P. 1
Mutagénesis

Mutagénesis

|Views: 1.918|Likes:
Publicado porMati Hartman

More info:

Categories:Types, School Work
Published by: Mati Hartman on Sep 10, 2012
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PPTX, PDF, TXT or read online from Scribd
See more
See less

10/17/2013

pdf

text

original

Mutagénesis

Ingeniería y Diseño Enzimático
Lic. Hartman Matías

2012

Definición

Alteración de la secuencia de ADN de un organismo. La forma sin modificaciones del ADN (salvaje o wild type, WT) se convierte en otra, portadora de la modificación, denominada mutante. Las mutaciones tienen lugar en todo el genoma, nuclear o mitocondrial, en secuencias codificantes o no y en distintos tipos de células.

Hacia los años ‘80, el estudio de los mecanismos implicados en los procesos de catálisis, activación o inhibición, eran realizados por modificación química de proteínas.

Actualmente existen metodologías que pueden aportar información novedosa y complementaria a la obtenida por modificación química, como las técnicas de Mutagénesis.

Clasificaciones  Según tipo de célula  Germinal (heredable)  Somática (no heredable)  Según magnitud  Grandes mutaciones (anomalías cromosómicas)  Mutaciones “medianas”  Mutaciones pequeñas o puntuales .

alquilantes e intercalantes bifuncionales  Agentes físicos: radiaciones UV y radiaciones ionizantes  Agentes biológicos: virus y transposones . mutágenos endógenos.  Mutaciones exógenas (inducidas)  Agentes químicos: acción directa. inestabilidad química N-glicosídica.Clasificaciones  Según mecanismo  Mutaciones endógenas (espontáneas) Errores en la replicación. desaminación oxidativa de bases.

Mutaciones puntuales  Generalmente implican un sólo nucleótido  Generan cambios que podrían afectar la estructura y función de las proteínas. wild type : 5'-ABCDEFGHIKLM-3' SUSTITUCIÓN INSERCIÓN DELECIÓN 5'-ABCDEFXHIJKLM-3' 5'-ABCDEFGXHJIKLM-3' 5'-ABCDEF—IJKLM-3' H  Sustitución: relativamente común en ADN codificante y no codificante  Inserción: muy común en ADN codificante pero rara en ADN no codificante  Deleción: común en ADN no codificante y poco frecuente en ADN codificante Cambios en el marco de lectura .

Mutaciones puntuales PpeTRXh MDHPpTRX01 MDHPpTRX02 MDHPpTRX03 (71) (71) (55) (57) (53) 71 80 90 100 110 120 130 140 150 160 ATGGCGGAGGAAAATCAAGTCATCGGCTGCCACACTACTCAAGCCTGGGAAGAGCAGCTCCATAAGGGAAACGAGAACAAGAAACTGGTGGTGGTG ATGGCGGAGGAAAATCAAGTCATCGGCTGCCACACTACTCAAGCCTGGGAAGAGCAGCTCCATAAGGGAAACGAGAGCAAGAAACTGGTGGTGGTG ATGGCGGAGGAAAATCAAGT-AT-GGGTGCCACACTACTCAAGCCTGGGAAGAGCAGCTCCATAAGGGAAACGAGAACAAGAAACTGGTGGTGGTG ATGGCGGAGGAAAATCAAGTCATCGGCTGCCACACTACTCAAGCCTGGGAAGAGCAGCTCCATAAGGGAAACGAGAACAAGAAACTGGTGGTGGTG Asn Ser .

Arg .  Aparecen con relativamente elevada frecuencia (23-25 %)  Tercer base: GAG  GAA.Mutaciones puntuales Silenciosas  A pesar del cambio en la secuencia de ADN no se altera la secuencia de la proteína. Glu  Primer base: CUA  UUA. Leu CUG  UUG. Leu AGA  CGA.

porque codifica uno o varios AA diferentes respecto a la secuencia original  Pueden ser benéficas o perjudiciales (más frecuentes)  Mutaciones que alteran el sentido: conservadora o no conservadora  Mutaciones que cambian el marco de lectura  Mutaciones que no cambian el marco de lectura  Mutaciones con terminación prematura de la proteína  Mutaciones con terminación retrasada .Mutaciones puntuales No Silenciosas  La alteración de la secuencia de nucleótidos afecta a la proteína.

Mutagénesis Inducida  Utilización de mutágenos sobre organismos de reproducción rápida  Función de las enzimas implicadas en las principales rutas metabólicas  No es difícil obtener mutantes para determinado proceso. lo difícil es encontrar qué mutación produce el defecto de una determinada proteína.  La tecnología del ADN recombinante ha permitido simplificar y sistematizar dicho proceso .

Ingeniería de Proteínas  Diseño racional y construcción de nuevas proteínas utilizando información estructural  Se utiliza para dos propósitos: 1) Disección de la estructura y actividad de proteínas existentes mediante alteraciones sistemáticas de sus estructuras y la examinación de los cambios en sus propiedades.  El estudio se enfoca en experimentos de ingeniería de proteínas que permiten determinar qué AAs se encuentran involucrados en la unión a sustratos. activadores e inhibidores o toman parte en la catálisis. . 2) Producción de nuevas proteínas para uso en medicina e industria. como así también determinar qué regiones o AAs se encuentran comprometidos en mecanismos de activación y otras propiedades alostéricas.

Ingeniería de Proteínas  Requerimientos para estudios de mutagénesis .

Laskowski & Janet M. ya sea local o globalmente.Ingeniería de Proteínas  Elección de la mutación  Se debe minimizar la reorganización de la estructura de la enzima. Si el cambio implica la aparición de un grupo demasiado grande. lo cual generalmente representa la pérdida de energías de interacciones no covalentes. Thornton Nature Reviews Genetics 9. Una enzima suele tolerar una cavidad dentro de ella. se pueden generar energías de repulsión que deben ser reacomodadas por una distorsión en la estructura. Roman A. 141-151 (February 2008) .  La reorganización o distorsión de la estructura de la enzima se acompaña de cambios energéticos desconocidos que pueden complicar el análisis.

 Eliminar el menor número de interacciones.  No agregar nuevos grupos funcionales a las cadenas laterales. Las deleciones son preferibles a los incrementos en el tamaño de la cadena lateral. Evitar la deleción de múltiples interacciones. Esto puede provocar reorganización local de la estructura si el nuevo grupo puede realizar nuevas interacciones.Ingeniería de Proteínas  Reglas Básicas  Elegir una mutación que elimine parte de la cadena lateral o que lleve a un cambio isoestérico. . Analizar el cambio de una única interacción ya es lo suficientemente difícil.  Evitar cargas puntuales desapareadas. La remoción de un grupo que solvata una carga puntual es peligroso.

Ingeniería de Proteínas  Mutaciones adecuadas para un análisis simple Ile Val Ala Gly Thr Ser La pérdida de un grupo –CH2– es una buena prueba para poner de manifiesto interacciones hidrofóbicas. Sólo se crea una pequeña cavidad .

Ingeniería de Proteínas Ile Val Ala Leu Se produce una mayor pérdida de energía y un mayor movimiento de las cadenas laterales dentro de la cavidad que cuando las deleciones son pequeñas .

.Ingeniería de Proteínas Ser Ala Cys Tyr Phe Son buenos para probar enlaces puente de hidrógeno.

Ingeniería de Proteínas Asn His Gln Se pueden sustituir como dadores de enlaces puente de hidrógeno. .

es aceptor de puente de H. aunque incluso en este lugar es peligroso. y el grupo –CONH2 es dador y aceptor. . ya que el –COO.Ingeniería de Proteínas Asp Asn Glu Gln Esta sustitución puede ser aceptable en la superficie de una proteína.

Ingeniería de Proteínas Ala Ante la duda mutar por Ala. Este suele ser un cambio deletivo y la Ala tiene pocas peculiaridades. puede provocar efectos no deseados en la estructura. La Gly en cambio. . y debido a su mayor libertad estructural.

Ingeniería de Proteínas .

Ingeniería de Proteínas Phe Tyr .

.Ingeniería de Proteínas Los estudios completos involucran la medida del perfil de las energías libres para las proteínas WT y mutante.

Ingeniería de Proteínas .

Ingeniería de Proteínas .

Ingeniería de Proteínas .

Ingeniería de Proteínas .

Thr o Tyr) .Phosphorylation Mimic Ingeniería de Proteínas El objetivo de esta clase de mutaciones es producir una carga negativa (Aminoácidos ácidos) donde se encontraría (espacialmente) la carga del grupo fosfato en los fosfoaminoácidos (Ser.

Ingeniería de Proteínas .

Ingeniería de Proteínas .

por lo cual la secuencia wild type debe ser conocida. Las técnicas más utilizadas son: Superposición y extensión Extensión por megaprimer Intercambio de segmentos Reacción en cadena combinada (CCR) PCR inversa QuickChange (Stratagene) .Mutagénesis Sitio Dirigida Se producen modificaciones en el ADN en un sitio definido.

Mutagénesis Sitio Dirigida  Superposición y extensión * * * * * * * .

Mutagénesis Sitio Dirigida  Extensión por megaprimer .

Mutagénesis Sitio Dirigida  Intercambio de segmentos .

Mutagénesis Sitio Dirigida  PCR inversa .

Mutagénesis Sitio Dirigida  QuickChange .

Mutagénesis Sitio Dirigida .

Mutagénesis al Azar Se producen modificaciones en el ADN en un sitio indefinido. por lo cual no es necesario conocer la secuencia a mutar Las técnicas más utilizadas son: Mutágenos químicos PCR propensa a error Utilización de oligonucleótidos degenerados Mutagénesis exploratoria por pentapéptido Mezcla de ADN .

Mutagénesis al Azar  Mutágenos Químicos  Se hace reaccionar un fragmento de ADNdc con un mutágeno químico (ácido nitroso o hidroxilamina)  Se clona la mezcla de fragmentos mutados en un vector recombinante que contenga el resto del gen WT  Los vectores que poseen la mutación generalmente deben ser identificados por secuenciación  La frecuencia de recuperación de mutantes por este método es relativamente baja. .

Mutagénesis al Azar  PCR propensa a errores  En presencia de Mn2+ o concentraciones anormales de Mg2+ la enzima Taq DNA Pol se puede hacer propensa al error  Luego de varias rondas las mutaciones crecen en el ADN amplificado .

. sólo por secuenciación.Mutagénesis al Azar  Utilización de oligonucleótidos degenerados  Es útil cuando los codones a ser alterados se hallan en una secuencia corta de ADN  Las secuencias mutantes no pueden distinguirse de las WT por los métodos habituales de screening.  La introducción de oligonucleótidos en sitios de restricción facilitaría la búsqueda.

Mutagénesis al Azar  Mutagénesis exploratoria por pentapéptido  Se insertan nucleótidos en posiciones al azar en el ADN blanco.  Es útil para el estudio estructural y funcional de proteínas. del cual la mayoría se remueve por digestión con endonucleasas de restricción. Los segmentos superficiales de una proteína toleran inserciones de pocos AAs conservando su funcionalidad. no así los segmentos internos.  La religación del ADN molde resulta en la inserción de nucleótidos que incluyen sitios de restricción. . Se introduce un cassette.

Mutagénesis al Azar A B A B .

Mutagénesis al Azar  Mezcla de ADN  Fragmentación aleatoria .

Mutagénesis al Azar  Random priming recombination (RPR) .

Cuarta impresión (2002). Revision #124001e. Zipursky. Capítulo 7. Matsudaira. Lewis. (1998) Combinatorial protein desing by in vitro recombination. (1998) Site-directed mutagenesis by combined chain reaction.stratagene. Biología molecular de la célula. Freeman (New York. 335-38. http://www.com . http://www. (1999) Structure and mechanism in protein structure. Cuarta edición. España). Panamericana (Madrid. Current opinion in chemical biology 2. USA). Darnell. Berk. A guide to enzyme catalysis and protein folding. (1997) Pentapeptide scanning mutagenesis: random insertion of a variable five amino acid cassette in a target protein. Capítulo 8. Fersht. Técnicas Bi W. 343-356. Watson. Herraez. Tema 25. (1996) Tercera edición. Analytical biochemistry 256. Harcourt (Madrid. pag. (2001) Texto ilustrado de Biología molecular e ingeniería genética. pag. Raff. 1866-67. QuikChange Site-directed mutagenesis kit.Bibliografía Introducción Alberts. Inc. Technical bulletin #E7102. New England Biolabs. Hayes F.com Stratagene. Stambrook PJ. Ed. España). (2003) Biología celular y molecular. Capítulo 15. Nucleic acids research 25. Ed. Bray. Roberts. GPS-LS Linker scanning system. Hallet B. Instruction manual. Sherratt DJ. Luque. Baltimore. Giver L. 137-40. 254-293. Ed. Omega (Barcelona. Arnold FH. pag. Lodish. pag 420-456. Ed.neb. 313-358. España).

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->