____________________________________________________________________________Biología General

TÉCNICO SUPERIOR BIOTECNOLOGÍA Y ANÁLISIS QUÍMICO-BIOLÓGICO

BIOLOGÍA GENERAL

Biól. Prof. Leticia Garcia

1

____________________________________________________________________________Biología General

A modo de introducción Programa de Biología General Unidad N° 1 Introducción

Í

NDICE
5 7 9 9 9 12 14 15 17 19 19 21 23 24 24 26 28 29 31 32 33 34 34 36 37 37

Características de los seres vivos Niveles de organización Clasificación de los seres vivos Dos tipos básicos de células: procariotas y eucariotas Actividades Unidad N° 2 El Agua El papel central del carbono Actividades Unidad N° 3 Células procariotas y eucariotas La membrana plasmática Otras estructuras externas a la membrana plasmática El núcleo Ácidos nucleicos: ADN y ARN Retículo Endoplasmático Aparato de Golgi Lisosomas Cloroplastos Mitocondrias Matriz citoplasmática y citosol Citoesqueleto

2

____________________________________________________________________________Biología General

Movimiento celular Actividades Unidad N° 4 Tipos de transporte desde y hacia la célula Actividades Unidad N° 5 Enzimas ATP Actividades Unidad N° 6 El proceso fotosintético Glucólisis y respiración celular Actividades Unidad N° 7 Ciclo celular: fases Mitosis El control de la proliferación celular y el cáncer Actividades Unidad N° 8 Meiosis Consecuencias de la meiosis Comparación entre mitosis y meiosis Actividades Unidad N° 9 Estructura del ADN Replicación del ADN Actividades Unidad N° 10 Procesos involucrados en la síntesis proteica Tipos de ARN Transcripción: copia de ARNm desde la secuencia de ADN
3

39 40 42 42 45 46 46 47 49 50 50 51 53 54 54 55 57 58 59 59 60 61 62 63 63 66 69 70 70 70 71

____________________________________________________________________________Biología General

Traducción del ARN en proteína Actividades Unidad N° 11 Introducción a la Microbiología Bacterias Levaduras Fermentación Usos de los microorganismos Actividades Bibliografía Bibliografía consultada Bibliografía recomendada

71 76 78 78 78 81 82 83 84 86 86 86

4

____________________________________________________________________________Biología General

B
Técnico/a Superior

IOLOGÍA GENERAL

A MODO DE INTRODUCCIÓN
Le presentamos aquí su material de estudio para Biología General. Desde esta asignatura, se pretende que usted logre una aproximación a muchos conocimientos biológicos que constituyen herramientas básicas para el futuro en Biotecnología y Análisis Químico Biológico. Le

recomendamos que lo tenga siempre a mano porque le servirá para la consulta permanente durante toda su Carrera.

Nuestros objetivos generales son:
Reconocer las características fundamentales de los seres vivos. Establecer relaciones integradoras entre estructura y función. Adquirir los conceptos necesarios para facilitar el estudio ulterior de los microorganismos y su rol biotecnológico. Emplear correctamente la terminología básica de la Biología en su expresión gráfica, oral y escrita, para facilitar la comunicación del educando con sus pares de áreas relacionadas. Adquirir entrenamiento para obtener información bibliográfica sobre temas biológicos.

Los contenidos generales de esta materia son:
1. Características diferenciales de los seres vivos. 2. La célula. 3. ADN, ARN, organización 4. Crecimiento y división celular 5. Introducción a la microbiología
5

____________________________________________________________________________Biología General

¿Cómo está organizada la materia?
El programa está dividido en 11 unidades, y en cada una de ellas Ud. encontrará textos, esquemas y fotografías ilustrativas para la mejor comprensión de los temas.

Además, hemos incorporado una sección de Actividades que tienen como objetivo reafirmar los conceptos nuevos aprendidos, relacionarlos entre sí y con conceptos anteriores.

La docente estará a su disposición durante las clases de consulta, las cuales servirán para aclarar cualquier tipo de duda que usted tenga. El día y horario serán convenidos entre todos los alumnos el primer día de clases.

Además, en los encuentros tutoriales mensuales, luego de aclarar cualquier duda que pudiera haber, se realizará una evaluación referida a las actividades que se hayan realizado durante el mes.

6

____________________________________________________________________________Biología General

P
Ácidos nucleicos.

ROGRAMA DE BIOLOGÍA GENERAL

Unidad Nº 1: Introducción Características diferenciales de los seres vivos. Clasificación de los seres vivos. Niveles de organización. Unidad Nº 2: Las moléculas de los seres vivos El agua. El papel central del carbono. Biomoléculas: Glúcidos. Lípidos. Proteínas. Unidad Nº 3: La célula: estructura y función Células procariotas y eucariotas. Membranas. El núcleo. El citoplasma. Orgánulos celulares. Citoesqueleto. Movimiento celular. Unidad Nº 4: Transporte de moléculas Movimiento de agua y solutos. Difusión. Ósmosis. Difusión facilitada. Transporte activo. Proteínas de transporte. Transporte mediado por vesículas. Unidad Nº 5: Flujo de energía Enzimas: estructura y función. Cofactores y coenzimas. El ATP. Unidad Nº 6: Fotosíntesis y Respiración celular Etapas de la fotosíntesis. Reacciones de captura de energía. Reacciones de fijación de carbono. Productos de la fotosíntesis. Glucólisis. Ciclo de Krebs. Transporte terminal de electrones. Rendimiento energético. Unidad Nº 7: Reproducción celular El ciclo celular. Mitosis. Citocinesis. Proliferación celular y cáncer. Unidad Nº 8: Meiosis y reproducción sexual Reproducción sexual: fecundación y meiosis. Etapas de la meiosis. Consecuencias de la reproducción sexual. Unidad Nº 9. La base química de la herencia

7

____________________________________________________________________________Biología General

Estructura química del DNA. La doble hélice. Replicación del DNA. Mecanismo de la replicación. Unidad Nº 10. El código genético y su traducción Genes y proteínas. Los RNAs: tipos, función y síntesis. El código genético. Mecanismo de síntesis de proteínas. Unidad Nº 11. Introducción a la Microbiología Bacterias: nutrición y reproducción. Levaduras. Fermentación. Usos de los microorganismos: energética. industria farmacéutica, industria alimentaria, producción

8

____________________________________________________________________________Biología General

U
interrogantes de la vida.

NIDAD N° 1

INTRODUCCIÓN
La Biología es una ciencia muy antigua. Desde hace muchos siglos, los hombres empezaron a estudiar los seres vivos en un intento por resolver los enigmas e

La Biología es la ciencia de la vida ya que estudia las formas que adoptan los seres vivos, su estructura, función, crecimiento, evolución, interrelaciones, etc. Es, actualmente, una ciencia tan amplia y abarca tantos temas que los biólogos han debido especializarse en alguna de las ciencias biológicas: zoología, botánica, anatomía, fisiología, embriología, histología, genética, taxonomía, ecología, etc.

CARACTERÍSTICAS DE LOS SERES VIVOS ¿Cómo podemos saber si “algo” es un ser vivo o es materia inerte? En principio es fácil determinar que una persona, una mosca, los palos borrachos y los caracoles son seres vivos, mientras que el aire y las piedras no lo son. Encontrar una definición de vida parece sencillo pero no lo es tanto. Se hace necesario, entonces, hacer un recuento de las características que comparten todos los seres vivos, a fin de establecer criterios que nos permitan distinguir entre la materia viva y la inerte. Los organismos vivos presentan una serie de atributos o características particulares que los describen. Las más importantes son: Metabolismo: En todos los seres vivos ocurren reacciones químicas que son esenciales para la nutrición, el crecimiento, la reproducción y el

mantenimiento de la vida en general. La suma de todas estas actividades

9

____________________________________________________________________________Biología General

recibe el nombre de metabolismo. Se dice que un organismo ha muerto cuando su metabolismo se ha detenido definitivamente. Organización específica: Los seres vivos no son homogéneos, sino que están integrados por diferentes partes, cada una de ellas con funciones especiales. Si bien los organismos varían enormemente en tamaño y apariencia todos están formados por unidades básicas denominadas células. Homeostasis: Los procesos metabólicos deben ser cuidadosa y

constantemente regulados para mantener un estado de equilibrio. El conjunto de mecanismos altamente eficientes y sensibles por los que las células mantienen su equilibrio interno recibe el nombre de homeostasis. La regulación de la temperatura corporal en el ser humano es un buen ejemplo de cómo operan estos mecanismos homeostáticos. Si la temperatura aumenta más allá de los 37 ºC (la temperatura normal), unas células especializadas detectan esta diferencia y envían a las glándulas sudoríparas la orden de aumentar la secreción de sudor. La evaporación del sudor humedece la piel, y favorece la pérdida de calor por intercambio con el ambiente. De la misma manera, cuando la temperatura corporal desciende con respecto a la normal se desencadenan procesos como los escalofríos que son rápidas contracciones musculares que producen calor y ayudan al organismo a recuperar su temperatura perdida. Crecimiento: El crecimiento puede definirse como el aumento de la cantidad de materia viva de un organismo, que da como resultado un incremento en el número y/o en el tamaño de las células que lo componen. Movimiento: Es otra característica de los seres vivos, pero es necesario distinguir entre movimiento y locomoción (que es el desplazamiento de un lugar a otro). El movimiento de casi todos los animales es muy obvio, pero en el caso de las plantas resulta casi imperceptible, aunque sin lugar a dudas existe. Irritabilidad: Los seres vivos son capaces de detectar estímulos y responder a ellos. Los estímulos son cambios físicos o químicos (temperatura, presión,
10

____________________________________________________________________________Biología General

composición química, sonido, luz, etc.) en el medio externo o interno. La respuesta que efectúan los seres vivos se denomina reacción o respuesta. En los animales complejos como el ser humano, algunas células del cuerpo están muy especializadas para reaccionar a ciertos tipos de estímulos, así, por ejemplo, las células de la piel detectan cambios de temperatura exterior, presión, etc. Reproducción: Ésta es, quizás, la característica que puede considerarse esencial de los seres vivientes: toda forma de vida proviene de otra forma de vida parecida que le dio origen. La reproducción puede ser asexual o sexual. La reproducción asexual (o sea, sin contacto sexual entre distintos individuos) ocurre en organismos simples como los protozoos y las bacterias que se dividen por fisión simple (se dividen en dos); las levaduras que lo hacen por gemación (producción de gemas); algunas plantas que pueden emitir estolones, yemas, gajos, etc., e incluso algunos animales. La reproducción sexual ocurre por unión de células especializadas llamadas gametos (en el ser humano son los óvulos de las mujeres y los espermatozoides de los varones) que dan lugar a un huevo o cigoto que se desarrollará desde ese momento como un nuevo ser. Cuando la reproducción es asexual los descendientes son iguales al organismo que les dio origen porque contienen exactamente la misma información genética, pero cuando la reproducción se realiza por vía sexual, cada individuo “hijo” es una combinación de las características genéticas de sus “padres”. Esta variabilidad es clave para analizar y entender los procesos de adaptación y evolución que se tratarán más adelante. Nutrición: Todos los seres vivos necesitan incorporar materiales desde el medio externo a fin de poder realizar todas sus funciones vitales. Este proceso se denomina alimentación o nutrición. Según su forma de alimentarse, los organismos se clasifican en dos grupos: Ι Los AUTÓTROFOS pueden producir su propio alimento a partir de materia inorgánica utilizando energía solar, a través de un proceso

11

____________________________________________________________________________Biología General

llamado FOTOSÍNTESIS (se explicará más adelante). En este grupo encontramos a las bacterias fotosintetizadoras, las algas y las plantas. Ι Los HETERÓTROFOS obtienen su alimento y la energía que necesitan de la materia orgánica de otro organismo. Son heterótrofas las bacterias en general, los protozoos, los hongos y los animales (ver más adelante).

NIVELES DE ORGANIZACIÓN La materia se encuentra organizada en diferentes estructuras, desde las más pequeñas hasta las más grandes, desde las más complejas hasta las más simples. Esta organización determina niveles que facilitan la comprensión del objeto de estudio de la Biología. Cada nivel de organización incluye a los niveles inferiores y constituye, a su vez, los niveles superiores. Y lo que es más importante, cada nivel se caracteriza por poseer propiedades que emergen en ese nivel y no existen en el anterior: las propiedades emergentes. Así, una molécula de agua tiene propiedades diferentes de la suma de las propiedades de sus átomos constitutivos -hidrógeno y oxígeno-. De la misma manera, una célula cualquiera tiene propiedades diferentes de las de sus moléculas constitutivas, y un organismo multicelular dado tiene propiedades nuevas y diferentes de las de sus células constitutivas. En la Tabla I-1 se describen brevemente las características de los distintos niveles de organización de la naturaleza.
Tabla I-1. Niveles de organización de los seres vivos y sus componentes. Elementos que Ciencia que Nivel Características lo forman lo estudia Físico-químico Átomos y moléculas Es el nivel más simple. Los átomos forman moléculas. Las moléculas son las partículas más pequeñas en que puede dividirse la materia sin perder Química, Física y otras

Ejemplos Proteínas, azúcares, hierro, oxígeno

12

____________________________________________________________________________Biología General Elementos que lo forman Ciencia que lo estudia

Nivel

Características ni modificar ninguna de sus propiedades intrínsecas

Ejemplos

Subcelular

Orgánulos

Está formado por las organelas subcelulares

Biología celular

Núcleo, aparato de Golgi, membrana plasmática

Celular

Células

Formado por las células, unidades estructurales de la vida. Todas las células tienen un plan organizativo común. Pueden formar individuos unicelulares o reunirse y dar origen a los organismos multicelulares

Biología celular,

Bacterias, levaduras,

Microbiología protozoarios

Tisular

Tejidos (epitelial, conectivo, nervioso, muscular, etc.)

Las células se agrupan de acuerdo a sus caracteres de forma y estructura, de actividad funcional y de estado fisicoquímico para formar los tejidos

Histología

Conectivo, epitelial, nervioso

De órganos, aparatos y sistemas

Órganos, aparatos y sistemas

Los tejidos se organizan formando estructuras funcionales que son los órganos. Los órganos se reúnen coordinadamente en aparatos (formados por distintos tipos de tejidos) y sistemas (formados principalmente por un solo tipo de tejido) para cumplir las diferentes funciones biológicas

Anatomía

Estómago, corazón, ojos, sistema circulatorio, aparato excretor, etc.

De organismos pluricelulares

Individuos

Los organismos pluricelulares

Zoología, Botánica, Medicina, y muchas más

Hombre, ombú, canarios, champignon, etc.

pluricelulares de están constituidos por un todas las especies conjunto funcionalmente armónico y coordinado de

13

____________________________________________________________________________Biología General Elementos que lo forman Ciencia que lo estudia

Nivel

Características aparatos y sistemas

Ejemplos

Poblacional

Individuos de una especie

Los individuos no viven aislados sino q se relacionan con otros individuos y con su medio. Los individuos de una misma especie que habitan un lugar en un momento determinado constituyen

Ecología

Enjambre de abejas, hormiguero

De comunidad

Poblaciones de un ambiente determinado

Una comunidad está formada por todas las poblaciones de una especie o de especies distintas que comparten un ambiente común e interaccionan entre sí

Ecología

Maíz, plagas del maíz, pájaros que comen insectos, aves de rapiña, etc.

Ecosistema

Comunidad y ambiente físico

Se denomina ecosistema al conjunto de seres vivios y el espacio físico donde habitan y se relacionan intercambiando materia y energía

Ecología

Laguna Mar Chiquita

Biosfera

Todas las especies de la Tierra y su ambiente

Se considera a la biosfera como un gran ecosistema donde conviven alrededor de cinco millones de especies

Ecología

CLASIFICACIÓN DE LOS SERES VIVOS El tema central de la Biología es el estudio de la vida, por lo que resulta imprescindible estudiarla dentro de un sistema de clasificación que nos permita ordenar las miles de formas en que la vida se presenta. Dado que la unidad fundamental de los seres vivos es la célula, en esta sección iniciaremos un recorrido por los principales grupos de organismos teniendo en cuenta, justamente, sus características celulares.

14

____________________________________________________________________________Biología General

Si bien existen varios sistemas de clasificación para los seres vivos. En la actualidad el más aceptado es el que ordena o agrupa a los organismos en cinco categorías generales denominadas reinos. Reino Monera (bacterias y algas verdeazuladas) Reino Protista (protozoos, algas simples) Reino Fungi (hongos y mohos) Reino Plantae (musgos, helechos y plantas con flores, algas complejas) Reino Animalia (invertebrados y vertebrados) DOS TIPOS BÁSICOS DE CÉLULAS: PROCARIOTAS Y EUCARIOTAS Los organismos más sencillos que viven actualmente corresponden al reino Monera. Son las bacterias y las cianobacterias (las cianobacterias son capaces de realizar fotosíntesis), constituidas por células procariotas. De acuerdo con el registro fósil, los organismos vivos más primitivos fueron células comparativamente simples que se parecían a los procariotas actuales. Todos los demás reinos (Protista, Fungi, Plantae y Animalia) agrupan a los organismos que están formados por células eucariotas y son evolutivamente más recientes que las procarióticas. Todos los miembros del reino Protista son organismos eucariotas unicelulares que algunas veces se agrupan formando colonias simples, pero sin llegar a constituir verdaderos tejidos. Son muy comunes en lagunas y otros ambientes acuáticos. Existen dos grupos principales de protistas: los protozoos, similares a animales (por ejemplo, los paramecios como el de la foto y las amebas) y los de tipo vegetal, que son capaces de realizar fotosíntesis, llamados comúnmente algas simples. El reino Fungi agrupa a todos los hongos. Estos organismos antiguamente estaban incluidos en el reino de las plantas ya que no poseen movimiento aparente y sus células tienen una estructura típicamente vegetal, denominada pared celular, sin embrago, a diferencia de las plantas, los hongos no poseen clorofila y por lo tanto son incapaces de realizar fotosíntesis. Desde el punto de vista nutricional son más parecidos a los animales porque se alimentan de otros seres vivos (son heterótrofos), y cumplen una importante función ecológica: la de descomponer los restos de los

15

____________________________________________________________________________Biología General

organismos muertos (de esta forma reciclan los nutrientes dentro del ecosistema). En este grupo de los hongos incluimos los mohos (por ejemplo los que crecen sobre el pan, los que se usan para la fabricación del queso roquefort, etc.), y los hongos verdaderos (las levaduras utilizadas para fabricar cerveza, los hongos del pino, los champiñones, etc.). En el reino Plantae encontramos a las plantas, que son organismos formados por muchas células (pluricelulares). Se alimentan mediante el proceso llamado fotosíntesis, que se realiza en cada célula, en organelas muy especializadas llamadas cloroplastos. Las células vegetales, además, están rodeadas por una cubierta rígida llamada pared celular constituida básicamente por celulosa, el material con que se fabrica el papel. Los principales grupos de plantas son los musgos y helechos (que no poseen flores) y las plantas con flores, que son las más abundantes, como las araucarias, los geranios, el trigo, las orquídeas, etc. Por último, el reino de los animales abarca a todos los organismos multicelulares cuyas células no poseen pared celular ni cloroplastos, es decir que no pueden realizar fotosíntesis, y por lo tanto, están obligados a alimentarse de otros seres vivos. Los animales complejos tienen un alto grado de especialización en sus tejidos y su cuerpo está muy organizado: poseen órganos sensoriales complejos, sistemas nerviosos y musculares, tienen la capacidad de moverse, etc. Los animales más simples son las esponjas y los corales. En el reino Animalia también están incluidos los moluscos (caracoles, pulpos, y almejas), las lombrices, los artrópodos (insectos, arácnidos, y ciempiés), y los vertebrados (peces, anfibios, reptiles, aves y mamíferos).

16

____________________________________________________________________________Biología General

ACTIVIDADES
1. Complete la siguiente tabla: Nivel de organización Célula Descripción

Grupo de tejidos organizados en estructuras funcionales. Partícula más pequeña de un elemento que aún conserva las propiedades de éste. Tejido

Molécula

Estructuras especializadas en el interior de las células.

2. A continuación te presentamos una lista de datos que sirven para describir los cinco reinos en que clasificamos a los seres vivos. Anota al lado de cada Reino las letras de las frases que le correspondan. Se puede usar cada frase todas las veces que la necesite. Reino Monera: _ _ _ _ _ _ _ _ _ _ Reino Protista: _ _ _ _ _ _ _ _ _ _ Reino Fungi: _ _ _ _ _ _ _ _ _ _ _ Reino Plantae: _ _ _ _ _ _ _ _ _ _ Reino Animalia: _ _ _ _ _ _ _ _ _ a. b. c. d. e. f. Degradan la materia orgánica de los ecosistemas Algunos son heterótrofos y otros autótrofos No poseen clorofila Células procarióticas Poseen células con núcleo verdadero (eucariotas) Son el grupo más primitivo en la evolución

17

____________________________________________________________________________Biología General

g. h. i. j. k.

Sus células no poseen cloroplastos Poseen ADN (material genético) Todos son heterótrofos Sus células poseen cloroplastos Son unicelulares a veces parásitos y otros de vida libre

3. Una población está formada por un conjunto de individuos (marca la opción correcta): que se reproducen y dejan descendencia fértil. de distintas especies que viven en un lugar y en un tiempo en común. que tienen la capacidad de reproducirse y dejan descendencia fértil y coexisten en un mismo espacio. de la misma o de distinta especie que viven en un lugar común.

18

____________________________________________________________________________Biología General

U
EL AGUA

NIDAD N° 2

LAS MOLÉCULAS DE LOS SERES VIVOS

El agua es el líquido más común de la superficie terrestre. La molécula de agua es polar, es decir, con dos zonas débilmente negativas y dos zonas débilmente positivas; en consecuencia, entre sus moléculas se forman enlaces débiles. Estos enlaces, en los que se une un átomo de hidrógeno con carga positiva débil que forma parte de una molécula, con un átomo de oxígeno que posee carga negativa débil y que pertenece a otra molécula, se conocen como puentes de hidrógeno. Cada molécula de agua puede formar puentes de hidrógeno con otras cuatro moléculas de agua (Figura II-1). Aunque los enlaces individuales son débiles y se rompen continuamente, la fuerza total de los enlaces que mantienen a las moléculas juntas es muy grande. Dentro de los sistemas vivos, muchas sustancias se encuentran en solución acuosa. Una solución es una mezcla uniforme de moléculas de dos o más sustancias. La sustancia presente en mayor cantidad, que es habitualmente líquida, se llama solvente, y las sustancias presentes en cantidades menores se llaman solutos. La polaridad de las moléculas de agua es la responsable de la capacidad solvente del agua. Muchas de las moléculas importantes en los sistemas vivos, como los azúcares, tienen regiones de carga parcial positiva o negativa. Estas moléculas, por lo tanto, atraen moléculas de agua y se disuelven en agua. Las moléculas polares que se disuelven rápidamente en agua son llamadas hidrofílicas ("que aman al agua''). Estas moléculas se disuelven fácilmente en agua porque sus regiones parcialmente cargadas atraen moléculas de agua tanto o más que lo que se atraen entre sí. Las

19

____________________________________________________________________________Biología General

moléculas polares de agua compiten de este modo con la atracción existente entre las moléculas de soluto. Moléculas tales como las grasas, que carecen de regiones polares, tienden a ser muy insolubles en el agua. Los puentes de hidrógeno entre las moléculas de agua actúan como una fuerza que excluye a las moléculas no polares. Como resultado de esta exclusión, las moléculas no polares tienden a agruparse en el agua, al igual que las gotitas de grasa tienden a juntarse, por ejemplo, en la superficie del caldo de gallina. Dichas moléculas son llamadas hidrofóbicas ("que tienen aversión por el agua") y los agrupamientos se producen por interacciones hidrofóbicas.

Figura II-1. Modelo que representa la formación de puentes de hidrógeno entre moléculas de agua.

20

____________________________________________________________________________Biología General

EL PAPEL CENTRAL DEL CARBONO Un átomo de carbono puede formar cuatro enlaces covalentes con cuatro átomos diferentes como máximo. En términos del papel biológico del carbono, es de gran importancia el hecho de que pueda combinarse con otros átomos de carbono y con átomos distintos para formar una gran variedad de cadenas fuertes y estables y de compuestos con forma de anillo. Las moléculas orgánicas derivan sus configuraciones tridimensionales primordialmente de sus esqueletos de carbono. Sin embargo, muchas de sus propiedades específicas dependen de grupos funcionales. Una característica general de todos los compuestos orgánicos es que liberan energía cuando se oxidan. Entre los tipos principales de moléculas orgánicas importantes en los sistemas vivos están los carbohidratos, los lípidos, las proteínas y los ácidos nucleicos.

CARBOHIDRATOS Son compuestos ternarios (C, H y O) mucho más numerosos en vegetales que en animales. Son ejemplos de glúcidos, la glucosa, la ribosa, el almidón, la celulosa. Son materiales energéticos fácilmente aprovechables por las células. Combinados con otros compuestos forman parte de las membranas, de los ácidos nucleicos, etc. LÍPIDOS Son compuestos ternarios (C, H y O). Pueden ser simples (grasas neutras, triglicéridos), esteroides (vitamina D, colesterol) o conjugados (fosfolípidos, glucolípidos). Cumplen diversas funciones: energéticas, estructurales,

mecánicas, de transporte, etc.

PROTEÍNAS

21

____________________________________________________________________________Biología General

Son compuestos cuaternarios (C, H, O y N). Son moléculas gigantes formadas por aminoácidos. Las proteínas se encuentran en casi todas las estructuras celulares. Funcionan como sostén y protección de las células (colágeno), como enzimas acelerando las reacciones bioquímicas en los seres vivos (amilasa), como encargadas del transporte de diferentes sustancias (hemoglobina), como hormonas (insulina), como parte del sistema de defensa de los organismos (inmunoglobulinas), etc.

ÁCIDOS NUCLEICOS ARN y ADN. Son moléculas grandes y complejas que contienen C, H, O, N y P. Son polímeros de moléculas más pequeñas denominadas nucleótidos. El ADN contiene la información genética que dirige la síntesis de proteínas, proceso en el cual participan distintos tipos de ARN.

22

____________________________________________________________________________Biología General

ACTIVIDADES
1. ¿Cuál es la importancia biológica de las proteínas, los carbohidratos, los lípidos y los ácidos nucleicos? Ejemplifique.

2. Las plantas habitualmente almacenan reservas energéticas en forma de polisacáridos, mientras que en la mayoría de los animales los lípidos son la forma principal de almacenamiento de energía. ¿Por qué es ventajoso para los animales tener su reserva de energía almacenada como lípidos y no como polisacáridos? ¿Qué tipos de materiales de almacenamiento esperaría encontrar en las semillas?

23

____________________________________________________________________________Biología General

U

NIDAD N° 3

LA CÉLULA: ESTRUCTURA Y FUNCIÓN
La Biología Celular es la rama de la Biología que tiene como objeto de estudio la célula: su estructura, su funcionamiento, sus adaptaciones, sus mecanismos de reproducción, su interacción con otras células para formar tejidos y órganos, etc. La célula es la unidad estructural y funcional fundamental de los seres vivos capaz de crecer, nutrirse y reproducirse. Todas las células comparten dos características esenciales. La primera es una membrana externa, la membrana celular -o membrana plasmática- que separa el citoplasma de la célula de su ambiente externo. La otra es el material genético -la información hereditaria- que dirige las actividades de una célula y le permite reproducirse y transmitir sus características a la progenie. A continuación, distinguiremos dos tipos de células, las procariotas y las eucariotas.

CÉLULAS PROCARIOTAS Y CÉLULAS EUCARIOTAS Los organismos más sencillos que viven actualmente corresponden al Reino de los Procariontes o Monera. Son las bacterias y las cianófitas, cianobacterias o algas verde-azuladas (capaces de realizar fotosíntesis) (Figura III-1). En vez de presentar un núcleo rodeado por una membrana nuclear, las células procariotas tienen una región nuclear en la que hay una única molécula de ADN. El cromosoma de los procariontes suele ser circular en lugar de tener forma de bastón como los de las células eucarióticas.
24

____________________________________________________________________________Biología General

Figura III-1. Esquema de una célula procariótica, en este caso una bacteria, en la cual se señalan las principales estructuras subcelulares.

De acuerdo con el registro fósil, los organismos vivos más primitivos fueron células comparativamente simples que se parecían a los procariontes actuales. Las células eucariotas tienen una organización subcelular mucho más compleja, con un sistema de membranas internas que delimitan orgánulos, como por ejemplo el núcleo (Figura III-2). Son eucariotas todas las células de los organismos que pertenecen a los demás reinos: Protistas, Fungi, Plantae y Animalia. Se considera que las células eucarióticas son evolutivamente más nuevas que las procarióticas. A pesar de las diferencias entre organismos procariotas y eucariotas, hay semejanzas importantes en su organización molecular y en su función. Por ejemplo, todos los organismos vivientes utilizan el mismo código genético y una maquinaria similar para la síntesis de proteínas.

25

____________________________________________________________________________Biología General

Figura III-2. Ejemplo de célula eucariótica: célula animal. Están representados los principales orgánulos y estructuras que la forman.

LA MEMBRANA PLASMÁTICA La membrana celular (o membrana plasmática) es el límite exterior de las todas células. Mide de 7 a 10 nm de espesor, y cuando se la observa con el microscopio electrónico se puede ver como una línea doble, fina e ininterrumpida. La membrana celular y también la otras membranas son películas delgadas formadas por una bicapa lipídica continua, conocida con el nombre de mosaico fluido (Figura III-3). Se trata de una doble capa constituida básicamente por moléculas de fosfolípidos y colesterol dispuestas con sus colas hidrófobas (que repelen el agua) hacia el interior de la membrana, y sus cabezas hidrofílicas (que tienen afinidad por los medios acuosos) orientadas hacia el citoplasma por un lado y hacia en medio exterior por el otro. Algunos de estos fosfolípidos están unidos a carbohidratos y forman los glucolípidos. Existen, además, distintos tipos de proteínas incluidas en la bicapa cumpliendo funciones estructurales, pero también actúan como traslocadores o canales para el

26

____________________________________________________________________________Biología General

transporte. Pueden tener también propiedades de regulación o reconocimiento. Algunas son enzimas, antígenos y diversos tipos de moléculas receptoras. Estas proteínas de membrana se clasifican en:

• Intrínsecas o integrales representan más del 70 % sobre el total de las
proteínas. Atraviesan las dos capas y pueden sobresalir hacia uno u otro lado o hacia ambos. Algunas de estas proteínas pueden estar unidas a cadenas cortas de carbohidratos formando las glucoproteínas. Por estar más fuertemente unidas a la estructura de la membrana para extraerlas se deben emplear métodos drásticos, con detergentes o solventes orgánicos.

• Periféricas o extrínsecas: están asociadas a las regiones polares de los
lípidos. Pueden ser separadas usando procedimientos suaves con soluciones acuosas.

Figura III-3. Esquema de una sección de membrana plasmática según el modelo de mosaico fluido. Se pueden observar los distintos tipos de proteínas, las moléculas de colesterol, y los fosfolípidos de la estructura básica.

27

____________________________________________________________________________Biología General

Las dos caras de la membrana difieren en cuanto a su composición, es decir que la membrana es asimétrica. Dentro de cada hemicapa los lípidos tienen cierta libertad de movimiento transversal. Tanto las glucoproteínas como los glucolípidos se encuentran en la capa externa. En relación con sus funciones, la membrana plasmática:

• Regula el pasaje de materiales hacia y desde la célula. • Participa en el reconocimiento y la adhesión intercelulares. • Se adapta a todos los cambios de forma y tamaño de la célula. • Es el soporte de muchísimas reacciones químicas. • Es el componente principal de las vesículas que se forman durante los
procesos de endocitosis y exocitosis.

OTRAS ESTRUCTURAS EXTERNAS A LA MEMBRANA PLASMÁTICA Además de la membrana celular, las células de las plantas, las algas, los hongos y las bacterias están rodeadas por una gruesa pared celular. Esta pared celular está formada principalmente por fibras de celulósicas en las que pueden estar incorporadas otras sustancias tales como la lignina (el componente principal de la madera) y las pectinas (que se utilizan para la fabricación de jaleas y mermeladas). Su función es envolver, proteger y dar rigidez a los contenidos de la mayoría de las células vegetales y algunas bacterias. Las células animales, en cambio, tienen por fuera de sus membranas plasmáticas una delgada cubierta celular llamada glucocáliz. Sus principales componentes son las cadenas de oligosacáridos de las glucoproteínas y glucolípidos de la membrana plasmática, los cuales crean un microambiente que da protección a la célula. El glucocáliz está involucrado en la cohesión intercelular y en el reconocimiento molecular ya que las cadenas glucídicas actúan como antígenos. En el tejido conectivo y en otros tejidos derivados de él, las células están rodeadas por una considerable cantidad de matriz extracelular o sustancia extracelular. Dicha matriz está compuesta esencialmente por proteínas fibrosas como el colágeno, la elastina y la fibronectina, y por una sustancia gelatinosa formada por
28

____________________________________________________________________________Biología General

proteoglicanos. En algunos tejidos, como el tejido óseo, el esmalte y la dentina de los dientes, la matriz está mineralizada.

EL NÚCLEO
El orgánulo más conspicuo en casi todas las células animales y vegetales es el núcleo. Es una estructura limitada que contiene componentes específicos relacionados con la actividad e intercambio de sustancias con el resto de la célula. El núcleo se encuentra separado del resto de la célula por medio de una envoltura nuclear que está perforada. A través de estos poros se realizan los intercambios de materiales desde y hacia el citoplasma celular.

Figura III-4. Fotografía del núcleo de una célula. El núcleo es una estructura discreta que contiene los cromosomas. La membrana nuclear está perforada por poros que permiten el intercambio de material celular entre nucleoplasma y citoplasma.

Dentro del núcleo encontramos:

• Nucleoplasma: es la parte soluble del núcleo. Posee mayor densidad que
el citoplasma. En él encontramos la cromatina y compuestos solubles (proteínas, enzimas, iones, etc.).

• Nucléolo: es un corpúsculo de presencia constante en casi todas las células
eucariotas animales y vegetales. En el nucléolo se forman las subunidades de los ribosomas. Suele haber de uno a cuatro por célula.
29

____________________________________________________________________________Biología General

• Cromatina: es un conjunto de sustancias químicas que constituyen una
estructura nuclear constante de todas las células. Contiene 30 % de ADN, 10 % de ARN y 60 % de proteínas. Allí ocurre la síntesis de los ARN o transcripción. Se distinguen dos formas o tipos de cromatina: la eucromatina comprende regiones de cromatina no condensada que puede tener actividad génica. Y la heterocromatina que abarca regiones que están más condensadas. Es genéticamente inactiva. En la etapa de división celular la cromatina se compacta arrollándose sobre sí misma y se organiza en forma de cromosomas (Figura III-5).

Figura III-5. Ejemplo de un ácido nucleico: el ADN y su empaquetamiento en un cromosoma en metafase

30

____________________________________________________________________________Biología General

ÁCIDOS NUCLEICOS: ADN Y ARN
Los ácidos nucleicos son moléculas complejas muy grandes compuestas por C, H, O, N y P. El ADN es el principal reservorio de la información genética de las células y se encuentra fundamentalmente en el núcleo de las células eucariotas forma el cromosoma de las células procariotas. Las principales características de los ácidos nucleicos están sintetizadas en la Tabla III-1.

Tabla III-1. Comparación entre ADN y ARN

ADN ARN Localización Núcleo (cromosomas) 99 % Núcleo (especialmente Citoplasma (plástidos y mitocondrias) 1 % en el nucléolo Citoplasma (en los ribosomas y libre en el citosol) Tipos ADN cromosómico ARN mensajero ARN de transferencia ARN ribosómico Composición Macromolécula, polinucleótido con Macromolécula, química estructura típica de doble hélice polinucleótido de cadena simple Unidad Nucleótido formado por: un azúcar Igual, pero el azúcar es estructural (desoxirribosa), una base nitrogenada (hay la ribosa y en vez de cuatro diferentes: adenina, guanina, timina tiene uracilo citosina y timina) y un grupo fosfato. Los nucleótidos están unidos por medio de puentes fosfodiéster que unen el C3 de la pentosa de un nucleótido con el C5 de la pentosa del nucleótido adyacente Origen Por autoduplicación A partir del ADN (transcripción) Función Información genética. Síntesis de proteínas Control de las funciones celulares (traducción)

31

____________________________________________________________________________Biología General

Figura III-6. Esquema que representa la típica estructura de doble hélice de una molécula de ADN.

RETÍCULO ENDOPLASMÁTICO El retículo endoplasmático es una red de sacos aplanados, túbulos y conductos intercomunicantes que existe en las células eucarióticas. Contribuye junto con el citoesqueleto a dar sostén a la célula. El retículo endoplasmático funciona, además, como un sistema de transporte de diversas sustancias químicas entre una parte y otra de la célula, e incluso hacia el exterior gracias a la enorme fluidez de sus membranas. Se pueden distinguir dos tipos de retículo:

• El retículo endoplasmático rugoso (R.E.R.), presenta ribosomas (pequeños
gránulos formados por ARN y proteínas) unidos a su membrana. En la superficie del R.E.R. se realiza la síntesis proteica. Las proteínas sintetizadas por los ribosomas, pasan al lúmen del retículo y allí maduran hasta ser exportadas a su destino definitivo; o bien son excretadas directamente hacia el exterior celular.

32

____________________________________________________________________________Biología General

• El retículo endoplásmico liso (R.E.L.), carece de ribosomas y está formado
por túbulos ramificados y pequeñas vesículas esféricas. En este retículo se realiza la síntesis de lípidos.

Figura III-7. Microfotografía electrónica de una sección de retículo endoplasmático rugoso en la que pueden distinguirse las típicas formaciones de sacos aplanados.

APARATO DE GOLGI Descubierto por C. Golgi en 1898, consiste en un conjunto de estructuras de membrana que forma parte del elaborado sistema de membranas interno de las células. Se encuentra más desarrollado cuanto mayor es la actividad celular. La unidad básica del orgánulo es el sáculo, que consiste en una vesícula o cisterna aplanada. Además, pueden observarse toda una serie de vesículas más o menos esféricas a ambos lados y entre los sáculos. El conjunto de todos los sacos y vesículas constituye el aparato o complejo de Golgi.

33

____________________________________________________________________________Biología General

Figura III-8. Estructura típica del aparato de Golgi con sus vesículas y sáculos observados a través del microscopio electrónico.

LISOSOMAS Los lisosomas son orgánulos provistos de una membrana única. Están llenos de enzimas digestivas del grupo de las hidrolasas, por lo que se pueden considerar como paquetes de enzimas listas para actuar en el momento oportuno. Los lisosomas se forman a partir del retículo endoplasmático rugoso y posteriormente las enzimas son empaquetadas por el complejo de Golgi. Los lisosomas recién sintetizados se denominan lisosomas primarios. Cuando los lisosomas primarios se unen a las vacuolas endocíticas o, en otros casos, encierran partes de la propia célula (autofagia), forman los lisosomas secundarios. CLOROPLASTOS Los cloroplastos son orgánulos exclusivos de las células vegetales. En ellos tiene lugar la fotosíntesis, proceso en el que se transforma la energía lumínica en energía química

34

____________________________________________________________________________Biología General

Tienen una organización muy similar a la de la mitocondria, aunque son de mayor tamaño y tiene un compartimiento más, porque presenta un tercer tipo de membrana. Un cloroplasto tiene tres membranas y presenta tres compartimientos:

• La membrana externa es muy permeable, gracias a la presencia de porinas. • La membrana interna es menos permeable, no presenta pliegues. Entre
ambas membranas queda un primer compartimiento que es el espacio intermembrana. La membrana interna delimita un espacio que es el estroma, donde se encuentran ribosomas, copias de ADN, distintos tipos de ARN, gránulos de almidón y gotas de lípidos.

• La membrana tilacoidal es el tercer tipo de membrana, aparece formando
unos sacos aplanados denominados tilacoides, los cuales forman unas agrupaciones llamadas grana. Los tilacoides están interconectados y delimitan una tercera cavidad que es el espacio tilacoidal. Es la responsable de la captación de la energía solar, gracias a la presencia de clorofilas y de otros pigmentos asociados con proteínas.

Figura III-9. Esquema de un cloroplasto en la que se representan todos los espacios y grupos de membranas que lo forman. La función de los cloroplastos es la fotosíntesis.

35

____________________________________________________________________________Biología General

MITOCONDRIAS Las mitocondrias son orgánulos granulares y filamentosos que se encuentran en el citoplasma de todas las células eucariotas. Aunque su distribución dentro de la célula es generalmente uniforme, existen numerosas excepciones. Por otro lado, las mitocondrias pueden desplazarse de una parte a otra de la célula. En promedio, hay unas 2000 mitocondrias por célula, pero las células que desarrollan trabajos intensos, como las musculares, tienen un número mayor que las poco activas, como por ejemplo las epiteliales. Una mitocondria está rodeada por una membrana mitocondrial externa, dentro de la cual hay otra estructura membranosa, la membrana mitocondrial interna, que emite pliegues hacia el interior para formar las llamadas crestas mitocondriales. Éstas, a su vez, se encuentran tapizadas de pequeños salientes denominados partículas elementales. Entre las dos membranas mitocondriales queda un espacio llamado cámara externa, mientras que la cámara interna es un espacio limitado por la membrana mitocondrial interna, que se encuentra llena de un material denominado matriz mitocondrial.

Figura III- 10. Esquema que representa la estructura de una mitocondria. La membrana interna está organizada en crestas y la matriz llena toda la mitocondria. La mitocondria es el orgánulo responsable de la respiración celular. 36

____________________________________________________________________________Biología General

La principal función de las mitocondrias es generar energía para mantener la actividad celular mediante procesos de respiración aerobia.

MATRIZ CITOPLASMÁTICA Y CITOSOL El citoplasma comprende todo el volumen de la célula, salvo el núcleo. Engloba numerosas estructuras especializadas y orgánulos. La solución acuosa concentrada en la que están suspendidos los orgánulos se llama citosol. Es un gel de base acuosa que contiene gran cantidad de moléculas grandes y pequeñas, y en la mayor parte de las células es, con diferencia, el compartimiento más voluminoso (en las bacterias es el único compartimiento intracelular). En el citosol se producen muchas de las funciones más importantes de mantenimiento celular, como las primeras etapas de descomposición de moléculas nutritivas y la síntesis de muchas de las moléculas que constituyen la célula.

CITOESQUELETO El citoesqueleto es una red de filamentos proteicos del citosol que ocupa el interior de todas las células animales y vegetales. Adquiere una relevancia especial en las animales, que carecen de pared celular rígida, pues el citoesqueleto mantiene la estructura y la forma de la célula. Actúa como bastidor para la organización de la célula y la fijación de orgánulos y enzimas. También es responsable de muchos de los movimientos celulares. En muchas células, el citoesqueleto no es una estructura permanente, sino que se desmantela y se reconstruye sin cesar. Se forma a partir de tres tipos principales de filamentos proteicos: microtúbulos, filamentos de actina y filamentos intermedios, unidos entre sí y a otras estructuras celulares por diversas proteínas:

• Los microtúbulos son tubos cilíndricos de 20-25 nm en diámetro. Están
compuestos de subunidades de la proteína tubulina. Los microtúbulos

37

____________________________________________________________________________Biología General

actúan como un andamio para determinar la forma celular, y proveen un conjunto de pistas para que se muevan los orgánulos y las vesículas. Los microtúbulos también forman las fibras del huso para separar los cromosomas durante la mitosis. Cuando se disponen en forma geométrica dentro de flagelos y cilias, son usados para la locomoción. Otras estructuras formadas por microtúbulos son los centríolos, dos pequeños cilindros localizados en el interior del citoplasma. Son exclusivos de células animales. Con el microscopio electrónico se observa que la parte externa de los centríolos está formada por nueve tripletes de microtúbulos. Los centríolos se cruzan formando un ángulo de 90.

a)

b)

Figura III-11. Los centríolos son cilindros de microtúbulos que se encuentran en las células animales exclusivamente, cuya función principal es la de originar los husos mitóticos. a) Esquema general. b) Detalle de la ubicación de los centríolos en ángulo recto.

• Los microfilamentos son finas fibras de proteínas como un hilo de 3-6 nm
de diámetro. Están compuestos predominantemente de un tipo de proteína contráctil llamada actina, que es la proteína celular más abundante. La asociación de los microfilamentos con la proteína miosina es la responsable por la contracción muscular. Los microfilamentos también pueden llevar a cabo movimientos celulares, incluyendo desplazamiento, contracción y citocinesis.

• Los filamentos intermedios miden cerca de 10 nm en diámetro y proveen
fuerza de tensión a la célula.

38

____________________________________________________________________________Biología General

Figura III-12. Distribución y disposición de los distintos elementos que componen el citoesqueleto en la célula, en este caso, una célula animal.

MOVIMIENTO CELULAR Los movimientos de las células eucarióticas están casi siempre mediatizados por los filamentos de actina o microtúbulos. Muchas células tienen en la superficie pelos flexibles llamados cilias o flagelos, que contienen un núcleo formado por un haz de microtúbulos capaz de desarrollar movimientos de flexión regulares que requieren energía. Los espermatozoides nadan con ayuda de flagelos, por ejemplo, y las células que revisten el intestino y otros conductos del cuerpo de los vertebrados tienen en la superficie numerosas cilias que impulsan líquidos y partículas en una dirección determinada. Se encuentran grandes haces de filamentos de actina en las células musculares donde, junto con una proteína llamada miosina, generan contracciones poderosas. Los movimientos asociados con la división celular dependen en animales y plantas de los filamentos de actina y los microtúbulos, que distribuyen los cromosomas y otros componentes celulares entre las dos células hijas en fase de segregación.

39

____________________________________________________________________________Biología General

ACTIVIDADES
1. Señale las semejanzas y diferencias entre las células procariotas y eucariotas en los ítems indicados: a) Núcleo c) Reproducción e) Mitocondrias g) Pared celular b) ADN d) Membranas internas f) Cloroplastos

2. ¿Poseen membrana celular y pared celular todas las células?

3. ¿A qué se debe la fluidez de la membrana plasmática?

4. Explique el concepto de asimetría de membrana.

5. Enumere las funciones de la membrana plasmática.

6. Indique los procesos bioquímicos o fisiológicos con los que están relacionados los siguientes orgánulos: a) ribosomas c) retículo endoplasmático liso b) lisosomas d) aparato de Golgi

7. Explique el recorrido de una glucoproteína de la membrana plasmática desde que comienza su síntesis hasta que llega a la membrana. Señale el camino que siguen todas las proteínas destinadas a ser secretadas por la célula. ¿En qué se diferencia el recorrido de ambos tipos de proteínas desde que comienza su síntesis hasta que llegan a su destino final?

8. ¿Cómo definiría el citoesqueleto? ¿Qué componentes se distinguen?

40

____________________________________________________________________________Biología General

9. Relacione los términos: cilios, flagelos y centríolos. ¿En qué función biológica están implicados?

41

____________________________________________________________________________Biología General

U

NIDAD N° 4

EL TRANSPORTE DE MOLÉCULAS

TIPOS DE TRANSPORTE DESDE Y HACIA LA CÉLULA Transportes a través de la membrana

Figura IV-1. Tipos de transporte a través de la bicapa lipídica

El transporte pasivo: Es un proceso de difusión de sustancias a través de la membrana que no requiere inversión de energía celular. Se produce siempre a favor del gradiente, es decir desde una zona de alta concentración hacia una de baja concentración. La velocidad de la difusión depende del tamaño y la forma de las partículas, de sus cargas eléctricas y de su temperatura. Este transporte puede ocurrir por:

• Difusión simple: es el paso de pequeñas moléculas que se realiza a través
de la bicapa lipídica. (Figura IV-1, A). Generalmente difunden sustancias

42

____________________________________________________________________________Biología General

apolares como el oxígeno y el nitrógeno atmosférico, o algunas moléculas polares de muy pequeño tamaño, como el agua, el CO2, el etanol y la glicerina.

• Difusión facilitada:
A través de canales (Figura IV-1, B). Se realiza mediante las denominadas proteínas de canal o ionóforos. Así entran iones como el Na+, K+, Ca2+ y Cl-. Las proteínas de canal tienen un orificio o canal interno, cuya apertura está regulada, por ejemplo por ligandos que se unen a una determinada región (el receptor), la cual sufre una transformación estructural que induce la apertura del canal. A través de permeasas (Figura IV-1, C). Permite el transporte de pequeñas moléculas polares, como los aminoácidos, monosacáridos, etc., que al no poder atravesar la bicapa lipídica, requieren que proteínas transmembranosas faciliten su paso. Estas proteínas reciben el nombre de proteínas transportadoras o permeasas.

El transporte activo (Figura IV-1, D). En este proceso también actúan proteínas de membrana, pero éstas requieren energía, en forma de ATP, para transportar las moléculas de uno al otro lado de la membrana. Se produce cuando el transporte se realiza en contra del gradiente electroquímico. Un ejemplo de transporte activo es la bomba de Na+/K+ (Figura IV-2). La bomba de Na+/K+. Requiere una proteína transmembranosa que bombea Na+ hacia el exterior de la membrana y K+ hacia el interior. Otros mecanismos de intercambio Las células también pueden intercambiar materiales con el exterior utilizando los procesos de endocitosis y exocitosis. En la exocitosis la célula expulsa productos de desecho o secreciones (por ejemplo las hormonas). En la endocitosis los materiales son englobados por una sección de membrana e introducidos a la célula. Un tipo particular de endocitosis es la fagocitosis, en la cual la célula “ingiere” grandes partículas sólidas (Figura IV-3).
43

____________________________________________________________________________Biología General

Figura IV-2. Un ejemplo de transporte activo: la bomba sodio/potasio

Figura IV-3. La célula engloba enteras las partículas sólidas en vesículas fagocíticas que luego se unen a otras vesículas digestivas repletas de enzimas, que degradan la materia orgánica.

44

____________________________________________________________________________Biología General

ACTIVIDADES

1. ¿Qué tipos de sustancias pueden atravesar las membranas por difusión simple? ¿Se trata de un transporte activo o pasivo? Justifique su respuesta. 2. Enumere y discuta en detalle las principales características de la difusión facilitada. 3. ¿Qué se entiende por ionóforo? 4. ¿Por qué se dice que la bomba de Na+/K+ es un mecanismo de transporte activo? 5. Si en una célula se inhibe la síntesis de ATP, ¿podrían llevarse a cabo procesos de transporte pasivo?, ¿y los de transporte activo? Justifique. 6. Enumere las principales finalidades que tiene la formación de vesículas en la membrana plasmática, en relación con la incorporación y eliminación de sustancias.

45

____________________________________________________________________________Biología General

U
ENZIMAS

NIDAD N° 5

FLUJO DE ENERGÍA

Los sistemas vivos convierten la energía de una forma en otra a medida que cumplen funciones esenciales de mantenimiento, crecimiento y reproducción. Al total de las reacciones químicas que ocurren en las células constituyen el metabolismo. Las reacciones metabólicas ocurren en series, llamadas vías, cada una de las cuales sirve a una función determinada en la célula. Cada paso en una vía es controlado por una enzima específica. Las reacciones escalonadas de las vías enzimáticas les permiten a las células llevar a cabo sus actividades químicas con una notable eficiencia, en lo que concierne a la energía y a los materiales. Para reaccionar, las moléculas deben poseer suficiente energía, la energía de activación, a fin de chocar con suficiente fuerza para superar su repulsión mutua y debilitar los enlaces químicos existentes. Las enzimas actúan como catalizadores; disminuyen la energía de activación incrementando enormemente la velocidad a la que se producen las reacciones químicas en las células. Una reacción no catalizada requiere más energía de activación que una catalizada, como una reacción enzimática. La menor energía de activación en presencia del catalizador frecuentemente está dentro del intervalo de energía que poseen las moléculas, de tal modo que la reacción puede ocurrir rápidamente, sin adición o con poca adición de energía. Las enzimas son grandes moléculas de proteínas globulares cuyo modo de plegamiento asegura que grupos particulares de aminoácidos formen un sitio activo. Cuando las enzimas pierden su estructura tridimensional característica, se dice que
46

____________________________________________________________________________Biología General

están desnaturalizadas. Las moléculas reactivas, conocidas como sustrato, se ajustan con precisión a este sitio activo (Figura V-1). Aunque la conformación de una enzima puede cambiar temporalmente en el curso de una reacción, no se altera permanentemente. La velocidad de las reacciones enzimáticas también se ve influida por la temperatura y por el pH, que afectan la atracción entre los aminoácidos de la molécula proteica y también entre el sitio activo y el sustrato. Muchas enzimas requieren de cofactores, que pueden ser iones simples, tales como Mg2+ o Ca2+, o como moléculas orgánicas no proteicas conocidas como coenzimas. Muchas coenzimas, como el NAD, funcionan como transportadores de electrones, y diferentes coenzimas mantienen a los electrones en niveles energéticos ligeramente distintos. Muchas vitaminas son parte de coenzimas.

Figura V-1. La enzima posee un sitio activo donde se une el sustrato. De esta manera se facilita la reacción.

ATP Todas las actividades biosintéticas de la célula, muchos de sus procesos de transporte y una diversidad de otras actividades requieren de energía. Una gran proporción de esta energía es suministrada por una sola sustancia: el adenosín trifosfato o ATP. La glucosa y otros carbohidratos son formas de almacenamiento de energía y también formas en las que se transfiere energía de célula a célula y de organismo a organismo. En cierto sentido, son como el dinero depositado en un banco. Sin embargo, el ATP es como el cambio de bolsillo: es la moneda energética de la célula que puede gastarse de inmediato.

47

____________________________________________________________________________Biología General

La molécula de ATP está formada por la base nitrogenada adenina, el azúcar de cinco carbonos ribosa y tres grupos fosfato. Los tres grupos fosfato están unidos por dos enlaces covalentes que se rompen con facilidad, produciendo cada uno aproximadamente 7 kilocalorías de energía por mol.

Figura V-2. Representación de la eliminación del tercer fosfato de la molécula de ATP y de la energía liberada en ese proceso.

48

____________________________________________________________________________Biología General

ACTIVIDADES
1. ¿Cuál es la base de la especificidad de la acción enzimática? ¿Cuál es la ventaja para la célula de esta especificidad? ¿Cuáles serían las desventajas para la célula? 2. ¿Qué formas de almacenamiento de energía tienen lugar en los seres vivos? ¿Cómo definiría la función del ATP?

49

____________________________________________________________________________Biología General

U
EL PROCESO FOTOSINTÉTICO

NIDAD N° 6

FOTOSÍNTESIS Y RESPIRACIÓN CELULAR

La fotosíntesis es el proceso en virtud del cual los organismos con clorofila, como las plantas verdes, las algas y algunas bacterias, capturan energía en forma de luz y la transforman en energía química. La fotosíntesis ocurre en dos etapas. En la primera etapa de la fotosíntesis, la luz es absorbida por las moléculas de clorofila a, que están compactadas de un modo especial en las membranas tilacoides. Los electrones de las moléculas de clorofila a son lanzados a niveles energéticos superiores, y, en una serie de reacciones, su energía adicional es usada para formar ATP a partir de ADP y para reducir una molécula transportadora de electrones conocida como NADP+. El NADP+ se reduce por la adición de dos electrones y de un protón, formando NADPH. En esta primera etapa de la fotosíntesis, también se escinden moléculas de agua, suministrando electrones que reemplazan a los que han sido lanzados desde las moléculas de clorofila a. La escisión de las moléculas de agua es la causa de que se forme oxígeno libre, que difunde hacia el exterior. En la segunda etapa de la fotosíntesis, el ATP y el NADPH formados en la primera etapa se utilizan para reducir el carbono del dióxido de carbono a un azúcar simple. Así, la energía química almacenada temporalmente en las moléculas de ATP y de NADPH se transfiere a moléculas adecuadas para el transporte y el almacenamiento de energía en las células de las algas o en el cuerpo de las plantas. La resultante de este proceso es pues la formación de un esqueleto de carbono, a partir del cual pueden construirse luego otras moléculas orgánicas. La incorporación inicial de CO2 en compuestos orgánicos se conoce como fijación del carbono. Los
50

____________________________________________________________________________Biología General

pasos por los cuales se lleva a cabo, llamados las reacciones de fijación del carbono, ocurren en el estroma del cloroplasto.

Figura VI-1. Resumen esquemático de las etapas de la fotosíntesis.

GLUCÓLISIS Y RESPIRACIÓN CELULAR La oxidación de la glucosa es una fuente principal de energía en la mayoría de las células. Cuando la glucosa se degrada en una serie de pequeños pasos por medio de enzimas, una proporción significativa de la energía contenida en la molécula vuelve a empaquetarse en los enlaces fosfato de las moléculas de ATP. La primera fase en la degradación de la glucosa es la glucólisis que se efectúa en el citoplasma de la célula. La segunda fase es la respiración aeróbica, que requiere oxígeno y, en las células eucarióticas, tiene lugar en las mitocondrias. La respiración comprende el ciclo de Krebs y el transporte terminal de electrones acoplado al proceso de fosforilación oxidativa. Todos estos procesos están íntimamente relacionados.

51

____________________________________________________________________________Biología General

En presencia de oxígeno, el ácido pirúvico entra en el ciclo de Krebs donde se sintetiza más ATP y se transfieren más electrones y protones a las coenzimas. Estas coenzimas aceptoras de electrones transfieren su carga a la cadena transportadora de electrones a lo largo de la cual, paso a paso, los electrones caen a niveles inferiores de energía. A medida que esto ocurre, se fabrica mucho más ATP. Al final de la cadena transportadora, los electrones se reúnen con los protones y se combinan con el oxígeno, formándose agua. En ausencia de oxígeno, el ácido pirúvico puede convertirse en ácido láctico o etanol. Este proceso, llamado fermentación, no produce ATP, pero regenera las moléculas de coenzima aceptoras de electrones, necesarias para que la glucólisis continúe.

Figura VI-2. Resumen esquemático de las etapas de oxidación de la glucosa.

52

____________________________________________________________________________Biología General

ACTIVIDADES
1. Complete las siguientes frases:

• El proceso de la fotosíntesis consume._______________.y ___________ y
produce.________________ y ____________.

• Los cloroplastos contienen pilas de sacos membranosos planos llamadas
_______________. Cada saco individual recibe el nombre de _____________.

• Las reacciones a través de las cuales las células extraen energía de las
moléculas combustibles, utilizan oxígeno y producen dióxido de carbono y agua se denominan ___________________. 2. Describa en términos generales los acontecimientos de la fotosíntesis. 3. Dibuje un cloroplasto e indique todas sus membranas y compartimientos. ¿De qué forma la estructura del cloroplasto se asemeja a la de la mitocondrio? ¿En qué difiere? 4. De las siguientes afirmaciones relacionadas con la respiración celular, ¿cuál es la verdadera y por qué?:

• Es un proceso catabólico del que se obtiene energía directamente utilizable por
la célula para su desarrollo y productos más simples.

• Es un proceso que sólo ocurre en las células animales, pues los vegetales
tienen otros mecanismos para conseguir lo mismo.

• Consiste en una combustión incompleta de la materia orgánica dando lugar a
compuestos orgánicos más sencillos. 5. Los organismos aeróbicos son tanto o más eficientes que los anaerobios para convertir energía, entonces, ¿por qué hay anaerobios en este planeta?, ¿por qué no se han extinguido?

53

____________________________________________________________________________Biología General

U
CICLO CELULAR: FASES

NIDAD N° 7

REPRODUCCIÓN CELULAR

El ciclo celular comprende cuatro períodos denominados G1, S, G2 y M. A continuación se presentan algunos de los hechos más notables que ocurren en cada período:

• El período G1, llamado primera fase de crecimiento, se inicia con una
célula hija que proviene de la división de la célula madre. La célula aumenta de tamaño, se sintetiza nuevo material citoplásmico, especialmente proteínas y ARN.

• El período S o de síntesis, en él tiene lugar la duplicación del ADN.
Cuando acaba este período, el núcleo contiene el doble de proteínas nucleares y de ADN que al principio.

• El período G2, o segunda fase de crecimiento, en el cual se siguen
sintetizando ARN y proteínas; el final de este período queda marcado por la aparición de cambios en la estructura celular, los cuales se hacen visibles con el microscopio y que nos indican el principio de la mitosis o división celular.

• El período M o de división celular es la etapa mitótica o de
distribución del ADN y el citoplasma en dos células hijas`.

54

____________________________________________________________________________Biología General

Figura VII-1. Esquema que representa las diferentes etapas del ciclo celular

En pocas palabras podemos decir que el ciclo celular comprende dos etapas fundamentales: la interfase y la división o mitosis. La interfase, a su vez, comprende los períodos G1, S y G2, y es el intervalo entre las divisiones de la célula. Se registra una intensa actividad biosintética, y un aumento del tamaño de la célula.

MITOSIS La mitosis es el proceso de división celular por el cual se conserva la información genética contenida en sus cromosomas que pasa de esta manera a las sucesivas células hijas. La mitosis es un proceso de multiplicación celular que participa en el desarrollo, el crecimiento y la regeneración del organismo. Este proceso tiene lugar por medio de una serie de operaciones sucesivas que se desarrollan de una manera continua, y que, para facilitar su estudio, han sido separadas en varias etapas:

Profase. La cromatina en el núcleo comienza a condensarse y forma los cromosomas. Cada cromosoma está constituido por dos cromátidas, que se mantienen unidas por un

55

____________________________________________________________________________Biología General

estrangulamiento que es el centrómero. Cada cromátida corresponde a una larga cadena de ADN. El nucléolo desaparece. Los centríolos comienzan a moverse hacia los polos opuestos de la célula y comienza a desarrollarse el huso mitótico. Prometafase. La membrana nuclear se disuelve. Los cromosomas quedan en aparente desorden.

Metafase. Las fibras del huso ordenan los cromosomas en el plano ecuatorial del huso, los cuales forman la placa metafásica. Esta organización ayuda a asegurar que en la próxima fase, cuando los cromosomas se separan, cada nuevo núcleo recibirá una copia de cada cromosoma. Anafase. Los pares de cromosomas se separan en sus dos cromátidas. Los centrómeros emigran a lo largo de las fibras del huso en direcciones opuestas, arrastrando cada uno en su desplazamiento a una cromátida. La anafase constituye la fase crucial de la mitosis, porque en ella se realiza la distribución de las dos copias de la información genética original. Telofase. Los dos grupos de cromátidas, comienzan a descondensarse, se reconstruye la membrana nuclear

alrededor de cada conjunto cromosómico, definiendo los nuevos núcleos hijos. Las fibras del huso se dispersan. A continuación tiene lugar la división del citoplasma. Citocinesis. Es el proceso de clivaje y separación del citoplasma. En células animales se forma un anillo contráctil de actina y miosina en la región ecuatorial, que se profundiza hasta que la célula se divide. En células vegetales, la pared

56

____________________________________________________________________________Biología General

rígida requiere que una placa celular sea sintetizada entre las dos células hijas. Durante esta etapa los componentes citoplasmáticos y los orgánulos se distribuyen entre las células hijas.

EL CONTROL DE LA PROLIFERACIÓN CELULAR Y EL CÁNCER La capacidad de proliferar en forma descontrolada está relacionada con la acumulación de ciertos cambios en la célula. El cáncer es el resultado de una serie de modificaciones accidentales en el material genético que trae como consecuencia la alteración del comportamiento normal de la célula. Existen genes que contribuyen a originar un cáncer los cuales, en sus “versiones normales”, están relacionados con el control del crecimiento y la sobrevida de la célula. Entre ellos, los protooncogenes estimulan la proliferación celular y los genes supresores de tumores, la inhiben. La versión alterada de un protooncogen se denomina oncogen (del griego onkos, “tumor”) y puede ser responsable, por ejemplo, del aumento desmedido de una proteína estimuladora del crecimiento. Por otra parte, la versión alterada de un gen supresor puede resultar en la pérdida de una proteína inhibidora del crecimiento o de una proteína activadora de la muerte programada. En ambos casos, la presencia de estos genes alterados conduce a la proliferación descontrolada de las células que se encuentra en el origen de todo cáncer. Mientras las células tumorales quedan restringidas a una masa única, se dice que el tumor es benigno. Un tumor benigno puede proseguir su crecimiento sin invadir el tejido circundante; puede también detener su crecimiento o reducirse. En muchas ocasiones, es posible removerlo quirúrgicamente y lograr así una cura completa. Una característica clave de las células cancerosas es que, a diferencia de las células normales, tienen la capacidad de emigrar, invadir nuevos tejidos y establecer nuevas colonias. Este proceso se denomina metástasis. Un tumor que adquiere esta capacidad pasa a ser maligno y causa frecuentemente la muerte.

57

____________________________________________________________________________Biología General

ACTIVIDADES
1. En un organismo pluricelular, casi todas sus células se dividen en uno u otro momento. ¿Por qué deben dividirse la mayoría de las células de un organismo pluricelular?

2. Distinga entre los siguientes términos: ciclo celular/división celular; mitosis/citocinesis; cromátide/cromosoma.

3. ¿Cuáles son las etapas de la mitosis?

4. Haga un esquema de la anafase de una célula que tenga 2n = 4 cromosomas.

58

____________________________________________________________________________Biología General

U
MEIOSIS

NIDAD N° 8

MEIOSIS Y REPRODUCCIÓN SEXUAL

La meiosis es un tipo especial de división celular que tiene lugar en las células germinales de los organismos de reproducción sexual. Consta de dos divisiones nucleares y celulares llamadas meiosis I y meiosis II. Durante el período S de la interfase la célula duplica su ADN y cada cromosoma duplicado queda formado por dos cromátidas, llamadas cromátidas hermanas. La profase I es muy compleja y en ella tiene lugar el proceso conocido como sinapsis. Durante la sinapsis los cromosomas homólogos (es decir los dos que forman el par cromosómico) se encuentran y forman tétradas, se alinean y se aparean intercambiando algunas secciones de ADN desde una cadena a otra. Este proceso de intercambio de material genético es llamado entrecruzamiento y es el principal responsable de la variabilidad genética entre individuos. Durante la profase I los centríolos se desplazan hacia los polos opuestos, se forma el huso entre ellos y la membrana nuclear se disuelve. Las fases de la primera división que suceden a la profase son relativamente parecidas a las de la mitosis. Así, en la metafase I los cromosomas homólogos todavía unidos por los quiasmas (puntos en donde se producen los

entrecruzamientos), se orientan en el plano ecuatorial de la célula. Durante la anafase I se completa la separación de los cromosomas homólogos hacia los polos. Las cromátidas siguen unidas por sus centrómeros. En la telofase I se regenera la envoltura nuclear, los cromosomas se distienden y las células hijas se separan.

59

____________________________________________________________________________Biología General

La segunda división es similar a la mitosis pero en este caso la interfase no tiene fase S, es decir que el ADN no se duplica. La profase II es muy similar a la profase mitótica. Durante la metafase II las cromátidas migran hacia el ecuador del huso mitótico y en la anafase II los centrómeros se rompen y las cromátidas hermanas se separan y emigran hacia los polos opuestos. Así, en la telofase II se forman las membranas nucleares, los cromosomas se desenrollan formando los filamentos de cromatina y luego ocurre la citocinesis. Las dos divisiones meióticas sucesivas producen cuatro núcleos haploides, cada uno de los cuales contiene uno y solo uno de los diferentes tipos de cromosomas. Las células somáticas, es decir aquellas que se dividen por mitosis, tienen dos copias de cada cromosoma, es decir, son diploides.

Figura VIII-1. Esquema de la meiosis con sus dos etapas: meiosis I y meiosis II.

CONSECUENCIAS DE LA MEIOSIS La meiosis es el proceso mediante el cual se obtienen células especializadas para intervenir en la reproducción sexual.

60

____________________________________________________________________________Biología General

Reduce a la mitad el número de cromosomas, y así, al unirse las dos células sexuales, vuelve a restablecerse el número cromosómico de la especie. Se produce una recombinación de la información genética. La meiosis origina una gran variación de gametos debido al

entrecruzamiento de segmentos de los cromosomas homólogos. COMPARACIÓN ENTRE MITOSIS Y MEIOSIS Los acontecimientos que tienen lugar durante la meiosis se asemejan a los de la mitosis, pero una comparación de los dos procesos muestra un buen número de diferencias importantes.

Figura VIII-2. Esquema de la meiosis con sus dos etapas: meiosis I y meiosis II.

61

____________________________________________________________________________Biología General

ACTIVIDADES
1. La siguiente figura representa el esquema de una célula que va a dividirse por meiosis:

• ¿Cuál

es

el

número

diploide

de

cromosomas

de

la

célula

representada?.¿Cuántos pares de cromosomas homólogos y cuántas cromátidas contiene?

• Represente mediante esquemas: el resultado de la formación de un
quiasma entre cada pareja de homólogos, la anafase I, la telofase I y la telofase II. Sólo hay que realizar uno de los posibles resultados hasta obtener las cuatro células finales.

2. Los perros tienen un número diploide de cromosomas de 78. ¿Cuántos cromosomas esperaría encontrar en un espermatozoide? ¿En una célula del riñón?

3. Dibuje los ocho gametos posibles que resultarían de la meiosis en una célula vegetal con 6 cromosomas (n=3). Suponga que no ocurre entrecruzamiento.

4. Enumere las semejanzas y diferencias entre los procesos de mitosis y meiosis.

62

____________________________________________________________________________Biología General

U
LA ESTRUCTURA DEL ADN

NIDAD N° 9

LA BASE QUÍMICA DE LA HERENCIA

Erwin Chargaff analizó las bases nitrogenadas del ADN en diferentes formas de vida, concluyendo que la cantidad de purinas no siempre se encontraba en proporciones iguales a las de las pirimidinas (contrariamente a lo propuesto por Levene), la proporción era igual en todas las células de los individuos de una especie dada, pero variaba de una especie a otra. Los experimentos de Hershey-Chase probaron que el ADN era el material genético pero no cómo el ADN conformaba los genes. El ADN debía transferir información de la célula de origen a la célula hija. Debía también contener información para replicarse a sí mismo, ser químicamente estable y tener pocos cambios. Sin embargo debía ser capaz de sufrir cambios mutacionales. Sin mutaciones no existiría el proceso evolutivo. Muchos científicos se interesaron en descifrar la estructura del ADN, entre ellos, Francis Crick, James Watson, Rosalind Franklin, y Maurice Wilkins. Watson y Crick integraron todos los datos disponibles en un intento de desarrollar un modelo de la estructura del ADN. Franklin tomó fotomicrografías de difracción de rayos X de cristales de ADN, que fueron la pieza clave del rompecabezas. Los datos que se conocían por ese tiempo eran: 1) El ADN es una molécula grande y también muy larga y delgada. 2) Los datos de las bases proporcionados por Chargaff (A=T y C=G; purinas/pirimidinas = k para una misma especie).

63

____________________________________________________________________________Biología General

3) Los datos de la difracción de los rayos X de Franklin y Wilkins (King's College de Londres). 4) Los trabajos de Linus Pauling sobre proteínas (forma de hélice mantenida por puentes hidrógeno), quién sugirió para el ADN una estructura semejante. En definitiva, el ADN es una doble hélice, con las bases dirigidas hacia el centro, perpendiculares al eje de la molécula (como los peldaños de una escalera caracol) y las unidades azúcar-fosfato a lo largo de los lados de la hélice (como las barandas de una escalera caracol). Las hebras que la conforman son complementarias (deducción realizada por Watson y Crick a partir de los datos de Chargaff): A se aparea con T y C con G y este apareamiento se mantiene debido a la acción de los puentes hidrógeno entre ambas bases. Una purina con doble anillo siempre se aparea con una pirimidina con un solo anillo en su molécula. Las purinas son la Adenina (A) y la Guanina (G). Ya se ha nombrado varias veces en este módulo al ATP (Adenosintrifosfato), formado por la misma adenina, pero en ese caso el azúcar es ribosa, mientras que en el ADN se encuentra la desoxirribosa. Las Pirimidinas son la Citosina (C) y la Timina (T). Las bases son complementarias, con A en un lado de la molécula únicamente encontramos T del otro lado, lo mismo ocurre con G y C. Si conocemos la secuencia de bases de una de las hebras, conocemos su complementaria.

64

____________________________________________________________________________Biología General

Figura IX-1: Representación de la doble hélice de ADN.

65

____________________________________________________________________________Biología General

REPLICACIÓN DEL ADN Una vez que se comprobó que el ADN era el material hereditario y se descifró su estructura, lo que quedaba era determinar cómo el ADN copiaba su información y cómo la misma se expresaba en el fenotipo (el conjunto de las características de un organismo resultantes de la expresión de su genotipo: la información contenida en su ADN). Matthew Meselson y Franklin W. Stahl diseñaron el experimento para determinar el método de la replicación del ADN. Los tres modelos de replicación posibles eran: Replicación conservativa durante la cual se produciría un ADN completamente nuevo durante la replicación. En la replicación semiconservativa se originan dos moléculas de ADN, cada una de ellas compuesta de una hebra del ADN original y de una hebra complementaria nueva. En otras palabras el ADN se forma de una hebra vieja y otra nueva. Es decir que las hebras existentes sirven de molde complementario a las nuevas. La replicación dispersiva implicaría la ruptura de las hebras de origen durante la replicación que, de alguna manera, se reordenarían en una molécula con una mezcla de fragmentos nuevos y viejos en cada hebra de ADN.

El experimento de Meselson-Stahl (Figura IX-1) consistió en cultivar la bacteria Escherichia coli en un medio que contenía nitrógeno pesado (15N es más pesado que el isótopo más común, el
14N).

La primera generación de bacterias se hizo crecer en
15N

un medio que únicamente contenía transfirió luego a un medio con

como fuente de nitrógeno. La bacteria se

14N.

Watson y Crick habían pronosticado que la

replicación del ADN era semiconservativa, de ser así el ADN extraído de las bacterias luego de cultivarlas por una generación en 14N tendría un peso intermedio entre el ADN extraído del medio con 15N y el del extraído de medio con 14N y así fue.

66

____________________________________________________________________________Biología General

Figura IX-2: El experimento de Meselson-Stahl

La replicación del ADN, que ocurre una sola vez en cada generación celular, necesita de muchos “ladrillos”, enzimas, y una gran cantidad de energía en forma de ATP (como ya se ha dicho, luego de la fase S del ciclo celular las células pasan a una fase G a fin de, entre otras cosas, recuperar energía para la siguiente fase de la división celular). La replicación del ADN se produce en el ser humano a una velocidad de 50 nucleótidos por segundo y en procariotas a 500/segundo. Los nucleótidos tienen que se armados y estar disponibles en el núcleo juntamente con la energía para unirlos. La iniciación de la replicación siempre acontece en un cierto grupo de nucleótidos llamados origen de la replicación, y requiere, entre otras, las enzimas helicasas para romper los puentes hidrógeno y las topoisomerasas para aliviar la tensión, y las proteínas de unión a cadena simple para mantener separadas las cadenas abiertas. Una vez que se abre la molécula, se forma una área conocida como “burbuja de replicación”. En ella se encuentran las “horquillas de replicación”. Por acción de la ADN-polimerasa los nuevos nucleótidos entran en la horquilla y se enlazan con el nucleótido correspondiente de la cadena de origen (A con T, C con G). Los
67

____________________________________________________________________________Biología General

procariotas abren una sola burbuja de replicación, mientras que los eucariotas abren múltiples burbujas. Finalmente el ADN se replica en toda su longitud por confluencia de estas “burbujas”. Dado que las cadenas del ADN son antiparalelas, y que la replicación procede solo en la dirección 5' to 3' en ambas cadenas, numerosos experimentos mostraron que una cadena formará una copia continua, mientras que en la otra se formarán una serie de fragmentos cortos conocidos como fragmentos de Okazaki. La cadena que se sintetiza de manera continua se conoce como cadena adelantada y, la que se sintetiza en fragmentos, cadena atrasada. Para que trabaje la ADN-polimerasa es necesaria la presencia, en el inicio de cada nuevo fragmento, de pequeñas unidades de ARN conocidas como cebadores. A posteriori, cuando la polimerasa toca el extremo 5' de un cebador, se activan otras enzimas, que remueven los fragmentos de ARN, colocan nucleótidos de ADN en su lugar y, una ADN-ligasa los une a la cadena en crecimiento.

68

____________________________________________________________________________Biología General

ACTIVIDADES
1. ¿En que se basaron los experimentos de Meselson y Stahl? ¿Qué conclusiones se elaboraron?

2. Sintetice en un párrafo de no más de 10 renglones las características químicas del ADN.

3. Sintetice en un párrafo de no más de 10 renglones el proceso de replicación del ADN.

4. ¿Qué quiere decir que en la replicación del ADN una cadena se copia de forma continua y la otra lo hace de forma discontinua y desfasada?

5. ¿Cómo respaldaría el argumento de que el ADN es el material genético? Haga una lista de por lo menos menos cinco puntos fuertes de su argumentación.

69

____________________________________________________________________________Biología General

U

NIDAD N° 10

EL CÓDIGO GENÉTICO Y SU TRADUCCIÓN
PROCESOS INVOLUCRADOS EN LA SÍNTESIS PROTEICA El "dogma" central de la genética molecular: "La información fluye del DNA al RNA y de éste a las proteínas". La replicación del DNA ocurre sólo una vez en cada ciclo celular, durante la fase S previa a la mitosis o a la meiosis. La transcripción y la traducción, sin embargo, ocurren repetidamente a través de toda la interfase del ciclo celular. Nótese que, según este dogma, los procesos ocurren en una sola dirección. Una diversidad de experimentos ha demostrado que se cumple, salvo algunas pocas excepciones. La principal excepción al dogma central es un proceso llamado transcripción inversa, en el cual la información codificada por ciertos virus que contienen RNA se transcribe a DNA por la acción de la enzima transcriptasa inversa.

Figura X-1: Procesos involucrados en la síntesis proteica

TIPOS DE ARN El ácido ribonucleico mensajero (ARNm) es el molde para la construcción de la proteína.

70

____________________________________________________________________________Biología General

El ácido ribonucleico ribosómico (ARNr) se encuentra en el sitio donde se construye la proteína: el ribosoma. El ácido ribonucleico de transferencia (ARNt) es el transportador que coloca el aminoácido apropiado en el sitio correspondiente. El ARN tiene el azúcar ribosa en vez de desoxirribosa. La base uracilo (U) reemplaza a la timina (T) en el ARN. El ARN tiene una sola hebra, si bien el ARNt puede formar una estructura de forma de trébol debido a la complementariedad de sus pares de bases.

TRANSCRIPCIÓN: COPIA DE ARNm DESDE LA SECUENCIA DE ADN

La ARN-polimerasa abre la parte del ADN a ser transcripta. Solo una de las hebras del ADN (la hebra codificante) se transcribe. Los nucleótidos de ARN se encuentran disponibles en la región de la cromatina (este proceso sólo ocurre en la interfase) y se unen en un proceso de síntesis similar al del ADN. TRADUCCIÓN DEL ARN EN PROTEÍNA

Fue el astrónomo George Gamow quien señaló que el código que representa a los aminoácidos debía consistir en grupos de al menos tres de las cuatro bases del ADN. En efecto, los 20 aminoácidos están representados en el código genético por la agrupación de tres letras (triplete) de las cuatro existentes. Si uno considera las posibilidades de arreglo de cuatro letras agrupadas de a tres (43) resulta que tenemos 64 posibilidades de palabras a codificar, o 64 posibles codones (secuencia de tres bases en el ARNm que codifica para un aminoácido específico o una secuencia de control). El código genético consiste en 61 codones para aminoácidos y 3 codones de terminación, que detienen el proceso de traducción. El código genético es por lo tanto redundante, en el sentido que tiene varios codones para un mismo aminoácido. Por
71

____________________________________________________________________________Biología General

ejemplo, la glicina es codificada por los codones GGU, GGC, GGA, y GGG. Si un codón muta por ejemplo de GGU a CGC, se especifica el mismo aminoácido. La regulación de los genes de los procariotas difiere de la de los eucariotas pero la de los procariotas es mucho más fácil de estudiar y a ellos se refiere gran parte de los estudios. Los promotores son secuencias de ADN que comienzan señales para la transcripción del ARN. Los terminadores son señales de detención. La molécula de ARNm puede tener de 500 a 10.000 nucleótidos. Los ribosomas son las organelas de la célula donde se sintetizan la proteínas. Los ribosomas están formados por una subunidad liviana (30S) y una pesada (50S), el ARNr difiere en cada uno de ellos. La subunidad 30S tiene un ARNr 16S y 21 proteínas diferentes. La subunidad 50S consiste en ARNr 23S y 5S y 34 proteínas diferentes.

Figura X-2: Subunidades ribosomales

• La subunidad liviana tiene el sitio para que se pegue el ARNm. Tiene un rol crucial en la decodificación del ARN pues monitorea el apareamiento de bases entre el codón del ARNm y el anticodón de ARNt. También trabaja con la subunidad 50S en el proceso denominado traslocación (proceso por el cual el ARNt asociado al ARNm se mueve un codón) • La subunidad pesada tiene dos sitios para el ARNt. Cataliza la formación de la unión peptídica. • El ARNt tiene forma de trébol y es el que lleva el aminoácido apropiado al ribosoma cuando el codón lo “llama”.

72

____________________________________________________________________________Biología General

• En la parte terminal del brazo más largo del ARNt se encuentran tres bases, el anticodón, que son complementarias con el codón. • Existen 61 ARNt diferentes, cada uno posee un sitio diferente para pegar el aminoácido y un anticodón diferente. Para el codón UUU, el codón

anticomplementario es AAA. • La unión del aminoácido apropiado al ARNt está controlado por una enzima: la aminoacil-ARNt-sintetasa. • La energía para la unión del aminoácido al ARNt proviene de la conversión de ATP (adenosín-trifosfato) a AMP (adenosín-monofosfato).

Figura X-3: ARNt. Se observa el extremo aceptor de aminoácidos y el anticodón.

La traducción es el proceso de convertir las secuencias del ARNm en una secuencia de aminoácidos. El código de iniciación es el AUG que codifica para el aminoácido metionina (Met). La traducción no ocurre si no está el codón AUG, por lo tanto la metionina (en realidad la formil-metionina, f-Met) es siempre el primer aminoácido de la cadena polipeptídica, y frecuentemente se elimina al final del proceso.
73

____________________________________________________________________________Biología General

El complejo formado por ARNt/ARNm/subunidad ribosómica pequeña es llamado complejo de iniciación. La subunidad grande se pega al complejo de iniciación. Luego de esta fase el mensaje progresa durante la elongación de la cadena polipeptídica. • Un nuevo ARNt lleva otro aminoácido al sitio P vacío del complejo ribosoma/ARNm y posteriormente se forma un enlace peptídico con el aminoácido del sitio ocupado. • El complejo se mueve a lo largo del ARNm hasta el próximo triplete, liberando el sitio A. • El nuevo ARNt entra en el sitio A y se repite el proceso. Cuando el codón es un codón determinación, un factor de liberación se pega al sitio, parando la traducción y liberando al complejo ribosómico del ARNm.

Figura X-4: Resumen de los procesos de transcripción y traducción.

74

____________________________________________________________________________Biología General

A menudo muchos ribosomas leen el mismo mensaje y forman una estructura conocida como polisoma. De esta manera la célula puede rápidamente fabricar varias proteínas similares. La secuencia de los aminoácidos determina la interacción entre los mismos y por lo tanto define la manera en que la proteína recientemente formada se pliega y adopta su conformación en el espacio. Sin embargo muchas proteínas por sin solas no alcanzan su conformación nativa y requieren de complejos proteicos que la ayudan: las “chaperoninas”. A modo de resumen, la figura de la página siguiente sintetiza los conceptos de transcripción y traducción.

75

____________________________________________________________________________Biología General

ACTIVIDADES
1. Distinga entre los siguientes términos: ARNm, ARNt y ARNr / codón anticodón. 2. ¿A qué se llama, en este marco, el “dogma central de la Biología”? 3. Sintetice en un párrafo de no más de 10 renglones el proceso de transcripción. 4. Sintetice en un párrafo de no más de 10 renglones el proceso de traducción. 5. Señala los aspectos diferentes que encuentras entre replicación y

transcripción? ¿Qué tienen en común? 6. Observa los siguientes esquemas, relativos al funcionamiento de los ácidos nucleicos, e indica cuáles son verdaderos y cuáles son falsos: ADN transcripción ARN ADN traducción proteína ADN replicación ADN1 + ADN2 ADN traducción ARN 7. Dada la siguiente secuencia de ADN: ATA ACA TCG ATC TAC Deduzca la secuencia del ARNm y de los anticodones de los ARNt que intervienen en la síntesis del correspondiente polipéptido. 8. En la purificación de unas moléculas de ARNt se obtiene un fragmento cuya secuencia de bases nitrogenadas es la siguiente:

AUACGGCUAUCAGA UAUGCCCAUAGUCU
76

____________________________________________________________________________Biología General

¿Puede encontrarse en ese fragmento la secuencia del anticodón? Fundamenta tu respuesta. 9. Consultando la tabla de la clave genética, señala el polipéptido que saldría de este trozo de ADN:

TACGCTGCGATAAACATTGCTCGAGAT
10. Teniendo en cuenta la tabla del código genético, establece todos los pasos que conducirán a la síntesis del péptido leucina-alanina-prolina-serina-argininaarginina-valina, indicando: Una secuencia entre todas las posibles, del ADN bicatenario correspondiente, teniendo en cuenta que el codón de iniciación es el AUG en el ARNm. La secuencia de codones del ARNm. El número de ARNt que intervendrán en el proceso y sus anticodones específicos.

77

____________________________________________________________________________Biología General

U
microorganismos pertenecientes

NIDAD N° 11

INTRODUCCIÓN A LA MICROBIOLOGÍA La Microbiología es la rama de la Biología que se ocupa del estudio de a los Reinos Monera (bacterias), Protista

(algas,protozoarios, etc.) y Fungi (levaduras, etc.), y de los virus. BACTERIAS Las bacterias viven sobre o dentro de casi todo material o hábitat existente en la tierra, desde suelos hasta el agua y el aire; desde los ambientes templados hasta el hielo del Ártico y en las hendiduras volcánicas. Cada centímetro cuadrado de piel humana tiene en promedio 100.000 bacterias. Una simple cucharadita de tierra contiene más de 109 bacterias. Son microorganismos de organización muy sencilla, llamados también procariontes. Las características principales de los procariontes ya fueren explicadas en la Unidad N° 1 del presente módulo. A modo de repaso recordemos que las bacterias están formadas por (ver figura VII-1):

• Un citoplasma, el cual presenta un aspecto viscoso (en su zona central
aparece un nucleoide que contiene la mayor parte del ADN bacteriano).

• En algunas bacterias aparecen fragmentos circulares de ADN con
información genética: los plásmidos.

• La membrana plasmática presenta invaginaciones, que son los
mesosomas, donde se encuentran enzimas que intervienen en la síntesis de ATP, y los pigmentos fotosintéticos en el caso de bacterias fotosintéticas.
78

____________________________________________________________________________Biología General

• En el citoplasma se encuentran inclusiones de diversa naturaleza
química.

• Muchas bacterias pueden presentar flagelos que le permiten moverse
a través de los ambientes líquidos. Pueden poseer también, fimbrias o pili muy numerosos y cortos, que pueden servir como pelos sexuales para el paso de ADN de una célula a otra.

• Poseen ARN y ribosomas característicos, para la síntesis de proteínas. • Tienen una pared celular que es rígida y que está formada con
moléculas exclusivas de bacterias.

Figura XI-1. Esquema de una bacteria sencilla. Se señalan las estructuras más importantes.

Según su forma se clasifican en: bacilos (con forma de bastones), cocos (parecen esferas pequeñas), y espiroquetas y espirilos (de forma espiralada). Nutrición bacteriana
79

____________________________________________________________________________Biología General

El éxito evolutivo de las bacterias se debe en parte a su versatilidad metabólica. Todos los mecanismos posibles de obtención de materia y energía podemos encontrarlos en las bacterias. Según la fuente de carbono que utilizan, los seres vivos se dividen en autótrofos, cuya principal fuente de carbono es el CO2, y heterótrofos cuando su fuente de carbono es materia orgánica. Por otra parte según la fuente de energía, los seres vivos pueden ser fotótrofos, cuya principal fuente de energía es la luz, y los organismos quimiótrofos, cuya fuente de energía es un compuesto químico que se oxida. Atendiendo a las anteriores categorías, entre las bacterias podemos encontrar las siguientes formas:

• Las bacterias quimioheterótrofas, utilizan un compuesto orgánico
como fuente de carbono, y a su vez, este mismo compuesto es la fuente de energía. La mayor parte de las bacterias cultivadas en laboratorios y las bacterias patógenas son de este grupo.

• Las bacterias quimioautótrofas, utilizan compuestos inorgánicos
reducidos como fuente de energía (por ejemplo el H2S, o el Fe+2) y el CO2 como fuente de carbono.

• Las bacterias fotoautótrofas, utilizan la luz como fuente de energía y
el CO2 como fuente de carbono.

• Las bacterias fotoheterótrofas, utilizan la luz como fuente de energía
y compuestos orgánicos como fuente de carbono. Reproducción En general las bacterias se reproducen asexualmente mediante división celular simple, también llamada fisión binaria transversal. Tras la duplicación del ADN, la pared bacteriana crece hasta formar un tabique transversal que separa de las dos nuevas bacterias. Pero además, las bacterias poseen mecanismos de reproducción sexual mediante los cuales se intercambian fragmentos de ADN. Esta recombinación genética ocurre por medio de tres mecanismos diferentes:
80

____________________________________________________________________________Biología General

• Transformación: Consiste en el intercambio genético producido
cuando una bacteria es capaz de captar fragmentos de ADN de otra bacteria que se encuentran dispersos en el medio donde vive.

• Conjugación: En este proceso, una bacteria donadora F+ transmite a
través de un puente o pili, un fragmento de ADN, a otra bacteria receptora F-. La bacteria que se llama F+ posee un plásmido, además del cromosoma bacteriano.

• Transducción: En este caso la transferencia de ADN de una bacteria a
otra, se realiza a través de un virus bacteriófago, que se comporta como un vector intermediario entre las dos bacterias.

a)

b)

Figura XI-2. Ejemplos de bacterias: a) Escherichia coli, b) Streptococcus beta-hemolítico y c) Bacillus tetanicus

LEVADURAS Las levaduras son hongos unicelulares que se reproducen asexualmente por gemación en la mayoría de los casos, aunque también lo hacen por fisión, y sexualmente por formación de esporas. En general, las células de las levaduras son más grandes que la mayoría de las bacterias, son ovaladas y miden alrededor de 3 a 6 µm. Ciertas levaduras se agrupan para formar colonias.

81

____________________________________________________________________________Biología General

Figura XI-3. Esquema de una célula de levadura en gemación, su principal forma de reproducción.

Figura XI-4. Microfotografía electrónica de barrido de algunas células de Candida albicans.

FERMENTACIÓN Es una respiración anaerobia (en ausencia de oxígeno) en la que se genera ATP mediante un proceso en el cual se utilizan compuestos orgánicos como donadores y aceptores de electrones. Existen dos tipos de fermentación:

82

____________________________________________________________________________Biología General

• La fermentación alcohólica en la cual se obtiene alcohol etílico a
partir de compuestos como el azúcar o el ácido pirúvico.

• La fermentación láctica en la que el producto final es lactato.
USOS DE LOS MICROORGANISMOS Los microorganismos se encuentran en todas partes, en el agua hirviente, incrustados en el hielo, inmersos en el petróleo. Algunos pueden alimentarse de materiales en apariencia poco nutritivos, como el petróleo, la madera, el plástico e incluso rocas sólidas. Cuando, además, se examinan las sustancias que los microbios son capaces de manufacturar, empiezan a revelarse las inmersas posibilidades de la biotecnología. Gran cantidad de productos procedentes de la biotecnología se encuentran en casi todos los campos de la vida moderna:

• En medicina: tratamientos para enfermedades como cáncer o
diabetes; antibióticos como la penicilina y la tetraciclina; vacunas contra enfermedades víricas y parasitarias; nuevos y más rápidos métodos de diagnóstico.

• En la agricultura y producción de alimentos: plantas resistentes a
enfermedades y mejor adaptadas a ambientes extremos; sustancias capaces de acelerar el crecimiento de los animales, vacunas contra las infecciones del ganado; alimentos para animales compuestos en gran medida por microorganismos.

• En la producción de energía: combustibles renovables, incluidos
metano e hidrógeno, y alcohol combustible para usos domésticos e industriales.

• En la industria: fuentes de enzimas fundamentales para la fabricación
de plásticos, pinturas, fibras artificiales y adhesivos; microbios que pueden extraer metales de rocas sólidas; nuevos sistemas de control de la contaminación.

83

____________________________________________________________________________Biología General

ACTIVIDADES
1. ¿Qué quiere decir la palabra microbio? 2. ¿Qué seres vivos pertenecen al reino Monera? 3. ¿Qué seres unicelulares conoce?. Indique algunos de ellos que sean perjudiciales para el hombre o para la biosfera y otros que sean beneficiosos. 4. ¿Qué grupos de microbios pueden producir enfermedades en un ser vivo? 5. Defina los siguientes términos: prión, bacteria fermentadora, bacteriófago, transformación bacteriana. 6. Los microorganismos constituyen un conjunto muy heterogéneo:

• Cite dos que presenten una organización procariota. • Mencione otros dos cuya organización sea eucariota. • Cite dos que tengan una organización vírica.
7. En el año 1928, Alexander Fleming advirtió “de forma casual” que el moho que había contaminado un cultivo de estafilococos había hecho desaparecer a su alrededor las colonias bacterianas. Esta observación fue el punto de partida de las investigaciones que, con los años, demostrarían que el moho del género Penicillium segrega una sustancia destructora de las bacterias patógenas. “El azar sólo favorece a los espíritus preparados”, Louis Pasteur.

• Desde el punto de vista de la investigación, comente brevemente el
significado de la frase de Pasteur.

• ¿Qué es un cultivo de microorganismos? • Investigue: ¿Cuáles son las principales aportaciones de Pasteur a la
ciencia?. ¿En qué época vivió?

84

____________________________________________________________________________Biología General

8. Complete las siguientes frases:

• Una célula tiene nutrición autótrofa cuando __________________________. • Una célula tiene nutrición heterótrofa cuando _________________________. • Una célula es fotosintética cuando ___________________________________. • Una célula es quimiosintética cuando ________________________________. • Una célula realiza la fermentación cuando ____________________________.
Una célula realiza la respiración cuando

______________________________.

85

____________________________________________________________________________Biología General

BIBLIOGRAFÍA SUGERIDA PARA LOS ESTUDIANTES • • • Curtis, H.; Barnes, S. Biología. Editorial Medica Panamericana. 2000. Audesirk, T.; Audesirk, G.; Byers ,B.E. Biología. La vida en la Tierra. Prentice Hall. 2003. Solomon, E.P.; Berg, R.G.; Martin, D.W.; Villee, C. Biología. Interamericana McGraw-Hill. 5ª Edición. 2001.

BIBLIOGRAFÍA CONSULTADA • • • • • • Alberts, B.; Bray, D.; Lewis, J.; Raff, M.; Roberts, K.; Watson, J.D. Biología Molecular de la Célula. Omega. 1996. Audesirk, T.; Audesirk, G.; Byers ,B.E. Biología. La vida en la Tierra. Prentice Hall. 2003. Curtis, H.; Barnes, S. Biología. Editorial Medica Panamericana. 2000. Griffiths, A.J.; Gelbart, W.M.; Miller, J.H. Lewontin, R.C. Genética Moderna. McGraw-Hill. 2000. Lehninger, A.L.; Nelson, D.L.; Cox, M.M. Principios de Bioquímica. Omega. 2000. Solomon, E.P.; Berg, R.G.; Martin, D.W.; Villee, C. Biología. Interamericana McGraw-Hill. 5ª Edición. 2001.

86

Sign up to vote on this title
UsefulNot useful