Está en la página 1de 49

TRABAJOS EN BIOINFORMATICA CON SECUENCIAS EN DNA

ALEJANDRO GARCIA DE LOS REYES 070150062009

DOCTOR GUSTAVO ADOLFO VALLEJO

UNIVERSIDAD DEL TOLIMA DEPARTAMENTO DE BIOLOGIA FACULTAD DE CIENCIAS 2012

5.1 SECUENCIAS DEL GENBANK EN FORMATO FASTA PARA LA ADICIN DE VECTORES.

DEBIDO A QUE NECESITO 5 SECUENCIAS DE MENOR TAMAO A 1000BP TOMAR OTRO ORGANISMO PARA ESTE EJERCICIO. ORGANISMO: Rattus norvegicus

SECUENCIA #1

SECUENCIA #3

SECUENCIA #2

SECUENCIA #4

SECUENCIA #5

SECUENCIA #1 VECTOR #1 VECTOR #2

Vector 1 (210pb)

Vector 2 (140pb)

SECUENCIA #2 VECTOR #3 VECTOR #4

Vector 3 (210pb)

Vector 2 (140pb)

SECUENCIA #3 VECTOR #5 VECTOR #6

Vector 5 (210pb)

Vector 6 (140pb)

SECUENCIA #4 VECTOR #7 VECTOR #8

Vector 7 (210pb)

Vector 8 (140pb)

SECUENCIA #5 VECTOR #9 VECTOR #10

Vector 9 (210pb)

Vector 10 (140pb)

5.2 LIMPIEZA Y EDICIN DE SECUENCIAS

5.3. OBTENCIN Y ANLISIS DE MAPAS DE RESTRICCIN DE LAS SECUENCIAS

SECUENCIA N1
Van91I Esp1396I DraII BsaWI gtgaaaggctagttggggccagagaatgggaaccagccaaagtctctaggccccgccctgggcggaagaaaccgg base pairs cactttccgatcaaccccggtctcttacccttggtcggtttcagagatccggggcgggacccgccttctttggcc 1 to 75 PflMI EcoO109I AccB7I AccB1I Bbv12I PpuMI Eco64I Alw44I DraII NspBII VneI AspHI agcgactgggacctttagcagcggcaccagactacactgtgcacccaccatgagtcttgacatccagtgtgagca base pairs tcgctgaccctggaaatcgtcgccgtggtctgatgtgacacgtgggtggtactcagaactgtaggtcacactcgt 76 to 150 EcoO109I MspA1I ApaLI Psp5II BanI Alw21I BshNI BsiHKAI Eco24I AspHI MspA1I Alw21I SstI NspBII EcoICRI Bbv12I gctgagtgatgcccggtggacagagctccttcccctgatccaacaataccaagtggtcaggctggatgactgtgg base pairs cgactcactacgggccacctgtctcgaggaaggggactaggttgttatggttcaccagtccgacctactgacacc 151 to 225 PvuII Ecl136II BsiHKAI BanII SacI FriOI Psp124BI Bsp1720I SacI AhdI Bpu1102I Bbv12I MslI AspEI EcoICRI Eco24I cctcactgaagtgcggtgcaaagacatcaggtcagcgatccaggccaaccctgccctgacagagctcagcctacg base pairs ggagtgacttcacgccacgtttctgtagtccagtcgctaggtccggttgggacgggactgtctcgagtcggatgc 226 to 300

Eco57I

EclHKI Eam1105I

Ecl136II FriOI BlpI Alw21I CelII BanII

DraII SfcI BsiHKAI BstSFI MflI SstI BstXI Alw21I BpmI PstI BstX2I caccaatgaactgggtgatgctggtgtgggtctggtgctccagggcctgcagaatcccacttgtaagatccagaa base pairs gtggttacttgacccactacgaccacacccagaccacgaggtcccggacgtcttagggtgaacattctaggtctt 301 to 375 AspHI Bbv12I AlwNI XhoII Psp124BI AspHI GsuI BstYI BsiHKAI EcoO109I CelII BlpI SfcI PpuMI AlwNI Eco57I PstI DraII AccI gctgagccttcagaactgcagcttgacggaagctggctgtggggtcctgcctgatgtgctgcgctctttgtctac base pairs cgactcggaagtcttgacgtcgaactgccttcgaccgacaccccaggacggactacacgacgcgagaaacagatg 376 to 450 Bpu1102I BstSFI EcoO109I Bsp1720I Psp5II Eco147I Pme55I PpuMI MslI AatI Eco57I DraII cctgcgtgaactacatctcaatgacaaccctctgggggatgaaggcctgaagctgctctgtgaaggactccggga base pairs ggacgcacttgatgtagagttactgttgggagaccccctacttccggacttcgacgagacacttcctgaggccct 451 to 525 StuI EcoO109I SseBI Psp5II

MspA1I FriOI HindIII Eco57I NspBII BanII cccccagtgccgtcttgagaagcttcagttggaatactgtaacctcacagctaccagctgcgagcccctggcctc base pairs gggggtcacggcagaactcttcgaagtcaaccttatgacattggagtgtcgatggtcgacgctcggggaccggag 526 to 600 PvuII Eco24I

BsiHKAI Alw21I DraI BstXI agtgctcagggtgaaacctgactttaaagagctagtattgagcaacaatgacttccatgaggctggtatccacac base pairs tcacgagtcccactttggactgaaatttctcgatcataactcgttgttactgaaggtactccgaccataggtgtg 601 to 675 Bbv12I AspHI

AlwNI DraIII DraII Eco57I HindII GsuI GsuI tctgtgccagggcctgaaggattctgcctgtcaactggagtcactcaaactggagaactgtggtatcacatcagc base pairs agacacggtcccggacttcctaagacggacagttgacctcagtgagtttgacctcttgacaccatagtgtagtcg 676 to 750 EcoO109I HincII BpmI BpmI

MflI BstX2I caactgcaaggatctgtgtgatgttgtggcctccaaagcctcactgcaagaactggacttgggcagcaacaagct base pairs gttgacgttcctagacacactacaacaccggaggtttcggagtgacgttcttgacctgaacccgtcgttgttcga 751 to 825 XhoII BstYI SfcI BsiHKAI MspA1I BsrDI Alw21I NspBII gggcaacacaggcattgcagcactgtgctcaggactgctgcttcccagctgcaggctgaggactctgtggctctg base pairs cccgttgtgtccgtaacgtcgtgacacgagtcctgacgacgaagggtcgacgtccgactcctgagacaccgagac 826 to 900 Bbv12I PvuII AspHI BstSFI

PstI PstI PpuMI DrdI BstSFI DraII AlwNI Eco57I ggactgtgatgtcactgcagaaggctgcaaggacctgtgccgtgtcctcagagccaagcagagcctgaaggaact base pairs cctgacactacagtgacgtcttccgacgttcctggacacggcacaggagtctcggttcgtctcggacttccttga 901 to 975 SfcI EcoO109I Psp5II

AccB1I BglI BsrDI Eco57I Eco64I cagcctagctggcaatgagctgaaggatgagggtgcccaactgctgtgtgagagcctgttagagcctggctgtca base pairs gtcggatcgaccgttactcgacttcctactcccacgggttgacgacacactctcggacaatctcggaccgacagt 976 to 1050 BanI BshNI

MspA1I MspA1I NspBII BstSFI NspBII HindII gctggagtcactgtgggtaaagacctgtagcctcacagctgcctcttgtccccacttctgctcggtgttgaccaa base pairs cgacctcagtgacacccatttctggacatcggagtgtcgacggagaacaggggtgaagacgagccacaactggtt 1051 to 1125 PvuII GsuI SfcI PvuII HincII BpmI BcoI Ama87I NspBII AvaI DraII aaatcgttctctgtttgagctgcaaatgagcagcaacccgctgggagactcgggagtcgtggagctttgcaaggc base pairs tttagcaagagacaaactcgacgtttactcgtcgttgggcgaccctctgagccctcagcacctcgaaacgttccg 1126 to 1200 MspA1I BsoBI EcoO109I Eco88I DrdI

BsaWI BseAI Kpn2I SfcI MroI AccIII AlwNI cctgggctatccggacacagtgctgcgtgtgctttggctgggagactgtgatgtgacagacagtggctgcagcag base pairs ggacccgataggcctgtgtcacgacgcacacgaaaccgaccctctgacactacactgtctgtcaccgacgtcgtc 1201 to 1275 Bsp13I BstSFI BsiMI PstI BspEI BalI BssAI MluNI BsrFI XcmI CfrI SgrAI ccttgccactgtcctgctggccaaccgcagcttgagggaactggacctcagtaacaactgcatgggggacaccgg base pairs ggaacggtgacaggacgaccggttggcgtcgaactcccttgacctggagtcattgttgacgtaccccctgtggcc 1276 to 1350 EaeI AgeI MscI PinAI Bse118I DrdI MspA1I Cfr10I GsuI NspBII Eco57I tgtcctacaactgctggagagcctcaaacagcccagctgcgcccttcagcagcttgtcctgtatgacatttactg base pairs acaggatgttgacgacctctcggagtttgtcgggtcgacgcgggaagtcgtcgaacaggacatactgtaaatgac 1351 to 1425 BsaWI BpmI PvuII

ApaI BpmI Bse21I BbsI DraII FriOI BseRI CvnI Bsp14 Bbv16II Bsp120I EcoNI AocI BsrGI gacggatgaggtggaagaccagcttcgggccctggaggaggaaaggccatccctgaggatcatttcctgagatgt base pairs ctgcctactccaccttctggtcgaagcccgggacctcctcctttccggtagggactcctagtaaaggactctaca 1426 to 1500 BpuAI PspOMI Eco24I Bsu36I SspBI BpiI EcoO109I GsuI Eco81I BanII

Bsh1365I BstYI AvrII AseI Bse8I XhoII StyI VspI MamI BglI BstX2I Eco130I acacctctggacacaagatattaatccagccccagaggcagcccaccagatctctggctttgggtgtcctagggt base pairs tgtggagacctgtgttctataattaggtcggggtctccgtcgggtggtctagagaccgaaacccacaggatccca 1501 to 1575 PshBI BglII BlnI EcoT14I BsrBRI MflI BstXI BssT1I AsnI BsaBI XcmI ErhI 07I HincII MflI HindII BstX2I Eco57I tgactggcgataagcattgggatcttacttcagtagaaaactttaagacactttataactattaaaatactttgt base pairs actgaccgctattcgtaaccctagaatgaagtcatcttttgaaattctgtgaaatattgataattttatgaaaca 1576 to 1650 XhoII BstYI

tggcaaaaaaaaaaaaaaaaaaaaaaaaa accgttttttttttttttttttttttttt

base pairs 1651 to 1679

SECUENCIA N2
PstI EarI BstSFI EcoNI BstSFI Eam1104I PstI gcccnncaaaaggtgctgcagcagaaggtggggtttgaagagacattctgcagcttggaaatccccaggcacaat base pairs cgggnngttttccacgacgtcgtcttccaccccaaacttctctgtaagacgtcgaacctttaggggtccgtgtta 1 to 75 SfcI Ksp632I SfcI BalI BsiHKAI AccB1I MluNI DraIII Alw21I Eco64I BseRI CfrI gtgtgatatgggatagagccttgtgctctgtcctggtgccaggcagaggagagtcaagaaggtgatggccattcc base pairs cacactataccctatctcggaacacgagacaggaccacggtccgtctcctctcagttcttccactaccggtaagg 76 to 150 Bbv12I BanI EaeI AspHI BshNI MscI BsaBI MamI BsrBRI FauNDI agttgtactggatacacatcaaagaatacttatgaccatatgtataggtatcacggcccaggtgtccccagggct base pairs tcaacatgacctatgtgtagtttcttatgaatactggtatacatatccatagtgccgggtccacaggggtcccga 151 to 225 Bsh1365I NdeI Bse8I MflI BsoBI FriOI BamHI BanII BstX2I cagaagtccaggaaaacatcctcaaagcacaatacaagtattctggataagtctcaagacagaactcaggatccc base pairs gtcttcaggtccttttgtaggagtttcgtgttatgttcataagacctattcagagttctgtcttgagtcctaggg 226 to 300 Eco24I BstI AvaI XhoII BstYI

Ama87I cgagcagcatcgcgggtttgttccgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg base pairs gctcgtcgtagcgcccaaacaaggcacacacacacacacacacacacacacacacacacacacacacacacacac 301 to 375 Eco88I BcoI BsaBI Eco72I MamI MslI BbrPI BsrBRI PmaCI tcttggatttccatccacgtgggagaaagtgaaggggctgtaatgtttcctttccacaaccagggcggacacgca base pairs agaacctaaaggtaggtgcaccctctttcacttccccgacattacaaaggaaaggtgttggtcccgcctgtgcgt 376 to 450 Bsh1365I PmlI Bse8I BsaAI BstXI ApoI ApoI BcgI EcoRI DraII AlwNI gaccattcggaggcataagcagcactggaattcagtgagggccttttgacagcccctgaaatttatgtctggctg base pairs ctggtaagcctccgtattcgtcgtgaccttaagtcactcccggaaaactgtcggggactttaaatacagaccgac 451 to 525 AcsI EcoO109I AcsI

Bsp143II PpuMI GsuI BstH2I DraI BseRI DraII gagtgagatagcgcccctcatatttaaacagttttggtcagaggagaaaaatgtaaaaagggtccctagctaatg base pairs ctcactctatcgcggggagtataaatttgtcaaaaccagtctcctctttttacatttttcccagggatcgattac 526 to 600 BpmI HaeII EcoO109I Psp5II

Bsp143II DraII BstH2I aggccccggccttccttttatggcgctttagtatgtaattagagttggcttcgtgtaaaccaccagcacgctcgg base pairs tccggggccggaaggaaaataccgcgaaatcatacattaatctcaaccgaagcacatttggtggtcgtgcgagcc 601 to 675 EcoO109I HaeII

DsaI acttttaacagccttatggatgtcaggagggaaaataaatagtcccctgtttgtacttggaccgtgggtgaatta base pairs tgaaaattgtcggaatacctacagtcctcccttttatttatcaggggacaaacatgaacctggcacccacttaat 676 to 750 BstDSI

SECUENCIA

N 3

BglI ggcagaaaacaagatgtcagtgtcagagatggacggactcctgtgcggctgggcttggtaatggctgccttcgag base pairs ccgtcttttgttctacagtcacagtctctacctgcctgaggacacgccgacccgaaccattaccgacggaagctc 1 to 75

AseI MspA1I MspA1I VspI NspBII MslI NspBII gcattaatttcagctgagagccaccatccctgtgtccagctgagacacatcaagctgaactcatcgccctattca base pairs cgtaattaaagtcgactctcggtggtagggacacaggtcgactctgtgtagttcgacttgagtagcgggataagt 76 to 150 PshBI PvuII PvuII AsnI

BbsI Bbv16II tttccatcttatttcatgtggaaaagaagactgtgttccccaatgatagaaacgggatgtagagacagaataaaa base pairs aaaggtagaataaagtacaccttttcttctgacacaaggggttactatctttgccctacatctctgtcttatttt 151 to 225 BpuAI BpiI Ama87I XmaI BcoI BspMI AvaI Cfr9I AcsI cctgctcataaaagagaaggaaaattatgtccccgggccactggttccttcactatctgtgctaataaatttgag base pairs ggacgagtattttctcttccttttaatacaggggcccggtgaccaaggaagtgatagacacgattatttaaactc 226 to 300 BsoBI PspALI ApoI PspAI SmaI

Eco88I ApoI DraII EcoRI BseRI gccctgggaaagtgaattcagatgcctgaacttcaagtctcctcacgttcaacatgggaacaagggtgctaatca base pairs cgggaccctttcacttaagtctacggacttgaagttcagaggagtgcaagttgtacccttgttcccacgattagt 301 to 375 EcoO109I AcsI

ccgtaactcctagcaggacaatgattataacatatactataatcaccacatgacaggaggggagccatgtattcc base pairs ggcattgaggatcgtcctgttactaatattgtatatgatattagtggtgtactgtcctcccctcggtacataagg 376 to 450

BbiII AcyI Hin1I tgtgcattttcacagacgccattcttctttctttaactggttattttatatacttacatttcaaatgttatcccc base pairs acacgtaaaagtgtctgcggtaagaagaaagaaattgaccaataaaatatatgaatgtaaagtttacaatagggg 451 to 525 Msp17I Hsp92I BsaHI BsiHKAI Alw21I cttcctggtttgccctccgcaaaaccctatcccattccccatcccccttgcttctatgagggtgctcccccaccc base pairs gaaggaccaaacgggaggcgttttgggatagggtaaggggtagggggaacgaagatactcccacgagggggtggg 526 to 600 Bbv12I AspHI

EcoT14I BssT1I Eco130I acccacccactcccgcctcatcatcatcccccccacactggggcatcaagcctccacaagaccaagggcctctct base pairs tgggtgggtgagggcggagtagtagtagggggggtgtgaccccgtagttcggaggtgttctggttcccggagaga 601 to 675 StyI EcoO109I ErhI DraII PshBI EarI AsnI Eam1104I tcccattaatgtctgacg agggtaattacagactgc Ksp632I VspI AseI

base pairs 676 to 693

SECUENCIA 4
ApoI BstSFI gcgaacacacacacacacatacacacacgcacacatacacacacacactgaatcctataggaatttttttatttt base pairs cgcttgtgtgtgtgtgtgtatgtgtgtgcgtgtgtatgtgtgtgtgtgacttaggatatccttaaaaaaataaaa 1 to 75 SfcI AcsI

AlwNI attgaaaagaaagaacatagataatgtttataattttcagcatctgtaacaaaaacattgttggacttcaaatcc base pairs taacttttctttcttgtatctattacaaatattaaaagtcgtagacattgtttttgtaacaacctgaagtttagg 76 to 150

BsiHKAI Alw21I cttttttctgctgttctcagaacattcaggactagactagaaacatagttcatggtagagcacttgctgggtatg base pairs gaaaaaagacgacaagagtcttgtaagtcctgatctgatctttgtatcaagtaccatctcgtgaacgacccatac 151 to 225 Bbv12I AspHI

EarI Eam1104I attgaagcctgtgcttgattcctagtagagacaaaggcagagaggtaaggggaggaagagagagagagagagagt base pairs taacttcggacacgaactaaggatcatctctgtttccgtctctccattcccctccttctctctctctctctctca 226 to 300 Ksp632I

tcactggaaaatctaaggtgaatggatcaaagttatttctgtttcttcctccttacaaggaattaaagtggtaaa base pairs agtgaccttttagattccacttacctagtttcaataaagacaaagaaggaggaatgttccttaatttcaccattt 301 to 375

BalI MluNI BstSFI CfrI ttatacgaaactaagaataaatctacagaagtgctgaaaatggccatgttactatgggatttctcaaaaaattaa base pairs aatatgctttgattcttatttagatgtcttcacgacttttaccggtacaatgataccctaaagagttttttaatt 376 to 450 SfcI EaeI MscI

aactgttagattgagacaaaaaccaaagggagaaatccaaagtccaacggaaggggatgaagggaacacatcact base pairs ttgacaatctaactctgtttttggtttccctctttaggtttcaggttgccttcccctacttcccttgtgtagtga 451 to 525

BspHI FriOI GsuI BanII Eco57I BstSFI ggagtcatgagtttgatgttcttagagccctgaaggaaatcctgagctacagggcatggttgccaatgccaatga base pairs cctcagtactcaaactacaagaatctcgggacttcctttaggactcgatgtcccgtaccaacggttacggttact 526 to 600 BpmI Eco24I SfcI RcaI

BfrI Bst98I BsaBI AvrII BstDSI EarI Vha464I MamI StyI FriOI Eam1104I BsrBRI Eco130I BanII XbaI gaagagcttaaggcaactgatgagtatcagcaacttttcctaggagtattgggctccacggtttgtctagaaggt base pairs cttctcgaattccgttgactactcatagtcgttgaaaaggatcctcataacccgaggtgccaaacagatcttcca 601 to 675 Ksp632I Bsh1365I BlnI EcoT14I Eco24I BspTI SapI Bse8I BssT1I DsaI MspCI AflII ErhI Bse21I CvnI BstSFI AocI GsuI aacaatggctgcctgggggctacaggagtctatgatcctcctaaggcatgaactggagcaagcaggaaaaacggg base pairs ttgttaccgacggacccccgatgtcctcagatactaggaggattccgtacttgacctcgttcgtcctttttgccc 676 to 750 SfcI Bsu36I BpmI Eco81I

PshAI FauNDI gccatgtcctagtcaccaaaaatggctactcaggaatgacagatgtctagattctacatatgaaagaaaatgggt base pairs cggtacaggatcagtggtttttaccgatgagtccttactgtctacagatctaagatgtatactttcttttaccca 751 to 825 XbaI NdeI

Ksp22I RcaI PshAI AcsI FbaI MslI gacttctgtcctcctgagttgaaattccatctctgacatgatcatcttcatgacatctgttgtggttaaaaaaaa base pairs ctgaagacaggaggactcaactttaaggtagagactgtactagtagaagtactgtagacaacaccaatttttttt 826 to 900 ApoI BclI BspHI

HaeII NgoMI Eco47III Bse118I PstI Aor51HI BssAI NaeI BstSFI aaaaaagtttcttttatccagcgctagtgccggcagtgtagggccacatagcatctgcaggatagtttcacctga base pairs ttttttcaaagaaaataggtcgcgatcacggccgtcacatcccggtgtatcgtagacgtcctatcaaagtggact 901 to 975 AfeI BsrFI Cfr10I SfcI BstH2I NgoAIV Bsp143II MroNI

gtcagcaaagcgtcccacccgataaactccatcccatctcacactgccaatggctactctctgagactggcagc cagtcgtttcgcagggtgggctatttgaggtagggtagagtgtgacggttaccgatgagagactctgaccgtcg

base pairs 976 to 1049

SECUENCIA N5
BsiHKAI PpuMI NspBII Alw21I BcgI DraII tcagcggttaagagcactgacttcgcttccacaggtcccaagttcaagtcaccagcacccacattaggcggctca base pairs agtcgccaattctcgtgactgaagcgaaggtgtccagggttcaagttcagtggtcgtgggtgtaatccgccgagt 1 to 75 MspA1I Bbv12I EcoO109I AspHI Psp5II MflI NsiI BstX2I Zsp2I HincII GsuI Ppu10I BseRI NspI aaacttctgaccccaactccaggggatctgatgcatccggcctcctcaagtcaacatacccacatgcaagcacac base pairs tttgaagactggggttgaggtcccctagactacgtaggccggaggagttcagttgtatgggtgtacgttcgtgtg 76 to 150 BpmI Mph1103I HindII XhoII EcoT22I BstYI

acataactaaaaataataatagaaagtagccttaaaaaacaaaaaaaaggactgaccaccaggctatgaaagaaa base pairs tgtattgatttttattattatctttcatcggaattttttgttttttttcctgactggtggtccgatactttcttt 151 to 225

SspI ggcaggcagaatattacacaacacacctgaaccaaatgtcccgaatgtcccggcctgcttgctcccagctagtta base pairs ccgtccgtcttataatgtgttgtgtggacttggtttacagggcttacagggccggacgaacgagggtcgatcaat 226 to 300

Bst98I MspCI PpuMI BspTI DraII ctgctgggtcttaagacctctgaaagagaggctagtagatcatccttcctaccccaaaagtgagaagaaggtccc base pairs gacgacccagaattctggagactttctctccgatcatctagtaggaaggatggggttttcactcttcttccaggg 301 to 375 BfrI EcoO109I Vha464I Psp5II AflII Vha464I AvrII BfrI StyI BspTI Eco130I tcttaagagggagagtaatcaggatcaaatccagaaaacacgatccagtcctaggcagcaagacggtccctgtgc base pairs agaattctccctctcattagtcctagtttaggtcttttgtgctaggtcaggatccgtcgttctgccagggacacg 376 to 450 AflII BlnI EcoT14I MspCI BssT1I Bst98I ErhI

BsgI BsaI agagaccacatacggacctcacggttgcttctgctactactattgctgctgtggatttgggaaagctaaaagcat base pairs tctctggtgtatgcctggagtgccaacgaagacgatgatgataacgacgacacctaaaccctttcgattttcgta 451 to 525 Eco31I

agaacgggagcagcagagtcaatggggtcagagagactgaatcttctcatgctatccctttgttaccagcatacg base pairs tcttgccctcgtcgtctcagttaccccagtctctctgacttagaagagtacgatagggaaacaatggtcgtatgc 526 to 600

NspI cacatgcaagcacactgccttacatacagaaggtgctaaagaaacaaactttgaaaatgagttaaaaacaaaggt base pairs gtgtacgttcgtgtgacggaatgtatgtcttccacgatttctttgtttgaaacttttactcaatttttgtttcca 601 to 675

Alw21I AccB7I ScaI Bsp1720I PflMI Eco255I Bpu1102I Esp1396I cagtgtttctgagagtactgttgtatgtgctcagcccagggagtggcactattagaaggcatggccctattaaag base pairs gtcacaaagactctcatgacaacatacacgagtcgggtccctcaccgtgataatcttccgtaccgggataatttc 676 to 750 Acc113I BlpI BsiHKAI CelII AspHI Van91I Bbv12I FriOI BanII tggatgtggccctgttggagcccctgtgtcagtgcgggtgtggg acctacaccgggacaacctcggggacacagtcacgcccacaccc Eco24I

base pairs 751 to 794

5.4 ANLISIS DE LOS NUCLEOTIDOS DEL DNA SECUENCIA # 1

SECUENCIA # 2

SECUENCIA # 3

SECUENCIA # 4

SECUENCIA # 5

5.5 DETERMINACIN DEL PESO MOLECULAR


SECUENCIA #1

DNA Molecular Weight


Results for 1679 residue sequence "Untitled" starting "GTGAAAGGCT" 519648.78 Da SECUENCIA #2

DNA Molecular Weight


Results for 780 residue sequence "Untitled" starting "GCCCNNCAAA" 242173.97 to 242254.03 Da SECUENCIA #3

DNA Molecular Weight


Results for 693 residue sequence "Untitled" starting "GGCAGAAAAC" 212843.83 Da SECUENCIA #4

DNA Molecular Weight


Results for 1049 residue sequence "Untitled" starting "GCGAACACAC" 324982.49 Da SECUENCIA #5

DNA Molecular Weight


Results for 794 residue sequence "Untitled" starting "TCAGCGGTTA" 245419.20 Da

CONSTRUCCION DE CONTIGS A PARTIR DE DATOS CRUDOS DE SECUENCIAMIENTO DE ADN CON EL PAQUETE STADEN

ALEJANDRO GARCIA DE LOS REYES 070150062009

DOCTOR GUSTAVO ADOLFO VALLEJO

UNIVERSIDAD DEL TOLIMA DEPARTAMENTO DE BIOLOGIA FACULTAD DE CIENCIAS 2012

PROCESAMIENTO Y EDICION DE SECUENCIAS ALINEAMIENTO DE DOS SECUENCIAS (PAIRWISE COMPARISONS) Y ALINEAMIENTO MULTIPLE DE SECUENCIAS P08246 y P05049 LOCAL

P08246 y P05049 GLOBAL

Qu diferencias encuentra observa en los resultados del alineamiento local y el alineamiento global without end-gap penalti? En el alineamiento local, se presenta un 30,4 % de similaridad en 56 aa entre Human leukocyte elastase y Serine protease snake , mientras que en el alineamiento global se presenta un 13.8 % de identidad en 458 aa.

CONCLUSIN El alineamiento local es ms tiles para secuencias diferenciadas en las que se sospecha que existen regiones muy similares o motivos de secuencias similares dentro de un contexto mayor, mientras que en el alineamiento global se intenta alinear cada residuo de cada secuencia, siendo ms til cuando las secuencias problema iniciales son similares y aproximadamente del mismo tamao.

L28038 y L28039 LOCAL

L28038 y L28039 GLOBAL