y. tracción animal. el barbecho. química] Atributo técnico 1 Manual Modo [desmontar y quemar. “No quitar malezas” puede atender a situaciones donde no existe la extracción real de las malezas.disco. a Deshierbe a mano Eficiencia (horas/ha) mano. cincel. cincel. mecánica.6a Clasificadores y atributos relacionados con la limpieza de la parcela. desmontar y cubrir con abono verde] Mecánica Grado [limpieza moderada. buey.disco. labranza y deshierbe. intermedia e intensa] Manual Atributo técnico 2 Labranza [Sin labranza. no se incluyen en el valor de dominio. caballo. directo (ripper-planter)] vaca. mula/burro] Eficiencia (horas/ha) Mecánico Tipo de arado Clase de maquinaria [dos ruedas (ligera). sea por el método de herbicidas.[vertedera.y práctico manejarlas por separado. labranza mínima/unidad de sembrado les usados [búfalo. Tracción animal Tipo (y número) de anima. El clasificador para el control de malezas especifica el modo de mecanismos de control. manual. mecánica] Alcance de la labranza [labranza completa.

Las especificaciones son asignadas de manera arbitraria. el herbicida más usado en los trópicos (www. mientras que una aplicación (ea) de más de 2500 gha-1. ingrediente activo y tasa de aplicación entre si esto se lleva a la práctica con el uso del azadón o mediante la extracción totalmente manual. dado que el Roundup es. por lo 314 Manual de biología de suelos tropicales . que es la sustancia activa del Roundup. Una tasa de aplicación de (ea) menos de 850 gha-1 se considera un volumen bajo (VB) de aplicación.iastate. se debería especificar el ingrediente activo (ia). Una diferencia más.edu/mgmt/2004) por la cantidad de aplicaciones especificada en gramos equivalentes de ácido (ea) por hectárea de glifosato. los diferentes tipos de ingredientes activos y las fórmulas que existen (Oregon State University. VA (> 2500 g ia/ha)] Herbicida. cultivo para el control de malezas] Atributo técnico 2 Eficiencia (horas/ha) Tipo de equipo (ej. por mucho.6a Continúa. VI mochila. Si se considera de vital importancia.edu/pnw/weeds). azadón rotatorio) Eficiencia (horas/ha) Químico Volumen de aplicación Tipo de equipo [aspersor de [VB (< 850 g ia/ha). la distinción se hace acorde con su aplicación: el uso de aspersor de mochila es el más común. se recomienda implementar un sistema de clasificación para la aplicación de volumen de herbicidas que sea relevante para el área en cuestión. En cuanto al uso de químicos en el control de malezas. junto con la cantidad en gramos del ingrediente activo por hectárea.Tabla 11. basadas en recomendaciones generales para su aplicación en diferentes cultivos. se considera un volumen alto (VA). si se requiere información más detallada acerca del Roundup. azadón de presión. 2005). Nivel 4 – Clasificador Atributo técnico 1 Mecánico Tipo de deshierbe [labranza frecuente. weeds.ippc. Las especificaciones de manejo de malezas no cubren todas las medidas de control de malezas. otros mecanismos] (entre 850 y 2500 g ia/ ha). orst. o cualquier otro tipo de herbicida. se basa en el volumen de la aplicación que resulta no viable. Sin embargo. los cuales se convierten de libras por acre a gramos por hectárea (weeds. si se considera el gran número de herbicidas que se encuentran disponibles en el mercado.

se definen clases similares: control natural o medidas culturales. en lugar de usar un valor en particular. control biológico o mecanismos de control químico (Tabla 11. 1985). Respecto al uso de pesticidas. Los volúmenes especificados se refieren a la forma líquida en la cual el pesticida o el fungicida se obtienen. Tasas de aplicación bajas de menos de una tonelada por hectárea por año se consideran insuficientes para mantener los niveles de humus y de materia orgánica en el suelo.6b).que la libreta de campo es un buen complemento para la observación relacionada con cualquier medida específica de control de malezas. se hace una distinción basada en si éstos son ampliamente aplicados en todo el campo o si la aplicación se restringe a puntos específicos y también al tipo de equipo utilizado. Los elementos nutritivos pueden referirse a un solo elemento (por ejemplo N) en los fertilizantes simples o la combinación de elementos en mezclas incompletas o mezclas completas (el porcentaje de peso se relaciona al N para el nitrógeno. Los fertilizantes de bajo grado tienen menos del 25% de nutrientes para las plantas. mientras que los fertilizantes de alto grado contienen hasta el 50% de elementos nutritivos. En cuanto a los fertilizantes orgánicos e inorgánicos. Para abonos. estas cantidades se suministran una vez cada cuatro a seis años (ILACO. Con relación a las medidas de control de plagas y enfermedades. sin tomar en cuenta su modo de empleo. Con respecto a la aplicación de fertilizantes inorgánicos. dentro del rango especificado. se deberán tomar en cuenta los valores más altos. Generalmente. las cifras se convierten en tasas de aplicación por año. Se presume que el modo de aplicación no traerá muchas consecuencias para la tasa de aplicación. y las mismas clases de volumen se consideran relevantes. fungicidas u otros químicos. los rangos de tasas de aplicación se especifican para los límites superiores e inferiores de las clases. Eso se hace para poder acomodar los diferentes grados de fertilizantes. se prevén especificaciones para la tasa de aplicación. (2002) y son usadas en caso de aspersión aérea. En este punto. Dos toneladas por hectárea por año se consideran suficientes para todo tipo de cultivo. La frecuencia de la aplicación puede variar y en la tabla que se observa a continuación. se podrían especificar cantidades reales de aplicación. en caso de considerarse relevante. P2O5 para el fósforo y K2O para el potasio) El índice toma D escripción y clasificación de uso de suelo en puntos de muestreo 315 . Cuando se utilicen fertilizantes de bajo grado. sin considerar las disoluciones hechas antes de la aplicación. Las clases de volúmenes para aplicar pesticidas se obtienen de Craig et al. se presume que se requieren entre 5 y 10 toneladas por hectárea para poder mantener los niveles de humus en el suelo. estos se basan en asumir un contenido de materia orgánica del 30%.

se podría considerar añadir una clase para las tasas muy altas que serían aplicaciones de 300 kg ha-1 o más. por lo tanto. ya sea en o alrededor del hoyo de plantación. Una aplicación de 75 kg ha-1 de N requerirá 150 kg ha-1 de un fertilizante con N de alto grado y alrededor de 350 kg ha-1 de un fertilizante de bajo grado. Esto sería particularmente relevante donde se practican cultivos migratorios o donde las selvas han sido convertidas recientemente en suelo agrícola. La limpieza también es importante en sistemas de barbecho. especialmente. cuando incluyen quemas. La aplicación del fertilizante. se incluye como clasificador separado. por lo tanto. La manera en que se prepara la parcela puede tener un profundo impacto en la biodiversidad del suelo. estos valores se toman como el límite superior de la clase de “tasa de aplicación de fertilizante medio”. 6a) se enlista cuando el campo ha sido convertido a partir de bosque o vegetación secundaria desde hace más de 20 años. lo que ha ocurrido en algunos márgenes de selvas en donde opera el proyecto CSMBGBD. Actualmente. Esto sería la aplicación recomendada para un suelo moderadamente fértil que produce alrededor de cuatro toneladas de maíz (grano). “Sin limpieza” (ver Tabla 11. Las otras clases se derivan de estas cifras. “La limpieza moderada” está indicada cuando se utilizan medios manuales y mecánicos. en donde una tasa muy baja de aplicación representa alrededor de 10 a 15% de esta cantidad de referencia. o si las tasas de aplicación altas son de particular interés. cualquier incidencia de fue316 Manual de biología de suelos tropicales .75 kg ha-1 de N como punto de referencia para la aplicación de N. En todos los sistemas es importante registrar si la quema se lleva a cabo para eliminar la vegetación muerta o si esta vegetación se queda como abono orgánico. Sin embargo. La conversión puede incluir operaciones para nivelar el suelo. para alrededor de tres toneladas de trigo en suelos relativamente fértiles y 25 toneladas de mandioca en suelos moderadamente fértiles. La “limpieza intensa” significa que la tierra se limpia completamente con el uso de tractores oruga y otra maquinaria pesada. será relevante en el caso de tasas bajas o muy bajas de aplicación. en donde los árboles se cortan a mano o con sierra de cadena y los troncos se remueven utilizando tractores u otra maquinaria más ligera. lo cual coincide más o menos con la duración máxima de barbecho bajo sistemas de cultivos migratorios. de un fertilizante de alto grado y de 700 kg ha-1 o más de un fertilizante de bajo grado. se hace una distinción entre sistemas de “desmontar y quema” y “desmontar y cubrir con abonos verdes”. Otra distinción se hace basada en el tipo de equipo usado. Si las tasas de aplicación son generalmente altas.

composta. alta (>150–350 kg/ha) Aplicación [hoyos. franjas. aviones] Fertilizantes orgánicos Tipo de fertilizantes [residuos de cultivos. abonos. estiércol de corral] Aplicación [hoyos. o de manera homogénea en la parcela] Cosecha [manual. alta (>2 t/ha/año)] Fertilizantes [sin fertilizante. mezclas completas] Tasa de aplicación [muy baja (<20 – 60 kg/ha). media (entre 75– 175 y 150–350 kg/ha). media (entre 1–2 t/ha/año). mecánica] Eficiencia (Horas/ha) D escripción y clasificación de uso de suelo en puntos de muestreo 317 . (VA >200L/ha)] Tipo de químico y tasa de aplicación Tasa de aplicación [baja (<1t/ha/año). o de manera homogénea en la parcela] Inorgánico Clases de fertilizantes [simple. Tabla 11. combinación de fertilizantes químicos y orgánicos] Equipo usado [aspersor de mochila. franjas. aspersor de motor. baja (entre 25–60 y 75–175 kg/ha). Nivel 4 – Clasificador Manejo de plagas y enfermedades [medidas preventivas y control natural. mezclas incompletas. VI (entre 100 y 200L/ha).go como parte de las prácticas de manejo deberá registrarse en esta sección como fenómeno importante. fertilizantes y cosecha. control químico y biológico] Atributo técnico 1 Control químico Aspersión [aspersión focalizada.6b Clasificadores y atributos para el manejo de plagas y enfermedades. vehículos. fertilizantes químicos. aspersión en toda la parcela] Atributo técnico 2 Volumen de aplicación [UVB (<10L/ha). VB (entre 10-100L/ha). abono verde.

bancos.Otras observaciones sobre el manejo de suelo y cultivos Aparte de registrar las características del manejo de suelo y de cultivos como se describió en las tablas anteriores. la mejor manera de categorizarlas es determinar si incluyen medidas agronómicas (como cultivos mixtos. el uso de elementos de vegetación (referido a tiras de pastizales. número de macollos por planta de cereal. De manera general. etc. que se practica en el Níger).net). Probablemente. incluyendo las relacionadas con técnicas de recolección de agua. si se conoce la técnica con un nombre en particular (por ejemplo “Zai”. sean incluidas. muros de contención. 2001). esta información deberá adjuntarse. lo que aumenta la capacidad de retención y reduce la pérdida de suelo. construcciones y empalizadas. al igual que las del estatus del cultivo. las características del crecimiento del cultivo pueden utilizarse como una medida representativa del rendimiento. cuando se compara con un cultivo de 318 Manual de biología de suelos tropicales . acolchonado. La información de las medidas de conservación no se captura directamente en el registro de los atributos enlistados arriba. corta vientos y otros) o medidas estructurales que incluyen terrazas. El registro debe contener la descripción de las medidas de conservación del suelo y el agua. Las medidas de conservación de suelo y agua afectarán las poblaciones de organismos del suelo indirectamente por el almacenamiento de agua mejorada. en donde se observa que la altura del cultivo es menor. La World Overview of Conservation Approaches and Technologies (WOCAT). altura y diámetro relativos del cultivo en crecimiento (ver Stocking y Murnaghan. se incluyen como medidas estructurales. La información sobre el rendimiento de la cosecha es igual de útil. Las técnicas de recolección de agua como cavar zanjas. entre otras. Las evaluaciones del rendimiento basadas en campo deberán incluir lo siguiente: población de plantas por metro cuadrado. provee una visión general en su página web de muchas técnicas existentes (www. el crecimiento puede clasificarse como: crecimiento retardado. especialmente. hondonadas y otras.). El rendimiento del cultivo como indicador integra muchos factores. pero no como base de clasificación. por lo que es difícil obtener cifras confiables y del todo correctas. cuando se relacionan con su manejo. De manera alternativa. barreras de setos. Estos datos proporcionan información adicional sobre el cultivo principal tal y como se especifica en el primer nivel del sistema de clasificación. wocat. se recomienda que las observaciones de las prácticas de conservación de suelo y agua. Las observaciones del estatus de los cultivos podrían ser útiles para corroborar los resultados anteriores (o resultados de clasificación). cultivos en curvas de nivel.

La fragmentación del uso de suelo que puede ser evaluada a partir de estas observaciones resulta ser. Si se conoce la plaga o enfermedad específica. y la severidad de la infección en términos del grado en el cual la planta es afectada. deberá enlistarse su nombre. Queda fuera del marco de este capítulo proporcionar información más detallada sobre plagas. y cultivo de crecimiento vigoroso. permite una evaluación del uso del suelo en un punto de muestreo particular. Este es el caso cuando la cobertura de árboles es escasa (menos de 10 a 20%). todos a nivel parcela o paisaje.crecimiento vigoroso. están disD escripción y clasificación de uso de suelo en puntos de muestreo 319 . un importante aspecto de la intensidad del uso del suelo. el factor Ruthenberg se establece. permite la validación y la verificación de las observaciones en el lugar del muestreo. plantas de menor vigor. lo cual puede ocurrir cuando los árboles están dispersos dentro de la parcela. El uso de suelo en el área circundante del punto de muestreo tendrá una notable influencia sobre la biodiversidad del suelo de la parcela en observación. dentro de una proporción espacial entre barbecho y el suelo cultivado en el uso de suelo actual. Las observaciones del estatus del cultivo deberán acompañarse de observaciones acerca de la incidencia de plagas y enfermedades e incluir el porcentaje del cultivo afectado. frijol y col. Existen guías disponibles para registrar deficiencias específicas de nutrientes en cultivos (ver Stocking y Murnaghan. y finalmente. enfermedades y sus clasificaciones. cercas vivas y otros elementos de vegetación importantes. por sí misma. se esperaría encontrar barbecho como parte del patrón de uso de suelo. lo que resulta importante para un mapeo del uso de suelo. en el caso de cultivos migratorios o sistemas de barbecho. la primera distinción se hace en función de si éstos son continuos. Además. con un diámetro del cultivo menor y una decoloración generalizada en sus hojas. Esto permite la inclusión de elementos de vegetación leñosa en la descripción que no están capturados en el sistema de descripción de uso de suelo. por ejemplo. dentro del contexto del uso de suelo en las áreas de los alrededores (esto ayuda a establecer si el uso de suelo en la parcela en observación es representativo o no). Respecto a la distribución de los campos (evaluación del patrón de distribución). 2001) por signos de déficit de nutrientes en maíz. en principio. Patrones de distribución en el campo y árboles en la finca Las observaciones relacionadas con el tipo de campo y con los elementos de vegetación leñosa dentro de la parcela bajo observación y sus alrededores están incluidas.

) 320 Manual de biología de suelos tropicales . áreas vacías o cuerpos de agua artificiales y cuerpos de agua naturales (hielo y nieve). son las características del suministro de agua y la permanencia del cultivo. áreas terrestres seminaturales. utilizando las clases mayores de cobertura de suelo del LCCS.tribuidos en forma de racimos o dispersos (ver Tabla 11. en donde se especifican los cultivos principales. La segunda distinción se refiere al tamaño. mediana. dispersa] Atributo técnico 1 Continuo Distribución del tamaño de la parcela [uniforme. Clasificador espacial Distribución espacial de la parcela [continua. lo que parece relevante especialmente en el caso de áreas cultivadas terrestres.7). superficies artificiales. Residencial. irregular] Patrón de la parcela [regular. vegetación acuática (semi) natural. irregular] No continuo Parte de las tierras cultivadas [% de cultivo y área de manejo] Parte de la cobertura vegetal [% de área (semi) natual] Parte del área acuática cultivada [% de área acuática cultivada] Parte acuática no cultivada [% de área acuática no cultivada] Área urbanizada [% de superficie artificial] Atributo técnico 2 Uniforme clases de tamaño (mayoría del campo) [pequeña. etc.7 Características de la parcela y distribución del uso de suelo. grande] Cultivo principal (lista de los cultivos de cuatro parcelas vecinas ) Cultivo principal (lista de cultivos de cuatro parcelas vecinas) Cobertura del suelo (cobertura dominante de áreas no cultivadas) Tipo de cultivo o actividad Tipo de área acuática Tipo de área urbanizada (ej. agrupada. queda una opción para especificar los porcentajes del área usando varias categorías: tierras cultivadas y áreas manejadas. industrial. forma y patrón de los campos y finalmente. Los distintos componentes de uso del suelo pueden describirse con mayor detalle. Tabla 11. áreas acuáticas cultivadas o de inundación regular. El patrón del campo se relaciona a la forma del lugar y al arreglo espacial del mismo.

es importante registrar la localización del punto de muestreo respecto al lindero del campo. DESCRIPCIÓN Y CLASIFICACIÓN DE USO DE SUELO Definición y descripción de clases de uso de suelo No es el propósito de este capítulo describir cómo las clases de uso de suelo se definen. Clasificador espacial Atributo técnico 1 Atributo técnico 2 Suelo desnudo [% de áreas desnudas] Cuerpos de agua [% de Tipo de cuerpos de agua [arcuerpos de agua] tificial. a partir de los claD escripción y clasificación de uso de suelo en puntos de muestreo 321 . En el caso de porcentajes bajos de cobertura de árboles y árboles dispersos dentro del campo o alineados en forma de cerca viva. si es posible)] El último elemento que debe ser registrado es la presencia de elementos permanentes de vegetación leñosa en el paisaje. Se entiende que los tramos de bosque y otra vegetación leñosa fueron ya cubiertos por el método de clasificación para uso de suelo. natural (especificar tipo.7 Continúa. como estanques. Más información trata de la cobertura o densidad del componente árbol. para leña o material de construcción). La información sobre los árboles pertenecientes a la familia leguminosa es útil en relación con la ocurrencia de las bacterias formadoras de nódulos. El primer atributo describe la distribución espacial de los árboles. La Tabla 11. pantanos. presas.8 especifica los atributos utilizados para describir los TROF. Es importante derivar las clases de manera sistemática. especificado en términos del número de árboles por hectárea o longitud de los elementos lineales de la vegetación leñosa. aunque estos elementos pueden ser característicos del uso y cobertura del suelo y tener mayor influencia sobre la presencia de la biota específica del suelo. nueces. Las “zonas verdes” se refieren a árboles espaciados en filas dispuestas como empalizadas. Los atributos técnicos permiten una descripción del tipo de árbol (ya sea por especie u otro nivel taxonómico) y el propósito de tener árboles (por ejemplo. Como se ha mencionado. para cosechar frutas. este podría no ser el caso. para madera. Se hace referencia a éstos como árboles en una finca (TROF).Tabla 11.

de manera que un conjunto de clases definido para un área en particular puede ser fácilmente mapeado en el conjunto de clases utilizados para otra área y viceversa. principalmente árboles de sombra. barreras contra el viento u otros elementos leñosos. el diseño de la clasificación jerárquica y el atributo de los valores de clase. cuando se toman en cuenta atributos técnicos adicionales. no necesariamente tienen que implicar una definición de un conjunto adicional de clases en el siguiente nivel de la clasificación jerárquica. distintos grados de cobertura de árboles pueden observarse dentro de la clase “plantación de árboles” (o aun dentro de las plantaciones de teca).Tabla 11. principalmente madera. utilizando reglas de decisión. No todos los atributos o clasificadores tendrán que tomarse en cuenta. “cultivo de temporada” y “cultivo permanente”. son explicados a continuación. es posible distinguir entre una plantación de teca y otra de hule. Por otra parte. una clase de uso de suelo podría ser definida en función de los siguientes valores de atributos: “cultivo de árboles”. pero esto pue322 Manual de biología de suelos tropicales . otros] Barreras contra el viento u otros arreglos lineales: especies de árboles Empalizadas: tipo o especie dominante Atributo técnico 2 Cobertura (% de linderos que constituyen cercas vivas) Densidad (número de árboles por ha) Longitud total por ha (m/ha) sificadores y atributos presentados aquí. Si únicamente se consideran los primeros tres niveles en la clasificación jerárquica. zonas verdes] Atributo técnico 1 Cercas vivas: especies de árboles Árboles dispersos dentro de la parcela Propósito [principalmente frutas y nueces. Los principios de la definición de usos de clase de suelo. “cultivo único”. tipo de cultivo). cercas vivas. árboles dispersos dentro de la parcela. por ejemplo. Las clases se definen por la combinación particular de clasificadores y atributos (determinados por el valor de los mismos). Esto se traduce en “plantación de árboles”.8 Características de los árboles en la finca (TROF). “parcela de tamaño grande”. relacionados con observaciones de campo. Si se contemplan atributos adicionales del cultivo principal (por ejemplo. lo que determina el nivel de detalle con que se definen las clases. Nivel 5 Clasificador Tipo de TROF [sin TROF.

Para información precisa habrá que referirse a las Tablas 11. O. no todos los atributos pueden ser fácilmente organizados en una tabla. Las clases se asignan de acuerdo con las reglas de decisión y al mismo tiempo las clases se definen. Las reglas de decisión generalmente toman la forma de un conjunto de condiciones SI – ENTONCES que aplica los atributos. esta característica es general en áreas grandes y no en parcelas. como han sido presentados arriba. en la jerarquía de clasificación para observaciones en parcela. “sin irrigación”. el factor “tiempo de cultivo” puede tener prioridad sobre el cultivo principal como la característica dominante. lo que D escripción y clasificación de uso de suelo en puntos de muestreo 323 . Debido a que el sistema que se presenta trata de áreas cultivadas y manejadas. Esto se refiere a los niveles de la clasificación jerárquica. Una clasificación jerárquica se establece de manera similar. Más bien. Y. sin embargo.de no ser relevante para definir clases separadas de plantaciones de árboles. Los clasificadores especifican un “cultivo de árboles”.8. un “campo grande”. plantación de árboles).1 a la 11. y por ello podría usarse para realizar ejercicios de mapeo a pequeña escala. ver Huising (1993). se retiene la información sobre el porcentaje de cobertura como un valor de atributo en particular para cada observación individual (instancia u ocurrencia) del objeto clase (es decir. tal y como se observa en la Tabla 11. combinados a través de operadores Booleanos (es decir. XO y NO). Debido a la estructura anidada.9 proporciona una lista generalizada de los clasificadores y atributos de clases de acuerdo con el nivel la clasificación jerárquica. Para ilustrar la definición y descripción de la clase.9 contiene una vista global de la estructura de la clasificación principal. hay que tomar en cuenta los valores especificados para los diferentes clasificadores y atributos técnicos. decidiendo la presencia de un clasificador sobre otro.10. en áreas donde los cultivos migratorios o permanentes se practican uno al lado del otro. Por ejemplo: SI (<forma de vida> igual a ‘árbol’ y <tamaño de parcela> igual a ‘grande’ y <combinación de cultivos> igual a ‘único’ y <factor tiempo de cultivo> igual a ‘permanente’) ENTONCES <clase> = ‘plantación de árboles’. Para una explicación de clasificación y jerarquías agregadas. La Tabla 11. No obstante. La Tabla 11. y “un cultivo permanente”. la jerarquía considera el cultivo principal como la puerta de entrada. en donde el factor “tiempo de cultivo” sería el parámetro en la jerarquía agregada y no. y no a los niveles de generalización (el segundo eje en el sistema de clasificación).

a un sistema agroforestal en donde los árboles de hule (Hervea brasiliensis) crecen dentro de la selva (Joshi et al. una plantación de más de 10 años de teca (que forma un dosel cerrado).11 muestra los datos para una parcela imaginaria de maíz. frecuentemente no son relevantes para cultivos de plantación. Esto. que la parcela es cultivada de manera permanente con un pequeño periodo de barbecho cada dos años. La principal categoría de uso de suelo a la que esta parcela en particular pertenecerá puede definirse como “cultivos permanentes a pequeña escala con maíz como cultivo principal”. por lo tanto. por ejemplo. enfermedades y la fertilización del suelo no tienen lugar. es importante informar sobre el uso del suelo circundante. La Tabla 11. En cuanto a los clasificadores del nivel 5. Algunos de los clasificadores de suelo y atributos de suelo y cultivos. permitirá una distinción entre hule de “jungla”.000 m² por tamaño de la parcela). se pueden distinguir plantaciones de frutales. Tomando en cuenta la información del cultivo principal (clasificadores del nivel 1) se describirá la parcela como grande (con 10. el manejo de plagas. Las diferencias entre la intensidad de uso de suelo. por ejemplo. podría basarse en la clase de atributo nivel 1 “densidad de árboles” o en el atributo nivel 2 “combinación de cultivo de árboles”. De manera alternativa. con 100 árboles por hectárea y que recibe 1.200 mm de lluvia por año. 2002) o en lugares donde se cultivan únicamente árboles de hule. o si forma parte de un paisaje dominado por plantaciones de cultivos de árboles. lo cual únicamente tendrá sentido si existe una gran variación de dichas características dentro del área y si éstas reflejan diferentes regímenes de manejo. se pueden distinguir plantaciones de árboles destinadas a la producción de madera para tablas o para otros fines y si se utiliza la información sobre el propósito. El manejo de estas plantaciones. Posteriormente. el segundo nivel indica que entre el maíz se encuentran otros cultivos y. de cacao y otras.significa una plantación grande de árboles.. con relación a la variedad de plantaciones. el tercer nivel. Se pueden tomar en cuenta medidas para el control de malezas mediante corte o también el uso de químicos. si la plantación de árboles bajo estudio es un pequeño bosque aislado dentro de un ambiente dominado por cultivos anuales. porque la preparación del campo. se podría definir una subclase añadiendo la descripción “intercalada con un cultivo de leguminosas” para distinguirla del maíz como único cultivo. se clasificará como “extensivo”. Si se utiliza la información sobre la especie de árbol. El primer nivel especifica que se trata de una pequeña parcela cuyo cultivo principal es el maíz. si la información es correcta y se considera importante en el contexto de la clasifica324 Manual de biología de suelos tropicales .

Nivel 2 cultivo combinado Cultivos simples o múltiples Suministro de agua Factor tiempo de cultivo Nivel 3 prácticas culturales Cobertura del cultivo Nivel 1 características del cultivo y el campo Clasificador Forma de vida del cultivo principal Tamaño del campo Segundo Densidad o espacio entre tipo de cultivo plantas Tercer tipo de cultivo Cantidad de agua suministrada Número de Clase de cobertura del cultivos cultivo Tiempo de secuencia Arreglo espacial Tipo de irrigación Duración del período de barbecho Índice Ruthenberg Clase de tamaño del campo D escripción Modo de preparación del campo Tipo de tracción Frecuencia Tipo de operación Alcance de la operación Frecuencia Modo de deshierbe Manejo de plagas y enfermedades Prácticas de fertilización Tipo de fertilizante Volumen aplicado Atributos Nivel de especie 1 Tipo de cultivo (categoría) Forma del campo Tipo de barbecho Tipo especifico de barbecho Atributos Nivel de especie 2 Cultivo especifico (categoría o especies) Atributos Nivel de especie 3 Cultivo variedad (especie o variedad.Tabla 11.9 Niveles del 1 al 5 de clasificadores y atributos para la clasificación del uso de suelo.) Nivel 4 manejo Modo de cosecha y clasificación de uso de suelo en puntos de muestreo Clasificador Medios de limpieza Atributos Nivel de especie 1 Grado de limpieza Modo de limpieza 325 .

9 Continúa. 3 Atributos Nivel de especie 4 Nivel 5 Configuración espacial del campo y árboles en la finca Clasificador Configuración espacial de los árboles en la finca Atributos nivel 1 Propósito de los árboles en la finca Atributos nivel 2 Tipo de especies de árboles dominantes .Tabla 11. Nivel 2 cultivo combinado Tipo de equipo Ubicación. Modo de equipamiento Aplicación Nivel 3 prácticas culturales Tipo de arado Alcance de la operación Eficiencia Clasificación de la aplicación Tipo de fertilizante Tipo de químicos Tipo de herbicida Volumen Volumen aplicado Volumen aplicado aplicado Patrones de distribución del campo Cobertura de árboles (copa) Densidad de árboles o longitud de barreras Patrones de distribución del tamaño del campo Partes del área terrestre cultivadas y manejadas Partes terrestres no cultivadas Arreglo espacial del campo Forma de vida del cultivo principal Otros tipos de uso o cobertura Clasificación de la aplicación Clasificafión de la aplicación Tipo de equipo 326 Eficiencia Nivel 1 características del cultivo y el campo Atributos Nivel de especie 2 Manual de biología de suelos tropicales Atributos Nivel de especie.

Tamaño o clases de tamaño del campo Tipo de cultivo principal % cobertura Nivel 5 Configuración espacial del campo y árboles en la finca Atributos nivel 3 Especies de árboles D escripción y clasificación de uso de suelo en puntos de muestreo 327 .9 Continúa.Tabla 11.

Tabla 11. Nivel 2 Combinación de cultivos Único 328 Nivel 3 Prácticas culturales De temporada n/a n/a n/a n/a Permanente n/a Grande Regular Cerrado Vegetación natural* 10.10 Ejemplo de clasificadores y de posibles valores de atributos de una plantación de teca. de hoja ancha leñoso >10 años Manual de biología de suelos tropicales Atributo téc.200 mm** n/a n/a Nivel 1 Características del cultivo y el campo Clasificador Árboles Atributos técnicos Nivel 1 Perenes.Teca nico nivel 2 Atributo téc. aunque esto por lo general se describe en las características del sitio.000 m2 100 árboles/ ha n/a n/a 1. ** En el caso de sistemas de temporada de ser posible debe especificarse la cantidad de lluvia. se puede describir las plantas debajo de los árboles y estas plantas pertenecerán a la categoría de vegetación (semi) natural. si es relevante. aunque no se discuten en este capítulo.Tectona grandis nico nivel 3 * En este caso. . para lo cual se utilizan otros parametros.

infraestructura 329 n/a . habas.16 1 cultivo adicional Simultaneo 2 filas alternadas NA Intermitente De temporada Permanente Mejorado Nivel 1 Características del cultivo y el campo Nivel 3 Prácticas culturales Clasificador Gramíneas Pequeño Atributos nivel de especie 1 Cereales Cuadrada D escripción Mecánica y química Labranza frecuente (2x) y fumigación una vez (1x) Aspersor de mochila VB (Roundup) Continuo n/a n/a Pequeño Uniforme 90% Regular Hierbas y gramíneas Chícharos.000 m2 Mediano a grande 75 x 25 cm Frijoles NA 0.11 Ejemplo de clasificadores y valores de atributos para parcelas de maíz.Tabla 11. maíz 10% n/a n/a n/a n/a Ninguno Fertilizante químico Directamente hoyos Manual VMB (muy bajo) 50 kg CAN/ha n/a Atributos nivel de especie 2 Maíz Mucuna (abono verde) Atributos nivel de especie 3 Nivel de manejo 4 n/a Tracción animal n/a 2 bueyes n/a Arado de vertedera n/a Nivel 5 Configuración espacial del campo y árboles en la finca No TROF y clasificación de uso de suelo en puntos de muestreo n/a n/a Caminos . Nivel 2 Combinación de cultivos Múltiple 2.

Giller et al. con un bajo volumen de herbicidas. Manejo y nivel de insumos: la información en el manejo del cultivo y el suelo habla de que el nivel de perturbación del suelo se considera intermedio (habiendo sido arado dos veces con el uso de tracción animal) y que el insumo de químicos ha sido bajo. La norma general es que los sistemas culturales y manejados son más intensivos que los naturales (cuanto más insumos de manejo se requieran para mantener los sistemas. sin que esto quede reflejado en la definición de las clases. Esta sección pretende demostrar cómo un conjunto de clases podrá definirse y organizarse en una estructura jerárquica y que el sistema es bastante flexible en cuanto a la selección de clasificadores y atributos considerados para su clasificación. Los clasificadores de nivel 5 y los atributos describen que el suelo es cultivado de manera continua. en “un manejo caracterizado por el uso de tracción animal y bajo insumos agroquímicos”. manejo de plagas. La información específica se refiere a la densidad de la planta. que las parcelas son generalmente pequeñas. insumos de ener330 Manual de biología de suelos tropicales . pero una definición de un índice o medida de la intensidad de uso de suelo no es fácil. uso de nutrientes. al arreglo específico de la combinación del cultivo y a qué especie es utilizada para mejorar el barbecho. sin el uso de fungicidas o pesticidas y únicamente con muy baja cantidad de fertilizantes.ción. El grado de interferencia con (perturbación o alteración) el ecosistema natural sería una buena medida de la intensidad del uso de suelo. más intenso será su uso). Un esquema de clasificación estándar no funcionará porque la definición de un conjunto de clases depende del contexto y del propósito específico de la clasificación. el manejo tiene por objetivo modificar o establecer condiciones que propicien la producción de un cultivo. Esto podría traducirse. principalmente. con cultivos anuales. dependiendo de las reglas de clasificación.. Parece que existe un consenso sobre los factores que determinan la intensidad del uso de suelo. (1997) definieron un índice de intensidad de uso de suelo que considera la frecuencia de la ocupación de suelo (según lo expresado en el índice Ruthenberg). el criterio para mejorar el barbecho podría considerarse en la definición de las subclases. con escasa o sin presencia de árboles. Ordenamiento de las clases de uso de suelo respecto a la intensidad de su uso En sistemas agrícolas. que indica patrones de uso de suelo fragmentados y un uso intensivo del suelo.

indicando que el sistema con una proporción mayor de vegetación permanente (ya sea como elementos de vegetación natural o cultivada) representa una intensidad menor de uso o un grado menor de perturbación. aunque no directamente relacionado con la influencia de la operación del manejo. el componente de la cobertura de la vegetación (semi) permanente es un indicador útil. puesto que cada índice es una expresión particular de la intensidad del uso de suelo. También. El segundo gradiente D escripción y clasificación de uso de suelo en puntos de muestreo 331 . con la relevancia de que un índice en particular dependiente del contexto o propósito para el cual se está desarrollando. en el caso de cultivos migratorios. que en el entorno de márgenes de selva se traduce en elementos de vegetación leñosa. Existen dos principales ejes a lo largo de los cuales se mide la intensidad del uso: el primero. a la intensidad (o amplitud) de las operaciones. se traduce directamente en la frecuencia del cultivo. la proporción del tiempo durante el cual la vegetación del suelo se restablece de manera semipermanente. los esfuerzos para crear un índice universal o una medida de la intensidad de uso de suelo serán inútiles.gía y manejo de agua. En ambos casos. como factores relevantes. Han existido varios intentos por definir una medida de intensidad de uso de suelo. El primer gradiente representa la presencia (proporción en el espacio o tiempo) de vegetación seminatural. La presencia de vegetación permanente en el sistema de cultivo limitará las posibilidades para cultivar el suelo o la proporción del suelo que puede ser cultivado. Además. Para los propósitos de investigar tendencias en la pérdida de la diversidad del suelo en relación con un incremento en la intensidad de su uso. se refiere a la permanencia (o frecuencia) de operaciones y el segundo. Lo anterior permite un arreglo de los componentes de la vegetación (objetos) a lo largo de dos gradientes. Esto se hace considerando aquellos atributos (y clasificadores) que expresen un aspecto en particular de la intensidad de uso de suelo. la presencia de vegetación permanente disminuirá la influencia de la variación climática en el ecosistema del suelo. se requieren categorías de clases de uso de suelo en términos de la intensidad de uso de suelo (o alternativamente una definición de clases de uso de suelo que reflejen diferentes niveles de la intensidad de uso de suelo). reflejando el grado en el que estos factores tienen un efecto en los ecosistemas (el grado en el que se altera o perturba el ecosistema natural) y debido a que algunas veces los datos requeridos para una evaluación cuantitativa de la intensidad del uso de suelo no son accesibles. de la misma manera como lo ilustran Kuechler y Zoonneveld (1988). Es decir. puesto que es difícil asignar un peso adecuado a las variables explicativas. pero éstos no han sido del todo exitosos.

selva). a árboles plantados o cultivados (árboles cultivados) o elementos de vegetación no leñosos (por ejemplo. pero sobre todo.“sistemas de barbecho”-“cultivos permanentes” (véase Tabla 11. los objetos de uso de suelo son ordenados a lo largo del segundo gradiente de intensidad de uso de suelo. Los objetos se refieren a árboles que existen en la naturaleza (en el caso de vegetación natural). lo que resulta relevante en el caso de sistemas particulares de uso de suelo. cultivos anuales y pastizales) en el caso de elementos de vegetación cultivados. y presencia o ausencia del componente arbóreo. La localización a lo largo de los dos ejes.“cultivos migratorios”.representa la cobertura de vegetación leñosa. En segundo lugar. este eje también expresa una partición en el espacio entre los elementos de vegetación natural y cultivada. para el sistema de cultivo permanente. Cultivos anuales-campo Componente de le vegetación leñosa y semileñosa (natural) Componente de la vegetación leñosa cultivada Componente de la vegetación leñosa no cultivada Componente árbol Selva Tiempo de cultivo-permanencia Plantación 332 Manual de biología de suelos tropicales . como se ha especificado en el atributo técnico 1. dentro del sistema de cultivo. Se puede hacer una subdivisión adicional basándose en la duración del periodo de barbecho. Además de servir como una partición en el tiempo. dentro de cada una de las clases definidas. en el siguiente nivel de especificación. El continuo puede representarse gráficamente con un triángulo en donde los tres ángulos representan los valores extremos de la cobertura del suelo que solo pueden estar constituidos por árboles naturales (es decir. En primer lugar. la permanencia se expresa con el factor “tiempo de cultivo” y el sistema de clasificación permite un arreglo de clases de uso de suelo. de acuerdo con el componente Figura 11. se determina basándose en los clasificadores y atributos del sistema de clasificación.1 Disposición del uso del suelo y las clases de cobertura basadas en la presencia y ausencia de vegetación natural. sólo de árboles plantados (plantación) o sólo de cultivos anuales o pastizales.5). de acuerdo con el incremento en la intensidad: “sin cultivar”. como en el sistema de “hule de la selva” mencionado arriba.

Si la cobertura de los árboles es escasa.1). Por ejemplo. tracción animal o medios mecánicos). “plátano y otras plantas herbáceas similares”. como un nivel más de intensidad.5). dentro de las clases resultado de los dos pasos explicados arriba. También se podrían considerar operaciones de deshierbe con “deshierbe mecánico”. Tabla 11.árbol o arbusto en el sistema de cultivo (referido a las proporciones en el espacio o en el tiempo). Existen dos aspectos que deben ser considerados en relación al manejo: uno se relaciona con el grado de perturbación física debida a las operaciones de manejo y el otro se relaciona con el grado de interferencia química con el sistema (uso de agroquímicos). como se ve reflejado en la información sobre la categoría del cultivo (ver atributo técnico 1. Las clases se ordenan de acuerdo con este gradiente utilizando las características del cultivo principal (Tabla 11. En el tercer paso. Una vez más. tiene que considerarse la información relacionada con los árboles en la finca (Tabla 11. Los clasificadores y atributos del nivel 4 (especialmente relacionados con las operaciones de cultivo. deshierbe y de manejo de plagas y enfermedades) son utilizados para definir las clases de intensidad. se deberá considerar la intensidad de las operaciones. porcentaje de la cobertura del cultivo. el orden de intensidad de uso sería el siguiente: “cultivo herbáceo”. las cuatro clases de intensidad se definen de acuerdo con el grado de mecanización (es decir. las plantaciones de árboles se consideran menos intensivas que cuando se trata de arbustos pequeños como el del café o té. operación de cultivo) y con el grado de uso de agroquímicos (para el control de malezas y manejo de plagas y enfermedades) tal y como se indica en la Figura 11.2.1) junto con las características de la cobertura del cultivo (es decir. “cereales” y “arroz” (ver Tabla 11. Respecto al tipo de cultivo de gramíneas. el rango se lleva a cabo basado en las características de manejo (el cuarto nivel en el sistema de clasificación). sin cultivo. la clase “bambú” aparece antes que las clases de “pastos”.3).2) y combinaciones de cultivo (Tabla 11. D escripción y clasificación de uso de suelo en puntos de muestreo 333 . los cultivos de árboles se consideran menos intensivos cuando se comparan con cultivos de arbustos. de gramíneas y con formas de vida herbáceas. “lúpulo y otras enredaderas perenes herbáceas” y “cultivo de cobertura”. Si únicamente se toma en cuenta la forma de vida del cultivo principal. Una asignación de la intensidad de clases se basa en el valor del clasificador en las operaciones de cultivo (es decir.1). Tabla 11. A un nivel más general. En el caso de cultivos de árboles (sistema basado en árboles) se puede considerar el número de estratos de la vegetación y el porcentaje de cobertura del suelo para una categoría posterior. Una diferenciación adicional para cultivos que no son árboles se basa en la permanencia o duración del cultivo. Respecto a los cultivos sin gramíneas. manual.

pero una diferencia más.2. El arado de vertedera tiene un efecto más profundo en el suelo (remoción completa). una evaluación por pares de clases de uso de suelo individuales en la región de superposición dará la clasificación final en términos de la intensidad de uso de suelo.Figura 11. En cuanto al orden de categoría respecto del uso de agroquímicos. la clase de uso de suelo más intensiva pertenece a “cultivos migra334 Manual de biología de suelos tropicales .3. ALTO NIVEL DE INSUMOS QUIMICOS Grado de disturbio físico INTENSIDAD BAJA: BAJO GRADO DE MECANIZACIÓN. ver Tabla 11. ALTO NIVEL DE INSUMOS QUIMICOS Uso de agroquimicos INTENSIDAD ALTA: ALTO GRADO DE MECANIZACIÓN. estas clases tienen que relacionarse entre sí. tipo de equipo o maquinaria usada en el caso de plagas y enfermedades y el volumen de aplicación. La superposición será considerable entre las clases de sistemas de barbecho y sistemas de cultivos permanentes. el arado escarificado.6b). BAJO NIVEL DE INSUMOS QUIMICOS Otra diferencia podría establecerse en función del tipo de animales o maquinaria usada (de acuerdo con los caballos de fuerza) y el tipo de arado empleado. Esto se puede observar en la figura 11. Los cuatro cuadrantes de intensidad definidos por el nivel de mecanización y uso de agroquímicos. y no reconoce que puede haber una superposición considerable en términos de intensidad de uso de suelo entre las clases. El procedimiento jerárquico descrito arriba producirá ramificaciones claramente separadas en la clasificación del árbol. BAJO NIVEL DE INSUMOS QUIMICOS INTENSIDAD MEDIA: ALTO GRADO DE MECANIZACIÓN. Como se ilustra en la figura 11. el arado de cincel y. Para poder llegar a una clasificación final de clases de uso de suelo en términos de intensidad de uso. Al final. en el primer paso de la clasificación. considerando una plantación de árboles (cultivo permanente bajo manejo extensivo) representará un sistema menos intensivo que un cultivo manejado intensivamente bajo un sistema de barbecho corto. A nivel más general.3. podría basarse en el volumen de aplicación (aplicación selectiva o localizada. los clasificadores para el control de malezas y manejo de plagas y enfermedades. por último. seguido por el arado de disco. son considerados de manera conjunta. INTENSIDAD MEDIA: BAJO GRADO DE MECANIZACIÓN. que representa el nivel más bajo de perturbación. únicamente se considera el “uso” o el “no uso” de agroquímicos.

si el suelo está en barbecho el 60% del tiempo y la vegetación de ese suelo es pasto. en esta fase. Para establecer una comparación de clases de uso de suelo individual. sistema de barbecho (barbecho 4-5 meses) Pte: cultivo de árboles extensivo. cultivo permanente Pcmi: cultivo de intensidad media. cultivo permanente torios” y es seguida por el de menos intensidad de uso “cultivo permanente”. Donde: Fn: selva natural Fl: selva explorada Slce: cultivo extensivo. se aplican los mismos criterios que en el segundo y tercer pasos de la clasificación. cultivo migratorio (barbecho < 1–2 años) Flce: cultivo extensivo. cultivo permanente Pgi: pastizales intensivos. sin distinguir. sistema de barbecho (4-5 meses < barbecho < 8-9 meses) Fsci: cultivo intensivo. sistema de barbecho (barbecho > 8-9 meses) Fmcm: cultivo de intensidad media. cultivo permanente Pti: cultivo de árboles intensivo. si proviene de orígenes culturales o (semi) naturales (por ejemplo.3 Clasificación del uso del suelo en términos de la intensidad de uso. cultivo permanente Pge: pastizales extensivos. que corresponde al 66% del tiempo que la tierra no es cultivada.Figura 11. en primera instancia. considerando que la cobertura de árboles en plantaciones puede ser entre el 60% al 70% de la intensidad de uso. lo que se toma como el límite superior para la clase “cultivos migratorios”. bajo cultivo migratorio (periodo de barbecho > 8-10 años) Smce: cultivo extensivo. que se considera la forma de vida de la vegetación dominante o cultivo. donde se determina el orden a lo largo del gradiente de intensidad de uso de suelo descrito anteriormente. en las regiones superpuestas entre la categoría mayor de uso de suelo. cultivo permanente Pchi: cultivo intensivo. Esto quiere decir. bajo cultivo migratorio (1-2 años < barbecho < 8-10 años) Ssce: cultivo extensivo. este pasto se considera el tipo de vegeD escripción y clasificación de uso de suelo en puntos de muestreo 335 .

. con la introducción de una noción de que la extracción de productos de la selva sirve como un indicador para la intensidad de uso. más que al barbecho en sí) para permitir a la clase bajo consideración subir una o dos posiciones en el orden de clasificación.. Techniques and Equipment. Ericksen (eds) Slash-and-Burn Agriculture: The Search for Alternatives. F. Peter Okoth por las discusiones en la preparación de este capítulo. Woods. Respecto a la selva. Sanchez and P. Moreira. si se compara con un cultivo anual con un sistema de barbecho corto (Fsc). I. es decir.. REFERENCIAS Bignell. Nwaga. L.. J. P. H. (2000) Land Cover Classification System (LCCS): Classification Concepts and User Manual. “sistemas de barbecho” refiriéndose al componente de cultivo. un cultivo con un manejo intensivo bajo un sistema de barbecho corto (Fsci) puede subir una posición. GCP/RA/287/ITA Africover – East Africa Project and Soil Resources.-X. Igualmente. A. in D. S. D. Strategies and Methods of Introduction. L. V. (2005) ‘Belowground diversity assessment: Developing a key functional group approach in best-bet alternatives to Slash-and-Burn’. Management and Conservation Service. D. De esta manera. (2002) ‘Aerial application’.. J. B. P. (2002) Soil Management and Conservation for Small Farms. De Freitas. 2005). Agradecimientos Al profesor Ken Giller por sus comentarios y al Dr. 336 Manual de biología de suelos tropicales . G. Huang. Rome. Dibog. A. y Jansen..tación dominante). N. Palm. M. aun en el caso de que sean manejados intensivamente (Pgi) tendrán una clasificación más baja en términos de intensidad de uso de suelo. Columbia University Press. FAO Soils Bulletin 77. J. New York. si se compara con un área de cultivo permanente bajo manejo intermedio o bajo (Pcmi). S. Craig.. Tondoh. Di Gregorio. Pashanasi. Susilo. Marcel Dekker Inc. P. selva manejada y selva explotada. FAO. Rome. y Swift. in C. A. A. M... F. En el segundo ejemplo se considera la intensidad de manejo (en relación con el cultivo más demandante del sistema. de acuerdo con los sistemas de uso de suelo en el trópico húmedo a diferencia del proyecto ASB (Bignell et al. y Dorr. E. los pastizales permanentes. Pimentel (ed) Encyclopaedia of Pest Management.New York. Vosti. se hace una distinción entre selva natural. FAO. J.

W. www. M.. ILACO (1985) Compendium for Agricultural Development in the Tropics and Sub-Tropics. and Murnaghan. (eds) (1988) Vegetation Mapping. E. M. M. (1980) Farming Systems in the Tropics. E. Karanja. Vink. Hopkins (eds) Biological Diversity and Function in Soils. www. Oregon State University (2005) Pacific Northwest Weed Management Handbook. A. Springer Verlag. vol. Izac.. Akiefnawati. vol. van Noordwijk. I. Clarendon Press. R. Wichman Verlag. London. K. Oxford. in M. Barois.. (1993) ‘Land use zones and land use patterns in the Atlantic Zone of Costa Rica.. P. Handbook of Vegetation Science. K. (1997) ‘Agricultural intensification. y Kiefer.. D. van Noordwijk. Barrios. Moreira. Dordrecht.D. G. John Wiley & Sons.asp.. Berlin WOCAT. T. E.orst. M.. Joshi. (2005) ‘Soil biodiversity in rapidly changing tropical landscapes: Scaling down and scaling up’. R. F. R. Baere. (2002) Jungle Rubber: A Traditional Agroforestry System Under Pressure. Wibawa.. www. Zandstra. Earthscan Publications Ltd. Cambridge University Press.Giller.. M. ICRAF-Southeast Asia Regional Research Programme. J. Cambridge. 6. Kluwer Academic. Swift. S. Iowa State University (2004) ‘Weed Science’. D.iastate. Elsevier Science Publishers B.. M. D. 3–16. E. P. Ebner. Thesis. Ph. Molenaar. H. G. M. The Netherlands.. Huising. D escripción y clasificación de uso de suelo en puntos de muestreo 337 . P. Applied Soil Ecology. (1998) An introduction to the Theory of Spatial Object Modelling for GIS. MacArthur. M. N.weeds. y Zonneveld. Manurung. N. (1991) ‘Formal data structures...-M.. Giller. A.. W. Bogor.edu/pnw/weeds. Heipke (eds) Digital Photogrammetric Systems. Boutin.. D. J. A. soil biodiversity and ecosystem function’.. Kuechler. Usher. J. G. H. Stocking. y Williams.edu/mgmt/2004/ world... y Huising. pp.org/swcmeas. Taylor & Francis Ltd. 3rd edition. S. The Netherlands. World Overview of Conservation Approaches and Techniques. Fritsch and C. Vincent. y Swift. y Collinsons. The Netherlands. I. New York. Amsterdam. J. N. L. object dynamics and consistency rules’.shtml. Molenaar. in H. E. M. H. (1987) Remote Sensing and Image Interpretation.. 10. Ruthenberg. W. A pattern recognition approach to land use inventory at the sub-regional scale using remote sensing and GIS applying an object oriented and data-driven approach’. A. Lavelle. D. Bignell. ippc. Karlsruhe. London. Wageningen Agricultural University.wocat. Bardgett and D. B.. P. Indonesia. Lavelle. J.V. (1975) Land Use in Advancing Agriculture. Lillesand. (2001) Handbook for the Field Assessment of Land Degradation. M.

.

Cx Postal 478. Kenya. Brazil. PO Box 30677-00100. Universidade Federal de Minas Gerais. Institute for Tropical Biology and Conservation. CEP 70910-900 Brasilia.org. H-1088 Budapest. Brazil. Bangalore. Bagyaraj. GKVK Campus.Colaboradores L. constant@unb. Franklin. R.coe@ criar. Systematic Zoology Research Group of Hungarian Academy of Sciences and Hungarian Natural History Museum.hu. Huang. J. Malaysia. 13. beth@inpa.bignell@qmul. Barross str. Abreu.com. (finado). C.uk. Nairobi. P. S.br.ac. World Agroforestry Centre (ICRAF). United Nation Avenue. E. Bignell. Cx Postal 4457. E.com. Universiti Malaysia Sabah. Gigiri. r. Instituto Nacional de Pesquisas da Amazõnia (National Institute for Amazonian Research-INPA). Universidade de Brasilia. Instituto de Ciências Biológicas. Brasilia. University of Agricultural Sciences. Instituto de Ciencias Biológicas. 88999 Kota Kinabalu. Constantino. Departamento de Zoología. DF. E. CEP 69011-970.904-979. cares@unb. Csuzdi. csuzdi-alef@nhmus. Brazil. dbagyaraj@vsnl. 339 .gov. CEP 70. Departament of Agricultural Microbiology. DF.br.br. Manaus. Departamento de Fitopatología. AM. Cares. Coordenação de pesquisas em Entomologia.904-970. R. Campus Universitario Darcy Ribeiro. M. D. Universidade de Brasilia (UNB). J. Instituto de Química. Hungary. CEP 70. Brazil. Brazil. Cx Postal 4457. India. D. d. lmabreu@gmail. Belo Horizonte MG. Brasilia. Coe. Departamento de Fitopatología. DF. Sabah. Universidade de Brasilia (UNB).

World Agroforestry Centre SE Asia. S. CEP 37200-000. J. AM. C. W. LIPI JI.br. Jalan Sumantri Brojonegoro nº 1. Departamento de Ciência do Solo (Soil Science Department). RC Biology. CEP 89010-971. M.rahmadi@lipi.E. CEP 37200-000 Lavras MG. Brazil. University of Lampung. fxsusilo@tlkom.edu. Brazil. ludwig@ufla. Louzada.huising@cgiar. Universidade Federal de Lavras. CEP 37200-000. X. Cx Postal 3037. F. B. Faculdade de Ciências Agrárias. Cx Postal 3037. Tropical Soil Biology and Fertillity (FSBF) Institute of CIAT. United Nations Avenue. Susilo. UFR des Sciences et de la Nature. Bogor. Université d’Abobo-Adjamé. c/o ICRAF.fr. N.gov. F. Faculty of Agriculture.br. Universidade Federal de Lavras. Moreira. Côte d’Ivoire. alcmoino@ufla. 801. Lavras. Kenya. Manaus. morais@inpa.id. asgknila@yahoo. 46. J.br. Department of Plant Protection.go. S. m. Coordenação de Pesquisas en Entomnologia.com. Université d’Abobo-Adjamé. Cx Postal 478. PO Box 161. Gigiri. c/o ICRAF. Universidade Regional de Blumenau. Universitas Lampung. Cx Postal 3037. PO Box 30677-00100 Nairobi. C. Abidjan. 340 Manual de biología de suelos tropicales . Tondoh. Silva. Zoology Division. Cx Postal 1507. MG. 16001 Indonesia. Bandar Lampung 35145. CEP 69070-000 Manaus. Universidade Federal de Lavras. PO Box 30677-00100. Brazil. MG. Konaté. Kenya. L.com. Lavras . Instituto Nacional de Pesquisas da Amazônia (Nationale Institute for Amazonian Research-INPA). Jr. Indonesia.van-noordwijk@cgiar. Morais. Departamento de Entomología.com. A. Faculty of Agriculture. L.br. Pfenning. Departamento de Biología (Biology Department). Indonesia. Lavras. Huising. 69011-970.br. E. nmarques@ufam. Raya Jakarta-Bogor Km. CEP 37200-000. Tropical Soil Biology and Fertility Institute of CIAT. M. Côte d’Ivoire. Skonate2@yahoo. Departamento de Ciências Naturais. J. fmoreira@ufla. Brazil. Universidade Federal de Lavras. Nairobi. Brazil. Universidade Federal doAmazonas.br. Abidjan 02. Swift..org. N. J. H. CEP. j. 02 BP 801. Bandar Lampung 35145. Indonesia. M. swiftmj2003@ yahoo.net. Cx Postal 3037. SC. sturmer@furb. J. Stürmer. AM Brazil. Gigiri. Jalan Suantri Brojonegoro nº1. cahyo. Brazil. Karyanto. Centre de Recherche en Ecologie. M.P. van Noordwijk. Departamento de Fitopatologia. S. tondohj@ yahoo. Rahmadi. Moino. A. Cibinong. United Nations Avenue.com. jlouzada@gmail.com. Blumenau.

Lavras. zanetti@ufla. Brazil. CEP 37200-000. Cx Postal 37. C olaboradores 341 . MG.br. Departamento de Entomologia (Enthomology Department). Zanetti. Universidade Federal de Lavras.R.

.

290 bacterias fijadoras de nitrógeno (BFNFNL) 177-213 Basidiomycota 248. 151. 126. 251-252 bienes y servicios. 99. 93. 334 Ascomycota 248. 132 mesofauna 159. 334 aislamiento 190. 290-294 alimentación especializada o incidental 111 almacenamiento de las muestras 78.314. Véase atributos atributos técnicos específicos. 247–248 arado 311.Índice analítico A abundancia macrofauna 98. 194-197. 288.160 nematodos 171-172 AC. 263 análisis de conglomerados (cluster) 267 análisis de correspondencia (AC) 266 análisis de varianza (ANOVA) 265 análisis filogenéticos198. Véase análisis de correspondencia ácaros oribátidos 150 ácaros 149-159 acceso a puntos de muestreo 84.85 ácido láctico 156 aditivos 279. 191. 252-153 Asia 140–141 atributos 297.127. 302-329 atributos de tamaño de unidades de muestreo campo o parcela 304-307 cuadrícula 81-82 atributos técnico. 40.164. 217. 243. Véase servicios ecosistémicos biomasa 127. 132 343 . 177-214. 246 agroquímicos 313. 291 análisis automatizado del espaciador intergénico ribosomal (ARISA) 261. de uso de suelo 302 B bacteria 39. 280 África 141–142 agroecosistemas 43.

101. 164 descomposición 29-35. 304307. 300. 58. Véase electroforesis en gel con gradiente de desnaturalización diapausa 289 disección 157 diseños multiescala 64 diversidad BFNFNL 178-182. 301. 97. 194 HMA 219-222. 265-267 macrofauna 98-100. 331-332 Chromista 247 Chytridiomycota 248. 197. 58 . 304-324. 190 caracterización de sitios 87-88 caracterización genética 197 cartografía. Véase Proyecto. 334335 clasificación de procesos 93. 310. 254-255 D D. 316 cultivos puros 198 cultivos secundarios 307 cultivos trampa 231-232 curvas de acumulación de especies 113. 226-232 hongos 244. 265-267. 303 DGGE. 125-132. 325-329 conjunto mínimo de datos 129-132 contaminación 78 control microbiano 287 cosecha 311. 37-38. 94. Véase colonizadores cálculo. 251 ciclo de nutrientes 34 clasificación de uso de suelo 332. Véase taxonómica clasificación. 149-162 colonización 219-224 colonizadores (c) 172-174 combinación de cultivos 308-311. 171-172 cercas vivas y otros elementos de vegetación 319-321. Véase enumeración cobertura. 243. 246 descriptores genéricos 194 desmonte de la tierra 311. 158-160. cultivo 305. 313-315 determinación a priori 65. 325-329 caracterización cultural 189. conservación y manejo sostenible de la biodiversidad del suelo 344 Manual de biología de suelos tropicales cuadrícula estratificada 84-85 cultivo post inundación 308 cultivos de sotobosque 308 cultivos migratorios 309. 302-304 densidad. 102 clasificación.biopesticidas 288 bioturbación 34 C C. 96. cultivo 305-307 depredadores 37. 129. 319-320. 325-329 colecciones de recursos genéticos 267 Collembola 123. 124. Véase disturbio datos requeridos y análisis 49-50. 317 cPCR. 245. 188. Véase PCR competitivo CSM-BGBD. 298. 302. jerarquía 323 clasificadores 297. 302. 307 características del cultivo 301. 265 curvas de rarefacción 265 Cylindrocladium spp. 110 nematodos 171-172 uso de suelo 42-43. uso de suelo 81 categorías tróficas 110-112.

112125. 317 fertilizantes inorgánicos 315 fijación de nematodos 165-169 G glomerales 220 Glomeromycota 247 gradientes. 317. 71 etiqueta 97. 115-117. Véase ensayo de reducción de acetileno escala 62 escalas espaciales de muestreo 42-50. 99.6567. 283 extracción DNA 197. 128 especies trampa 185-186 esporas 88. 116-125. 226-228. 330-333 familia Acaulosporaceae 238 familia Archaeosporaceae 239 familia Gigasporaceae 240 familia Glomeraceae 236 familia Pacisporaceae 239 familia Paraglomeraceae 239 fase de pupa 284 fauna de la hojarasca 37. 104. 152-155 enfermedad 35. 312. 322-323. 113. 229-231. 140 especies anécicas 100. muestreo 80-81 gremios 114-115 grupos funcionales 29-41. 192 .99-100. 191 enumeración 168. 110-111. 114-118. 193 equidad 266 ERA. 319 enfoque sesgado 65 enfoques transversales 57 ensamble de especies 110 ensayo de reducción de acetileno (ERA) 185. 128 fertilizantes 314-316. 162. 287. 130. 128 especies clave 129 especies endógenas 99. 315. 70. 189. 288 esquemas de muestreo alternativos 5789. 85-86 escarabajos 100-113. 263 embudo de extracción 149. 190.E eficiencia en la labranza 312-314 electroforesis en gel con gradiente de desnaturalización (DGGE) 259-260. 128 especies epigeas 78. 163-165 grupos funcionales de la biota del suelo 38-41 H herbívoros 37 hidróxido de potasio (KOH) 156 hipótesis de CSM-BGBD 57 Í ndice analítico 345 . 257 esporas de HMA 226-228 método de Berlese 152-154 método de extracción Winkler 92. 36. 218. 98 estándares para BFNFNL descripción de especies 194-196 estatus de los cultivos 318 estratificación en el muestreo 55-57. 94-100 esquemas de puntos de muestreo 72-75 estacionalidad 88. 132 nematodos 165-166 extracciones núcleo por núcleo 154 F factor tiempo de cultivo 309.

173 índice de riqueza de género 171 índice de Shannon–Wiener 266 infiltración de glicerina 168 ingenieros del ecosistema 34. 243-280 hongos saprofitos 41. 187. 217. 37. 313. 301. 263-264 índice fitoparasítico (IFP) 172-174 índice de madurez (IM) 172. 166-168 organismos entomopatógenos 290. 140-144 mesofauna 156-159 moscas de la fruta 284-285 nematodos 163-165. 185–187 huella molecular 196-198.93–100. 259-260. 297-336 investigaciones piloto 60 irrigación308. 193 jerarquía clasificación 323 clasificación de uso de suelo 300-302. 100–113 . 243-280 hongos antagonistas 41 hongos del suelo. 91. 129 inoculación 47. 87-88. muestreo de 63. 91-92. 193 insectos 287-294 intensidad de uso de suelo agrícola 42. 330-336 inventarios 41-50. patógenos de plantas 41. Véase también taxonomía IM. Véase Sistema de clasificación de cobertura de suelo límites. 217-241 hormigas 40. 100-113. 140 hospederos promiscuos 178-185. 310 limpieza de malezas 313-315 listas de especies 107-109 lombrices de tierra 40. 64. 305-306. 44. 304. 229-230 hongos 255-256 lombrices de tierra 98-100 macrofauna 105-110. 334 labranza mínima 312 LCCS. 293. 41 HMA 217–241 patógenos de plantas y saprofitos 41.HMA. 46 datos requeridos 48-50 descripción y clasificación 299. 53. 302-304 manejo de la biota del suelo 47-49 muestreo 79-80 replicación y tamaño de muestra 60–65 I identificación grupos funcionales en macrofauna 112-113 HMA 226-228. 243-280 hongos fitopatógenos 41 hongos micorrizógenos 217-241 hongos micorrizógenos arbusculares (HMA) 41. 317 J jarras de Leonard 186. 114-118. 91. Véase índice de madurez imágenes satelitales 67. 306 índice de diversidad de Shannon 171 346 Manual de biología de suelos tropicales L labranza 312. Véase hongos micorrizógenos arbusculares hongos entomopatógenos 287-294 esquema de medición por puntos 74 grupos funcionales 39.

56. 263 método de Seinhorst 168 método de Seinhorst modificado 169 método Winkler 92. 91-148 manejo 311-319. 249. 73. 193–195 clasificación de usos de suelo 297-336 diseño y estrategias 53-90 hongos 249 inventarios de biodiversidad 42-47 macrofauna 91-148 mesofauna 149-162 moscas de la fruta 282-285 muestreo adaptativo 64.M macrofauna 39. para hongos 252-255 mesofauna 39. 130 métodos de extrapolación 105 métodos de montaje 157–158. 197. 73 microhabitat 47. 229–230 métodos TSBF 93–94 microfauna 37-38.84–85 nematodos 165 punto de muestreo 62-63 muestreo aleatorio 55–56 muestreo en cuadrícula clasificación de uso de suelo 304 CSM-BGBD 79–80. 131 monolitos complementarios para lombrices de tierra 97 moscas de la fruta 281-286 muestras compuestas 61–65. 193 muestras control 193. 82–83. 118.84–85 paisajes 61-63 aleatorio y sistemático 67-68 muestreo en transectos monolitos para lombrices de tierra 97 macrofauna 75. 321-330 materia orgánica 29-35 materia orgánica del suelo (MSO) 34.118125. 290 método de filtración de partículas 252– 254. 214 muestreo dentro de una parcela 65 muestreo animales 39 BFNFNL185–189. 97 muestreo no aleatorio 67 muestreo secuencial 64 muestreo simple aleatorio (MSA) 55. 40. 54. 131 número de muestras 81–83 esquema de puntos de muestreo 72–75 muestreo estratificado 67. 263-264 método de la cuadrícula de intersección 227-228 método de partículas de suelo251–253 método de reacción en cadena de la polimerasa (PCR) 196.256–259. 67-68 muestreo sistemático 67-68 N nematodos 163–176. 260. 58 mecanismos de control 313-315 mecanización 311. 75-77. 287–295 nematodos bacteriófagos 164 nematodos omnívoros 164 Í ndice analítico 347 . 40. 261.149-160 método de Berlese 149-160 método de Berlese modificado 154-155 método de centrifugación en azúcar 166 método de de extracción 190. 48-49 monolitos 94–100. 73. 98-100. 40.114–118. 126. 114-118. 39. 334 media poblacional 25 medidas de conservación 318 “medio 79” 214 medio “S” 293 medio selectivo.

102 nivel de parche 46–47. 132 Pythium spp. 263 prácticas culturales 301. 250 .79–89. subparcela o microhabitat 47. Conservación y manejo sostenible de la biodiversidad del suelo (CSMBGBD) 45–47. 48. 85–86. 184–186. 329 preparación de la tierra 311-312 primers específicos para “hongos” 257258 principales grupos funcionales 35-38. 7980. 145. 49 nitrogenasa 184. 298 prueba de hipótesis 55–57. muestreo 60-62 polimorfismo de conformación de cadena única (SSCP) 261. 83–84.140–144 nomenclatura 106. 263 polimorfismo de longitud de fragmentos de restricción (RFLP) 260 polimorfismo de longitud de fragmentos de restricción terminal (T-RFLP) 260. 317. 49 nivel neotropical 142. 314 Phytophthora spp. 78.185–198. 328. Véase Método de reacción en cadena de la polimerasa permanencia de la vegetación 330–332 persistencia (p) 172. 330 PCR competitivo (cPCR) 262 PCR cuantitativo 261-262 PCR.147–148 nivel regional 44. 165. 250 plagas 35.nematodos parásitos de plantas 164 nematos micofagos 164 nicho. 41 procedimientos basados en cultura 333–245. 49. separación de 85-86 puntos. muestreo 81.218. 300–336 patógenos fúngicos de plántulas 255 perturbación (P) 56. 325. 63 prueba piloto 60 pseudo-replicas 62 puntos de medición 53 puntos de muestreo 74 puntos de muestreo. 81. 219 población. 126. 249–255 proceso de aclarado 156-157 procesos de degradación 44 procesos de rehabilitación 44 productores primarios 37 programa Africover 299 propágulos infectivos 219-224 protozoa 247 proyecto. 191 nivel de nicho 47. 126 número más probable (NMP) 218. 57. 307–311. 244. 64-65. 174 pesticidas 286. 219224 O observación directa 302 observaciones secundarias 303 Oomycota 250 organismos entomopatógenos 287–295 organismos mutualistas 39 P p. 48-49. Véase persistencia paisajes 44–47.61-62 parcelas de muestreo y clasificación de uso de suelo 46–47. 315. 38. 319 plantaciones 322–324 348 Manual de biología de suelos tropicales plantaciones de teca 328 plantas hospederas 178–182.

284 neotropical 145 Véase también identificación visión general 29.279–280 técnicas de lavado para partículas del suelo 252. Véase electroforesis en una matriz de gel con un gradiente lineal térmico (TGGE) 259–260. 41. 188189 técnicas de cebo 119. 325. 317 taxonomía BFNFNL 177–182 HMA 219-222. 256–265 termitas 40.187 trampas McPhail 282 BFNFNL 190 pitfall 118-125. 123. 93-95. 263 técnicas de preservación 267 técnicas de preservación 93-94. 334. medición del estatus de los cultivos 318-319 resguardo de especímenes 192-193. 328. 147 termitas que se alimentan de madera 111 termitas que se alimentan del suelo 110 TGGE.249–252. 30–33. 304–319. 300–302. 124. 149 trampa 118-125. 155158 técnicas específicas de DNA 197. 335–336 sistemas de cultivo 42. 140.124. 91. 314–316. 229-230 macrofauna 105 mesofauna 158-159 moscas de la fruta 281.267 técnicas de procesamiento de muestras 78. 36-41 técnica de infección de plantas 178. 130-132. Véase Polimorfismo de conformación de cadena única sustancias químicas 156-158 349 . 103. 82. 103105. 251 Ricinius communis 254–255 riqueza de especies 265–267. 227 tipos de anidación 112-113 trampa de especies múltiples 185. 126.R reactivo de Melzer 230-231 reglas de decisión para la clasificación de usos del suelo 323 rendimiento. 297–299 rizosfera 249 rotación. 79 solución de nutrientes Jensen’s 215 solución Nesbitt 158 SSCP. 285 respuestas multivariadas de interés 63-64 RFLP ver polimorfismo de longitud de fragmentos de restricción rhizobia 177-183 Rhizoctonia spp. 149 trampa White 293 Í ndice analítico S secuencia de cultivos 107 secuenciación 16S rDNA 196 selección subjetiva 67 servicios ecosistémicos 29–36. 130-132. 263 tinción de raíces 224–226. cultivos 310-311 roundup 314 T tasas de aplicación 303. 163 sistema de clasificación de cobertura de suelo (LCCS) 299 sistemas de barbecho 309–310. 253-255. 145. 329 sitios de muestreo 60-63. 100–113.

300.trampas sin cebo 118 transecto de entrenamiento 102 transformación de datos 126. 87 variabilidad intragrupo 51 vegetación leñosa 319. efectos de mitigación 301. 320–322 vegetación semi-permanente 331 vegetación. 48 W WOCAT World Overview of Conservation Approaches and Technologies 318 Z Zygomycota 248 350 Manual de biología de suelos tropicales . 83-84 Véase también intensidad de uso de suelo área de uso de suelo 46. 70–72. 132 U uso de suelo a priori definición de clases descriptivas 65. 298. 64. 58 hongos 243 inventarios 87-88 muestreo 65-67. Véase polimorfismo de longitud de fragmentos de restricción terminal trituradores 260 V valores cp 171-174 variabilidad 70-72 variabilidad de datos 44. 331–333 ventanas para muestreo 60. 303 BFNFNL 186 cartografía 81 definición de clases 321–324 descripción y clasificación 297–336 diversidad 42. 83.7981. 159-160 transformadores procariotas 38 T-RFLP. 61–62.

C. Muestreo y caracterización de la biodiversidad bajo suelo . Av. S. México.A. editado por Fátima M.V.000 ejemplares . E.mx Se tiraron 1.proagraf. Badillo.com. Moreira. Jeroen Huising y David E. de C. Xalapa. S. Tel/FAX (228) 890 6204/815 1876 www. 20 de Noviembre No 649. Bignell se terminó de imprimir durante el mes de mayo de 2012 en los talleres gráficos PROAGRAF. 91190.Manual de biología de suelos tropicales. Veracruz. P. Col.

Sign up to vote on this title
UsefulNot useful