Está en la página 1de 55

LA CLULA Y LA BASE FSICO-QUMICA DE LA VIDA

1. LOS TOMOS Y LAS MOLCULAS DE LA VIDA. LOS COMPUESTOS INORGNICOS


1. Se sumergen dos clulas en soluciones de distinta concentracin salina (A y B del dibujo): (sep 97 A1) a) Deduce la concentracin relativa de las soluciones A y B. (0,5 Puntos) b) Nombra las estructuras sealadas en el dibujo. (0,5 Puntos) c) Explica el proceso por el cual el agua entra en "A" y sale en "B". (1 Punto)

2. Las sales minerales son esenciales para el mantenimiento de la vida: (sep 98 A1) a) Respecto al citoplasma celular, definir medio hipertnico y medio hipotnico. (0,5 puntos) b) Explica razonadamente que le ocurrira a una planta si se riega con agua salada. (0,5 puntos) c) Poner un ejemplo, mencionando composicin y funcin, de sales minerales en estado slido (sales insolubles) presentes en los seres vivos. (1 punto) 3. En relacin con las sales minerales: (jun 99 B1) a) Explica las formas en que se pueden encontrar las sales minerales en los seres vivos, pon un ejemplo de cada una de ellas e indica su funcin. (1 punto) b) En relacin con la clula explica los siguientes trminos: medio externo isotnico, medio externo hipertnico, medio externo hipotnico, e indica en qu consiste la smosis. (1 punto) 4. Los elementos biognicos se combinan entre s para formar biomolculas (principios inmediatos) que aparecen siempre en la materia viva. (mod 00 B1) a) Indica las clases de elementos biognicos y explica sus diferencias. (1 punto) b) Explica los tipos de biomolculas (principios inmediatos), segn su naturaleza qumica. (1 punto) 5. El agua es la molcula ms abundante en la materia viva. (mod 01 A1) a) Explica dos propiedades del agua. ( 1 punto) b) Explica dos funciones del agua en los seres vivos. (1 punto) 6. En relacin con las sales minerales en los organismos vivos: (jun 03 A1) a) Explica en qu situacin las clulas estn turgentes. (0,5 puntos) b) Explica en qu situacin las clulas estn plasmolizadas. (0,5 puntos) c) Pon un ejemplo de una sal mineral disuelta y otra precipitada e indica la funcin de cada una de ellas. (1 punto) 7. En relacin con la composicin de los seres vivos, define los siguientes trminos: (mod 04 A1) CUESTIONES DE SELECTIVIDAD 1997 2005 1

a) Bioelemento o elemento biognico. (0,5 puntos) b) Biomolcula. (0,5 puntos) Oligoelemento. (0,5 puntos) c) Glcido. (0,5 puntos)

2. LOS GLCIDOS
8. Los polisacridos son macromolculas presentes en los seres vivos. (mod 99 A1) a) Concepto de polisacrido (0,5 puntos). b) Cita dos polisacridos: uno caracterstico de vegetales y otro de animales, indicando su composicin y su funcin (1 punto) c) Indica la localizacin, dentro de la clula, de cada uno de los ejemplos citados. (0,5 puntos) 9. En relacin con los glcidos: (sep 00 B1) a) Indica si los siguientes compuestos: sacarosa, almidn, glucgeno y lactosa, son disacridos o polisacridos. (1 punto) b) En relacin con los compuestos indicados en el apartado anterior, indica en qu tipo de clula, animal o vegetal, se encuentran los homopolisacridos y cul es su funcin. (1 punto) 10. Los glcidos son biomolculas que desempean diversas funciones esenciales para el organismo. (mod 01 B1) a) Enumera dos tipos diferentes de glcidos y pon un ejemplo de cada uno de ellos. (0,5 puntos) b) Enumera dos tipos de asociacin entre glcidos y otras biomolculas. (0,5 puntos) c) Explica dos de las funciones que desempean los glcidos en el organismo y pon un ejemplo de glcido en cada una de ellas. (1 punto) 11. Con relacin a la clula vegetal: (sep 01 A1) a) b) c) d) Explica la composicin qumica de la celulosa. (0,5 puntos) Indica a qu grupo de biomolculas pertenece la hemicelulosa. (0,5 puntos) Indica la localizacin de la celulosa en dicha clula. (0,5 puntos) Cita dos biomolculas presentes en las clulas, vegetales o animales, con idnticas caractersticas qumicas a las anteriores. (0,5 puntos)

12. Con relacin a los glcidos: (mod 02 B1) a) Explica la constitucin de los disacridos. (0,5 puntos) b) Indica si los compuestos que se citan a continuacin son monosacridos, disacridos o polisacridos: galactosa, celobiosa, glucgeno y sacarosa. (1 punto) c) Indica la composicin qumica de la sacarosa y explica si se trata o no de un azcar reductor. (0.5 puntos) 13. En relacin con los glcidos: (jun 03 B1) a) Cita una pentosa e indica su funcin biolgica. (0,5 puntos) b) Explica cmo se establece la unin entre los monosacridos para formar un disacrido. (0,5 puntos) c) Cita un disacrido de inters biolgico caracterstico de la clula vegetal y otro de la clula animal e indica los componentes de cada uno de ellos. (1 punto) 14. En relacin con la composicin de los seres vivos, define los siguientes trminos: (mod 04 A1) a) Bioelemento o elemento biognico. (0,5 puntos) b) Biomolcula. (0,5 puntos) Oligoelemento. (0,5 puntos) c) Glcido. (0,5 puntos)

CUESTIONES DE SELECTIVIDAD 1997 2005 2

15. En relacin con las biomolculas, explique: (jun 04 B1) La La La La formacin formacin formacin formacin del del del del enlace enlace enlace enlace O-glucosdico (0,5 puntos). peptdico (0,5 puntos). que da lugar al nuclesido (0,5 puntos). que da lugar al nucletido (0,5 puntos).

16. En relacin con las biomolculas: (mod 05 B1) a) Explique los siguientes trminos: polisacrido y lpido saponificable. (1 punto) b) Indique un homopolisacrido y un heteropolisacrido, ambos con funcin estructural. (0,5 puntos) c) En las clulas animales, cite un lpido saponificable con funcin estructural y otro con funcin energtica. (0,5 puntos) 17. Muchos seres vivos estn constituidos, entre otras, por las siguientes biomolculas: Glucgeno, fosfolpidos, enzimas y ATP. (sep 05 A2) Relacione cada una de ellas con su principal funcin biolgica (1 punto). Indique las unidades estructurales de cada una (1 punto). 18. Referente a las biomolculas orgnicas: (sep 05 B1) a) Indique a qu grupo de molculas biolgicas pertenece el ejemplo que se representa y cite la denominacin del enlace sealado con la letra A (0,5 puntos).

b) A la vista del ejemplo anterior, indique si el enlace establecido y sealado con la letra A, es monocarbonlico o dicarbonfico. Razone la respuesta (0,75 puntos). c) Cite tres molculas que pertenezcan al mismo grupo general que el ejemplo del primer apartado (0,75 puntos).

3. LOS LPIDOS
19. Lpidos (jun 97 B1) a) Explica las caractersticas generales de los lpidos, sealando los grandes grupos en que se clasifican. (1 punto) b) Qu grupos de lpidos poseen funcin vitamnica? Pon ejemplos. ( 1 punto) 20. Lpidos (mod 98 A1) a) Explica dos funciones biolgicas de los lpidos. (1 punto) b) Dibuja un esquema que represente una grasa neutra (acilglicrido) indicando el nombre de las molculas implicadas y el tipo de enlace. (1 punto) 21. Los fosfoglicridos son lpidos complejos que poseen un comportamiento anfiptico. (jun 99 A1) a) Explica su composicin qumica y haz referencia al tipo de enlaces entre sus componentes. (1 punto) b) En qu estructura celular se localizan de forma mayoritaria los fosfoglicridos?. Explica el comportamiento anfiptico y su importancia en la organizacin de esa estructura. (1 punto)

CUESTIONES DE SELECTIVIDAD 1997 2005 3

22. Los lpidos constituyen un grupo de biomolculas estructural y funcionalmente muy heterogneo. (jun 00 A1) a) Describe la estructura general de dos tipos diferentes de lpidos. (1 punto) b) Indica cuatro funciones que desempean los lpidos en el organismo. (1 punto) 23. Los triacilglicridos o grasas son utilizados en la alimentacin humana. (sep 00 A1) a) Explica su composicin qumica. (0,5 puntos) b) Explica la diferencia, desde el punto de vista qumico, entre los aceites (grasas lquidas a temperatura ambiente) y los sebos (grasas slidas a temperatura ambiente). (0,5 puntos) c) Explica en qu consiste la saponificacin. (0,5 puntos) d) Menciona dos grupos de lpidos insaponificables. (0,5 puntos) 24. Relacionado con los lpidos: (sep 02 B1) Explica qu es un lpido saponificable. (0,5 puntos) Explica la composicin qumica de los fosfoglicridos (fosfolpidos). (1 punto) Cita la funcin biolgica ms importante de los fosfolpidos e indique su disposicin en la clula. (0,5 puntos) 25. En relacin con las biomolculas: (mod 05 B1) a) Explique los siguientes trminos: polisacrido y lpido saponificable. (1 punto) b) Indique un homopolisacrido y un heteropolisacrido, ambos con funcin estructural. (0,5 puntos) c) En las clulas animales, cite un lpido saponificable con funcin estructural y otro con funcin energtica. (0,5 puntos) 26. Muchos seres vivos estn constituidos, entre otras, por las siguientes biomolculas: Glucgeno, fosfolpidos, enzimas y ATP. (sep 05 A2) Relacione cada una de ellas con su principal funcin biolgica (1 punto). Indique las unidades estructurales de cada una (1 punto). 27. Entre las siguientes macromolculas: cidos nucleicos, glcidos, protenas y lpidos: (mod 06 A2) a) Diga cules son los respectivos monmeros de las tres primeras macromolculas y sus correspondientes tipos de enlace (0,5 puntos). b) Indique cules de ellas tienen estructura secundaria. Razone la respuesta (0,5 puntos). c) Diga cules de ellas son constitutivas de las membranas celulares. Razone la respuesta (1 punto). 28. Referente a los lpidos: (mod 06 B1) Si se ponen en proporciones, adecuadas: grasas (triacilglicridos), agua y una base (NaOH o KOH), explique la reaccin que tendra lugar, cite su nombre e indique el producto que se obtendra (0,75 puntos). Explique como se formara un triacilglicrido (0,5 puntos). Cite tres tipos de lpidos e indique la funcin de cada uno de ellos (0,75 puntos).

4. LAS PROTENAS. ACCIN ENZIMTICA


29. Las protenas son importantes componentes moleculares de los seres vivos. (mod 97 B1) a) Cita las principales funciones biolgicas de las protenas. (1 punto) b) Explica el tipo de enlace por el que las unidades constituyentes de las protenas se unen, poniendo un ejemplo. (1 punto) 30. Protenas: (jun 97 A1) CUESTIONES DE SELECTIVIDAD 1997 2005 4

a) La compleja estructura de las protenas se forma por sucesivos plegamientos de la cadena de aminocidos. Explica a qu se deben y en qu consisten los llamados plegamientos al azar, en lmina y en hlice . (1 punto) b) Al calor, la clara de huevo liquida se vuelve slida siendo el proceso irreversible. Razona por qu. (1 punto) 31. En el esquema se representa la molcula de la lisozima: (sep 97 B1)

a) De qu tipo de molcula se trata y qu tipo de estructura presenta? (1 Punto) b) Cmo se llaman las subunidades representadas por crculos y qu tipo de enlace las une? (0,5 Puntos) c) De qu depende el que las subunidades se unan en ese y no en otro orden? (0,5 Puntos) 32. (jun 98 A1)

a) b) c) d)

Qu representa la anterior molcula? (0,5 puntos) Qu tipo de enlace une las distintas unidades? (0,5 puntos) Pon 2 ejemplos de macromolculas con ste tipo de enlace (0,5 puntos) Cita alguna de las funciones biolgicas de estas macromolculas (0,5 puntos)

33. En relacin con la estructura de las protenas: (sep 99 B1) a) Define en qu consiste la estructura primaria de una protena. (0,5 puntos) b) Menciona dos tipos de estructuras secundarias y seala qu tipo de enlaces mantienen estas estructuras. (0,5 puntos) c) Explica en qu consiste la estructura cuaternaria de las protenas y mencione un ejemplo. (0,5 puntos) d) Indica cmo se denomina el proceso por el que una protena pierde su estructura terciaria o globular y cita una causa que lo desencadene. (0,5 puntos) 34. Los enzimas participan de forma clave en todas las reacciones metablicas. (mod 00 A1) a) Defina brevemente los conceptos de enzima y coenzima.(1 punto) b) Explica dos caractersticas de las enzimas. (0,5 puntos) c) Defina el concepto de vitamina. (0,5 puntos) 35. Con relacin a las enzimas y vitaminas: (jun 01 A1) a) Explica los siguientes trminos: enzima, cofactor, coenzima y vitamina. (1 punto) b) Cita dos vitaminas mencionando en cada caso una anomala carencial, e indica si son liposolubles o hidrosolubles. (1 punto) 36. En relacin con las protenas: (sep 03 A1) CUESTIONES DE SELECTIVIDAD 1997 2005 5

a) Explica su estructura primaria y secundaria. (1 punto) b) Explica en qu consiste la desnaturalizacin y la renaturalizacin proteica. (0,5 puntos) c) Cite dos factores que pueden causar la desnaturalizacin. (0,5 puntos) 37. En relacin con las biomolculas, explique: (jun 04 B1) a) b) c) d) La La La La formacin formacin formacin formacin del del del del enlace enlace enlace enlace O-glucosdico (0,5 puntos). peptdico (0,5 puntos). que da lugar al nuclesido (0,5 puntos). que da lugar al nucletido (0,5 puntos).

38. En el metabolismo de los seres vivos: (sep 04 A2) Indique qu es un coenzima y qu papel desempea (1 punto). Ponga un ejemplo de un coenzima oxidado e indique una ruta metablica en la que acte (0,5 puntos). Explique qu ocurre con los coenzimas reducidos en la cadena respiratoria (0,5 puntos). 39. Con referencia a las protenas: (jun 05 - B1) a) Defina estructura terciaria y cuaternaria de una protena (0,5 puntos). b) Explique el significado del trmino "desnaturalizacin" aplicado a las protenas (0,5 puntos). c) Diga cuatro funciones de las protenas indicando un ejemplo en cada caso (1 punto). 40. Muchos seres vivos estn constituidos, entre otras, por las siguientes biomolculas: Glucgeno, fosfolpidos, enzimas y ATP. (sep 05 A2) a) Relacione cada una de ellas con su principal funcin biolgica (1 punto). b) Indique las unidades estructurales de cada una (1 punto). 41. Entre las siguientes macromolculas: cidos nucleicos, glcidos, protenas y lpidos. (mod 06 A2) a) Diga cules son los respectivos monmeros de las tres primeras macromolculas y sus correspondientes tipos de enlace (0,5 puntos). b) Indique cules de ellas tienen estructura secundaria. Razone la respuesta (0,5 puntos). c) Diga cules de ellas son constitutivas de las membranas celulares. Razone la respuesta (1 punto).

5. LOS NUCLETIDOS Y LOS CIDOS NUCLEICOS


42. cidos nucleicos: (mod 97 A1) a) Nombra las unidades estructurales que los forman y los enlaces que las unen. (0,5 puntos) b) Explica las diferencias qumicas y estructurales de los dos tipos de cidos nucleicos. (1 punto) c) Menciona al menos una localizacin de cada tipo de cido nucleico. (0,5 puntos) 43. cidos nucleicos. (mod 97 B4) a) Explica con detalle el proceso de sntesis de ARN en el ncleo de una clula. (1 punto) b) Indica tres tipos de ARN sealando el papel que desempean en la sntesis de protenas. (0,5 puntos) c) Escribe la secuencia de ARN que se transcribira utilizando como molde la secuencia inferior del ADN en el dibujo. (0,5 puntos)

44. Cromosoma metafsico: (sep 97 A2) CUESTIONES DE SELECTIVIDAD 1997 2005 6

a) Explica cmo se condensa y empaqueta la molcula de DNA cuando pasa de profase a metafase durante la mitosis. (1 Punto) b) Dibuja un cromosoma metafsico, y seala una cromtida, el centrmero, un telmero y un brazo. (1 Punto) 45. Independientemente de la longitud y secuencia especfica de un ADN de doble cadena: (jun 98 B3) a) Qu bases nitrogenadas podramos encontrar? (0,5 puntos) b) Qu relaciones cuantitativas existiran entre dichas bases? (1 punto) c) Se cumpliran estas relaciones para el caso de un ADN de cadena sencilla? Razona tu respuesta. (0,5 puntos) 46. El cido ribonucleico (ARN) es una macromolcula presente en los seres vivos. (mod 99 A3) a) Explica la composicin del ARN. (0,5 puntos) b) Indica los tipos de ARN que conozca, explicando la funcin de cada uno de ellos. (1 punto) c) En qu estructuras de la clula se encuentra ARN de forma significativa? (0,5 puntos) 47. En la clula vegetal, la formacin de ATP tiene lugar durante determinados procesos metablicos. (mod 00 A2) a) Explica las caractersticas qumicas del ATP, y cita los enlaces entre sus componentes y seala su importancia en el metabolismo celular. (1 punto) b) Indica en qu procesos se produce la sntesis de ATP y seala los lugares de la clula dnde suceden. (1 punto) 48. El siguiente fragmento de una cadena de ADN representa el inicio de un gen: (mod 00 A4) 3' TACCCGAGATGT....... 5' a) Determina la secuencia de bases de su ARN mensajero e indica su polaridad. (0,5 puntos) b) Determina la secuencia de bases de la cadena complementaria de ADN e indica su polaridad. (0,5 puntos) c) En qu componentes se diferencian el ADN y el ARN? (1 punto) 49. El adenosn trifosfato o ATP es una molcula central en el metabolismo celular. (jun 00 B1) a) Describe su estructura general y explica la importancia del ATP en el metabolismo. (1 punto) b) En una clula vegetal, indica en qu orgnulos se realiza mayoritariamente la sntesis de ATP y menciona el nombre de los procesos de sntesis. (1 punto) 50. En relacin con el cido desoxirribonuclico (ADN): (mod 01 A4) a) Cul es la composicin qumica del ADN? (0,5 puntos) b) Indica la importancia biolgica de la estructura primaria del ADN. (0,5 puntos) c) Explica el modelo de la doble hlice de ADN (Watson y Crick). (1 punto) 51. El dogma central de la biologa molecular se puede representar esquemticamente de la siguiente manera: (mod 01 B4) ADN ARN protena a) Indica las diferencias que existen entre la composicin y estructura del ADN y del ARN. (1 punto) b) Indica el nombre de los procesos ADN ARN y ARN Protena e indica en qu parte de la clula eucaritica se producen. (0,5 puntos) c) Menciona tres tipos distintos de ARN y cita el proceso que permite el paso de ARN a ADN. (0,5 puntos) 52. Con relacin a la biosntesis de protenas en clulas eucariticas: (jun 01 B4) CUESTIONES DE SELECTIVIDAD 1997 2005 7

a) Menciona el nombre del proceso e indica su localizacin celular. (0,5 puntos) b) Indica el nombre de la molcula que lleva el codn y el nombre de la molcula que lleva el anticodn. (0,5 puntos) c) Indica la funcin del ARN transferente en este proceso y explica la relacin entre su estructura y su funcin. (1 punto) 53. Con relacin a los ARN de clulas eucariticas: (sep 01 B4) a) Indica las clases de ARN que conozcas. (0,75 puntos) b) Explica la funcin de cada uno de ellos. (0,75 puntos) c) Explica brevemente el proceso de maduracin del ARN. (0,5 puntos) 54. Con relacin al proceso de replicaci6n del ADN: (sep 02 B4) a) Nombra las protenas y enzimas que intervienen en la etapa de desenrollamiento y apertura de la doble hlice y explica sus funciones. (1,5 puntos) b) Explica dos diferencias en el proceso de replicacin del ADN en organismos procariticos y eucariticos. (0,5 puntos) 55. En relacin con el material hereditario: (mod 04 A4) a) Indica semejanzas y diferencias en cuanto a la composicin qumica del ADN y ARN. (1 punto) b) Define el concepto de gen a nivel molecular e indica en qu se diferencian los genes de procariotas y eucariotas. (0,5 puntos) c) Define los trminos exn e intrn. (0,5 puntos) 56. En relacin con las biomolculas, explique: (jun 04 B1) a) b) c) d) La La La La formacin formacin formacin formacin del del del del enlace enlace enlace enlace O-glucosdico (0,5 puntos). peptdico (0,5 puntos). que da lugar al nuclesido (0,5 puntos). que da lugar al nucletido (0,5 puntos).

57. Respecto al ATP: (sep 04 B1) Indique el grupo de molculas al que pertenece y cul es su papel metablico (0,5 puntos). Explique las posibles formas de sntesis de ATP (1 punto). Indique dos rutas metablicas donde se obtenga ATP (0,5 puntos.) 58. Referente al material hereditario: (jun 05 - B4) Copie y complete la tabla que aparece a continuacin y que corresponde a las cadenas complementarias de un fragmento de ADN. Utilice las letras: P para el cido fosfrico, S para la pentosa (2'desoxirribos, A para adenina, C para citosina, G para guanina y T para timina. Indique, en cada caso, el nmero de puentes de hidrgeno que se establecen entre las dos bases nitrogenadas (1 punto).

Al analizar las proporciones de bases nitrogenadas de un fragmento monocatenario de ADN humano los resultados fueron los siguientes: 27% de A, 35% de G, 25% de C y 13% de T. Indique cul ser la proporcin de bases de la cadena complementaria (0,5 puntos). Respecto a su composicin qumica, cite las diferencias existentes entre una molcula de ADN y una de ARN (0,5 puntos). 59. Muchos seres vivos estn constituidos, entre otras, por las siguientes biomolculas: Glucgeno, fosfolpidos, enzimas y ATP. (sep 05 A2) CUESTIONES DE SELECTIVIDAD 1997 2005 8

Relacione cada una de ellas con su principal funcin biolgica (1 punto). Indique las unidades estructurales de cada una (1 punto). 60. Entre las siguientes macromolculas: cidos nucleicos, glcidos, protenas y lpidos. (mod 06 A2) Diga cules son los respectivos monmeros de las tres primeras macromolculas y sus correspondientes tipos de enlace (0,5 puntos). Indique cules de ellas tienen estructura secundaria. Razone la respuesta (0,5 puntos). Diga cules de ellas son constitutivas de las membranas celulares. Razone la respuesta (1 punto).

6. LA TEORA CELULAR. MODELOS DE ORGANIZACIN CELULAR


61. En cuanto a los tipos de clulas procariticas y eucariticas: (sep 02 A1) a) Cita los componentes esenciales comunes. (1 punto) b) Cita sus diferencias. (1 punto) 62. Uno de los mayores hitos en la historia de la Biologa fue el enunciado de la Teora Celular. (mod 03 A1) a) Indica los postulados de la Teora Celular. (1 punto) b) Cite los tres cientficos que primero postularon la Teora Celular y el que la culmin demostrando su validez para el sistema nervioso. (1 punto) 63. En cuanto a su nivel de complejidad, las clulas se clasifican en procariticas y eucariticas. (mod 04 B1) a) Cita las principales diferencias entre ambos tipos celulares. (1,5 puntos) b) Cita un ejemplo de organismo procaritico y otro de organismo eucaritico. (0,5 puntos) 64. En cuanto a la evolucin de la clula y sus orgnulos (mod 05 A1) a) Defina la teora endosimbitica (Lynn Margulis, 1970). (1 punto) b) Cite tres diferencias entre una clula eucariota y una procariota, y ponga un ejemplo de clula procariota. (1 punto) 65. Con relacin a la clula: (jun 05 - A1) a) Defina la clula (0,5 puntos). b) Cite los componentes comunes de las clulas procariotas y eucariotas (1 punto). c) Cite dos componentes exclusivos de las clulas eucariotas (0,5 puntos).

7. PAREDES CELULARES Y MEMBRANA PLASMTICA


66. Membrana plasmtica: (jun 97 B4) a) Dibuja un diagrama rotulado de la membrana plasmtica segn el modelo de mosaico fluido. (1 punto) b) Explica dnde se sintetizan las protenas intrnsecas o integrales de la membrana. (1 punto) 67. El dibujo representa a la membrana plasmtica: (sep 98 B1)

CUESTIONES DE SELECTIVIDAD 1997 2005 9

a) Cita los componentes sealados con los nmeros 1, 2, 3 y 4. (1 punto) b) Explica cmo se realiza el paso de pequeas molculas a su travs, sin consumo de energa. (1 punto) 68. Entre el lquido intracelular y el lquido extracelular de una clula animal se observan las siguientes concentraciones de los productos A, B, y C: (mod 99 B2) Lquido intracelular A 10 mM B 50 mM C 5 mM Lquido extracelu- Al cabo de unos Lquido intracelular lar minutos se obserA 4 mM van los siguientes A 12 mM B 40 mM B 30 mM cambios C 5 mM C 20 mM Lquido extracelular A 2 mM B 40 mM C 20 mM

a) Nombra qu procesos han utilizado los compuestos A y B para moverse de un lado a otro de la membrana (0,5 puntos) b) Seala la diferencia fundamental entre un proceso y otro. (1 punto) c) Por qu no han cambiado las concentraciones de C? (0,5 puntos) 69. En relacin con la membrana plasmtica: (sep 99 A1) a) Explica la composicin qumica de la membrana plasmtica. (0,5 puntos) b) Modelo hipottico sobre su estructura. Explcalo mediante un esquema, sealando sus componentes. (0,75 puntos) c) De qu formas puede realizarse el transporte de sustancias a travs de la membrana? (0,75 puntos) 70. Las clulas vegetales estn rodeadas por una envoltura denominada pared celular. (sep 99 B2) a) Explica la composicin qumica y la estructura de dicha pared. (1 punto) b) Indica dos funciones que desempee la pared en la clula vegetal. (0,5 puntos) c) Indica el principal orgnulo implicado en la formacin de la pared celular y en qu fase de la mitosis se origina. (0,5 puntos) 71. Aunque existen diferencias entre las membranas de distintos tipos de clulas, as como entre la membrana plasmtica y la que rodea a diversos orgnulos, las membranas celulares tienen una estructura bsica comn a todas ellas. (mod 00 B2) a) Realice un esquema de la membrana plasmtica en el que figuren los principales componentes de la misma. (1 punto) b) Mencione cuatro de las funciones de la membrana plasmtica. (1 punto) 72. La clula vegetal, adems de la pared celular, tiene otras caractersticas diferenciales con la clula eucariota animal. (jun 00 A2) a) Cita las otras diferencias existentes. (0,5 puntos) b) Explica la composicin qumica de la pared celular. (1 punto) c) Cita dos funciones de la pared celular. (0,5 puntos) 73. En relacin con los intercambios celulares a travs de las membranas: (jun 00 A3) CUESTIONES DE SELECTIVIDAD 1997 2005 10

a) Indica las caractersticas del transporte pasivo que lo diferencian del transporte activo. (0,5 puntos) b) Cita los mecanismos de transporte pasivo que permiten entrar en la clula las molculas de oxgeno y de glucosa. (0,5 puntos) c) Nombra los mecanismos que permiten la entrada y salida de macromolculas en la clula. Explica cmo se llevan a cabo estos procesos. (1 punto) 74. Una de las funciones de la membrana celular es la de transporte de molculas entre el medio celular y el medio externo. Define los siguientes conceptos: (jun 01 B2) a) b) c) d) Difusin simple. (0,5 puntos) Difusin facilitada. (0,5 puntos) Transporte activo. (0,5 puntos) Endocitosis. (0,5 puntos)

75. Con respecto a la membrana celular de la clula eucaritica. (mod 02 A1) a) Indica su composicin qumica. (0,5 puntos) b) Cita dos funciones de la membrana celular. (0,5 puntos) c) Dibuja un esquema del modelo de membrana propuesto por Singer y Nicolson y seala sus componentes. (1 punto) 76. El sistema de membranas celulares consta de la membrana plasmtica y de sistema de endomembranas, poseyendo ambos una estructura similar. (sep 03 B1) a) Cita los componentes de la unidad de membrana y explica a qu se debe la denominacin de "mosaico fluido" segn el modelo de membrana de Singer y Nicholson. (1 punto) b) Cita dos funciones de la membrana. (0,5 puntos) c) Define glicoclix. (0,5 puntos)

8. SISTEMAS DE MEMBRANAS, ORGNULOS MEMBRANOSOS Y NO MEMBRANOSOS


77. Mitocondrias (mod 97 B2) a) Dibuja el esquema de una mitocondria poniendo nombre a sus partes. (0,5 puntos) b) Haz un esquema con las principales etapas de la degradacin de la glucosa en una clula. (0,5 puntos) c) Explica las principales etapas de la degradacin del cido pirvico en presencia de oxgeno durante la respiracin celular. (1 punto) 78. La fotografa muestra el corte transversal de una prolongacin de una clula eucarionte: (jun 97 A2)

a) Di qu estructura es y nombra los elementos sealados por las flechas. ( 1 punto) b) Explica la funcin que cumple esta estructura en las clulas. (1 punto) 79. En el dibujo se representa un orgnulo celular: (sep 97 A3) CUESTIONES DE SELECTIVIDAD 1997 2005 11

a) Indica el orgnulo de que se trata, poniendo nombre a las estructuras sealadas mediante flechas. (1 Punto) b) Localiza al menos dos de los procesos bioqumicos que tienen lugar en dicho orgnulo. (1 Punto) 80. En la mitocondrias tienen lugar importantes procesos bioqumicos: (sep 97 B2) a) Dibuja una mitocondria, nombrando y sealando sus partes. (1 Punto) b) Localiza al menos dos de los procesos bioqumicos que tienen lugar en la mitocondria. (1 Punto) 81. En el dibujo de esta clula: (mod 98 B1) a) Nombra 10 de los elementos sealados. (1 punto)

b) Explica si se trata de una clula animal o vegetal y en qu fase del ciclo celular se encuentra. (1 punto) 82. El dibujo representa una mitocondria: (jun 98 A2)

CUESTIONES DE SELECTIVIDAD 1997 2005 12

a) Nombra los componentes sealados con un nmero. (1 punto) b) Indica cual es la funcin que caracteriza a la mitocondria y en qu tipo de clula se encuentra este orgnulo. (0,5 puntos) c) Seala la funcin que realizan los componentes 3 y 4 del esquema. (0,5 puntos) 83. El retculo endoplsmico es una estructura membranosa situada en el interior celular. (jun 98 B1) a) Explica qu dos modalidades de retculo endoplsmico coexisten en la clula y qu funciones bsicas tiene cada una de estas modalidades. (1 punto) b) Si tuvieras que observar al microscopio electrnico una clula, qu caracterstica morfolgica te permitira distinguir inmediatamente una modalidad de la otra? (0,5 puntos) c) El retculo endoplsmico, es exclusivo de clulas animales, de clulas vegetales de ambos tipos de clulas? Razona su respuesta. (0,5 puntos) 84. En el siguiente esquema se representa un cloroplasto: (jun 99 A3)

a) Nombra los compartimentos y estructuras que se sealan. (1 punto) b) Menciona las partes de la estructura de este orgnulo asociadas con los siguientes procesos: sntesis de ATP, ciclo de Calvin, cadena de transporte electrnico y fotlisis. (1 punto) 85. En relacin con los ribosomas: (jun 99 B2) a) b) c) d) Explica su estructura. (0,5 puntos) Explica su composicin qumica. (0,5 puntos) Explica la funcin de los ribosomas. (0,5 puntos) Indica la localizacin de los ribosomas en clulas procariotas y eucariotas. (0,5 puntos)

86. En la clula vegetal, la formacin de ATP tiene lugar durante determinados procesos metablicos. (mod 00 A2) a) Explica las caractersticas qumicas del ATP, y cita los enlaces entre sus componentes y seala su importancia en el metabolismo celular. (1 punto) b) Indica en qu procesos se produce la sntesis de ATP y seala los lugares de la clula dnde suceden. (1 punto)

CUESTIONES DE SELECTIVIDAD 1997 2005 13

87. El adenosn trifosfato o ATP es una molcula central en el metabolismo celular. (jun 00 B1) a) Describe su estructura general y explica la importancia del ATP en el metabolismo. (1 punto) b) En una clula vegetal, indica en qu orgnulos se realiza mayoritariamente la sntesis de ATP y menciona el nombre de los procesos de sntesis. (1 punto) 88. En relacin con los lisosomas: (jun 00 B2) a) Define lisosoma primario. (0,5 puntos) b) Cita el orgnulo que origina los lisosomas y otro orgnulo que intervenga en la sntesis de su contenido. (0,5 puntos) c) Explica cmo se convierte un lisosoma primario en lisosoma secundario o fagolisosoma. (0,5 puntos) d) Cita la funcin de los lisosomas. (0,5 puntos) 89. Las mitocondrias son unos orgnulos que estn presentes en las clulas eucariotas. (sep 00 A2) a) Haz un esquema o dibujo de una mitocondria y seala sus componentes. (1 punto) b) Indica la localizacin en las mitocondrias de los siguientes procesos metablicos: cadena de transporte de electrones y ciclo de Krebs. (0,5 puntos) c) Cmo se llaman los productos del ciclo de Krebs que al oxidarse ceden sus electrones a la cadena de transporte electrnico? Cul es el aceptor final de los electrones? (0,5 puntos) 90. En relacin con el aparato de Golgi y el retculo endoplasmtico rugoso: (mod 01 A2) a) Haz un dibujo del aparato de Golgi y otro del retculo endoplasmtico rugoso relacionados entre s y nombra en ellos sus componentes. (1 punto) b) Explica la relacin funcional del aparato de Golgi con el retculo endoplasmtico rugoso. (0,5 puntos) c) Indica dos orgnulos o estructuras celulares en las que intervenga el aparato de Golgi en su formacin. (0,5 puntos) 91. En relacin con la fotosntesis: (mod 01 B2) a) Define los siguientes trminos: grana, fotosistema I, estroma y ciclo de Calvin. (1 punto) b) A qu procesos de la fotosntesis est asociada la obtencin de los siguientes productos: ATP; oxgeno; ribulosa 1,5-bifosfato; NADPH. (1 punto) 92. En relacin con el citoesqueleto: (mod 01 B3) a) Cita dos componentes del citoesqueleto e indica su composicin. (1 punto) b) Explica la funcin de los dos componentes citados en el apartado anterior. (1 punto) 93. Con relacin a la fuente de energa utilizada por los organismos. (jun 01 A2) a) Explica la diferencia fundamental entre un organismo quimioauttrofo (quimiosinttico) y un organismo fotoauttrofo (fotosinttico). (0,5 puntos) b) Explica la diferencia fundamental entre fotofosforilacin (fosforilacin fotosinttica) y fosforilacin oxidativa. (0,5 puntos) c) Indica el tipo de clulas y el compartimento celular donde se producen los procesos indicados en el apartado anterior. (1 punto) 94. Con relacin al Aparato de Golgi (Complejo de Golgi). (jun 01 B1) a) Explica sus caractersticas estructurales. (1 punto) b) Cmo se originan las vesculas golgianas? Cal es su funcin? (0,5 puntos) c) Cita dos funciones del aparato de Golgi. (0,5 puntos) 95. Con relacin al aparato ciliar de la clula: (sep 01 B1) CUESTIONES DE SELECTIVIDAD 1997 2005 14

a) Expn la estructura y funcin de un cilio. (1,5 puntos) b) Dibuja el esquema de la seccin transversal de su axonema. (0,5 puntos) 96. Existen sustancias proteicas que se sintetizan en la clula y posteriormente son segregadas al exterior. (jun 02 A1) a) Cita, por orden de actuacin, las estructuras y orgnulos citoplsmicos que intervienen en este proceso. (1 punto) b) En su paso a travs del complejo de Golgi, por qu cara del complejo entran estas molculas y por cul salen? (0,5 puntos) c) Con qu denominacin se conoce el proceso ms habitual de excrecin de sustancias al exterior y qu estructuras celulares intervienen en l? (0,5 puntos) 97. Con relacin a los orgnulos de la clula eucaritica. (jun 02 B1) a) Realiza un esquema de la mitocondria y seala sus componentes. (1 punto) b) Indica las semejanzas, a nivel estructural, entre las mitocondrias y los cloroplastos. (1 punto) 98. Un componente fundamental del citoplasma de clulas eucariotas es el citoesqueleto: (jun 04 A1) a) Enumere los componentes de esta estructura (0,75 puntos). b) De los anteriores, uno de ellos participa en el transporte de orgnulos y partculas en el interior de la clula. Ctelo, explique su estructura e indique otra funcin que desempea (1,25 puntos). 99. Respecto a los lisosomas: (sep 04 A1) a) Explique su estructura, composicin y funcin (1 punto). b) Defina lisosoma primario y lisosoma secundario (0,5 puntos). c) Explique el significado y funcin de fagolisosoma (0,5 puntos). 100. Respecto a los cilios: (sep 05 A1)

a) Cite sus diferentes zonas estructurales (0,75 puntos). b) Dibuje un esquema rotulado de un corte transversal de su tallo, indicando sus elementos (1,25 puntos). 101. En relacin con el proceso de secrecin en clulas eucariotas: (mod 06 A1)

a) Cite las molculas y orgnulos celulares que intervienen en el proceso, desde su sntesis hasta su excrecin al exterior celular (1 punto). b) Indique la funcin de cada una de las molculas y orgnulos citados en el apartado anterior (1 punto).

9. EL NCLEO INTERFSICO

CUESTIONES DE SELECTIVIDAD 1997 2005 15

FISIOLOGA CELULAR
10. EL NCLEO EN DIVISIN. EL CICLO CELULAR
102. La meiosis ocurre en aquellas clulas que van a formar gametos: (mod 97 A2)

a) Explica por qu es necesario que se produzca la meiosis en este tipo de clulas (0,5 puntos) b) Relaciona la variabilidad gentica de las especies con el proceso meitico. (1 punto) c) Desde el punto de vista evolutivo, la reproduccin sexual presenta ventajas o inconvenientes frente a la reproduccin asexual? Razona la respuesta. (0,5 puntos) 103. Los dibujos representan diferentes etapas de la divisin de una clula. (mod 97 B3)

a) Explica de qu divisin se trata y por qu, ordenando la secuencia correcta de las etapas. (1 punto) b) Explica si se trata de una clula vegetal o animal, aportando al menos dos razones. (0,5 puntos) c) Qu diferencias existen entre las clulas resultantes de una mitosis y de una meiosis? (0,5 puntos) 104. El dibujo representa una fase concreta del proceso meitico: (jun 97 A4)

a) Explica razonadamente de qu fase y de qu divisin se trata. (1 punto) b) Cuntos quiasmas se han producido, como mnimo, en esta meiosis? (0,5 puntos) c) Cuntos cromosomas tiene el organismo al que pertenece esta clula? (0,5 puntos) 105. Cromosoma metafsico: (sep 97 A2)

a) Explica cmo se condensa y empaqueta la molcula de DNA cuando pasa de profase a metafase durante la mitosis. (1 Punto) b) Dibuja un cromosoma metafsico, y seala una cromtida, el centrmero, un telmero y un brazo. (1 Punto) 106. El dibujo representa una clula eucarionte que se divide sucesivamente: (sep 97 B3)

CUESTIONES DE SELECTIVIDAD 1997 2005 16

a) Indica qu proceso representa y nombre las etapas 1, 2 y 3. (1 Punto) b) Explica dnde se da este proceso en la especie humana y por qu debe realizarse. (1 Punto) 107. En una etapa de la meiosis los cromosomas homlogos se acercan formando parejas y se aparean ntimamente: (mod 98 A3) a) Qu nombre reciben estas parejas de cromosomas? (0,5 puntos) b) Qu fenmeno ocurre en estas parejas que resulta en un aumento de variabilidad gentica? (1 punto) c) En qu etapa concreta se observan estas parejas de cromosomas? (0,5 puntos) 108. En el dibujo de esta clula: (mod 98 B1)

a) Nombra 10 de los elementos sealados. (1 punto)

b) Explica si se trata de una clula animal o vegetal y en qu fase del ciclo celular se encuentra. (1 punto) 109. Meiosis. (mod 99 A2)

a) Significado biolgico de la meiosis. (0,5 puntos) b) Haz un esquema de una clula en anafase I meitica de un organismo con 2n = 4 cromosomas en la que se haya producido un quiasma en uno de los bivalentes. (1 punto) c) Indica las diferencias ms notables entre la anafase II meitica y la anafase mittica. (0,5 puntos) 110. En el cromosoma. (mod 99 B1)

CUESTIONES DE SELECTIVIDAD 1997 2005 17

a) Haz un esquema del cromosoma metafsico indicando los siguientes componentes: cromtida, brazo cromosmico, centrmero, telmero, constriccin secundaria y cinetocoro. (1,5 puntos) b) Explica qu es un cariotipo. (0,5 puntos) 111. El cromosoma metafsico. (jun 99 A2)

a) Haz un esquema del cromosoma metafsico en el que seales y nombres todos los elementos o partes que conozcas. (1,5 puntos) b) Nombre los tipos morfolgicos de cromosomas metafsicos que conozcas. (0,5 puntos) 112. En relacin con la meiosis: (jun 99 B3)

a) Para una especie 2n = 6 haz un esquema de la metafase I meitica. (1 punto) b) Por qu se dice que la primera divisin meitica es reduccional? (0,5 puntos) c) Cul es el significado gentico de la meiosis? (0,5 puntos) 113. Las clulas vegetales estn rodeadas por una envoltura denominada pared celular. (sep 99 B2) a) Explica la composicin qumica y la estructura de dicha pared. (1 punto) b) Indica dos funciones que desempee la pared en la clula vegetal. (0,5 puntos) c) Indica el principal orgnulo implicado en la formacin de la pared celular y en qu fase de la mitosis se origina. (0,5 puntos) 114. La grfica representa la variacin del contenido de ADN por clula durante un supuesto ciclo celular. Responde razonadamente a las siguientes preguntas: (sep 99 B3)

a) Qu ocurre en el intervalo de tiempo entre 1 y 2 y cmo se denomina esta fase? (0,5 puntos) b) Cmo se llaman las fases que tienen lugar en el intervalo comprendido entre 2 y 3? (1 punto) c) Nombra la fase en que el contenido de ADN es mnimo. (0,5 puntos) 115. En relacin con la meiosis: (mod 00 A3)

a) Indica el significado biolgico de la meiosis. (1 punto) b) Haz un esquema de una clula en metafase I con 2n = 4 cromosomas. (1 punto) 116. Desde que una clula se origina hasta que se divide en dos clulas hijas, hay dos etapas claramente diferenciadas en el ciclo celular. (mod 00 B3) a) Qu nombre recibe cada una de estas etapas? (0,5 puntos) b) En qu fases se subdivide cada etapa? (0,5 puntos) c) Menciona en qu momentos del ciclo celular hay cambios en la cantidad de ADN. (0,5 puntos) d) Menciona un ejemplo de clula que no experimente divisin celular una vez que ha alcanzado la diferenciacin. (0,5 puntos) CUESTIONES DE SELECTIVIDAD 1997 2005 18

117. En relacin con los procesos de mitosis y meiosis de los organismos pluricelulares. (jun 00 B3) a) En cul de estos dos procesos se produce recombinacin gentica? Menciona el mecanismo responsable de la recombinacin. (0,5 puntos) b) En qu tipos de clulas tienen lugar la mitosis y la meiosis? (0,5 puntos) c) Cuntas clulas hijas se producen en cada uno de ellos? (0,5 puntos) d) Explica el significado biolgico del proceso de la meiosis. (0,5 puntos) 118. Respecto al ciclo celular. (sep 00 A3)

a) Define el estado de interfase de dicho ciclo, e indica en qu forma se encuentra el material gentico de la clula en ese estado. (0,5 puntos) b) Seala los distintos perodos en los que se divide la interfase. (0,75 puntos) c) Explica lo que ocurre en cada uno de ellos. (0,75 puntos) 119. En relacin con los procesos de mitosis y meiosis celulares: (sep 00 B3)

a) Haz un esquema comparativo entre la metafase mittica y la primera metafase meitica en un organismo 2n = 4 cromosomas. (1 punto) b) Durante la mitosis, indica en qu momento se transforma la cromatina en cromosomas y cundo se transforman los cromosomas en cromatina. (0,5 puntos) c) En la meiosis: indica en qu fase o periodo se separan los cromosomas y en qu periodo o fase se separan las cromtidas. (0,5 puntos) 120. En relacin con los procesos de mitosis y meiosis: (mod 01 A3)

a) En cul de los dos procesos se producen bivalentes?. Dibuja un bivalente (0,5 puntos) b) Menciona en qu fase se separan los bivalentes y explica qu acontecimientos tienen lugar durante un metafase mittica. (0,75 puntos) c) Dibuja la anafase I meitica de un organismo 2n = 6 cromosomas. (0,75 puntos) 121. Con relacin a los procesos de mitosis y meiosis en clulas animales o vegetales superiores: (jun 01 A3) a) En qu tipo de clulas de estos organismos tiene lugar la meiosis? Y la mitosis? (0,5 puntos) b) En cul de estos procesos y en qu fase del mismo se produce sobrecruzamiento? Haz un esquema grfico del sobrecruzamiento. (0,5 puntos) c) Explica la importancia biolgica de la meiosis. (1 punto) 122. Respecto a los procesos de mitosis y meiosis, y para un organismo con 2n = 8 cromosomas: (jun 01 B3) a) Si se tratara de un vegetal, dibuja una anafase II. Cules son las diferencias respecto a la anafase I? (1 punto) b) Indica las principales diferencias entre la citocinesis de una clula animal y la de una vegetal. (0,5 puntos) c) Qu cantidad de ADN tendra esta clula durante la metafase I? Razona la respuesta. (0,5 puntos) 123. Con relacin a la meiosis de una clula vegetal: (sep 01 A3)

a) Dibuja la anafase I y la anafase II para 2n = 6. (1 punto) b) Explica los acontecimientos que tienen lugar durante la profase I. (1 punto) 124. Respecto al proceso meitico: (sep 01 B3)

a) Cmo se denomina la estructura que se forma por el apareamiento de cromosomas homlogos? En qu fase del proceso se lleva a cabo? (0,5 puntos) CUESTIONES DE SELECTIVIDAD 1997 2005 19

b) Define los siguientes trminos: quiasmas, meiocito, gameto, cinetocoro. (1punto) c) Para una clula con 2n = 6 cromosomas: cuntas cromtidas existen en cada polo en anafase II? Razona la respuesta. (0,5 puntos) 125. Respecto al ciclo celular de los organismos eucariticos: (mod 02 A3)

a) Indica las etapas del mismo, y haz una breve descripcin de los principales acontecimientos que tienen lugar en cada una de ellas. (1 punto) b) Una clula haploide, puede experimentar meiosis? Razona la respuesta. (0,5) puntos. c) Explica en qu se diferencia la metafase mittica de la metafase I de la meiosis. (0,5 puntos) 126. Con relacin a los procesos de mitosis y meiosis: (mod 02 B3)

a) Seala dos diferencias entre ambos. (0,5 puntos) b) Haz un dibujo de la anafase mittica para una clula 2n = 6. (0,5 puntos) c) Explica la importancia biolgica del proceso meitico. (1 punto) 127. Con referencia al ciclo celular y a los procesos de divisin: (jun 02 A3)

a) Define los siguientes trminos: periodo G1; cromosoma homlogo; sobrecruzamiento; haploide. (1 punto) b) Haz un esquema grfico de una anafase II meitica y de una anafase mittica en un vegetal con una dtacin cromosmica 2n = 6. (0,5 puntos) c) Explica el significado biolgico de la mitosis. (0,5 puntos) 128. Considerando el proceso meitico: (jun 02 B3)

a) Puede una clula haploide sufrir meiosis? Razona la respuesta (0,5 puntos) b) Podra un organismo haploide sufrir meiosis en alguna parte de su ciclo? Razona tu respuesta. (0,5 puntos) c) Explica la importancia biolgica de la meiosis. (1 punto) 129. Con respecto a la divisin meitica: (sep 02 A3)

a) Explica qu es la meiosis cigtica y la meiosis gametognica. Indica en cada caso en qu tipo de organismos se lleva a cabo. (0,5 puntos) b) Explica la importancia biolgica de la meiosis. (1 punto) c) Dibuja una anafase II para una dotacin cromosmica 2n=6. (0,5 puntos) 130. Respecto al proces de divisin celular en animales y en vegetales superiores: (sep 02 B3)

a) Haz un esquema grfico de una anafase mit6tica en una clula animal y en una clula vegetal para una dotacin cromosmica de 2n=6. (1 punto) b) Explica en qu difiere la citocinesis tpica de una clula animal y la de una clula vegetal. (1 punto) 131. Con relacin al proceso meitico: (mod 03 A3)

a) Indica cundo se produce el reparto de las cromtidas hermanas entre los ncleos hijos. Razona la respuesta. (0,5 puntos) b) Explica el significado biolgico de la meiosis (1 punto). c) Para una dotacin cromosmica 2n = 4, haz un esquema grfico de la anafase II. (0, 5 puntos) 132. En una clula somtica de una especie animal con un nmero cromosmico 2n=6. (jun 03 A3) a) Representa un esquema de una profase y de una metafase. (1 punto) b) Cules son los eventos principales de la anafase y de la telofase?. (1 punto) 133. Referido al ciclo celular: (jun 03 B3) CUESTIONES DE SELECTIVIDAD 1997 2005 20

a) Dibuja un esquema de las etapas del ciclo celular indicando cada una de sus fases en sucesin cronolgica. (1 punto) b) Define y explica brevemente el significado biolgico de G0 y de S. (1 punto) 134. En un organismo eucaritico de reproduccin sexual, con un nmero cromosmico 2n=4 y todos los cromosomas telocntricos: (sep 03 A3) a) Dibuja un esquema de una anafase II. (1 punto) b) Cul es el sentido biolgico de la meiosis? (1 punto) 135. Realiza un esquema y enumera las caractersticas principales de: (sep 03 B3)

a) Citocinesis en una clula animal. (1 punto) b) Citocinesis en una clula vegetal. (1 punto) 136. La figura adjunta representa clulas de un organismo diploide en divisin. (mod 04 A3)

a) Estas clulas estn en divisin meitica o mittca? Razona, la respuesta. (1 punto) b) En qu etapa de la mitosis o de la meiosis se encuentran? Razona la respuesta. (1 punto) 137. En relacin con los cromosomas: (mod 04 B3)

a) Realiza un esquema de un cromosoma en metafase mittica y seala las partes principales del mismo. (1 punto) b) Cmo se clasifican en relacin con la posicin que ocupa la constriccin primaria? Define cada uno de ellos. (1 punto) 138. Con referencia a los procesos de divisin celular y reproduccin de los organismos: (jun 04 B3) a) Indique la importancia biolgica del proceso mittico (0,5 puntos). b) Suponiendo una dotacin cromosmica de 2n=6, represente grficamente una anafase mittica y una anafase II meitica (1 punto). c) Defina los siguientes conceptos: cromosoma homlogo, cromtidas hermanas (0,5 puntos). 139. Con referencia a los procesos de divisin celular eucaritica: (sep 04 A3)

a) Establezca tres diferencias entre los acontecimientos que tienen lugar durante la profase mittica y la profase I meitica (1 punto). b) Qu representa la meiosis en la reproduccin y variabilidad de las especies? (0,5 puntos). c) Haga un esquema de un bivalente indicando sus componentes (0,5 puntos). 140. Una determinada especie animal tiene tres pares de cromosomas: (jun 04 A3)

a) Indique cuntos cromosomas tendr un espermatozoide, cuntos tendr un vulo? Razone la respuesta (0,5 puntos). b) Haga un esquema de la metafase mittica de una clula de ese organismo (0,5 puntos). c) Indique en qu tipo de clulas de ese animal se llevara a cabo la mitosis, y la meiosis? (0,5 puntos). CUESTIONES DE SELECTIVIDAD 1997 2005 21

d) Qu tipos de espermatozoides puede formar ese animal en funcin de los cromosomas sexuales? Razone la respuesta (0,5 puntos). 141. Con referencia al ciclo celular de una clula eucaritica: (sep 04 B3)

a) Dibuje un cromosoma metacntrico y otro acrocntrico, cada uno de ellos en metafase y anafase mitticas indicando en cada caso sus diversas partes o componentes (1 punto). b) Indique cuales son las diferencias ms notables entre el significado biolgico de la mitosis y de la meiosis (1 punto). 142. Con referencia al ciclo celular de un organismo con dos pares de cromosomas homlogos, uno acrocntrico y otro metacntrico: (mod 05 A3) a) Haga un esquema grfico de una anafase mittica. (0,5 puntos) b) Describa los principales acontecimientos que tienen lugar en la profase mittica. (1 punto) c) Indique una similitud y una diferencia entre una anafase mittica y una anafase II meitica. (0,5 puntos) 143. En relacin a los cromosomas metafsicos: (jun 05 - A3)

a) Defina qu son los telmeros e indique cuantos tendra un cromosoma metacntrico en la metafase mittica (0,5 puntos). b) Explique qu entiende por centrmero y por cinetocoro (0,5 puntos). c) Cuntos brazos y cuntas cromtidas tendra un cromosoma metacntrico, y uno telocntrico? (0,5 puntos) d) Realice una representacin grfica de una pareja de cromosomas metacntricos y otra de telocntricos en metafase mittica, y seale la presencia de una constriccin secundaria en la pareja de metacntricos (0,5 puntos). 144. Con relacin a la divisin celular: (jun 05 - B3)

a) Respecto a la citocinesis: (1) en qu consiste?, (2) cundo ocurre?, (3) qu diferencia bsica existe entre la citocinesis de una clula animal y de una vegetal?, y (4) cmo se denominan las estructuras que facilitan la citocinesis en ambos tipos de clulas? (1 punto). b) Respecto a la anafase: (1) qu regiones cromosmicas interactan con los microtbulos?, (2) qu les sucede a esos microtbulos?, (3) qu estructuras migran a polos opuestos en la anafase de la meiosis?, y (4) qu estructuras migran en la anafase II de la meiosis? (1 punto). 145. En relacin a la divisin de una clula somtica animal: (sep 05 A3)

a) Qu sucesos ocurren durante la profase? (0,5 puntos). b) Qu diferencias existen entre la anafase y la telofase? (1 punto). c) Realice un esquema de una clula con 2n=4 en anafase (0,5 puntos). 146. Respecto a la divisin celular: (sep 05 B3)

a) Cite cuatro sucesos que ocurren en la profase de una clula somtica (1 punto). b) Identifique, y explique, los dos tipos de anafase que aparecen representadas a continuacin teniendo en cuenta que las clulas tienen dos cromosomas telocntricos (1 punto).

147.

Con relacin a la meiosis: (mod 06 A3) CUESTIONES DE SELECTIVIDAD 1997 2005 22

a) Qu sucesos especficos ocurren durante la profase de la primera divisin meitica? (0,5 puntos). b) Qu es un quiasma, y cundo se visualiza? (0,5 puntos). c) Qu sucede en la anafase de la primera divisin meitica? (0,5 puntos). d) En la representacin mostrada a la derecha aparece un bivalente al final de la profase de la primera divisin meitica. Qu error presenta ese esquema? Realice un esquema en el cual

el error est subsanado (0,5 puntos).

148.

Con relacin a la meiosis: (mod 06 B3)

a) Explique cmo se genera la variabilidad gentica (0,5 puntos). b) Cuntas divisiones ocurren durante la meiosis, y cuntas clulas se generan a partir de una clula? (0,5 puntos). c) Teniendo en cuenta un organismo con 2n=4, copie y complete el siguiente cuadro (1 punto).

11. EL METABOLISMO. BIOENERGTICA


149. Con relacin a la fuente de energa utilizada por los organismos. (jun 01 A2)

a) Explica la diferencia fundamental entre un organismo quimioauttrofo (quimiosinttico) y un organismo fotoauttrofo (fotosinttico). (0,5 puntos) b) Explica la diferencia fundamental entre fotofosforilacin (fosforilacin fotosinttica) y fosforilacin oxidativa. (0,5 puntos) c) Indica el tipo de clulas y el compartimento celular donde se producen los procesos indicados en el apartado anterior. (1 punto) 150. Con relacin al tipo de metabolismo que presentan los seres vivos. (sep 01 A2)

a) Explica el significado de: anabolismo y catabolismo. (1 punto) b) Indica a qu tipo de reacciones, anablicas o catablicas, pertenecen las siguientes rutas metablicas: gluclisis, gluconeognesis, ciclo de Calvin, y -oxidacin de los cidos grasos. (1 punto) 151. Con relacin a la gluclisis: (mod 02 A2)

a) Indica a qu tipo de reacciones del metabolismo pertenece. Razona la respuesta. (0,5 puntos) b) Indica en qu compartimento celular se lleva a cabo el proceso. (0,5 puntos) c) Menciona los productos iniciales y finales de la ruta. (0,5 puntos) d) Indica qu molculas colaboran en esta ruta para captar los electrones (poder reductor) y la energa. (0,5 puntos) 152. Con referencia al catabolismo: (sep 02 A2) CUESTIONES DE SELECTIVIDAD 1997 2005 23

a) Qu son las reacciones catablicas? Cita un ejemplo. (0,5 puntos) b) Qu son las fermentaciones? Cita un ejemplo. (0,5 puntos) c) Cita el nombre de las etapas que seguir el cido pirvico en una clula eucaritica hasta quedar degradado a C02 y H20, y nombra el compartimento celular donde tienen lugar. (1 punto) 153. Relacionado con el metabolismo celular: (sep 03 A2)

a) Define anabolismo y catabolismo. (0,5 puntos) b) Nombra el sustrato inicial y el producto final de la gluclisis e indica si se trata de una va anablica o catablica. (0,5 puntos) c) Nombra un sustrato inicial y el producto final de la gluconeognesis e indica si se trata de una va anablica o catablica. (0,5 puntos) d) Indica los compartimentos celulares donde se realizan las vas metablicas nombradas en los apartados b y c. (0,5 puntos) 154. a) b) c) d) 155. Define los siguientes trminos: (sep 03 B2) Organismos Organismos Organismos Organismos fotoauttrofos o fotosintticos. (0,5 puntos) quimioauttrofos o quimiosintticos. (0,5 puntos) aerbicos o aerobios. (0,5 puntos) anaerbicos o naerobios. (0,5 puntos)

En relacin con el metabolismo celular: (mod 04 B2)

a) Explica el significado de anabolismo y de catabolismo. (1 punto) b) Explica la diferencia fundamental entre un organismo aerbico y otro anaerbico. (0,5 puntos) c) Cita un proceso catablico que se realice en aerobiosis y otro en anaerobiosis. Indica la localizacin celular de cada ejemplo citado. (0,5 puntos) 156. En relacin con el metabolismo de los seres vivos: (mod 05 A2)

a) Indique los tipos de procesos metablicos y la finalidad de cada uno de ellos. (1 punto) b) Indique los tipos de organismos en relacin a su metabolismo, la fuente de carbono utilizada en cada caso y seale dicha fuente. (1 punto) 157. Referente a la sntesis de ATP: (jun 05 - A2)

a) Indique sus mecanismos de sntesis en la clula (0,5 puntos). b) Cite la localizacin de los mecanismos de sntesis de ATP en el cloroplasto y explique el mecanismo de produccin en el citado orgnulo (0,75 puntos). c) Indique la denominacin de los procesos de sntesis de ATP en los cloroplastos y cite una diferencia entre ambos procesos (0,75 puntos). 158. Con relacin al metabolismo celular: (sep 05 B2)

a) Explique cul es la finalidad de las reacciones anablicas (0,5 puntos). b) A qu tipo de proceso metablico pertenece la fotosntesis?. Razone la respuesta (0,5 puntos). c) Cite las fases del Ciclo de Calvin e indique su localizacin a nivel de orgnulo (1 punto).

12. LA GLUCLISIS Y LAS FERMENTACIONES


159. Fermentaciones: (mod 97 A4)

a) Define el concepto de fermentacin. (0,5 puntos) b) Indica dos diferencias esenciales entre la fermentacin y la respiracin. (0,5 puntos) c) Explica dos diferentes aplicaciones biotecnolgicas de las fermentaciones. (1 punto) CUESTIONES DE SELECTIVIDAD 1997 2005 24

160. En la degradacin aerobia de la glucosa hay tres etapas en las que se libera energa: glclisis, ciclo de Krebs y cadena respiratoria. (jun 97 A3) a) Sin necesidad de frmulas, explica brevemente la etapa de la gluclisis. (1 punto) b) Resume el balance energtico de cada una de las tres etapas mencionadas inicialmente, y el balance energtico final del proceso respiratorio. (1 punto) 161. El diagrama representa el proceso de consumo anaerobio de glucosa en el tejido muscular. (jun 98 B2)

a) Complete el diagrama poniendo en las casillas el nmero de carbonos de cada uno de los tres compuestos. (0,5 puntos) b) Indica el nombre de los procesos sealados con X e Y. (0,5 puntos) c) En qu lugar de la clula sucede el proceso X? (0,5 puntos) d) Qu ganancia neta en ATP hay en el proceso X? (0,5 puntos) 162. En algunos organismos el cido pirvico procedente de la gluclisis sigue una ruta metablica denominada fermentacin, mediante la cual obtienen energa. (sep 98 B2) a) Seala las diferencias fundamentales entre fermentacin y respiracin celular (1 punto). b) Qu microorganismos pueden realizar fermentaciones? (0,5 puntos) c) Menciona algn producto industrial que se obtenga por fermentacin y que le resulte familiar (porque se consuma en su casa, por ejemplo) (0,5 puntos) 163. Durante la fabricacin de la cerveza se producen una serie de reacciones anaerobias: (mod 99 A4) a) Indica cmo se llama el proceso global y qu tipo de microorganismo interviene. (0,5 puntos) b) Describe, desde el punto de vista qumico, la reaccin global de este proceso y en qu parte de la clula se localiza.(1 punto) c) Cita dos ejemplos de otros procesos similares, indicando su inters industrial. (0,5 puntos) 164. En la degradacin aerobia de la glucosa se pueden distinguir las siguientes etapas: gluclisis, transformacin de piruvato en acetil-CoA, ciclo de Krebs y cadena transportadora de electrones: (mod 99 B4) a) Sita en la clula eucaritica cada una de estas etapas. (1 punto) b) Explica qu coenzimas reducidos se producen y en qu etapas. (0,5 puntos) c) Explica para qu se utilizan estos coenzimas reducidos en el proceso respiratorio. (0,5 puntos) 165. La siguiente va metablica, cuya reaccin global se indica a continuacin, es esencial para el metabolismo de las clulas animales: (sep 00 B2) Glucosa + 2 NAD+ + 2 ADP + 2 Pi 2 Piruvato + 2 NADH + 2H+ + 2 ATP + 2 H2O a) Indica el nombre de la va y en qu compartimento celular se produce. (0,5 puntos) b) Explica los posibles destinos metablicos que puede tener el piruvato producido. (1 punto) c) Escribe la reaccin global de oxidacin de la glucosa. (0,5 puntos) CUESTIONES DE SELECTIVIDAD 1997 2005 25

166.

Con relacin al tipo de metabolismo que presentan los seres vivos. (sep 01 A2)

a) Explica el significado de: anabolismo y catabolismo. (1 punto) b) Indica a qu tipo de reacciones, anablicas o catablicas, pertenecen las siguientes rutas metablicas: gluclisis, gluconeognesis, ciclo de Calvin, y -oxidacin de los cidos grasos. (1 punto) 167. Con relacin a la gluclisis: (mod 02 A2)

a) Indica a qu tipo de reacciones del metabolismo pertenece. Razona la respuesta. (0,5 puntos) b) Indica en qu compartimento celular se lleva a cabo el proceso. (0,5 puntos) c) Menciona los productos iniciales y finales de la ruta. (0,5 puntos) d) Indica qu molculas colaboran en esta ruta para captar los electrones (poder reductor) y la energa. (0,5 puntos) 168. Con referencia al catabolismo: (sep 02 A2)

a) Qu son las reacciones catablicas? Cita un ejemplo. (0,5 puntos) b) Qu son las fermentaciones? Cita un ejemplo. (0,5 puntos) c) Cita el nombre de las etapas que seguir el cido pirvico en una clula eucaritica hasta quedar degradado a C02 y H20, y nombra el compartimento celular donde tienen lugar. (1 punto) 169. Relacionado con el metabolismo celular: (sep 03 A2)

a) Define anabolismo y catabolismo. (0,5 puntos) b) Nombra el sustrato inicial y el producto final de la gluclisis e indica si se trata de una va anablica o catablica. (0,5 puntos) c) Nombra un sustrato inicial y el producto final de la gluconeognesis e indica si se trata de una va anablica o catablica. (0,5 puntos) d) Indica los compartimentos celulares donde se realizan las vas metablicas nombradas en los apartados b y c. (0,5 puntos) 170. En relacin con el metabolismo celular: (mod 04 B2)

a) Explica el significado de anabolismo y de catabolismo. (1 punto) b) Explica la diferencia fundamental entre un organismo aerbico y otro anaerbico. (0,5 puntos) c) Cita un proceso catablico que se realice en aerobiosis y otro en anaerobiosis. Indica la localizacin celular de cada ejemplo citado. (0,5 puntos) 171. En los procesos de fermentacin: (sep 04 B2)

a) Indique un tipo de fermentacin, sealando la molcula inicial, el producto final y un microorganismo capaz de realizar dicho proceso (1 punto). b) Explique por qu en la fermentacin se obtiene un menor rendimiento energtico que en la respiracin (0,5 puntos). c) Explique qu ocurre en la fermentacin con el coenzima NADH obtenido en la gluclisis (0,5 puntos). 172. En relacin con el metabolismo celular: (mod 06 B2)

a) Nombre la ruta metablica anaerobia por la que las clulas obtienen ATP a partir de glucosa. Indique cul es el producto final de dicha ruta y el compartimento celular en el que transcurre (0,75 puntos). b) Nombre las etapas que seguir dicho producto final en una clula eucaritica en condiciones aerobias (0,75 puntos). c) Indique el destino que seguir dicho producto final en condiciones anaerobias. Nombre un organismo o una clula capaces de seguir este proceso (0,5 puntos). CUESTIONES DE SELECTIVIDAD 1997 2005 26

13. LA RESPIRACIN CELULAR


173. Fermentaciones: (mod 97 A4)

a) Define el concepto de fermentacin. (0,5 puntos) b) Indica dos diferencias esenciales entre la fermentacin y la respiracin. (0,5 puntos) c) Explica dos diferentes aplicaciones biotecnolgicas de las fermentaciones. (1 punto) 174. Mitocondrias (mod 97 B2)

a) Dibuja el esquema de una mitocondria poniendo nombre a sus partes. (0,5 puntos) b) Haz un esquema con las principales etapas de la degradacin de la glucosa en una clula. (0,5 puntos) c) Explica las principales etapas de la degradacin del cido pirvico en presencia de oxgeno durante la respiracin celular. (1 punto) 175. En la degradacin aerobia de la glucosa hay tres etapas en las que se libera energa: glclisis, ciclo de Krebs y cadena respiratoria. (jun 97 A3) a) Sin necesidad de frmulas, explica brevemente la etapa de la gluclisis. (1 punto) b) Resume el balance energtico de cada una de las tres etapas mencionadas inicialmente, y el balance energtico final del proceso respiratorio. (1 punto) 176. Algunos organismos obtienen energa por oxidacin total de la glucosa. El proceso celular se realiza en dos fases (o etapas) claramente diferenciadas. (sep 98 A2) a) b) c) d) Qu nombre recibe cada una de estas fases. (0,5 puntos) En qu lugar de la clula tiene lugar cada una de ellas? (0,5 puntos) Cul es la caracterstica ms notable que diferencia a una fase de la otra? (0,5 puntos) Cmo influye esa caracterstica en la produccin de energa? (0,5 puntos)

177. En la degradacin aerobia de la glucosa se pueden distinguir las siguientes etapas: gluclisis, transformacin de piruvato en acetil-CoA, ciclo de Krebs y cadena transportadora de electrones: (mod 99 B4) a) Sita en la clula eucaritica cada una de estas etapas. (1 punto) b) Explica qu coenzimas reducidos se producen y en qu etapas. (0,5 puntos) c) Explica para qu se utilizan estos coenzimas reducidos en el proceso respiratorio. (0,5 puntos) 178. Los cidos grasos se degradan por la va metablica conocida como -oxidacin o hlice de Lynen: (sep 99 A2) a) En qu compartimento celular tiene lugar esta va en clulas eucariotas? (0,5 puntos) b) Cul es el producto final de la degradacin de los cidos grasos? (0,5 puntos) c) A qu proceso metablico, orientado a la obtencin de energa, se incorpora este producto final? (0,5 puntos) d) En qu compartimento celular tiene lugar este ltimo proceso metablico? (0,5 puntos) 179. Las mitocondrias son unos orgnulos que estn presentes en las clulas eucariotas. (sep 00 A2) a) Haz un esquema o dibujo de una mitocondria y seala sus componentes. (1 punto) b) Indica la localizacin en las mitocondrias de los siguientes procesos metablicos: cadena de transporte de electrones y ciclo de Krebs. (0,5 puntos) c) Cmo se llaman los productos del ciclo de Krebs que al oxidarse ceden sus electrones a la cadena de transporte electrnico? Cul es el aceptor final de los electrones? (0,5 puntos) 180. La siguiente va metablica, cuya reaccin global se indica a continuacin, es esencial para el metabolismo de las clulas animales: (sep 00 B2) CUESTIONES DE SELECTIVIDAD 1997 2005 27

Glucosa + 2 NAD+ + 2 ADP + 2 Pi 2 Piruvato + 2 NADH + 2H+ + 2 ATP + 2 H2O a) Indica el nombre de la va y en qu compartimento celular se produce. (0,5 puntos) b) Explica los posibles destinos metablicos que puede tener el piruvato producido. (1 punto) c) Escribe la reaccin global de oxidacin de la glucosa. (0,5 puntos) 181. Con relacin al tipo de metabolismo que presentan los seres vivos. (sep 01 A2)

a) Explica el significado de: anabolismo y catabolismo. (1 punto) b) Indica a qu tipo de reacciones, anablicas o catablicas, pertenecen las siguientes rutas metablicas: gluclisis, gluconeognesis, ciclo de Calvin, y -oxidacin de los cidos grasos. (1 punto) 182. Con relacin al proceso fotosinttico: (mod 02 B2)

a) Indica las etapas del mismo y su localizacin en el orgnulo implicado. (1 punto) b) Cul es la diferencia entre la fotofosforilacin acclica y la cclica? Razona la respuesta. (0,5 puntos) c) Cita otro orgnulo de la clula vegetal donde se produzca ATP de forma mayoritaria e indica la denominacin del proceso. (0,5 puntos) 183. Respecto al catabolismo de los glcidos en una clula eucaritica: (jun 02 A2)

a) Nombra las etapas que experimentar una molcula de glucosa hasta que se convierte por completo en CO2 y H2O. (1 punto) b) Cita los compartimentos celulares por los que transcurren dichas etapas. (0,5 puntos) c) Indica dos mecanismos mediante los cuales se sintetiza ATP a lo largo de esas etapas. (0,5 puntos) 184. Con referencia al ciclo de Krebs o ciclo de los cidos tricarboxlicos de una clula eucaritica: (mod 03 A2) a) Indica el compartimento celular en el que transcurre y di si se trata de una ruta anablica, catablica o anfiblica. (0,5 puntos) b) Nombra tres rutas de las que puede proceder el acefil-CoA que se incorpora al ciclo. (0, 75 puntos) c) Nombra las coenzimas que participan en el ciclo recogiendo el poder reductor e indica si se obtienen oxidados o reducidos . (0,75 puntos) 185. En relacin con el metabolismo celular: (jun 03 A2)

a) Explica la finalidad (significado fisiolgico) del Ciclo de Krebs e indica su localizacin a nivel de orgnulo. (0,75 puntos) b) Explica la finalidad (significado fisiolgico) del Ciclo de Calvin e indica su localizacin, a nivel de orgnulo. (0,75 puntos) c) Indica en qu tipo de clula, vegetal y/o animal, se producen los ciclos citados. (0,5 puntos) 186. Relacionado con el ciclo de Krebs para una clula eucaritica: (mod 04 A2)

a) Nombra el compartimento celular en el que transcurre y cita el sustrato que se incorpora al ciclo. (0,5 puntos) b) Cita el nombre de dos coenzimas que intervienen en dicho ciclo para recoger el poder reductor. (0,5 puntos) c) Indica una finalidad de dicho ciclo y di si se trata de una va aerobia o anaerobia. (0,5 puntos) d) Nombra dos rutas de las que puede proceder el sustrato que se incorpora al ciclo. (0,5 puntos) 187. En relacin con el metabolismo celular: (mod 04 B2) CUESTIONES DE SELECTIVIDAD 1997 2005 28

a) Explica el significado de anabolismo y de catabolismo. (1 punto) b) Explica la diferencia fundamental entre un organismo aerbico y otro anaerbico. (0,5 puntos) c) Cita un proceso catablico que se realice en aerobiosis y otro en anaerobiosis. Indica la localizacin celular de cada ejemplo citado. (0,5 puntos) 188. Con referencia al catabolismo: (jun 04 A2)

a) Explique la diferencia entre respiracin y fermentacin (1 punto). b) Explique a qu se debe el diferente rendimiento energtico en estos procesos (1 punto). 189. En el metabolismo de los seres vivos: (sep 04 A2)

d) Indique qu es un coenzima y qu papel desempea (1 punto). e) Ponga un ejemplo de un coenzima oxidado e indique una ruta metablica en la que acte (0,5 puntos). f) Explique qu ocurre con los coenzimas reducidos en la cadena respiratoria (0,5 puntos). 190. Respecto al ATP: (sep 04 B1)

a) Indique el grupo de molculas al que pertenece y cul es su papel metablico (0,5 puntos). b) Explique las posibles formas de sntesis de ATP (1 punto). c) Indique dos rutas metablicas donde se obtenga ATP (0,5 puntos.) 191. El siguiente esquema representa procesos importantes en el metabolismo animal: (jun 05 B2) a) Diga cmo se denominan los compuestos indicados con los nmeros 1 y 2 as como los procesos con las letras A, B y C (1 punto). b) En qu compartimentos celulares se desarrollan dichos procesos? (0,5 puntos). c) Aparte de los productos finales, en qu se diferencian los procesos B y C? (0,5 puntos).

14. ANABOLISMO, FOTOSNTESIS Y QUIMIOSNTESIS


192. En la fotosntesis: (mod 97 A3)

a) Explica los fenmenos ms importantes de la fase lumnica. (1,5 puntos) b) Haz un esquema de las etapas de la fase oscura. (0,5 puntos) 193. El diagrama representa la absorcin de CO2 por cm2 de hoja, en dos plantas de especies diferentes: (jun 97 B2)

CUESTIONES DE SELECTIVIDAD 1997 2005 29

a) Interpreta la grfica. (1 punto) b) Explica el significado del punto X. (0,5 puntos) c) Qu factor podra estar actuando como factor limitante a partir de intensidades de luz superiores a 5? (0,5 puntos) 194. Indica el proceso representado en el diagrama, nombrando las etapas numeradas del 1 al 5. (2 puntos) (mod 98 B2)

195.

Algunas bacterias pueden obtener energa por quimiosntesis. (jun 98 A4)

a) Concepto de quimiosntesis. (0,5 puntos) b) Cita las fases de la quimiosntesis. (0,5 puntos) c) Pon un ejemplo de una bacteria que participe en el ciclo del nitrgeno y explica su importancia en los ciclos biogeoqumicos. (1 punto) 196. En el siguiente esquema se representa un cloroplasto: (jun 99 A3)

a) Nombra los compartimentos y estructuras que se sealan. (1 punto) b) Menciona las partes de la estructura de este orgnulo asociadas con los siguientes procesos: sntesis de ATP, ciclo de Calvin, cadena de transporte electrnico y fotlisis. (1 punto) CUESTIONES DE SELECTIVIDAD 1997 2005 30

197.

En relacin con la fotosntesis: (mod 01 B2)

a) Define los siguientes trminos: grana, fotosistema I, estroma y ciclo de Calvin. (1 punto) b) A qu procesos de la fotosntesis est asociada la obtencin de los siguientes productos: ATP; oxgeno; ribulosa 1,5-bifosfato; NADPH. (1 punto) 198. Con relacin a la fuente de energa utilizada por los organismos. (jun 01 A2)

a) Explica la diferencia fundamental entre un organismo quimioauttrofo (quimiosinttico) y un organismo fotoauttrofo (fotosinttico). (0,5 puntos) b) Explica la diferencia fundamental entre fotofosforilacin (fosforilacin fotosinttica) y fosforilacin oxidativa. (0,5 puntos) c) Indica el tipo de clulas y el compartimento celular donde se producen los procesos indicados en el apartado anterior. (1 punto) 199. Con relacin al tipo de metabolismo que presentan los seres vivos. (sep 01 A2)

a) Explica el significado de: anabolismo y catabolismo. (1 punto) b) Indica a qu tipo de reacciones, anablicas o catablicas, pertenecen las siguientes rutas metablicas: gluclisis, gluconeognesis, ciclo de Calvin, y -oxidacin de los cidos grasos. (1 punto) 200. Con relacin a la fotosntesis: (sep 01 B2)

a) Explica qu es un fotosistema. (0,5 puntos) b) Indica un organismo que realice la fotosntesis oxignica y otro que realice la fotosntesis anoxignica e indica en qu compartimentos celulares la realiza cada uno. (1 punto) c) Explica la importancia fisiolgica y ecolgica de la fotosntesis oxignica. (0,5 puntos) 201. Con relacin al proceso fotosinttico: (mod 02 B2)

a) Indica las etapas del mismo y su localizacin en el orgnulo implicado. (1 punto) b) Cul es la diferencia entre la fotofosforilacin acclica y la cclica? Razona la respuesta. (0,5 puntos) c) Cita otro orgnulo de la clula vegetal donde se produzca ATP de forma mayoritaria e indica la denominacin del proceso. (0,5 puntos) 202. Relativo al ciclo de Calvin: (jun 02 B2)

a) Indica cul es la finalidad de dicho ciclo y nombra el compartimento celular en el que transcurre. (0,5 puntos) b) Nombra las fases de dicho ciclo. (0,75puntos) c) Escribe una reaccin global para dicho ciclo y cita el mecanismo por el que se ha obtenido el ATP necesario (0,75 puntos) 203. Con relacin a la fotosntesis: (sep 02 B2)

a) Define fotosntesis oxignica y fotosntesis anoxignica. (0,5 puntos) b) Define fotofosforilaci6n cclica y fotofosforilaci6n no cclica (acclica) en los vegetales. (0,5 puntos) c) Indica el nombre de la ruta metab6lica en la que ocurre la fjaci6n del carbono y el compartimento celular en el que se lleva a cabo. (0,5 puntos) d) Indica la reaccin global de la ruta a la que te has referido en el apartado anterior. (0,5 puntos) 204. En relacin con el metabolismo celular: (jun 03 A2)

a) Explica la finalidad (significado fisiolgico) del Ciclo de Krebs e indica su localizacin a nivel de orgnulo. (0,75 puntos)

CUESTIONES DE SELECTIVIDAD 1997 2005 31

b) Explica la finalidad (significado fisiolgico) del Ciclo de Calvin e indica su localizacin, a nivel de orgnulo. (0,75 puntos) c) Indica en qu tipo de clula, vegetal y/o animal, se producen los ciclos citados. (0,5 puntos) 205. Relacionado con el metabolismo de los seres vivos auttrofos: (jun 03 B2)

a) Indica dos procesos por los que diferentes seres vivos pueden realizar un anabolismo auttrofo. (0,5 puntos) b) Nombra un organismo capaz de realizar cada uno de los procesos citados en el apartado anterior. (0,5 puntos) c) Cita dos componentes de un fotosistema. (0,5 puntos) d) Nombra las dos etapas que constituyen el anabolismo auttrofo de cualquiera de los organismos citados anteriormente. (0,5 puntos) 206. Relacionado con el metabolismo celular: (sep 03 A2)

a) Define anabolismo y catabolismo. (0,5 puntos) b) Nombra el sustrato inicial y el producto final de la gluclisis e indica si se trata de una va anablica o catablica. (0,5 puntos) c) Nombra un sustrato inicial y el producto final de la gluconeognesis e indica si se trata de una va anablica o catablica. (0,5 puntos) d) Indica los compartimentos celulares donde se realizan las vas metablicas nombradas en los apartados b y c. (0,5 puntos) 207. En el proceso fotosinttico: (jun 04 B2)

a) Indique sus fases y qu proceso bsico se realiza en cada una de ellas (1 punto). b) Indique el papel que desempean los fotosistemas y seale su localizacin a nivel de orgnulo (0,5 puntos). c) Indique el mecanismo de obtencin de ATP en tal proceso y su localizacin a nivel de orgnulo (0,5 puntos). 208. El ciclo de Calvin: (mod 05 B2)

a) Indique si se trata de un proceso anablico o catablico y su localizacin a nivel de orgnulo. (0,5 puntos) b) Seale la molcula que se regenera en el ciclo y el coenzima reducido que se requiere. (0,5 puntos) c) Indique la molcula que aporta energa al ciclo y en qu etapa se ha obtenido la citada molcula. (0,5 puntos) d) Explique cul es la finalidad de dicho ciclo. (0,5 puntos) 209. Referente a la sntesis de ATP: (jun 05 - A2)

a) Indique sus mecanismos de sntesis en la clula (0,5 puntos). b) Cite la localizacin de los mecanismos de sntesis de ATP en el cloroplasto y explique el mecanismo de produccin en el citado orgnulo (0,75 puntos). c) Indique la denominacin de los procesos de sntesis de ATP en los cloroplastos y cite una diferencia entre ambos procesos (0,75 puntos). 210. Con relacin al metabolismo celular: (sep 05 B2)

a) Explique cul es la finalidad de las reacciones anablicas (0,5 puntos). b) A qu tipo de proceso metablico pertenece la fotosntesis?. Razone la respuesta (0,5 puntos). c) Cite las fases del Ciclo de Calvin e indique su localizacin a nivel de orgnulo (1 punto).

CUESTIONES DE SELECTIVIDAD 1997 2005 32

LA BASE DE LA HERENCIA ASPECTOS QUMICOS Y GENTICA MOLECULAR


15. GENTICA MENDELIANA
211. En relacin con las aportaciones de Mendel al estudio de la herencia: (mod 05 A4)

a) Defina qu es un retrocruzamiento. Describa, utilizando smbolos genticos, un ejemplo del mismo. (1 punto) b) Indique los genotipos y las proporciones fenotpicas de la descendencia obtenida de la autofecundacin de un heterocigoto para dos caracteres. (1 punto) 212. Se cruzan dos cobayas homocigticos, uno de ellos de pelaje liso de color negro y otro de pelaje rizado y blanco. El rizado domina sobre el liso, mientras que el blanco es recesivo. (mod 05 B3) a) Utilizando smbolos genticos para los caracteres definidos, indique los genotipos de ambos parentales. (0,5 puntos) b) Indique los genotipos y los fenotipos que tienen los individuos de la F1. (0,5 puntos) c) Calcule las proporciones genotpicas y fenotpicas de la F2. (1 punto)

16. EXPRESIN DE LA INFORMACIN GENTICA


213. cidos nucleicos. (mod 97 B4)

d) Explica con detalle el proceso de sntesis de ARN en el ncleo de una clula. (1 punto) e) Indica tres tipos de ARN sealando el papel que desempean en la sntesis de protenas. (0,5 puntos) f) Escribe la secuencia de ARN que se transcribira utilizando como molde la secuencia inferior del ADN en el dibujo. (0,5 puntos)

214.

En el esquema se representa la molcula de la lisozima: (sep 97 B1) a) De qu tipo de molcula se trata y qu tipo de estructura presenta? (1 Punto) b) Cmo se llaman las subunidades representadas por crculos y qu tipo de enlace las une? (0,5 Puntos) c) De qu depende el que las subunidades se unan en ese y no en otro orden? (0,5 Puntos)

215.

Observe el esquema siguiente: (sep 98 A3)

a) Cmo se denomina cada una de las etapas numeradas en el mismo? (1 punto) b) Indica cules de estas etapas se producen normalmente en la clula eucaritica, indicando dnde se produce cada una de ellas. (1 punto) 216. Si un fragmento de una cadena de ADN tiene la secuencia: (sep 98 B3) 3 TAGCGTGACCAAGTC 5 a) Cul ser la secuencia de bases de su ARN mensajero? (0,5 puntos) CUESTIONES DE SELECTIVIDAD 1997 2005 33

b) Cuntos aminocidos podra tener como mximo la cadena polipeptdica resultante ? (0,5 puntos) c) Cita la caracterstica del cdigo gentico que ha utilizado para calcular el nmero de aminocidos. (1 punto) 217. En la replicacin del ADN: (jun 99 A4)

a) Qu significa que la replicacin del ADN es semiconservativa? (0,5 puntos) b) Qu significa que la replicacin del ADN es bidireccional? (0,5 puntos) c) Explica las semejanzas y diferencias en la sntesis de las dos cadenas de ADN en una horquilla de replicacin (1 punto) 218. La transcripcin y la traduccin son procesos fundamentales en la clula eucariota. (sep 99 A3) a) Define y distingue entre ambos procesos e indica en qu parte de la clula se produce cada uno de ellos. (1 punto) b) Nombra los tipos de ARN que intervienen en la traduccin y explica la funcin de cada uno de ellos. (1 punto) 219. El siguiente fragmento de una cadena de ADN representa el inicio de un gen: (mod 00 A4) 3' TACCCGAGATGT....... 5' a) Determina la secuencia de bases de su ARN mensajero e indica su polaridad. (0,5 puntos) b) Determina la secuencia de bases de la cadena complementaria de ADN e indica su polaridad. (0,5 puntos) c) En qu componentes se diferencian el ADN y el ARN? (1 punto) 220. La siguiente secuencia de ADN corresponde a un fragmento de un gen: (jun 00 B4) 3' GGCAATATCCGA 5' a) Indica la secuencia de nucletidos de su ARNm y la polaridad de la secuencia. (0,5 puntos) b) Menciona el nmero mximo de aminocidos que se sintetizarn en el proceso de traduccin. (0,5 puntos) c) Introduce una mutacin puntual (gnica) en la secuencia de ADN e indica una posible consecuencia de la mutacin en la secuencia de aminocidos de la protena. (0,5 puntos) d) Explica dos posibles efectos de la mutacin puntual para la clula. (0,5 puntos) 221. La siguiente secuencia polinucleotdica corresponde a un fragmento del inicio de un gen de una cepa bacteriana: (sep 00 A4) 3' TACAATTCCCGGGCAACACAC 5' a) Escribe la secuencia de bases del ARN mensajero que se puede sintetizar e indica su polaridad. (0,5 puntos) b) Cul es el nmero mximo de aminocidos que puede codificar este fragmento? (0,5 puntos) c) Qu caractersticas del cdigo gentico has utilizado para determinar el nmero de aminocidos? (0,5 puntos) d) Si se detectara una variante de la cepa que produjera un polipptido de cinco aminocidos, cmo pudo producirse la variante? (0,5 puntos) 222. En relacin con la expresin de la informacin gentica: (sep 00 B4)

a) Cita y define los dos procesos que tienen lugar en la expresin de la informacin gentica. (1 punto) b) Dnde tienen lugar los procesos anteriores en clulas procariotas y eucariotas. (1 punto) 223. El dogma central de la biologa molecular se puede representar esquemticamente de la siguiente manera: (mod 01 B4) CUESTIONES DE SELECTIVIDAD 1997 2005 34

ADN ARN protena a) Indica las diferencias que existen entre la composicin y estructura del ADN y del ARN. (1 punto) b) Indica el nombre de los procesos ADN ARN y ARN Protena e indica en qu parte de la clula eucaritica se producen. (0,5 puntos) c) Menciona tres tipos distintos de ARN y cita el proceso que permite el paso de ARN a ADN. (0,5 puntos) 224. Con relacin a la biosntesis de protenas en clulas eucariticas: (jun 01 B4)

a) Menciona el nombre del proceso e indica su localizacin celular. (0,5 puntos) b) Indica el nombre de la molcula que lleva el codn y el nombre de la molcula que lleva el anticodn. (0,5 puntos) c) Indica la funcin del ARN transferente en este proceso y explica la relacin entre su estructura y su funcin. (1 punto) 225. La expresin de los genes es un proceso universal de todos los seres vivos. (sep 01 A4)

a) Cul es la naturaleza molecular de los genes? (0,5 puntos) b) Explica los dos procesos fundamentales que tienen lugar en la expresin de un gen. (1 punto) c) En los organismos eucariticos, dnde tienen lugar los dos procesos anteriores? (0,5 puntos) 226. Con relacin a los ARN de clulas eucariticas: (sep 01 B4)

a) Indica las clases de ARN que conozcas. (0,75 puntos) b) Explica la funcin de cada uno de ellos. (0,75 puntos) c) Explica brevemente el proceso de maduracin del ARN. (0,5 puntos) 227. Con relacin al proceso de replicacin del ADN: (mod 02 A4)

a) Qu es la replicacin del ADN? (0,5 puntos) b) Cul es su significado biolgico? (0,5 puntos) c) Si una cadena de un fragmento de ADN tiene la siguiente secuencia: 3' ATTGGCATAGC 5' Cul es la secuencia y polaridad de la otra cadena de la doble hlice? (0,5 puntos) d) Indica las etapas que tienen lugar en el proceso de la replicacin del ADN. (0,5 puntos) 228. Con relacin al cdigo gentico: (mod 02 B4)

a) Qu es el cdigo gentico y para qu sirve? (0,5 puntos) b) Qu es un codn? (0,5 puntos) c) Explica cuatro caractersticas del cdigo gentico. (1 punto) 229. En el proceso de replicacin del ADN en bacterias (Escherichia coli): (jun 02 A4)

a) Explica el significado de los siguientes trminos: replicacin semiconservativa y replicacin bidireccional. (0,5 puntos) b) Explica brevemente el mecanismo de la sntesis de ADN en la cadena retardada. (1,5 puntos) 230. Con relacin a la etapa de iniciacin de la sntesis de una cadena polipeptdica (primera etapa de la traduccin): (jun 02 B4) a) Qu elementos constituyen el complejo de iniciacin? (1 punto) b) Qu elementos constituyen un ribosoma completo y funcional? (1 punto) CUESTIONES DE SELECTIVIDAD 1997 2005 35

231. Un determinado segmento de ADN tiene la siguiente secuencia de nucletidos en una de las cadenas: (sep 02 A4) ... 3' TTCCAGCAT 5' ... a) Cul debe ser la secuencia de nucletidos de la otra cadena?. Marca los extremos 3' y 5'. (0,5 puntos) b) Si la enzima ARN polimerasa lee este segmento de ADN, cul debe ser la secuencia de nucletidos de la cadena de ARN mensajero?. Marca los extremos 3' y 5'. (0,5 puntos) c) Define los siguientes trminos de mutaciones puntuales (gnicas): mutacin silenciosa y mutacin de cambio de sentido. Indica las consecuencias que tendran estas mutaciones en la secuencia de aminocidos codificada. (1 punto) 232. Con relacin al proceso de replicaci6n del ADN: (sep 02 B4)

a) Nombra las protenas y enzimas que intervienen en la etapa de desenrollamiento y apertura de la doble hlice y explica sus funciones. (1,5 puntos) b) Explica dos diferencias en el proceso de replicacin del ADN en organismos procariticos y eucariticos. (0,5 puntos) 233. Considera el siguiente segmento de ADN perteneciente a un organismo procaritico: (mod 03 A4) 5' ATTCGCGATGGG 3' ... 3' TAAGCGCTACCC 5' ... Si la cadena inferior es la cadena- molde utilizada por la enzima ARN polimerasa: a) Escribe la secuencia de nucletidos del ARN transcrito y marca sus extremos 5' y 3'. (0,5 puntos) b) Qu papel desempeara este ARN transcrito en el proceso de traduccin? (0,5 puntos) c) En qu compartimento celular se localizara el proceso de transcripcin? Y el proceso de traduccin? (0,5 puntos) d) Define los trminos de transcripcin y traduccin. (0,5 puntos) 234. En relacin con la expresin gnica: (sep 03 A4)

a) Explica en que consiste el proceso de traduccin y cita en qu estructuras de la clula se realiza. (0,5 puntos) b) Indica que papel desempean en este proceso los sitios P y A de ribosoma y la enzima aminoacil-ARNt-sintetasa. (0,75 puntos) c) Indica cmo se denomina el triplete de bases que en el ARNm codifica para un aminocido especfico, cmo se denomina el triplete de bases complementarias en el ARNt e indica cual sera el triplete de bases de ARNt si su complementario para el aminocido valina en el ARNm es GUA. (0,75 puntos) 235. En relacin con la replicacin: (sep 03 B4)

a) Indica la finalidad de proceso de replicacin y en qu perodo del ciclo celular tiene lugar este proceso. ( 0,5 puntos) b) Indica dos diferencias en la replicacin de procariotas y eucariotas. (0,5 puntos) c) Explica qu es un cebador y por qu es necesaria su presencia en el proceso de replicacin. (0,5 puntos) d) Supn que tomando como molde la cadena retardada de una molcula de ADN se han sintetizado dos fragmentos de Okazaki. Indica el nombre y funcin de dos enzimas, implicadas en la unin de dichos fragmentos. (0,5 puntos) 236. En relacin con el material hereditario: (mod 04 A4)

a) Indica semejanzas y diferencias en cuanto a la composicin qumica del ADN y ARN. (1 punto)

CUESTIONES DE SELECTIVIDAD 1997 2005 36

b) Define el concepto de gen a nivel molecular e indica en qu se diferencian los genes de procariotas y eucariotas. (0,5 puntos) c) Define los trminos exn e intrn. (0,5 puntos) 237. El siguiente esquema muestra la secuencia de procesos conocida como EL DOGMA CENTRAL DE LA BIOLOGA MOLECULAR: (mod 04 B4)

a) Indica y describe brevemente cada uno de los procesos biolgicos que se indican con las letras a, b, c, d en el esquema. (1 punto) b) Cada uno de los elementos que se citan a continuacin actan en los procesos que ha indicado en la pregunta anterior. Haz una lista colocando cada elemento en el proceso que le corresponde: ARN polimerasa dependiente de ADN, ribosomas, ADN polimerasa, anticodn, transcriptasa inversa, promotor, aminocidos, ARNt y cebadores. (1 punto) 238. Referente a la replicacin: (jun 04 A4)

a) El siguiente esquema corresponde a la replicacin de una molcula de ADN, en el que las flechas indican la direccin de replicacin de las nuevas cadenas

b) c) Indique lo que significan las letras A, B, C, y E (1 punto). d) Explique por qu es necesaria la sntesis de los fragmentos, sealados en el esquema con la letra C, e indique los pasos necesarios para que se unan dichos fragmentos haciendo referencia al nombre y actividad de las enzimas implicadas en este proceso (1 punto). 239. En relacin con la replicacin. (jun 04 B4)

a) Explique de forma razonada cual es el significado y finalidad de la replicacin semiconservativa y semidiscontinua del ADN (1 punto). b) Indique qu es un cebador y qu enzima es la encargada de su sntesis (0,5 puntos). c) Considere el siguiente fragmento de una cadena de ADN cuya secuencia de nucletidos es: 3' TTTACTGAA 5' Escriba la cadena complementaria tras la replicacin del mismo indicando su polaridad. Si el punto de inicio de la replicacin hubiese sido el nucletido A, subrayado en la secuencia, conteste razonadamente si desde ese punto hacia la izquierda la sntesis de la nueva cadena hubiese sido continua o discontinua (0,5 puntos). 240. En relacin con la informacin gentica y sus alteraciones: (sep 04 A4)

a) Si un polipptido tiene 450 aminocidos, indique cuntos ribonucletidos tendr el fragmento del ARNm que codifica esos aminocidos. Razone la respuesta (0,5 puntos). b) 5'GUU-UUC-GCA-UGG3', son cuatro codones de una molcula de ARNm. Indique cules sern los anticodones de las molculas de ARNt. Qu significa que el cdigo gentico es degenerado? (0,5puntos). c) Suponga que en un fragmento de ADN que codifica un polipptido se produce una mutacin puntual que afecta a un par de bases. Debido a ello, cuando la clula sintetice de nuevo el polipptido. a ste le podra haber ocurrido uno de los cuatro hechos siguientes: 1. Que se codifique el mismo aminocido que el sintetizado antes de la mutacin. CUESTIONES DE SELECTIVIDAD 1997 2005 37

2. La sustitucin de un aminocido por otro distinto. 3. Que el nuevo polipptido sintetizado sea ms corto 4. Que el nuevo polipptido sintetizado sea ms largo Basndose en sus conocimientos del cdigo gentico, explique el por qu de cada uno de estos resultados (1 punto). 241. Referente a replicacin, expresin y mutacin. (sep 04 B4)

a) Explique cmo se mantiene y se transmite la informacin gentica en los seres vivos. Describa brevemente cada uno de los procesos implicados (1 punto). b) Si durante la replicacin del ADN se inserta un nucletido incorrecto en la cadena de nueva sntesis, indique el nombre de la enzima encargada de subsanar este error y explique como lo hara (0,5 puntos). c) Indique en qu direccin son sintetizadas siempre las nuevas cadenas de ADN y cite cmo se denomina a la hebra de ADN que se transcribe en ARNm (0,5 puntos).

242.

En relacin con el cdigo gentico: (mod 05 B4) a) Cite cuatro caractersticas del cdigo gentico para todos los tipos celulares y explique qu quiere decir que el cdigo gentico es degenerado. (1 punto) b) Para la sntesis del polipptido Tyr-LeuMet-Phe se han utilizado los siguientes ARNt: 3UAC5, 3AAU5, 3AAA5 Y 3AUA5 Escriba la secuencia de nucletidos del ARNm cuya traduccin da lugar al pptido indicado y la secuencia de la cadena molde del ADN del gen correspondiente. (1 punto)

243.

Con relacin a la expresin gnica: (jun 05 - A4)

a) Cite y defina los procesos necesarios para la expresin de la informacin gentica (0,75 puntos). b) Indique la secuencia y la polaridad del ARNm que se transcribira utilizando como molde la secuencia inferior del siguiente ADN: 5'ATCGAAGTT 3 3'TAGCTTCAA 5' (0,5 puntos) c) Si la molcula de ARNm obtenido en la cuestin anterior, comienza a leerse por el primer nucletido del extremo 5, se obtienen tres tripletes o codones distintos. Escriba para cada codn su anticodn correspondiente en el ARNt (0,75 Puntos). 244. Referente al cdigo gentico y mutacin: (sep 05 A4)

a) A partir de la siguiente secuencia de bases correspondiente a un fragmento de un gen:

Indique cul ser la secuencia del ARNm correspondiente a la cadena inferior de este fragmento, indicando su polaridad (0,5 puntos). b) Ayudndose de la tabla del cdigo gentico escriba la secuencia de aminocidos del polipptido codificado por ese fragmento de gen indicando los extremos amino y carboxilo (0,5 puntos). CUESTIONES DE SELECTIVIDAD 1997 2005 38

c) Si en el ADN se produjese una sustitucin del par C-G por el par T-A, indique cmo se altera el ARNm y la cadena polipeptdica (0,5 puntos). d) Explique qu significa que el cdigo gentico es degenerado (0,5 puntos). 245. Referente a la replicacin: (sep 05 B4)

a) Indique, mediante un esquema, qu se entiende por replicacin semiconservativa del ADN. (0,5 puntos). b) Explique cul es la finalidad de la replicacin del ADN e indique en qu etapa del cielo celular tiene lugar (0,5 puntos). c) Cite el nombre de la enzima principal en la sntesis de ADN en procariotas y seale en qu direccin sintetiza las nuevas cadenas (0,5 puntos). d) Indique cmo se denomina el lugar especfico donde se inicia la replicacin y qu quiere decir que la replicacin del ADN es bidireccional (0,5 puntos). 246. Referente a la expresin en eucariotas: (mod 06 A4)

a) El esquema adjunto representa los procesos de transcripcin, procesamiento o maduracin y traduccin. Identifique los distintos elementos de la figura representados por letras (1,25 puntos).

b) Explique qu es un exn e indique la funcin de los ARNt y de las enzimas Aminoacil-ARNt sintetasas (0,75 puntos).

17. CONSERVACIN Y ALTERACIONES DE LA INFORMACIN GENTICA


247. Cuando el mecanismo de replicacin de DNA no funciona de forma correcta se producen errores en la molcula de DNA: (jun 97 B3) a) Qu nombre se da a estos errores y como se producen? (1 punto) b) Explica las consecuencias para el individo y la relacin que existe con algunos factores ambientales. ( 1 punto) 248. Mutaciones: (mod 98 B3) CUESTIONES DE SELECTIVIDAD 1997 2005 39

a) Explica en qu consisten las mutaciones moleculares poniendo un ejemplo concreto. (1 punto) b) Explica las diferentes consecuencias de que una mutacin suceda en un gameto o en una clula somtica. (0,5 puntos) c) Discute brevemente estos dos agentes mutagnicos: tabaco y exposicin prolongada al sol y sus efectos e implicaciones sociales. (0,5 puntos) 249. Referente a las alteraciones estructurales de los cromosomas: (jun 98 A3)

a) Explica los tipos de alteraciones cromosmicas que conozcas. (1 punto) b) Haz un esquema que explica cmo se produce una alteracin cromosmica, incluyendo la situacin de partida y el resultado final. (1 punto) 250. Las mutaciones son alteraciones en el material gentico. (sep 99 B4)

a) Define qu es una mutacin puntual. (0,5 puntos) b) Enumera los tipos de mutaciones puntuales que conozca y las consecuencias que puede tener cada una de ellas en la secuencia de aminocidos de una protena. (1,5 puntos) 251. El ADN es una molcula que se encuentra sometida continuamente a las agresiones producidas por sustancias de su entorno celular. (mod 00 B4) a) Qu son las mutaciones y qu tipo de agentes mutagnicos las producen? (0,5 puntos) b) Enumere y explica los tipos de mutaciones que conoce. (1 punto) c) Establezca la relacin entre mutaciones y evolucin. (0,5 puntos) 252. La siguiente secuencia de ADN corresponde a un fragmento de un gen: (jun 00 B4) 3' GGCAATATCCGA 5' a) Indica la secuencia de nucletidos de su ARNm y la polaridad de la secuencia. (0,5 puntos) b) Menciona el nmero mximo de aminocidos que se sintetizarn en el proceso de traduccin. (0,5 puntos) c) Introduce una mutacin puntual (gnica) en la secuencia de ADN e indica una posible consecuencia de la mutacin en la secuencia de aminocidos de la protena. (0,5 puntos) d) Explica dos posibles efectos de la mutacin puntual para la clula. (0,5 puntos) 253. La siguiente secuencia polinucleotdica corresponde a un fragmento del inicio de un gen de una cepa bacteriana: (sep 00 A4) 3' TACAATTCCCGGGCAACACAC 5' a) Escribe la secuencia de bases del ARN mensajero que se puede sintetizar e indica su polaridad. (0,5 puntos) b) Cul es el nmero mximo de aminocidos que puede codificar este fragmento? (0,5 puntos) c) Qu caractersticas del cdigo gentico has utilizado para determinar el nmero de aminocidos? (0,5 puntos) d) Si se detectara una variante de la cepa que produjera un polipptido de cinco aminocidos, cmo pudo producirse la variante? (0,5 puntos) 254. Con relacin a las mutaciones. (jun 01 A4)

a) Define qu es una mutacin puntual (gnica) e indica el proceso celular responsable de la aparicin de este tipo de mutaciones. (0,5 puntos) b) En la siguiente secuencia de nucletidos de una cadena de ADN : 3ATGCCA 5 introduce una mutacin puntual y seala el tipo de mutacin producido. (0,5 puntos) c) Define qu es una mutacin cromosmica y pon un ejemplo. (0,5 puntos) d) Establece la relacin entre mutacin y evolucin. (0,5 puntos) CUESTIONES DE SELECTIVIDAD 1997 2005 40

255. Un determinado segmento de ADN tiene la siguiente secuencia de nucletidos en una de las cadenas: (sep 02 A4) ... 3' TTCCAGCAT 5' ... a) Cul debe ser la secuencia de nucletidos de la otra cadena?. Marca los extremos 3' y 5'. (0,5 puntos) b) Si la enzima ARN polimerasa lee este segmento de ADN, cul debe ser la secuencia de nucletidos de la cadena de ARN mensajero?. Marca los extremos 3' y 5'. (0,5 puntos) c) Define los siguientes trminos de mutaciones puntuales (gnicas): mutacin silenciosa y mutacin de cambio de sentido. Indica las consecuencias que tendran estas mutaciones en la secuencia de aminocidos codificada. (1 punto) 256. En relacin con las mutaciones: (jun 03 A4)

a) Explica el concepto de mutacin gnica e indica las consecuencias de estas mutaciones segn que afecten a clulas somticas o a clulas germinales. (0,75 puntos) b) Considera el siguiente fragmento de un gen de un organismo procariota: 5' TCGGA 3' 3' AGCCT 5' y que al replicarse la cadena indicada con una flecha, se introduce un error por la ADN polimerasa III de forma que la nueva cadena sintetizada presenta la siguiente secuencia: 5' TCAGA 3'. Explica qu error se ha producido y menciona un enzima que participe en la correccin. (0,5 puntos) c) Define los siguientes trminos: triploida, trisoma y monosoma. (0,75 puntos) 257. En relacin con la Ingeniera Gentica, mutagnesis y cncer: (jun 03 B4)

a) En qu consiste la terapia gnica? (0,5 puntos) b) Explica el concepto y origen del cncer. (0,75 puntos) c) Define protooncogenes y oncogenes. Indica cmo pueden originarse los oncogenes. (0,75 puntos) 258. En relacin con la informacin gentica y sus alteraciones: (sep 04 A4)

a) Si un polipptido tiene 450 aminocidos, indique cuntos ribonucletidos tendr el fragmento del ARNm que codifica esos aminocidos. Razone la respuesta (0,5 puntos). b) 5'GUU-UUC-GCA-UGG3', son cuatro codones de una molcula de ARNm. Indique cules sern los anticodones de las molculas de ARNt. Qu significa que el cdigo gentico es degenerado? (0,5puntos). c) Suponga que en un fragmento de ADN que codifica un polipptido se produce una mutacin puntual que afecta a un par de bases. Debido a ello, cuando la clula sintetice de nuevo el polipptido. a ste le podra haber ocurrido uno de los cuatro hechos siguientes: 1. 2. 3. 4. Que se codifique el mismo aminocido que el sintetizado antes de la mutacin. La sustitucin de un aminocido por otro distinto. Que el nuevo polipptido sintetizado sea ms corto Que el nuevo polipptido sintetizado sea ms largo

Basndose en sus conocimientos del cdigo gentico, explique el por qu de cada uno de estos resultados (1 punto). 259. Referente a replicacin, expresin y mutacin. (sep 04 B4)

a) Explique cmo se mantiene y se transmite la informacin gentica en los seres vivos. Describa brevemente cada uno de los procesos implicados (1 punto). b) Si durante la replicacin del ADN se inserta un nucletido incorrecto en la cadena de nueva sntesis, indique el nombre de la enzima encargada de subsanar este error y explique como lo hara (0,5 puntos). CUESTIONES DE SELECTIVIDAD 1997 2005 41

c) Indique en qu direccin son sintetizadas siempre las nuevas cadenas de ADN y cite cmo se denomina a la hebra de ADN que se transcribe en ARNm (0,5 puntos). 260. Referente a la mutacin: (mod 06 B4)

a) Explique qu se entiende por mutacin y realice una clasificacin de las mismas (0,5 puntos). b) Cite un tipo de mutacin cromosmica y explique grficamente en qu consiste (0,5 puntos). c) La siguiente secuencia de ADN corresponde a un fragmento de un gen: 5' CATGTTGGA 3' 3' GTACAACCT 5' Si se produce el cambio de un par de bases en este fragmento, indique las posibles consecuencias de esta mutacin en la secuencia de aminocidos de la protena (0,5 puntos). d) Explique qu relacin hay entre las mutaciones y la evolucin de las especies (0,5 puntos).

CUESTIONES DE SELECTIVIDAD 1997 2005 42

MICROBIOLOGA Y BIOTECNOLOGA
18. LAS FORMAS ACELULARES: LOS VIRUS
261. El virus VIH es el causante de la enfermedad denominada sndrome de inmunodeficiencia adquirida ms conocida por SIDA y su material gentico es ARN. (jun 99 B4) a) b) c) d) Menciona dos mecanismos o vas de transmisin o contagio de este virus. (0,5 puntos) Qu tipo de clulas son el blanco de este virus? (0,5 puntos) Cmo se denomina el proceso por el que el ARN del virus pasa a ADN? (0,5 puntos) Cmo se denominan los virus animales cuyo material gentico es ARN y que realicen el proceso descrito en el apartado c? (0,5 puntos) En relacin con los virus: (jun 00 A4)

262.

a) Qu es un virus y cul es su composicin? (0,5 puntos) b) Menciona las fases que comprende el ciclo ltico de un virus bacterifago. (1 punto) c) Pon un ejemplo de una enfermedad causada por un virus e indica la va de transmisin. (0,5 puntos) 263. Con relacin a los virus: (sep 01 A5)

a) Define qu es un virus y menciona sus caractersticas biolgicas ms importantes. (0,5 puntos) b) Menciona dos criterios diferentes utilizados en la clasificacin de los virus. (0,5 puntos) c) Explica las diferencias que existen entre los ciclos lisognico y ltico de un virus. (0,5 puntos) d) Cita dos enfermedades humanas causadas por virus. (0,5 puntos) 264. La microbiologa estudia un grupo muy diversos de microorganismos: (mod 02 A5)

a) Excluyendo los virus, enumera los tres reinos fundamentales en los que se clasifican los microorganismos, indicando una caracterstica relevante de cada uno de ellos. (0,75 puntos) b) Cita tres ejemplos de microorganismos pertenecientes a cada uno de los reinos mencionados en el apartado anterior. (0,75 puntos) c) Explica brevemente las principales caractersticas de los virus. (0,5 puntos) 265. Respecto a los virus: (jun 03 B5)

a) Define que es un virin e indica su composicin. (0,5 puntos) b) Haz el esquema de un bacterifago sealando sus diferentes partes. (1 punto) c) Menciona las dos formas de reproduccin de un bacterifago cul de ellas provoca la lisis de la bacteria? (0,5 puntos)

19. LOS MICROORGANISMOS. LAS BACTERIAS


266. Con ayuda de dibujos: (sep 97 A4)

a) Explica el proceso de la conjugacin en una bacteria determinada. (1 punto) b) Razona sobre la importancia biolgica de este tipo de reproduccin. (1 punto) 267. El dibujo representa un esquema simplificado de una bacteria: (mod 98 A2)

CUESTIONES DE SELECTIVIDAD 1997 2005 43

a) Nombra los 5 elementos sealados por las flechas. (1 punto) b) Menciona 5 estructuras u orgnulos celulares presentes en eucariotas y que no puedan estar presentes en una bacteria, indicando su funcin. (1 punto) 268. Algunas bacterias pueden obtener energa por quimiosntesis. (jun 98 A4)

a) Concepto de quimiosntesis. (0,5 puntos) b) Cita las fases de la quimiosntesis. (0,5 puntos) c) Pon un ejemplo de una bacteria que participe en el ciclo del nitrgeno y explica su importancia en los ciclos biogeoqumicos. (1 punto) 269. a) b) c) d) En relacin con los ribosomas: (jun 99 B2) Explica su estructura. (0,5 puntos) Explica su composicin qumica. (0,5 puntos) Explica la funcin de los ribosomas. (0,5 puntos) Indica la localizacin de los ribosomas en clulas procariotas y eucariotas. (0,5 puntos)

270. Bacterias y levaduras son microorganismos que pueden realizar fermentaciones para la obtencin de energa. (sep 99 B5) a) Seala las diferencias fundamentales de organizacin celular entre estos dos tipos de microorganismos. ( 1 punto) b) Pon un ejemplo de fermentacin realizada por bacterias e indica el balance global de la misma. (0,5 puntos) c) Pon un ejemplo de fermentacin realizada por levaduras y mencione un proceso industrial en el que tenga aplicacin. (0,5 puntos) 271. En la industria alimentaria existen procesos en los que se utilizan levaduras. (sep 00 A5)

a) Pon un ejemplo de proceso industrial relacionado con la industria alimentaria en el que se utilicen levaduras e indica cmo se denomina el proceso metablico que tiene lugar. (0,5 puntos) b) Cul es balance global del proceso metablico citado anteriormente? (0,5 puntos) c) Realiza un esquema de la organizacin celular de las levaduras. (1 punto) 272. La microbiologa estudia un grupo muy diversos de microorganismos: (mod 02 A5)

a) Excluyendo los virus, enumera los tres reinos fundamentales en los que se clasifican los microorganismos, indicando una caracterstica relevante de cada uno de ellos. (0,75 puntos) b) Cita tres ejemplos de microorganismos pertenecientes a cada uno de los reinos mencionados en el apartado anterior. (0,75 puntos) c) Explica brevemente las principales caractersticas de los virus. (0,5 puntos) 273. Con relacin a la utilizacin de los microorganismos en la industria alimentara: (jun 02 A5)

a) Menciona el microorganismo que se utiliza en la fabricacin del queso e indica otra aplicacin del mismo en la industria alimentada. (0,5 puntos) CUESTIONES DE SELECTIVIDAD 1997 2005 44

b) Indica la reaccin metablica que realiza dicho microorganismo en el proceso de elaboracin del queso, indicando los productos iniciales y finales de la reaccin. (0,75 puntos) c) Dibuja un esquema del microorganismo citado donde se aprecie su organizacin estructural. (0,75 puntos) 274. En relacin con las bacterias: (mod 04 A5)

a) Menciona dos mecanismos de transferencia de material gentico entre bacterias, indicando en qu consiste cada uno de ellos. (0,5 puntos) b) Indica las principales funciones de la pared celular bacteriana. (1 punto) c) Respecto al metabolismo bacteriano, indica el significado de los trminos quimiotrofo y aerobio facultativo. (0,5 puntos)

20. EL APROVECHAMIENTO DE LOS MICROORGANISMOS. LA BIOTECNOLOGA. INGENIERA GENTICA

275.

Fermentaciones: (mod 97 A4)

a) Define el concepto de fermentacin. (0,5 puntos) b) Indica dos diferencias esenciales entre la fermentacin y la respiracin. (0,5 puntos) c) Explica dos diferentes aplicaciones biotecnolgicas de las fermentaciones. (1 punto) 276. La aplicacin de tcnicas de gentica molecular ha permitido la mejora de calidad, duracin, etc. de algunos de los productos agrcolas que consumimos: (jun 97 B5) a) Explica con cierto detalle alguna de estas tcnicas. (1 punto) b) Consideraciones ticas y legales que deben tenerse en cuenta antes de modificar el material gentico de productos utilizados en la alimentacin humana. (1 punto) 277. Los agricultores gastan anualmente una importante cantidad de dinero en abonos nitrogenados tales como nitrato amnico y urea. (sep 97 B4) a) Explica la transformacin por bacterias del ion amonio (txico) a formas asimilables por las plantas. (1 Punto) b) Describe brevemente el ciclo del nitrgeno en la naturaleza. (1 Punto) 278. El nitrgeno es un elemento muy abundante en la atmsfera, a la vez que componente esencial de los seres vivos. Sin embargo, slo unos pocos microorganismos son capaces de fijar el N2 atmosfrico. (mod 98 A4) a) Explica un ejemplo de fijacin bacteriana del N2. (1 punto) b) Otras bacterias del suelo obtienen energa oxidando amoniaco a compuestos asimilables por las plantas. Explica el proceso. (1 punto) 279. Existen muchas sustancias de gran inters que, como los antibiticos, pueden extraerse de microorganismos. El descubrimiento de la penicilina por el Dr. A.Fleming (1928), marc un cambio radical en el tratamiento y curacin de las enfermedades producidas principalmente por bacterias. (mod 98 B4) a) Define el concepto de antibitico explicando el modo de accin de uno de ellos. (1 punto) b) Cita algunos microorganismos que intervienen en la produccin de antibiticos. (1 punto) 280. Los microorganismos pueden ser de gran utilidad para el hombre ya que intervienen en muchos procesos de inters como la produccin de antibiticos, la elaboracin de cerveza, vino, pan, productos lcteos etc. (jun 98 B4) a) Qu tipo de microorganismos participan en los procesos de elaboracin del vino y de la cerveza? (0,5 puntos) b) Qu proceso metablico se produce en la elaboracin de estos productos? (0,5 puntos) c) ,Qu tipo de microorganismos participan en la elaboracin del yogur? (0,5 puntos) CUESTIONES DE SELECTIVIDAD 1997 2005 45

d) Qu tipo de proceso metablico se da en la elaboracin del yogur? (0,5 puntos) 281. En la industria alimentaria es frecuente el uso de microorganismos: (sep 98 A4)

a) Cita los tipos de microorganismos utilizados ms frecuentemente en la produccin de alimentos (0,5 puntos) b) Explica dos procesos de la industria alimentaria basados en la actividad de microorganismos. (1 punto) c) Describe el papel de algunos microorganismos en las intoxicaciones alimentarias. (0,5 puntos) 282. En algunos organismos el cido pirvico procedente de la gluclisis sigue una ruta metablica denominada fermentacin, mediante la cual obtienen energa. (sep 98 B2) a) Seala las diferencias fundamentales entre fermentacin y respiracin celular (1 punto). b) Qu microorganismos pueden realizar fermentaciones? (0,5 puntos) c) Menciona algn producto industrial que se obtenga por fermentacin y que le resulte familiar (porque se consuma en su casa, por ejemplo) (0,5 puntos) 283. Debido a la biotecnologa la importancia de algunos microorganismos es cada da mayor: (sep 98 B4) a) Define en qu consiste la biotecnologa, relacionndola con la utilizacin de microorganismos (1 punto). b) Menciona un proceso biotecnolgico basado en la actuacin de levaduras. (0,5 puntos) c) Indica qu tipo de clulas son las levaduras. (0,5 puntos) 284. Durante la fabricacin de la cerveza se producen una serie de reacciones anaerobias: (mod 99 A4) a) Indica cmo se llama el proceso global y qu tipo de microorganismo interviene. (0,5 puntos) b) Describe, desde el punto de vista qumico, la reaccin global de este proceso y en qu parte de la clula se localiza.(1 punto) c) Cita dos ejemplos de otros procesos similares, indicando su inters industrial. (0,5 puntos) 285. a) b) c) d) 286. A menudo aparecen en la prensa noticias referentes a ingeniera gentica: (mod 99 B3) Explica en qu consiste la ingeniera gentica. (0,5 puntos) Explica qu es un plsmido.(0,5 puntos) Explica cmo actan las enzimas de restriccin (0,5 puntos) Pon un ejemplo de una aplicacin prctica de la ingeniera gentica. (0,5 puntos) Algunos microorganismos viven en simbiosis con los vegetales. (sep 99 A4)

a) Explica en qu consiste la simbiosis. (0,5 puntos) b) Menciona los tipos de microorganismos que intervienen en el ciclo del nitrgeno. (0,5 puntos) c) Explica la importancia para la agricultura de la simbiosis microorganismos-plantas en el ciclo del nitrgeno y pon un ejemplo. (1 punto) 287. Bacterias y levaduras son microorganismos que pueden realizar fermentaciones para la obtencin de energa. (sep 99 B5) a) Seala las diferencias fundamentales de organizacin celular entre estos dos tipos de microorganismos. ( 1 punto) b) Pon un ejemplo de fermentacin realizada por bacterias e indica el balance global de la misma. (0,5 puntos) c) Pon un ejemplo de fermentacin realizada por levaduras y mencione un proceso industrial en el que tenga aplicacin. (0,5 puntos) 288. Algunos microorganismos, por su capacidad para producir toxinas, pueden causar enfermedades infecciosas en los seres vivos. (mod 00 A5) CUESTIONES DE SELECTIVIDAD 1997 2005 46

a) Explica qu significa el trmino "infeccin". Cmo se denominan los microorganismos que producen enfermedades? (0,5 puntos) b) Explica qu significa el trmino "virulencia" e indica, en funcin de la misma, los distintos tipos de microorganismos. (0,5 puntos) c) Explica que significa el trmino "toxina" e indica sus tipos. (1 punto) 289. En muchos procesos relacionados con la industria alimentaria se producen fermentaciones por microorganismos. (jun 00 A5) a) Pon un ejemplo de dichos procesos y mencione el tipo de microorganismo implicado. (0,5 puntos) b) Comenta la funcin metablica que desempea el microorganismo citado e indica los productos iniciales y finales del proceso. (0,75 puntos) c) Realiza un esquema del microorganismo citado, haciendo referencia a su organizacin estructural. (0,75 puntos) 290. Algunos microorganismos y otros agentes patgenos son los responsables de numerosas enfermedades infecciosas. (jun 00 B5) a) Cita cuatro vas de transmisin de las enfermedades infecciosas y pon un ejemplo para cada una de ellas. (1 punto) b) Qu significan los siguientes trminos: epidemia, pandemia, enfermedad endmica y zoonosis? (1 punto) 291. En la industria alimentaria existen procesos en los que se utilizan levaduras. (sep 00 A5)

a) Pon un ejemplo de proceso industrial relacionado con la industria alimentaria en el que se utilicen levaduras e indica cmo se denomina el proceso metablico que tiene lugar. (0,5 puntos) b) Cul es balance global del proceso metablico citado anteriormente? (0,5 puntos) c) Realiza un esquema de la organizacin celular de las levaduras. (1 punto) 292. En relacin con los agentes infecciosos y microorganismos de inters industrial: (mod 01 A5) a) Desde un punto de vista taxonmico, menciona cuatro grupos distintos de agentes infecciosos. (1 punto) b) Pon un ejemplo de agente infeccioso y menciona la enfermedad que causa. (0,5 puntos) c) Menciona un proceso industrial en el que participe un microorganismo, sealando el grupo taxonmico al que pertenezca. (0,5 puntos) 293. Con relacin a la utilizacin de los microorganismos con fines industriales: (jun 01 A5)

a) Define el concepto de biotecnologa. (0,5 puntos) b) Menciona un microorganismo utilizado en la industria alimentaria y explica brevemente el proceso en el que participa. (0,75 puntos) c) Menciona un microorganismo utilizado en la industria farmacutica y explica brevemente el proceso en el que participa. (0,75 puntos) 294. Con relacin a la utilizacin de los microorganismos en la industria alimentara: (jun 02 A5) a) Menciona el microorganismo que se utiliza en la fabricacin del queso e indica otra aplicacin del mismo en la industria alimentada. (0,5 puntos) b) Indica la reaccin metablica que realiza dicho microorganismo en el proceso de elaboracin del queso, indicando los productos iniciales y finales de la reaccin. (0,75 puntos) c) Dibuja un esquema del microorganismo citado donde se aprecie su organizacin estructural. (0,75 puntos) 295. Relacionado con las enfermedades infecciosas: (sep 02 A5)

CUESTIONES DE SELECTIVIDAD 1997 2005 47

a) Cita un ejemplo de agente patgeno perteneciente a cada uno de los siguientes grupos: bacterias, virus, protoctistas y hongos. Indica la enfermedad que produce cada uno de ellos. (1 punto) b) Define el concepto de toxina. Enumera, los tipos de toxinas que conozca indicando sus diferencias y cita un ejemplo de enfermedad causada por un microorganismo productor de toxinas. (1 punto) 296. Con relacin a los microorganismos: (mod 03 A5)

a) Menciona las principales tcnicas de tincin utilizadas en la visualizacin y estudio de los microorganismos. (0,5 puntos) b) Explica el significado del trmino esterilizacin y menciona dos procedimientos diferentes de esterilizacin (1 punto) c) Explica el significado del trmino quimioterapia y cita un ejemplo de agente quimioteraputico. (0,5 puntos) 297. Con referencia a la moderna biotecnologa: (sep 03 A5)

a) Define los siguientes conceptos: ingeniera gentica, clula hospedadora, clonacin y vector de clonacin. (1 punto) b) Menciona cuatro aplicaciones prcticas de la ingeniera gentica y pon un ejemplo de cada una de ellas. (1 punto) 298. a) b) c) d) 299. En relacin con los microorganismos: (jun 04 A5) En qu consiste la esterilizacin? (0,5 puntos). Cite dos mtodos de esterilizacin (0,5 puntos). Cul es la finalidad de la pasteurizacin? (0,5 puntos). Indique para que sirve la tincin de Gram (0,5 puntos). En relacin con los microorganismos y sus aplicaciones: (sep 04 A5)

a) Qu son los antibiticos? (0,5puntos) b) Indique dos grupos de microorganismos capaces de fabricar antibiticos (0,5 puntos). c) Seale otras dos sustancias producidas por la industria farmacutica obtenidas mediante procesos biotecnolgicos y su utilidad mdica (1 punto). 300. En relacin con la ingeniera gentica: (mod 05 A5)

a) Qu es una molcula de ADN recombinante?, qu es un plsmido bacteriano? Explique con qu finalidad se introduce una molcula de ADN recombinante fabricada in vitro dentro de un organismo husped (por ejemplo E. coli). (0,75 puntos) b) Indique los pasos necesarios para construir in vitro una molcula de ADN recombinante. (0,5 puntos) c) Explique qu es un organismo transgnico y cite dos aplicaciones de la ingeniera gentica. (0,75 puntos) 301. Con referencia a los virus y otros agentes infecciosos: (jun 05 - A5)

CUESTIONES DE SELECTIVIDAD 1997 2005 48

a) Indique a qu tipo de ciclo corresponde el siguiente esquema y explique brevemente cada una de las fases representadas por nmeros (1 punto). b) Defina los trminos retrovirus y prin (0,5 puntos). c) Indique las diferencias entre el significado de los trminos epidemia y pandemia (0,5 puntos).

302.

En relacin con las enfermedades infecciosas: (sep 05 A5)

a) Defina los conceptos de infeccin, epidemia, pandemia y microorganismo patgeno (1 punto). b) Seale dos enfermedades infecciosas humanas, transmitidas por animales (0,5 puntos). c) Indique con qu sustancias, administradas a una persona, se puede conseguir una inmunidad activa y pasiva frente a estas enfermedades (0,5 puntos). 303. La elaboracin de ciertos productos lcteos se inicia con una primera reaccin en la que interviene un determinado tipo de microorganismos. Posteriormente se requiere que intervengan otros microorganismos hasta obtener el producto final: (mod 06 A5) a) Indique brevemente esa primera reaccin que se lleva a cabo (nombre del sustrato inicial y productos finales), y el microorganismo (que interviene en esta etapa del proceso (1 punto). b) El hongo Penicillium roquefortii es responsable del aspecto, olor y sabor de un determinado producto lcteo, sabra indicar cul es este producto y si este hongo participa antes o despus del microorganismo A en el proceso? (0,5 puntos). c) Otras especies de Penicillium se han empleado en la industria farmacutica. Indique el nombre de la primera sustancia que se obtuvo gracias a l y el nombre genrico de estos frmacos (0,5 puntos).

CUESTIONES DE SELECTIVIDAD 1997 2005 49

Inmunologa
21. LOS MECANISMOS DE DEFENSA ORGNICA INTERNA. EL SISTEMA INMUNE
304. Si como se muestra en el dibujo, los anticuerpos presentes en la membrana plasmtica de un linfocito B interaccionan por primera vez con un antgeno: (mod 97 A5)

a) Explica los cambios que ocurrirn en el linfocito B. (1 punto) b) Nombra los tipos de clulas que se encontrarn en la descendencia de este linfocito B. (1 punto) 305. Inmunidad. (mod 97 B5)

a) Qu se entiende como inmunidad? Explica la diferencia entre inmunidad natural y adquirida sealando el papel de las "vacunas". (1 punto) b) Explica la naturaleza qumica de antgenos y anticuerpos, incluyendo un esquema de una reaccin antgeno-anticuerpo. (0,5 puntos) c) Nombra las clulas implicadas en la respuesta celular y humoral. (0,5 puntos) 306. La inmunidad en general, se considera que comprende los mecanismos de defensa de un organismo frente a organismos extraos y en ella tiene gran importancia las reacciones antgeno-anticuerpo: (sep 97 B5) a) Explica qu es un anticuerpo, y dibuja la molcula de uno de ellos sealando sus partes. (1 punto) b) Explica que es un antgeno y que caractersticas tiene la reaccin antgeno-anticuerpo. (1 punto) 307. Defensa contra las infecciones virales: (mod 98 A5)

a) Explica por qu es reconocida por el sistema inmune una clula infectada por un virus. (1 punto) b) Qu tipo de linfocito reconoce a las clulas infectadas por virus y cmo acta? (1 punto) 308. El significado original de "antgeno" es generador de anticuerpos. Los antgenos son molculas que cuando penetran en el organismo son reconocidos por algunos tipos celulares: (jun 98 A5) a) Nombra los dos tipos principales de clulas sanguneas que reconocen antgenos.(0,5 puntos) b) Menciona cul de estos dos tipos celulares est implicado en la respuesta humoral.(0,5 puntos) c) Menciona cul de estos dos tipos celulares est implicado en la respuesta inmune celular. (0,5 puntos) d) Menciona cul de estos dos tipos celulares, una vez reconocido el antgeno, induce la secrecin de anticuerpos contra ese antgeno. (0,5 puntos)

CUESTIONES DE SELECTIVIDAD 1997 2005 50

309. El esquema representa una de las molculas ms importantes en la respuesta inmune. (mod 99 A5)

a) Nombra esta molcula indicando su estructura su funcin. (1 punto) b) Di qu clulas del cuerpo humano producen estas molculas, explicando de qu tipo celular proceden. (0,5 puntos) c) Explica el papel de estas molculas en las enfermedades autoinmunes. (0.5 puntos). 310. Referente a los linfocitos T: (mod 99 B5)

a) Qu tipos de linfocitos T conoces y como acta cada uno de ellos. (1 punto). b) Menciona dnde se originan y dnde maduran.(1 punto) 311. En relacin con la respuesta inmune primaria y secundaria: (sep 00 B5)

a) Cundo se origina la respuesta inmune primaria y cundo la secundaria. (0,5 puntos) b) Explica dos diferencias entre la respuesta inmune primaria y la secundaria e indica qu tipo de clulas son las responsables de las diferencias entre ambos tipos de respuestas. (0,75 puntos) c) Qu mtodo de inmunizacin artificial se basa en inducir el desarrollo de la respuesta inmune?. Explica el procedimiento de este mtodo y su finalidad. (0,75 puntos) 312. Respecto a la respuesta inmune: (mod 01 B5)

a) Define el concepto de antgeno. (0,5 puntos) b) Define el concepto de anticuerpo. (0,5 puntos) c) Menciona el tipo de clulas sanguneas que se encargan de la produccin de anticuerpos y el tipo celular del que se diferencian. (0,5 puntos) d) Nombra el tipo de enfermedades originadas al producirse anticuerpos contra estructuras del propio organismo. Pon un ejemplo de este tipo de enfermedades. (0,5 puntos) 313. Con relacin a la respuesta inmune, explica brevemente los siguientes conceptos y menciona el tipo de clula y/o molcula que participa: (sep 01 B5) a) b) c) d) 314. Inmunidad humoral. (0,5 puntos) Inmunidad celular. (0,5 puntos) Memoria inmunolgica. (0,5 puntos) Inmunidad natural pasiva. (0,5 puntos) Con relacin a las clulas que participan en la respuesta inmune: (mod 02 B5)

a) Indica el origen, tipos y funciones de los linfocitos T. (1 punto) b) Indica el origen y funcin de los linfocitos B. (0,5 puntos) c) Indica el origen y funcin de los macrfagos. (0,5 punto) CUESTIONES DE SELECTIVIDAD 1997 2005 51

315.

Referido a la respuesta inmune, explica brevemente los siguientes conceptos: (sep 02 B5)

a) Respuesta inmune. (0,5 puntos) b) Inmunidad humoral. (0,75 puntos) c) Inmunidad celular. (0,75 puntos) 316. En relacin con la respuesta inmune: (jun 03 A5)

a) Define inmunidad especfica e inespecfica. (0,5 puntos) b) Di en cul de ambos mecanismos participan: los linfocitos, el interfern, la inflamacin y los anticuerpos. (1 punto) c) Define inmunidad natural e indica su origen. (0,5 puntos) 317. Entre los procesos con que cuenta el sistema inmune para la defensa de organismo, se encuentra la inmunidad celular. (sep 03 B5) a) Define inmunidad celular y cita sus diferencias con respecto a la inmunidad humoral. (0,75 puntos) b) Cita la clula responsable de la inmunidad celular y sus dos tipos principales. (0,5 puntos) c) Cita la funcin de los TH (cooperadores), de los TC (citotxicos) y de los TS (supresores). (0,75 puntos) 318. La activacin de la defensa especfica es un proceso fundamental en la respuesta inmune. (mod 04 B5) a) Define defensa especfica. (0,5 puntos) b) Cita la clula responsable de la inmunidad humoral, en qu otra clula se diferencia y la funcin de esta ltima. (0,75 puntos) c) Describe qu tipo de molcula es un anticuerpo y dibuja un esquema rotulado del mismo, indicando dnde se produce la unin al antgeno. (0,75 puntos) 319. Con referencia al sistema inmunolgico: (sep 04 B5)

a) Defina el concepto de interfern e indique brevemente cmo lleva a cabo su accin (1 punto). b) Diga que es la hipersensibilidad (0,5 puntos). c) Defina el concepto de antgeno (0,5 puntos). 320. Con relacin a la inmunidad: (jun 05 - B5)

a) Defina respuesta inmune (0,75 puntos). b) Indique y explique los tipos de respuesta inmunitaria especfica (0,5 puntos). c) Cite tres clulas que participan en la respuesta inmune (0,75 puntos). 321. Con relacin a la respuesta inmunolgica especfica humoral: (sep 05 B5)

a) Defina el trmino memoria inmunolgica y cite la clula responsable de su existencia (1 punto). b) Defina respuesta primaria y respuesta secundara y explique dos diferencias existentes entre ellas (1 punto). 322. En relacin con las clulas implicadas en el proceso inmunolgico: (mod 06 B5)

a) Indique el lugar de maduracin de los linfocitos T y cite el tipo de inmunidad en la que intervienen (0,5 puntos). b) Cite tres tipos de linfocitos T y explique sus funciones respectivas (1,5 puntos).

22. INMUNOLOGA Y ENFERMEDAD


323. Inmunidad. (mod 97 B5) CUESTIONES DE SELECTIVIDAD 1997 2005 52

a) Qu se entiende como inmunidad? Explica la diferencia entre inmunidad natural y adquirida sealando el papel de las "vacunas". (1 punto) b) Explica la naturaleza qumica de antgenos y anticuerpos, incluyendo un esquema de una reaccin antgeno-anticuerpo. (0,5 puntos) c) Nombra las clulas implicadas en la respuesta celular y humoral. (0,5 puntos) 324. Los microorganismos, la infeccin y la inmunidad: (jun 97 A5)

a) Qu diferencia existe entre suero y vacuna? Explcala. (1 punto) b) Qu tipo de inmunidad adquieren los individuos en cada caso? (1 punto) 325. En algunos casos para defendemos de las infecciones se aplican sueros utilizando mecanismos de inmunidad artificial pasiva: (sep 97 A5) a) Qu es un suero y en qu casos debe usarse?(1 punto) b) Explica cmo se obtienen los sueros. (1 punto) 326. En algunas vacunas hay que administrar varias dosis para alcanzar una proteccin suficiente: (mod 98 B5) a) Explica lo que ocurre al administrar la 1 dosis y lo que ocurre con dosis posteriores. (1 punto) b) En qu casos se espera que la vacuna reproduzca de forma atenuada algunos sntomas de la enfermedad y en qu casos la vacuna no va a reproducir la enfermedad atenuada? (0,5 puntos). 327. En algunas vacunas hay que administrar varias dosis para alcanzar una proteccin suficiente: (jun 98 B5) a) Explica lo que ocurre al administrar la 1 dosis y lo que ocurre con dosis posteriores. (1 punto) b) En qu casos se espera que la vacuna reproduzca de forma atenuada algunos sntomas de la enfermedad? (0,5 puntos) c) En qu casos la vacuna no va a producir ningn sntoma de la enfermedad? (0,5 puntos) 328. Los transplantes de rganos han evitado la muerte segura de un gran nmero de personas: (sep 98 A5) a) Relaciona el transplante de rganos con el sistema inmune de receptor y donante. (1 punto) b) Explica por qu se suele buscar el donante entre los miembros de la familia. (0,5 puntos) c) Explica la importancia de los transplantes con algn ejemplo concreto. (0,5 puntos) 329. En algunos casos para defendemos de las infecciones se aplican sueros utilizando mecanismos de inmunidad artificial pasiva: (sep 98 B5) a) Menciona qu tipos de molculas son responsables de la inmunidad proporcionada por los sueros. (0,5 puntos) b) Nombra un ejemplo de suero que sea de utilizacin habitual. (0,5 puntos) c) En qu ocasiones deben usarse los sueros? (0,5 puntos) d) Explica cmo se obtienen los sueros. (0,5 puntos) 330. El esquema representa una de las molculas ms importantes en la respuesta inmune. (mod 99 A5)

CUESTIONES DE SELECTIVIDAD 1997 2005 53

a) Nombra esta molcula indicando su estructura su funcin. (1 punto) b) Di qu clulas del cuerpo humano producen estas molculas, explicando de qu tipo celular proceden. (0,5 puntos) c) Explica el papel de estas molculas en las enfermedades autoinmunes. (0.5 puntos). 331. La lactancia materna proporciona al beb inmunidad natural pasiva. (jun 99 A5)

a) Explica en qu consiste en este caso este tipo de inmunidad. (0,5 puntos) b) Pon otro ejemplo diferente de inmunidad natural pasiva. (0,5 puntos) c) Explica en qu consiste la inmunidad artificial pasiva y cundo debe utilizarse. (1 punto) 332. La alergia o hipersensibilidad se produce cuando un antgeno, normalmente inocuo, da lugar a una reaccin inmunolgica que puede llegar a tener graves consecuencias para el organismo. (jun 99 B5) a) Explica qu es un alrgeno y mencione un ejemplo. (0,5 puntos) b) Nombra una molcula responsable de los sntomas de la alergia o mediador alrgico. (0,5 puntos) c) Explica en qu consiste y que consecuencias puede tener el shock anafilctico. (0,5 puntos) d) Cita dos medidas para reducir los sntomas que se manifiestan en la alergia. (0,5 puntos) 333. En relacin con la respuesta inmune: (sep 99 A5)

a) Qu son las vacunas y con qu fin se utilizan? (0,5 puntos) b) En qu casos deben utilizarse las vacunas? (0,5 puntos) c) Describe cuatro tipos de antgenos utilizados en la obtencin de las vacunas. (1 punto) 334. El sistema inmunitario es responsable del rechazo que se produce en algunos casos de trasplante o injerto. (mod 00 B5) a) Menciona las molculas responsables del rechazo. (0,5 puntos) b) Explica por qu los trasplantes entre gemelos idnticos o univitelinos no provocan reacciones de rechazo. (0,5 puntos) c) Pon un ejemplo de trasplante e indica cundo se aconseja su realizacin. (0,5 puntos) d) Explica una medida para reducir el riesgo de rechazo en los trasplantes. (0,5 puntos) 335. En relacin con la respuesta inmune primaria y secundaria: (sep 00 B5)

a) Cundo se origina la respuesta inmune primaria y cundo la secundaria. (0,5 puntos) b) Explica dos diferencias entre la respuesta inmune primaria y la secundaria e indica qu tipo de clulas son las responsables de las diferencias entre ambos tipos de respuestas. (0,75 puntos) c) Qu mtodo de inmunizacin artificial se basa en inducir el desarrollo de la respuesta inmune?. Explica el procedimiento de este mtodo y su finalidad. (0,75 puntos) 336. Respecto a la respuesta inmune: (mod 01 B5)

a) Define el concepto de antgeno. (0,5 puntos) b) Define el concepto de anticuerpo. (0,5 puntos) CUESTIONES DE SELECTIVIDAD 1997 2005 54

c) Menciona el tipo de clulas sanguneas que se encargan de la produccin de anticuerpos y el tipo celular del que se diferencian. (0,5 puntos) d) Nombra el tipo de enfermedades originadas al producirse anticuerpos contra estructuras del propio organismo. Pon un ejemplo de este tipo de enfermedades. (0,5 puntos) 337. Con respecto a las alteraciones de la respuesta inmune: (jun 01 B5)

a) Explica el concepto de inmunodeficiencia. (0,5 puntos) b) Explica las diferencias que existen entre inmunodeficiencias congnitas y adquiridas. Cita un ejemplo de inmunodeficiencia. (0,75 puntos) c) Explica el concepto de enfermedad autoinmune y cita un ejemplo. (0,75 puntos) 338. Con relacin a la respuesta inmune, explica brevemente los siguientes conceptos y menciona el tipo de clula y/o molcula que participa: (sep 01 B5) a) b) c) d) 339. Inmunidad humoral. (0,5 puntos) Inmunidad celular. (0,5 puntos) Memoria inmunolgica. (0,5 puntos) Inmunidad natural pasiva. (0,5 puntos) Con respecto al trasplante de rganos: (jun 02 B5)

a) Define los conceptos de xenotrasplante e isotrasplante. (0,5 puntos) b) Explica brevemente el concepto y las causas del rechazo inmunolgico. (1 punto) c) Explica brevemente las medidas utilizadas en la prevencin del rechazo inmunolgico. (0,5 puntos) 340. En relacin con la respuesta inmune: (jun 03 A5)

a) Define inmunidad especfica e inespecfica. (0,5 puntos) b) Di en cul de ambos mecanismos participan: los linfocitos, el interfern, la inflamacin y los anticuerpos. (1 punto) c) Define inmunidad natural e indica su origen. (0,5 puntos) 341. a) b) c) d) 342. Con respecto a los tipos de inmunidad, dependiendo de la forma de adquirirla: (jun 04 B5) Defina Defina Defina Defina inmunidad inmunidad inmunidad inmunidad natural pasiva (0,5 puntos). natural activa (0,5 puntos). artificial pasiva (0,5 puntos). artificial activa (0,5 puntos).

Con referencia al sistema inmunolgico: (sep 04 B5)

a) Defina el concepto de interfern e indique brevemente cmo lleva a cabo su accin (1 punto). b) Diga que es la hipersensibilidad (0,5 puntos). c) Defina el concepto de antgeno (0,5 puntos). 343. Referido a la respuesta inmune. (mod 05 B5)

a) Diga qu es la inmunodeficiencia y mencione cuntos tipos hay. (0,5 puntos) b) Explique en qu consiste la inmunizacin pasiva y diga una ventaja y un inconveniente de la misma. (1 punto) c) Defina enfermedad autoinmune y diga un ejemplo. (0,5 puntos)

CUESTIONES DE SELECTIVIDAD 1997 2005 55