P. 1
Guia Genetica Grado Noveno

Guia Genetica Grado Noveno

|Views: 3.510|Likes:

More info:

Published by: Jaime Hernan Cortes Restrepo on Jan 30, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as DOCX, PDF, TXT or read online from Scribd
See more
See less

11/08/2015

pdf

text

original

INSTITUCIÓN EDUCATIVA PABLO SEXTO AREA DE CIENCIAS NATURALES GUIA DE GENETICA GRADO: NOVENO LOGROS

células que forme un ser vivo, estos pueden ser: UNICELULARES o PLURICELULARES. FUNCION DE NUTRICIÓN: Es el conjunto de funciones orgánicas mediante las cuales los alimentos son transformados en sustancias aptas para el crecimiento y la actividad de los seres vivos. Las células encargadas de estas funciones se llaman SOMATICAS y están en todos los tejidos pero son diferentes a los de los órganos reproductores. FUNCIÓN DE REPRODUCCIÓN: Es la función que realizan los seres vivos para producir seres iguales (clones) o al menos semejantes a ellos, con el fin de asegurar la supervivencia de las especies, las células que llevan a cabo la reproducción en los seres pluricelulares se llaman germinales o gametos; son eucariotas y su función la determina el núcleo. En toda célula la estructura fundamental para la reproducción y transmisión de caracteres es el núcleo celular, centro de control de la célula. En el núcleo están los cromosomas, si este se destruye, la célula muere. Actividad: Establece un cuadro comparativo de las células, los organelos celulares, su posición y función y completando con una buena ilustración. Los cromosomas se encuentran localizados en el núcleo de la célula y si esta no se esta dividiendo, aparece como material difuso llamado cromatina. Recuerda que los cromosomas están formados por muchos genes y que su composición química es de ADN y proteínas. Los genes tienen toda a información del individuo, así como las instrucciones para preparar sustancias que necesita, por eso es importante conocer toda la estructura molecular del material genético y la forma como funciona y como codifica la información. El ciclo celular comprende el conjunto de procesos que una célula debe realizar para cumplir la replicación exacta del ADN y la segregación (separación o división) de los cromosomas replicados en dos células distintas .son muchos los procesos reproductivos que puede realizar los organismos vivos, división binaria, gemación, esporulación que son procesos amitóticos, mitosis, meiosis, reproducción vegetativa, la reproducción meiótica es un proceso exclusivo de las células sexuales por eso mencionaremos la gametogénesis. Espermatogénesis Se realiza en los testículos Ocurre a partir de la espermatogonia Cada espermatogonia da origen a cuatro espermatozoides

    

Establece la forma como se lleva a cabo el intercambio de relaciones entre el ambiente y los seres vivos. Determina el nivel evolutivo y reproductivo de los seres vivos Analiza y explica los trabajos de Mendel en el desarrollo de la genética. Participa crítica y responsablemente en los trabajos individuales y grupales propios del desarrollo de la asignatura Realiza investigación sociológica para conocer su historia familiar, elabora su árbol genealógico

INDICADORES DE LOGROS  Analiza la importancia de la reproducción en la conservación de las especies  Justifica la importancia de la genética en el mejoramiento de las especies  Analiza y explica las Leyes de Mendel.  Realiza correctamente ejercicios sobre las Leyes de Mendel  Conoce la importancia de la recombinación genética.  Realiza un árbol genealógico de su familia.  Comprende el código genético en la formación de proteínas.  Realiza correctamente una figura representativa de la molécula de la doble hélice del ADN.  Realiza eficientemente ejercicios sobre trascripción y traducción del código genético.  Comprende cómo afectan las mutaciones la síntesis de proteínas. FUNDAMENTACIÓN LA GENETICA La reproducción es el proceso mediante el cual los seres vivos originan otros seres semejantes para conservar la especie. La reproducción puede ser asexual o sexual; la asexual se realiza dsin la intervención de gametos, y la sexual por medio de gametos masculinos y femeninos maduros. Los seres vivos están constituidos por unidades estructurales, las células. Según el número de

En la meiosis el material se divide equitativamente Los espermatozoides se producen durante toda su vida Se produce en el hombre De un espermatocito I, se forman 4 espermatozoides funcionales. Ovogénesis Se realiza en los ovarios Ocurre a partir de la ovogonia Cada ovogonia da origen a un ovocito II el cual sólo en el caso de ser fecundado pasará a llamarse óvulo y a 2 cuerpos polares I y a un cuerpo polar II (sólo en caso de fecundación). En meiosis I no se divide el citoplasma por igual, quedando una célula hija (ovocito II) con casi todo el citoplasma La mujer nace con un número determinado de Folículos, aproximadamente 400.000 Se produce en la mujer De un ovocito I, se forma un óvulo funcional. SEMEJANZAS ENTRE ESPERMATOGÉNESIS Y OVOGÉNESIS Ambos son sub-procesos de la gametogénesis Los 2 producen gametos En ambos se produce la meiosis Los 2 son procesos de la reproducción sexual en mamíferos Ambos procesos se producen dentro de las gónadas Los 2 inician sus fases a partir de la meiosis

Meiosis Exceptuando los cromosomas que determinan el sexo (cromosomas sexuales), cada núcleo diploide contiene dos versiones muy semejantes de cada uno de los otros cromosomas (autosomas), una de las cuales procede del padre y otra de la madre. Ambas versiones se llaman cromosomas homólogos. En el caso del ser humano, existen 23 parejas de cromosomas homólogos. Cada pareja se diferencia de las demás en su forma, tamaño, tinción, etc. Todos los cromosomas autosómicos son casi idénticos y se nombran del 1 al 22, mientras que los cromosomas sexuales son diferentes y se nombran Y y X. En la imagen podéis ver el mapa cromosómico (conjunto de cromosomas organizados por parejas homólogas) del ser humano. Esquema del mapa cromosómico humano Las únicas células diploides que pueden realizar la meiosis se encuentran en los órganos reproductores masculino y femenino, y como resultado originan las células reproductoras o gametos, que son haploides. El proceso de formación de las células reproductoras se denomina gametogénesis. La gametogénesis de espermatozoides se denomina espermatogénesis, y la de óvulos, ovogénesis u ovogénesis.

El ADN y ARN es el material genético que está presente en el núcleo de las células, se representa mediante las siguientes moléculas químicas, en las cuales el ADN acido desoxirribonucleico se visualiza como una doble cadena de nucleótidos conformados por: fosfato, base nitrogenada que puede ser Adenina(A), Timina (T), Citosina (C) , Guanina(G) y un azúcar tipo pentosa llamado Desoxirribosa, y con polaridad que lo ubica para la lectura desde el extremo 3’ a 5’, ubicados como una escalera en espiral, la célula lo sintetiza para copiar el mensaje recibido y esto lo hace colocando las bases nitrogenadas en los peldaños de dicha escalera de tal forma que se aparea así: A-T y C- G, y el fosfato con el azúcar permanecen constantes , semejándose a la estructura rígida de la escalera. ACTIVIDAD Consulta el modelo de WATSON Y CRICK Estructura de doble espiral del ADN.

por una cadena sencilla de nucleótidos en los cuales las bases nitrogenadas son Adenina(A), Uracilo(U), Citosina (C) y Guanina(G);un fosfato y un azúcar tipo pentosa que en este caso se denomina Ribosa, las bases nitrogenadas se aparean así: A-U y C-G, al igual que el ADN tiene polaridad 3’ a 5’ y lo más importante es que el ARN se forma a partir del ADN es decir por cada cadena de ADN se forma un ARN diferente, el cual traduce el mensaje y lo envía para ser codificado por medio de los diferentes ARNs ¿ Como se llaman los diferentes ARN y que función cumplen? y solo así se lee el mensaje cuando se ha codificado una serie de aminoácidos y se halla recibido los mensajes de iniciar la lectura (AUG) que codifica la señal de inicio pero que también se lee como Metionina y así se lee cada tres bases nitrogenadas, lo que se conoce como codón hasta cuando se dé nuevamente el mensaje para terminar de hacerlo,(UAA, UAG o UGA) que traducen pare. A continuación estudiaremos la forma de leer los mensajes del ADN mensajero y realizaremos ejercicios de duplicación de la cadena de ADN y la codificación del ARN, utilizando los nucleótidos y la siguiente tabla: ejemplo

sintesis de proteinas. ARN El ARN También es material genético presente en los cromosomas de la célula, está conformado

ejemplo:

e. Que diferencias existen entre los azucares del ADN y el ARN f. Por qué se dice que el ADN está al servicio de la justicia y las ciencias forenses, justifique su respuesta Selecciona la respuesta adecuada 4. La mitosis difiere de la meiosis en que: a.. la mitosis da origen a dos células hijas y la meiosis da origen a cuatro células hijas b. en la mitosis hay apareamiento de cromosomas homólogos y en la meiosis no.

ACTIVIDAD: 1. DEFINA LOS SIGUIENTES TERMINOS: Mitosis, meiosis cromosomas, genes, código genético, aminoácido, mutaciones, genoma humano, manipulación genética, clonación, codón, nucleótido, base nitrogenada, ADN, ARN, ARNt, ARNr, ARNm. 2. Dibuje un fragmento del ADN, e identifique las partes que lo conforman 3. Realice los siguientes ejercicios a. Del siguiente fragmento de una cadena de ADN complete, La cadena complementaria de ADN, las cadenas de ARN, señale la polaridad y trate de encontrar el mensaje que traduce cada uno de los codones encontrados, no olvide utilizar la tabla del código genético. 3’ TACCGATTACGTGGCTAGTCACGTAGC TCAGCTCAGCGCTCAGGAGTCGTAGG CTAGGGTGGGGGTTTAAACCCCTGGC CCAAATATCGGTACGTCAGTCGATCGT TGACTGCAGTGTCAGCCCTTAAA 5’ b. De la siguiente secuencia de amino acidos obtenga: el ARN, ADN correspondiente Fen-leu-ser-ser-tyr-his—ala-ala-met-lis-gly-ser-val trp-ser-glu-Asn-pro-leu-tir-tir-val-fen- his –pare. c. Identifique los codón que se forma : 3’AUCUUUACUAUGGUCACUUUGAGCGUC ACUGCUACGUACGUACGUUGCAAUGCCG GUAAUGCUGCAUGUCGAUUCGCAUCGCA UU5’ d. Como se puede presentar las mutaciones en el código genético?

c. la mitosis es la división de las células sexuales y la meiosis de las células somáticas. d. la mitosis genera variabilidad genética y la meiosis produce células idénticas a la madre. 5. Cual fue el aporte de Watson y Crick en el estudio de la genética. 6. consulta y comparte con tus compañeros sobre la utilización del ADN en la detección de enfermedades, los cultivos y la biodiversidad. GUIA GENETICA SEGUNDA PARTE FUNDAMENTACIÓN GENETICA: Es la rama de las ciencias que estudia la herencia y la trasmisión de las características hereditarias de un individuo a otro de la misma especie. Durante el siglo XIX se establecieron los fundamentos de la genética, aunque se desarrolló completamente en el siglo XX. Esta rama de las ciencias naturales estudia la transmisión, de las semejanzas y las diferencias entre los individuos con ascendencia común. Usa conocimientos de botánica, zoología, bioquímica, estadística. La aplicación de la genética en el campo agropecuario ha permitido seleccionar variedades de plantas y animales de mayor producción que sus antecesores. En el campo industrial, los procedimientos biotecnológicos, aplican la genética para obtener hormonas,

vacunas, ácidos orgánicos, interferón, y muchos otros productos. La evolución de las especies vivientes se aplica en parte, por la aparición gradual de variantes genéticas a causa de las mutaciones. LEYES DE MENDEL Desde los albores de la civilización humana fue evidente que los miembros de una misma familia presentaran rasgos físicos semejantes. Este fenómeno se observaba también en los linajes de animales domésticos y en las plantas que se reproducían mediante semillas. Sobre la naturaleza de la transmisión de los caracteres de una generación a otra formularon diversas teorías. Hacia la misma época en que Darwin escribió el origen de las especies, Gregory Mendel (1822-1884), u sacerdote agustino de nacionalidad austríaca, realizo una serie de experimentos que habrían de conducir a un nuevo concepto sobre los mecanismos de herencia. La gran contribución de Mendel, señala el comienzo de la genética. La gran contribución de Mendel consistió en demostrar que las características hereditarias se transmiten de una generación a otra a través de factores y sus trabajos se realizaron con plantas de guisantes razón por la cual debemos repasar la reproducción en los vegetales.(órganos reproductores, reproducción vegetativa y relacionarla con la transmisión de características de una planta a otra)

ACTIVIDAD INDIVIDUAL: Para entender el tema de la genética es necesario que aprendamos los términos claves y así se puede trabajar con los cálculos matemáticos propios del tema a los que llamaremos probabilidades genéticas Consulta los siguientes términos: Herencia, genes, generación parental, alelos, cariotipo, híbridos, primera generación, segunda generación, fenotipo, genotipo, cruces genéticos, homocigoto, heterocigoto, especie, filial, generación, dominancia, recesibilidad, semilla ACTIVIDADES GRUPALES 1. A partir del grafico anterior describa las características que tuvo en cuenta Mendel con las plantas de guisantes 2. Enuncie las leyes de Mendel, pero analiza las gráficas para tratar de deducirlas antes de consultarlas

Características de las plantas que tuvo en cuenta Mendel para sus estudios genéticos.

3. Explica en el grafico cuál de las leyes de Mendel se está expresando, y los genotipos y fenotipos de padres e hijos

aspectos físicos que son comunes para varios miembros o aquellos que aparecen esporádicamente en algunos como por ejemplo a. OJOS, color, tamaño, parpados, las pestañas, las cejas , entre otros

b. CABELLO, color, forma c. NARIZ, tamaño, forma d. LENGUA, en U, en W, tamaño e. OREJAS, tamaño, forma f. MENTON, forma, tamaño, partido

g. ESTATURA, 4. como se llama la segunda ley de Mendel y como explicas en el grafico la aparición de un ratón café 5. Escribe el fenotipo y el genotipo representado en los graficos 6. Cómo son los padres y que características presentan los hijos en el cruce que representa la tercera ley de Mendel También se podrá tener en cuenta enfermedades, mutaciones o síndromes que puedan aparecer, Sólo cuando tratamos de conocer nuestros ancestros podremos saber la frecuencia en que aparece dichas características; ahora recopila fotografía, escucha historias y arma tu propia historia la cual podrás tener en el medio virtual como lo es la pagina Myheritage.com en la cual colocaras tus datos y realizaras tu árbol genealógico, cuentale a los miembros de tu familia en que consiste el trabajo para que ellos también formen parte de la investigación y recopilación de imágenes. En clase te daremos las indicaciones pertinentes para que inicies tu trabajo, manos a la obra y buena suerte futuro investigador. RECUERDA QUE ES IMPORTANTE CONOCER LOS ENUNCIADOS E LAS LEYES DE MENDEL, PERO LO MAS IMPORTANTE ES SABER INTERPRETARLOS Y APLICARLOS A NUESTRO PROPIO ESTUDIO Leyes de Mendel 7. describe el Fenotipo y el Genotipo que se representan en el gráfico anterior, resaltando las características dominantes y recesivas que se encuentran en estos cruces genéticos. LAS LEYES DE MENDEL SE APLICAN A TODOS LOS SERES VIVOS Y SUS DESCENDIENTE Ahora miremos en cada una de nuestras familias las características genéticas que son dominantes y cuales son recesivas, como podremos analizar 1. Primera ley de Mendel LEY DE LA UNIFORMIDAD Cuando dos individuos de raza pura se crucen todos sus hijos 100% serán iguales entre sí, heterocigotos 2. Segunda ley de Mendel LEY DE LA SEGREGACION O DISTRIBUCIÓN DE CARACTERES Cuando dos individuos se cruzan, sus genes se separan para ser entregados en forma independiente En este caso se

puede encontrar 16 posibilidades de aparición de las carcteristicas 3. Tercera ley de Mendel LEY DE LA INDEPENDENCIA DE CARACTERES O RECOMBINACIÓN INDEPENDIENTE Cuando se cruzan individuos que difieren en dos o más características, un determinado carácter se transmitirá de generación en generación en forma independiente a los demás. APLICACIÓN MENDEL DE LAS LEYES DE

homocigotos o heterocigotos las características parentales.  Genética humana genética humana describe el estudio de la herencia biológica en los seres humanos. La genética humana abarca una variedad de campos incluidos: la genética clásica, citogenética, genética molecular, biología molecular, genómica, genética de poblaciones, genética del desarrollo, genética médica y el asesoramiento genético. El estudio de la genética humana puede ser útil ya que puede responder preguntas acerca de la naturaleza humana, comprender el desarrollo eficaz para el tratamiento de enfermedades y la genética de la vida humana. Grupo sanguíneo

A. CRUCES MONOHIBRIOS: en este tipo de cruces sólo se tiene en cuenta una característica para ser analizado: se cruzan plantas de flores rojas homocigotas RR con flores blancas homocigotas rr, como serán sus descendientes? Da como resultado 4 posibilidades diferentes, dependiendo si son heterocigotos, pero con padres homocigotos todos los hijos serán iguales entre sí B. CRUCES DIHIBRIDOS en ellos se tienen en cuenta dos características como por ejemplo Cabello forma y color, diferentes para los padres y se analiza la probabilidad de aparición en los hijos. En este caso se puede encontrar 64 posibilidades de aparición de las características C. Ejercicios y elaboración de cuadros de Punnet

El tipo de sangre es determinado, en parte, por los antígenos de los grupos sanguíneos A, B, O presentes en los glóbulos rojos y blancos, inclusive. Un grupo sanguíneo es una clasificación de la sangre de acuerdo con las características presentes o no en la superficie de los glóbulos rojos y en el suero de la sangre. Las dos clasificaciones más importantes para describir grupos sanguíneos en humanos son los antígenos (el sistema ABO) y el factor Rh. El sistema ABO fue descubierto por Karl Landsteiner en 1901, convirtiéndolo en el primer grupo sanguíneo conocido; su nombre proviene de los tres tipos de grupos que se identifican: los de antígeno A, de antígeno B, y "O". Las transfusiones de sangre entre grupos incompatibles pueden provocar una reacción inmunológica que puede desembocar en hemólisis, anemia, fallo renal, shock y muerte. En los grupos sanguíneos se maneja codominancia, razón por la cual representamos las dos letras mayúsculas. PADRES OxO HIJOS POSIBLES O HIJOS NO POSIBLES A-B- AB

Se cruzan un caballo negro y uno blanco, ambos homocigotos, tienen todos sus descendientes negros heterocigotos, dos de estos caballos se cruzan, que descendientes pueden tener? Indica para el ejercicio anterior los porcentajes que son posibles en la descendencia, el genotipo y el fenotipo Mi tipo de sangre es___, averiguo el tipo de sangre de mi papá y de mi mamá y elaboro el cruce genético en un cuadro de Punnet, puedo tener en cuenta el de mis hermanos para predecir si son

OxA AxA OxB BxB AxB

O–A O–B O–A B - AB A–B A – B - AB

B – AB A – AB

-----O – AB

O x AB A x AB B x AB AB x AB

O

Los cuadros de los grupos sanguíneos entre padres y sus descendientes, son útiles en casos de medicina legal, pero no en todos donde se discuta la paternidad responsable. HERENCIA DEL FACTOR Rh En 1940, el Dr. Landsteiner descubrió otro grupo de antígenos que se denominaron factores Rhesus (factores Rh), porque fueron descubiertos durante unos experimentos con monos Rhesus. Las personas con factores Rhesus en su sangre se clasifican como Rh positivas; mientras que aquellas sin los factores se clasifican Rh negativas. Las personas Rh negativas forman anticuerpos contra el factor Rh, si están expuestas a sangre Rh positiva. Los antígenos del sistema Rh son de naturaleza proteica. El antígeno D posee la mayor capacidad antigénica. Antígeno. Son moléculas capaces de desencadenar una respuesta inmunitaria por parte del organismo. El principal problema es que cuando se posee un antígeno, se poseen anticuerpos contra el resto de antígenos. Todo ser humano posee para el grupo sanguíneo y para el Rh dos alelos, luego todos los genotipos y sus fenotipos posibles son los siguientes:

Cromosomas sexuales XX y XY no solo definen el sexo de la descendencia. HERENCIA LIGADA AL SEXO El estudio de la herencia humana se ha dificultado por varios factores entre los que podemos destacar  Reducido número de hijos  Largo periodo de gestación  Tiempo largo para llegar a ser fecundables ( a partir de la madurez sexual) Por lo tanto se estudia las historias familiares o el árbol genealógico y se ha logrado establecer el cumplimiento de las leyes de Mendel.

Otras características que podemos tener en cuenta para nuestro estudio genealógico que son dominantes son enrollamiento de la lengua, lóbulos de la oreja separados, presencia de vellos en las falanges, dedo anular más grande que el índice; ahora miremos algunas de estas características entre los compañeros del

grupo, cuáles de ellas serán dominantes y cuales recesivas, explica tu respuesta. COMO SE PUEDE DETERMINAR EL SEXO EN EL SER HUMANO La especie humana posee 46 cromosomas dispuestos en 23 pares, de esos 23 pares 22 son somáticos o autosomas (heredan caracteres no sexuales) y uno es una pareja de cromosomas sexuales (llamados también heterocromosomas o gonosomas), identificados como XX en las mujeres y como XY en los hombres. Esta pareja de cromosomas sexuales no solo llevan los genes que determinan el sexo, sino que también llevan otros que influyen sobre ciertos caracteres hereditarios no relacionados con el sexo. Al realizarse la fecundación existe la probabilidad de un 50% que sea hombre y un 50% que sea mujer GEMELOS También llamados Univitelinos por que se forma a partir de un solo huevo o cigoto formado por la fecundación de un ovulo y un espermatozoide, tendrán los mismos genes, el mismo sexo y se parecerá uno al otro, pero puede ocurrir que la separación no sea completa y quede entre ellos puntos de unión formándose así los siameses, que son gemelos al nacer y estarán unidos por alguna parte del cuerpo, los avaces científicos han permitido separalos siempre y cuando no se comprometa órganos o tejidos vitales .

HERENCIA LIGADA AL SEXO EN EL SER HUMANO Herencia ligada al cromosoma X. La herencia ligada al cromosoma X quiere decir que el gen que causa el rasgo o el trastorno se localiza en el cromosoma X . Cabe recordar que las mujeres poseen dos cromosomas X mientras que los hombres poseen un cromosoma X y un cromosoma Y. Los genes del cromosoma X pueden ser recesivos o dominantes, y su expresión en las mujeres y en los hombres no es la misma debido a que los genes del cromosoma Y no van apareados exactamente con los genes del X. Los genes recesivos ligados al cromosoma X se expresan en las mujeres únicamente si existen dos copias del gen (una en cada cromosoma X). Sin embargo, en los varones sólo debe haber una copia de un gen recesivo ligado al cromosoma X para que el rasgo o el trastorno se exprese. A. Por ejemplo, una mujer puede ser portadora de un gen recesivo en uno de sus cromosomas X sin saberlo y transmitírselo a su hijo, que expresará el rasgo o el trastorno. Herencia ligada a X y ligada a Y Los genes ligados a X se encuentran en el cromosoma sexual X y, tal como los genes autosómicos, tienen tipos recesivos y dominantes. Los desórdenes recesivos ligados a X raramente son vistos en mujeres y usualmente afectan únicamente a hombres. Esto es debido a que los hombres heredan su cromosoma X (y todos los genes ligados a X) de su madre. Los padres únicamente pasan su cromosoma Y a sus hijos varones, así que ningún rasgo ligado a X es pasado de padre a hijo. Las mujeres expresan desórdenes ligados a X cuando son homocigotas para el mismo y se convierten en portadoras cuando son heterocigotos. Un desorden ligado a X es la Hemofilia A. La hemofilia es un desorden en el cual la sangre no coagula eficientemente debido a una deficiencia en el factor de coagulación VIII.

MELLIZOS: Se forma cuando una mujer es muy fértil y produce dos o más óvulos y estos son fecundados, cada uno por un espermatozoide diferente, pueden ser con caracteres diferentes y podrán ser de diferente sexo

Entre los ejemplos de trastornos recesivos ligados al cromosoma X se destacan los casos del daltonismo y la hemofilia, miopía, enfermedades provocadas por un gen recesivo situado precisamente en el segmento diferencial del cromosoma X. Recalcamos que, debido a su ubicación, para que una mujer padezca la enfermedad debe ser homocigota recesiva (tener el gen recesivo en ambos cromosomas X), mientras que en los hombres basta con que el gen recesivo se encuentre en el único cromosoma X que tienen. Daltonismo Esta enfermedad, determinada por un gen recesivo del cromosoma X, es una anomalía que consiste en la incapacidad de distinguir los colores rojo y verde. Se suele llamar también ceguera para los colores, y hay muchos tipos. La enfermedad fue descrita por una persona afectada, el químico inglés John Dalton, en 1794. El nombre de esta alteración hace referencia, precisamente, a este científico. Como ya dijimos, el gen responsable de la enfermedad es recesivo y su presencia origina el daltonismo en el hombre, mientras que la mujer que lo posee es portadora y no lo manifiesta. Para que una mujer sea daltónica es necesario que tenga genes del daltonismo en los dos cromosomas X (homocigota) , lo cual es bastante poco frecuente EJEMPLOS: 1. Madre normal (XNXN) y padre normal (XNY): XN XN Y XNXN X NY XN XNXN X NY

Todas las hijas portadoras (100 por ciento) y todos los hijos hijos normales (100 por ciento). Hemofilia La hemofilia A es un trastorno en el cual la sangre no coagula adecuadamente debido a una insuficiencia del factor de coagulación llamado Factor VIII. El resultado es un sangrado abundante anormal que no se detiene, aun en el caso de una cortadura pequeña. A las personas con hemofilia A les aparecen moretones con facilidad y pueden tener hemorragias internas dentro de las articulaciones y los músculos. La hemofilia A ocurre en uno de cada 10.000 varones recién nacidos.

ACTIVIDAD  Considere los siguientes casos transmisión de estas enfermedades:  Hombre enfermo con mujer normal  Hombre normal con mujer portadora  Hombre enfermo y mujer portadora Realice los cruces, haga los cuadros, analice resultados, saque conclusiones y los más importante sustente.  Consiga láminas o fotografías de gemelos, mellizos, siameses y haga un mapa conceptual con semejanzas y diferencias entre ellos.  En caso de accidente por qué se debe atender rápidamente a los hemofílicos y que deben llevar para identificarlos.  Explique los términos Donante universal y Receptor universal en cuanto a los grupos sanguíneos  Como influye el factor Rh en los grupos sanguíneos. para

Ninguno de sus hijos (hombres y mujeres) será daltónico ni portador. 2. Madre normal (XNXN) y padre daltónico (XdY): XN Xd Y XdXN X NY XN XdXN X NY

MALFORMACIONES CROMOSOMICAS Los procesos de mitosis y meiosis son tan perfectos que en muy pocas ocasiones ocurren malformaciones; sin embargo entre ellas podemos considerar los síndromes de Down, Turner y Klinefelter en los cuales se presenta monosomias, trisomías o delecciones LAS MUTACIONES son cambios repentinos en la estructura del ADN, algunas consideradas variaciones genéticas pero otras solo son alteraciones en el número total de los cromosomas; algunas de las mutaciones pueden darse de manera natural (o al azar ) o inducida provocada por agentes mutagénicos como los son las radiaciones alfa, beta gama, x, contacto con agentes químicos, alcohol, drogas, sustancias del ambiente entre otros. Ejemplos de autosómicos: rasgo dominante y los trastornos son la enfermedad de Huntington y la acondroplastia. Herencia autosómicos recesiva. El carácter autosómicos recesivo es un patrón de herencia de un rasgo, enfermedad o trastorno que se transmite a través de las familias. Para que un rasgo o enfermedad recesiva se manifieste, dos copias del gen (o los genes) responsable de la aparición de ese rasgo o desorden tienen que estar presentes en el genoma del individuo Debido al hecho de que se necesitan dos copias de un gen para expresar la característica, muchas personas pueden, sin saberlo, ser portadores de una enfermedad. De un aspecto evolutivo, una enfermedad o rasgo recesivo puede permanecer oculto durante varias generaciones antes de mostrar el fenotipo. Ejemplos de trastornos autosómica recesiva son albinismo, fibrosis quística, enfermedad de TaySachs B. . En personas con desórdenes como trisomía X, en la cual el genotipo presenta tres cromosomas X, la inactivación de X desactivará todos los cromosomas X hasta que sólo quede uno activo. La inactivación de X no sólo se limita a las mujeres: hombres con el síndrome de Klinefelter, que tienen un cromosoma X extra, también sufrirán inactivación de X para tener sólo un cromosoma X completamente activo. La herencia ligada a Y ocurre cuando un gen, rasgo o desorden se transfiere a través del cromosoma Y. Como los cromosomas Y sólo se encuentran en hombres, los rasgos ligados a Y sólo son transmitidos de padre a hijo. El factor determinante de testículos, que está localizado

en el cromosoma Y, determina la masculinidad de los individuos Cariotipo Un cariotipo es una herramienta muy útil en citogenética. Un cariotipo es la imagen de todos los cromosomas en la etapa de metafase organizado en función de la longitud y la posición del centrómero. Un cariotipo puede ser útil también en genética clínica, debido a su capacidad para diagnosticar trastornos genéticos. En un cariotipo normal, la aneuploidía puede ser detectada con claridad por la posibilidad de observar cualquier cromosoma faltante o adicional.1 C. Trastornos genéticos.

Los seres humanos tienen varias enfermedades genéticas, a menudo causadas por genes recesivos. Algunos ejemplos de enfermedades genéticas humanas son: el síndrome de Turner, la enfermedad de Huntington, el cáncer, el autismo y la anemia de células falciformes.

Síndrome del maullido del gato- Un trastorno causado por una delección en el brazo corto del cromosoma 5. Esta supresión se traduce en un fenotipo de retraso mental, problemas de comportamiento, y un llanto parecido al maullido de un gato. Aproximadamente uno de cada 50.000 nacimientos tendrá el síndrome.4 Enfermedad de Huntington- Un trastorno neurológico causado por una secuencia repetitiva de un trinucleótido. Huntingtons es un rasgo autosómico dominante. La mayoría de los individuos con la enfermedad muestran el fenotipo por primera vez alrededor de los 40 años de edad. Los síntomas son movimientos incontrolables, retraso mental y problemas de comportamiento.5 Síndrome de Turner- Es una enfermedad genética rara caracterizada por presencia de un solo cromosoma X. Fenotípicamente son mujeres (por ausencia de cromosoma Y). A las mujeres con síndrome de Turner les falta parte o todo un cromosoma X. La falta de cromosoma Y determina el sexo femenino de todos los individuos afectados, y la ausencia del segundo cromosoma X, la falta de desarrollo de los caracteres sexuales primarios y secundarios. Esto confiere a las mujeres que padecen el síndrome de Turner un aspecto infantil e

infertilidad de por vida. Su incidencia es de alrededor de 1 de cada 2.500 niñas.

glucosa que puede producir diabetes, cansancio excesivo, amenorrea en mujeres, y euforia u otros síntomas sicológicos. ACTIVIDAD FINAL DE GENETICA NO OLVIDE SUSTENTAR SUS RESPUESTAS, NO BASTA CON SEÑALAR, DEMOSTREMOS QUE SE CUMPLIÓ CON EL OBJETIVO DE TRABAJAR CON GUIAS Completa los espacios en blanco 1. La apariencia externa de un organismo se llama_________ 2. El fenotipo esta determinado por la dotación genética llamada___________adquirida en la reproducción de sus progenitores 3. Los genes se localizan en pares en ____________ 4. Un gen puede presentarse en dos formas llamadas________ y cada una es capaz de determinar una característica contraria( alto, bajo) 5. Los alelos se nombran con letras mayúsculas si se trata d un gen que se manifiesta sobre otro y se llama____________ 6. Si los alelos de un par de genes son iguales el organismo es_________con especto a dicho par ( AA- aa) 7. Si los genes son diferentes, el organismo es:_____________ 8. El científico considerado el padre de la genetia es_______________________ 9. Cuando en un cruce no aparece caracteres de ningún progenitor sino que se presenta un intermedio entre ellos debido a la dominancia incompleta de los caracteres se llama_________ 10. El ser humano viene determinado por los cromosomas ___________que además de portar los genes para determinar el sexo, contiene otros genes responsables de otras carcteristicas. 11. La hemofilia es una enfermedad recesiva ligada al cromosoma_ y solo la padecen los________; como justificas tú el hecho que las mujeres portemos la enfermedad pero no seamos enfermas?

Síndrome de Klinefelter- Un trastorno en los hombres provocado por la presencia de un cromosoma X adicional. Estas personas tienen un genotipo de 47 XXY en vez del normal XY. Los síntomas de este síndrome son los senos agrandados, testículos pequeños, y la esterilidad

Síndrome de Down: antes llamado mongolismo, malformación congénita causada por una alteración del cromosoma 21 que se acompaña de retraso mental moderado o grave. Los enfermos con síndrome de Down presentan estatura baja, cabeza redondeada, frente alta y aplanada, y lengua y labios secos y fisurados. Presentan epicanto, pliegue de piel en la esquina interna de los ojos. Las palmas de las manos muestran un único pliegue transversal, y las plantas de los pies presentan un pliegue desde el talón hasta el primer espacio interdigital (entre los dos primeros dedos). En muchos casos padecen cardiopatías congénitas y tienden a desarrollar leucemia. El cociente de inteligencia (CI) varía desde 20 hasta 60 (una inteligencia media alcanza el valor 100), pero con procedimientos educativos específicos y precoces, algunos enfermos consiguen valores más altos. La incidencia global del síndrome de Down se aproxima a uno de cada 700 nacimientos, pero el riesgo varía con la edad de la madre. La incidencia en madres de 25 años es de 1 por 2000 nacidos vivos, mientras que en madres de 35 años es de 1 por cada 200 nacimientos y de 1 por cada 40 en las mujeres mayores de 40 años. La anomalía cromosómica causante de la mayoría de los casos de síndrome de Down es la trisomía del 21, presencia de tres copias de este cromosoma. Por tanto, los pacientes presentan 47 cromosomas en vez de 46.

Síndrome de Cushing: grupo de trastornos similares descritos por primera vez por Harvey Williams Cushing en 1932 y producido por niveles elevados de glucocorticoides circulantes, en particular de cortisol. Los síntomas que se presentan son: enrojecimiento de las mejillas, obesidad en el tronco, aumento del apetito, cara de luna llena, piel fina que se lesiona con facilidad, mala cicatrización de las heridas, aumento de la susceptibilidad a las infecciones, debilidad y atrofia de los músculos proximales, hipertensión, acné, osteoporosis, intolerancia a la

12. La herencia de los grupos sanguíneos está determinada por un par de alelos múltiples, siendo el A y B___________ el AB es una herencia_________y el grupo O es recesivo 13. El factor Rh es también una característica heredada, la presencia de la proteína en el plasma es una característica dominante Rh + pero su ausencia está determinada en forma recesiva o____________ 14. Los cambios inesperados o errores genéticos que se suceden en la transmisión de los caracteres hereditarios se llaman__________________ 15. En la siguiente sopa de letras encuentras los nombres de autores de teorías sobre la evolución y términos empleados en genética A L E L O L O C U S F E O A M A B C R S E N A M O R G D M G N P K A P K E N E E O D A R W I N O N N T N B C K O M P D O I A T K M N I K E T P R O I N B P R L I O S H I B R I D O P D O M I N A N T E O

  

Autor de la teoría de selcción natural Autor de la teoría de caracteres adquiridos Individuo resultante del cruce de dos especies

17. Realiza los cruces genéticos del libro contextos naturales 9 paginas 14, 15, 23 18. A que se refiere el termino dominancia incompleta, de 2 ejemplos. 19. Lee la guía con atención y señala las palabras de difícil comprensión, consúltalas en el diccionario. 20. Elabora un crucigrama con treinta conceptos empleados en la temática de genética 21. Elabora un mapa conceptual con la temática expuesta en la guía de genética y susténtala. 22. Solicita al docente los cuadernillos de pruebas saber, para que puedas resolver estos cuestionarios con mucha responsabilidad y sobre todo aclara dudas en la forma como se plantean las pruebas de estado.

16. Utiliza las pistas dadas a continuación y recorre la sopa de letras en forma horizontal y vertical únicamente colocando en frente la palabra que le corresponde         Gen de una pareja que controla una misma característica Acido nucleico que interviene en la herencia Lugar donde se localiza un gen Autor de las leyes sobre la herencia Carácter que predomina sobre otro Unidad hereditaria localizada en el cromosoma Apariencia externa de un individuo Suma total de genes heredados

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->